Patent Grant
10272043
The present invention relates to a composition comprising one or more oxalate degrading enzymes for delivering the enzymes in active form to the stomach, where the one or more oxalate degrading enzymes exert their effect. Thus, the present invention provides means for reducing oxalate in the stomach. A composition of the invention comprises particles comprising one or more oxalate degrading enzymes embedded in a first polymeric material, wherein the embedded enzyme retains at least two times the activity of the one or more non-embedded free enzymes obtained from the same batch upon incubation in USP simulated gastric juice at 37° C. for at least 60 min under similar conditions.
Kidney/urinary tract stone disease (urolithiasis) is a major health problem throughout the world. Most of the stones associated with urolithiasis are composed of calcium oxalate alone or calcium oxalate plus calcium phosphate. Other disease states have also been associated with excess oxalate. These include, vulvodynia, oxalosis associated with end-stage renal disease, cardiac conductance disorders, Crohns's disease, and other enteric disease states.
Oxalic acid, and/or its salts, oxalate, is found in a wide variety of foods, and is therefore, a component of many constituents in human and animal diets. Increased oxalate absorption may occur after foods containing elevated amounts of oxalic acid are eaten. Foods such as spinach and rhubarb are well known to contain high amounts of oxalate, but a multitude of other foods and beverages also contain oxalate. Because oxalate is found in such a wide variety of foods, diets that are low in oxalate and which are also palatable are hard to formulate. In addition, compliance with a low oxalate diet is often problematic.
The risk for formation of kidney stones revolves around a number of factors that are not yet completely understood. Kidney or urinary tract stone disease occurs in as many as 12% of the population in Western countries and about 70% of these stones are composed of calcium oxalate or of calcium oxalate plus calcium phosphate. Some individuals (e.g. patients with intestinal disease such as Crohn's disease, inflammatory bowel disease, or steatorrhea and also patients that have undergone jejunoileal bypass surgery) absorb more of the oxalate in their diets than do others. For these individuals, the incidence of oxalate urolithiasis increases markedly. The increased disease incidence is due to increased levels of oxalate in kidneys and urine, and this, the most common hyperoxaluric syndrome in humans, is known as enteric hyperoxaluria. Oxalate is also a problem in patients with end-stage renal disease and there is recent evidence that elevated urinary oxalate is also involved in vulvar vestibulitis (vulvodynia).
Enteric coated compositions comprising oxalate degrading bacteria have been suggested for reducing oxalate concentrations. However, enteric coated compositions pass through the stomach in intact form, i.e. the coating is intact and accordingly, no oxalate can be degraded in the stomach. Accordingly, there is still a need for developing compositions that enable degradation of oxalate already in the stomach in order to degrade especially dietary oxalate. Moreover, such compositions are suitable for use in the treatment of enteric and absorptive hyperoxalurias such as hyperoxalurias causing recurrent stone disease. The objective with such a treatment is for the patients to have normal urinary oxalate levels.
The present invention comprises compositions and methods for treating and preventing oxalate-related conditions. Compositions of the present invention comprise enzymes that reduce oxalate. Methods of the present invention comprise administering the compositions to treat or prevent oxalate-related conditions, and methods for making and using such compositions. Compositions of the present invention reduce oxalate under gastric conditions, such as low pH and in the presence of proteases. Composition of the present invention reduce oxalate in the stomach of humans and other animals. Compositions reduce non-systemic oxalate, e.g. oxalate in the gastrointestinal tract, notably in the stomach, and preventing exogenous oxalate (e.g. from food) from entering the systemic circulation.
A composition according to the present invention comprises particles comprising one or more enzymes embedded in a first polymeric material, wherein the embedded enzymes retain at least two times the activity of the one or more non-embedded enzymes from the same batch, after incubation of both the embedded and the non-embedded (free) enzymes in simulated gastric fluid (84 mM HCl and 3.2 mg/ml pepsin at pH ranging from 1.0 to 4.0) at 37° C. for at least 60 minutes. Compositions comprise particles that may further be coated with a second polymeric material.
Compositions may also comprise polymeric materials that may be cross-linked, and optionally, the cross-links may be reduced. In specific embodiments, the first polymeric material is chitosan, alginate, pectin or hyaluronic acid. In addition to the one or more enzymes and the first polymeric material, the particle compositions may also contain one or more additives such as, e.g., pH adjusting agents, buffering agents, solubilizing agents, stabilizers, preservatives, cofactors for the enzymes or one or more pharmaceutically acceptable excipients such as, e.g. fillers, diluents, carriers or the like.
Methods of the present invention comprise providing compositions for non-systemic treatment, for example, providing a composition that enables reducing oxalate in the stomach to avoid the absorption of oxalate from the gastrointestinal tract. The composition protects the oxalate-reducing enzymes embedded therein from the acidic and enzyme-damaging environment in the stomach, and maintains the enzymatic activity in such a harsh environment. Methods of treatment and prevention comprise providing the compositions taught herein in which one or more oxalate degrading enzyme are embedded in a first polymeric material, optionally coating the obtained particles with a second polymeric material, optionally cross-linking the first and/or second polymeric material and optionally reducing the cross-linkages.
The compositions of the present invention are suitable in methods of treatment or prevention of oxalate-related conditions including, but not limited to, hyperoxaluria, absorptive hyperoxaluria, enteric hyperoxaluria, primary hyperoxaluria, idiopathic calcium oxalate kidney stone disease (urolithiasis), vulvodynia, oxalosis associated with end-stage renal disease, cardiac conductance disorders, inflammatory bowel disease, Crohn's disease, ulcerative colitis, and patients who have undergone gastrointestinal surgery and bariatric surgery (surgery for obesity), and/or who have undergone antibiotic treatment. A method of treatment or prevention comprises orally administering to a subject a composition of the present invention, in an effective amount, to reduce the oxalate in the stomach of the subject, and thus reduce the overall oxalate burden of the subject in an efficient and effective manner. Such compositions are pharmaceutically acceptable for oral administration.
Enzymes used in the compositions and methods of the present invention are oxalate reducing enzymes, and include, but are not limited to, oxalate oxidase, oxalate decarboxylase (in the present context abbreviated OxDc), oxalyl-CoA decarboxylase, or formyl-CoA transferase, or combinations thereof. Moreover, other enzymes, cofactors and co-enzymes that are substituents of oxalate degradation pathways or involved in oxalate metabolic pathways, particularly oxalate reduction, are also of relevance alone or in combination with one or more of the oxalate reducing enzymes. In the present invention, not only the enzymes (proteins) are encompassed by this definition, but also polynucleotide sequences that encode oxalate-reducing genes and proteins are contemplated by the present invention. The present invention also contemplates any binding partners of these enzymes and includes antibodies and antibody fragments that bind to or interact with the enzymes.
The enzymes may be derived by isolation from organisms, they may be purified, they may be made synthetically, semi-synthetically or by recombinant means, or they may be used as a cell lysate. The enzymes used in the compositions may be purified recombinant protein, but since the enzymes can also be made in certain bacteria that are safe, it is also contemplated to use those bacteria as whole cells or as lysate. The oxalate-degrading enzyme is normally present in a composition of the invention in an amount that is sufficient to degrade substantially all oxalate normally present in a standard meal. Depending on the food choices, an average Western diet can contain 100 to 300 mg of oxalate/day. In general, about 0.2 g of the particles comprising enzyme (equal to 20 mg of OxDc in 1 mL of suspension of particles) can remove 180 mg oxalate in simulated gastric conditions within 30 min.
One aspect the present invention comprises a composition comprising particles comprising one or more oxalate degrading enzymes embedded in a first polymeric material, wherein the embedded enzyme retains at least two times the activity of the one or more non-embedded free enzymes, obtained from the same batch, upon incubation in USP simulated gastric juice containing 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, such as, e.g., from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3 at 37° C. for at least 60 minutes.
The present invention comprises compositions and methods for treating and preventing oxalate-related conditions. Compositions of the present invention comprise enzymes that reduce oxalate. The compositions of the present invention are designed so that the enzymes retain their activity even if the compositions are subjected to a gastric environment. Methods of the present invention comprise administering the compositions to treat or prevent oxalate-related conditions, and methods for making and using such compositions. More specific, the invention relates to a composition that is designed to enable reduction of oxalate under gastric conditions, thereby enabling a reduction of oxalate already in the stomach. Such a composition is specifically designed to reduce non-systemic oxalate, e.g. oxalate in the gastrointestinal tract, notably in the stomach, and preventing exogenous oxalate (e.g. from food) from entering the systemic circulation.
As mentioned above, the background of the present invention was the need to be able to administer oxalate degrading enzymes to the stomach in order to degrade dietary oxalate and prevent the uptake of oxalate from the stomach and intestinal tract, which prevents oxalate-related diseases and disorders, such as, e.g., hyperoxaluria, primary hyperoxaluria, idiopathic calcium oxalate kidney stone disease (urothiliasis), and especially the absorptive and enteric hyperoxaluria. The administered enzymes are protected from the protein degradation and/or pH or acidic dependent degradation occurring under gastric conditions of the stomach, i.e. low pH and in the presence of pepsin.
Thus, the present invention relates to a composition, wherein the enzymes are embedded in a polymeric material which protects the enzymes from degradation under gastric conditions. It can be envisaged that this composition may comprise any enzyme, but for the purpose of the present invention, oxalate degrading enzymes, such as, e.g., oxalate decarboxylase, oxalate oxidase, or a combination of oxalyl-CoA decarboxylase and formyl CoA transferase, or a combination of any of these, is contemplated by the present invention.
A composition according to the present invention comprises particles comprising one or more enzymes embedded in a first polymeric material, wherein the embedded enzymes retain at least two times the activity of the one or more non-embedded enzymes from the same batch, after incubation of both the embedded and the non-embedded (free) enzymes in simulated gastric fluid (84 mM HCl and 3.2 mg/ml pepsin at pH ranging from 1.0 to 4.0) at 37° C. for at least 60 minutes. The particles may further be coated with a second polymeric material. As used herein, the term “enzymes from the same batch” means enzymes that are isolated or synthesized under identical conditions, and generally are isolated or synthesized in the same isolation or synthesis procedure where the resulting enzyme composition is generally referred to as a batch. For example, a solution of enzymes is divided into two portions in which one portion of enzymes is embedded in a particle and may undergo further treatment, and the other portion of enzymes is treated differently, and these enzymes are considered to be from the same batch.
Normally, two different routes of treatment of oxalate-related disease can be employed, dependent on whether the aim of the treatment is systemic or non-systemic. Methods of the present invention provide a composition for non-systemic treatment, i.e. to provide a composition that enables reducing oxalate in the stomach in order to avoid absorption of oxalate from the gastrointestinal tract. To the best of the inventors' knowledge such a composition is novel and is based on a novel principle of, on the one hand protecting the enzyme from the acidic and enzyme-damaging environment in the stomach, and on the other hand, maintaining the enzymatic activity even in an acidic environment. This goal may be accomplished by embedding the one or more oxalate degrading enzyme in a first polymeric material, optionally coating the obtained particles with a second polymeric material, optionally cross-linking the second polymeric material and optionally reducing the cross-linked coated particles.
