Patent Application
20210346328
Provided herein are methods of treating, delaying progression of, or reducing the severity of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells through administration of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, such administration results in one or more of the following: inhibited or reduced COX-2 expression; inhibited or reduced PGE2 expression; inhibited or reduced EP4 expression; inhibited or reduced aberrant subchondral bone remodeling and/or innervation; inhibited or reduced cartilage degeneration; and inhibited or reduced joint destruction.
Arthritis is a joint disorder that affects 1 or more joints. Osteoarthritis (OA) and rheumatoid arthritis (RA) are the 2 most common forms of arthritis. OA is characterized mainly by joint pain and stiffness, especially affecting the weightbearing joints, such as the knee and hip (see, Busija, L., et al. Clinical rheumatology 24, 757-768 (2010)). Muscle atrophy and joint deformities appear during the advanced stages (see, Buckwalter, J. A. & Martin, J. A. Osteoarthritis. Advanced drug delivery reviews 58, 150-167 (2006)). RA is an autoimmune disease involving chronic synovial inflammation within the joints. Approximately 0.5% to 1% of the population has RA, and small joints are more frequently affected than large joints (see, Smolen, J. S., Aletaha, D. & McInnes, I. B. Rheumatoid arthritis. The Lancet 388, 2023-2038 (2016)). RA is characterized by increased levels of inflammatory cytokines in the synovial joints, including tumor necrosis factor-α (TNF-α), interleukin-6, and interleukin-1 (see, McInnes, I. B. & Schett, G. The New England journal of medicine 365, 2205-2219 (2011)). Currently, arthritis treatment focuses on controlling the symptoms, especially pain; there is no satisfactory prevention or cure. During the end stages of OA and RA, joint replacement is often necessary (see, Smolen, J. S., Aletaha, D. & McInnes, I. B. The Lancet 388, 2023-2038 (2016); Glyn-Jones, S., et al. The Lancet 386, 376-387 (2015)). OA is a costly and prevalent joint disease. OA is predicted to affect 67 million people in the United States by 2030 (see, Sampson, E. R., et al. Science translational medicine 3, 101ra193 (2011)), and in developed countries, its treatment costs between 1.0% and 2.5% of gross domestic product (see, Hiligsmann, M., et al. Seminars in arthritis and rheumatism 43, 303-313 (2013)).
Thus, there is a critical need for improved treatments for arthritis.
The present invention addresses this need.
Clinically, many arthritis patients have joint pain and degeneration with no history of trauma or other known cause. Some patients show clear genetic correlations through family history of the disease (see, van Meurs, J. B. Osteoarthritis and cartilage 25, 181-189 (2017)). There has been a major effort to identify potential genetic risk factors for arthritis (see, Styrkarsdottir, U., et al. Nat Genet 49, 801-805 (2017); Evangelou, E., et al. Annals of the rheumatic diseases 73, 2130-2136 (2014); Liu, Y., et al. J Rheumatol 44, 1652-1658 (2017); Valdes, A. M., et al. American journal of human genetics 82, 1231-1240 (2008)). Studying spontaneous OA in animals offers a unique opportunity to identify the factors that may cause joint degeneration. STR/Ort mice are an inbred substrain of STR/N mice (see, Staines, K. A., et al., Osteoarthritis and cartilage 25, 802-808 (2017)). The origin of STR/Ort mice can be traced to 1951, when they were originally established from the NHO strain through 3-methylcholanthrene injection between the F4 and F27 generations (see, Mason, R. M., et al. Osteoarthritis and cartilage 9, 85-91 (2001)). The substrain of STR/Ort mice was developed from the STR/1N strain after initiating inbreeding following a period of non-inbreeding (see, Mason, R. M., et al. Osteoarthritis and cartilage 9, 85-91 (2001)). Notably, the STR/Ort strain is prone to develop OA, which is characterized by subchondral bone sclerosis, osteophyte formation, and articular cartilage degeneration (see, Staines, K. A., et al., Osteoarthritis and cartilage 25, 802-808 (2017). It is worth mentioning that male mice have a higher incidence of OA than female mice (see, Staines, K. A., et al., Osteoarthritis and cartilage 25, 802-808 (2017). Histological lesions of STR/Ort mice closely resemble those of human OA. Previous studies have shown that OA lesions often develop in the medial tibia plateau of the knee joint, rather than the lateral plateau (see, Staines, K. A., et al., Osteoarthritis and cartilage 25, 802-808 (2017). Thus, STR/Ort mice are a promising model of spontaneous OA to study the genetic factors involved in OA.
