Patent Application
20190300967
Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) blockade can induce durable clinical remissions in a minority of patients with metastatic melanoma. However, prior to the invention described herein, molecular signatures precisely predicting response and resistance to CTLA4 blockade were unknown. As such, there is a pressing need to identify more effective methods for predicting response or resistance to CTLA4 blockade.
The invention is based, at least in part, upon the identification of a gene expression signature that discriminates clinical outcomes of CTLA4 blockade. Specifically, described herein is a specific cluster of cancer-testis antigens and microRNA-211 that are predictive of resistance and response, respectively, to ipilimumab in melanoma. In some aspects, the invention relates to methods, arrays, and kits for diagnosing, monitoring, and treating melanoma.
As described in detail below, in one aspect, the invention is a gene expression signature that predicts clinical response and resistance to CTLA4 blockade, e.g., ipilimumab, in patients with metastatic melanoma.
In one aspect, increased expression of at least one of the following genes significantly correlates with resistance to ipilimumab: MAGEA2, CSAG4, MAGEA2B, AC093787 (RP11-215P9), MAGEA12, CSAG1, GABRA3, CSAG3, makorin ring finger protein 9 (MKRN9P), keratin 8 pseudogene 8 (KRT8P8), MAGEA6, EYA1, CSAG2, RP11-379D21.3, MAGE family member C1 (MAGEC1), RP1-273G13.1, MAGEA3, miR-218-1, pregnancy specific beta-1-glycoprotein 11 (PSG11), X-inactive specific transcript (XIST), RP11-360D2.1, pregnancy specific beta-1-glycoprotein 10 pseudogene (PSG10P), miR-1262, tachykinin 3 (TAC3), PSG8, heat shock protein family B (small) member 3 (HSPB3), gap junction protein beta-6 (GJB6), GABRQ, MAGEA1, MAGEA11, MAGEA9B, and PSG6.
A cluster of CT antigen genes on the Xq28 cytoband (i.e., MAGEA2, CSAG4, MAGEA2B, MAGEA12, CSAG1, CSAG3, MAGEA6, CSAG2, MAGEA3) correlate with resistance to ipilimumab. Additionally, miR-211 and transient receptor potential cation channel subfamily M member 1 (TRPM1) (which subsumes miR-211) correlate with response to ipilimumab.
Also provided is a gene expression signature that predicts clinical response and resistance to a combination of an agonist of an HMGB1 pathway, HMGB1 receptor (henceforth “HMGB1 agonist”)(e.g., toll-like receptor (TLR) agonists); or agonist of autophagy (e.g., metformin, temozolomide, trifluoperazine, divalproex sodium, vorinostat, rapamycin, everolimus, MG-132, doxorubicin, ABT-737, BCL2 inhibitors/antagonists, gemcitabine, torin 1, resveratrol, etc); or an agonist of miR-211, miR-185 and/or miR-513A2; or Xq28-CGA antagonist and CTLA4 blockade, e.g., ipilimumab or tremelimumab, in patients with melanoma, e.g., metastatic melanoma. Specifically, increased expression of at least one of the following genes significantly correlates with benefit to treatment with a TLR agonist (or autophagy agonist or Xq28-CGA antagonist) and ipilimumab: MAGEA2, MAGE2AB, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, and CSAG3. For example, the Xq28-CGA inhibitor comprises an antibody, an aptamer, or a small molecule. Additionally, decreased expression of at least one of these genes significantly correlates with benefit to treatment with an agonist of miR-211, miR-185 and/or miR-513A2. For example, the miR agonist comprises a miR mimetic (natural or synthetic) or an aptamer.
Accordingly, provided is a method of determining whether inhibition of cytotoxic T-lymphocyte-associated protein 4 (CTLA4) in a subject, e.g., a human subject, with melanoma will result in clinical benefit (e.g., inhibition of melanoma cancer cells) in the subject, comprising: obtaining a test sample from a subject having or at risk of developing melanoma; determining the expression level of at least one melanoma-associated gene in the test sample; comparing the expression level of the melanoma-associated gene in the test sample with the expression level of the melanoma-associated gene in a reference sample; and determining whether CTLA4 blockade will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the level of the melanoma-associated gene in the reference sample.
Also provided is a method of treating cancer comprising administering an effective amount of a CTLA4 inhibitor and an effective amount of an HMGB1 agonist or autophagy agonist or Xq28-CGA antagonist. For example, the CTLA4 inhibitor comprises ipilumamab. In another example, the HMGB1 agonist comprises high mobility group box 1 (HMGB1), TLR agonists like unmethylated CpG DNA (e.g., CpG-oligodeoxynucleotides or CpG-ODN), Hiltonol (poly-ICLC), Bacillus Calmette-Guérin (BCG), monophosphoryl lipid A (MPL), imiquimod, etc. In other example, the agonist of autophagy comprises inducers of autophagy, e.g., metformin, temozolomide, trifluoperazine, divalproex sodium, vorinostat, mTOR inhibitors (e.g., rapamycin, everolimus), MG-132, doxorubicin, ABT-737, BCL2 inhibitors/antagonists, gemcitabine, torin 1, resveratrol, etc. In other example, the agonist of miR-211, miR-185 and/or miR-513A2 comprises a miR mimetic (synthetic or natural) or an aptamer.
Also provided are methods of determining whether administration of a CTLA4 inhibitor and an HMGB1 agonist to a subject with melanoma will result in clinical benefit in the subject comprising obtaining a test sample from a subject having or at risk of developing melanoma; determining the expression level of at least one melanoma-associated gene in the test sample; comparing the expression level of the melanoma-associated gene in the test sample with the expression level of the melanoma-associated gene in a reference sample; and determining whether administration of a CTLA4 inhibitor and an HMGB1 agonist will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the level of the melanoma-associated gene in the reference sample.
For example, the test sample is obtained from the melanoma, wherein the melanoma-associated gene comprises a cancer germline antigen (CGA) gene; and determining that administration of the CTLA4 inhibitor and the HMGB1 agonist in a subject with melanoma will result in clinical benefit in the subject if the expression level of the CGA gene in the test sample is higher than the level of the CGA gene in the reference sample.
In one aspect, the CGA gene comprises MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, or CSAG3.
Alternatively, the expression level of the melanoma-associated gene in the test sample is compared with a threshold expression level of the melanoma-associated gene (e.g., a “cut-off level”). The method involves determining whether CTLA4 blockade will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the threshold expression level of the melanoma-associated gene.
In another case, the expression level of the melanoma-associated gene in the test sample is compared with an expression level of a housekeeping gene within the test sample. The method involves determining whether CTLA4 blockade will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the expression level of the housekeeping gene. For example, clinical benefit in the subject comprises complete or partial response or stable disease with overall survival of greater than one year as defined by response evaluation criteria in solid tumors (RECIST). In some cases, clinical benefit is associated with an inhibition of melanoma cells. By contrast, the absence of clinical benefit (i.e., no clinical benefit) in the subject comprises progressive disease or stable disease with overall survival of less than one year as defined by RECIST. Alternatively or in addition to using RECIST, clinical benefit in the subject is evaluated using immune-related response criteria (irRC). For example, clinical benefit comprises long-term survival in spite of disease progression or response defined by irRC criteria
The expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the level of the melanoma-associated gene in the reference sample, the threshold expression level, or the expression level of a housekeeping gene. For example, the expression level of the melanoma-associated gene in the test sample is upregulated (i.e., increased) by at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 15 fold, at least 20 fold, at least 25 fold, at least 30 fold, at least 35 fold, at least 40 fold, at least 45 fold, at least 50 fold, at least 60 fold, at least 70 fold, at least 80 fold, at least 90 fold, at least 100 fold, at least 125 fold, at least 150 fold, at least 175 fold, at least 200 fold, at least 250 fold, at least 300 fold, at least 350 fold, at least 400 fold, at least 500 fold, at least 600 fold, at least 700 fold or at least 800 fold as compared to the level of the melanoma-associated gene in the reference sample, the threshold expression level, or the expression level of a housekeeping gene.
Alternatively, the expression level of the melanoma-associated gene in the test sample is downregulated (i.e., decreased) by at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 15 fold, at least 20 fold, at least 25 fold, at least 30 fold, at least 35 fold, at least 40 fold, at least 45 fold, at least 50 fold, at least 60 fold, at least 70 fold, at least 80 fold, at least 90 fold, at least 100 fold, at least 125 fold, at least 150 fold, at least 175 fold, at least 200 fold, at least 250 fold, at least 300 fold, at least 350 fold, at least 400 fold, at least 500 fold, at least 600 fold, at least 700 fold or at least 800 fold as compared to the level of the melanoma-associated gene in the reference sample, the threshold expression level, or the expression level of a housekeeping gene.
In one aspect, the test sample is obtained from the melanoma tissue, from the tumor microenvironment, or from tumor-infiltrating immune cells. For example, the test sample is obtained from the melanoma and the melanoma-associated gene comprises a gene on chromosome Xq28. For example, the melanoma-associated gene comprises a cancer germline antigen (CGA) gene (i.e., a cancer-testis (CT) antigen gene); and the method involves determining that inhibition of CTLA4 in a subject with melanoma will not result in clinical benefit in the subject if the expression level of the CGA gene in the test sample is higher than the level of the CGA gene in the reference sample. Exemplary CGA genes include melanoma-associated antigen 2 (MAGEA2), MAGEA3, MAGEA6, MAGEA12, chondrosarcoma associated gene 1 (CSAG1), CSAG2, CSAG3, and CSAG4.
Optionally, the melanoma-associated gene is hypomethylated, e.g., there is a decrease in the epigenetic methylation of cytosine residues in CpG dinucleotides deoxyribonucleic acid (DNA) in the promoter and/or a change in epigenetic methylation of cytosine residues in CpG dinucleotides in the gene body. For example, a CGA gene is hypomethylated in the promoter. For example, local hypomethylation of the Xq28 MAGE genes described herein, e.g., MAGEA2, MAGEA3, MAGEA6, or MAGEA12, is identified. Alternatively, or in addition, global hypomethylation of the genes in the test sample is identified. As described herein, hypomethylation of genes is an indication that inhibition of CTLA4 in a subject with melanoma will not result in clinical benefit in the subject.
Optionally, the melanoma-associated gene is hypermethylated, e.g., there is an increase in the epigenetic methylation of cytosine residues in CpG dinucleotides deoxyribonucleic acid (DNA) in the promoter and/or a change in epigenetic methylation of cytosine residues in CpG dinucleotides in the gene body. For example, a CGA gene is hypermethylated in the promoter. For example, local hypermethylation of the Xq28 MAGE genes described herein is identified. Alternatively, or in addition, global hypermethylation of the genes in the test sample is identified. As described herein, hypermethylation of genes is an indication that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject.
Alternatively, the test sample is obtained from the melanoma and the melanoma-associated gene comprises a pregnancy-specific glycoprotein (PSG) gene, a γ-aminobutyric acid (GABA) A receptor gene, an epithelial-to-mesenchymal transition gene, an embryonic development/differentiation gene, an angiogenesis gene, or an extracellular matrix (ECM) gene; and the method involves determining that inhibition of CTLA4 in a subject with melanoma will not result in clinical benefit in the subject if the expression level of the PSG gene, GABA A receptor gene, epithelial-to-mesenchymal transition gene, embryonic development/differentiation gene, angiogenesis gene, or extracellular matrix gene in the test sample is higher than the level of the respective gene in the reference sample.
Exemplary PSG genes include PSG1, PSG2, PSG4, PSG5, PSG6, PSG7, PSG8, PSG9, and PSG11. In some cases, the PSG gene is hypomethylated. Suitable GABA A receptor genes include gamma-aminobutyric acid type A receptor alpha 3 subunit (GABRA3), gamma-aminobutyric acid type A receptor beta 1 subunit (GABRB1), GABRB2, gamma-aminobutyric acid type A receptor gamma 2 subunit (GABRG2), gamma-aminobutyric acid type A receptor theta subunit (GABRQ), gamma-aminobutyric acid type A receptor rho 1 subunit (GABRR1). In one aspect, the epithelial-to-mesenchymal transition gene comprises claudin 1 (CLDN1), CLDN2, eyes absent homolog 1 (EYA1), snail family zinc finger 1 (SNAI1), transforming growth factor beta 2 (TGFB2), or wingless-type MMTV integration site family member 3 (WNT3). Exemplary embryonic development/differentiation genes include homeobox D13 (HOXD13), HOXD11, HOXA2, HOXA5, and HOXD10. In some cases, the angiogenesis gene comprises angiopoietin 1 (ANGPT1), angiopoietin-2 (ANG2), or platelet derived growth factor subunit A (PDGFA). Suitable ECM genes include protocadherin beta 2 (PCDHB2), PCDHB3, PCDHB6, PCDHB10, protocadherin gamma subfamily A3, (PCDHGA3), PCDHGB1, PCDHGB2, elastin microfibril interfacer 1 (EMILIN1), and tenascin N (TNN).
In other cases, the test sample is obtained from the melanoma, and the melanoma-associated gene comprises micro ribonucleic acid-211 (miR-211), miR-513A2, or miR-185. It is determined that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of miR-211, miR-513A2, or miR-185 in the test sample is higher than the level of miR-211, miR-513A2, or miR-185, respectively, in the reference sample.
In other cases, the test sample is obtained from the melanoma, and the melanoma-associated gene comprises melastatin-1 (TRPM1). It is determined that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of TRPM1 in the test sample is higher than the level of TRPM1 in the reference sample.
In one aspect, the test sample is obtained from the melanoma and the melanoma-associated gene comprises miR-211, cluster of differentiation 5 molecule like (CD5L), interleukin 12 receptor subunit beta 2 (IL12RB2), fas apoptotic inhibitory molecule 3 (FAIM3), and/or pre T-Cell antigen receptor alpha (PTCRA). It is determined that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of miR-211, CD5L, IL12RB2, FAIM3, and PTCRA in the test sample is higher than the level of the corresponding gene in the reference sample.
In another aspect, the test sample is obtained from the melanoma, and the melanoma-associated gene comprises miR-211, MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, CSAG3, or CSAG4. It is determined that inhibition of CTLA4 in a subject with melanoma will not result in clinical benefit in the subject if the expression level of miR-211 in the test sample is lower than the level of miR-211 in the reference sample and if the expression level of MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, CSAG3, and CSAG4 in the test sample is higher than the level of the corresponding gene in the reference sample.
Alternatively, the test sample is obtained from a melanoma or the infiltrating immune cells, wherein the melanoma-associated gene comprises a T cell infiltration-associated gene, a receptor signaling gene, an activation gene, a cytotoxicity gene, a humoral immunity gene, and/or an immune inhibitory receptor gene. It is determined whether inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of the T cell infiltration-associated gene, receptor signaling gene, activation gene, or cytotoxicity gene in the test sample is higher than the level of the corresponding gene in the reference sample.
Suitable T cell infiltration-associated genes include cluster of differentiation 2 (CD2), CD6, and C-X-C motif chemokine ligand 13 (CXCL13). Exemplary receptor signaling genes include CD3D, CD3E, CD3G, lymphocyte-specific protein tyrosine kinase (LCK), T cell receptor alpha gene, T cell receptor beta gene, and PTCRA. Suitable activation genes include CD28, inducible t-cell co-stimulator (ICOS), eomesodermin (EOMES), interleukin-2 receptor subunit beta (IL2RB), Fas ligand (FASLG), and signaling lymphocytic activation molecule family member 6 (SLAMF6). In one aspect, cytotoxicity genes include granulysin (GNLY), granzyme A (GZMA), GZMB, GZMH, GZMK, and perforin 1 (PRF1). Suitable humoral immunity genes include CD19, CD72, Fc receptor-like protein 1/3 (FCRL1/3), and membrane spanning 4-domains A1 (MS4A1).
In some cases, immune inhibitory receptors include a receptor specific to or preferentially expressed by T cells such as CTLA4 and lymphocyte-activation gene-3 (LAG3). Alternatively, the immune inhibitory receptor comprises a receptor specific to or preferentially expressed by B cells such as CTLA4, FCRL1, and FCRL3. In other cases, the immune inhibitory receptor comprises a receptor specific to or preferentially expressed by macrophages such as CD5L. In other aspects, the immune inhibitory receptor comprises a receptor specific to or preferentially expressed by eosinophils/mast cells such as sialic acid-binding Ig-like lectin 8 (SIGLEC8). Alternatively, the immune inhibitory receptor comprises fas apoptotic inhibitory molecule 3 (FAIM3/TOSO).
In one aspect, the test sample is obtained from the melanoma and the melanoma-associated gene comprises CD2, CD6, CXCL13, CD3D, CD3E, CD3G, LCK, T cell receptor alpha gene, T cell receptor beta gene, CD28, ICOS, EOMES, IL2RB, FASLG, SLAMF6, GNLY, GZMA, GZMB, GZMH, GZMK, PRF1, PTCRA, CD19, CD72, FCRL1/3, MS4A1, CTLA4, LAG3, FCRL1, FCRL3, CD5L, SIGLEC8, and/or FAIM3/TOSO (or any combination thereof). It is determined that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of CD2, CD6, CXCL13, CD3D, CD3E, CD3G, LCK, T cell receptor alpha gene, T cell receptor beta gene, CD28, ICOS, EOMES, IL2RB, FASLG, SLAMF6, GNLY, GZMA, GZMB, GZMH, GZMK, PRF1, PTCRA, CD19, CD72, FCRL1/3, MS4A1, CTLA4, LAG3, FCRL1, FCRL3, CD5L, SIGLEC8, and/or FAIM3/TOSO (or any combination thereof) in the test sample is higher than the level of the corresponding gene in the reference sample.
Alternatively, the test sample is obtained from the melanoma and the melanoma-associated gene comprises miR-211, along with one or more of CD2, CD6, CXCL13, CD3D, CD3E, CD3G, LCK, T cell receptor alpha gene, T cell receptor beta gene, CD28, ICOS, EOMES, IL2RB, FASLG, SLAMF6, GNLY, GZMA, GZMB, GZMH, GZMK, PRF1, PTCRA, CD19, CD72, FCRL1/3, MS4A1, CTLA4, LAG3, FCRL1, FCRL3, CD5L, SIGLEC8, and/or FAIM3/TOSO (or any combination thereof). It is determined that inhibition of CTLA4 in a subject with melanoma will result in clinical benefit in the subject if the expression level of miR-211, along with one or more of CD2, CD6, CXCL13, CD3D, CD3E, CD3G, LCK, T cell receptor alpha gene, T cell receptor beta gene, CD28, ICOS, EOMES, IL2RB, FASLG, SLAMF6, GNLY, GZMA, GZMB, GZMH, GZMK, PRF1, PTCRA, CD19, CD72, FCRL1/3, MS4A1, CTLA4, LAG3, FCRL1, FCRL3, CD5L, SIGLEC8, and/or FAIM3/TOSO (or any combination thereof) in the test sample is higher than the level of the corresponding gene in the reference sample.
Suitable samples include those with deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) therein. For example, the sample is a tumor sample. In anther aspect, the sample is a tumor microenvironment sample. Optionally, the sample is a plasma sample or a blood sample. In some cases, the sample comprises one or more circulating tumor cells.