In one embodiment of the invention, a reduction in oxalate absorption is achieved by providing oxalate-degrading enzymes to the gastrointestinal tract, particularly the stomach. Compositions of the present invention comprise oxalate reducing enzymes including, but not limited to, oxalate oxidase, oxalate decarboxylase, oxalyl-CoA decarboxylase, or formyl-CoA transferase, or combinations thereof. These enzymes use oxalate as a substrate. Methods of the present invention comprise providing enzymatic compositions for degradation of dietary oxalate in the stomach, thus lowering the concentration of available oxalate in the stomach for absorption. This will also reduce the amount of oxalate going into the intestine for absorption in this segment of the gastrointestinal tract. In addition to absorptive pathways, oxalate secretory pathways have been recently identified in the human stomach. The compositions of the present invention would also be useful in degrading the oxalate secreted into the stomach from the circulatory system, and thus the methods of the present invention contemplate an overall reduction of the oxalate load in an individual.
In another embodiment, the present invention provides compositions and methods for the delivery of an effective amount of an oxalate reducing enzyme to the stomach of a human or animal, particularly to those who are at increased risk for oxalate-related disease. Enzyme activity is used to degrade oxalate in the stomach and reduce the amount of oxalate present in the stomach and intestinal tract, thereby reducing the amount of oxalate available for absorption. Lower levels of oxalate in the gastrointestinal tract can also lead to increased oxalate excretion from the blood into the intestines through the oxalate secretory pathways.
The compositions of the present invention are suitable for use in oxalate-related conditions including, but not limited to, hyperoxaluria, absorptive hyperoxaluria, enteric hyperoxaluria, primary hyperoxaluria, idiopathic calcium oxalate kidney stone disease (urolithiasis), vulvodynia, oxalosis associated with end-stage renal disease, cardiac conductance disorders, inflammatory bowel disease, Crohn's disease, ulcerative colitis, and patients who have undergone gastrointestinal surgery and bariatric surgery (surgery for obesity), and/or who have undergone antibiotic treatment.
A feature of a composition of the present invention is the ability of the particle to protect the oxalate-degrading enzymes from degradation by conditions such as those found in the gastric environment including, but not limited to, degradation by a protease such as pepsin or degradation due to the acidic environment.
The term “oxalate degrading enzyme” as used herein is intended to denote any enzyme that is capable of reducing oxalate. It may reduce oxalate per se and/or it may function in an oxalate reduction pathway. The present invention contemplates the use of any known oxalate reducing or degrading enzymes, and such terms “oxalate reducing” and “oxalate degrading” are used interchangeably herein.
Enzymes used in the compositions and methods of the present invention include, but are not limited to, oxalate oxidase, oxalate decarboxylase (in the present context abbreviated OxDc), oxalyl-CoA decarboxylase, or formyl-CoA transferase, or combinations thereof. Moreover, other enzymes, cofactors and co-enzymes that are substituents of oxalate degradation pathways or involved in oxalate metabolic pathways, particularly oxalate reduction, are also of relevance alone or in combination with one or more of the above-mentioned enzymes. In the present context not only the enzymes are encompassed by this definition, but also polynucleotide sequences that encode oxalate-reducing genes and proteins are contemplated by the present invention. The present invention also contemplates any binding partners of these enzymes and includes antibodies and antibody fragments that bind to or interact with the enzymes.
The enzymes may be derived by isolation from organisms, they may be purified, they may be made synthetically, semi-synthetically or by recombinant means, or they may be used as a cell lysate. Normally, the enzymes will be employed as purified recombinant protein, but since the enzymes can also be made in certain bacteria that are safe, it is also contemplated to use those bacteria as whole cells or as lysate. Due to the medical use of a composition of the invention, it is preferred that the one or more enzymes used are well-defined with respect to purity and activity. The cell lysate, if used, may be made from any microorganism that has oxalate-reducing functions, e.g. O. formigenes.
The compositions of the present invention may also comprise one or more additional factors which may improve the enzyme activity. These additional factors may be, e.g., oxalyl CoA, MgCl2, and/or thiamine diphosphate (an active form of vitamin B1).
In specific embodiments, one or more enzymes from the three main classes of oxalate-degrading enzymes are employed.
The three main classes of oxalate-degrading enzymes include the following. The first, oxalate oxidase, is expressed in higher plants and catalyzes the oxygen dependent oxidation of oxalate to CO2 with concomitant formation of H2O2. This reaction forms the basis of current assays for the detection of urinary oxalate levels. A rapid three-step purification procedure has been developed to obtain oxalate oxidase from barley roots. This enzyme is also present in beetroot stem and root, amaranthus leaves, sorghum and many other grains.
Oxalate decarboxylase (EC 4.1.1.2), the second class of oxalate metabolizing enzymes, is mainly present in various fungi. It has been reported and characterized in several fungi such as, Myrothecium verrucaria, certain strains of Aspergillus niger, white rot fungus, Coriolus versicolor and Collybia velutipes. This enzyme converts oxalate to formate and carbon dioxide in an oxygen dependent reaction. Oxalate decarboxylases also have been used in the clinical assay of oxalate in blood and urine and can be used to lower oxalate levels in foods and the environment. The first bacterial oxalate decarboxylase recently has been described as the product of the YvrK gene which is expressed as a cytosolic protein in Bacillus subtilis. The YvrK protein (the B. subtilis oxalate decarboxylase) has been expressed as a functional recombinant protein in E. coli, purified to homogeneity and fully characterized.
The third class is the bacterial enzyme, oxalyl-CoA decarboxylase, which is active on the CoA-activated substrate and converts it into formyl-CoA. A formyl-CoA transferase then acts to exchange formate and oxalate on CoA. These enzymes have been studied in the oxalate degrading bacteria, Pseudomonas oxalaticus commonly found in the soil and in Oxalobacter formigenes, residing in the GI tract of vertebrates and humans.
The enzymes have been fully reviewed in, “The enzymes of oxalate metabolism: Unexpected structures and metabolism” Svedruzic D. et al. Arch Biochem Biophys. 2005 Jan. 1; 433(1):176-92, which is herein incorporated in its entirety. The enzymes, whether native enzymes, isolated proteins or those made by recombinant techniques, may be modified by recombinant or chemical means and may contain side groups or other appended molecules. For example, enzymes may be modified to have linker molecules for attachment to other molecules or chemical compounds.
In a specific embodiment of the invention, a reduction in oxalate levels is achieved by use of oxalate-degrading enzymes produced by a recombinant means, such as, e.g., Escherichia Coli, or other organisms which have been transformed to express oxalate-degrading enzymes.
Examples of recombinant enzymes of relevance in the present context are:
www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=M7 7128&doptcmdl=GenBank
GenBank Accession number M77128
www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=U82 167&doptcmdl=GenBank
GenBank Accession number U82167
www.ebi.ac.uk/cgi-bin/dbfetch?db=emblcds&id=CAA11727 CoDing Sequence Accession number AJ223978
and/or
www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=Y14 203&doptcmdl=GenBank
GenBank Accession number Y14203
DNA sequences encoding oxalate-degrading enzymes are known to those skilled in the art and are described in, e.g. WO 98/16632, which is incorporated herein in its entirety.
Additionally, a composition according to the present invention may comprise enzymes that comprise modifications or mutations, including, but not limited to, chimeras formed using domains comprising the oxalate degrading active site of an oxalate reducing enzyme, or peptide fragments, notably those comprising or consisting of the active sites; modifications or mutations, including, but not limited to, deletions, insertions, replacements, reversions, mutations for increased activity, substitution of naturally occurring amino acids with non-natural amino acids, or other modifications known to those skilled in the art. Such modified enzymes may have more, less or the same activity as native enzymes, or may have characteristics that are the same or different from native or unmodified enzymes. The present invention contemplates methods and compositions comprising whole enzymes, fragments, peptides, binding regions, active sites or other functional regions, segments, sequences and promoter and control sequences of oxalate reducing enzymes.
In one example, an oxalate decarboxylase was modified. In total, 7 genes were created from the original yvrk gene sequence (the wild-type yvrk). The original gene was from Bacillus subtilis, the gene sequence was optimized for expression in E. coli using an algorithm from GenScript Corporation, Piscataway, N.J. The gene was optimized for codon usage, balancing GC content, removing repetitive elements, and ensuring the absence of internal restriction sites for cloning. The codon optimized gene resulted in a protein with the identical amino acid sequence as the wild-type yvrk.
Modifications were then made to the single cysteine codon of both the wild-type yvrk gene, and the optimized yvrk gene, resulting in 6 additional unique gene sequences. The cysteine codons were modified to serine, arginine, or alanine codons. The modifications were performed for the purposes of eliminating disulfide bonding, and modifying the secondary and tertiary structure of the enzyme.
The gene sequence of the wild-type yvrk gene may be optimized for additional expression systems such as Pichia or Saccharomyces using the same methods. In addition, expression in a Bacillus expression system may be improved by optimizing the gene for optimum codon usage and GC content, and removal of repetitive elements. Codon optimization may also be used for modification of the secondary structure of the protein at positions other than the cysteine codon already modified, or in addition to the cysteine modification, for example, as a method to improve pegylation, microsphere binding or encapsulation, as a method to improve pH stability at low pHs, or as a method to improve the activity of the protein.
Original yvrk sequence with the cysteine codon marked in bold.
Yvrk gene sequence optimized for E. coli, with restriction sites at the 5′ and 3′ ends (underlined), and the cysteine codon marked in bold.
CATATGAAAAAACAGAATGACATTCCACAGCCGATTCGCGGCGATAAAGG
GCAGTAAAGGATCC
The oxalate-degrading enzyme is normally present in a composition of the invention in an amount that is sufficient to degrade substantially all oxalate normally present in a standard meal. Depending on the food choices, an average Western diet can contain 100 to 300 mg of oxalate/day. In general, about 0.2 g of the particles comprising enzyme (equal to 20 mg of OxDc in 1 mL of suspension of particles) can remove 180 mg oxalate in simulated gastric conditions within 30 min.
An effective amount comprises an amount of activity units of oxalate-reducing enzyme activity that will reduce a portion of the oxalate present, or a level of activity units of oxalate-reducing enzyme activity that will initiate a reduction in the amount of oxalate or maintain a lowered amount of oxalate in the individual, compared to the amount of oxalate present before administration of the composition. The number of activity units of oxalate-reducing enzyme activity that can be used in a single dose composition can range from about 0.0001 units to about 5,000 units, from about 5 units to 100 units, from 0.05 to 50 units, to 0.5 to 500, from about 0.01 units to about 50 units, from about 0.01 units to about 5 units, from about 1 units to about 100 units, from about 25 units to about 50 units, from about 30 units to about 100 units, from about 40 units to about 120 units, from about 60 units to about 15 from about 50 units to about 100 units, from about 100 units to about 500 units, from about 100 units to about 300 units, from about 100 units to about 400 units, from about 100 units to about 5,000 units, from about 1,000 units to about 5,000 units, from about 2,500 units to about 5,000 units, from about 0.001 units to about 2,000 units and all ranges encompassed therein. A unit of the enzyme is the amount of enzyme that will degrade one micromole of oxalate per minute at 37° C.
