Patent Application
20230140200
The present disclosure provides, inter alia, compositions and methods for identifying cells undergoing non-apoptotic cell death in a subject. Compositions and methods for detecting and classifying cell death modalities are also provided.
This application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing XML file “CU20038-US-seq.xml”, file size of 47,658 bytes, created on Aug. 4, 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
Ferroptosis is a regulated form of cell death that involves accumulation of lethal phospholipid peroxides and is suppressed by iron chelators and lipophilic antioxidants (Stockwell et al., 2017). It is characterized by loss of activity of glutathione peroxidase 4 (GPX4), which is the major protein in animals that can reduce lipid hydroperoxides in a membrane phospholipid context (Yang et al., 2014).
Ferroptosis induction has been shown to have potential as a cancer therapeutic strategy. Unlike apoptosis, which most cancer cells can evade, ferroptosis is lethal to many tumor cells that have become dependent on suppression of ferroptosis for their survival, including some of the most drug-resistant and aggressive cancer cells, such as persister cells and cells that have undergone epithelial-mesenchymal transition (EMT) (Hangauer et al., 2017; Viswanathan et al., 2017). Thus, triggering ferroptosis may open up new therapeutic avenues for treating drug-resistant cancers (Hangauer et al., 2017). The first two ferroptosis inducers reported, erastin and RSL3, were identified in phenotypic screens targeting engineered tumor cells (Dixon et al., 2012). To date, four classes of ferroptosis inducers have been discovered (Feng and Stockwell, 2018). Class 1 ferroptosis inducers act through inhibition of system xc−, the transmembrane cystine-glutamate antiporter, which imports cystine into cells. Cystine, the cysteine disulfide, is required for the biosynthesis of glutathione (GSH), which is a cofactor and co-substrate for GPX4. Depletion of GSH leads to loss of GPX4 activity, resulting in accumulation of lethal lipid peroxides and ferroptotic cell death. Erastin and its more potent analogs imidazole ketone erastin (IKE) and piperazine erastin (PE), as well as the clinically used drugs sulfasalazine and sorafenib, belong to this class of inducers.
Class 2 ferroptosis inducers act through direct inhibition of GPX4. (1S, 3R)-RSL3 (henceforth RSL3) covalently interacts with GPX4 and inhibits its enzymatic activity, resulting in ferroptotic cell death (Yang et al., 2014). Class 3 ferroptosis inducers, ferroptosis inducer 56 (FIN56) and caspase-independent lethal 56 (CIL56), deplete GPX4 protein and mevalonate-derived coenzyme Q10, which is an endogenous lipophilic antioxidant that suppresses lipid peroxidation (Shimada et al., 2016). The class 4 ferroptosis inducer, ferroptosis inducer endoperoxide (FINO2), acts by oxidizing iron, driving lipid peroxidation, and indirectly inactivating GPX4 enzymatic function in cells (Abrams et al., 2016; Gaschler et al., 2018).
A number of ferroptosis inhibitors have also been identified. The first class includes iron chelators, which chelate excessive labile iron and prevent lipid peroxidation. The second class constitutes radical-trapping antioxidants, including vitamin E, butylated hydroxytoluene (BHT), ferrostatin-1 (Fer-1), and liproxstatin-1. These agents prevent lipid peroxidation through an H-atom transfer mechanism (Skouta et al., 2014). Other ferroptosis inhibitors include deuterated polyunsaturated fatty acids (D-PUFAs), inhibitors of Acyl-CoA Synthetase Long Chain Family Member 4 (ACSL4), glutaminolysis inhibitors, lipoxygenase inhibitors, cycloheximide, beta-mercaptoethanol, dopamine, selenium, and vildagliptin (Stockwell et al., 2017).
Ferroptosis is implicated in various human diseases and pathologies: it has been found that ferroptosis plays a role in the progression of degenerative diseases of the kidney, heart, liver, and brain (Feng and Stockwell, 2018). Stroke, Alzheimer's disease, Huntington's disease and Parkinson's disease are among candidates for neurodegenerative diseases involving ferroptosis (Weiland et al., 2018).
In order to identify the extent to which ferroptosis occurs in pathological and physiological contexts, it is necessary to identify reagents that selectively label cells undergoing ferroptosis. Three hallmarks of ferroptosis, oxidation of PUFA-PLs, redox-active iron, and loss of lipid peroxide repair capacity, have been used as criteria to measure the extent to which ferroptosis occurs (Dixon and Stockwell, 2019). First, the fluorescent probes C11-BODIPY and LiperFluo are used as indicators of lipid peroxidation. BODIPY-C11 indicates the production of reactive oxygen species (ROS) in a lipophilic environment through a change in fluorescence of the probe. It is sensitive to the free radical species formed from hydroperoxides, but not hydroperoxides themselves (Drummen et al., 2002). In contrast, Liperfluo directly reacts with lipid hydroperoxides to form highly fluorescent Liperfluo-OX, which can be detected at long wavelengths (Yamanaka et al., 2012). Second, an increase in redox-active iron quantitatively determines the ratio of ferrous (Fe2+) to ferric (Fe3+) iron. Third, loss of lipid peroxide repair is commonly determined by the enzymatic activity of GPX4. NADPH is added as an indicator of the ability of GPX4 to reduce its substrate and cofactor glutathione. However, these experiments are technically challenging, are limited to biochemical assays, and cannot be used in fixed tissue sections.
Accordingly, there is a need for methods to analyze biological samples such as tissue sections from human patients to determine the extent to which cells are undergoing ferroptosis. This disclosure is directed to meeting these and other needs.
Ferroptosis is a form of regulated cell death process driven by the iron-dependent accumulation of polyunsaturated-fatty-acid-containing phospholipids (PUFA-PLs). Three key molecular features of ferroptosis are peroxidation of PUFA-PLs, increased redox-active ferrous iron, and defective lipid peroxide repair (Dixon and Stockwell, 2019). However, there is currently no reliable means of selectively staining ferroptotic cells in tissue sections to characterize relevant models and diseases. The present disclosure addresses this gap by generation of ferroptosis-specific antibodies. For example, mice were immunized with membranes from diffuse large B cell lymphoma (DLBCL) cells treated with the ferroptosis inducer piperazine erastin (PE), and approximately 4,750 of the resulting monoclonal antibodies generated were screened. One antibody, termed 3F3 anti-Ferroptotic Membrane Antibody (3F3-FMA), was found to be effective as a selective ferroptotic staining reagent using immunofluorescence (IF). The antigen of 3F3-FMA was identified by immunoprecipitation and mass spectrometry as the human transferrin receptor protein 1 (TfR1), which imports iron from the extracellular environment into cells. This finding was validated with several additional anti-TfR1 antibodies. 3F3-FMA was compared to other potential ferroptosis staining reagents via immunofluorescence staining and visualized by fluorescence microscopy and flow cytometry. It was found that anti-TfR1 and anti-MDA antibodies were effective in reliably staining ferroptotic tumor cells in two human cell line xenograft cancer models. In summary, these findings suggest that TfR1 antibodies can be used as a molecular marker to selectively label cells undergoing ferroptosis. Together, these antibodies allow for the first time the detection of cells undergoing ferroptosis in human tissue sections.
Accordingly, one embodiment of the present disclosure is a method for identifying cells undergoing non-apoptotic cell death in a subject comprising: a) contacting a biological sample from the subject with an anti-TfR1 (transferrin receptor protein 1) antibody; and b) determining whether the anti-TfR1 antibody specifically binds to a cell in the sample, wherein the binding of the antibody to a cell in the sample is indicative of the cell undergoing non-apoptotic cell death.
Another embodiment of the present disclosure is a method for identifying ferroptosis in a subject, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; c) carrying out an immunofluorescent assay on the sample; and d) identifying the presence of or absence of ferroptosis by quantifying membrane fluorescence intensity of the sample.
Another embodiment of the present disclosure is a method for identifying cells undergoing ferroptosis in a subject, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody; and c) determining whether the anti-TfR1 3B8 2A1 antibody and the anti-MDA 1F83 antibody selectively bind to a cell in the sample.
A further embodiment of the present disclosure is a method for treating a cancer in a subject, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; d) determining whether the antibody selectively binds to a cell in the sample; and e) continuing the current treatment if ferroptosis is present, otherwise adjusting the treatment protocol if ferroptosis is absent.
Another embodiment of the present disclosure is a method for treating a cancer in a subject, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody, wherein one or both of the antibodies is tagged with one or more fluorescent molecules; d) detecting a fluorescent signal, if present, wherein the presence or absence of ferroptosis is determined by quantifying membrane fluorescence intensity of the sample via flow cytometry and/or fluorescence microscopy; and e) continuing the current treatment if ferroptosis is present, otherwise adjusting the treatment protocol if ferroptosis is absent.
An additional embodiment of the present disclosure is a method for identifying ferroptosis in a cell, comprising: a) contacting the cell with an anti-TfR1 (transferrin receptor protein 1) antibody; b) carrying out an immunofluorescent assay on the cell; and c) identifying the presence or absence of ferroptosis by quantifying membrane fluorescence intensity of the cell.
Another embodiment of the present disclosure is a method for identifying ferroptosis in a cell, comprising: a) contacting the cell with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody; b) carrying out an immunofluorescent assay on the cell; and c) identifying the presence or absence of ferroptosis by quantifying membrane fluorescence intensity of the cell via flow cytometry and/or fluorescence microscopy.
Still another embodiment of the present disclosure is an isolated monoclonal antibody or antigen binding fragment thereof, comprising a heavy chain variable region and a light chain variable region, comprising: in the heavy chain variable region, the heavy chain complementarity determining regions set forth as SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, and in the light chain variable region, the light chain complementarity determining regions set forth as SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. The present disclosure also provides the monoclonal antibody and antigen binding fragment disclosed above.
Another embodiment of the present disclosure is an isolated nucleic acid molecule encoding the antibody or antigen binding fragment disclosed herein.
Another embodiment of the present disclosure is a vector comprising the nucleic acid molecule disclosed herein.
Another embodiment of the present disclosure is a host cell, comprising the nucleic acid molecule disclosed herein or a vector comprising such nucleic acid molecule.
Another embodiment of the present disclosure is a method for treating or ameliorating the effects of a cancer in a subject in need thereof, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; d) determining whether the antibody selectively binds to a cell in the sample; and e) administering a therapeutically effective amount of radiation to the subject if ferroptosis is present.
Still another embodiment of the present disclosure is a method for enhancing the anti-tumor effect of radiation in a subject with cancer undergoing radiotherapy, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; c) determining whether the antibody selectively binds to a cell in the sample; and d) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis if ferroptosis is absent.
A further embodiment of the present disclosure is a composition, comprising an effective amount of the antibody or antigen binding fragment disclosed herein, or a nucleic acid molecule encoding such antibody or antigen binding fragment, and a pharmaceutically acceptable carrier.
Another embodiment of the present disclosure is a method for identifying a classifier that detects and classifies a cell death modality in a cell. The method comprises: (a) treating cultured cells with a select cell death inducer; (b) contacting the treated cells with an agent targeting a biomarker of the cell death modality; (c) carrying out an immunofluorescent assay on the cells and collecting a set of images of various cell regions; (d) analyzing the images to generate features that are statistically significantly correlated to the cell death modality; (e) performing further statistical analysis on the features generated in step (d) to select signature-features that constitute the classifier; and (f) confirming the accuracy of the classifier with a second set of images that are independently collected by repeating steps (a) to (c).