In some cases, the reference sample is obtained from healthy normal tissue, melanoma that received a clinical benefit from CTLA4 inhibition, or melanoma that did not receive a clinical benefit from CTLA4 inhibition.
Optionally, the expression level of the melanoma-associated gene is detected via an Affymetrix Gene Array hybridization, next-generation sequencing, ribonucleic acid sequencing (RNA-seq), a real time reverse transcriptase polymerase chain reaction (real time RT-PCR) assay, immunohistochemistry (IHC), immunofluorescence, or methylation-specific PCR.
In one aspect, the expression level of the melanoma-associated gene is detected via RNA-seq and the reference sample is obtained from healthy normal tissue from the same individual as the test sample or one or more healthy normal tissues from different individuals.
In other cases, the expression level of the melanoma-associated gene is detected via RT-PCR and the reference sample is obtained from the same tissue as the test sample. In this case, levels of a housekeeping gene are determined in the reference sample. Suitable housekeeping genes include glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase 1 (HPRT1), and serine/threonine protein kinase (PSK1). The method involves determining whether CTLA4 blockade will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the expression level of the housekeeping gene.
The methods described herein optionally further comprise treating the subject with a chemotherapeutic agent, radiation therapy, cryotherapy, or hormone therapy. Exemplary chemotherapeutic agents include dacarbazine, temozolomide, nab-paclitaxel, paclitaxel, cisplatin, or carboplatin.
In some cases, the methods described herein further comprise administering an inhibitor of the melanoma-associated gene with a higher level of expression compared to the level of the melanoma-associated gene in the reference sample, thereby treating the melanoma. Suitable inhibitors include a small molecule inhibitor, RNA interference (RNAi), an antibody, an antibody fragment, an antibody drug conjugate, an aptamer, a chimeric antigen receptor (CAR), a T cell receptor, or any combination thereof.
In some cases, the antibody or antibody fragment is partially humanized, fully humanized, or chimeric. For example, the antibody fragment is a nanobody, an Fab, an Fab′, an (Fab′)2, an Fv, a single-chain variable fragment (ScFv), a diabody, a triabody, a tetrabody, a Bis-scFv, a minibody, an Fab2, an Fab3 fragment, or any combination thereof.
Alternatively, the methods described herein further comprise administering an agonist of the melanoma-associated gene with a higher level of expression compared to the level of the melanoma-associated gene in the reference sample, thereby treating the melanoma.
Optionally, the methods include administering to the subject a CTLA4 inhibitor, thereby treating the melanoma. For example, the CTLA4 inhibitor is an anti-CTLA4 antibody, e.g., ipilimumab or tremelimumab.
Also provided are compositions for predicting no clinical benefit in response to CTLA4 therapy comprising a melanoma-associated gene. For example, the melanoma-associated gene comprises MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, CSAG3, or CSAG4 synthesized complementary deoxyribonucleic acid (cDNA).
In some cases, the composition further comprises PSG1, PSG2, PSG4, PSG5, PSG6, GABRA3, GABRB1, GABRB2, GABRG2, GABRQ, GABRR1, CLDN1, CLDN2, EYA1, SNAI1, TGFB2, WNT3, HOXD13, HOXD11, HOXA2, HOXA5, HOXD10, ANGPT1, ANG2, PDGFA, PCDHB2, PCDHB3, PCDHB6, PCDHB10, PCDHGA3, PCDHGB1, PCDHGB2, EMILIN1, and/or TNN synthesized cDNA.
Also provided are compositions for predicting clinical benefit in response to CTLA4 therapy comprising miR-211 and a melanoma-associated gene selected from the group consisting of CD5L, IL12RB2, FAIM3, PTCRA, CD2, CD6, CXCL13, CD3D, CD3E, CD3G, LCK, T cell receptor alpha gene, T cell receptor beta gene, GNLY, GZMA, GZMB, GZMH, GZMK, PRF1, CD19, CD72, FCRL1/3, MS4A1, CTLA4, LAG3, FCRL1, FCRL3, SIGLEC8, and FAIM3/TOSO synthesized cDNA.
In one aspect, the melanoma-associated gene is immobilized on a solid support. Optionally, the melanoma-associated gene is linked to a detectable label. Exemplary detectable labels include a fluorescent label, a luminescent label, a chemiluminescent label, a radiolabel, a SYBR Green label, and a Cy3-label.
Preferably, the compositions comprising melanoma-associated genes include synthetic or non-naturally occurring melanoma-associated genes.
Provided is a method of treating cancer in a subject in need thereof, comprising: administering a therapeutically effective amount of one or more CTLA4 inhibitor agents to the subject, wherein the subject is identified as (a) not having aberrant expression of at least one resistant cancer-associated gene or miRNA, or (b) having aberrant expression of at least one beneficial cancer-associated gene or miRNA.
Also provided is a method of treating cancer in a subject in need thereof, comprising: (a) analyzing a biological sample from the subject for: (i) aberrant expression of at least one resistant cancer-associated gene or miRNA, wherein the aberrant expression of the at least one resistant cancer-associated gene or miRNA is not present in the biological sample, or (ii) aberrant expression of at least one beneficial cancer-associated gene or miRNA, wherein the aberrant expression of the at least one beneficial cancer-associated gene or miRNA is present in the biological sample; (b) identifying the subject as a candidate for receiving one or more CTLA4 inhibitor agents; and (c) administering a therapeutically effective amount of the one or more CTLA4 inhibitor agents to the subject.
The invention provides a method of identifying a subject with cancer as a candidate for receiving one or more CTLA4 inhibitor agents, comprising: (a) analyzing a biological sample from the subject for: (i) aberrant expression of at least one resistant cancer-associated gene or miRNA, wherein the aberrant expression of the at least one resistant cancer-associated gene or miRNA is not present in the biological sample, or (ii) aberrant expression of at least one beneficial cancer-associated gene or miRNA, wherein the aberrant expression of the at least one beneficial cancer-associated gene or miRNA is present in the biological sample; and (b) identifying the subject as a candidate for receiving one or more ctla4 inhibitor agents.
Also provided is a method to predict a response of a subject with cancer to a CTLA4 therapy, the method comprising: (a) assaying for (i) aberrant expression of at least one resistant cancer-associated gene or miRNA in a biological sample from the subject, wherein the aberrant expression of the at least one resistant cancer-associated gene or miRNA is not present in the biological sample, or (ii) aberrant expression of at least one beneficial cancer-associated gene or miRNA in a biological sample from the subject, wherein the aberrant expression of the at least one beneficial cancer-associated gene or miRNA is present in the biological sample; and (b) predicting a response of the subject with cancer to a CTLA4 therapy to be positive based on the assaying.
Described herein is a method of treating cancer comprising administering an effective amount of a CTLA4 inhibitor and an effective amount of an agonist (or inducer) of autophagy. For example, the CTLA4 inhibitor comprises ipilimumab or tremelimumab. In some cases, the autophagy agonist comprises metformin, temozolomide, trifluoperazine, divalproex sodium, vorinostat, rapamycin, everolimus, MG-132, doxorubicin, ABT-737, BCL2 inhibitors/antagonists, gemcitabine, torin 1, or resveratrol, etc.
Also provided herein are methods of determining whether administration of a CTLA4 inhibitor and an autophagy agonist to a subject with melanoma will result in clinical benefit in the subject comprising obtaining a test sample from a subject having or at risk of developing melanoma; determining the expression level of at least one melanoma-associated gene in the test sample; comparing the expression level of the melanoma-associated gene in the test sample with the expression level of the melanoma-associated gene in a reference sample; and determining whether administration of a CTLA4 inhibitor and an autophagy agonist will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the level of the melanoma-associated gene in the reference sample. For example, the autophagy agonist comprises metformin, temozolomide, trifluoperazine, divalproex sodium, vorinostat, rapamycin, everolimus, MG-132, doxorubicin, ABT-737, BCL2 inhibitors/antagonists, gemcitabine, torin 1, or resveratrol, etc.
In some cases, the test sample is obtained from the melanoma, wherein the melanoma-associated gene comprises a cancer germline antigen (CGA) gene; and the method comprises determining that administration of the CTLA4 inhibitor and the autophagy agonist in a subject with melanoma will result in clinical benefit in the subject if the expression level of the CGA gene in the test sample is higher than the level of the CGA gene in the reference sample. For example, the CGA gene comprises MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, or CSAG3.
Also provided are methods of treating cancer comprising administering an effective amount of a CTLA4 inhibitor and an effective amount of a agonist (or inducer) of miR-211, miR-185 and/or miR-513A2. For example, the CTLA4 inhibitor comprises ipilimumab or tremelimumab. In some cases, the agonist of miR-211, miR-185 and/or miR-513A2 comprises a miR mimetic (natural or synthetic) or aptamer.
Also provided are methods of determining whether administration of a CTLA4 inhibitor and a miR-211, miR-185, or miR-513A2) agonist to a subject with melanoma will result in clinical benefit in the subject comprising: obtaining a test sample from a subject having or at risk of developing melanoma; determining the expression level of at least one melanoma-associated gene in the test sample; comparing the expression level of the melanoma-associated gene in the test sample with the expression level of the melanoma-associated gene in a reference sample; and determining whether administration of a CTLA4 inhibitor and an miR-211, miR-185 and/or miR-513A2 agonist will inhibit melanoma in the subject if the expression level of the melanoma-associated gene in the test sample is differentially expressed as compared to the level of the melanoma-associated gene in the reference sample. For example, the miR-211, miR-185 and/or miR-513A2 agonist comprises a miR mimetic (natural or synthetic) or aptamer.
In some cases, the test sample is obtained from the melanoma, wherein the melanoma-associated gene comprises a micro RNA gene; and determining that administration of the CTLA4 inhibitor and the miR-211, miR-185, and/or miR-513A2 agonist in a subject with melanoma will result in clinical benefit in the subject if the expression level of the miR-211, miR-513A2, or miR-185 in the test sample is higher than the level of the miR-211, miR-185 and/or miR-513A2 in the reference sample.
In other cases, the test sample is obtained from the melanoma, wherein the melanoma-associated gene comprises a melastatin-1 (TRPM1) gene; and determining that administration of the CTLA4 inhibitor and the miR-211, miR-185, and/or miR-513A2 agonist in a subject with melanoma will result in clinical benefit in the subject if the expression level of the TRPM1 gene in the test sample is higher than the level of the TRPM1 gene in the reference sample.
Provided herein are kits comprising reagents for assaying a biological sample from a subject with cancer for: (a) aberrant expression of at least one resistant cancer-associated gene or miRNA, or (b) aberrant expression of at least one beneficial cancer-associated gene or miRNA.
In one aspect, the aberrant expression of the at least one resistant cancer-associated gene or miRNA comprises overexpression of the at least one resistant cancer-associated gene or miRNA.
In another aspect, the aberrant expression of the at least one resistant cancer-associated gene is characterized by expression from a hypomethylated form of the at least one resistant cancer-associated gene.
In some cases, the aberrant expression of at least one beneficial cancer-associated gene or miRNA comprises overexpression of the at least one beneficial cancer-associated gene or miRNA.
Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term “about.”
The phrase “aberrant expression” is used to refer to an expression level that deviates from (i.e., an increased or decreased expression level) the normal reference expression level of the gene.
The term “antineoplastic agent” is used herein to refer to agents that have the functional property of inhibiting a development or progression of a neoplasm in a human, e.g., a melanoma. Inhibition of metastasis is frequently a property of antineoplastic agents.
By “agent” is meant any small compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
By “alteration” is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art-known methods such as those described herein. As used herein, an alteration includes at least a 1% change in expression levels, e.g., at least a 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% change in expression levels. For example, an alteration includes at least a 5%-10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.
By “ameliorate” is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
The term “antibody” (Ab) as used herein includes monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity. The term “immunoglobulin” (Ig) is used interchangeably with “antibody” herein.
An “isolated antibody” is one that has been separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the antibody is purified: (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. An IgM antibody consists of 5 of the basic heterotetramer unit along with an additional polypeptide called J chain, and therefore contain 10 antigen binding sites, while secreted IgA antibodies can polymerize to form polyvalent assemblages comprising 2-5 of the basic 4-chain units along with J chain. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable domain (VH) followed by three constant domains (CH) for each of the α and γ chains and four CH domains for μ and ε isotypes. Each L chain has at the N-terminus, a variable domain (VL) followed by a constant domain (CL) at its other end. The VL is aligned with the VH and the CL is aligned with the first constant domain of the heavy chain (CH1). Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains. The pairing of a VH and VL together forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page 71, and Chapter 6.
The L chain from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (κ) and lambda (λ), based on the amino acid sequences of their constant domains (CL). Depending on the amino acid sequence of the constant domain of their heavy chains (CH), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, having heavy chains designated alpha (α), delta (δ), epsilon (ε), gamma (γ) and mu (μ), respectively. The γ and α classes are further divided into subclasses on the basis of relatively minor differences in CH sequence and function, e.g., humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The term “variable” refers to the fact that certain segments of the V domains differ extensively in sequence among antibodies. The V domain mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable domains. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called “hypervariable regions” that are each 9-12 amino acids long. The variable domains of native heavy and light chains each comprise four FRs, largely adopting a β-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the β-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC).
The term “hypervariable region” when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region generally comprises amino acid residues from a “complementarity determining region” or “CDR” (e.g., around about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the VL, and around about 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the VH when numbered in accordance with the Kabat numbering system; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)); and/or those residues from a “hypervariable loop” (e.g., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the VL, and 26-32 (H1), 52-56 (H2) and 95-101 (H3) in the VH when numbered in accordance with the Chothia numbering system; Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)); and/or those residues from a “hypervariable loop”/CDR (e.g., residues 27-38 (L1), 56-65 (L2) and 105-120 (L3) in the VL, and 27-38 (H1), 56-65 (H2) and 105-120 (H3) in the VH when numbered in accordance with the IMGT numbering system; Lefranc, M. P. et al. Nucl. Acids Res. 27:209-212 (1999), Ruiz, M. e al. Nucl. Acids Res. 28:219-221 (2000)). Optionally the antibody has symmetrical insertions at one or more of the following points 28, 36 (L1), 63, 74-75 (L2) and 123 (L3) in the VL, and 28, 36 (H1), 63, 74-75 (H2) and 123 (H3) in the VH when numbered in accordance with AHo; Honneger, A. and Plunkthun, A. J. Mol. Biol. 309:657-670 (2001)).
By “germline nucleic acid residue” is meant the nucleic acid residue that naturally occurs in a germline gene encoding a constant or variable region. “Germline gene” is the DNA found in a germ cell (i.e., a cell destined to become an egg or in the sperm). A “germline mutation” refers to a heritable change in a particular DNA that has occurred in a germ cell or the zygote at the single-cell stage, and when transmitted to offspring, such a mutation is incorporated in every cell of the body. A germline mutation is in contrast to a somatic mutation which is acquired in a single body cell. In some cases, nucleotides in a germline DNA sequence encoding for a variable region are mutated (i.e., a somatic mutation) and replaced with a different nucleotide.
The term “monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier “monoclonal” is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al., Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (see, e.g., U.S. Pat. No. 4,816,567). The “monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example.
Monoclonal antibodies include “chimeric” antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Also provided are variable domain antigen-binding sequences derived from human antibodies. Accordingly, chimeric antibodies of primary interest herein include antibodies having one or more human antigen binding sequences (e.g., CDRs) and containing one or more sequences derived from a non-human antibody, e.g., an FR or C region sequence. In addition, chimeric antibodies of primary interest herein include those comprising a human variable domain antigen binding sequence of one antibody class or subclass and another sequence, e.g., FR or C region sequence, derived from another antibody class or subclass. Chimeric antibodies of interest herein also include those containing variable domain antigen-binding sequences related to those described herein or derived from a different species, such as a non-human primate (e.g., Old World Monkey, Ape, etc). Chimeric antibodies also include primatized and humanized antibodies.
Furthermore, chimeric antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. For further details, see Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).
A “humanized antibody” is generally considered to be a human antibody that has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization is traditionally performed following the method of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting import hypervariable region sequences for the corresponding sequences of a human antibody. Accordingly, such “humanized” antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
A “human antibody” is an antibody containing only sequences present in an antibody naturally produced by a human. However, as used herein, human antibodies may comprise residues or modifications not found in a naturally occurring human antibody, including those modifications and variant sequences described herein. These are typically made to further refine or enhance antibody performance.
An “intact” antibody is one that comprises an antigen-binding site as well as a CL and at least heavy chain constant domains, CH 1, CH 2 and CH 3. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variant thereof. Preferably, the intact antibody has one or more effector functions. An “antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab′, F(ab′)2, and Fv fragments; diabodies; linear antibodies (see U.S. Pat. No. 5,641,870; Zapata et al., Protein Eng. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
The phrase “functional fragment or analog” of an antibody is a compound having qualitative biological activity in common with a full-length antibody. For example, a functional fragment or analog of an anti-IgE antibody is one that can bind to an IgE immunoglobulin in such a manner so as to prevent or substantially reduce the ability of such molecule from having the ability to bind to the high affinity receptor, FcεRI.
Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, and a residual “Fc” fragment, a designation reflecting the ability to crystallize readily. The Fab fragment consists of an entire L chain along with the variable region domain of the H chain (VH), and the first constant domain of one heavy chain (CH 1). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody yields a single large F(ab′)2 fragment that roughly corresponds to two disulfide linked Fab fragments having divalent antigen-binding activity and is still capable of cross-linking antigen. Fab′ fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the CH1 domain including one or more cysteines from the antibody hinge region. Fab′-SH is the designation herein for Fab′ in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab′)2 antibody fragments originally were produced as pairs of Fab′ fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
The “Fc” fragment comprises the carboxy-terminal portions of both H chains held together by disulfides. The effector functions of antibodies are determined by sequences in the Fc region, which region is also the part recognized by Fc receptors (FcR) found on certain types of cells.
“Fv” is the minimum antibody fragment that contains a complete antigen-recognition and -binding site. This fragment consists of a dimer of one heavy- and one light-chain variable region domain in tight, non-covalent association. From the folding of these two domains emanate six hypervariable loops (three loops each from the H and L chain) that contribute the amino acid residues for antigen binding and confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
“Single-chain Fv” also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the VH and VL antibody domains connected into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the sFv to form the desired structure for antigen binding. For a review of sFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994); Borrebaeck 1995, infra.
The term “diabodies” refers to small antibody fragments prepared by constructing sFv fragments (see preceding paragraph) with short linkers (about 5-10 residues) between the VH and VL domains such that inter-chain but not intra-chain pairing of the V domains is achieved, resulting in a bivalent fragment, i.e., fragment having two antigen-binding sites. Bispecific diabodies are heterodimers of two “crossover” sFv fragments in which the VH and VL domains of the two antibodies are present on different polypeptide chains. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
As used herein, an antibody that “internalizes” is one that is taken up by (i.e., enters) the cell upon binding to an antigen on a mammalian cell (e.g., a cell surface polypeptide or receptor). The internalizing antibody will of course include antibody fragments, human or chimeric antibody, and antibody conjugates. For certain therapeutic applications, internalization in vivo is contemplated. The number of antibody molecules internalized will be sufficient or adequate to kill a cell or inhibit its growth, especially an infected cell. Depending on the potency of the antibody or antibody conjugate, in some instances, the uptake of a single antibody molecule into the cell is sufficient to kill the target cell to which the antibody binds. For example, certain toxins are highly potent in killing such that internalization of one molecule of the toxin conjugated to the antibody is sufficient to kill the infected cell.