A composition of the present invention comprises a particle comprising an oxalate-degrading enzyme embedded in a first polymeric material. In the non-limiting examples herein are described methods of how to embed the enzyme in the first polymeric material. A person skilled in the art may find other methods suitable for use in order to prepare a composition according to the present invention. By incorporation of the enzyme in the first polymeric material, the enzyme obtains a certain protection against conditions similar to gastric fluid with respect to pH and pepsin. The resulting embedded enzyme composition appears as particles, i.e. discrete units in micron- or nano-size. Accordingly, the terms “particles”, “microparticles” and “nanoparticles” are used herein to describe compositions containing one or more kinds of an oxalate-reducing enzyme embedded in a first polymer or in a first and a second polymer. In general the term “particles” are used as the broadest term, i.e. without any specific size or shape attribution, whereas the term “microparticles” is used when the particles obtained have mean particle sizes in the range of 1 μm to 1000 μm. Likewise, the term “nanoparticles” is used herein when the particles obtained have mean particle sizes ranging from 1 nm to 1000 nm. As used herein the singular of the term “an enzyme” refers to multiple copies of the enzyme molecule, as is commonly understood in reference to protein molecules. As used herein, the term “one or more enzymes” means that one type of enzyme may be present, such as formyl-CoA transferase is intended, or more than one type of enzyme, such as a composition comprising, for example oxalyl CoA decarboxylase and formyl CoA transferase; oxalate decarboxylase and oxalate oxidase, or a combination of wild-type enzyme and mutant enzyme, are present in the composition.
Normally, the particles of a composition of the invention have an average diameter of from about 50 nm to about 1 mm, such as, e.g., from about 500 μm to about 500 μm, from about 1 μm to about 500 μm, from about 2 μm to about 100 μm, from about 4 μm to about 80 μm, from about 6 μm to about 60 μm, from about 8 μm to about 40 μm, from about 10 μm to about 20 μm.
The term “embedded” as used herein is intended to denote that the enzyme is admixed or contacted with the first polymeric material in such a way that
Thus, in a composition of the invention the oxalate-degrading enzyme is protected from the (gastric) environment. Furthermore, the composition of the invention does not substantially release the enzyme to the (gastric) environment. In other words, the enzyme remains in the composition after oral administration for a sufficient period of time to enable oxalate in the stomach to be degraded. In a composition, a first polymeric material may function as a protective carrier for the enzyme and at the same time may allow the substrate, i.e. oxalate, to diffuse or otherwise be transported into the composition to enable an in situ degradation of oxalate. A feature of a composition of the present invention is the composition's ability to retain the enzymatic activity for a period of time longer than that observed for an enzyme that is not embedded in a polymeric matrix, especially under acidic conditions. Accordingly, one aspect the present invention comprises a composition comprising particles comprising one or more oxalate degrading enzymes embedded in a first polymeric material, wherein the embedded enzyme retains at least two times the activity of the one or more non-embedded free enzymes, obtained from the same batch, upon incubation in USP simulated gastric juice containing 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, such as, e.g., from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3 at 37° C. for at least 60 minutes. It is important that the test conditions for the composition according to the invention and the free enzymes are the same, for example, with respect to the nature and purity of the enzyme, the initial concentration of the enzyme, the test volume, the composition of the incubation medium (e.g. simulated gastric juice or fluid), the temperature etc.
Normally, the embedded enzyme retains at least three times the activity, at least four times the activity, or at least five times the activity of the one or more non-embedded free enzymes obtained from the same batch upon incubation in USP simulated gastric juice containing 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3, at 37° C. for at least 30 minutes, at least 45 min, at least 60 minutes, at least 75 minutes, at least 90 minutes, at least 105 minutes or at least 120 minutes.
In a specific embodiment, the one or more embedded oxalate degrading enzymes in a composition of the invention retain at least two times, at least 10 times, at least 50 times or at least 100 times, the activity of the one or more non-embedded free enzyme, obtained from the same batch, upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3, at 37° C. for at least 60 minutes.
Simulated gastric juice (gastric fluid) referred to above is described in USP (United States Pharmacopoeia) and contains pepsin and has a specific ratio of concentrated HCl. (USP simulated gastric juice contains 2 g NaCl, 3.2 g pepsin and 7 mL concentrated HCl in 1 L volume. The pH of this solution usually ranged from 1.2 to 1.5, depending on the concentration of the HCl used. In some examples herein, the pH was adjusted to above 2. This may be the case when microparticles without any coating were employed. For the present purpose, the pH should be in the acid range, i.e. at the most about 7, at the most 6 and the pH range should normally be from about 1 to about 5, from about 2 to about 5. In the experimental section herein are more details relating to the above-mentioned test and to determination of the enzymatic activity.
The residence time in the stomach of a human is on average about 120 min. It is contemplated that the enzymatic activity of the compositions of the present invention is retained at a sufficient level, an effective level, for 120 min or more. From the examples herein it is seen that it is possible to retain at least 50% of the enzymatic activity for a composition according to the invention after 120 min of exposure to an acidic environment. If the enzyme that is used is not embedded in a polymer, e.g., a non-embedded enzyme, the activity decline is very rapid, and no activity is left after 60 min in acidic environment.
Normally, the activity of one or more oxalate degrading enzymes in a composition according to the invention at the most decreases to about 30%, at the most decreases to 40% such as at the most decreases to about 50%, at the most decreases to about 60% or at the most decreases to about 70%, when incubated in an aqueous buffer solution having a pH in the range of from about 1.0 to about 5, in a range of from about 1.0 to about 4.5, from about 1.5 to about 4.5, from about 2.0 to about 4.0 or from about 2.2 to about 4.0, for about 60 min. for about 90 min, for about 105 minutes or for about 120 minutes, with the initial activity being set to 100%.
In a specific embodiment, the activity of the oxalate degrading enzyme in a composition of the present invention at the most decreases to 80%, with the initial activity being set to 100%, when tested at a pH of from about 2.0 to about 4.0 for a time period of 60 min.
In a further specific embodiment, the activity of one or more oxalate degrading enzymes in a composition of the present invention at the most decreases to about 20% when incubated in an aqueous buffer solution having a pH in the range of from about 2 to about 4.5 for 2 hours, and the initial activity being set to 100%. Notably, the activity at the most decreases to 30%, and the initial activity being set to 100%.
Suitable buffer substances for providing a buffer solution having a specific pH are known to persons skilled in the art. Examples are glycine buffers (pH 2-3), acetate buffers, phosphate buffers, borate buffers and the like. The buffer solution may contain additional ingredients such as e.g. inorganic salt in order to adjust the ionic strength of the buffer solution, or one or more proteases like e.g. pepsin in order to ensure that the conditions in the buffer solutions challenge whether the embedded enzyme can withstand such harsh conditions. In the event that one or more proteases are included, the concentration thereof is normally at the same level as that used in USP simulated gastric juice.
As mentioned herein before, the oxalate degrading enzymes can be of various types, classes, identity and nature. In a preferred aspect, a composition of the present invention comprises one or more oxalate degrading enzymes including oxalate decarboxylase, oxalate oxidase, or a combination of oxalyl-CoA decarboxylase and formyl CoA transferase, or combination thereof.
Suitable polymeric materials for use as a first polymeric material in a composition of the present invention, include, but are not limited to, man-made or natural polymers, including, but not limited to,
i) a polysaccharide: alginate including alginic acid, alginate e.g. sodium alginate, potassium alginate, ammonium alginate, calcium alginate, propane-1,2-diol alginate, acacia, carrageenan, chitosan and its derivatives, chondroitin sulfate, dextran derivatives, heparin, hyaluronic acid, inulin, a cellulose or a cellulose derivative including methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, ethylmethylcellulose, or the like or combinations thereof; ii) a mucopolysaccharide, iii) a gum including locust bean gum, guar gum, tragacanth, agar, acacia gum, xanthan gum, karaya gum, tara gum, gellan gum, or the like or combinations thereof; iv) a gelling- or swelling agent including hydrocolloids and hydrogelling agents such as, agar, carrageenan, gelatin, polyvinylpyrrolidone, or the like, or combinations thereof; v) others like e.g. protein and polyamide: collagen, albumin, protamine, spermine, synthetic polymer: poly (acrylic acid), poly amino acids (polylysine, etc), polyphosphoric acid, tripolyphosphate, poly (L-lactic acid), poly (vinyl alcohol), poly (DL-lactic acid-co-glycolic acid), or mixtures and combinations thereof.
In specific embodiments the first polymeric material is chitosan, alginate, pectin or hyaluronic acid. In more specific embodiments, the first polymeric material is chitosan or alginate.
Other polymeric materials may be biopolymers or synthetic polymers. Examples of biopolymers include, but are not limited to, proteins, polysaccharides, mucopolysaccharides, heparin, heparin sulfate, heparinoids, dermatan sulfate, pentosan polysulfate, chondroitin sulfate, cellulose, agarose, chitin, carrageenin, linoleic acid, and allantoin, cross-linked collagen, fibronectin, laminin, elastin, cross-linked elastin, collagen, gelatin, hyaluronic acid, chitosan alginate, dextran, methylcellulose, polylysine, and natural rubber. In the compositions of the present invention wherein polymeric matrices are formed, these matrices are porous such that small water soluble molecules can enter and exit the polymeric matrix, including, but not limited to molecules such as oxalate, formic acid, formate, carbon dioxide, oxygen, or oxalyl-CoA. A concentration of the first polymeric material in a composition of the invention is normally in a range from 20% to 70% of the total dry materials.
In addition to the one or more enzymes and the first polymeric material, the particles may also contain one or more additives such as, e.g., pH adjusting agents, buffering agents, solubilizing agents, stabilizers, preservatives, cofactors for the enzymes or one or more pharmaceutically acceptable excipients such as, e.g. fillers, diluents, carriers or the like.
Moreover, it may be advantageous to create a localized acidic pH environment around a protein when the physiological conditions result in a pH well above the reasonable working range of the enzyme. For example, in a higher pH location, an oxalate degrading protein with maximum activity at pH three would benefit from a delivery vehicle capable of reducing the local pH in the proximity around the enzyme to around three.
One method for reducing the local pH is to incorporate a polymer that can undergo hydrolytic degradation in physiological conditions to produce acidic products that reduce the localized pH. For example, alpha polyesters such as PLA, PGA and PLGA biodegrade hydrolytically in vivo to form organic acids (lactic acid and glycolic acid) which can drive down the pH locally into to a functionally desirable range for the enzyme. Poly(dl-lactide) (DLPLA) is an amorphous polymer exhibiting a random distribution of both isomeric forms of lactic acid that can degrade quickly.