Yet another embodiment of the present disclosure is a method for detecting a cell death modality in a system. The method comprises: (a) obtaining a biological sample from the system and contacting the biological sample with an agent targeting a biomarker of the cell death modality; (b) carrying out an immunofluorescent assay on the biological sample and collecting a set of images of various cell regions; (c) constructing a classifier following the method disclosed herein; and (d) applying the classifier on the set of images collected in step (b) to detect the cell death modality.
The application file contains at least one drawing executed in color. Copies of this patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
It is believed that a ferroptosis-specific antibody would facilitate examining the consequences of ferroptosis in a variety of contexts, including tissue sections, as well as cells in culture. Several antigens have been proposed as potential indicators of ferroptosis.
PTGS2 mRNA, encoding cyclooxygenase-2 (COX-2), was the most upregulated gene in BJeLR cells upon treatment with either erastin or RSL3 in a survey of 83 oxidative stress genes (Yang et al., 2014). CHAC1 mRNA (cation transport regulator homolog 1), an ER stress response gene, was found to be upregulated during the inhibition of system xc− (Dixon et al., 2014). RT-qPCR is used to measure the mRNA level of PTGS2 and CHAC1 in cells. However, detecting ferroptosis using antibodies against the proteins encoded by these genes has proved challenging; moreover, CHAC1 mRNA is primarily upregulated by system xc− inhibitors, but not by other ferroptosis inducers, and PTGS2 is upregulated in other contexts.
Acyl-CoA synthetase long-chain family member 4 (ACSL4) was found to be required for ferroptotic cell death (Dixon et al., 2015; Doll et al., 2017; Yuan et al., 2016). The expression of ACSL4 was downregulated in ferroptosis-resistant cells compared to ferroptosis-sensitive cells (Yuan et al., 2016). However, it is not clear whether the expression level of ACSL4 changes for ferroptosis-sensitive cells undergoing ferroptosis (Muller et al., 2017).
MDA (malondialdehyde) and 4-HNE (4-hydroxynonenal) are aldehydic secondary products of lipid peroxidation. Antibodies against these species and their protein adducts are candidate ferroptosis markers. The anti-MDA 1F83 antibody was raised to target malondialdehyde-modified proteins (Yamada et al., 2001). It has been used as a ferroptosis marker in tissue sections from a mouse lymphoma xenograft model (Zhang et al., 2019). However, these species are also markers of oxidative stress, and may not be specific for ferroptosis compared to other oxidative stress contexts. Therefore, additional specific antibodies for ferroptosis are needed.
In the present disclosure, we report on production of an untargeted pool of monoclonal antibodies from the spleens of mice that were challenged with the membrane fractions of cells induced to undergo ferroptosis with piperazine erastin (PE), an erastin analog and system xc− inhibitor. After screening of ˜4,750 monoclonal antibodies by flow cytometry, 672 antibodies were selected as candidates. A second-round of screening using immunofluorescence resulted in selection of three antibodies as candidates. The 3F3 anti-ferroptotic membrane antibody (3F3-FMA) was selected in a third-round screen of the three hits using immunofluorescence.
The selectivity of 3F3-FMA was validated by treating cells with various ferroptosis inducers and inhibitors, as well as in a comparison with apoptosis inducers. We also tested the 3F3-FMA antibody in several cancer cell lines, and identified the antigen of 3F3-FMA as transferrin receptor protein 1 (TfR1) by immunoprecipitation and mass spectrometry. TfR1 imports iron from the extracellular environment into cells, contributing to the cellular iron pool required for ferroptosis (Yang and Stockwell, 2008). We found that 3F3-FMA was located at the plasma membrane and in the Golgi by co-localization with organelle markers. We compared 3F3-FMA staining with staining by three other anti-TfR1 antibodies, as well as anti-MDA, anti-4-HNE and anti-ACSL4 antibodies, to assess their scope of applications. We found that anti-TfR1 3B8 2A1, anti-TfR1 H68.4, anti-MDA 1F83 and anti-4-HNE ab46545 could detect ferroptotic cells in culture by immunofluorescence. Flow cytometry was sensitive enough to detect the difference between RSL3-treated and DMSO-treated groups for all tested antibodies. Anti-TfR1 3B8 2A1 and anti-MDA 1F83 antibodies provided robust results in mouse xenograft tumor tissue sections. In summary, these findings suggest that anti-TfR1 antibodies, including 3F3-FMA antibody, can be used to directly and selectively label cells undergoing ferroptosis in cell culture and tissue samples. A combination of anti-TfR1 and anti-MDA antibodies is hence proposed to detect ferroptotic cells in human tissue sections. The discovery of TfR1 as a ferroptosis marker implies that TfR1 has a key role in ferroptosis, shedding new light on the mechanisms of ferroptosis.
Accordingly, one embodiment of the present disclosure is a method for identifying cells undergoing non-apoptotic cell death in a subject comprising: a) contacting a biological sample from the subject with an anti-TfR1 (transferrin receptor protein 1) antibody; and b) determining whether the anti-TfR1 antibody specifically binds to a cell in the sample, wherein the binding of the antibody to a cell in the sample is indicative of the cell undergoing non-apoptotic cell death.
In some embodiments, the non-apoptotic cell death is ferroptosis. As used herein, “ferroptosis” means regulated cell death that is iron-dependent. Ferroptosis is characterized by the overwhelming, iron-dependent accumulation of lethal lipid reactive oxygen species. (Dixon et al., 2012) Ferroptosis is distinct from apoptosis, necrosis, and autophagy. (Id.) Assays for ferroptosis are as disclosed herein, for instance, in the Examples section.
Another embodiment of the present disclosure is a method for identifying ferroptosis in a subject, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; c) carrying out an immunofluorescent assay on the sample; and d) identifying the presence of or absence of ferroptosis by quantifying membrane fluorescence intensity of the sample.
In some embodiments, the quantification step is carried out by flow cytometry and/or fluorescence microscopy. In some embodiments, the biological sample is a tissue section, a biopsy, blood, or other appropriate bodily fluid.
In some embodiments, the anti-TfR1 antibody targets ectodomains of TfR1. In some embodiments, the anti-TfR1 antibody is selected from 3F3 anti-ferroptotic membrane antibody (3F3-FMA), anti-TfR1 3B8 2A1 antibody, anti-TfR1 H68.4 antibody, and combinations thereof.
In some embodiments, the method disclosed herein further comprises contacting the sample with at least one second antibody. In some embodiments, the at least one second antibody is selected from the group consisting of an anti-MDA (malondialdehyde) antibody, an anti-4-HNE (4-hydroxynonenal) antibody, an anti-ACSL4 (acyl-CoA synthetase long-chain family member 4) antibody, and combinations thereof. In some embodiments, the at least one second antibody is selected from anti-MDA 1F83 antibody, anti-4-HNE ab46545 antibody, and combinations thereof.
In some embodiments, the subject is suffering from a disease associated with dysregulation of non-apoptotic cell death, such as ferroptosis. In some embodiments, the disease is a cancer selected from the group consisting of brain cancer, breast cancer, colon cancer, liver cancer, sarcoma, leiomyosarcoma, hepatocyte-derived carcinoma, fibrosarcoma, glioblastoma, and lymphoma.
In some embodiments, the method disclosed herein further comprises treating the subject identified as having cells undergoing non-apoptotic cell death or ferroptosis by administering to the subject a ferroptosis modulator selected from the group consisting of erastin, imidazole ketone erastin (IKE), piperazine erastin (PE), sulfasalazine, sorafenib, RSL3, ferroptosis inducer 56 (FIN56), caspase-independent lethal 56 (CIL56), deplete GPX4 protein, mevalonate-derived coenzyme Q10, ferroptosis inducer endoperoxide (FINO2), and combinations thereof.
As used herein, the terms “modulate”, “modulating”, “modulator” and grammatical variations thereof mean to change, such as increasing, decreasing or reducing the occurrence of ferroptosis. In the present disclosure, “contacting” means bringing the compound and optionally one or more additional therapeutic agents into close proximity to the sample such as cells in need of such modulation. This may be accomplished using conventional techniques of drug delivery to the subject or in the in vitro situation by, e.g., providing the compound and optionally other therapeutic agents to a culture media in which the cells are located.
Another embodiment of the present disclosure is a method for identifying cells undergoing ferroptosis in a subject, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody; and c) determining whether the anti-TfR1 3B8 2A1 antibody and the anti-MDA 1F83 antibody selectively bind to a cell in the sample.
A further embodiment of the present disclosure is a method for treating a cancer in a subject, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; d) determining whether the antibody selectively binds to a cell in the sample; and e) continuing the current treatment if ferroptosis is present, otherwise adjusting the treatment protocol if ferroptosis is absent.
In some embodiments, the cancer is selected from the group consisting of brain cancer, breast cancer, colon cancer, liver cancer, sarcoma, leiomyosarcoma, hepatocyte-derived carcinoma, fibrosarcoma, glioblastoma, and lymphoma.
In some embodiments, the anti-TfR1 antibody is selected from 3F3 anti-ferroptotic membrane antibody (3F3-FMA), anti-TfR1 3B8 2A1 antibody, anti-TfR1 H68.4 antibody, and combinations thereof.
In some embodiments, the method disclosed herein further comprises contacting the sample with at least one second antibody. In some embodiments, the at least one second antibody is selected from anti-MDA 1F83 antibody, anti-4-HNE ab46545 antibody, and combinations thereof.
In some embodiments, the agent that induces ferroptosis is selected from the group consisting of erastin, imidazole ketone erastin (IKE), piperazine erastin (PE), sulfasalazine, sorafenib, RSL3, ferroptosis inducer 56 (FIN56), caspase-independent lethal 56 (CIL56), deplete GPX4 protein, mevalonate-derived coenzyme Q10, ferroptosis inducer endoperoxide (FINO2), and combinations thereof.
In some embodiments, one or more of the antibodies, including the first and/or second antibodies, are tagged with a detectable label. In some embodiments, the detectable label is selected from fluorescent molecules, radioisotopes, enzymes, antibodies, linkers and combinations thereof. In some embodiments, the detectable label is a fluorescent molecule and determining whether the antibody selectively binds to the cell is carried out by quantifying membrane fluorescence intensity of the sample via flow cytometry and/or fluorescence microscopy.
As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present disclosure may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population, may fail to respond or respond inadequately to treatment.
As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.
As used herein, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.
Another embodiment of the present disclosure is a method for treating a cancer in a subject, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody, wherein one or both of the antibodies is tagged with one or more fluorescent molecules; d) detecting a fluorescent signal, if present, wherein the presence or absence of ferroptosis is determined by quantifying membrane fluorescence intensity of the sample via flow cytometry and/or fluorescence microscopy; and e) continuing the current treatment if ferroptosis is present, otherwise adjusting the treatment protocol if ferroptosis is absent.
An additional embodiment of the present disclosure is a method for identifying ferroptosis in a cell, comprising: a) contacting the cell with an anti-TfR1 (transferrin receptor protein 1) antibody; b) carrying out an immunofluorescent assay on the cell; and c) identifying the presence or absence of ferroptosis by quantifying membrane fluorescence intensity of the cell.
In some embodiments, the quantification step is carried out by flow cytometry and/or fluorescence microscopy.
In some embodiments, the anti-TfR1 antibody targets ectodomains of TfR1. In some embodiments, the anti-TfR1 antibody is selected from 3F3 anti-ferroptotic membrane antibody (3F3-FMA), anti-TfR1 3B8 2A1 antibody, anti-TfR1 H68.4 antibody, and combinations thereof.