As used herein, an antibody is said to be “immunospecific,” “specific for” or to “specifically bind” an antigen if it reacts at a detectable level with the antigen, preferably with an affinity constant, Ka, of greater than or equal to about 104 M−1, or greater than or equal to about 105 M−1, greater than or equal to about 106 M−1, greater than or equal to about 107 M−1, or greater than or equal to 108 M−1. Affinity of an antibody for its cognate antigen is also commonly expressed as a dissociation constant KD, and in certain embodiments, HuM2e antibody specifically binds to M2e if it binds with a KD of less than or equal to 10−4 M, less than or equal to about 10−5 M, less than or equal to about 10−6 M, less than or equal to 10−7 M, or less than or equal to 10−8 M. Affinities of antibodies can be readily determined using conventional techniques, for example, those described by Scatchard et al. (Ann. N.Y. Acad. Sci. USA 51:660 (1949)).
Binding properties of an antibody to antigens, cells or tissues thereof may generally be determined and assessed using immunodetection methods including, for example, immunofluorescence-based assays, such as immuno-histochemistry (IHC) and/or fluorescence-activated cell sorting (FACS).
An antibody having a “biological characteristic” of a designated antibody is one that possesses one or more of the biological characteristics of that antibody which distinguish it from other antibodies. For example, in certain embodiments, an antibody with a biological characteristic of a designated antibody will bind the same epitope as that bound by the designated antibody and/or have a common effector function as the designated antibody. The term “antagonist” antibody is used in the broadest sense, and includes an antibody that partially or fully blocks, inhibits, or neutralizes a biological activity of an epitope, polypeptide, or cell that it specifically binds. Methods for identifying antagonist antibodies may comprise contacting a polypeptide or cell specifically bound by a candidate antagonist antibody with the candidate antagonist antibody and measuring a detectable change in one or more biological activities normally associated with the polypeptide or cell.
Antibody “effector functions” refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
By “binding to” a molecule is meant having a physicochemical affinity for that molecule.
By “control” or “reference” is meant a standard of comparison. In one aspect, as used herein, “changed as compared to a control” sample or subject is understood as having a level that is statistically different than a sample from a normal, untreated, or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. An analyte can be a naturally occurring substance that is characteristically expressed or produced by the cell or organism (e.g., an antibody, a protein) or a substance produced by a reporter construct (e.g, β-galactosidase or luciferase). Depending on the method used for detection, the amount and measurement of the change can vary. Determination of statistical significance is within the ability of those skilled in the art, e.g., the number of standard deviations from the mean that constitute a positive result.
“Detect” refers to identifying the presence, absence, or amount of the agent (e.g., a nucleic acid molecule, for example deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)) to be detected.
By “detectable label” is meant a composition that when linked (e.g., joined—directly or indirectly) to a molecule of interest renders the latter detectable, via, for example, spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Direct labeling can occur through bonds or interactions that link the label to the molecule, and indirect labeling can occur through the use of a linker or bridging moiety which is either directly or indirectly labeled. Bridging moieties may amplify a detectable signal. For example, useful labels may include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent labeling compounds, electron-dense reagents, enzymes (for example, as commonly used in an enzyme-linked immunosorbent assay (ELISA)), biotin, digoxigenin, or haptens. When the fluorescently labeled molecule is exposed to light of the proper wave length, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, p-phthaldehyde and fluorescamine. The molecule can also be detectably labeled using fluorescence emitting metals such as 152 Eu, or others of the lanthanide series. These metals can be attached to the molecule using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). The molecule also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged molecule is then determined by detecting the presence of luminescence that arises during the course of chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
A “detection step” may use any of a variety of known methods to detect the presence of nucleic acid (e.g., methylated DNA) or polypeptide. The types of detection methods in which probes can be used include Western blots, Southern blots, dot or slot blots, and Northern blots.
As used herein, the term “diagnosing” refers to classifying pathology or a symptom, determining a severity of the pathology (e.g., grade or stage), monitoring pathology progression, forecasting an outcome of pathology, and/or determining prospects of recovery.
By the terms “effective amount” and “therapeutically effective amount” of a formulation or formulation component is meant a sufficient amount of the formulation or component, alone or in a combination, to provide the desired effect. For example, by “an effective amount” is meant an amount of a compound, alone or in a combination, required to ameliorate the symptoms of a disease, e.g., melanoma, relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an “effective” amount.
The term “expression profile” is used broadly to include a genomic expression profile. Profiles may be generated by any convenient means for determining a level of a nucleic acid sequence, e.g., quantitative hybridization of microRNA, labeled microRNA, amplified microRNA, complementary/synthetic DNA (cDNA), etc., quantitative polymerase chain reaction (PCR), and ELISA for quantitation, and allow the analysis of differential gene expression between two samples. A subject or patient tumor sample is assayed. Samples are collected by any convenient method, as known in the art. According to some embodiments, the term “expression profile” means measuring the relative abundance of the nucleic acid sequences in the measured samples.
By “FDR” is meant False Discovery Rate. When performing multiple statistical tests, for example, in comparing the signal of two groups in multiple data features, there is an increasingly high probability of obtaining false positive results, by random differences between the groups that can reach levels that would otherwise be considered statistically significant. In some cases, in order to limit the proportion of such false discoveries, statistical significance is defined only for data features in which the differences reached a p-value (by two-sided t-test) below a threshold, which is dependent on the number of tests performed and the distribution of p-values obtained in these tests.
By “fragment” is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. For example, a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. However, the invention also comprises polypeptides and nucleic acid fragments, so long as they exhibit the desired biological activity of the full length polypeptides and nucleic acid, respectively. A nucleic acid fragment of almost any length is employed. For example, illustrative polynucleotide segments with total lengths of about 10,000, about 5000, about 3000, about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs in length (including all intermediate lengths) are included in many implementations of this invention. Similarly, a polypeptide fragment of almost any length is employed. For example, illustrative polypeptide segments with total lengths of about 10,000, about 5,000, about 3,000, about 2,000, about 1,000, about 5,000, about 1,000, about 500, about 200, about 100, or about 50 amino acids in length (including all intermediate lengths) are included in many implementations of this invention.
“Hybridization” means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
By “hybridize” is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
The terms “isolated,” “purified,” or “biologically pure” refer to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation.
A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
Similarly, by “substantially pure” is meant a nucleotide or polypeptide that has been separated from the components that naturally accompany it. Typically, the nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with they are naturally associated.
By “isolated nucleic acid” is meant a nucleic acid that is free of the genes which flank it in the naturally-occurring genome of the organism from which the nucleic acid is derived. The term covers, for example: (a) a DNA which is part of a naturally occurring genomic DNA molecule, but is not flanked by both of the nucleic acid sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner, such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a synthetic cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Isolated nucleic acid molecules according to the present invention further include molecules produced synthetically, as well as any nucleic acids that have been altered chemically and/or that have modified backbones. For example, the isolated nucleic acid is a purified cDNA or RNA polynucleotide. Isolated nucleic acid molecules also include messenger ribonucleic acid (mRNA) molecules.
By an “isolated polypeptide” is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
The term “immobilized” or “attached” refers to a probe (e.g., nucleic acid or protein) and a solid support in which the binding between the probe and the solid support is sufficient to be stable under conditions of binding, washing, analysis, and removal. The binding may be covalent or non-covalent. Covalent bonds may be formed directly between the probe and the solid support or may be formed by a cross linker or by inclusion of a specific reactive group on either the solid support or the probe or both molecules. Non-covalent binding may be one or more of electrostatic, hydrophilic, and hydrophobic interactions. Included in non-covalent binding is the covalent attachment of a molecule to the support and the non-covalent binding of a biotinylated probe to the molecule. Immobilization may also involve a combination of covalent and non-covalent interactions.
By “marker” is meant any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder, e.g., melanoma.
By “melanoma-associated gene” is meant a nucleic acid associated with the pathogenesis of melanoma.
By “modulate” is meant alter (increase or decrease). Such alterations are detected by standard art-known methods such as those described herein.
The term, “normal amount” refers to a normal amount of a complex in an individual known not to be diagnosed with melanoma. The amount of the molecule can be measured in a test sample and compared to the “normal control level,” utilizing techniques such as reference limits, discrimination limits, or risk defining thresholds to define cutoff points and abnormal values (e.g., for melanoma). The “normal control level” means the level of one or more proteins (or nucleic acids) or combined protein indices (or combined nucleic acid indices) typically found in a subject known not to be suffering from melanoma. Such normal control levels and cutoff points may vary based on whether a molecule is used alone or in a formula combining other proteins into an index. Alternatively, the normal control level can be a database of protein patterns from previously tested subjects who did not convert to melanoma over a clinically relevant time horizon. In another aspect, the normal control level can be a level relative to a housekeeping gene.
The level that is determined may be the same as a control level or a cut off level or a threshold level, or may be increased or decreased relative to a control level or a cut off level or a threshold level. In some aspects, the control subject is a matched control of the same species, gender, ethnicity, age group, smoking status, body mass index (BMI), current therapeutic regimen status, medical history, or a combination thereof, but differs from the subject being diagnosed in that the control does not suffer from the disease in question or is not at risk for the disease.
Relative to a control level, the level that is determined may be an increased level. As used herein, the term “increased” with respect to level (e.g., expression level, biological activity level, etc.) refers to any % increase above a control level. The increased level may be at least or about a 1% increase, at least or about a 5% increase, at least or about a 10% increase, at least or about a 15% increase, at least or about a 20% increase, at least or about a 25% increase, at least or about a 30% increase, at least or about a 35% increase, at least or about a 40% increase, at least or about a 45% increase, at least or about a 50% increase, at least or about a 55% increase, at least or about a 60% increase, at least or about a 65% increase, at least or about a 70% increase, at least or about a 75% increase, at least or about a 80% increase, at least or about a 85% increase, at least or about a 90% increase, or at least or about a 95% increase, relative to a control level.
Relative to a control level, the level that is determined may be a decreased level. As used herein, the term “decreased” with respect to level (e.g., expression level, biological activity level, etc.) refers to any % decrease below a control level. The decreased level may be at least or about a 1% decrease, at least or about a 5% decrease, at least or about a 10% decrease, at least or about a 15% decrease, at least or about a 20% decrease, at least or about a 25% decrease, at least or about a 30% decrease, at least or about a 35% decrease, at least or about a 40% decrease, at least or about a 45% decrease, at least or about a 50% decrease, at least or about a 55% decrease, at least or about a 60% decrease, at least or about a 65% decrease, at least or about a 70% decrease, at least or about a 75% decrease, at least or about a 80% decrease, at least or about a 85% decrease, at least or about a 90% decrease, or at least or about a 95% decrease, relative to a control level.
Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity, e.g., at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule.
For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., more preferably of at least about 37° C., and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C., more preferably of at least about 42° C., and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
By “neoplasia” is meant a disease or disorder characterized by excess proliferation or reduced apoptosis. Illustrative neoplasms for which the invention can be used include, but are not limited to pancreatic cancer, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (Hodgkin's disease, non-Hodgkin's disease), Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, glioblastoma multiforme, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodenroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma).
As used herein, in one aspect, “next-generation sequencing” (NGS), also known as high-throughput sequencing, is the catch-all term used to describe a number of different sequencing methodologies including, but not limited to, Illumina® sequencing, Roche 454 Sequencing™, Ion Torrent™: Proton/personal genome machine (PGM) sequencing, and SOLiD sequencing. These recent technologies allow for sequencing DNA and RNA much more quickly and cheaply than the previously used Sanger sequencing. See, LeBlanc et al., 2015 Cancers, 7: 1925-1958, incorporated herein by reference; and Goodwin et al., 2016 Nature Reviews Genetics, 17: 333-351, incorporated herein by reference.
As used herein, “obtaining” as in “obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural.
The phrase “pharmaceutically acceptable carrier” is art recognized and includes a pharmaceutically acceptable material, composition or vehicle, suitable for administering compounds of the present invention to mammals. The carriers include liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agent from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations.
By “protein” or “polypeptide” or “peptide” is meant any chain of more than two natural or unnatural amino acids, regardless of post-translational modification (e.g., glycosylation or phosphorylation), constituting all or part of a naturally-occurring or non-naturally occurring polypeptide or peptide, as is described herein.
“Primer set” means a set of oligonucleotides that may be used, for example, for PCR. A primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80, 100, 200, 250, 300, 400, 500, 600, or more primers.
The terms “preventing” and “prevention” refer to the administration of an agent or composition to a clinically asymptomatic individual who is at risk of developing, susceptible, or predisposed to a particular adverse condition, disorder, or disease, and thus relates to the prevention of the occurrence of symptoms and/or their underlying cause.
The term “prognosis,” “staging,” and “determination of aggressiveness” are defined herein as the prediction of the degree of severity of the neoplasia, e.g., melanoma, and of its evolution as well as the prospect of recovery as anticipated from usual course of the disease. Once the aggressiveness (e.g. the Gleason score) has been determined, appropriate methods of treatments are chosen.
Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it is understood that the particular value forms another aspect. It is further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. It is also understood that throughout the application, data are provided in a number of different formats and that this data represent endpoints and starting points and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point “15” are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 as well as all intervening decimal values between the aforementioned integers such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to sub-ranges, “nested sub-ranges” that extend from either end point of the range are specifically contemplated. For example, a nested sub-range of an exemplary range of 1 to 50 may comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.
By “reduces” is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.
A “reference sequence” is a defined sequence used as a basis for sequence comparison or a gene expression comparison. A reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 40 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 or about 500 nucleotides or any integer thereabout or there between.
The term “sample” as used herein refers to a biological sample obtained for the purpose of evaluation in vitro. Exemplary tissue samples for the methods described herein include tissue samples from melanoma tumors or the surrounding microenvironment (i.e., the stroma). With regard to the methods disclosed herein, the sample or patient sample preferably may comprise any body fluid or tissue. In some embodiments, the bodily fluid includes, but is not limited to, blood, plasma, serum, lymph, breast milk, saliva, mucous, semen, vaginal secretions, cellular extracts, inflammatory fluids, cerebrospinal fluid, feces, vitreous humor, or urine obtained from the subject. In some aspects, the sample is a composite panel of at least two of a blood sample, a plasma sample, a serum sample, and a urine sample. In exemplary aspects, the sample comprises blood or a fraction thereof (e.g., plasma, serum, fraction obtained via leukopheresis). Preferred samples are whole blood, serum, plasma, or urine. A sample can also be a partially purified fraction of a tissue or bodily fluid.
A reference sample can be a “normal” sample, from a donor not having the disease or condition fluid, or from a normal tissue in a subject having the disease or condition. A reference sample can also be from an untreated donor or cell culture not treated with an active agent (e.g., no treatment or administration of vehicle only). A reference sample can also be taken at a “zero time point” prior to contacting the cell or subject with the agent or therapeutic intervention to be tested or at the start of a prospective study.
A “solid support” describes a strip, a polymer, a bead, or a nanoparticle. The strip may be a nucleic acid-probe (or protein) coated porous or non-porous solid support strip comprising linking a nucleic acid probe to a carrier to prepare a conjugate and immobilizing the conjugate on a porous solid support. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to a binding agent (e.g., an antibody or nucleic acid molecule). Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, or test strip, etc. For example, the supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation. In other aspects, the solid support comprises a polymer, to which an agent is chemically bound, immobilized, dispersed, or associated. A polymer support may be a network of polymers, and may be prepared in bead form (e.g., by suspension polymerization). The location of active sites introduced into a polymer support depends on the type of polymer support. For example, in a swollen-gel-bead polymer support the active sites are distributed uniformly throughout the beads, whereas in a macroporous-bead polymer support they are predominantly on the internal surfaces of the macropores. The solid support, e.g., a device contains a binding agent alone or together with a binding agent for at least one, two, three or more other molecules.
By “specifically binds” is meant a compound or antibody that recognizes and binds a polypeptide of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample, which naturally includes a polypeptide of the invention.
A “specific binding agent” describes agents having greater than 10-fold, preferably greater than 100-fold, and most preferably, greater than 1000-fold affinity for the target molecule as compared to another molecule. As the skilled artisan will appreciate the term specific is used to indicate that other biomolecules present in the sample do not significantly bind to the binding agent specific for the target molecule. Preferably, the level of binding to a biomolecule other than the target molecule results in a binding affinity which is at most only 10% or less, only 5% or less only 2% or less or only 1% or less of the affinity to the target molecule, respectively. A preferred specific binding agent will fulfill both the above minimum criteria for affinity as well as for specificity. For example, an antibody has a binding affinity in the low micromolar (10−6), nanomolar (10−7-10−9), with high affinity antibodies in the low nanomolar (10−9) or pico molar (10−12) range for its specific target molecule.
By “substantially identical” is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
The term “subject” as used herein includes all members of the animal kingdom prone to suffering from the indicated disorder. In some aspects, the subject is a mammal, and in some aspects, the subject is a human. The methods are also applicable to companion animals such as dogs and cats as well as livestock such as cows, horses, sheep, goats, pigs, and other domesticated and wild animals.
A subject “suffering from or suspected of suffering from” a specific disease, condition, or syndrome has a sufficient number of risk factors or presents with a sufficient number or combination of signs or symptoms of the disease, condition, or syndrome such that a competent individual would diagnose or suspect that the subject was suffering from the disease, condition, or syndrome. Methods for identification of subjects suffering from or suspected of suffering from conditions associated with cancer (e.g., melanoma) is within the ability of those in the art. Subjects suffering from, and suspected of suffering from, a specific disease, condition, or syndrome are not necessarily two distinct groups.
As used herein, “susceptible to” or “prone to” or “predisposed to” or “at risk of developing” a specific disease or condition refers to an individual who based on genetic, environmental, health, and/or other risk factors is more likely to develop a disease or condition than the general population. An increase in likelihood of developing a disease may be an increase of about 10%, 20%, 50%, 100%, 150%, 200%, or more.
The terms “treating” and “treatment” as used herein refer to the administration of an agent or formulation to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease, so as to effect a reduction in severity and/or frequency of symptoms, eliminate the symptoms and/or their underlying cause, and/or facilitate improvement or remediation of damage. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
As used herein, in one aspect, the “tumor microenvironment” (TME) is the cellular environment in which a tumor exists, including surrounding blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells, lymphocytes, signaling molecules and the extracellular matrix (ECM). The tumor and the surrounding microenvironment are closely related and interact constantly. Tumors can influence the microenvironment by releasing extracellular signals, promoting tumor angiogenesis and inducing peripheral immune tolerance, while the immune cells in the microenvironment can affect the growth and evolution of cancerous cells, such as in immuno-editing.