In addition, it may be desirable to include a buffer in the delivery vehicle in the form of a base, base containing or base generating material that works in conjunction with the in vivo pH, or the localized pH, or a combination of both to optimize/control the local pH around the enzyme. These buffers may include salts of organic or inorganic compounds or a number of other buffers. It is understood that the pKa of the conjugate acids of which the buffering materials are associated/derived from can be utilized in the appropriate selection of buffering materials.
The particles may be subjected to a cross-linking procedure. Such a cross-linking procedure may strengthen the properties of the particles such as to avoid loss of enzymatic activity by negative impact of pH or pepsin from the surroundings during storage or after oral administration, or to reduce release of the enzyme from the particles or to reduce or prevent migration of the enzyme towards the surface of the particles. The cross-linking procedures and suitable material for use in such a procedure are described herein.
The particles of the invention may be constructed of polymers that are cross-linked by physical or chemical cross-linking. Physical cross-linking may comprise opposite charged polymers cross-linked with each other by salt bonds (for example: chitosan, which is positively charged, cross-links with tripolyphosphate or heparin, which are negatively charged polymers), charged polymers cross-link with opposite charged ions (for example: alginate with Ca2+, carboxymethyl-cellulose with Al3+). The term “physical cross-linking” used in the present context also includes non-covalent bindings and/or interactions.
Chemical cross-linking generally comprises cross linking by cross-linkers with two reactive functional groups such as by polymer bearing amine groups such as proteins, polyamide, chitosan and its derivatives, may be cross-linked through glutaraldehyde or genipin. UV irradiation can be used to induce polymers bearing light sensitive groups to form covalent cross-links.
Methods for preparation of nano- and micro-particles are known in the art and include emulsion, coacervation/precipitation, spray-drying techniques and others. The properties of nanoparticles or microparticles (for examples: micro-environmental buffer capacity, mechanical strength, particle size, oxalate diffusion rate, interactions with enzymes) largely depend on selected polymer(s), polymer composition and ratio, cross-linking method and preparation procedure. More than one type of cross-linking may be utilized in the microparticles of the invention (e.g. chemical cross-linking as well as physical cross-linking, see the examples herein).
In a specific embodiment the first polymeric material is cross-linked to itself and/or to the one or more enzymes embedded in the first polymeric material.
In a composition of the invention, such as a composition wherein the first polymeric material is cross-linked to itself and/or the enzymes embedded therein, the level of retained enzymatic activity upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 for pH about 3, at 37° C. for at least 30 minutes, for at least 60 minutes, for at least for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or at for least 240 minutes is increased by a factor of at least 2, at least 5, at least 10, at least 15, at least 20, at least 50 or at least 100 as compared to compositions of enzymes of the same batch embedded in the polymer but without the polymer being cross-linked or the enzymes and polymer being cross-linked; or compared to the same batch of free enzymes.
The particles, optionally the particles wherein at least a part of the first polymeric material is cross-linked, may also be provided with a coating. Such a coating has generally the same function as the first polymer, i.e. to avoid a substantial decrease in the enzymatic activity of the enzyme embedded in the first polymer during storage and/or after oral administration.
Accordingly, in a specific embodiment, the particles are coated with a second polymeric material. Suitable coating materials are such materials that allow an aqueous composition containing oxalate to diffuse into, or otherwise enter, the particle of the invention. As mentioned above, the substrate (i.e. the oxalate-containing medium) enters into the particle composition of the invention so that enzymatic degradation of oxalate can occur. Accordingly, coating materials resulting in either diffusion coating or otherwise permeable coatings (e.g. coatings containing pore-forming substances that are substantially water-soluble) can be applied.
Examples of suitable coating materials include, but are not limited to, the materials contemplated as first polymeric materials. A coating material may be chosen that is different than that used as a first polymeric material, but the first polymeric material and the coating material may also be the same. Specific examples of coating materials are film-forming agents such as, e.g. polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxyethylcellulose, hydroxypropylcellulose, polydextrose, maltodextrin, or other polysaccharides including chitosan, alginates and hyaluronic acid. In specific embodiments, the coating material, if present, is one that can be subjected to cross-linking such as, e.g., chitosan and alginate.
In a specific embodiment the first and/or second polymeric material is a polysaccharide such as chitosan, alginate, pectin or hyaluronic acid. The first and second polymeric materials may be the same or different.
Normally, the polymer percentage of the first and, if present, second polymer material is from about 10% to about 80%, from about 60% to about 80% of the total dry material of a particle.
If present, the coating material is normally applied in such an amount the weight gain of the particles is at the most about 40%. As seen from the examples herein, the concentration of the coating material in a particle composition is normally at the most 25% w/w such as at the most about 20% w/w, at the most about 15% w/w or at the most about 10%. A particle having a coating is referred to herein as a coated composition.
In a composition of the invention, such as in a coated composition of the invention, the level of retained enzymatic activity upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5, such as pH about 3, at 37° C. for at least 60 minutes, for at least for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or at for least 240 minutes is increased by a factor of at least 2, at least 10, at least 50 or at least 100 as compared to compositions of the same batch of enzymes embedded in particles lacking a coating, or compared to the same batch of free enzymes.
As mentioned above and as shown in the Examples herein, the stability of the enzymatic activity of the oxalate-degrading enzyme in a composition of the invention may be further improved by employing coated particles wherein the coating has been subjected to cross-linking. Cross-linking of a polymeric material is well-known in the art and may be performed by physical cross-linking or by use of a chemical cross-linking agent.
Suitable chemical cross-linking agents for use in this context include, but are not limited to, dialdehyde, 1-ethyl-3[3-dimethylaminopropyl]carbodiimide (EDC), disuccinimidyl suberate (DSS) or (N-[p-maleimidophenyl]isocyanate (PMPI). In a specific embodiment, the cross-linking agent is a dialdehyde, notably glutaraldehyde or glyoxal. In an embodiment, the cross-linking agent is glutaraldehyde. The cross-linking is normally carried out in 1-5% gluteraldehyde in 50 mM phosphate buffer, pH 7.5 at 37° C., shaking for 1-2 hours.
As mentioned above, a feature of a composition of the invention is that the first and, if present, second polymeric material is permeable for small molecules to allow the substrates for and products of the reaction catalyzed by the one or more enzymes to diffuse through said polymeric materials. Moreover, the first and/or second polymeric materials remain substantially intact upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3, at 37° C. for at least 60 minutes, for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or for at least 240 minutes.
In another embodiment the first and/or second polymeric materials are cross-linked to themselves and/or each other and/or to the one or more enzymes.
In a composition of the invention, such as in a coated or a coated and cross-linked coating composition of the invention, the level of retained enzymatic activity upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5 such as pH about 3, at 37° C. for at least 60 minutes, for at least for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or at for least 240 minutes, is increased by a factor of at least 2, at least 10, at least 50 or at least 100 as compared to compositions of enzymes of the same batch embedded in particles but where the particles lack a second layer of polymeric material (a coating), or a second layer that is cross-linked, or compared to the same batch of free enzymes.
As seen from the Examples herein, a composition of the invention wherein the bonds between the chemical cross-linking agent and the one or more enzymes and/or the first polymeric material and/or the second polymeric material have been reduced by a reducing agent, may lead to further improvements with respect to retaining the enzymatic activity of the composition. Such a reducing agent may be one well-known in the art such as e.g., a reducing agent such as NaBH4 or NaCNBH3.
In a composition of the invention, notably in a coated, with cross-linked coating, and reduced cross-links composition of the invention, wherein the first and/or second polymeric material may be cross-linked, and such a cross-linked material may or may not be reduced, the level of retained enzymatic activity upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5, such as pH about 3, at 37° C. for at least 60 minutes, for at least for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or for at least 240 minutes is increased by a factor of at least 2, at least 10, at least 50 or at least 100 as compared to compositions of the same batch of enzymes in a particle that has not been subjected to a reducing agent; or compared to the same batch of free enzymes.
In a specific embodiment of the invention, the one or more embedded enzymes retain at least two times, at least 10 times, at least 50 times or at least 100 times, the activity of the one or more non-embedded free enzymes obtained from the same batch of enzymes upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5, such as pH about 3, at 37° C. for at least 60 minutes, for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or for at least 240 minutes.
In another specific embodiment of the invention, the one or more embedded enzymes retain at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the initial activity of the embedded enzymes upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5, such as pH about 3, at 37° C. for at least 60 minutes, for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or for at least 240 minutes.
In a further specific embodiment of the invention, the one or more enzymes retain from about 95% to about 100% of the initial activity of the embedded enzymes upon incubation in 84 mM HCl and 3.2 mg/ml pepsin at pH>1, e.g. in a range of pH about 1 to pH about 5, from pH about 2 to pH about 5, from pH about 2.5 to pH about 4.5, from pH about 2.5 to pH about 3.5, such as pH about 3, at 37° C. for at least 60 minutes, for at least 80 minutes, for at least 100 minutes, for at least 120 minutes, for at least 140 minutes, for at least 160 minutes, for at least 180 minutes, for at least 200 minutes, for at least 220 minutes, or for at least 240 minutes.
The enzyme embedded in a particle of the invention is capable of reducing oxalate content of food. As demonstrated in the Examples herein, a composition of the invention comprising 20 mg of one or more oxalate-degrading enzymes degrades at least 40%, such as, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 95% or at least 99% of the oxalate present in 200 g spinach within 1 hour at pH=2.5.
Compositions of the invention may be prepared by employment of various polymeric materials. The following notation is used in the examples herein:
OxDc XX nanoparticles, such as chitosan nanoparticles, denote nanoparticles wherein chitosan is employed as the first polymeric material in which OxDc is embedded.
A comparison of the stability between the embedded enzyme and the free enzyme.
YY coated OxDc XX microparticles, such as alginate coated OxDc chitosan nanoparticles, denote nanoparticles wherein chitosan is employed as the first polymeric material in which OxDc is embedded and the nanoparticles are coated with alginate.
ZZ cross-linked YY coated OxDc XX microparticles, such as glutaraldehyde cross-linked alginate coated OxDc chitosan microparticles, denote microparticles wherein chitosan is employed as the first polymeric material in which OxDc is embedded, and the nanoparticles are coated with alginate to form microparticles, and the microparticles are subsequently cross-linked with glutaraldehyde.
Reduced ZZ cross-linked YY coated OxDc XX microparticles, such as reduced glutaraldehyde cross-linked alginate coated OxDc chitosan microparticles, denote microparticles wherein chitosan is employed as the first polymeric material in which OxDc is embedded and the nanoparticles that are formed are coated with alginate, which forms microparticles, and the microparticles are subsequently cross-linked with glutaraldehyde and subjected to reduction.
Accordingly,
OxDc chitosan/TPP nanoparticles are nanoparticles made from chitosan which contain TPP and have OxDC embedded therein.