In some embodiments, the method disclosed herein further comprises contacting the cell with at least one second antibody. In some embodiments, the at least one second antibody is selected from the group consisting of an anti-MDA (malondialdehyde) antibody, an anti-4-HNE (4-hydroxynonenal) antibody, an anti-ACSL4 (acyl-CoA synthetase long-chain family member 4) antibody, and combinations thereof. In some embodiments, the at least one second antibody is selected from anti-MDA 1F83 antibody, anti-4-HNE ab46545 antibody, and combinations thereof.
In some embodiments, the cell is a cancer cell. In some embodiments, the cancer is selected from the group consisting of brain cancer, breast cancer, colon cancer, liver cancer, sarcoma, leiomyosarcoma, hepatocyte-derived carcinoma, fibrosarcoma, glioblastoma, and lymphoma.
Another embodiment of the present disclosure is a method for identifying ferroptosis in a cell, comprising: a) contacting the cell with an anti-TfR1 3B8 2A1 antibody and an anti-MDA 1F83 antibody; b) carrying out an immunofluorescent assay on the cell; and c) identifying the presence or absence of ferroptosis by quantifying membrane fluorescence intensity of the cell via flow cytometry and/or fluorescence microscopy.
In some embodiments, the cell is a mammalian cell. Preferably, the mammalian cell is obtained from a mammal selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammalian cell is a human cancer cell.
Still another embodiment of the present disclosure is an isolated monoclonal antibody or antigen binding fragment thereof, comprising a heavy chain variable region and a light chain variable region, comprising: in the heavy chain variable region, the heavy chain complementarity determining regions set forth as SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, and in the light chain variable region, the light chain complementarity determining regions set forth as SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. The present disclosure also provides the monoclonal antibody and antigen binding fragment disclosed above.
In some embodiments, the monoclonal antibody or antigen binding targets ectodomains of TfR1.
In some embodiments, the heavy chain variable region comprises the amino acid sequence set forth as SEQ ID NO: 1. In some embodiments, the light chain variable region comprises the amino acid sequence set forth as SEQ ID NO: 2. In some embodiments, the heavy and light chain variable regions comprise the amino acid sequences set forth as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
In some embodiments, the monoclonal antibody or antigen binding fragment comprises a human framework region. In some embodiments, the monoclonal antibody is an IgG.
In some embodiments, the antigen binding fragment is a Fv, Fab, F(ab′)2, scFV or a scFV2 fragment.
Another embodiment of the present disclosure is an isolated nucleic acid molecule encoding the antibody or antigen binding fragment disclosed herein. In some embodiments, the isolated nucleic acid molecule encoding the antibody or antigen binding fragment comprises nucleic acid sequences set forth as SEQ ID NOs: 9 and 10. In some embodiments, the isolated nucleic acid molecule comprises nucleic acid sequences set forth as SEQ ID NOs: 11 to 16.
Another embodiment of the present disclosure is a vector comprising the nucleic acid molecule disclosed herein.
Another embodiment of the present disclosure is a host cell, comprising the nucleic acid molecule disclosed herein or a vector comprising such nucleic acid molecule.
The present disclosure further provides compositions comprising an antibody disclosed herein and kits comprising an antibody or a composition disclosed herein with instructions for the use of the antibody or the composition, respectively.
The kits may also include suitable storage containers, e.g., ampules, vials, tubes, etc., for each antibody of the present disclosure (which, e.g., may be in the form of compositions) and other reagents, e.g., buffers, balanced salt solutions, etc., for use in administering the active agents to subjects. The antibodies and/or compositions of the disclosure and other reagents may be present in the kits in any convenient form, such as, e.g., in a solution or in a powder form. The kits may further include a packaging container, optionally having one or more partitions for housing the antibodies and/or compositions and other optional reagents.
Another embodiment of the present disclosure is a method for treating or ameliorating the effects of a cancer in a subject in need thereof, comprising: a) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis; b) obtaining a biological sample from the subject; c) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; d) determining whether the antibody selectively binds to a cell in the sample; and e) administering a therapeutically effective amount of radiation to the subject if ferroptosis is present.
Still another embodiment of the present disclosure is a method for enhancing the anti-tumor effect of radiation in a subject with cancer undergoing radiotherapy, comprising: a) obtaining a biological sample from the subject; b) contacting the sample with an anti-TfR1 (transferrin receptor protein 1) antibody; c) determining whether the antibody selectively binds to a cell in the sample; and d) administering to the subject a therapeutically effective amount of an agent that induces ferroptosis if ferroptosis is absent.
In some embodiments, the cancer is selected from the group consisting of sarcoma, renal cell carcinoma, diffuse large B-cell lymphoma, fibrosarcoma, glioma, uterine sarcoma, primary glioblastoma, lung cancer, non-small cell lung cancer, colorectal cancer, melanoma, prostate cancer, pancreatic cancer, brain cancer, breast cancer, colon cancer, liver cancer, leiomyosarcoma, lung adenocarcinoma, and hepatocyte-derived carcinoma. In some embodiments, the cancer is resistant to radiation.
In some embodiments, the co-administration of the agent and radiation provides a synergistic effect compared to administration of either the agent or radiation alone.
In some embodiments, the anti-TfR1 antibody is selected from 3F3 anti-ferroptotic membrane antibody (3F3-FMA), anti-TfR1 3B8 2A1 antibody, anti-TfR1 H68.4 antibody, and combinations thereof.
In some embodiments, the method disclosed herein further comprises contacting the sample with at least one second antibody. In some embodiments, the at least one second antibody is selected from anti-MDA 1F83 antibody, anti-4-HNE ab46545 antibody, and combinations thereof.
In some embodiments, the agent that induces ferroptosis is selected from the group consisting of erastin, imidazole ketone erastin (IKE), piperazine erastin (PE), sulfasalazine, sorafenib, RSL3, ferroptosis inducer 56 (FIN56), caspase-independent lethal 56 (CIL56), deplete GPX4 protein, mevalonate-derived coenzyme Q10, ferroptosis inducer endoperoxide (FIN02), and combinations thereof. In some embodiments, the agent that induces ferroptosis is selected from IKE, RSL3, sorafenib, and combinations thereof.
A further embodiment of the present disclosure is a composition, comprising an effective amount of the antibody or antigen binding fragment disclosed herein, or a nucleic acid molecule encoding such antibody or antigen binding fragment, and a pharmaceutically acceptable carrier.
Determining cell death mechanisms occurring in patient and animal tissues is a longstanding goal that requires suitable biomarkers and accurate quantification. However, effective methods remain elusive. To develop more powerful and unbiased analytic frameworks, the present disclosure provides a machine learning approach for automated cell death classification.
Accordingly, another embodiment of the present disclosure is a method for identifying a classifier that detects and classifies a cell death modality in a cell. The method comprises: (a) treating cultured cells with a select cell death inducer; (b) contacting the treated cells with an agent targeting a biomarker of the cell death modality; (c) carrying out an immunofluorescent assay on the cells and collecting a set of images of various cell regions; (d) analyzing the images to generate features that are statistically significantly correlated to the cell death modality; (e) performing further statistical analysis on the features generated in step (d) to select signature-features that constitute the classifier; and (f) confirming the accuracy of the classifier with a second set of images that are independently collected by repeating steps (a) to (c).
In some embodiments, the cell death modality is selected from the group consisting of apoptosis, ferroptosis, necroptosis and pyroptosis. In some embodiments, the select cell death inducer is selected from the group consisting of an apoptosis inducer, a ferroptosis inducer, a necroptosis inducer and a pyroptosis inducer.
In some embodiments, the cell death modality is apoptosis, and the select cell death inducer is an apoptosis inducer, which is staurosporine (STS).
In some embodiments, the cell death modality is ferroptosis, and the select cell death inducer is a ferroptosis inducer. Non-limiting examples of a ferroptosis inducer include erastin, imidazole ketone erastin (IKE), piperazine erastin (PE), sulfasalazine, sorafenib, RSL3, ferroptosis inducer 56 (FIN56), caspase-independent lethal 56 (CIL56), deplete GPX4 protein, mevalonate-derived coenzyme Q10, ferroptosis inducer endoperoxide (FINO2), and combinations thereof.
In some embodiments, the biomarker of the cell death modality is TfR1 (transferrin receptor protein 1), and the agent targeting the biomarker is an anti-TfR1 antibody. In some embodiments, the anti-TfR1 antibody is a 3F3 anti-ferroptotic membrane antibody (3F3-FMA).
In some embodiments, DAPI and FITC-phalloidin are used in steps (b) and (c).
In some embodiments, the cell regions include nuclei, cytoplasm, and membrane.
In some embodiments, the statistical analysis performed in step (e) includes pairwise logistic regression and multinomial logistic regression.
Yet another embodiment of the present disclosure is a method for detecting a cell death modality in a system. The method comprises: (a) obtaining a biological sample from the system and contacting the biological sample with an agent targeting a biomarker of the cell death modality; (b) carrying out an immunofluorescent assay on the biological sample and collecting a set of images of various cell regions; (c) constructing a classifier following the method disclosed herein; and (d) applying the classifier on the set of images collected in step (b) to detect the cell death modality.
In some embodiments, the system is selected from cultured cells, an animal disease model, and a human subject. In some embodiments, the human subject is a patient receiving a cancer therapy. Thus, this method can be used to assess the response of cancer patients to therapy.
The following examples are provided to further illustrate the methods of the present disclosure. These examples are illustrative only and are not intended to limit the scope of the disclosure in any way.
6 L of media (1% Pen-Strep 10% FBS and 89% RPMI with L-glutamine) containing 400 million OCI-LY7 (DSMZ Cat #ACC-688, RRID:CVCL_1881) cells/L were treated with 5 μM PE (piperazine erastin). Cells were incubated for 19 h at 37° C., then production of lipid ROS was confirmed using BODIPY-C11 by flow cytometry. Ferroptotic cells were pelleted in centrifuge at 1000 rpm for 10 min at 25° C. Cells were resuspended in 1 mL lysis buffer with a pan-protease inhibitor, lysed using a dounce homogenizer. 70% cell lysis was confirmed by microscope. Pellet containing the nuclear fraction and unlysed cells was obtained by centrifuge at 700×g for 10 min at 4° C. Supernatant was spun at 700×g for 10 min at 4° C. Supernatant was then transferred to a new tube and placed in centrifuge at 10,000×g for 45 min at 4° C. Pellet consisting of total membrane was resuspended in upper phase solution. Lower phase was added and mixture was incubated on ice for 5 min. Mixture was spun at 1000×g for 5 min at 4° C. Upper phase was collected and diluted with 5× volume of H2O and incubated on ice for 10 min. Mixture was spun at 17,000×g for 15 min at 4° C. and pellet composed of plasma membrane was collected. Fractions were confirmed using western blot.
Murine monoclonal antibody (clone FH3F3) was generated at the Fred Hutchinson Antibody Technology Core Facility, Seattle Wash. Briefly, female 20-week-old mice (various strains) were immunized with ferroptotic membrane fractions (see previous methods). Following a 12-week boosting protocol, splenocytes were isolated from four high titer mice and electrofused with a myeloma fusion partner generate hybridoma cells. Approximately 4,750 hybridomas positive for IgG secretion were then identified and isolated using a ClonePix2 colony picker (Molecular Devices, CPII). Primary screening of the 4,750 clones was performed by indirect flow cytometry of ferroptotic LY-7 cells (5 μM IKE treated for 19 h at 37° C., fixed with 0.01% formaldehyde in PBS for 15 min at 22° C., permeabilized in FACS buffer with 0.5% v/v Tween-20 detergent). Clones showing fluorescent staining ˜4-fold over background levels (irrelevant primary antibody plus secondary antibody) were isolated for culture and frozen down as the “Primary Clone Archive”. Clone 3F3 was further identified within the Primary Clone Archive by fluorescent staining and high-content image analysis. Clone 3F3 was then subcloned by limiting dilution-CPII colony picking. Small scale antibody productions in serum free media (Gibco Hybridoma SFM) were carried out followed by affinity chromatography (AKTA Pure, MabSelectSuRe) to obtain ˜5 mg of purified IgG1 from subclones 3F3a and 3F3 h.