In some cases, a composition of the invention is administered orally or systemically. Other modes of administration include rectal, topical, intraocular, buccal, intravaginal, intracisternal, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, or parenteral routes. The term “parenteral” includes subcutaneous, intrathecal, intravenous, intramuscular, intraperitoneal, or infusion. Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis. They could, however, be preferred in emergency situations. Compositions comprising a composition of the invention can be added to a physiological fluid, such as blood. Oral administration can be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule. Parenteral modalities (subcutaneous or intravenous) may be preferable for more acute illness, or for therapy in patients that are unable to tolerate enteral administration due to gastrointestinal intolerance, ileus, or other concomitants of critical illness. Inhaled therapy may be most appropriate for pulmonary vascular diseases (e.g., pulmonary hypertension).
Pharmaceutical compositions may be assembled into kits or pharmaceutical systems for use in arresting cell cycle in rapidly dividing cells, e.g., cancer cells. Kits or pharmaceutical systems according to this aspect of the invention comprise a carrier means, such as a box, carton, tube, having in close confinement therein one or more container means, such as vials, tubes, ampoules, bottles, syringes, or bags. The kits or pharmaceutical systems of the invention may also comprise associated instructions for using the kit.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
The transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All published foreign patents and patent applications cited herein are incorporated herein by reference. Genbank and NCBI submissions indicated by accession number cited herein are incorporated herein by reference. All other published references, documents, manuscripts and scientific literature cited herein are incorporated herein by reference. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The invention is based, at least in part, upon the identification of a gene expression signature that discriminates clinical outcomes of CTLA4 blockade. CTLA4 blockade can induce durable clinical remissions in a minority of patients with metastatic melanoma. However, prior to the invention described herein, molecular signatures precisely predicting response and resistance were unknown. While increased neoantigen burden and clonality as well as increased expression of immune-related genes correlate with response, prior to the invention described herein, these molecular signatures were not clinically robust. Moreover, mechanistic insight into clinical resistance was lacking, and prior to the invention described herein, the contribution of epigenetic mechanisms was poorly understood.
Ipilimumab is an FDA-approved antibody targeting the CTLA4 pathway. Ipilimumab was the first agent to show an overall survival benefit in metastatic melanoma. However, only 15-20% of patients benefit from ipilimumab treatment. Prior to the invention described herein, there was no way to predict clinical outcome. Because ipilimumab carries significant autoimmune toxicity, predicting who will and will not benefit is of critical clinical importance. Ipilimumab is falling out of clinical use with the approval of newer, less toxic immunotherapies; however, long term survival data is only available for this agent. Thus, the results presented herein allow for precisely pairing CTLA4 blockade therapy with the appropriate patient.
Briefly, transcriptomic and clinical data from three independent melanoma cohorts were analyzed to identify correlates of outcome to CTLA4 blockade: (i) Cohort 1 comprised 40 pre-ipilimumab tumor samples (discovery set); (ii) Cohort 2 comprised 6 pre-treatment (ipilimumab or tremelimumab) samples (validation set 1); and (iii) Cohort 3 comprised 473 melanoma samples from The Cancer Genome Atlas (validation set 2). As described herein, genes that were differentially expressed between the clinical benefit (CB) and no clinical benefit (NB) groups were identified using unadjusted Wilcoxon tests (p<0.05), and a two-fold over-expression threshold in either group. The hypergeometric test was used to evaluate overlap of differentially expressed genes between cohorts, and the single-sample gene set enrichment (ssGSEA) method to identify pathway-level differences. Moreover, TCGA melanoma samples with high expression of the Xq28 CGA locus exhibited profound global hypomethylation, implicating epigenomic dysregulation and overexpression of Xq28 CGAs in primary resistance to CTLA4 blockade. Methylation-specific PCR of specific methylation sites of MAGE-A2, MAGE-A3, and MAGE-A12 revealed decreased methylation at these sites in nonresponding (vs. responding) tumors.
As described in detail below, 7 of the top 10 genes overexpressed in primary resistant tumors were cancer-germline antigens (CGA's), ranging from 60-180 fold enrichment. All 7 CGA's clustered tightly together within a narrow 75 kb region of chromosome Xq28. This pattern was clinically validated in Cohort 2 where this specific CGA cluster was similarly enriched in primary resistant tumors. Importantly, this pattern was biologically validated by finding that genes associated with clinical resistance from Cohort 1 significantly overlapped with genes associated with Xq28-CGA cluster expression in The Cancer Genome Atlas (TCGA) melanoma samples, further supporting the association of Xq28 expression with clinical resistance. As described in detail below, TCGA melanoma samples with high expression of the Xq28 CGA locus exhibited profound global hypomethylation, implicating epigenomic dysregulation and overexpression of Xq28 cancer testis antigen (CTA) in primary resistance to CTLA4 blockade.
Moreover, as described in detail below, in patients with clinical benefit, microRNA-211 was enriched over 700-fold, with statistically significant overlap observed between genes associated with clinical response and those associated with miR-211 in TCGA. The Xq28 associated CGA and miR-211 expression signatures were unique to CTLA4 blockade and did not predict outcome to anti-PD1 therapy. Expression levels of Xq28 associated CGAs and miR-211 predicted clinical outcome with 100% sensitivity and 40% specificity, outperforming previously identified correlates of benefit (ROC curve AUC=0.85). Expression of a coordinately transcribed cluster of 7 cancer germline antigens on chromosome Xq28 and miR-211 was strongly associated with resistance and response to anti-CTLA4 therapy respectively in metastatic melanoma. Thus, evaluation of transcriptional activity of these genes informs therapeutic preference in this disease.
Antibodies targeting the CTLA4 pathway in advanced melanoma have yielded durable clinical benefit in a minority of patients. Moreover, the combination of CTLA4 blockade with antagonists to another “immune checkpoint,” the programmed death (PD-1) pathway, increases response rates in metastatic melanoma compared with either agent alone, suggesting the potential for combining CTLA4 blockade with other immunotherapeutics. However, prior to the invention described herein, robust determinants of response and resistance to CTLA4 blockade were elusive, hindering efforts to rationally combine it with other therapies and precisely pair it with patients likely to respond.
Several investigators have identified genomic and transcriptional markers, such as the overall number of somatic mutations, number and clonality of tumor-specific “neoantigens,” and expression of immune genes, to correspond with response. However, the extensive overlap of these molecular signatures between responding and nonresponding tumors precludes their use in predicting clinical outcome. In preclinical studies, epigenetic programs have modulated response to anti-CTLA4 therapy, but prior to the invention described herein, they have not been investigated in large clinical cohorts. To date, discovery of robust predictive molecular signatures have been limited by sample size and lack of validation cohorts. As described in detail below, to interrogate and identify non-genomic determinants of clinical outcome to CTLA4 blockade in advanced melanoma, transcriptomic data from two previously reported clinical treatment cohorts as well as transcriptomic and DNA methylation data from The Cancer Genome Atlas (TCGA) was aggregated and analyzed.
Both as monotherapy and in combination with PD-1 blockade, anti-CTLA4 antibodies have induced substantial clinical benefit in melanoma; yet, prior to the invention described herein, robust molecular signatures of clinical outcome were elusive. Moreover, insight into mechanisms of primary clinical resistance was lacking. Knowledge of both is critical given the increasing evaluation of CTLA4 blockade in hematologic malignancies and the need to both rationally design combinatorial strategies as well as identify new immunotherapeutic targets. Here, the importance of in situ transcriptomic analyses to uncover immunotherapeutically relevant biology was revealed.
In particular, as described in detail below, a critical genomic locus on Xq28 that harbors a coordinately regulated cluster of CT antigens was identified. The striking enrichment of these genes with primary resistance affirms their status as a recent therapeutic target; the encoded proteins have been implicated in the ubiquitination of key tumor suppressors—notably TP53 and AMPK—that contributed to oncogenesis. In fact, these CT antigens specifically cluster in an inverted repeat DNA structure on Xq28, in which they are expressed coordinately and independently from CT antigens outside of this cluster. Thus, the finding that all of these genes appear as the most upregulated genes in resistant tumors reinforces their relevance as a genomic unit to clinical outcome to CTLA4 blockade.
As described in detail below, a co-enrichment of immunosuppressive pathways was identified along with these CT antigens, including the PSG genes as well as the GABA A receptor, which was recently implicated in attenuating T cell priming—a process also governed by the CTLA4 pathway. Associated immunosuppression may explain the long history of failed immunotherapeutic approaches targeting CT antigens such as MAGEA3 and MAGEA6 that lie within the Xq28 locus. The finding of multiple genes involved in epithelial-to-mesenchymal transition (EMT) is consistent with preclinical data suggesting EMT as an immunoevasive pathway employed by melanomas. Moreover, using TCGA data, global hypomethylation patterns were identified that strongly associated with high expression of CTA's from the Xq28 locus, implicating epigenomic mechanisms of resistance to CTLA4 blockade.
In responding tumors, the analysis revealed enrichment of the melanoma-suppressive miR-211 and a diversity of immune effectors, including T cells, B cells, macrophages, and eosinophils. miR-211 has been shown to inhibit TGF-beta signaling members (which were upregulated in resistant tumors), suppress the EMT phenotype, and mitigate the invasive phenotype. An increased number of genes mapping to both T cell and B cell receptors were identified, implicating an active adaptive immune response that appears to be diverse in its antigen recognition.
Although statistical stringency was relaxed because of the small cohort, the converging results from alternative cohorts bolster the results presented herein. Given that CTLA4 blockade may impact immune priming as opposed to the effector arm (influenced by the PD1 pathway), the results presented herein shed light into the mechanisms governing response/resistance to therapeutic manipulation of immune priming. The results presented herein indicate that response/resistance mechanisms to immune priming differ substantially from those relevant to clinical manipulation of effector immunity. As immunotherapeutic combinations are increasingly evaluated, understanding these mechanisms are important for precisely pairing patients with the appropriate combinations to avoid toxicity and ensure efficacy. The gene signatures described herein are potential therapeutic targets to sensitize to or combine with CTLA4 blockade.
Moreover, precisely pairing patients with cancer to the appropriate immunotherapy would reduce toxicity and costs as well as accelerate drug development. While ipilimumab as a single agent can induce durable tumor remissions in metastatic melanoma, only about 15-20% of patients with melanoma will benefit. Thus the majority of patients with melanoma are already resistant to ipilimumab. The results presented herein not only suggest a combination of immunotherapies that would raise this response rate, but they identify a signature to select those patients that would benefit from the combination (e.g. CTLA4 blockade+HMGB1 receptor agonist; or CTLA4 blockade+Xq28-CGA antagonist) over monotherapy. For example, a patient with high expression of the CGA gene would be assigned to the CTLA4 blockade+HMGB1 receptor agonist combination (or CTLA4 blockade+Xq28-CGA antagonist combination), whereas a patient with low expression of the CGA gene would be assigned to anti-CTLA4 monotherapy.
Cancer starts when cells in the body begin to grow out of control. Cells in nearly any part of the body can become cancer, and can then spread to other areas of the body. Melanoma is a cancer that usually starts in a certain type of skin cell, i.e., melanocytes. Melanocytes make a brown pigment called melanin, which gives the skin its tan or brown color. Melanin protects the deeper layers of the skin from some of the harmful effects of the sun. For most people, when skin is exposed to the sun, melanocytes make more melanin, causing the skin to tan or darken.
Other names for “melanoma” include malignant melanoma and cutaneous melanoma. Most melanoma cells still make melanin, so melanoma tumors are usually brown or black. However, some melanomas do not make melanin and can appear pink, tan, or even white. Melanomas can develop anywhere on the skin, but they are more likely to start on the trunk (chest and back) in men and on the legs in women. The neck and face are other common sites. Having darkly pigmented skin lowers the risk of melanoma at these more common sites, but anyone can get melanoma on the palms of the hands, soles of the feet, and under the nails. Melanomas can also form in other parts of the body such as the eyes, mouth, genitals, and anal area, but these are much less common than melanoma of the skin. Melanoma is much less common than basal cell and squamous cell skin cancers. However, melanoma is more dangerous because it is much more likely to spread to other parts of the body if not caught early.
The primary cause of melanoma is ultraviolet light (UV) exposure in those with low levels of skin pigment. The UV light may be from either the sun or from other sources, such as tanning devices. About 25% develop from moles. Those with many moles, a history of affected family members, and who have poor immune function are at greater risk. A number of rare genetic defects such as xeroderma pigmentosum also increase risk. Avoiding UV light and the use of sunscreen may prevent melanoma.
Melanoma may spread to other sites in the body by metastais. Metastatic melanoma may cause nonspecific paraneoplastic symptoms, including loss of appetite, nausea, vomiting and fatigue. Metastasis of early melanoma is possible, but relatively rare: less than a fifth of melanomas diagnosed early become metastatic. Brain metastases are particularly common in patients with metastatic melanoma. Melanoma may also spread to the liver, bones, abdomen or distant lymph nodes.
Visual inspection is the most common diagnostic technique. Moles that are irregular in color or shape are typically treated as candidates. To detect melanomas (and increase survival rates), it is recommended to regularly examine moles for changes (shape, size, color, itching or bleeding) and to consult a qualified physician when a candidate appears.
Early signs of melanoma are changes to the shape or color of existing moles or, in the case of nodular melanoma, the appearance of a new lump anywhere on the skin. At later stages, the mole may itch, ulcerate or bleed. Early signs of melanoma are summarized by the mnemonic “ABCDE”:
These classifications do not, however, apply to the most dangerous form of melanoma, nodular melanoma, which has its own classifications:
Following a visual examination and a dermatoscopic exam, or in vivo diagnostic tools such as a confocal microscope, the doctor may biopsy the suspicious mole. A skin biopsy performed under local anesthesia is often required to assist in making or confirming the diagnosis and in defining severity. Elliptical excisional biopsies may remove the tumor, followed by histological analysis and Breslow scoring. Punch biopsies are contraindicated in suspected melanomas, for fear of seeding tumor cells and hastening the spread of malignant cells.
Lactate dehydrogenase (LDH) tests are often used to screen for metastases, although many patients with metastases (even end-stage) have a normal LDH; extraordinarily high LDH often indicates metastatic spread of the disease to the liver.
It is common for patients diagnosed with melanoma to have chest X-rays and an LDH test, and in some cases CT, MRI, PET and/or PET/CT scans. Although controversial, sentinel lymph node biopsies and examination of the lymph nodes are also performed in patients to assess spread to the lymph nodes.
A diagnosis of melanoma is supported by the presence of the S-100 protein marker. Additionally, HMB-45 is a monoclonal antibody that reacts against an antigen present in melanocytic tumors such as melanomas. It is used in anatomic pathology as a marker for such tumors. The antibody was generated to an extract of melanoma. It reacts positively against melanocytic tumors, but not other tumors, thus demonstrating specificity and sensitivity.
The following are melanoma stages with 5 year survival rates. Stage 0: melanoma in situ (99.9% survival); Stage I/II: invasive melanoma (89-95% survival); Stage II: high risk melanoma (45-79% survival); Stage III: regional metastasis (24-70% survival); Stage IV: distant metastasis (7-19% survival).
Recent evidence suggests that the prognosis of melanoma patients with regional metastases is influenced by tumor stroma immunobiology (Akbani et al., 2015 Cell (161), 1681-1696, incorporated herein by reference).
Treatment is typically removal by surgery. In those with slightly larger cancers, nearby lymph nodes may be tested for spread. Most people are cured after tumor excision if spread has not occurred. Excisional biopsies may remove the tumor, but further surgery is often necessary to reduce the risk of recurrence. Complete surgical excision with adequate surgical margins and assessment for the presence of detectable metastatic disease along with short- and long-term followup is standard. Often this is done by a wide local excision (WLE) with 1 to 2 cm margins.
For those in whom melanoma has spread, immunotherapy, biologic therapy, radiation therapy, or chemotherapy may improve survival. With treatment, the five-year survival rates in the United States is 98% among those with localized disease and 17% among those in whom spread has occurred. The likelihood that it will come back or spread depends on the melanoma thickness, how fast the cells are dividing, and whether or not the overlying skin has broken down.
Various chemotherapy agents, including temozolomide, dacarbazine (also termed DTIC), immunotherapy (with interleukin-2 (IL-2) or interferon (IFN)), as well as local perfusion, are used for treatment of melanoma. The overall success in metastatic melanoma is quite limited. Therapies for metastatic melanoma include biologic immunotherapy agents ipilimumab, pembrolizumab, and nivolumab; BRAF inhibitors, such as vemurafenib and dabrafenib; and a MEK inhibitor, trametinib.
Radiation therapy is often used after surgical resection for patients with locally or regionally advanced melanoma or for patients with unresectable distant metastases. Kilovoltage x-ray beams are often used for these treatments and have the property of the maximum radiation dose occurring close to the skin surface.
CTLA4 or CTLA-4 (cytotoxic T-lymphocyte-associated protein 4), also known as CD152 (cluster of differentiation 152), is a protein receptor that, functioning as an immune checkpoint, downregulates immune responses. CTLA4 is constitutively expressed in regulatory T cells (Tregs), but only upregulated in conventional T cells after activation. CTLA4 acts as an “off” switch when bound to CD80 or CD86 on the surface of antigen-presenting cells. Recent reports suggest that blocking CTLA4 (using antagonistic antibodies against CTLA such as ipilimumab (FDA approved for melanoma in 2011)) results in therapeutic benefit. CTLA4 blockade inhibits immune system tolerance to tumors and provides a useful immunotherapy strategy for patients with cancer. See, Grosso J. and Jure-Kunkel M. 2013, Cancer Immun., 13: 5, incorporated herein by reference.
Ipilimumab, a fully human monoclonal antibody specific to CTLA-4, improves overall survival in metastatic melanoma patients (Ji et al., 2012 Cancer Immunol Immunother, 61: 1019-1031, incorporated herein by reference). Indeed, monoclonal antibodies directed against CTLA4, such as ipilimumab, yield considerable clinical benefit for patients with metastatic melanoma by inhibiting checkpoint activity; however, prior to the invention described herein, clinical predictors of response to these therapies were incompletely characterized (Van Allen, et al., 2015 Science, 350(6257): 207-211, incorporated herein by reference). See also, Snyder et al., 2014 The New England Journal of Medicine, 373(20): 1984, incorporated herein by reference.
The WHO Criteria for evaluating the effectiveness of anti-cancer agents on tumor shrinkage, developed in the 1970s by the International Union Against Cancer and the World Health Organization, represented the first generally agreed specific criteria for the codification of tumor response evaluation. These criteria were first published in 1981 (Miller et al., 1981 Clin Cancer Res., 47(1): 207-14, incorporated herein by reference). WHO Criteria proposed >50% tumour shrinkage for a Partial Response and >25% tumour increase for Progressive Disease.
RECIST is a set of published rules that define when tumors in cancer patients improve (“respond”), stay the same (“stabilize”), or worsen (“progress”) during treatment (Eisenhauer et al., 2009 European Journal of Cancer, 45: 228-247, incorporated herein by reference). Only patients with measurably disease at baseline should be included in protocols where objective tumor response is the primary endpoint.
The response criteria for evaluation of target lesions are as follows:
The response criteria for evaluation of best overall response are as follows. The best overall response is the best response recorded from the start of the treatment until disease progression/recurrence (taking as reference for PD the smallest measurements recorded since the treatment started). In general, the patient's best response assignment will depend on the achievement of both measurement and confirmation criteria.