Alginate coated OxDc chitosan/TPP microparticles are microparticles based on the nanoparticles formed from chitosan and TPP and embedded OxDc, the nanoparticles are coated with alginate to form microparticles.
Glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles corresponds to the microparticles mentioned above, but the microparticles have been subjected to glutaraldehyde treatment to establish cross-linking.
Reduced glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles corresponds to the microparticles mentioned above further being subjected to a reduction process.
A composition of the invention is suitable for use for oral administration to a subject. A composition is provided as oral pharmaceutical formulations, which may be delivered to the oral cavity, the mouth, a buccal patch, to the stomach, attached to the stomach mucosa, in a slow release liquid, in a quick release tablet in the mouth or stomach, coating the esophagus, in a liquid or solid form accompanying food, prior to ingesting food, or immediately after ingesting food.
The composition administered is normally in solid form e.g. in the form of particles or in a solid dosage form e.g. in the form of sachets, capsules or tablets (e.g. the particles are further processed into a suitable dosage form by methods well-known by a person skilled in the art). To this end, suitable pharmaceutically acceptable excipients may be added such as, e.g., fillers, binders, disintegrants, colors, flavors, pH-adjusting agents, stabilizers etc. Moreover, one or more further therapeutically and/or prophylactically substances may be added and/or other enzymes, cofactors, substrates, coenzymes, minerals and other agents that are helpful in the reduction of oxalate.
Examples of suitable pharmaceutically acceptable excipients include: dextrins, maltodextrins, dextrose, fructose, glucose, lactose, cellulose derivatives including carboxymethylcellulose calcium, carboxymethylcellulose sodium, hydroxypropylcellulose, hydroxypropylmethylcellulose (HPMC), microcrystalline cellulose (e.g., various grades of Avicel®), starches or modified starches (e.g. potato starch, maize starch, rice starch, pre-gelatinised starch), polyvinyl acetate, polyvinylpyrrolidone, agar, sodium alginate, sodium croscarmellose, calcium hydrogen phosphate, calcium phosphate (e.g. basic calcium phosphate, calcium hydrogen phosphate), calcium sulphate, carboxyalkylcellulose, dextrates, dibasic calcium phosphate, gelatine, gummi arabicum, hydroxypropyl cellulose, hydroxypropylmethylcellulose, methylcellulose, polyethylene glycol, polyethylene oxide, and as lubricants: talc, magnesium stearate, calcium stearate, stearic acid, hydrogenated vegetable oils and the like.
Methods of the present invention comprise treating or preventing oxalate-related conditions in humans and animals by administering an effective amount of oxalate-reducing compositions comprising one or more oxalate-reducing microorganisms, one or more oxalate reducing enzymes or combination and mixtures thereof in the particle compositions taught herein. Methods comprise providing compositions comprising the enzyme-embedded particles taught herein to a subject, human or animal, and reducing oxalate present in the subject, treating or preventing oxalate related conditions, and/or reducing a portion of the oxalate ingested. Methods for reducing oxalate in a human or animal comprise administering an effective amount of a composition comprising one or more oxalate-reducing enzymes or fragments having oxalate reducing activity in the embedded enzyme particle compositions of the present invention to a subject, human or animal, and reducing oxalate present. The reduction may take place in any tissue or body fluid environment of the subject. Body fluids include secretions of the body such as nasal or gastric secretions, saliva, blood, serum, urine, chyme or digestive matter, tissue fluid, and other fluid or semi-solid materials made by humans or animals. For example, embedded enzyme particle compositions can be administered orally to a human or animal and the oxalate-reducing enzyme activity reduces the oxalate present in the stomach of the human or animal. Embedded enzyme particle compositions of the present invention may be mixed in liquids, food or other dietary materials and provided to a human or animal so that the oxalate-reducing enzyme activity of the particles is effective in the stomach environment. Embedded enzyme particle compositions of the present invention may also be mixed with foodstuffs or other materials in which oxalate is found and the oxalate-reducing enzyme activity of the particles reduces the oxalate present in the foodstuff or other materials.
The methods for treating and preventing oxalate-related conditions comprise administering a composition comprising particles comprising an effective amount of oxalate-reducing enzymes. An effective amount comprises an amount of activity units of oxalate-reducing enzyme activity that will reduce a portion of the oxalate present, or a level of activity units of oxalate-reducing enzyme activity that will initiate a reduction in the amount of oxalate or maintain a lowered amount of oxalate in the individual compared to the amount of oxalate present before administration of the composition. The number of activity units of oxalate-reducing enzyme activity that can be used in a single dose composition can range from about 0.0001 units to about 5,000 units, from about 5 units to 100 units, from 0.05 to 50 units, to 0.5 to 500, from about 0.01 units to about 50 units, from about 0.01 units to about 5 units, from about 1 units to about 100 units, from about 25 units to about 50 units, from about 30 units to about 100 units, from about 40 units to about 120 units, from about 60 units to about 15 from about 50 units to about 100 units, from about 100 units to about 500 units, from about 100 units to about 300 units, from about 100 units to about 400 units, from about 100 units to about 5,000 units, from about 1,000 units to about 5,000 units, from about 2,500 units to about 5,000 units, from about 0.001 units to about 2,000 units and all ranges encompassed therein. The compositions may further include other enzymes, cofactors, substrates, coenzymes, minerals and other agents that are helpful in the reduction of oxalate. An unit of the enzyme is the amount of enzyme that will degrade one micromole of oxalate per minute at 37° C.
In a treatment method, an effective amount of a particle composition as taught herein is administered orally to be ingested by a subject at least once a day, at least twice a day, at least three times a day, at least four times a day or more if necessary, and such administration can be for one day, two days, three days, four days, five days, or a week, two weeks, three weeks, or a month, two months, three months, four months, five months, six months, more than six months, one year, two years, or for years or continuously through the life of the patient. Such treatment may be continued to maintain the desired oxalate levels in a subject.
It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
All patents, patent applications and references included herein are specifically incorporated by reference in their entireties.
It should be understood, of course, that the foregoing relates only to exemplary embodiments of the present invention and that numerous modifications or alterations may be made therein without departing from the spirit and the scope of the invention as set forth in this disclosure.
Although the exemplary embodiments of the present invention are provided herein, the present invention is not limited to these embodiments. There are numerous modifications or alterations that may suggest themselves to those skilled in the art.
The present invention is further illustrated by way of the examples contained herein, which are provided for clarity of understanding. The exemplary embodiments should not to be construed in any way as imposing limitations upon the scope thereof. On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.
Methods
Assay for Enzymatic Activity
Samples are appropriately diluted with Tris buffer (typically 5 or 10 times) to 0.5-1 mg/ml, of which 10 μL are aliquoted into 1.5 mL eppendorf tubes. To each tube, 390 μL warm substrate buffer (usually 20 mM oxalate in 20 mM citrate buffer, pH 4) is added and immediately placed on a thermomixer for exactly 10 minutes, at which time 100 μL 0.5M H2SO4 is added. Total formate produced is measured directly by HPLC. Using an ion exchange column (Aminex HPX-87H, BioRad) and an isocratic gradient of 20 mM H2SO4, formate is detected by UV at 210 nm with peaks typically eluting at 14.3 minutes.
Stability Test
Incubation in Buffer at a pH of from about 2 to about 3
After incubation of OxDc free enzyme or the composition in question containing the OxDc enzyme embedded in a polymeric material in 100 mM glycine buffer at a pH range from 2 to 3 for a certain period, the remaining OxDc activity was analyzed.
Incubation in Simulated Gastric Fluid
A particle composition containing from about 2 mg OxDc to about 20 mg OxDc was placed in a vessel containing 100 mL of simulated gastric fluid prepared according to USP, i.e. by dissolving 2 g NaCl, 3.2 g pepsin, and 7 mL concentrated HCl in a final volume of 1 L. At suitable time intervals, a sample was drawn and assayed for OxDc activity as described above.
Incubation in Buffer
The same procedure as described above (for simulated gastric fluid). However, various buffer solutions were employed dependent on the pH value of interest. Suitable buffers include glycine buffers (pH 2-3), acetate buffers (pH 3-6), phosphate buffers (pH 5-8), borate buffers (pH 8-9) and the like. A protease may be added such as, e.g., pepsin in a concentration normally corresponding to the concentration found in the USP simulated gastric fluid.
Preparation of OxDC Alginate Microparticles and Influence of Various Process Parameters on the Stability
This example illustrates the preparation and stability of OxDc alginate microparticles and, furthermore, illustrates the influence of various process parameters on the stability of OxDc embedded in the microparticles.
Preparation of OxDc Alginate Microparticles
Microparticles I—Emulsification 1:
11 ml of the mixture of alginate (1.8%, w/v) and OxDc (10:1, v/v; OxDc, 20 mg/ml, in 10 mM TrisHCl, pH 3.9) in 50 mM citrate buffer, pH 3.9, were mixed with 20 ml mineral oil containing 0.5% triton x-100 by magnetic stirring at 600 rpm for 10 min to reach stable emulsion state, then 4 ml CaCl2 mineral oil emulsion (2 ml 0.2 M CaCl2+2 ml mineral oil) was added and continued to stir for 30 min. 8 ml chitosan mineral oil emulsion (4 ml 0.8% chitosan and 4 ml mineral oil) was then added and stirred for another 30 min. Microparticles were collected by centrifugation. In the following these microparticles are denoted Microparticles I.
Microparticles II—Emulsification 2:
All the same as “Emulsification 1” except that the mixture of alginate and OxDc was in 10 mM TrisHCl buffer, pH 8. In the following these microparticles are denoted Microparticles II.
Chitosan Coated OxDc Alginate Microparticles—Alginate Gelation at Different Concentrations (Emulsification) and Further Coating of the Microparticles with Chitosan:
8 ml of alginate (1.2% or 3%; w/v) was mixed with 0.5 ml OxDc (16 mg/ml) in 50 mM TrisHCl buffer, pH 9, then mixed with 15 ml mineral oil containing 0.8% triton x-100 by magnetic stirring at 600 rpm for 10 min to reach stable emulsion state, then 8 ml CaCl2 mineral oil emulsion (4 ml 1 M CaCl2+4 ml mineral oil) was added and continued to stir for 30 min, then added 50 ml 1 M CaCl2 under stirring. Microparticles were collected by centrifugation and washed with water twice. All microparticles (about 4 ml) were merged in the mixture of 36 ml 0.4% chitosan, pH 5.45 and 4 ml of 4 M CaCl2 and shaken at 200 rpm for 1 h. In the following these microparticles are denoted as Chitosan coated OxDc alginate microparticles.
All microparticles obtained in this example had a particle size distribution estimated to be in a range of about 1-100 μm.
The microparticles obtained were assayed for enzymatic activity as described above. The total enzyme activity is the enzyme activity of the enzymes prior to embedding the enzymes in the polymeric matrix, and this amount is set to 100%. The following results were obtained:
About 40% and 48% of the total enzyme activity was found in the microparticles prepared at pH 3.9 (Microparticles I) and at pH 8 (Microparticles II), respectively. The stability of the two kinds of microparticles was tested at pH 3 with 3.2 mg/ml of pepsin.