Sensory nerves are innervated in peripheral tissues, including skin, joint, respiratory, and gastrointestinal tissues, to sense stimuli inside or outside the body, such as pain, temperature, odors, and tastes (see, Pinho-Ribeiro, et al., Trends Immunol 38, 5-19 (2017); Snyder, D. J. & Bartoshuk, L. M. Rev Endocr Metab Disord 17, 149-158 (2016)). The signals collected from sensory nerve endings are processed in the central nervous system to initiate physiological responses. Bone is the largest organ, accounting for more than 80% of body weight. Bone is also an endocrine organ that regulates calcium and mineral metabolism, glucose, fatty acids, and even cancer metastasis by interacting with other tissues (see, Kushwaha, P., et al., Bone, (2017); Engblom, C. et al. Science 358 (2017); Karner, C. M. & Long, F. Bone (2017)). The skeleton has abundant sensory and sympathetic innervations (see, Serre, C. M., et al., Bone 25, 623-629 (1999); Mach, D. B. et al. Neuroscience 113, 155-166 (2002); Hara-Irie, F., et al., Bone 18, 29-39 (1996); Chenu, C. J Musculoskelet Neuronal Interact 4, 132-134 (2004)) and interacts with the central nervous system (see, Oury, F. et al. Genes Dev. 24, 2330-2342, doi:10.1101/gad.1977210 (2010); Ducy, P. et al. Cell 100, 197-207 (2000)). Sympathetic nerves induce catabolic activity in bone through serotonin and cAMP-response element binding protein (CREB) signaling in the hypothalamus (see, Oury, F. et al. Genes Dev. 24, 2330-2342 (2010); Yadav, V. K. et al. Cell 138, 976-989 (2009); Ortuno, M. J. et al. Nat. Med. 22, 1170-1179 (2016)). Specific deletion of sensory nerves in bone impairs bone mass accrual (see, Fukuda, T. et al. Nature 497, 490-493 (2013); Levi, B. Sci Transl Med 9, doi:10.1126/scitranslmed.aan3780 (2017)). Patients with sensory nerve malfunction or loss have an increased bone fracture rate and significantly diminished post-injury bone regeneration (see, Perez-Lopez, L. M., et al., Case Rep Pediatr 2015, 589852; Bar-On, E. et al. J. Bone Joint Surg. Br. 84, 252-257 (2002)). These observations indicate that sensory nerves sense changes in bone density, mechanical stress, and metabolic activity to control bone homeostasis.
Experiments conducted during the course of developing embodiments for the present invention hypothesized the existence of one or more molecules that transmit signals of changes in bone to sensory nerve fibers. Cyclooxygenase activity and prostaglandins are known to mediate skeletal metabolism and inflammation (see, Blackwell, K. A., et al., Trends Endocrinol Metab 21, 294-301 (2010); Bley, K. R., et al., Trends Pharmacol. Sci. 19, 141-147 (1998)). Among prostaglandins, prostaglandin E2 (PGE2) is a multifunctional molecule whose production is controlled by the limiting enzyme cyclooxygenase (COX) (see, Blackwell, K. A., et al., Trends Endocrinol Metab 21, 294-301 (2010)). Evidence shows that PGE2 can elicit primary pain and prolong nociceptor sensitization (see, Kawabata, A. Biol. Pharm. Bull. 34, 1170-1173 (2011); Kuner, R. Nat. Med. 16, 1258-1266, doi:10.1038/nm.2231 (2010)). Non-steroidal anti-inflammatory drugs and COX2 selective inhibitors are the current major medications to treat musculoskeletal pain (see, O'Connor, J. P. & Lysz, T. Drugs Today (Barc) 44, 693-709 (2008)). A multicenter study revealed that COX2 selective inhibitor is associated with lower bone mineral density (BMD) in men; whereas, in postmenopausal women it promotes BMD (see, Salari, P. & Abdollahi, M. Inflamm Allergy Drug Targets 8, 169-175 (2009)), implicating PGE2 in the regulation of bone.
The 15-hydroxyprostaglandin dehydrogenase gene (HPGD) encodes a NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (15-PGDH), which catalyzes PGE2. Mutation of this gene impairs the degradation of PGE2 (see, Uppal, S. et al. Nat. Genet. 40, 789-793 (2008)). HPGD mutant mice showed an increased PGE2 level in vivo, which can effectively promote regeneration in different tissues (see, Zhang, Y. et al. Science 348, aaa2340 (2015); Coggins, K. G. et al. Nat. Med. 8, 91-92 (2002); Myung, S. J. et al. Proc. Natl. Acad. Sci. U. S. A. 103, 12098-12102 (2006)). Interestingly, patients with HPGD mutation have presented with subperiosteal new bone formation (see,Yuksel-Konuk, B. et al. Rheumatol. Int. 30, 39-43 (2009)). PGE2 is also potent in stimulating bone formation, and its bone anabolic effect is believed to be through its receptor EP4 in the osteoblasts (see, Blackwell, K. A., et al., Trends Endocrinol Metab 21, 294-301 (2010); Raisz, L. G. & Woodiel, F. N. Prostaglandins Other Lipid Mediat. 71, 287-292 (2003); Minamizaki, T., eta al., Bone 44, 1177-1185 (2009)). However, conditional knockout of the prostaglandin E receptor 4 gene (EP4) in osteoblastic cells did not impair bone density, implying that the bone formation effect of PGE2 does not act through osteoblasts (see, Gao, Q. et al. Bone 45, 98-103 (2009)). In pathological conditions of bone loss during aging or after menopause, the impaired function of sensory nerves and elevated PGE2 level appear simultaneously (see, Burt-Pichat, B. et al. Endocrinology 146, 503-510 (2005); Strotmeyer, E. S. et al. J. Bone Miner. Res. 21, 1803-1810 (2006)). Thus, PGE2-induced pain may reflect its activation of sensory nerves to transmit a “signal” of bone density to maintain bone homeostasis.