Plate and liquid handling was performed using a HTS platform system composed of a Sciclone G3 Liquid Handler from PerkinElmer (Waltham, Mass., USA), a MultiFIo™ Dispenser (Biotek Instruments, Bad Friedrichshall, Germany) and a Cytomat™ Incubator (Thermo Fisher Scientific, Waltham, Mass., USA) (Schorpp and Hadian, 2014). Cell seeding and assays were performed in black 384-well CellCarrier-384 Ultra Microplates (PerkinElmer, 6057300). Image acquisition and image-based quantification was performed using an Operetta®/Columbus™ high-content imaging platform (PerkinElmer, USA).
For the screening with five technical replicates, HT-1080 cells were washed with PBS, trypsinized and resuspended in cell culture medium. The cell suspension (2,000 cells in 50 μl per well) was dispensed into collagen (Sigma-Aldrich, St. Louis, Mass., USA) pre-coated 384-well plates (PerkinElmer 384-well CellCarrierUltra™). 24 h after seeding, medium was exchanged to medium containing 0.3 μM RSL3 (1 mM stock solution) dissolved in 100% dimethyl sulfoxide (DMSO) or DMSO alone. 50 μl medium with 0.3 μM RSL3/DMSO was added per well. The cells were then incubated (37° C.; 5% CO2) for 2.5 h prior to fixation and antibody staining. After incubation time the medium was removed and cells were washed with PBS, fixed with 4% PFA for 10 min and washed again with PBS. After permeabilizing (0.5% Tween-20) for 10 min and blocking (1% BSA in PBS) for 2 h, cells were incubated with primary antibody selection in blocking solution (1:20) overnight at 4° C. The following secondary antibody was applied for 1 h at room temperature: anti-mouse Alexa488 (1:500, Invitrogen). Cells were again washed with PBS and then stained with Hoechst 33342 and Phalloidin-TRITC for 1 h at r.t. in the dark and then extensively washed with PBS afterwards. Finally, plates were recorded using the automated Operetta® microscope with the 20× high NA objective for high-resolution images (PerkinElmer, USA). For quantification, three images of each condition were recorded using three channels (Hoechst, Alexa488, TRITC). This resulted in a cell number of at least 100 cells of each condition in all wells. Quantification on cell number, cytoplasmic intensity, nucleus intensity and spot number per cell was performed using the Columbus Software (PerkinElmer, USA).
Multiparametric image analysis was performed using Columbus Software 2.8.0 (PerkinElmer). Hoechst signal was used to detect all cell nuclei. Phalloidin-TRITC signal was used to determine the cytoplasmic region to the corresponding nucleus. Moreover, we applied a filter to remove border objects (nuclei that cross image borders) and cells with extremely small nuclei (dead cells). In a next step we have calculated the morphology and Alexa488 fluorescence intensity in each cell region (nucleus and cytoplasm). In addition, we performed spot detection in the cytoplasm and used morphology and intensity parameter for each spot to define “big spots”. Each spot was detected as a small region within the corresponding image by having a higher intensity than its surrounding area. Furthermore, we selected cells with three or more “big spots” in the cytoplasm and calculated the percentage of “positive” cells in each well. Finally, a hit was defined if the ratio of cytoplasmic intensity and/or the ratio of cells with more than 3 spots was >1 in at least 3 of 5 plates after RSL3 treatment. An illustration on the automated detection method using the Hoechst-, phalloidin-TRITC- and Alexa488 antibody-signal is presented in
HT-1080 (ATCC Cat #CRL-7951, RRID:CVCL_0317), A-673, SK-BR-3, SK-LMS-1 and Huh-7 cells were treated with 1 μM RSL3 for 4 h, 15 μM erastin for 8 h, 10 μM IKE for 8 h, 15 μM FINO2 for 8 h, 10 μM FIN56 for 8 h, 100 μM tBuOOH for 8 h, 1 μM staurosporine (STS) for 6 h, 2 μM camptothecin (CPT) for 24 h, 1 μM RSL3+5 μM Fer-1 for 4 h and 10 μM IKE+5 μM Fer-1 for 8 h on poly-lysine-coated cover slips (Sigma Aldrich P4832) in 24-well plate. Media were taken out and the cells were gently washed with PBS++(PBS with 1 mM CaCl2) and 0.5 mM MgCl2) twice. The cells were fixed and permeabilized by adding 200 μL/well of 4% paraformaldehyde (PFA) in PBS with 0.1% Triton X-100 (PBT), and incubated at room temperature for 18 min. The cells were then washed with PBT three times. Then the cells were blocked with 5% goat serum (ThermoFisher 50197Z) in PBT for 1 h at room temperature. The cells were incubated with purified mouse monoclonal antibodies (1:5 dilution), mouse mAb 3F3 FMA (1:500 dilution), Transferrin Receptor/CD71 Monoclonal Antibody, Clone: H68.4, Invitrogen (Thermo Fisher Scientific Cat #13-6800, RRID:AB_2533029, 1:250 dilution), Cd71 (D7G9X) XP® Rabbit mAb (Cell Signaling Technology Cat #13113, RRID:AB_2715594, 1:100 dilution), CD71 (3B8 2A1) (Santa Cruz Biotechnology Cat #sc-32272, RRID:AB_627167, 1:50 dilution), Tom20 (FL-145) (Santa Cruz Biotechnology Cat #sc-11415, RRID:AB_2207533, 1:250 dilution), PDI antibody [RL90]-ER Marker (Abcam Cat #ab2792, RRID:AB_303304, 1:100 dilution), Gm130 (D6B1) XP® Rabbit mAb (Cell Signaling Technology Cat #12480, RRID:AB_2797933, 1:3200 dilution), Anti-Malondialdehyde antibody (Abcam Cat #ab6463, RRID:AB_305484, 1:400 dilution), Anti-4 Hydroxynonenal antibody (Abcam Cat #ab46544, RRID:AB_722493, 1:50 dilution), ACSL4 Antibody (F-4) (Santa Cruz Biotechnology Cat #sc-365230, RRID:AB_10843105, 1:50 dilution), mouse mAb 1F83 (1:100 dilution), which specifically recognizes the malondialdehyde (MDA)-lysine adduct 4-methyl-1,4-dihydropyridine-3,5-dicarbaldehyde (MDHDC) (Yamada et al., 2001), in PBT with 1% BSA and 5% goat serum overnight at 4° C. The cells were washed with PBT for 5 min three times. The cells were incubated with Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (Thermo Fisher Scientific Cat #A-11032, RRID:AB_2534091, 1:200 dilution) or Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific Cat #A-11034, RRID:AB_2576217, 1:200 dilution) at room temperature for 1 h. The cells were washed with PBT for 5 min three times. ProLong Diamond antifade mountant with DAPI (ThermoFisher P36962) was added to stain the nucleus. All images were captured on a Zeiss LSM 800 confocal microscope at Plan-Apochromat 63×/1.40 Oil DIC objective with constant laser intensity for all samples. When applicable, line-scan analysis was performed on representative confocal microscopy images using Zeiss LSM software to qualitatively visualize fluorescence overlap.
The quantification of the intensity of antibodies was analyzed using CellProfiler 3.1.8 (Carpenter et al., 2006) (CellProfiler Image Analysis Software, RRID:SCR_007358). Nuclei were firstly identified as primary objects using global minimum cross entropy strategy. Cytoplasm were then identified as secondary objects based on primary objects by propagation using global minimum cross entropy strategy. The plasma membranes were identified as the outermost 5 pixels of cytoplasm. Then mean intensities and size areas of nuclei, cytoplasm and plasma membranes were then measured and reported. Graphs were drawn by Prism 7.
HT-1080 cells were seeded in DMEM (Corning 10-013-CM) and 10% Hi-FBS with 1% penicillin and streptomycin (PS) with 1% MEM Non-Essential Amino Acids Solution (100×) (Thermo Fisher Scientific 11140-076) 16 h prior to use. DMSO or 1 μM of RSL3 was added and incubated for 4 h. Following treatment, the medium was aspirated from each dish and cells were washed twice with PBS. Cells were lysed with 70 μl lysis buffer (RIPA buffer from ThermoFisher, cat. 89900, 1 mM EDTA, 1 mM PMSF, 1× Halt™ protease inhibitor cocktail from ThermoFisher, cat. 78430 and 1× Halt™ phosphatase inhibitor cocktail from ThermoFisher, cat. 78426). Unlysed cells and debris were pelleted for 15 min at 16,000×g at 4° C. The samples were incubated with 10 μg of 3F3 FMA overnight at 4° C. with shaking. The next day, Thermo Scientific Pierce Protein AG Magnetic Beads (Thermo Fisher Scientific 88802) were washed with TBS with 0.05% Tween 20 (wash buffer) and then were incubated with sample/antibody mixture for 1 h with mixing. The beads were collected with a magnetic stand and then washed with wash buffer for three times. The beads were used for mass spectrometry.
Trypsin digestion was performed overnight at 37° C. Supernatants were collected and dried down in a speed-vac, and peptides were dissolved in a solution containing 3% acetonitrile and 0.1% formic acid. Peptides were desalted with C18 disk-packed stage-tips. Desalted peptides were injected onto an EASY-Spray PepMap RSLC C18 50 cm×75 μm column (Thermo Scientific), which was coupled to the Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific). Peptides were eluted with a non-linear 110 min gradient of 5-30% buffer B (0.1% (v/v) formic acid, 100% acetonitrile) at a flow rate of 250 nl/min. The column temperature was maintained at a constant 50° C. during all experiments. Thermo Scientific™ Orbitrap Fusion™ Tribrid™ mass spectrometer was used for peptide MS/MS analysis. Survey scans of peptide precursors were performed from 400 to 1575 m/z at 120K FWHM resolution (at 200 m/z) with a 2×105 ion count target and a maximum injection time of 50 ms. The instrument was set to run in top speed mode with 3 s cycles for the survey and the MS/MS scans. After a survey scan, tandem MS was performed on the most abundant precursors exhibiting a charge state from 2 to 6 of greater than 5×103 intensity by isolating them in the quadrupole at 1.6 Th. CID fragmentation was applied with 35% collision energy and resulting fragments were detected using the rapid scan rate in the ion trap. The AGC target for MS/MS was set to 1×104 and the maximum injection time limited to 35 ms. The dynamic exclusion was set to 45 s with a 10 ppm mass tolerance around the precursor and its isotopes. Monoisotopic precursor selection was enabled. MS data analysis
Raw mass spectrometric data were analyzed using MaxQuant v. 1.6.1.0 (Cox and Mann, 2008) (MaxQuant, RRID:SCR_014485) and employed Andromeda for database search (Cox et al., 2011) at default settings with a few modifications. The default was used for first search tolerance and main search tolerance: 20 ppm and 6 ppm, respectively. MaxQuant was set up to search the reference Human proteome database downloaded from Uniprot. MaxQuant performed the search trypsin digestion with up to 2 missed cleavages. Peptide, Site and Protein FDR were all set to 1% with a minimum of 1 peptide needed for Identification but 2 peptides needed to calculate a protein level ratio. The following modifications were used as fixed carbamidomethyl modification of cysteine, and oxidation of methionine (M), Deamination for asparagine or glutamine (NQ) and acetylation on N-terminal of protein were used as variable modifications. MaxQuant combined folder was uploaded in scaffold for data visualization.
siRNA Knockdown Assay
10 μM of siRNAs were combined with 250 μl of Opti-MEM serum-free media (Life Technologies 31985-070) in one tube. 6 μl of Lipofectamine RNAiMAX (Thermo Fisher Scientific 13778150) was combined with 250 μl of Opti-Mem media in another tube. They were equilibrated at r.t. for 5 min. Then two tubes were combined, transferred into 6-well plate and incubated at 37° C. for 20 min. 0.25 million HT-1080 cells were then added to 6-well plate and incubated for 48 h. Cells were reseeded in regular media for additional 24 h. Regular IF procedure was then conducted.