About 42% and 60% of the total enzyme activity was found in the chitosan coated OxDc alginate microparticles prepared by 1.2% and 3% of alginate, respectively. The stability of the two kinds of chitosan coated OxDc alginate microparticles was tested at pH 3 with 3.2 mg/ml of pepsin (
Accordingly, the pH present during the preparation of the microparticles seems to influence the stability of OxDc during incubation, i.e. an increase in pH favors better stability and an increase in alginate concentration also seems to have a positive impact on the stability.
Preparation of OxDc Nanoparticles and Coating Thereof
This example illustrates the preparation of OxDc-containing nanoparticles and various coatings thereof.
OxDc Chitosan/Tripolyphosphate Nanoparticles:
40 ml 0.15% (w/v) of tripolyphosphate (TPP) containing 0.5 mg/ml OxDC, pH 8.1 (adjusted by HCl before adding OxDC) was dropped into 120 ml 0.18% (w/v) chitosan in 0.13% (w/v) acetic acid, pH 3.92. Nanoparticles were collected by centrifugation and washed with water twice. This process produced about 4 ml of nanoparticles suspension.
OxDc Chitosan/TPP Nanoparticles Coated with Alginate:
0.8 ml of the nanoparticle suspension was diluted in 10 ml water under stirring, and then 5 ml of 1.2% alginate solution (in 25 mM TrisHCl buffer, pH 8.6) was added by dropping. The mixture was kept under stirring for 5 min. The size of the coated nanoparticles increased to 2-400 μm, with the majority around 30 μm (see
OxDc Chitosan/TPP Nanoparticles Coated with Carrageenen:
0.8 ml of the nanoparticle suspension was diluted in 10 ml water under stirring, then 5 ml of 0.5% carrageenen solution (natural pH 8.9) was added by dropping. The mixture was kept under stirring for 5 min. The coated nanoparticles should form microparticles and have a similar distribution as those coated with alginate (see above). The microparticles were collected by centrifugation and washed twice with water, and resuspended.
OxDc Chitosan/TPP Microparticles Coated with Either Alginate or Carrageenen were Cross-Linked with Glutaraldehyde at Different Concentrations of Glutaraldehyde:
0.2 ml of the microparticle suspension was diluted in 0.8 ml water under stirring, and then 2 ml of 0.15-7.5% glutaraldehyde solution (in 50 mM KPB, pH 7.5) was added and mixed. The mixture was kept under stirring for 15-40 min and the microparticles were collected by centrifugation and washed twice with water.
Reduction of Glutaraldehyde Cross-Linked Alginate Coated OxDc Chitosan/TPP Microparticles
Two different kinds of glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles were prepared: one was cross-linked without addition of CaCl2 and the other with addition of 1.2 M CaCl2 10 min after cross-linking reaction (1% of glutaraldehyde) started. After the cross-linking reaction ran for 1 h, microparticles were collected by centrifugation and washed with water twice. The two kinds of microparticles were further suspended in 100 mM of KPB, pH 7.5. A certain amount of NaBH4 powder was added to the suspension solutions to make final concentration of 20 mM NaBH4 and kept in the dark and shaking for 14 h.
The following results were obtained:
OxDc Chitosan/TPP Nanoparticles:
Nanoparticles were too small to be visually observed under the optical microscope. OxDc was almost 100% trapped by the nanoparticles under the current conditions. Under these conditions, OxDC was dissolved with TPP at high pH (8.6) and then dropped into a low pH (3.92) chitosan solution. The great preference of the enzyme dissolved in high pH over low pH is a factor in maintaining the enzyme inside the nanoparticles at the nanoparticle formation period. The stability of OxDc at pH 3.0 in the OxDc chitosan/TPP nanoparticles was between that of microparticle I and microparticle II from Example 1 and
Alginate Coated OxDC Chitosan/TPP Microparticles:
The stability of OxDc at pH 3.0 was further improved when an alginate coating was applied, compared to uncoated nanoparticles See
Carrageenen Coated OxDc Chitosan/TPP Microparticles:
The stability of OxDC at pH 3.0 was further improved when a carrageenen coating was applied (compared to uncoated nanoparticles)
Alginate Coated OxDc Chitosan/TPP Microparticles Wherein the Whole Particle is Cross-Linked with Glutaraldehyde at Different Concentrations of Glutaraldehyde:
(Though not wishing to be bound by any theory, it is believed that the glutaralaldehyde cross-linking occurs mostly within the chitosan molecule, linking chitosan molecules to itself and each other, and among chitosan molecules and enzyme molecules.)
Alginate coated microparticles plus cross-linking showed higher stability at low pH than the nanoparticles without alginate coating. High level of cross-linking improved the OxDc stability inside the alginate coated microparticles at low pH (
Reduction of Glutaraldehyde Cross-Linked Alginate Coated OxDc Chitosan/TPP Microparticles:
The stability of the glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles under low pH after the reduction of Schiff's double bounds was significantly improved. The glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles with CaCl2 addition during cross-linking lost 80% of OxDc activity after 120 minutes whereas the microparticles without CaCl2 addition under pH around 2.0 lost 80% activity in a very short time. For details, see
From the above series of experiments, the formulation of reduced glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles was selected for further development.
Experiments for In Vitro Testing of Removing Oxalate from Food Under Simulated Stomach Condition
In Vitro Testing of Reduced Glutaraldehyde Cross-Linked Alginate Coated OxDc Chitosan/TPP Microparticles
10, 20 and 40 g of spinach was mixed with 12 ml of simulated stomach juice (gastric fluid) (84 mM HCl with 3.2 mg/ml pepsin), respectively. Then water was added to make the final volumes of 40, 80 and 160 ml, respectively. After homogenizing the spinach, simulated gastric fluid and water, reduced glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles were added to degrade the oxalate released from the spinach. The (dosage) ratio of spinach/microparticle is 200 (200 g of spinach mixed with 1 g of microparticles) for all three conditions. Spinach was selected for this experiment, because it contains high amount of oxalate (about 200 mM of oxalate in the frozen spinach leaf).
Results and Discussion:
The amount of soluble oxalate is significantly influenced by pH. The pH values were 2.5, 3.5 and 4.2, for 10, 20 and 40 g of spinach conditions, respectively. The initial soluble oxalate concentrations were 30.0, 22.8 and 14.7 mM, for 10, 20 and 40 g of spinach conditions, respectively (
The OxDc microparticles kept removing more and more soluble oxalate (
If using these results to simulate treatment in vivo, assume that a person whose stomach contains 120 ml of gastric fluid is to begin ingesting a total of 400 g of spinach. After ingestion of 100 g spinach, 4 g of microparticles are taken. Almost all soluble oxalate will be removed within 2 min. Although ingestion of the spinach continues until 400 g is eaten, soluble oxalate is maintained below 3 mM during eating and quickly reduces to 0 after eating.
Formulated OxDC According to the Invention
I. Preparation of Formulated OxDC (Microparticles) and Testing its Stability at Low pH
Reduced glutaraldehyde cross-linked alginate coated OxDc chitosan/TPP microparticles are produced as follows:
After incubation of OxDc as free enzyme or in this microparticle in 100 mM glycine buffer at a pH range from 2 to 3 for a certain period, the remained OxDc activity was analyzed.
As shown in
Reduced glutaraldehyde cross-linked alginate coated OxDc chitosan/TTP microparticles retain stability at pH as low as 2.2. This is a significant improvement since the unformulated enzyme (free, non-embedded) is irreversibly inactivated at pH<3.0.
II. Studies on the Degradation of Oxalate by OxDc Microparticles
A. Degradation of Oxalate (as Sodium Oxalate) in Low Concentration Range:
OxDc microparticles (prepared as described under I, Example 4 above) containing 2 or 20 mg of OxDc were mixed with 100 ml oxalate solution with concentration from 0.05 to 2 mM at pH 3 at 37° C. The generated formate was measured during a period of time.
As shown in
0.05 mM to 2 mM oxalate concentration in the human stomach corresponds to a dietary intake of 5 mg to 180 mg of oxalate and an assumed stomach volume of 1 L. The average daily intake of oxalate in the Western diet is reported to be 100-500 mg/day in all the meals. The intake can be much higher if some high oxalate foods like spinach are eaten. Degradation of oxalate in the range of 15 to 30 mM from spinach has also been investigated and is described below.
20 mg of OxDc (estimated amount of enzyme protein in 1.0 ml of the microparticle formulation) almost completely degraded 0.05 mM to 2 mM oxalate in 2 minutes.
Degradation of Spinach Oxalate in Simulated Gastric Conditions:
Mixing spinach with simulated gastric fluid: 10, 20 and 40 g of spinach was mixed with 12 ml of simulated stomach juice (84 mM HCl with 3.2 mg/ml pepsin) then water was added to make the final volumes of 40, 80 and 160 ml, respectively.
Removing oxalate by OxDc: After homogenization of the spinach, gastric fluid and water suspensions, OxDc microparticles were added to degrade oxalate released from spinach. The (dosage) ratio of spinach/OxDc is approximately 2000 (2000 g of spinach mixed with microparticles having the activity of 1 g of OxDc) for all three conditions.