The immune-related response criteria (irRC) is a set of published rules that define when tumors in cancer patients improve (“respond”), stay the same (“stabilize”), or worsen (“progress”) during treatment, where the compound being evaluated is an immuno-oncology drug. The Immune-Related Response Criteria, first published in 2009 (Wolchok et al., 2009 Clin Cancer Res, 15(23):7412, incorporated herein by reference), arose out of observations that immuno-oncology drugs would fail in clinical trials that measured responses using the WHO or RECIST Criteria, because these criteria could not account for the time gap in many patients between initial treatment and the apparent action of the immune system to reduce the tumor burden. The key driver in the development of the irRC was the observation that, in studies of various cancer therapies derived from the immune system such as cytokines and monoclonal antibodies, the looked-for Complete and Partial Responses as well as Stable Disease only occurred after an increase in tumor burden that the conventional RECIST Criteria would have dubbed “Progressive Disease’. RECIST failed to take account of the delay between dosing and an observed anti-tumour T cell response, so that otherwise ‘successful’ drugs—that is, drugs which ultimately prolonged life—failed in clinical trials.
The irRC are based on the WHO Criteria; however, the measurement of tumor burden and the assessment of immune-related response have been modified as set forth below.
In the irRC, tumor burden is measured by combining ‘index’ lesions with new lesions. Ordinarily, tumor burden would be measured with a limited number of ‘index’ lesions (that is, the largest identifiable lesions) at baseline, with new lesions identified at subsequent timepoints counting as ‘Progressive Disease’. In the irRC, by contrast, new lesions are a change in tumor burden. The irRC retained the bidirectional measurement of lesions that had originally been laid down in the WHO Criteria.
In the irRC, an immune-related Complete Response (irCR) is the disappearance of all lesions, measured or unmeasured, and no new lesions; an immune-related Partial Response (irPR) is a 50% drop in tumor burden from baseline as defined by the irRC; and immune-related Progressive Disease (irPD) is a 25% increase in tumor burden from the lowest level recorded. Everything else is considered immune-related Stable Disease (irSD). Even if tumor burden is rising, the immune system is likely to “kick in” some months after first dosing and lead to an eventual decline in tumor burden for many patients. The 25% threshold accounts for this apparent delay.
The Cancer Genome Atlas (TCGA) is a project to catalogue genetic mutations responsible for cancer, using genome sequencing and bioinformatics (Cancer Genome Atlas N. Genomic Classification of Cutaneous Melanoma. 2015 Cell, 161(7):1681-96, incorporated herein by reference). TCGA applies high-throughput genome analysis techniques to improve the ability to diagnose, treat, and prevent cancer through a better understanding of the genetic basis of this disease.
The project scheduled 500 patient samples, more than most genomics studies, and used different techniques to analyze the patient samples. Techniques include gene expression profiling, copy number variation profiling, SNP genotyping, genome wide DNA methylation profiling, microRNA profiling, and exon sequencing of at least 1,200 genes. TCGA is sequencing the entire genomes of some tumors, including at least 6,000 candidate genes and microRNA sequences. This targeted sequencing is being performed by all three sequencing centers using hybrid-capture technology. In phase II, TCGA is performing whole exon sequencing on 80% of the cases and whole genome sequencing on 80% of the cases used in the project.
In general, methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides. Methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization, RNAse protection assays, RNA-seq, and reverse transcription polymerase chain reaction (RT-PCR). Alternatively, antibodies are employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS). For example, RT-PCR is used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and/or to analyze RNA structure.
In some cases, a first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by amplification in a PCR reaction. For example, extracted RNA is reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions. The cDNA is then used as template in a subsequent PCR amplification and quantitative analysis using, for example, a TaqMan® (Life Technologies, Inc., Grand Island, N.Y.) assay.
Differential gene expression can also be identified, or confirmed using a microarray technique. In these methods, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines and corresponding normal tissues or cell lines. Thus, RNA is isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA is extracted from frozen or archived tissue samples.
In the microarray technique, PCR-amplified inserts of cDNA clones are applied to a substrate in a dense array. The microarrayed genes, immobilized on the microchip, are suitable for hybridization under stringent conditions.
In some cases, fluorescently labeled cDNA probes are generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest (e.g., melanoma tissue). Labeled cDNA probes applied to the chip hybridize with specificity to loci of DNA on the array. After washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a charge-coupled device (CCD) camera. Quantification of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance.
In some configurations, dual color fluorescence is used. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. In various configurations, the miniaturized scale of the hybridization can afford a convenient and rapid evaluation of the expression pattern for large numbers of genes. In various configurations, such methods can have sensitivity required to detect rare transcripts, which are expressed at fewer than 1000, fewer than 100, or fewer than 10 copies per cell. In various configurations, such methods can detect at least approximately two-fold differences in expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(2): 106-149 (1996)). In various configurations, microarray analysis is performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.
RNA sequencing (RNA-seq), also called whole transcriptome shotgun sequencing (WTSS), uses next-generation sequencing (NGS) to reveal the presence and quantity of RNA in a biological sample at a given moment in time.
RNA-Seq is used to analyze the continually changing cellular transcriptome. See, e.g., Wang et al., 2009 Nat Rev Genet, 10(1): 57-63, incorporated herein by reference. Specifically, RNA-Seq facilitates the ability to look at alternative gene spliced transcripts, post-transcriptional modifications, gene fusion, mutations/SNPs and changes in gene expression. In addition to mRNA transcripts, RNA-Seq can look at different populations of RNA to include total RNA, small RNA, such as miRNA, tRNA, and ribosomal profiling. RNA-Seq can also be used to determine exon/intron boundaries and verify or amend previously annotated 5′ and 3′ gene boundaries.
Prior to RNA-Seq, gene expression studies were done with hybridization-based microarrays. Issues with microarrays include cross-hybridization artifacts, poor quantification of lowly and highly expressed genes, and needing to know the sequence of interest. Because of these technical issues, transcriptomics transitioned to sequencing-based methods. These progressed from Sanger sequencing of Expressed Sequence Tag libraries, to chemical tag-based methods (e.g., serial analysis of gene expression), and finally to the current technology, NGS of cDNA (notably RNA-Seq).
As described here, a gene signature was defined herein, which distinguishes CTLA-4 response in melanoma patients. Also described herein is a gene signature which distinguishes response to a combination of CTLA-4 blockade and a TLR (or autophagy) agonist. Exemplary distinguishing genes are provided below.
An exemplary human MAGEA2 amino acid sequence is set forth below (SEQ ID NO: 1; GenBank Accession No: NP_001269434, Version 1, incorporated herein by reference):
An exemplary human MAGEA2 nucleic acid sequence is set forth below (SEQ ID NO: 2; GenBank Accession No: NM_001282505, Version 1, incorporated herein by reference):
An exemplary human MAGEA3 amino acid sequence is set forth below (SEQ ID NO: 3; GenBank Accession No: CAG46566.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA3 nucleic acid sequence is set forth below (SEQ ID NO: 4; GenBank Accession No: NM_005362.3, Version 3, incorporated herein by reference):
An exemplary human MAGEA6 amino acid sequence is set forth below (SEQ ID NO: 5; GenBank Accession No: CAG46567.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA6 nucleic acid sequence is set forth below (SEQ ID NO: 6; GenBank Accession No: NM_005362.3, Version 3, incorporated herein by reference):
An exemplary human MAGEA12 amino acid sequence is set forth below (SEQ ID NO: 7; GenBank Accession No: EAW99432.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA12 nucleic acid sequence is set forth below (SEQ ID NO: 8; GenBank Accession No: NM_001166386.3, Version 3, incorporated herein by reference):
An exemplary human CSAG1 amino acid sequence is set forth below (SEQ ID NO: 9; GenBank Accession No: AAH59947.1, Version 1, incorporated herein by reference):
An exemplary human CSAG1 nucleic acid sequence is set forth below (SEQ ID NO: 10; GenBank Accession No: BC059947.1, Version 1, incorporated herein by reference):
An exemplary human CSAG2 amino acid sequence is set forth below (SEQ ID NO: 11; GenBank Accession No: EAW99427.1, Version 1, incorporated herein by reference):
An exemplary human CSAG2 nucleic acid sequence is set forth below (SEQ ID NO: 12; GenBank Accession No: AJ844639.1, Version 1, incorporated herein by reference):
An exemplary human CSAG3 amino acid sequence is set forth below (SEQ ID NO: 13; GenBank Accession No: AAI19736.1, Version 1, incorporated herein by reference):
An exemplary human CSAG3 nucleic acid sequence is set forth below (SEQ ID NO: 14; GenBank Accession No: NM_001129826.2, Version 2, incorporated herein by reference):
An exemplary human PSG1 amino acid sequence is set forth below (SEQ ID NO: 15; GenBank Accession No: AAH58285.1, Version 1, incorporated herein by reference):
An exemplary human PSG1 nucleic acid sequence is set forth below (SEQ ID NO: 16; GenBank Accession No: M93704.1, Version 1, incorporated herein by reference):
An exemplary human PSG2 amino acid sequence is set forth below (SEQ ID NO: 17; GenBank Accession No: AAH22316.1, Version 1, incorporated herein by reference):
An exemplary human PSG2 nucleic acid sequence is set forth below (SEQ ID NO: 18; GenBank Accession No: NM_031246.3, Version 3, incorporated herein by reference):
An exemplary human PSG4 amino acid sequence is set forth below (SEQ ID NO: 19; GenBank Accession No: AAH08405.1, Version 1, incorporated herein by reference):
An exemplary human PSG4 nucleic acid sequence is set forth below (SEQ ID NO: 20; GenBank Accession No: M94891.1, Version 1, incorporated herein by reference):
An exemplary human PSG5 amino acid sequence is set forth below (SEQ ID NO: 21; GenBank Accession No: AAH12607.1, Version 1, incorporated herein by reference):
An exemplary human PSG5 nucleic acid sequence is set forth below (SEQ ID NO: 22; GenBank Accession No: BC012607.1, Version 1, incorporated herein by reference):
An exemplary human PSG6 amino acid sequence is set forth below (SEQ ID NO: 23; GenBank Accession No: AAC25619.1, Version 1, incorporated herein by reference):
An exemplary human PSG6 nucleic acid sequence is set forth below (SEQ ID NO: 24; GenBank Accession No: M33666.1, Version 1, incorporated herein by reference):
An exemplary human GABRA3 amino acid sequence is set forth below (SEQ ID NO: 25; GenBank Accession No: AAG12455.1, Version 1, incorporated herein by reference):
An exemplary human GABRA3 nucleic acid sequence is set forth below (SEQ ID NO: 26; GenBank Accession No: NM_000808.3, Version 3, incorporated herein by reference):
An exemplary human GABRB1 amino acid sequence is set forth below (SEQ ID NO: 27; GenBank Accession No: AAH22449.1, Version 1, incorporated herein by reference):
An exemplary human GABRB1 nucleic acid sequence is set forth below (SEQ ID NO: 28; GenBank Accession No: NM_000812.3, Version 3, incorporated herein by reference):
An exemplary human GABRB2 amino acid sequence is set forth below (SEQ ID NO: 29; GenBank Accession No: AAI05640.1, Version 1, incorporated herein by reference):
An exemplary human GABRB2 nucleic acid sequence is set forth below (SEQ ID NO: 30; GenBank Accession No: NM_021911.2, Version 2, incorporated herein by reference):
An exemplary human GABRG2 amino acid sequence is set forth below (SEQ ID NO: 31; GenBank Accession No: AAD50273.1, Version 1, incorporated herein by reference):
An exemplary human GABRG2 nucleic acid sequence is set forth below (SEQ ID NO: 32; GenBank Accession No: NM_198904.2, Version 2, incorporated herein by reference):
An exemplary human GABRQ amino acid sequence is set forth below (SEQ ID NO: 33; GenBank Accession No: EAW99424.1, Version 1, incorporated herein by reference):
An exemplary human GABRQ nucleic acid sequence is set forth below (SEQ ID NO: 34; GenBank Accession No: NM_018558.3, Version 3, incorporated herein by reference):
An exemplary human GABRR1 amino acid sequence is set forth below (SEQ ID NO: 35; GenBank Accession No: EAW48558.1, Version 1, incorporated herein by reference):
An exemplary human GABRR1 nucleic acid sequence is set forth below (SEQ ID NO: 36; GenBank Accession No: NM_002042.4, Version 4, incorporated herein by reference):
An exemplary human CLDN1 amino acid sequence is set forth below (SEQ ID NO: 37; GenBank Accession No: CAG33419.1, Version 1, incorporated herein by reference):
An exemplary human CLDN1 nucleic acid sequence is set forth below (SEQ ID NO: 38; GenBank Accession No: NM_021101.4, Version 4, incorporated herein by reference):
An exemplary human CLDN2 amino acid sequence is set forth below (SEQ ID NO: 39; GenBank Accession No: AAH71747.1, Version 1, incorporated herein by reference):
An exemplary human CLDN2 nucleic acid sequence is set forth below (SEQ ID NO: 40; GenBank Accession No: NM_020384.3, Version 3, incorporated herein by reference):
An exemplary human EYA1 amino acid sequence is set forth below (SEQ ID NO: 41; GenBank Accession No: AAI21799.1, Version 1, incorporated herein by reference):
An exemplary human EYA1 nucleic acid sequence is set forth below (SEQ ID NO: 42; GenBank Accession No: NM_001288574.1, Version 1, incorporated herein by reference):
An exemplary human SNAI1 amino acid sequence is set forth below (SEQ ID NO: 43; GenBank Accession No: CAB52414.1, Version 1, incorporated herein by reference):
An exemplary human SNAI1 nucleic acid sequence is set forth below (SEQ ID NO: 44; GenBank Accession No: NM_005985.3, Version 3, incorporated herein by reference):
An exemplary human TGFB2 amino acid sequence is set forth below (SEQ ID NO: 45; GenBank Accession No: AAH99635.1, Version 1, incorporated herein by reference):
An exemplary human TGFB2 nucleic acid sequence is set forth below (SEQ ID NO: 46; GenBank Accession No: NM_001135599.3, Version 3, incorporated herein by reference):
An exemplary human WNT3 amino acid sequence is set forth below (SEQ ID NO: 47; GenBank Accession No: BAB70502.1, Version 1, incorporated herein by reference):
An exemplary human WNT3 nucleic acid sequence is set forth below (SEQ ID NO: 48; GenBank Accession No: NM_030753.4, Version 4, incorporated herein by reference):
An exemplary human HOXD13 amino acid sequence is set forth below (SEQ ID NO: 49; GenBank Accession No: AAC51635.1, Version 1, incorporated herein by reference):
An exemplary human HOXD13 nucleic acid sequence is set forth below (SEQ ID NO: 50; GenBank Accession No: NM_000523.3, Version 3, incorporated herein by reference):
An exemplary human HOXD11 amino acid sequence is set forth below (SEQ ID NO: 51; GenBank Accession No: AAI09395.1, Version 1, incorporated herein by reference):
An exemplary human HOXD11 nucleic acid sequence is set forth below (SEQ ID NO: 52; GenBank Accession No: NM_021192.2, Version 2, incorporated herein by reference):
An exemplary human HOXA2 nucleic acid sequence is set forth below (SEQ ID NO: 53; GenBank Accession No: NM_006726.1, Version 1, incorporated herein by reference):
An exemplary human HOXA2 nucleic acid sequence is set forth below (SEQ ID NO: 54; GenBank Accession No: NM_006735.3, Version 3, incorporated herein by reference):
An exemplary human HOXA5 amino acid sequence is set forth below (SEQ ID NO: 55; GenBank Accession No: P20719.2, Version 2, incorporated herein by reference):
An exemplary human HOXA5 nucleic acid sequence is set forth below (SEQ ID NO: 56; GenBank Accession No: NM_019102.3, Version 3, incorporated herein by reference):
An exemplary human HOXD10 amino acid sequence is set forth below (SEQ ID NO: 57; GenBank Accession No: P28358.2, Version 2, incorporated herein by reference):
An exemplary human HOXD10 nucleic acid sequence is set forth below (SEQ ID NO: 58; GenBank Accession No: NM_002148.3, Version 3, incorporated herein by reference):
An exemplary human ANGPT1 amino acid sequence is set forth below (SEQ ID NO: 59; GenBank Accession No: AAI52420.1, Version 1, incorporated herein by reference):
An exemplary human ANGPT1 nucleic acid sequence is set forth below (SEQ ID NO: 60; GenBank Accession No: NM_001146.4, Version 4, incorporated herein by reference):
An exemplary human ANG2 amino acid sequence is set forth below (SEQ ID NO: 61; GenBank Accession No: AAF21627.2, Version 2, incorporated herein by reference):
An exemplary human ANG2 nucleic acid sequence is set forth below (SEQ ID NO: 62; GenBank Accession No: AF024631.2, Version 2, incorporated herein by reference):
An exemplary human PDGFA amino acid sequence is set forth below (SEQ ID NO: 63; GenBank Accession No: P04085.1, Version 1, incorporated herein by reference):
An exemplary human PDGFA nucleic acid sequence is set forth below (SEQ ID NO: 64; GenBank Accession No: AH002927.2, Version 2, incorporated herein by reference):
An exemplary human PCDHB2 amino acid sequence is set forth below (SEQ ID NO: 65; GenBank Accession No: EAW61983.1, Version 1, incorporated herein by reference):
An exemplary human PCDHB2 nucleic acid sequence is set forth below (SEQ ID NO: 66; GenBank Accession No: NM_018936.3, Version 3, incorporated herein by reference):
An exemplary human PCDHB3 amino acid sequence is set forth below (SEQ ID NO: 67; GenBank Accession No: EAW61981.1, Version 1, incorporated herein by reference):
An exemplary human PCDHB3 nucleic acid sequence is set forth below (SEQ ID NO: 68; GenBank Accession No: NM_018937.4, Version 4, incorporated herein by reference):
An exemplary human PCDHB6 amino acid sequence is set forth below (SEQ ID NO: 69; GenBank Accession No: EAW61978.1, Version 1, incorporated herein by reference):
An exemplary human PCDHB6 nucleic acid sequence is set forth below (SEQ ID NO: 70; GenBank Accession No: AF217752.1, Version 1, incorporated herein by reference):
An exemplary human PCDHB10 amino acid sequence is set forth below (SEQ ID NO: 71; GenBank Accession No: AAQ89082.1, Version 1, incorporated herein by reference):
An exemplary human PCDHB10 nucleic acid sequence is set forth below (SEQ ID NO: 72; GenBank Accession No: NM_018930.3, Version 3, incorporated herein by reference):
An exemplary human PCDHGA3 amino acid sequence is set forth below (SEQ ID NO: 73; GenBank Accession No: Q9Y5H0.2, Version 2, incorporated herein by reference):
An exemplary human PCDHGA3 nucleic acid sequence is set forth below (SEQ ID NO: 74; GenBank Accession No: NM_018916.3, Version 3, incorporated herein by reference):
An exemplary human PCDHGB1 amino acid sequence is set forth below (SEQ ID NO: 75; GenBank Accession No: AAI03929.1, Version 1, incorporated herein by reference):
An exemplary human PCDHGB1 nucleic acid sequence is set forth below (SEQ ID NO: 76; GenBank Accession No: NM_018922.2, Version 2, incorporated herein by reference):
An exemplary human PCDHGB2 amino acid sequence is set forth below (SEQ ID NO: 77; GenBank Accession No: AAI01806.1, Version 1, incorporated herein by reference):
An exemplary human PCDHGB2 nucleic acid sequence is set forth below (SEQ ID NO: 78; GenBank Accession No: NM_018923.2, Version 2, incorporated herein by reference):
An exemplary human EMILIN1 amino acid sequence is set forth below (SEQ ID NO: 79; GenBank Accession No: AAH07530.1, Version 1, incorporated herein by reference):
An exemplary human EMILIN1 nucleic acid sequence is set forth below (SEQ ID NO: 80; GenBank Accession No: NM_007046.3, Version 3, incorporated herein by reference):
An exemplary human TNN amino acid sequence is set forth below (SEQ ID NO: 81; GenBank Accession No: AAI36620.1, Version 1, incorporated herein by reference):
An exemplary human TNN nucleic acid sequence is set forth below (SEQ ID NO: 82; GenBank Accession No: NM_022093.1, Version 1, incorporated herein by reference):