Cells were resuspended in 500 mL HBSS containing 2 μM C11-BODIPY (BODIPY 581/591 C11) (Thermo Fisher Scientific, D3861) and incubated at 37° C. for 15 min. Cells were pelleted and resuspended in HBSS strained through a 35 μm cell strainer (Fisher Scientific 08-771-23). Fluorescence intensity was measured on the FL1 channel with gating to record live cells only (gate constructed from DMSO treatment group). A minimum of 10,000 cells were analyzed per condition. Analysis was performed using FlowJo software.
HT-1080 cells were treated with DMSO or 1 μM RSL3 for 4 h. The cells were harvested by 0.25% Trypsin-EDTA (1×) (Invitrogen 25200-114) and washed with HBSS once. The cells were resuspended in 5% goat serum (ThermoFisher 50197Z) for 30 min on ice. The cells were incubated with mAb 3F3 FMA (1:500 dilution), Transferrin Receptor/CD71 Monoclonal Antibody, Clone: H68.4, Invitrogen (Thermo Fisher Scientific Cat #13-6800, RRID:AB_2533029, 1:250 dilution), CD71 (3B8 2A1) (Santa Cruz Biotechnology Cat #sc-32272, RRID:AB_627167, 1:50 dilution), Anti-Malondialdehyde antibody (Abcam Cat #ab6463, RRID:AB_305484, 1:400 dilution), Anti-4 Hydroxynonenal antibody (Abcam Cat #ab46544, RRID:AB_722493, 1:50 dilution), and mouse mAb 1F83 (1:100 dilution), which specifically recognizes the malondialdehyde (MDA)-lysine adduct 4-methyl-1,4-dihydropyridine-3,5-dicarbaldehyde (MDHDC) (Yamada et al., 2001) for 1 h on ice. The cells were washed with HBSS for 5 min three times by centrifugation. The cells were incubated with Goat anti-Mouse IgG (H+L) Secondary Antibody, Alexa Fluor® 488 conjugate (Thermo Fisher Scientific Cat #A-11001, RRID:AB_2534069, 1:200 dilution) or Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific Cat #A-11034, RRID:AB_2576217, 1:200 dilution) for 30 min on ice. The cells were washed with HBSS twice by centrifugation, then resuspended in HBSS strained through a 35 μm cell strainer (Fisher Scientific 08-771-23). Fluorescence intensity was measured on the FL1 channel with gating to record live cells only (gate constructed from DMSO treatment group). A minimum of 10,000 cells were analyzed per condition. Analysis was performed using FlowJo software (FlowJo, RRID:SCR_008520).
Tumor tissues were fixed in 4% paraformaldehyde (PFA) for 24 h at 4° C. followed by washing with PBS three times. The tissues were perfused in 30% sucrose for 24 h at 4° C. for cryo-protection. The samples were embedded in OCT cryostat sectioning medium, and then moved directly into a cryostat. After equilibration of temperature, frozen tumor tissues were cut into 5 μm thick sections. Tissue sections were mounted on to poly-L-lysine coated slides by placing the cold sections onto warm slides. Slides were stored at −80° C. until staining. For staining, slides were warmed to room temperature followed by washing with PBS twice. A hydrophobic barrier pen was used to draw a circle on each slide. The slides were permeabilized with PBS with 0.4% Triton X-100 (PBT) twice before non-specific-binding blocking by incubating the sections with 10% goat serum (ThermoFisher 50197Z) for 30 min at room temperature. The sections were separately incubated with mouse mAb 3F3 FMA (1:500 dilution), Transferrin Receptor/CD71 Monoclonal Antibody, Clone: H68.4, Invitrogen (Thermo Fisher Scientific Cat #13-6800, RRID:AB_2533029, 1:250 dilution), CD71 (3B8 2A1) (Santa Cruz Biotechnology Cat #sc-32272, RRID:AB_627167, 1:50 dilution), Anti-Malondialdehyde antibody (Abcam Cat #ab6463, RRID:AB_305484, 1:400 dilution), Anti-4 Hydroxynonenal antibody (Abcam Cat #ab46544, RRID:AB_722493, 1:50 dilution), and mouse mAb 1F83 (1:100 dilution), which specifically recognizes the malondialdehyde (MDA)-lysine adduct 4-methyl-1,4-dihydropyridine-3,5-dicarbaldehyde (MDHDC) (Yamada et al., 2001) overnight at 4° C. in humidified chambers. Sections were washed with PBT for three times before incubating with Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (Thermo Fisher Scientific Cat #A-11032, RRID:AB_2534091, 1:1000 dilution) or Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific Cat #A-11034, RRID:AB_2576217, 1:1000 dilution) at room temperature for 1 h. Slides were then washed twice with PBT three times. ProLong Diamond antifade mountant with DAPI (ThermoFisher P36962) was added onto slides, which were then covered with the coverslips, sealed by clear fingernail polish and observed under confocal microscopy. All images were captured on a Zeiss LSM 800 confocal microscope at Plan-Apochromat 63×/1.40 Oil DIC objective with constant laser intensity for all analyzed samples. The intensity above threshold of the fluorescent signal of the bound antibodies was analyzed using NIH ImageJ software (ImageJ, RRID:SCR_003070). Data were expressed as fold change comparing with the vehicle.
HT-1080 cells were seeded in DMEM (Corning 10-013-CM) and 10% Hi-FBS with 1% penicillin and streptomycin (PS) with 1% MEM Non-Essential Amino Acids Solution (100×) (Thermo Fisher Scientific 11140-076) 16 h prior to use. DMSO or 1 μM of RSL3 was added and incubated for 4 h. Following treatment, the medium was aspirated from each dish and cells were washed twice with PBS. Cells were lysed with 70 μl lysis buffer (RIPA buffer from ThermoFisher, cat. 89900, 1 mM EDTA, 1 mM PMSF, 1× Halt™ protease inhibitor cocktail from ThermoFisher, cat. 78430 and 1× Halt™ phosphatase inhibitor cocktail from ThermoFisher, cat. 78426). Unlysed cells and debris were pelleted for 15 min at 16,000×g at 4° C. Samples were separated using SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Transfer was performed using the iBlot2 system (Invitrogen). Membranes were treated with Li-COR Odyssey blocking buffer for at least 1 h at r.t., then incubated with mouse mAb 3F3 FMA (1:500 dilution), Transferrin Receptor/CD71 Monoclonal Antibody, Clone: H68.4, Invitrogen (Thermo Fisher Scientific Cat #13-6800, RRID:AB_2533029, 1:250 dilution), Cd71 (D7G9×) XP® Rabbit mAb (Cell Signaling Technology Cat #13113, RRID:AB_2715594, 1:100 dilution), CD71 (3B8 2A1) (Santa Cruz Biotechnology Cat #sc-32272, RRID:AB_627167, 1:50 dilution) in a 1:1 solution of PBS-T (PBS with 0.1% Tween 20) and Li-COR odyssey blocking buffer overnight at 4° C. Following three 5 min washes in PBS-T, the membrane was incubated with secondary antibodies, goat anti-rabbit or goat anti-mouse IgG antibody conjugated to an IRdye at 800CW (LI-COR Biosciences Cat #926-32211, RRID:AB_621843, 1:3000 dilution) and Alexa Fluor 680 goat anti-mouse IgG (H+L) (Thermo Fisher Scientific Cat #A-21058, RRID:AB_2535724, 1:3000 dilution) in a 1:1 solution of PBS-T and Li-COR Odyssey blocking buffer for 1 h at r.t. Following three 5 min washes in PBS-T, the membrane was scanned using the Li-COR Odyssey Imaging System.
qPCR
HT-1080 cells were seeded in 6-well plates at a density of 400 k cells/well and incubated overnight. The following day, IKE or RSL3 were diluted into wells from stock solutions and treated for indicated time periods. Following treatment, cells were rinsed in cold PBS, trypsinized, and pelleted in Eppendorf tubes. RNA was isolated from cell pellets using Qiagen's RNeasy extraction kit, following manufacturer's instructions (Qiagen). RNA quantity and quality was evaluated by a nanodrop spectrophotometer (Thermo Fisher Scientific). cDNA was generated from 2 μg of total RNA, which was then diluted ten-fold and used as a template in qPCR reactions on a Viia7 Real-Time system. Gene specific primers were used as follows: TfR1 FW: 5′ ACCATTGTCATATACCCGGTTCA 3′ (SEQ ID No: 18); TFR1 RV: 5′ CAATAGCCCAAGTAGCCAATCAT 3′ (SEQ ID No: 19); GAPDH FW: 5′ CTCCAAAATCAAGTGGGGCG 3′ (SEQ ID No: 20); GAPDH RV: 5′ ATGACGAACATGGGGGCATC 3′ (SEQ ID No: 21).
B cell lymphoma mouse xenograft model was generated by injecting 6-week-old NCG mice with 10 million SU-DHL-6 cells subcutaneously. The mice were treated after the tumor size reached 100 mm3. Mice were separated randomly into treatment groups of 3 and dosed with vehicle and 40 mg/kg IKE once daily by IP for 14 days. 3 h after the final dosage, mice were euthanized with CO2, and tumors were dissected, frozen on dry ice, and stored at −80° C. All experiments using animals were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at Columbia University, NY, USA.
Hepatocellular carcinoma (HCC) mouse xenograft tissue samples were generated by injecting 6-week-old NCG mice (2 male and 2 female per group) with 5 million human Huh-7 HCC cells subcutaneously. After three weeks, mice were dosed with vehicle or 50 mg/kg IKE once daily by IP for 2 days. 3 h after the final dosage, mice were euthanized with CO2. Tumors and liver tissues were dissected, frozen on dry ice, and stored at −80° C. All experiments using animals were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at Columbia University, NY, USA.
All procedures were performed according to the Columbia University Medical Center Institutional Animal Care and Use Committee. Murine glioma cell lines were created from tumor bearing mice. These tumors were generated by injection of a PDGF-IRES-Cre retrovirus into the subcortical white matter of mice with floxed PTEN and/or p53 (Sonabend et al., 2013). After mice reached end stage, the tumors were dissociated and primary cell cultures were created. These cells harbored the specific mutations of the original tumors, and could be re-injected to form gliomas in c57/B6 mice with high fidelity. Briefly, mice between the ages of 6-8 weeks received 50,000 murine glioma cells through stereotactic injection after being anesthetized with a ketamine/xylazine cocktail (87.5 mg/12.5 mg w/w). After cessation of toe-pinch reflex, the scalp was shaved and cleaned with serial use of betadine and 70% ethanol swabs. An incision was made and the skull was exposed. A burr hole was created, 2 mm anterior, 2 mm lateral and 2 mm deep to the right of the bregma. The cells were injected into the subcortical white matter over a period of 3 minutes (0.333 μL/min). Once the injection ceased, the needle was left in place for 1 minute before being slowly withdrawn. After tumor developed, brains were harvested and fixed in 4% paraformaldehyde and embedded in paraffin. 5 micron sections were made for staining.