Calculated total oxalate in all of the above preparations was 50 mM (spinach is reported to contain 18 g of total oxalate/kg). Due to different levels of buffering of the gastric fluid by the presence of spinach, the final pH of three spinach suspensions was 2.5, 3.5 and 4.2, respectively. The pH of the medium is known to affect the availability of soluble oxalate and therefore the concentration of bioavailable oxalate in three preparations tested were 30 mM (square points), 22 mM (diamond points) and 15 mM (triangle points), respectively. (
The microparticles with OxDc were capable of degrading a wide range of oxalate concentration from 0.05 mM to 30 mM in simulated gastric conditions in pH ranging from 2.5 to 4.2 (see
This application claims the priority of U.S. Provisional Patent Application No. 60/750,896, filed Dec. 16, 2005, which is herein incorporated in its entirety.
| Number | Name | Date | Kind |
|---|---|---|---|
| 4205132 | Sandine et al. | May 1980 | A |
| 4539118 | Crider | Sep 1985 | A |
| 4619897 | Hato et al. | Oct 1986 | A |
| 5206219 | Desai | Apr 1993 | A |
| 5263992 | Guire | Nov 1993 | A |
| 5286495 | Batich et al. | Feb 1994 | A |
| 5427935 | Wang et al. | Jun 1995 | A |
| 5547870 | Datta et al. | Aug 1996 | A |
| 5554147 | Batich et al. | Sep 1996 | A |
| 5603971 | Porzio et al. | Feb 1997 | A |
| 5604111 | Peck | Feb 1997 | A |
| 5607417 | Batich et al. | Mar 1997 | A |
| 5788687 | Batich et al. | Aug 1998 | A |
| 5868720 | Van Antwerp | Feb 1999 | A |
| 5912125 | Peck et al. | Jun 1999 | A |
| 5916790 | Enevold | Jun 1999 | A |
| 6033719 | Keogh | Mar 2000 | A |
| 6080404 | Branham et al. | Jun 2000 | A |
| 6090628 | Peck et al. | Jul 2000 | A |
| 6177478 | Holmes-Farley et al. | Jan 2001 | B1 |
| 6200562 | Allison et al. | Mar 2001 | B1 |
| 6203797 | Perry | Mar 2001 | B1 |
| 6214980 | Peck et al. | Apr 2001 | B1 |
| 6242230 | Batich et al. | Jun 2001 | B1 |
| 6281252 | Holmes-Farley et al. | Aug 2001 | B1 |
| 6297425 | Schelonge et al. | Oct 2001 | B1 |
| 6355242 | Allison et al. | Mar 2002 | B1 |
| 6566407 | Holmes-Farley et al. | May 2003 | B2 |
| 6642363 | Mooney | Nov 2003 | B1 |
| 6699469 | Allison et al. | Mar 2004 | B2 |
| 6929940 | Richards et al. | Aug 2005 | B1 |
| 8431122 | Sidhu et al. | Apr 2013 | B2 |
| 8486389 | Allison et al. | Jul 2013 | B2 |
| 8545836 | Sidhu et al. | Oct 2013 | B2 |
| 8900575 | Li et al. | Dec 2014 | B2 |
| 20010036473 | Scott et al. | Nov 2001 | A1 |
| 20020061292 | De Simone | May 2002 | A1 |
| 20030064109 | Qian | Apr 2003 | A1 |
| 20030138415 | Shepard | Jul 2003 | A1 |
| 20040120941 | Allison et al. | Jun 2004 | A1 |
| 20040234514 | Sidhu et al. | Nov 2004 | A1 |
| 20050272138 | Mateo | Dec 2005 | A1 |
| 20070178070 | Kaul et al. | Aug 2007 | A1 |
| 20070184118 | Li et al. | Aug 2007 | A1 |
| 20080317810 | Sidhu et al. | Dec 2008 | A1 |
| 20100028422 | Kaul et al. | Feb 2010 | A1 |
| 20110002906 | Sidhu et al. | Jan 2011 | A1 |
| 20130216515 | Sidhu et al. | Aug 2013 | A1 |
| 20140030324 | Sidhu et al. | Jan 2014 | A1 |
| Number | Date | Country |
|---|---|---|
| 3030185 | Apr 1982 | DE |
| 3204284 | Aug 1983 | DE |
| 9503951 | Apr 1997 | JP |
| WO 9531537 | Nov 1995 | WO |
| WO 9535377 | Dec 1995 | WO |
| WO 9807922 | Feb 1998 | WO |
| WO 9816632 | Apr 1998 | WO |
| WO 98052586 | Nov 1998 | WO |
| WO 0021504 | Apr 2000 | WO |
| WO 0074657 | Dec 2000 | WO |
| WO 2002058712 | Aug 2002 | WO |
| WO 2004042053 | May 2004 | WO |
| WO 2005060937 | Jul 2005 | WO |
| WO 2005123116 | Dec 2005 | WO |
| WO 2008105911 | Sep 2008 | WO |
| Entry |
|---|
| Russell et al., Upper Gastrointestinal pH in seventy nine healthy, elderly, North American Men and Women, Pharmaceutical Research, vol. 10, No. 2, 1993. |
| Migneault, Glutaraldehyde: behavior in aqueous solution, reaction with proteins, and application to enzyme crosslinking, BioTechniques, 37:790-802 (Nov. 2004). |
| U.S. Appl. No. 11/899,018, filed Aug. 31, 2007, Sidhu. |
| International Search Report dated Nov. 15, 2010 in application No. PCT/EP2010/003864. |
| International Search Report dated Jun. 4, 2008 in application No. PCT/US2005/045457. |
| European Search Report dated Sep. 4, 2009 in application No. EP 09 16 4430. |
| Khan et al., “A pH-Dependent Colon-Targeted Oral Drug Delivery System Using Methacrylic Acid Copolymers. II. Manipulation of Drug Release Using Eudragit® L100 and Eudragit S100 Combinations,” Drug Development and Industrial Pharmacacy, vol. 26, No. 5, pp. 549-554, 2000. |
| Aoki et al., “Purification of Recombinant Human Pepsinogens and Their Application as Immunoassay Standards,” Biochemistry and Molecular Biology International, vol. 45, No. 2, pp. 289-301, Jun. 1998. |
| Svedruzic et al., “The enzymes of oxalate metabolism: unexpected structures and mechanisms,” Archives of Biochemistry and Biophysics, vol. 433, No. 1, pp. 176-192, 2005. |
| Svedruzic, Mechanism of the reaction catalyzed by the oxalate decarboxylase from Bacillus subtilis, A dissertation for Ph.D., pp. 1-102, University of Florida, 2005. |
| Campieri et al., “Reduction of olxuria after an oral course of lactic acid bacteria at high concentration,” Kidney International, vol. 60, pp. 1097-1105, 2001. |
| European Search Report issued on Feb. 8, 2012 for application No. EP 06 84 8618 (corresponding to U.S. Pat No. 8,545,836). |
| Kailasapathy, “Microencapsulation of probiotic bacteria: Technology and potential applications,” Curr. Issues Intest. Microbiol., vol. 3, pp. 39-48, 2002. |
| Gombotz et al., “Protein release from alginate matrices,” Advanced Drug Delivery Reviews, vol. 31, pp. 267-285, 1998. |
| Jin et al., “The Solution and Solid State Stability and Excipient Compatability of Parthenolide in Feverfew,” AAPS Pharm Sci Tech, vol. 8, No. 4, pp. E1-E6, published on Dec. 14, 2007. |
| European Search Report dated Feb. 9, 2009 in application No. EP 08168165 (corresponding to U.S. Pat. No. 8,486,389). |
| Hoppe B, et al. (2005) Oxalate degrading bacteria: new treatment option for patients with primary and secondary hyperoxaluria, Urol Res. 33(5): 372-375. |
| Siva S, et al. (2009) A critical analysis of the role of gut Oxalobactcr formigcncs in oxalate stone disease. BJU Int. 103(1): 18-21. |
| Khan M.Z.I., et al. (2000) A pH-dependent colon-targeted oral drug delivery system using mcthacrylic acid copolymers. II. Manipulation of drug release using Eudragit L 100 and Eudragit S 100 combinations. Drug Dev Ind Pharm. 26(5): 549-554. |
| Office Action dated Jun. 4, 2009 in U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Office Action dated Oct. 15, 2009 U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Office Action dated Apr. 14, 2010 in U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Office Action dated Oct. 7, 2013 in U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Office Action dated Apr. 2, 2014 in U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Notice of Allowance dated Jul. 30, 2014 in U.S. Appl. No. 11/640,126 (U.S. Pat. No. 8,900,575). |
| Allison, M.J. et al., “Oxalate Degradation by Microbes of the Large Bowel of Herbivores: The Effect of Dietary Oxalate”, Science, vol. 212, pp. 675-676, 1981. |
| Allison, M.J. et al., “Oxalobacter Formigenes Gen. Nov., Sp. Nov.: Oxalate-Degrading Anaerobes that Inhibit the Gastrointestinal Tract”, Archives Microbiology, vol. 141, pp. 1-7, Pqs Feb. 1985. |
| Allison, M.J. et al., “Oxalate Degradation by Gastrointestinal Bacteria from Humans”, Journal of Nutrition, vol. 116, pp. 455-460, 1986. |
| Allison, M.J. et al., “Oxalate-Degrading Bacteria”, In Khan, S.R., Calcium Oxalate in Biological Systems CRC Press, Chapter 7, pp. 1 31-168, 1995. |
| Bowersock, T.L. et al., “Oral Vaccination of Animals with Antigens Encapsulated in Alginate Microspheres”, Vaccine, vol. 17, pp. 1804-1811, 1999. |
| Chandran, P. et al., “Improved Determination of Urinary Oxalate with Alkyamine Glass Bound Barley Oxalate Oxidase”, Journal of Biotechnology, vol. 85, pp. 1-5, Jan. 2001. |
| Cho, N.H. et al., “Novel Mucosal Immunization with Polysaccharide-Protein Conjugates Entrapped in Alginate Microspheres”, Journal of Controlled Release, vol. 53, pp. 215-224, Apr. 1998. |
| Daniel, S.L. et al., “Microbial Degradation of Oxalate in the Gastrointestinal Tracts of Rats”, Applied and Environmental Microbiology, vol. 53, No. 8., pp. 1793-1797, 1987. |
| Daniel, S.L. et al., “Intestinal Colonisation of Laboratory Rats by Anaerobic Oxalate—Degrading Bacteria: Effects on the Urinary and Faecal Excretion of Dietary Oxalate”, Microbial Ecology in Health and Disease, vol. 6, pp. 277-283, 1993. |
| Dawson, K.A. et al., “Isolation and Some Characteristics of Anaerobic Oxalate-Degrading Bacteria from the Rumen”, Applied and Environmental Microbiology, vol. 40, No. 4, pp. 833-839, 1980. |
| Defife, KM. et al., “Effects of Photochemically Immobilized Polymer Coatings on Protein Adsorption, Cell Adhesion, and the Foreign Body Reaction to Silicone Rubber”, Journal of Biomedical Materials Research, vol. 44, pp. 298-307, Mar. 1999. |
| Denstedt, J.D. et al., “Biomaterials Used in Urology: Current Issues of Biocompatibility, Infection, and Encrustation”, Journal of Endourology, vol. 12, pp. 493-500, Dec. 1998. |
| Denstedt, J.D. et al., “Advances in Ureteral Stent Technology”, The World Journal of Urology, vol. 18, pp. 237-242, Sep. 2000. |
| Ditizio, V. et al., “A Liposomal Hydrogel for the Prevention of Bacterial Adhesion to Catheters” Biomaterials, vol. 19, pp. 1877-1884, Oct. 1998. |
| Doane, L.T. et al., “Microbial Oxalate Degradation: Effects on Oxalate and Calcium Balance in Humans”, Nutrition Research, vol. 9, pp. 957-964, 1989. |