An exemplary human miR-211 nucleic acid sequence is set forth below (SEQ ID NO: 83; GenBank Accession No: NR_029624.1, Version 1, incorporated herein by reference):
An exemplary human CD5L amino acid sequence is set forth below (SEQ ID NO: 84; GenBank Accession No: AAQ88858.1, Version 1, incorporated herein by reference):
An exemplary human CD5L nucleic acid sequence is set forth below (SEQ ID NO: 85; GenBank Accession No: NM_005894.2, Version 2, incorporated herein by reference):
An exemplary human IL12RB2 amino acid sequence is set forth below (SEQ ID NO: 86; GenBank Accession No: AAI43250.1, Version 1, incorporated herein by reference):
An exemplary human IL12RB2 nucleic acid sequence is set forth below (SEQ ID NO: 87; GenBank Accession No: NM_001559.2, Version 2, incorporated herein by reference):
An exemplary human FAIM3 amino acid sequence is set forth below (SEQ ID NO: 88; GenBank Accession No: EAW93517.1, Version 1, incorporated herein by reference):
An exemplary human FAIM3 nucleic acid sequence is set forth below (SEQ ID NO: 89; GenBank Accession No: NM_005449.4, Version 4, incorporated herein by reference):
An exemplary human PTCRA amino acid sequence is set forth below (SEQ ID NO: 90; GenBank Accession No: AAI53830.1, Version 1, incorporated herein by reference):
An exemplary human PTCRA nucleic acid sequence is set forth below (SEQ ID NO: 91; GenBank Accession No: NM_001243168.1, Version 1, incorporated herein by reference):
An exemplary human CD2 amino acid sequence is set forth below (SEQ ID NO: 92; GenBank Accession No: AAA51946.1, Version 1, incorporated herein by reference):
An exemplary human CD2 nucleic acid sequence is set forth below (SEQ ID NO: 93; GenBank Accession No: NM_001328609.1, Version 1, incorporated herein by reference):
An exemplary human CD6 amino acid sequence is set forth below (SEQ ID NO: 94; GenBank Accession No: AAH33755.1, Version 1, incorporated herein by reference):
An exemplary human CD6 nucleic acid sequence is set forth below (SEQ ID NO: 95; GenBank Accession No: NM_006725.4, Version 4, incorporated herein by reference):
An exemplary human CXCL13 amino acid sequence is set forth below (SEQ ID NO: 96; GenBank Accession No: AAH12589.1, Version 1, incorporated herein by reference):
An exemplary human CXCL13 nucleic acid sequence is set forth below (SEQ ID NO: 97; GenBank Accession No: NM_006419.2, Version 2, incorporated herein by reference):
An exemplary human CD3D amino acid sequence is set forth below (SEQ ID NO: 98; GenBank Accession No: AEQ93556.1, Version 1, incorporated herein by reference):
An exemplary human CD3D nucleic acid sequence is set forth below (SEQ ID NO: 99; GenBank Accession No: BAJ000732.4, Version 4, incorporated herein by reference):
An exemplary human CD3E nucleic acid sequence is set forth below (SEQ ID NO: 101; GenBank Accession No: NM_16130.1, Version 1, incorporated herein by reference):
An exemplary human CD3G amino acid sequence is set forth below (SEQ ID NO: 101; GenBank Accession No: NM_000733.3,Version 3, incorporated herein by reference):
An exemplary human CD3G amino acid sequence is set forth below (SEQ ID NO: 102; GenBank Accession No: P09693.1, Version 1, incorporated herein by reference):
An exemplary human CD3G nucleic acid sequence is set forth below (SEQ ID NO: 103; GenBank Accession No: NM_000073.2, Version 2, incorporated herein by reference):
An exemplary human LCK amino acid sequence is set forth below (SEQ ID NO: 104; GenBank Accession No: P06239.6, Version 6, incorporated herein by reference):
An exemplary human LCK nucleic acid sequence is set forth below (SEQ ID NO: 105; GenBank Accession No: AH002862.2, Version 2, incorporated herein by reference):
An exemplary human T cell receptor alpha amino acid sequence is set forth below (SEQ ID NO: 106; GenBank Accession No: ALC78508.1, Version 1, incorporated herein by reference):
An exemplary human T cell receptor alpha nucleic acid sequence is set forth below (SEQ ID NO: 107; GenBank Accession No: M27377.1, Version 1, incorporated herein by reference):
An exemplary human T cell receptor beta amino acid sequence is set forth below (SEQ ID NO: 108; GenBank Accession No: CAA39990.1, Version 1, incorporated herein by reference):
An exemplary human T cell receptor beta nucleic acid sequence is set forth below (SEQ ID NO: 109; GenBank Accession No: L06888.1, Version 1, incorporated herein by reference):
An exemplary human GNLY amino acid sequence is set forth below (SEQ ID NO: 110; GenBank Accession No: CAG46657.1, Version 1, incorporated herein by reference):
An exemplary human GNLY nucleic acid sequence is set forth below (SEQ ID NO: 111; GenBank Accession No: NM_001302758.1, Version 1, incorporated herein by reference):
An exemplary human GZMA amino acid sequence is set forth below (SEQ ID NO: 112; GenBank Accession No: CAG33249.1, Version 1, incorporated herein by reference):
An exemplary human GZMA nucleic acid sequence is set forth below (SEQ ID NO: 113; GenBank Accession No: NM_006144.3, Version 3, incorporated herein by reference):
An exemplary human GZMB amino acid sequence is set forth below (SEQ ID NO: 114; GenBank Accession No: P10144.2, Version 2, incorporated herein by reference):
An exemplary human GZMB nucleic acid sequence is set forth below (SEQ ID NO: 115; GenBank Accession No: NM_004131.4, Version 4, incorporated herein by reference):
An exemplary human GZMH amino acid sequence is set forth below (SEQ ID NO: 116; GenBank Accession No: P20718.1, Version 1, incorporated herein by reference):
An exemplary human GZMH nucleic acid sequence is set forth below (SEQ ID NO: 117; GenBank Accession No: NM_033423.4, Version 4, incorporated herein by reference):
An exemplary human GZMK amino acid sequence is set forth below (SEQ ID NO: 118; GenBank Accession No: P49863.1, Version 1, incorporated herein by reference):
An exemplary human GZMK nucleic acid sequence is set forth below (SEQ ID NO: 119; GenBank Accession No: NM_002104.2, Version 2, incorporated herein by reference):
An exemplary human PRF1 amino acid sequence is set forth below (SEQ ID NO: 120; GenBank Accession No: P14222.1, Version 1, incorporated herein by reference):
An exemplary human PRF1 nucleic acid sequence is set forth below (SEQ ID NO: 121; GenBank Accession No: M31951.1, Version 1, incorporated herein by reference):
An exemplary human CD19 amino acid sequence is set forth below (SEQ ID NO: 122; GenBank Accession No: AAB60697.1, Version 1, incorporated herein by reference):
An exemplary human CD19 nucleic acid sequence is set forth below (SEQ ID NO: 123; GenBank Accession No: M84371.1, Version 1, incorporated herein by reference):
An exemplary human CD72 amino acid sequence is set forth below (SEQ ID NO: 124; GenBank Accession No: NP_001773.1, Version 1, incorporated herein by reference):
An exemplary human CD72 nucleic acid sequence is set forth below (SEQ ID NO: 125; GenBank Accession No: NM_001782.2, Version 2, incorporated herein by reference):
An exemplary human FCRL1/3 amino acid sequence is set forth below (SEQ ID NO: 126; GenBank Accession No: Q96LA6.1, Version 1, incorporated herein by reference):
An exemplary human FCRL1/3 nucleic acid sequence is set forth below (SEQ ID NO: 127; GenBank Accession No: NM_052938.4, Version 4, incorporated herein by reference):
An exemplary human MS4A1 amino acid sequence is set forth below (SEQ ID NO: 128; GenBank Accession No: P11836.1, Version 1, incorporated herein by reference):
An exemplary human MS4A1 nucleic acid sequence is set forth below (SEQ ID NO: 129; GenBank Accession No: NM_152866.2, Version 2, incorporated herein by reference):
An exemplary human CTLA4 amino acid sequence is set forth below (SEQ ID NO: 130; GenBank Accession No: AAL07473.1, Version 1, incorporated herein by reference):
An exemplary human CTLA4 nucleic acid sequence is set forth below (SEQ ID NO: 131; GenBank Accession No: AF414120.1, Version 1, incorporated herein by reference):
An exemplary human LAG3 amino acid sequence is set forth below (SEQ ID NO: 132; GenBank Accession No: AAH52589.1, Version 1, incorporated herein by reference):
An exemplary human LAG3 nucleic acid sequence is set forth below (SEQ ID NO: 133; GenBank Accession No: NM_002286.5, Version 5, incorporated herein by reference):
An exemplary human FCRL1 amino acid sequence is set forth below (SEQ ID NO: 134; GenBank Accession No: Q96LA6.1, Version 1, incorporated herein by reference):
An exemplary human FCRL1 nucleic acid sequence is set forth below (SEQ ID NO: 135; GenBank Accession No: NM_052938.4, Version 4, incorporated herein by reference):
An exemplary human FCRL3 amino acid sequence is set forth below (SEQ ID NO: 136; GenBank Accession No: AAH28933.1, Version 1, incorporated herein by reference):
An exemplary human FCRL3 nucleic acid sequence is set forth below (SEQ ID NO: 137; GenBank Accession No: NM_052939.3, Version 3, incorporated herein by reference):
An exemplary human SIGLEC8 amino acid sequence is set forth below (SEQ ID NO: 138; GenBank Accession No: Q9NYZ4.2, Version 2, incorporated herein by reference):
An exemplary human SIGLEC8 nucleic acid sequence is set forth below (SEQ ID NO: 139; GenBank Accession No: NM_014442.2, Version 2, incorporated herein by reference):
An exemplary human FAIM3/TOSO amino acid sequence is set forth below (SEQ ID NO: 140; GenBank Accession No: 060667.1, Version 1, incorporated herein by reference):
An exemplary human FAIM3/TOSO nucleic acid sequence is set forth below (SEQ ID NO: 141; GenBank Accession No: BC006401.2, Version 2, incorporated herein by reference):
An exemplary human MAGEA2B amino acid sequence is set forth below (SEQ ID NO: 142; GenBank Accession No: AAI12161.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA2B nucleic acid sequence is set forth below (SEQ ID NO: 143; GenBank Accession No: NM_001321400.1, Version 1, incorporated herein by reference):
An exemplary human MKRN9P amino acid sequence is set for the below (SEQ ID NO: 144; GenBank Accession No: Q6NVV0.1, Version 1, incorporated herein by reference):
An exemplary human MKRN9P nucleic acid sequence is set forth below (SEQ ID NO: 145; GenBank Accession No: NR_033410.1, Version 1, incorporated herein by reference):
An exemplary human MAGEC1 amino acid sequence is set forth below (SEQ ID NO: 146; GenBank Accession No: 060732.3, Version 3, incorporated herein by reference):
An exemplary human MAGEC1 nucleic acid sequence is set forth below (SEQ ID NO: 147; GenBank Accession No: NM_005462.4, Version 4, incorporated herein by reference):
An exemplary human PSG11 amino acid sequence is set forth below (SEQ ID NO: 148; GenBank Accession No: AAA60203.1, Version 1, incorporated herein by reference):
An exemplary human PSG11 nucleic acid sequence is set forth below (SEQ ID NO: 149; GenBank Accession No: M58591.1, Version 1, incorporated herein by reference):
An exemplary human TAC3 amino acid sequence is set forth below (SEQ ID NO: 150; GenBank Accession No: AAQ89042.1, Version 1, incorporated herein by reference):
An exemplary human TAC3 nucleic acid sequence is set forth below (SEQ ID NO: 151; GenBank Accession No: AY358679.1, Version 1, incorporated herein by reference):
An exemplary human PSG8 amino acid sequence is set forth below (SEQ ID NO: 152; GenBank Accession No: Q9UQ74.2, Version 2, incorporated herein by reference):
An exemplary human PSG8 nucleic acid sequence is set forth below (SEQ ID NO: 153; GenBank Accession No: AH007519.2, Version 2, incorporated herein by reference):
An exemplary human HSPB3 amino acid sequence is set forth below (SEQ ID NO: 154; GenBank Accession No: Q12988.2, Version 2, incorporated herein by reference):
An exemplary human HSPB3 nucleic acid sequence is set forth below (SEQ ID NO: 155; GenBank Accession No: CR450314.1, Version 1, incorporated herein by reference):
An exemplary human GJB6 amino acid sequence is set forth below (SEQ ID NO: 156; GenBank Accession No: 095452.2, Version 2, incorporated herein by reference):
An exemplary human GJB6 nucleic acid sequence is set forth below (SEQ ID NO: 157; GenBank Accession No: AY297110.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA1 amino acid sequence is set forth below (SEQ ID NO: 158; GenBank Accession No: P43355.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA1 nucleic acid sequence is set forth below (SEQ ID NO: 159; GenBank Accession No: NM_004988.4, Version 4, incorporated herein by reference):
An exemplary human MAGEA11 amino acid sequence is set forth below (SEQ ID NO: 160; GenBank Accession No: P43364.2, Version 2, incorporated herein by reference):
An exemplary human MAGEA11 nucleic acid sequence is set forth below (SEQ ID NO: 161; GenBank Accession No: AY747607.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA9B amino acid sequence is set forth below (SEQ ID NO: 162; GenBank Accession No: NP_001074259.1, Version 1, incorporated herein by reference):
An exemplary human MAGEA9B nucleic acid sequence is set forth below (SEQ ID NO: 163; GenBank Accession No: NM_001080790.1, Version 1, incorporated herein by reference):
An exemplary human TRPM1 amino acid sequence is set forth below (SEQ ID NO: 164; GenBank Accession No: AAH58286.1, Version 1, incorporated herein by reference):
An exemplary human TRPM1 nucleic acid sequence is set forth below (SEQ ID NO: 165; GenBank Accession No: BC058286.1, Version 1, incorporated herein by reference):
An exemplary human CSAG4 nucleic acid sequence is set forth below (SEQ ID NO: 166; GenBank Accession No: NR_073432.1, Version 1, incorporated herein by reference):
An exemplary human AC093787 (RP11-215P9) nucleic acid sequence is set forth below (SEQ ID NO: 167; GenBank Accession No: AC093787.1, Version 1, incorporated herein by reference):
An exemplary human KRT8P8 nucleic acid sequence is set forth below (SEQ ID NO: 168; GenBank Accession No: NG_009749.1, Version 1, incorporated herein by reference):
An exemplary human miR218-1 nucleic acid sequence is set forth below (SEQ ID NO: 169; GenBank Accession No: NR_029631.1, Version 1, incorporated herein by reference):
An exemplary human XIST nucleic acid sequence is set forth below (SEQ ID NO: 170; GenBank Accession No: U50908.1, Version 1, incorporated herein by reference):
An exemplary human PSG10P nucleic acid sequence is set forth below (SEQ ID NO: 171; GenBank Accession No: NR_026824.1, Version 1, incorporated herein by reference):
An exemplary human miR1262 nucleic acid sequence is set forth below (SEQ ID NO: 172; GenBank Accession No: NR_031664.1, Version 1, incorporated herein by reference):
An exemplary human RP11-360D2.1 nucleic acid sequence is set forth below (SEQ ID NO: 173; GenBank Accession No: HG492934.1, Version 1, incorporated herein by reference):
An exemplary human RP11 amino acid sequence is set forth below (SEQ ID NO: 174; GenBank Accession No: NP_056444.3, Version 3, incorporated herein by reference):
An exemplary human RP11 nucleic acid sequence is set forth below (SEQ ID NO: 175; GenBank Accession No: NM_015629.3, Version 3, incorporated herein by reference):
An exemplary human RP1 amino acid sequence is set forth below (SEQ ID NO: 176; GenBank Accession No: AAA20120.1, Version 1, incorporated herein by reference):
An exemplary human RP1 nucleic acid sequence is set forth below (SEQ ID NO: 177; GenBank Accession No: NM_006269.1, Version 1, incorporated herein by reference):
An exemplary human CD28 amino acid sequence is set forth below (SEQ ID NO: 178; GenBank Accession No: AAI12086.1, Version 1, incorporated herein by reference):
An exemplary human CD28 nucleic acid sequence is set forth below (SEQ ID NO: 179; GenBank Accession No: AJ295273.1, Version 1, incorporated herein by reference):
An exemplary human ICOS amino acid sequence is set forth below (SEQ ID NO: 180; GenBank Accession No: AAH28006.1, Version 1, incorporated herein by reference):
An exemplary human ICOS nucleic acid sequence is set forth below (SEQ ID NO: 181; GenBank Accession No: NM_012092.3, Version 3, incorporated herein by reference):
An exemplary human EOMES amino acid sequence is set forth below (SEQ ID NO: 182; GenBank Accession No: NP_001265111.1, Version 1, incorporated herein by reference):
An exemplary human EOMES nucleic acid sequence is set forth below (SEQ ID NO: 183; GenBank Accession No: NM_001278182.1, Version 1, incorporated herein by reference):
An exemplary human IL2RB amino acid sequence is set forth below (SEQ ID NO: 184; GenBank Accession No: CAG30392.1, Version 1, incorporated herein by reference):
An exemplary human IL2RB nucleic acid sequence is set forth below (SEQ ID NO: 185; GenBank Accession No: NM_000878.3, Version 3, incorporated herein by reference):
An exemplary human FASLG amino acid sequence is set forth below (SEQ ID NO: 186; GenBank Accession No: AAH17502.1, Version 1, incorporated herein by reference):
An exemplary human FASLG nucleic acid sequence is set forth below (SEQ ID NO: 187; GenBank Accession No: NM_000639.2, Version 2, incorporated herein by reference):
An exemplary human SLAMF6 amino acid sequence is set forth below (SEQ ID NO: 188; GenBank Accession No: AAI14496.1, Version 1, incorporated herein by reference):
An exemplary human SLAMF6 nucleic acid sequence is set forth below (SEQ ID NO: 189; GenBank Accession No: NM_001184714.1, Version 1, incorporated herein by reference):
An exemplary human GAPDH amino acid sequence is set forth below (SEQ ID NO: 190; GenBank Accession No: NP_001276675.1, Version 1, incorporated herein by reference):
An exemplary human GAPDH nucleic acid sequence is set forth below (SEQ ID NO: 191; GenBank Accession No: NM_002046.5, Version 5, incorporated herein by reference):
An exemplary human HPRT1 amino acid sequence is set forth below (SEQ ID NO: 192; GenBank Accession No: AAH00578.1, Version 1, incorporated herein by reference):
An exemplary human HPRT1 nucleic acid sequence is set forth below (SEQ ID NO: 193; GenBank Accession No: NM_000194.2, Version 2, incorporated herein by reference):
An exemplary human PSK1 amino acid sequence is set forth below (SEQ ID NO: 194; GenBank Accession No: NP_079418.1, Version 1, incorporated herein by reference):
An exemplary human PSK1 nucleic acid sequence is set forth below (SEQ ID NO: 195; GenBank Accession No: NM_025142.1, Version 1, incorporated herein by reference):
An exemplary human PSG7 amino acid sequence is set forth below (SEQ ID NO: 196; GenBank Accession No: NP_002774.2, Version 2, incorporated herein by reference):
An exemplary human PSG7 nucleic acid sequence is set forth below (SEQ ID NO: 197; GenBank Accession No: U18467.1, Version 1, incorporated herein by reference):
An exemplary human PSG8 amino acid sequence is set forth below (SEQ ID NO: 198; GenBank Accession No: AAI37501.1, Version 1, incorporated herein by reference):
An exemplary human PSG8 nucleic acid sequence is set forth below (SEQ ID NO: 199; GenBank Accession No: BC142628.1, Version 1, incorporated herein by reference):
An exemplary human PSG9 amino acid sequence is set forth below (SEQ ID NO: 200; GenBank Accession No: AAH20759.1, Version 1, incorporated herein by reference):
An exemplary human PSG9 nucleic acid sequence is set forth below (SEQ ID NO: 201; GenBank Accession No: BC020759.1, Version 1, incorporated herein by reference):
An exemplary human PSG11 amino acid sequence is set forth below (SEQ ID NO: 202 GenBank Accession No: AAA60203.1, Version 1, incorporated herein by reference):
An exemplary human PSG11 nucleic acid sequence is set forth below (SEQ ID NO: 203; GenBank Accession No: M58591.1, Version 1, incorporated herein by reference):
An exemplary human miR-185 nucleic acid sequence is set forth below (SEQ ID NO: 204; GenBank Accession No: NR_029706.1, Version 1, incorporated herein by reference):
An exemplary human miR-513a2 nucleic acid sequence is set forth below (SEQ ID NO: 205; GenBank Accession No: LM609506.1, Version 1, incorporated herein by reference):
An exemplary human HMGB1 amino acid sequence is set forth below (SEQ ID NO: 210 GenBank Accession No: CAG33144.1, Version 1, incorporated herein by reference):
An exemplary human HMGB1 nucleic acid sequence is set forth below (SEQ ID NO: 211; GenBank Accession No: NM_001313893.1, Version 1, incorporated herein by reference):
For therapeutic uses, the compositions or agents described herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable buffer such as physiological saline. Preferable routes of administration include, for example, subcutaneous, intravenous, interperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient. Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a therapeutic identified herein in a physiologically-acceptable carrier. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the clinical symptoms of the neoplasia, i.e., the melanoma. Generally, amounts will be in the range of those used for other agents used in the treatment of other diseases associated with neoplasia, although in certain instances lower amounts will be needed because of the increased specificity of the compound. For example, a therapeutic compound is administered at a dosage that is cytotoxic to a neoplastic cell.