To identify a reliable and specific ferroptosis marker, we started with generation of an untargeted pool of monoclonal antibodies, by injecting mice with ferroptotic membrane fractions. Suspension OCI-LY7 cells (DLBCL, diffuse large B cell lymphoma cells) were incubated with PE, a class 1 ferroptosis inducer, for 19 h at 37° C. An increase in lipid peroxides, confirmed by fluorescent changes of C11-BODIPY, was used as a sign of ferroptosis to select this time point and concentration (
Female 20-week-old mice were immunized with ferroptotic membrane fractions. Following a 12-week boosting protocol, splenocytes were isolated and electrofused with a myeloma fusion partner to generate hybridoma cells (Alkan, 2004). ˜4,750 antibodies to unknown targets were purified and tested in a high-throughput screen (
The three hits were verified on a larger scale by immunofluorescence using confocal microscopy. We used RSL3 in an initial validation experiment, because it's the most potent inducer, requiring low concentration and short incubation times. 30% of HT-1080 cells died after 4 h incubation of 1 μM RSL3. 3F3-FMA was the only Ab showing reliable differences in staining during RSL3-induced ferroptosis. During ferroptosis, 3F3-FMA stained cell boundaries and the inside puncta became brighter (
Quantification of membrane fluorescence intensity was subsequently used to evaluate the difference in membrane-localized antigen. We used various ferroptosis inducers—IKE, erastin, FIN56, FINO2 and tBuOOH, and the same changes of 3F3-FMA pattern were observed (
Next, this validation was expanded to other cancer cell lines. We selected A-673 (human muscle sarcoma cells), SK-BR-3 (human breast cancer cells), Huh-7 (hepatocyte-derived carcinoma cells) and SK-LMS-1 (human leiomyosarcoma cells) which are all sensitive to ferroptosis. Again, we found that 3F3-FMA staining concentrated at the cell boundaries and became brighter upon ferroptosis induction (
Similar to apoptosis, nuclear shrinkage under ferroptosis was also reproducibly found, with a 17% decrease in nuclear size (
The antigen of 3F3-FMA was identified using immunoprecipitation and mass spectrometry. First, we incubated 3F3-FMA with a cell lysate overnight. Then magnetic beads were added and washed, and bead-immobilized proteins were analyzed by mass spectrometry. Transferrin receptor protein 1 had the highest confidence identification as the target antigen at 63% with 32 exclusive unique peptides, 48 exclusive unique spectra and 53% amino acid coverage (
Next, to better localize 3F3-FMA staining within cells, 3F3-FMA was co-localized with Tom20 (mitochondria marker), PDI (ER marker) and GM130 (Golgi marker) using two secondary antibodies with different excitation and emission wavelengths. It's found that 3F3-FMA staining was not visible in mitochondria or the ER (
TfR1 is the main regulator of iron uptake in cells. After binding to iron-loaded transferrin, TfR1 is enclosed within clathrin-coated endocytic vesicles and internalized by cells. Iron is then released due to endosomal acidification. Apotransferrin and its receptor are sorted in the Golgi and to some extent transported back to the cell surface. It was therefore consistent with the known trafficking of TfR1 that we observed the 3F3-FMA antigen at the plasma membrane and in the Golgi.
In addition to 3F3-FMA, three other anti-TfR1 antibodies were acquired. Our goal was to test if these antibodies had similar staining pattern changes with 3F3-FMA, thereby further validating the TfR1 antigen. An additional goal was to compare these anti-TfR1 antibodies to see if one has advantages over others. To find the most specific and reliable ferroptosis marker, these TfR1 antibodies were compared with anti-MDA, anti-4-HNE and anti-ACSL4 antibodies, which have been explored as molecular markers of ferroptosis.
RSL3 was used to induce ferroptosis in this comparison test. We found an increase in membrane intensities for anti-TfR1 3B8 2A1 and anti-TfR1 H68.4 (
Next, we compared other potential ferroptosis-staining reagents—anti-MDA 1F83, anti-MDA ab6463, anti-4-HNE ab46545 and anti-ACSL4 sc-365230 antibodies. It's found that anti-MDA 1F83 and anti-4-HNE ab46545 were capable of staining HT-1080 cells during RSL3-induced ferroptosis (
These antibodies were then tested for their ability to detect STS-induced apoptosis to see if these antibodies could differentiate ferroptosis from apoptosis. An anti-cleaved-caspase-3 antibody was used to verify induction of apoptosis (
Anti-TfR1 3B8 2A1, anti-TfR1 H68.4, anti-MDA 1F83, and anti-4-HNE ab46545 antibodies were also tested in camptothecin-induced apoptosis; cleaved PARP antibody was used to detect induction of apoptosis. We found that, as with STS-induced apoptosis, TfR1 did not accumulate on the cell surface; there was rather a decrease in membrane intensity (
Next, we tested whether these antibodies could differentiate between ferroptosis and more general oxidative stress that does not lead to ferroptosis. HT-1080 cells were incubated with 1 mM H2O2 for 4 h to test if anti-TfR1 antibodies and other potential ferroptosis-staining reagents could differentiate ferroptosis from H2O2-induced cell death, which has been suggested to be a necrotic death associated with oxidative stress. We didn't observe increased membrane intensities for anti-TfR1 antibodies, including 3F3-FMA, TfR1 3B8 2A1 and TfR1 H68.4 (
To explore the scope of applications for these antibodies, anti-TfR1, anti-MDA and anti-4-HNE antibodies were tested using flow cytometry and western blot. It's found that all of these antibodies showed increased staining intensities in RSL3-treated HT-1080 cells (
In western blotting, increased intensity of the bands blotted by 3F3-FMA and anti-TfR1 H68.4 antibodies was detected in both RSL3-induced and IKE-induced ferroptosis, indicating increased level or accessibility of cellular TfR1 proteins, not just a change in localization (
Finally, 3F3-FMA was tested together with other anti-TfR1 antibodies, as well as anti-MDA and anti-4-HNE antibodies in mouse xenograft tumor tissue sections. The preparation of human B cell lymphoma xenograft tissue samples was described previously (Zhang et al., 2019). 6-week-old NCG mice were injected with 10 million SU-DHL-6 cells subcutaneously. The mice were treated after the tumor size reached 100 mm3. Mice were separated randomly into treatment groups and dosed with vehicle and 40 mg/kg IKE once daily by IP for 14 days. 3 h after the final dosage, mice were euthanized with CO2, and tumor tissue was dissected, frozen, fixed and cut to make slides (
Next, HCC (Hepatocellular carcinoma) mouse xenograft tissue samples were generated by injecting 6-week-old NCG mice with 5 million human Huh-7 HCC cells. After three weeks, mice were dosed with vehicle or 50 mg/kg IKE once daily by IP for 2 days. 3 h after the final dosage, mice were euthanized with CO2 and tumor tissue was dissected, frozen, fixed and sectioned to make slides (
Finally, we sought to test whether 3F3-FMA could be used in paraffin-embedded tissue samples, which are historically more abundant and accessible than fresh frozen tissues. We evaluated 3F3-FMA staining in mouse glioblastoma (GBM) paraffin-embedded tissue samples, to see if the increased TfR1 that has been observed in many tumors would render 3F3-FMA staining detectable in this setting over the low signal evident in normal brain tissue. 3F3-FMA was indeed able to recognize mouse TfR1 protein in these tumor samples, suggesting future studies could evaluate TfR1 levels as a ferroptosis marker in mouse, and possibly human, glioblastoma samples (
3F3-FMA was assessed together with three commercially available anti-TfR1 antibodies and four additional potential ferroptosis-staining reagents in different assays (immunofluorescence, flow cytometry, and tissue sections). A summary of applications is shown in Table 1. The anti-TfR1 3B8 2A1 and anti-MDA 1F83 antibodies perform best. They yielded reliable results in mouse xenograft tumor tissue samples, as well as immunofluorescence and flow cytometry applications. We propose that researchers can use a combination of anti-TfR1 3B8 2A1 and anti-MDA 1F83 antibodies as ferroptosis markers to stain human tissue sections, which will aid research on the role of ferroptosis in human disease.
The identification of TfR1 accumulation on the cell surface as a feature of ferroptosis is significant. Nonetheless, specificity is a potential limitation of using anti-TfR1 antibodies as ferroptosis markers. We found, however, that anti-TfR1 antibodies could differentiate ferroptosis from apoptosis; other cell death forms including necroptosis, autophagic death and pyroptosis have not been tested. It was reported previously that uptake of extracellular iron by a TfR1-dependent iron transport mechanism was required in hydroperoxide-induced DCFH oxidation and endothelial cell apoptosis (Tampo et al., 2003). Treatment with an anti-TfR1 antibody also dramatically inhibited iron uptake, intracellular oxidant formation, and doxorubicin-induced apoptosis (Kotamraju et al., 2002). Further validation of the specificity of anti-TfR1 antibodies is therefore needed across diverse contexts before we can be certain of its suitability as a specific marker of ferroptosis.
In addition to its potential use as a ferroptosis marker, future studies may examine why TfR1 accumulation on the cell surface occurs during ferroptosis. One hypothesis is that the internalization machinery is disrupted in the ferroptotic context. To test this hypothesis, we examined Epidermal Growth Factor Receptor (EGFR) because it uses the same clathrin-mediated endocytosis with TfR1 and is internalized in the presence of EGF only. However, EGFR was still internalized in the presence of EGF during ferroptosis, indicating that clathrin-mediated endocytosis is not affected during ferroptosis (
A further direction for the future is the study of the role of TfR1 in ferroptosis. It was reported previously that cells with knockdown of TfR1 became more resistant to erastin-induced cell death (Yang and Stockwell, 2008) and that siTfR1 RNAi significantly inhibited serum-dependent necrosis, which was subsequently determined to be ferroptosis (Gao et al., 2015). These results indicate that decreased iron uptake caused by knockdown of TfR1 is implicated in ferroptosis. However, the cellular iron pool is also controlled by an iron storage protein complex consisting of ferritin heavy chain 1 (FTH1) and ferritin light chain (FTL) (Harrison and Arosio, 1996). The precise role of TfR1 and the related iron metabolism pathway in ferroptosis remains to be determined.
TfR1 is abundantly expressed and actively involved in the progression of several kinds of cancers, including brain cancer, breast cancer, colon cancer, and liver cancer, rendering TfR1 a valuable target (Daniels et al., 2012). The increased need for iron uptake leads to the high expression of TfR1, because iron is required for tumor cell proliferation (Marques et al., 2016). On the other hand, the upregulation of iron uptake by TfR1 also refills the labile redox-active iron pool, which is needed for ferroptosis. Therefore, how iron metabolism is regulated between tumor progression and ferroptotic tumor suppression remains elusive. More research is needed to define the relationship between TfR1 expression, iron metabolism, ferroptosis and cancer progression.
In summary, we began with a pool of antibodies with unknown targets generated from PE-treated cell membrane fractions. The 3F3-FMA antibody was selected to mark ferroptotic cells and its antigen was identified as transferrin receptor protein 1 (TfR1). Different anti-TfR1 antibodies and other potential ferroptosis staining reagents were assessed in immunofluorescence, flow cytometry, western blot and tissue samples. Anti-TfR1 3B8 2A1 and Anti-MDA 1F83 antibodies were selected as the best-performed reagents across immunofluorescence, flow cytometry and tissue section applications. We recommend using a combination of these two antibodies to detect cells undergoing ferroptosis in diverse contexts.