| D'Urso, E.M. et al., “Poly(Ethylene Glycol)-Serum Albumin Hydrogel as Matrix for Enzyme Immobilization: Biomedical Applications”, Artificial Cells, Blood Substitutes and Immobilization, Biotechnology, vol. 23. xis. 587-595, Feb. 1995. |
| El-Faqih et al., “Polyurethane Internal Ureteral Stents in Treatment of Stone Patients: Morbidity Related to Indwelling Times”, The Journal of Urology, vol. 146, pp. 1487-1491, Dec. 1991. |
| Fuse, H et al., “Crystal Adherence to Urinary Catheter Materials in Rats”, The Journal of Urology, vol. 151, pp. 1703-1706, Jun. 1994. |
| Gaboury, S.R. et al., “Analysis of Gas Plasma-Modified Poly(dimethylsiloxane) Elastomer Surfaces”, American Chemical Society, pp. 777-790, 1993. |
| Gilchrist, T. et al., “Controlled Silver-Releasing Polymers and their Potential for Urinary Tract Infection Control”, Biomaterials, vol. 12, pp. 76-78, Jan. 1991. |
| Han, J.Z. et al., The Relationship of Oxalobacter Formigenes and Calcium Oxalate Calculi, Journal of Tongji Medical University, vol. 15, No. 4, pp. 249-252, 1995. |
| Hsiue, G.H. et al., “Surface Characterization and Biological Properties Study of Silicone Rubber Membrane Grafted with Phospholipid as Biomaterial via Plasma Induced Graft Copolymerization”. J Biomed Materials Research. vol. 42. rms. 134-147 Oct. 1998. |
| Ito, H. et al., “A New Oxalate-Degrading Organism Isolated from Human Feces”, Abstract, ASM General Meeting, Annual Meeting American Soc. Microbiol, vol. 1, pp. 0-106, 1995. |
| Jensen, N.S. et al., “Studies on the Diversity Among Anaerobic Oxalate Degrading Bacteria Now in the Species Oxalobacter Formigenes”, Abstract, Annual Meeting American Soc. Microbiol, vol. 1, Do. 1-12, 1994. |
| Johnson, J.R. et al., “Prevention of Catheter-Associated Urinary Tract Infection with a Silver Oxide-Coated Urinary Catheter: Clinical and Microbiologic Correlates”, Journal of Infectious Disease, vol. 162, pp. 1145-1150, Nov. 1990. |
| Keane, P.F. et al., “Characterization of Biofilm and Encrustation on Ureteric Stents in Vivo”, British Journal of Urology, pp. 687-691, Jun. 1994. |
| Kulik E. et al., “In Vitro Platelet Adhesion to Nonionic and Ionic Hydrogels with Different Water Contents”, Journal of Biomedical Materials Research, vol. 30, pp. 295-304, Mar. 1996. |
| Ko, Y.G. et al., “Immobilization of Poly (Ethylene Glycol) or its Sulfonate Polymer Surfaces by Ozone Oxidation”, Biomaterials, vol. 22, pp. 2115-2123, Aug. 2001. |
| Langefeld, S. et al., “Functionally Adapted Surfaces on a Silicone Keratoprosthesis”, The International Journal of Artificial Organs, vol. 22, pp. 235-241, 1999. |
| Lee, S.D. et al., “Characterization of Plasma-Induced Graft Polymerization of 2-Hydroxyethyl Methacrylate onto Silicone Rubber”, Journal of Applied Polymer Science, vol. 54, pqs. 1279-1287, 1994. |
| Lee, S.D. et al., “Plasma-Induced Grafted Polymerization of Acrylic Acid and Subsequent Grafting of Collagen onto Polymer Film as Biomaterials”, Biomaterials, vol. 17, pp. 1599-1608, Aug. 1996. |
| Lee, S.D. et al., “Preparation and Characterization of a Homobifunctional Silicone Rubber Membrane Grafted with Acrylic Acid Via Plasma-Induced Graft Copolymerization”, Journal of Polymer Science: Part A: Polymer Chemistry, vol. 34. pqs. 141-148, 1996. |
| Lung, H.Y. et al., “Cloning and Expression of the Oxalyl-CoA Decarboxylase Gene from the Bacterium, Oxalobacter Formigenes: Prospects for Gene Therapy to Control CaOxalate and Kidney Stone Formation”, Amer. J of Kidney Disease, vol. 17, pqs. 381-385, 1991. |
| Mason, M. et al., “Attachment of Hyaluronic Acid to Polypropylene, Polystyrene, Polytetrafluoroethylene”, Biomaterials, vol. 21, pp. 31-36, Jan. 2000. |
| Mutlu, M. et al., “Matrix Surface Modification by Plasma Polymerization for Enzyme Immobilization”, Journal of Materials Chemistry, vol. 1, pp. 447-450, 1991. |
| Nakada, S. et al., “Hyperbranched Modification of Unsaturated Side Chains of Polyethylene Introduced by y-Ray Irradiation Under a 1,3-Butadiene Atmosphere”, Colloid & Polymer Science, vol. 279, pqs. 754-762, 2001. |
| Oswald, P.R. at al., “Properties of Thermostable 6-Glucosidase Immobilized Using Tris (Hydroxymethyl) Phosphine as a Highly Effective Coupling Agent”, Enzyme and Microbial Technology, vol. 23, pp. 14-19, 1998. |
| Potezny, N. et al., “Urinary Oxalate Determination by Use of Immobilized Oxalate Oxidase in a Continuous-Flow System”, vol. 29, pp. 16-20, Jan. 1983. |
| Pundir, C. et al., “Immobilization of Sorghum Leaf Oxalate Oxidase onto Alkylamine and Arylamine Glass”, Chinese Journal of Biotechnology, vol. 15, pp. 129-138, 1999. |
| Reid, G. et al., “Microbial Adhesion and Biofilm Formation on Ureteral Stents in Vitro and in Vivo”, Journal of Urology, vol. 148, pp. 1592-1594, Nov. 1992. |
| Robert, M. et al., “Double-J Ureteric Stent Encrustations: Clinical Study on Crystal Formation on Polyurethane Stents”, Urologia Internationalis, vol. 58, pp. 100-104, 1997. |
| Santin, M. et aL, “Effect of the Urine Conditioning Film on Ureteral Stent Encrustation and Characterization of its Protein Composition”, Biomaterials, vol. 20, pp. 1245-1251, Jul. 1999. |
| Sidhu, H. et al., “Detection and Characterization of Oxalobacter Formigenes Strains Using Oligonucleotide Probes”, Meeting for Urolithaisis, pp. 537-539, 1996. |
| Solomons, C.C. et al., “Calcium Citrate for Vulvar Vestibulitis”, The Journal of Reproductive Medicine, vol. 36, No. 12, pp. 879-882, 1991. |
| Thakur, M. et al., “Discrete Analysis of Plasma Oxalate with Alkylamine Glass Bound Sorghum Oxalate Oxidase and Horseradish Peroxidase”, Journal of Biochemical and Biophysical Methods, vol. 44, pp. 77-88, Jul. 2000. |
| Tieszer, C. et al., “XPS and SEM Detection of Surface Changes on 64 Ureteral Stents after Human Usage”, John Wiley & Sons, Inc., pp. 321-330, Dec. 1997. |
| Tieszer, C. et al., “Conditioning Film Deposition on Ureteral Stents After Implantation”, Journal of Urology, vol. 160, pp. 876-881, Sep. 1998. |
| Tunney, M.M. et al., “Comparative Assessment of Ureteral Stent Biomaterial Encrustation”, Biomaterials, vol. 17, pp. 1541-1546, Aug. 1996. |
| Urban, M.W. et al., “DMA and ATR FT-IR Studies of Gas Plasma Modified Silicone Elastomer Surfaces”, Journal of Applied Polymer Science, vol. 39, pp. 265-283, 1990. |
| Wollin, T. et al., “Bacterial Biofilm Formation, Encrustation, and Antibiotic Adsorption to Ureteral Stents Indwelling in Humans”, Journal of Endourology, vol. 12, pp. 101-111, 1998. |
| Xing, L.C et al., “Oral Colon-Specific Drug Delivery for Bee Venom Peptide: Development of a Coated Calcium Alginate Gel Beads-Entrapped Lipsome”, Journal of Controlled Release, vol. 93, pp. 293-300, Dec. 2003. |
| De Oliveria Neto, G. et al. “Oxalate Determination in Urine Using an Immobilized Enzyme on Sorghum Vulgare Seeds in a Flow Injection Conductimetric System”, J. Braz. Chem. Soc., vol. 8, No. 1, pp. 47-51, 1997. |
| Barbalias, G. et al., “Encrustation of a Netal Alloy Urinary Stent: A Mechanistic Investigation”, European Urology, Abstract, vol. 38, No. 2, pp. 1-2, 2000. |
| Sofer, M. et al., “Encrustation of Biomaterials in the Urinary Tract”, Current Opinion in Urology, vol. 10, pp. 563-569, Nov. 2000. |
| International Search Report for PCT Application No. PCT/US20061047909 dated Sep. 23, 2008. |
| International Search Report for PCT Application No. PCT/US2006/047967 dated Oct. 6, 2008. |
| Grases, Felix et al., “Study on Concretions Developed Around Urinary Catheters and Mechanisms of Renal Calculi Development”, Nephron, vol. 88, pp. 320-328, Aug. 2000. |
| Sidhu, Harrneet et al., “Direct Quantification of the Enteric Bacterium Oxalobacter Formigenes in Human Focal Samples by Quantitative Competitive-Template PCR”, Journal of Clinical Microbiology, vol. 37, No. 5, pp. 1503-1509, May 1999. |
| Lane, Byron G., “Oxalate, Germin, and the Extracellular Matrix of Higher Plants”, The FASEB Journal, vol. 8, pp. 294-301, Mar. 1994. |
| Dominguez-Munoz, J.E. et al., “Effect of Oral Pancreatic Enzyme Administration on Digestive Function in Healthy Subjects: Comparison Between Two Enzyme Preparations”, Aliment Pharrnacol Ther., vol. 11, pp. 403-408, 1997. |
| Baetz, Albert L. et al., :Purification and Characterization of Oxalyl-Coenzyme A Decarboxylase from Oxalobacter Formigenes, Journal of Bacteriology, vol. 171, No. 5, pp. 2605-2608, May 1989. |
| Baetz, Albert L. et al.; “Purification and Characterization of Formyl-Coenzyme A. Transferase from Oxalobacter Formigenes”, Journal of Bacteriology, vol. 172, No. 7, pp. 3537-3540, Jul. 1990. |
| International Search Report and Written Opinion for related PCT Application No. PCT/US2005/021134 dated Nov. 14, 2007. |
| Barreiro-Iglesias et al., “Preparation of chitosan beads by simultaneous cross-linking/insolubilisation in basic pH Rheological optimization and drug loading/release behaviour,” European Journal of Pharmaceutical Sciences, vol. 24, pp. 77-84, 2005. |
| Remunan-Lopez et al., “Development of new chitosan-cellulose multicore microparticles for controlled drug delivery,” European Journal of Pharmaceutics and Biopharmaceutics, vol. 45, pp. 49-56, 1988. |
| Chen et al., “Clinical investigation on gastric oxalate absorption,” Chinese Medical Journal, vol. 116, No. 11, pp. 1749-1751, 2003. |
| Number | Date | Country | |
|---|---|---|---|
| 20150125538 A1 | May 2015 | US |
| Number | Date | Country | |
|---|---|---|---|
| 60750896 | Dec 2005 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 11640126 | Dec 2006 | US |
| Child | 14524361 | US |