The administration of a compound or a combination of compounds for the treatment of a neoplasia, e.g., a melanoma, may be by any suitable means that results in a concentration of the therapeutic that, combined with other components, is effective in ameliorating, reducing, or stabilizing a neoplasia. The compound may be contained in any appropriate amount in any suitable carrier substance, and is generally present in an amount of 1-95% by weight of the total weight of the composition. The composition may be provided in a dosage form that is suitable for parenteral (e.g., subcutaneously, intravenously, intramuscularly, or intraperitoneally) administration route. The pharmaceutical compositions may be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
Human dosage amounts can initially be determined by extrapolating from the amount of compound used in mice, as a skilled artisan recognizes it is routine in the art to modify the dosage for humans compared to animal models. In certain embodiments it is envisioned that the dosage may vary from between about 1 μg compound/Kg body weight to about 5000 mg compound/Kg body weight; or from about 5 mg/Kg body weight to about 4000 mg/Kg body weight or from about 10 mg/Kg body weight to about 3000 mg/Kg body weight; or from about 50 mg/Kg body weight to about 2000 mg/Kg body weight; or from about 100 mg/Kg body weight to about 1000 mg/Kg body weight; or from about 150 mg/Kg body weight to about 500 mg/Kg body weight. In other cases, this dose may be about 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500, or 5000 mg/Kg body weight. In other aspects, it is envisaged that doses may be in the range of about 5 mg compound/Kg body to about 20 mg compound/Kg body. In other embodiments, the doses may be about 8, 10, 12, 14, 16 or 18 mg/Kg body weight. Of course, this dosage amount may be adjusted upward or downward, as is routinely done in such treatment protocols, depending on the results of the initial clinical trials and the needs of a particular patient.
Pharmaceutical compositions according to the invention may be formulated to release the active compound substantially immediately upon administration or at any predetermined time or time period after administration. The latter types of compositions are generally known as controlled release formulations, which include (i) formulations that create a substantially constant concentration of the drug within the body over an extended period of time; (ii) formulations that after a predetermined lag time create a substantially constant concentration of the drug within the body over an extended period of time; (iii) formulations that sustain action during a predetermined time period by maintaining a relatively, constant, effective level in the body with concomitant minimization of undesirable side effects associated with fluctuations in the plasma level of the active substance (sawtooth kinetic pattern); (iv) formulations that localize action by, e.g., spatial placement of a controlled release composition adjacent to or in contact with the thymus; (v) formulations that allow for convenient dosing, such that doses are administered, for example, once every one or two weeks; and (vi) formulations that target a neoplasia by using carriers or chemical derivatives to deliver the therapeutic agent to a particular cell type (e.g., neoplastic cell). For some applications, controlled release formulations obviate the need for frequent dosing during the day to sustain the plasma level at a therapeutic level.
Any of a number of strategies can be pursued in order to obtain controlled release in which the rate of release outweighs the rate of metabolism of the compound in question. In one example, controlled release is obtained by appropriate selection of various formulation parameters and ingredients, including, e.g., various types of controlled release compositions and coatings. Thus, the therapeutic is formulated with appropriate excipients into a pharmaceutical composition that, upon administration, releases the therapeutic in a controlled manner. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, molecular complexes, nanoparticles, patches, and liposomes.
The pharmaceutical composition may be administered parenterally by injection, infusion or implantation (subcutaneous, intravenous, intramuscular, intraperitoneal, or the like) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants. The formulation and preparation of such compositions are well known to those skilled in the art of pharmaceutical formulation. Formulations can be found in Remington: The Science and Practice of Pharmacy, supra.
Compositions for parenteral use may be provided in unit dosage forms (e.g., in single-dose ampoules), or in vials containing several doses and in which a suitable preservative may be added (see below). The composition may be in the form of a solution, a suspension, an emulsion, an infusion device, or a delivery device for implantation, or it may be presented as a dry powder to be reconstituted with water or another suitable vehicle before use. Apart from the active agent that reduces or ameliorates a neoplasia, the composition may include suitable parenterally acceptable carriers and/or excipients. The active therapeutic agent(s) may be incorporated into microspheres, microcapsules, nanoparticles, liposomes, or the like for controlled release. Furthermore, the composition may include suspending, solubilizing, stabilizing, pH-adjusting agents, tonicity adjusting agents, and/or dispersing, agents.
As indicated above, the pharmaceutical compositions according to the invention may be in the form suitable for sterile injection. To prepare such a composition, the suitable active antineoplastic therapeutic(s) are dissolved or suspended in a parenterally acceptable liquid vehicle. Among acceptable vehicles and solvents that may be employed are water, water adjusted to a suitable pH by addition of an appropriate amount of hydrochloric acid, sodium hydroxide or a suitable buffer, 1,3-butanediol, Ringer's solution, and isotonic sodium chloride solution and dextrose solution. The aqueous formulation may also contain one or more preservatives (e.g., methyl, ethyl or n-propyl p-hydroxybenzoate). In cases where one of the compounds is only sparingly or slightly soluble in water, a dissolution enhancing or solubilizing agent can be added, or the solvent may include 10-60% w/w of propylene glycol.
Controlled release parenteral compositions may be in form of aqueous suspensions, microspheres, microcapsules, magnetic microspheres, oil solutions, oil suspensions, or emulsions. Alternatively, the active drug may be incorporated in biocompatible carriers, liposomes, nanoparticles, implants, or infusion devices.
Materials for use in the preparation of microspheres and/or microcapsules are, e.g., biodegradable/bioerodible polymers such as polygalactin, poly-(isobutyl cyanoacrylate), poly(2-hydroxyethyl-L-glutam-nine) and, poly(lactic acid). Biocompatible carriers that may be used when formulating a controlled release parenteral formulation are carbohydrates (e.g., dextrans), proteins (e.g., albumin), lipoproteins, or antibodies. Materials for use in implants can be non-biodegradable (e.g., polydimethyl siloxane) or biodegradable (e.g., poly(caprolactone), poly(lactic acid), poly(glycolic acid) or poly(ortho esters) or combinations thereof).
The present compositions may be assembled into kits or pharmaceutical systems for use in ameliorating a neoplasia (e.g., melanoma). Kits or pharmaceutical systems according to this aspect of the invention comprise a carrier means, such as a box, carton, tube or the like, having in close confinement therein one or more container means, such as vials, tubes, ampoules, or bottles. The kits or pharmaceutical systems of the invention may also comprise associated instructions for using the agents of the invention.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
First, expression data from a previously published cohort of pre-ipilimumab treated melanoma patients (Cohort 1) was analyzed (Van Allen et al., 2015 Science, 350(6257):207-11, incorporated herein by reference). The patients were classified into three groups based on their post-treatment outcome: (i) patients who achieved complete or partial response by Response Evaluation Criteria in Solid Tumors (RECIST) criteria or stable disease by RECIST criteria with overall survival greater than one year (“clinical benefit/CB;” n=13); (ii) patients who had progressive disease by RECIST criteria or stable disease with overall survival less than 1 year (“no benefit/NB;” n=22); and (iii) patients showing early progression on ipilimumab (progression-free survival (PFS)<6 months) with overall survival >2 years (“long-term survival with no clinical benefit/LTS;” n=5). The LTS group was removed from the differential expression analysis for three reasons: 1) their unique clinical course suggests a potentially different clinicobiology; 2) the small number of samples precludes any meaningful comparisons with the other two groups; and 3) the focus was purely on expression patterns distinguishing clear benefit from clear resistance. Therefore, an unbiased differential gene expression analysis was performed between the CB and NB groups. Because of the limited number of patients, the statistical stringency was relaxed in the unbiased differential expression analysis by forgoing multiple hypothesis correction. Using a cutoff of 2-fold difference between the absolute medians of the two groups (unadjusted Mann-Whitney p<0.05), 975 genes co-enriched in the ‘no benefit’ tumors (
Strikingly, 8 of the top 10 genes enriching 60-180 fold in ‘NB’ tumors clustered within a narrow 75 Kb region of chromosome Xq28 (
In addition to the CGA cluster on Xq28, increased expression of additional CGAs was identified in NB samples, though none were as highly expressed as those at the CRMA locus (Table 2,
Other differentially expressed genes corresponding to anti-CTLA4 resistance included epithelial-to-mesenchymal transition (CLDN1, CLDN2, EYA1, SNAI1, TGFB2, WNT3), embryonic development/differentiation (HOXD13, HOXD11, HOXA2, HOXA5, HOXD10), angiogenesis (ANGPT1, ANG2, PDGFA), and extracellular matrix (PCDHB2, PCDHB3, PCDHB6, PCDHB10, PCDHGA3, PCDHGB1, PCDHGB2, EMILIN1, TNN). Genes listed in Table 2.
Next, another previously published clinical cohort consisting of chemotherapy-naïve responding (n=4) and resistant (n=2) pre-anti-CTLA4 melanomas (confirmation cohort) was queried (Snyder et al., 2014 The New England Journal of Medicine, 371(23):2189-99, incorporated herein by reference). Here too, CGA's from the Xq28 locus were upregulated in resistant tumors (
To further validate these results in a larger cohort, the transcriptomes of 473 metastatic melanomas from The Cancer Genome Atlas (TCGA) were analyzed, dividing them into “CGA-Xq28 high” and “CGA-Xq28 low” groups based on their expression of these 8 CGA's (Cancer Genome Atlas N. Genomic Classification of Cutaneous Melanoma. 2015 Cell, 161(7):1681-96, incorporated herein by reference). A statistically significant overlap was identified between genes co-enriched with the CTA-Xq28 locus in TCGA and genes enriched with nonresponding pre-anti-CTLA4 tumors (p<10−16) (TABLE 3, 4). As expected, no overlap was seen between “CGA-Xq28 high”-associated genes in TCGA and genes associated with responding tumors (p=1) (
Similarly, significant overlaps were identified between “CGA-Xq28 low”-associated genes in TCGA and genes associated with clinical benefit (p=1.6×10−5) but no overlaps with genes associated with “no benefit” tumors (p=1). Thus the enrichment of these 8 CTA's from the Xq28 locus in primary resistant melanomas to anti-CTLA4 therapy is consistently observed among three different cohorts.
The cohort was heavily pretreated with dacarbazine (DTIC) or temozolamide, two epigenetic modifiers. However, no effect of history of DTIC/temozolamide treatment on clinical outcome was identified (
Because CGA expression is known to be regulated by DNA methylation (Sigalotti et al., 2002 Journal of immunotherapy, 25:16-26; Fratta et al., 2011 Molecular oncology, 5:164-82), locus specific methylation analysis was performed for the promoters of MAGEA3 and MAGEA6 as well as unique methylation sites within the gene bodies of MAGEA3, MAGEA6, and MAGE12. Within NB samples, significantly decreased DNA methylation was observed throughout the promoters for the MAGEA3 and MAGEA6 genes (
To further investigate DNA methylation patterns associated with CRMA expression, methylation data from TCGA melanoma samples was queried. Differential methylation analysis of 485,577 probes between samples with high and low expression of the CRMA locus (see STAR Methods for details) revealed 47 probes relatively hypermethylated in the “CRMA-high” group compared to 65,467 in the “CRMA-low” group (
Using a cutoff of 2-fold difference between the absolute medians of the two groups (nominal Mann-Whitney p<0.05), 175 protein-coding genes and 8 RNA genes co-enriched in the ‘clinical benefit’ tumors were identified. As the most upregulated gene, microRNA-211 (miR-211) was detected over 700-fold compared to ‘no benefit’ tumors (
In contrast to the immunosuppressive nature of genes associated with primary resistance, an inflammatory, activated immunologic response was identified in the tumor microenvironment of ‘clinical benefit’ tumors, consistent with previous findings (
These immune-related genes were classified as involved in T cell infiltration (CD2, CD6, CXCL13), receptor signaling (CD3D, CD3E, CD3G, LCK, and T cell receptor alpha and beta genes [n=19]), activation (CD28, ICOS, EOMES, IL2RB, FASLG, SLAMF6), and cytotoxicity (GNLY, GZMA, GZMB, GZMH, GZMK, PRF1). Interestingly, an enrichment of immature T cells was noted from increased expression of the pre-T cell receptor alpha chain (PTCRA). Additionally, a striking number of immunoglobulin heavy and light chain genes (n=33) were upregulated in ‘clinical benefit’ tumors, thereby implicating humoral immunity (CD19, CD72, FCRL1/3, MS4A1). Dysfunction of a diverse immune infiltrate was suggested by enrichment of immune inhibitory receptors specific to or preferentially expressed by T cells (CTLA4, LAG3), B cells (CTLA4, FCRL1, FCRL3), macrophages (CD5L) and eosinophils/mast cells (SIGLEC8), depicting a paralyzed anti-tumor immune infiltrate. Also, upregulation of FAIM3/TOSO, the Fc receptor for IgM that is expressed on B and T cells, was observed. Recently, single cell transcriptomic studies implicated both FAIM3 and CD5L as key regulators of Th17 pathogenicity.
To validate the association of miR-211 with clinical benefit, TCGA melanoma transcriptomes were queried. It was identified that genes co-enriched with miR-211 significantly overlapped with genes enriched in clinically benefiting tumors (p=2.5×10−13) whereas no significant overlap was seen between genes co-enriched with miR-211 and genes enriched in resistant tumors (p=0.99) (
Although studies have suggested common genomic signatures of response (i.e. neoantigen load and clonality) for both CTLA4 and PD1 pathway blockade, the immunobiological processes driven by these two molecules are distinct. Thus, it was hypothesized that the transcriptional signatures of response and resistance to CTLA4 blockade would be unique and not shared with PD1 pathway antagonists. Recently, the genomic and transcriptomic features of response to anti-PD1 therapy in melanomas were reported (Hugo et al., 2016 Cell, 165(1):35-44, incorporated herein by reference). Expression of the Xq28 CTA's and miR-211 were interrogated in these cohorts; however, no correlation with clinical outcome (
To evaluate the ability of these gene expression signatures to accurately discriminate clinical outcome to CTLA4 blockade, the correlation of the greatest expression value from the Xq28 CGA cluster (comprising genes MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, GSAG2, and CAG3) was evaluated with expression of miR-211 for all 40 patients from Cohort 1, including the long-term survivors with no clinical benefit, thus examining a “real world” scenario (
While the discovery cohort was generated from formalin-fixed samples from an observational, retrospective study, the findings were validated in an independent RNA-seq data set generated from cryopreserved tumors from a prospective, randomized trial using pre-treatment patient samples derived from the CheckMate 064 trial (Weber et al., 2016) (see STAR Methods for details). Again, the CRMA genes were amongst the most significantly upregulated genes (
Because of prior reports of discordance between cancer-germline RNA and protein expression across cancers (Chen et al., 2014), immunohistochemistry (IHC) was performed on NB and CB samples using the MAGE-A antibody (clone 6C1), which is broadly reactive for gene products from the MAGE-A family recognizing MAGEA1, A2, A3, A4, A6, A10 and A12. IHC analysis demonstrated that the NB cohort comprised a significantly higher proportion of MAGE-A+ tumors compared to the CB cohort (
Detectable MAGE-A protein expression associated with inferior overall survival after ipilimumab therapy (
To control for potential artifacts from whole transcriptome RNA-seq (e.g. cDNA library synthesis, read alignment), results were confirmed by gene-specific RT-qPCR of the original tumor RNA in the discovery set using three different housekeeping genes (
Although MAGE proteins have often been studied as immunotherapeutic targets bound to HLA molecules on the cell surface (Van Der Bruggen et al., 2002), recent studies have attributed them with key oncogenic capacities. Expression of MAGE-A3/A6 is necessary for cancer cell viability and can be sufficient to transform cells (Pineda et al., 2015). Critical to the oncogenic functions of MAGEs may be their defining ability to bind to and potentiate the activity of various E3 ubiquitin ligases (Lee and Potts, 2017). MAGE-A2, MAGE-A3, and MAGE-A6 all share specific binding to the TRIM28 ubiquitin ligase. Multiple groups have demonstrated MAGE-TRIM28-induced ubiquitination and proteasomal degradation of the p53 tumor suppressor protein (Doyle et al., 2010) and more recently the AMPK complex which controls cellular metabolic pathways such as autophagy (Pineda et al., 2015).