Further, the following vectors were constructed to express 3F3-FMA in the form of scFv in both mammalian cell and bacteria,
pcDNA3.1-scFv Construction (for Mammalian Cell Expression)
A target gene scFv of 875 bp was synthesized (5′-GGATCCGCCGCCACCATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGA CTGGGGTGAGGGCCGAAGTCCTCCTCCAACAATCCGGAACAGAACTCGTTAGACC TGGTGCACTGGTCAAGCTCTCCTGTAAAGCCAGTGGATTCAACATTCAGGACCTCT ACATTCACTGGGTCAAGCAACGCCCAGAGCAAGGGCTGGAGTGGATCGGCTGGA TTGATCCCGAGACAGATAACACAATCTACGATCCTAAGTTCCAGGGTAAGGCATCC ATAACTGCCGACACAAGCAGTAATACTGCATACCTCCAGCTGTCATCACTCACCAG CGAGGATACAGCCATGTACTACTGTTCCACTGGACTGCTGCAATGGTACTTTGATG TTTGGGGAGCAGGGACTGCCGTTACCGTGTCCTCTGGAGGCGGAGGGTCCGGTG GAGGAGGCTCCGGAGGTGGTGGCAGCGACATAGTCATGACACAGAGCCCAAGCA GCCTGGCTATGAGCATCGGGCAGAAGGTGACAATGCGGTGCAAGTCCTCTCAGAG TCTGCTGAACTCCTACAATCAGAAGAATTGTCTGGCCTGGTATCAACAGAAGCCAG GCCAAAGTCCTAAGCTCCTCCTGTATTTCGTTTCAACTCGCGAGTCTGGTGTGCCT GACAGATTCATCGGCAGTGGGAGCGGGACAGACTTCACTCTCACCATCAGTAGTG TCCAGGCTGAGGACCTGGCCGACTATTTCTGTCAACAACATTACTCAACTCCTCTG ACTTTCGGTGCTGGAACCAAACTGGAGCTGAAGGGCAGCGAGCAGAAACTGATTT CCGAAGAGGACCTGAGCCACCATCACCACCATCACTAATAGAATTC-3′, SEQ ID No: 22). The plasmid vector pcDNA3.1 and target gene were digested by EcoRI and BamHI. The digestion reaction was performed in a 37° C. water bath for 2 hours. The plasmid pcDNA3.1 and target gene were recovered by 1% agarose gel electrophoresis. The recovered plasmid pcDNA3.1 were ligated to the recovered target gene, and the ligation reaction was performed at 16° C. for 12 hours. Took 10 μl ligation product and 100 μl DH5a competent bacteria and mixed in an ice bath for 30 min, heat shock at 42° C. for 90 s, immediately placed on ice for 5 min, then added 700 μl LB medium, incubated at 37° C. for 50 min, and sucked 200 μl of the bacterial solution. After mixing with a pipette, evenly spreaded on a LB plate containing 100 μg/ml Ampicillin, and cultured in a 37° C. incubator overnight. Picked 5 single colonies and inoculated them in 5 ml LB culture medium containing 100 μg/ml Ampicillin, cultured at 300 rpm, 37° C. in a constant temperature shaker overnight, and expanded the overnight bacterial solution. The plasmid was extracted by the quantitative extraction kit, and then verified by sequencing.
pET28a-scFv Construction (for Bacterial Expression)
A target gene scFv of 812 bp was synthesized (5′-CCATGGAAGTGCTGCTGCAACAAAGCGGCACCGAACTGGTACGTCCGGGTGCTCT GGTGAAACTGTCTTGTAAAGCATCTGGTTTCAACATCCAGGACCTGTACATTCACT GGGTTAAACAGCGTCCGGAACAAGGCCTGGAATGGATCGGTTGGATCGACCCGG AAACTGACAACACTATCTACGACCCGAAATTCCAAGGTAAAGCAAGCATTACCGCA GACACCTCTTCCAACACCGCGTACCTGCAACTGTCCTCTCTGACCTCTGAAGATAC CGCAATGTACTACTGTAGCACTGGTCTGCTGCAATGGTACTTTGATGTTTGGGGTG CCGGTACTGCGGTGACTGTTTCCTCTGGTGGCGGTGGTTCTGGCGGTGGTGGTTC TGGTGGTGGTGGCTCTGACATTGTGATGACCCAGTCTCCGAGCAGCCTGGCGATG TCCATCGGTCAGAAGGTTACTATGCGCTGCAAGTCCTCCCAGTCCCTGCTGAACTC CTATAACCAGAAGAATTGTCTGGCTTGGTATCAGCAGAAACCGGGTCAATCTCCGA AGCTGCTGCTGTACTTTGTTTCTACTCGTGAGTCCGGTGTACCAGATCGCTTTATC GGTTCCGGTTCTGGCACCGACTTCACCCTGACCATCAGCTCCGTTCAGGCGGAGG ATCTGGCCGACTATTTCTGCCAGCAACACTATAGCACTCCGCTGACCTTTGGTGCT GGCACCAAACTGGAACTGAAGGGTTCTGAGCAGAAACTGATTAGCGAAGAGGATC TGTCTCATCACCACCACCATCATTAATAGCTCGAG-3′, SEQ ID No: 23). The plasmid vector pET28a and target gene were digested by NcoI and XhoI, and the digestion reaction was performed in a 37° C. water bath for 2 hours. The plasmid pET28a and target gene were recovered by 1% agarose gel electrophoresis. The recovered plasmid pET28a were ligated to the recovered target gene, and the ligation reaction was performed at 16° C. for 12 hours. Took 10 μl ligation product and 100 μl DH5a competent bacteria and mixed in an ice bath for 30 min, heat shock at 42° C. for 90 s, immediately placed on ice for 5 min, then add 700 μl LB medium, incubated at 37° C. for 50 min, and sucked 200 μl of the bacterial solution. After mixing with a pipette, evenly spreaded on a LB plate containing 100 μg/ml Kanamycin, and cultured in a 37° C. incubator overnight. Picked 5 single colonies and inoculated them in 5 ml LB culture medium containing 100 μg/ml Kanamycin, cultured at 300 rpm, 37° C. in a constant temperature shaker overnight, and expanded the overnight bacterial solution. The plasmid was extracted by the quantitative extraction kit, and then verified by sequencing.
We previously demonstrated that small molecule inducers of ferroptosis could synergize with radiation to promote cancer cell killing. Using a combination of radiation and IKE or sorafenib, we showed that synergistic tumor cell killing through ferroptosis can be extended to patient-derived models of glioma and lung cancer.
To improve/maximize the efficiency of the combination therapy of ferroptosis inducers and radiation, we will introduce the transferrin receptor 1 antibodies disclosed herein to the combination treatment in order to obtain critical information including, for example, whether the subject is undergoing ferroptosis, whether the treatment protocol needs adjustment such as, for example, modifying the dosage of the ferroptosis inducer, or replacing the ferroptosis inducer for another, etc.
Determining cell death mechanisms occurring in patient and animal tissues is a longstanding goal that requires suitable biomarkers and accurate quantification. However, effective methods remain elusive. To develop more powerful and unbiased analytic frameworks, we developed a machine learning approach for automated cell death classification. Image sets were collected of HT-1080 fibrosarcoma cells undergoing ferroptosis or apoptosis and stained with an anti-transferrin receptor 1 (TfR1) antibody, together with nuclear and F-actin staining. Features were extracted using high-content-analysis software, and a classifier was constructed by fitting a multinomial logistic lasso regression model to the data. The prediction accuracy of the classifier within three classes (control, ferroptosis, apoptosis) was 93%. Thus, TfR1 staining, combined with nuclear and F-actin staining, can reliably detect both apoptotic and ferroptosis cells when cell features are analyzed in an unbiased manner using machine learning, providing a method for unbiased analysis of modes of cell death.
Regulated cell death is a complex and tightly regulated phenomenon, involving intricate molecular mechanisms. For numerous cell death processes, molecular markers have been developed that identify cells undergoing apoptosis (Denton and Kumar, 2015) or necroptosis (He et al. 2022) through immunolabeling. Such markers may be used in cell culture and tissue histopathological applications to examine the prevalence of cell death processes, which may improve the treatment and diagnosis of diseases in which these processes are implicated.
Ferroptosis is a form of regulated cell death characterized by the iron-dependent accumulation of lipid peroxides, as well as the loss of cellular antioxidant repair capabilities (Stockwell et al. 2017). The enzyme glutathione peroxidase 4 (GPX4) is a cellular regulator of lipid peroxidation levels, and several ferroptosis inducers have been developed that specifically target the activity of this enzyme through direct inhibition (e.g., RSL3) (Yang et al. 2014). A second class of ferroptosis inducers (e.g., IKE and erastin) causes inactivation of GPX4 through depletion of glutathione via inhibition of the antiporter system xc− (Larraufie et al. 2015). Ferroptosis has been implicated in several disease pathologies, such as degenerative diseases and organ injury (Jiang et al. 2021; Weiland et al. 2018). Furthermore, ferroptosis induction may have potential as a cancer treatment strategy (Angeli et al. 2019; Chen et al. 2021).
Toward the goal of specific identification of ferroptosis in tissue samples, we previously discovered an effective ferroptosis-staining reagent, 3F3 anti-Ferroptotic Membrane Antibody (3F3-FMA), that can be used to stain cells and tissue samples directly (Feng et al. 2020). The antigenic target of 3F3-FMA is transferrin receptor 1 (TfR1), a membrane receptor that internalizes iron-bound transferrin through receptor-mediated endocytosis (Cheng et al. 2004). This iron uptake activity of TfR1 contributes to intracellular iron levels necessary for ferroptosis (Yang and Stockwell, 2008). 3F3-FMA, as well as other anti-TfR1 antibodies, exhibit an increase in total and membrane-localized fluorescence when used to stain cells undergoing ferroptosis in culture (compared to vehicle-treated control cells). TfR1 has been used to identify the occurrence of ferroptosis in traumatic brain injury (Chen et al. 2021) and myocardial ischemia/reperfusion injury (Fan et al. 2021), among other uses. Thus, TfR1 serves as a biomarker to facilitate the identification of ferroptosis in cell and tissue contexts.
The identification of plasma membrane fluorescence as a distinguishing feature between ferroptosis and other cell death processes upon staining with anti-TfR1 antibodies was discovered using visual inspection; here, we sought instead to evaluate the use of machine learning as an unbiased tool to detect ferroptotic cells. Machine learning methods facilitate the high-throughput analysis of cell image sets versus tedious and subjective manual processes; in cell biology applications, machine learning can increase processing capabilities and objectivity. The supervised machine learning pipeline involves image collection and pre-processing, object detection, and feature extraction and prioritization (Sommer and Gerlich, 2013). Our goals were to assess the machine learning potential in discriminating ferroptosis, apoptosis and control-treated samples as well as to provide a pipeline for identification of features that best distinguish those cell death modalities in our setting.
Therefore, after collecting images of fluorescently-stained cells treated with vehicle only or undergoing ferroptosis or apoptosis, images were analyzed via high-content-image analysis and a classifier was trained on the extracted data. The trained classifier corresponds to a non-exclusive list of informative features with assigned coefficients, which was validated with a second data set by successfully predicting the same classes. These results expand and strengthen the applicability of biomarkers, such as 3F3-FMA/TfR1, for differentiating cell death mechanisms in an objective and high-throughput manner.
To explore the application of machine learning to the classification of different cell death modalities, we collected large numbers of images of cells fixed and immunofluorescently stained with 3F3 anti-Ferroptotic Membrane Antibody (3F3-FMA), a ferroptosis-specific antibody with TfR1 as its target antigen. Specifically, HT-1080 cells were treated with ferroptosis inducers (RSL3, a GPX4 inhibitor, or IKE, a system xc− inhibitor), an apoptosis inducer (staurosporine, STS) (Bertrand et al. 1994), or DMSO vehicle control. In addition to being stained with anti-TfR1 3F3-FMA (labeled with AlexaFluor 594), cells were stained with DAPI as a nuclear marker and FITC-phalloidin as a cytoplasmic (F-actin) marker to assist identification of cellular features for machine learning classification (see below).
Machine learning tools are designed to adapt to any data pattern associated with the task to learn. There were several important aspects to consider in collecting images for machine learning classification. First, all treatments within a day (i.e., using the same microscope settings) were balanced. Moreover, we collected all images of the discovery data on one day and the validation data later on a different day. Second, the extent of cell death was standardized across the different conditions to analyze cells in an early stage of cell death induction. Specifically, we fixed cells in each treatment condition when they reached 10-20% cell death, so that cell death has been initiated, but not to the extent of excessive end-stage necrosis. At this point, the cells should still have intact cell membrane integrity and not have detached from the surface. The CellTiter-Glo (CTG) viability assay, which measures intracellular ATP levels as an indicator of viability, was used to monitor the extent of cell death. We performed a pilot study and established optimal concentration and timepoint ranges for each treatment (
Guided by the results of the pilot study, the first image set for training and discovery of classifiers was collected, and immunofluorescence experiments were performed when the extent of cell death reached 10-20% compared to DMSO control treatment in parallel CTG assays (
For the training set, once the cells were fixed and stained with DAPI, FITC-phalloidin, and anti-TfR1 3F3-FMA, 120 images were collected per treatment condition (DMSO control, RSL3, IKE, STS) with an average of 10 cells per image (
We then removed all features that contained undefined values (NaN, “Not a-Number”) and reduced the number of features from 1,473 to 1,373. We performed a principal component analysis (PCA) with the data matrix of 1,373 features and a total of 480 observations (=120 images per condition; DMSO, IKE, RSL3 and STS) and visualized principal component 1 and 2 (
This data set was then used for supervised machine learning to build a classifier that would allow the determination of whether treatments of cells with certain substances trigger ferroptosis or apoptosis (
A classifier is a mathematical function or procedure that assigns a sample to one or several classes, usually by calculating class scores for each sample (i.e., image) from its feature values. With respect to the type of mathematical procedure, classifiers vary in terms of interpretability and transferability to new data sets. Multinomial logistic regression models using the lasso (least absolute shrinkage and selection operator) inherently provide a feature selection and return a vector of coefficients for the selected features, called signature, which is directly interpretable and transferable.
For numerical stability of a treatment classifier, all non-normally distributed features (Shapiro-Wilk test of normality in discovery data, alpha=0.05) were Box-Cox transformed (parameters lambda1=0 and lambda2=1 if the p-value of this test was increased by transformation). Reduction of dimensionality was carried out by removal of redundancies (according to feature-pairwise Pearson correlation of |r|>0.9 in discovery data) and by pre-selection of informative features through treatment-pairwise logistic lasso regression analysis. Notably, only informative features of limited correlation among each other were used for signature discovery. The CRAN package glmnet was used to perform multinomial logistic lasso regression (Friedman et al. 2010). For classification of three groups (DMSO; IKE/RSL3; STS) a signature of 23 features was identified (
Together, this unbiased approach to classifier identification offers the possibility of discovering features that previously have not been considered in cell death. Hence, this strategy allows the development of a signature using features whose changes human eyes would not necessarily perceive, and helps to more accurately classify cell death states. Notably, there are highly correlated features in the full data set (
We then collected an independent second image set—using the same conditions with viabilities in the 80-90% range (
A four-class classifier trained to distinguish the three inducers (IKE, RSL3 and STS), as well as the DMSO control, did not differentiate between IKE and RSL3, as expected. Both classes were assigned identically to IKE (89 cases each) or RSL3 (31 and 29 cases) and minimally to STS (0 or 1 case). Combining IKE and RSL3 resulted in an accuracy of 94% (
The classifier performed well for detecting ferroptosis, as TfR1 is a known ferroptosis marker, and features from this channel are prominently represented in the signature. However, we were intrigued that apoptosis was also readily distinguished from the control group using the developed signature.
This classifier is based on images of cells treated with ferroptosis or apoptosis inducers and stained with anti-TfR1 3F3-FMA, DAPI and FITC-Phalloidin. It is important to consider that for any new (unknown) small molecule that is desired to be tested with this classifier, the concentration and incubation times reducing the viability to 80-90% have to be identified in advance. Standardized microscopy image acquisition of treated cells in combination with this classifier could provide the information of whether the substances induce ferroptosis or apoptosis. As with any analysis tool, some refinement might be needed.
Further, this work may have important implications for tissue analysis and allow for a high-throughput, objective procedure to identify ferroptosis and other cell death modalities in a tissue context, whether with animal disease models or patient samples. One such application may involve assessing the response of cancer patients to therapy (Chen et al. 2021).
This classifier cannot directly be applied to images taken under entirely different conditions (treatments, staining, etc.). However, we present a workflow on how researchers can develop a classifier based on a training image set for various cell death processes with the help of standardization of experiments and corresponding analysis tools. Hence, this strategy may serve as a blueprint to be employed for the detection of other cell death pathways, including necroptosis and pyroptosis, and ultimately a universal classifier that detects and classifies all of the major types of cell death.
Cell culture. HT-1080 (ATCC Cat #CRL-7951, RRID:CVCL 0317) cells were grown in Dulbecco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum, 1% penicillin-streptomycin, and 1% non-essential amino acids. Cells were grown in a humidified incubator at 37° C. and 5% CO2.
CellTiter-Glo assay. HT-1080 cells were plated in technical triplicates in white opaque 96-well plates at 15,000 cells/100 μL media per well. For the pilot experiment, the cells were treated with 1 μM RSL3, 20 μM IKE, or 1 μM staurosporine (STS) at different time points. For the immunofluorescence experiments, the cells were treated at the time points determined in the pilot experiment and several time points before and after. 100 μL of 50% CellTiter-Glo (Promega) and 50% cell culture medium was added to each well, and the cells were incubated and shaken for 2 min at room temperature. Luminescence was measured using a Victor X5 plate reader (PerkinElmer).
Immunofluorescence (IF). HT-1080 cells were treated with 1 μM RSL3, 20 μM IKE, or 1 μM STS on poly-lysine-coated coverslips (Sigma Aldrich P4832) in 24-well plates. When the cell death percentage reached around 10-20% (determined using the CellTiter-Glo assay), media was removed and the cells were gently washed with PBS++ (PBS with 1 mM CaCl2) and 0.5 mM MgCl2) twice, ensuring the cells did not dry out. The cells were fixed and permeabilized with 4% PFA in PBS with 0.1% Triton X-100 (PBT), with 200 μL per well. The plates were covered with foil, and the cells were incubated and shaken at room temperature for 15-20 min. The PFA was disposed of safely, and the cells were washed with PBT three times. The cells were blocked with 5% normal goat serum (NGS) (ThermoFisher 50197Z) in PBT for 1 h at room temperature. The cells were then incubated with mouse 3F3 anti-Ferroptotic Membrane Antibody (3F3-FMA) at 1:500 dilution in PBT with 1% bovine serum albumin (BSA) and 5% NGS at 4° C. overnight. The cells were washed with PBT for 5 min three times. The cells were then incubated with goat anti-mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (Thermo Fisher Scientific Cat #A-11032, RRID:AB_2534091) at 1:200 dilution and FITC-phalloidin at 1:1000 dilution in PBT with 1% BSA for 1 h at room temperature. The cells were washed with PBT for 5 min three times. The cells were placed on slides using Prolong Diamond anti-fade mountant with DAPI (ThermoFisher P36962). All images were collected on a Zeiss LSM 800 confocal microscope at Plan-Apochromat 63×/1.40 oil DIC objective with constant laser intensity for all images.
Automated image analysis. Image analysis was performed using Columbus software version 2.8.0 (PerkinElmer). In the following, the analysis steps in Columbus are described: DAPI and FITC signal were smoothened for the cell segmentation process using Median filters to reduce noise signals. Nuclei were detected via the DAPI signal. The FITC channel was used to define the cytoplasm and membrane region. In a next step, morphology/symmetry features, texture (SER features) and intensity properties of the DAPI, FITC and red channel were calculated for each cell region (nuclei, cytoplasm, and membrane). Moreover, we applied a filter to remove border objects (nuclei that cross image borders). For the detailed analysis pipeline in Columbus please see
STATISTICAL DATA ANALYSIS: Transformation and Feature Selection. From two data sets containing 480 samples each (120 DMSO, 120 IKE, 120 RSL3, 120 STS) 1,473 features were generated and exported by the Columbus imaging software. The data sets were filtered for completeness, i.e., all features containing ‘not-a-number’ (NaN) were excluded from analysis, resulting in 1373 features. The data set generated first, was assigned to model discovery, the second data set to model validation. Features that were non-normally distributed in the discovery data according to Shapiro test for normality (p<0.05) were log-transformed (i.e., log(1+x) also known as two-parameter Box-Cox-transformation with lambda1=0 and lambda2=1), if the transformed data were closer to normality in terms of Shapiro-test p-value. Of all pairs of features that were highly correlated in the discovery data (i.e., absolute Pearson correlation coefficient of larger than 0.9) one member was excluded from analysis iteratively; starting with the feature participating in the largest number of correlations in the training data set for classifier discovery, which was preserved, all highly correlated features were removed from both data sets.
Classifier Discovery. Further feature pre-selection was conducted on the discovery data by logistic regression for pairwise classification among control, ferroptosis, and apoptosis using the lasso (least absolute shrinkage and selection operator) (Tibshirani, 2011). All features that were selected at least once in the pairwise logistic regressions were preserved in the training data set for classifier discovery, on which the classifier was trained. For classification a multinomial logistic regression model with the lasso was used, resulting in a signature for sample classification. Lambda.1se was used as criterion for selection of the optimal penalty parameter. The quality of this signature was determined in terms of accuracy of classification of the validation data, where true class membership is known. Importance of signature-features was estimated by the product of the standard deviation of the transformed feature in the discovery data and the coefficient in the regression model. All statistical calculations were conducted using R version 4.0.3, for lasso regression, glmnet package was used (Friedman et al. 2010).
Data Availability. The data underlying this study (raw data as txt files, R code Rmd file, and complete and intermediate Rdata files) are openly available in Columbia University Academic Commons at https://doi.org/10.7916/3hdp-9j07.
All documents cited in this application are hereby incorporated by reference as if recited in full herein.
Although illustrative embodiments of the present disclosure have been described herein, it should be understood that the disclosure is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the disclosure.
The present application is a continuation-in-part of PCT International Application No. PCT/US2021/017216, filed Feb. 9, 2021, which claims benefit of U.S. Provisional Patent Application Ser. No. 62/972,503, filed on Feb. 10, 2020. The present application also claims benefit of U.S. Provisional Patent Application Ser. No. 63/314,962, filed on Feb. 28, 2022. The aforementioned applications are incorporated by reference herein in their entireties.
This invention was made with government support under grant nos. CA209896 and CA087497, awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62972503 | Feb 2020 | US | |
| 63314962 | Feb 2022 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2021/017216 | Feb 2021 | US |
| Child | 17818807 | US |