As described herein, the MAGE-A genes within the CRMA locus may target proteins that are involved in immune priming (governed partly by the CTLA4 pathway) rather than immune effector function (governed partly by the PD1 pathway). The results of a screen for direct substrates of MAGE-A through in vitro ubiquitination reactions on protein microarrays containing >9000 recombinant proteins were previously reported (Pineda et al., 2015). As a significantly ubiquitinated target of the MAGE-TRIM28 complex, high-mobility group box 1 (HMGB1) emerged as a likely candidate for its well-described roles in both autophagy and immunogenic cell death that is required for dendritic cell-mediated priming of an adaptive immune response (Apetoh et al., 2007; Tang et al., 2010) (
As a well-described damage-associated molecular pattern (DAMP), HMGB1 has been demonstrated to recruit a diverse inflammatory response by binding various toll-like receptors. In particular, HMGB1 can bind dsDNA to form immune complexes recognized by TLR9, resulting in secretion of immunostimulatory cytokines and proliferation of B cells (Avalos et al., 2010; Tian et al., 2007). Consistent with these studies, evidence for an inflammatory, activated immunologic response was identified in the tumor microenvironment of CB samples. Of 326 genes enriched in CB samples, 182 (55%) were identified as immune-related through manual curation, compared to only 16 of 457 (3.5%), in NB samples (Fisher's exact test, p<0.0001;
Furthermore, to interrogate immune subpopulations, their involvement was computationally inferred using recently collated gene sets describing specific immune subsets (Angelova et al., 2015). Multiple B and T cell subpopulations were significantly enriched within CB transcriptomes comprising activated, immature and mature B cells along with central memory CD4+ T cells, effector memory CD8+ T cells, T helper 1 and 2 cells, gamma-delta T cells, and T regulatory cells (
Finally, to ascertain whether the MAGE-TRIM28 complex can suppress autophagy in melanoma, LC3B and p62 staining in MAGE-A stained melanomas was examined. Significantly reduced expression of the autophagy marker LC3B was identified in MAGE-A+ melanomas (
MAGE family members were first identified as targets of anti-tumor T cells in melanoma, and their restricted expression in immune-privileged gonadal tissues and various tumor types highlighted them as immunogenic targets (Coulie et al., 2014; De Plaen et al., 1994; Simpson et al., 2005; van der Bruggen et al., 1991). Therefore, the findings of a specific subcluster of MAGE-A genes overexpressed in melanomas resistant to CTLA4 blockade were unexpected. However, clinical efforts to immunotherapeutically target these proteins have yielded mixed results, suggesting their in vivo immunogenicity should not be assumed (Vansteenkiste et al., 2016). Indeed, many groups have demonstrated the association of CGAs and especially the MAGE family with poor prognostic features in melanoma such as ulceration, thickness, metastases and progression in contrast to the positive prognosis afforded by immune infiltration (Azimi et al., 2012; Barrow et al., 2006; Roeder et al., 2005).
One possible explanation for these results is that reduced Xq28-CGA expression in responding tumors is a manifestation of effective anti-MAGE-A immune activity. Responding melanoma samples are characterized by immune infiltrates that may have already selected against tumor cells expressing high levels of Xq28-CGA genes. However, it was observed that other melanoma antigens previously demonstrated to elicit cellular and humoral responses, such as NY-ESO-1 (another cancer-germline antigen) and various differentiation antigens, showed no evidence of selection in the analysis (
An alternative explanation is that these particular Xq28-CGA genes induce immune resistance. Recently described cell-intrinsic functions for MAGE-A3/A6 have implicated these proteins in oncogene addiction, the ubiquitination of key tumor suppressors—notably TP53 and AMPK—that contribute to oncogenesis, and the repression of autophagy (Doyle et al., 2010; Pineda et al., 2015). As described herein, degradation of a protein involved in immune priming (governed in part by the CTLA4 pathway) as opposed to immune effector function (mediated partly by the PD1 pathway) might explain the specificity of the Xq28-CGA cluster to CTLA4, but not PD1, blockade. In fact, an in vitro screen of ubiquitination targets of the MAGE-A3/6-TRIM28 E3 ubiquitin ligase revealed HMGB1, a damage-associated molecular pattern (DAMP) intimately involved in induction of cellular autophagy and immunogenic cell death (
Binding of DAMPs to pattern recognition receptors (such as TLR family members) serve as ‘signal 0’ to kick-start the adaptive immune response through dendritic cell (DC) maturation and migration to the lymph nodes. There, DCs mediate antigen recognition by T cells (‘signal 1’), upregulate costimulatory receptors (‘signal 2’) and secrete polarization and differentiation cytokines (‘signal 3’) (Tang et al., 2012; Yatim et al., 2017). HMGB1 has been identified as a ‘signal 0’ that critically mediates immunogenic cell death—a process that has been proposed to rely on a combination of both antigenicity and adjuvanticity, the former conferred by neo-antigens (in tumors) and the latter provided by specific DAMPs (Galluzzi et al., 2017). Although melanomas have high neoantigen loads that correlate with response to checkpoint blockers, a defect in pathways required for cell death-associated release of DAMPs might decrease the adjuvanticity, and thus the overall immunogenicity, of a tumor. Importantly, both MAGE-A3/A6 and HMGB1 have been demonstrated to induce autophagy (Pineda et al., 2015; Tang et al., 2010), which is necessary for efficient dendritic cell cross-presentation of tumor antigens (Li et al., 2008). Indeed, short-hairpin RNA (shRNA)-mediated knockdown of HMGB1 or essential components of autophagy can abrogate immunogenic cell death (Apetoh et al., 2007; Michaud et al., 2011). Furthermore, loss-of-function polymorphisms in HMGB1-binding receptors or HMGB1 loss from malignant cells associate with poor outcome in patients treated with chemotherapeutic agents known to induce immunogenic cell death (Ladoire et al., 2015) and even in melanoma patients treated with DC-based vaccines (Tittarelli et al., 2012). Consequently, disabling the emission of danger signals such as HMGB1 may allow Xq28-CGA-expressing melanomas to inhibit the initiation of an adaptive immune response and impede the efficacy of CTLA4 blockade. Careful dissection of the role of MAGE-A-HMGB1 interactions in mediating outcome to CTLA4 blockade unveils new strategies to improve clinical responses to ipilimumab, for example through combination with HMGB1 receptor agonists.
Although the statistical stringency was relaxed because of the small discovery cohort, the finding of Xq28-CGA gene upregulation in primary resistance to CTLA4 blockade was validated through confirmation in a prospective, independent cohort and technical verification by qPCR and immunohistochemistry. Because both CTLA4 blockade and cancer vaccines impact immune priming and memory formation, the results presented herein may also explain the long history of unsuccessful cancer vaccination efforts targeting MAGEA3 and MAGEA6 (Palucka and Banchereau, 2014; Pedicord et al., 2011; Saiag et al., 2016; Vansteenkiste et al., 2016). The results presented herein also indicate that mechanisms of response and resistance to immune priming (e.g. CTLA4 blockade) may differ substantially from those relevant to clinical manipulation of effector immunity (e.g. PD1/PD-L1 blockade). As immunotherapeutic combinations are increasingly evaluated, understanding these mechanisms is important for precisely pairing patients with appropriate combinations to avoid toxicity and ensure efficacy. Nevertheless, these findings are investigated in larger, prospective cohorts to evaluate these signatures as potential biomarkers of outcome, and studied in preclinical models as potential therapeutic targets to sensitize to or combine with CTLA4 blockade.
The following materials and methods were used in this example.
A previously reported RNA-seq dataset of pre-therapy samples collected from a study cohort of 40 melanoma patients treated with ipilimumab (Van Allen et al., 2015) was analyzed. In this study, RNA and genomic DNA were extracted from formalin-fixed, paraffin-embedded (FFPE) tumor blocks, and Illumina's TruSeq Stranded Total RNA Sample Prep Kit was used to generate RNA-seq libraries. Patient classification was maintained from the original report (Table 1). The “clinical benefit” (CB) group (n=13) was defined as patients who achieved complete or partial response by RECIST criteria, or stable disease by RECIST criteria with overall survival greater than one year. The “no benefit” (NB) group (n=22) was defined as patients who had progressive disease by RECIST criteria or stable disease with overall survival less than 1 year. A third group of five patients was described with early progression on ipilimumab (progression-free survival <6 months) but overall survival exceeding 2 years. To identify genes associated with clinical benefit and no benefit, the differential expression analysis between the CB and NB groups was performed. The association of Xq28-CGA expression with survival outcome was evaluated in the entire cohort. Genes were identified as differentially expressed when their median expression differed by more than two-fold with a nominal one-sided p-value≤0.05 (Wilcoxon test).
An independent, validation cohort comprised 41 patients from the CheckMate 064 trial (Weber et al., 2016) treated with ipilimumab followed by nivolumab (Table 1). The trial also studied in parallel a cohort comprising patients treated with the reverse sequence of nivolumab followed by ipilimumab. Overall survival could not be assessed in this crossover design. Response assessments, collected at week 13 before the planned switch, were used to classify patients into either no progressive disease (“No PD”; comprising stable disease, complete response and partial response, n=12) or progressive disease (“PD”; n=29) from each arm. Tumor samples were cryopreserved in RNALater. RNA-seq libraries were generated using the Stranded TruSeq method, and 75 bp paired-end reads for duplexed samples were sequenced per lane (Expression Analysis, Inc; Morrisville, N.C.). RNA-Seq and associated clinical data were available for the following Xq28-CGA genes: MAGEA3, MAGEA2, MAGEA2B, MAGEA12, MAGEA6.
Xq28-CGA expression was evaluated in patients from two different anti-PD1-treated cohorts. Anti-PD1 cohort 1 comprised 28 pre-anti-PD1-treated tumors (Hugo et al., 2016); anti-PD1 cohort 2 comprised 37 pre-treatment tumors from the nivolumab followed by ipilimumab arm of the CheckMate064 trial (Hugo et al., 2016; Weber et al., 2016) (Table 1).
465 melanoma samples from TCGA (Cancer Genome Atlas, 2015) were used to further investigate identified gene expression and methylation signatures.
RNA sequencing data from the discovery cohort was aligned to the reference human genome with STAR (Dobin et al., 2013), followed by removal of duplicates and quantification with RSEM (Li and Dewey, 2011). RNA sequencing data from the CheckMate064 trial was first aligned using STAR (Dobin et al., 2013) followed by removal of duplicate reads. Gene level quantification of the reads was performed with the htseq-count tool (Anders et al., 2015).
Whole exome data for 110 patients from the discovery cohort (including the 40 with transcriptomic data) (Van Allen et al., 2015) and Infinium 450K methylation chip data for 476 samples from TCGA (Cancer Genome Atlas, 2015) was also obtained.
Identification of Genes Associated with Xq28-CGA Expression in TCGA
A metagene was defined as one comprising the following Xq28-CGA genes: MAGEA2, MAGEA3, MAGEA6, MAGEA12, CSAG1, CSAG2, and CSAG3 (MAGEA2B was not quantified by TCGA). The expression of this metagene was defined as the geometric mean of its components and was computed for each of 465 TCGA melanoma samples. TCGA samples with expression values in the bottom and top quartiles for this metagene were classified into “Xq28-CGA-low” (n=117) and “Xq28-CGA-high” (n=116) groups respectively. An unbiased gene expression analysis between these two groups was performed using one-sided Wilcoxon tests with a false discovery rate (FDR) threshold of 0.05 and two-fold change threshold.
Expression of target genes in the discovery cohort (Van Allen et al., 2015) from RNA that was extracted for RNA-sequencing was validated. TaqMan gene expression assays (Applied Biosystems, Foster City, Calif.) was used and cDNA amplification was performed using the TaqMan Gene Expression Master Mix (Applied Biosystems) on an Applied Biosystems 7500HT Fast real-time polymerase chain reaction (PCR) System (10-minute enzyme activation and 40 cycles of 15 s at 95° C., 1 minute at 60° C.). Samples were measured in duplicate; “undetermined” values were assigned a cycle threshold (Ct) of 40. HPRT1, GAPDH, and PGK1 were used as housekeeping genes to calculate relative expression values according to the delta-Ct method.
Level3 Infinium 450K methylation chip data was retrieved from TCGA for “Xq28-CGA-low” (n=117) and “Xq28-CGA-high” (n=116) groups. A probe-level comparison was performed between the two groups using Wilcoxon tests with an FDR of 0.05 for all 485,577 CpG probes. A probe with higher median beta values in one group was considered relatively hypermethylated in that group compared to the other.
The clinical benefit (CB) and no benefit (NB) groups were tested for variations in germline and somatic CNVs in Xq28 locus using GATK 4 target coverage denoising and ACNV pipelines. Raw coverage on whole exome Agilent targets for 110 normal and tumor samples was collected and GC bias was corrected for. The 40 samples with RNA-seq data used in this study were set aside and the remaining 70 samples were used to learn the target coverage bias profile (“panel of normals”). Then, the coverage profile of samples used in this study were denoised and normalized using the obtained panel of normals. Tumor samples with anomalously low signal-to-noise ratio and normal samples with significant contamination were detected and excluded from the analysis. Empirical distributions of raw copy ratios on all 16 Agilent targets in the Xq28 locus were calculated using an agnostic prior distribution and copy ratio likelihoods for each sample. Absolute copy ratios with respect to diploid were estimated by performing allelic CNV analysis, detecting copy neutral autosomal intervals, and normalizing the raw copy ratios accordingly.
The two groups were tested for germline and somatic copy number variations in the Xq28 locus using the two-sample KS test. The test was performed separately for each target, and for the copy ratio average on all 16 targets in the Xq28 locus. The copy ratio distributions in each case were identified via empirical bootstrap.
Genomic DNA samples of male patients was bisulfite-treated (EZ DNA Methylation-Gold™ Kit, Zymo Research) and individual amplicons were amplified via PCR (using TaKaRa EpiTaq™ HS, Clonetech). The following primer pairs were used: MAGEA3, MAGEA6 and MAGEA12 gene body, Forward Primer: GATTGTGTTTTTGAGGAGAAAATTT (SEQ ID NO: 206), Reverse Primer: CTCCCACTAACCCTAACTACAACTC (SEQ ID NO: 207). MAGEA3 and MAGEA6 gene promoter, Forward Primer: AATTTTAGGATTTTGAGGGATGAT (SEQ ID NO: 208), Reverse Primer: AAACCCTCTATCTAAAATAAAACCC (SEQ ID NO: 209). PCR products were subcloned (One Shot® TOP10 Chemically Competent E. coli, NEB) and individual colonies were sequenced for subsequent methylation analysis. For the local regression analysis (R package ‘msir’) the span smoothing parameter for loess was set to 0.4.
All specimens were evaluated by conventional histopathology. Antibodies used for IHC and IF included mouse anti-MAGE antibody (6C1; Santa Cruz Biotechnology, San Diego, Calif. USA) and rabbit anti-HMGB1 antibody (ab18256; Abcam, Cambridge, Mass.). Immunohistochemistry was performed with pressure cooker heat-induced epitope retrieval on 4-mm-thick sections prepared from formalin-fixed, paraffin-embedded tissues. In addition to detection of biomarker antibodies by use of chromogen vector NovaRed peroxidase substrate (Vector laboratory, Burlingame, Calif., USA), selected samples were evaluated by a dual labeling approach by combining NovaRed with a blue chromogen vector Blue AP substrate (Vector laboratory). Positive and negative tissue controls and isotype-specific irrelevant antibody controls were used to ensure specificity. Consistent with other reports of IHC for MAGE-A protein, nuclear and/or cytoplasmic staining was interpreted as a positive staining pattern; staining in any cancer cells, irrespective of percentage of positive cells or intensity, was regarded as positive.
Dual-labeling immunoflourescence was performed to complement immunohistochemistry as a means of two-channel identification of epitopes co-expressed in similar or overlapping sub-cellular locations. Briefly, 4-mm-thick paraffin sections were incubated with 1:100 mouse anti-MAGE antibody+1:1000 rabbit anti-HMGB1 antibody at 4° C. overnight and then incubated with 1:2000 Alexa Fluor 594-conjugated anti-mouse IgG and Alexa Fluor 488-conjugated anti-rabbit IgG (Invitrogen) at room temperature for 1 hour. The sections were cover slipped with ProLong Gold anti-fade with DAPI (Invitrogen). Sections were analyzed with a BX51/BX52 microscope (Olympus America, Melville, N.Y., USA), and images were captured using the CytoVision 3.6 software (Applied Imaging, San Jose, Calif., USA). Single label immunofluorescence was also performed using isotype-specific irrelevant primary antibodies and with switching of the secondary antibodies to ensure specificity and exclude cross reactivity.
The association of Xq28-CGA expression with overall survival was evaluated using the Kaplan-Meier method. In the discovery cohort, patients with Xq28-CGA expression values above the median were considered “high” and below the median were considered “low.” The effect of Xq28-CGA expression on overall survival adjusting for age, gender, number of pre-therapies, M-stage, LDH and neoantigen load was assessed using the Cox proportional hazards model.
Differential expression and methylation analyses within TCGA samples were performed using a false discovery rate (Benjamini-Hochberg) of 0.05. Hypergeometric tests were used to evaluate overlap of differentially expressed genes between the clinical and TCGA cohorts. Multivariable survival analysis was performed using the Cox proportional hazards model (R package ‘coxph’). All statistical analyses were done using R version-3.2.5. Overlaps of gene lists with pathways in the PANTHER (Protein ANalysis THrough Evolutionary Relationships) database (containing 177 pathways) were evaluated with the overrepresentation test using the Bonferroni correction (Mi et al., 2016).
indicates data missing or illegible when filed
indicates data missing or illegible when filed
The following references were cited in this specification.
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. All United States patents and published or unpublished United States patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are hereby incorporated by reference. Genbank and NCBI submissions indicated by accession number cited herein are hereby incorporated by reference. All other published references, documents, manuscripts and scientific literature cited herein are hereby incorporated by reference.
While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.
This application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62/407,591, filed Oct. 13, 2016, and to U.S. Provisional Application No. 62/565,411, filed Sep. 29, 2017, each of which is incorporated herein by reference in its entirety.
This invention was made with government support under grant number 1R01CA182461-01 awarded by the National Cancer Institute, under grant number 1R01CA184922-02 awarded by the National Cancer Institute, under grant number R50RCA211482A awarded by the National Cancer Institute, and under grant number 1R01CA155010-05 awarded by the National Cancer Institute. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2017/056599 | 10/13/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62407591 | Oct 2016 | US | |
| 62565411 | Sep 2017 | US |