Cyclooxygenase-2 (COX-2) inhibitors selectively block the COX-2 enzyme and have been used for treating OA and RA with low risk of adverse gastrointestinal effects (see, Steinmeyer, J. & Konttinen, Y. T. Advanced drug delivery reviews 58, 168-211 (2006)). As noted, blocking this enzyme impedes the production of prostaglandin (PG) E2, which is often the cause of pain and swelling of inflammation (see, Crofford, L. J., et al. Arthritis & Rheumatism 43, 4-13 (2000)). PGs are enzymatically derived metabolites of polyunsaturated fatty acids, such as arachidonic acid. As the most widely produced prostanoid in the human body, PGE2 is a well-known regulator of bone formation (see, Blackwell, K. A., et al., Trends in endocrinology and metabolism: TEM 21, 294-301 (2010)). The crucial limiting step during PGE2 synthesis is the enzyme that catalyzes cyclooxygenase (COX) and peroxidase reactions. There are 2 isoforms of COX: COX-1 is expressed at relatively stable levels in most tissues and is considered “constitutive,” whereas COX-2 is an inducible isoform that is generally expressed at very low levels in most tissues but can be induced to high levels by multiple factors (see, Crofford, L. J., et al. Arthritis & Rheumatism 43, 4-13 (2000)). COX-2 is more efficient at producing PGs than is COX-1 (see, Blackwell, K. A., Raisz, L. G. & Pilbeam, C. C. Trends in endocrinology and metabolism: TEM 21, 294-301 (2010)).
Experiments conducted during the course of development embodiments for the present invention demonstrated that genetically elevated COX-2 expression in the osteocytes of subchondral bone causes both spontaneous OA and rheumatoid arthritis (RA). It was determined that knockout of COX-2 in osteocytes or COX-2 inhibitor treatment effectively rescued the structure of subchondral bone and attenuate cartilage degeneration in spontaneous OA (STR/Ort) and tumor necrosis factor-a transgenic RA. Thus, it was determined that genetically elevated COX-2 expression in subchondral bone induces both OA- and RA-associated joint cartilage degeneration. Inhibition of COX-2 expression could potentially modify joint destruction in patients with arthritis.
Additional experiments investigated whether sensory nerve can sense bone density, metabolic activity, or mechanical stress to control bone homeostasis. It was found that prostaglandin E2 (PGE2) secreted by osteoblastic cells activates PGE2 receptor 4 (EP4) in sensory nerves to regulate bone formation by inhibiting sympathetic activity through the central nervous system. PGE2 secreted by osteoblasts increases when bone density decreases, as demonstrated in osteoporotic and aging animal models. Ablation of sensory nerves erodes the skeletal integrity in two sensory denervation mouse models (TrkAAvil−/−and iDTRAvilfl/−). Specifically, knockout of the EP4 gene in the sensory nerves (EP4Avil−/−) or cyclooxygenase-2 (COX2) (the rate-limiting enzyme for production of PGE2) in the osteoblastic cells (COX2OC−/−) significantly reduced bone volume in adult mice but not young mice during bone development. Sympathetic tone was increased in these two sensory denervation models, and propranolol, a β2-adrenergic antagonist, rescued the bone loss. Furthermore, injection of an inhibitor (SW033291) of PGE2 degradation enzyme 15-hydroxyprostaglandin dehydrogenase (15-PDGH) significantly boosted bone formation, whereas the effect was obstructed in EP4Avil−/− mice. Thus, such experiments demonstrated that PGE2 mediates sensory nerve to control bone homeostasis and promote regeneration.
Additional experiments determined that treatment of OA with COX-2 inhibitors is optimized with different dosage regimens than when used for pain management. For example, it was determined that effective OA treatment was observed with a COX-2 inhibitor dosage regimen of 8 mg/kg for 4 weeks. Quite the contrary, for pain management, COX-2 inhibitor dosage regimen is typically 30 mg/kg for one or two weeks are used. In brief, COX-2 inhibitor celecoxib was gavage fed at different dosages once a day for 4 weeks. Proteoglycan loss and calcification of articular cartilage were effectively attenuated by 8 mg/kg of COX-2 inhibitor in STR/Ort mice relative to controls, as indicated by safranin O and fast green staining; the OARSI score for articular cartilage also improved significantly.
Accordingly, in certain embodiments, the present invention provides methods of treating, delaying progression of, or reducing the severity of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells, the method comprising administering to a subject in need thereof a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, such administration results in one or more of the following: inhibited or reduced COX-2 expression; inhibited or reduced PGE2 expression; inhibited or reduced EP4 expression; inhibited or reduced aberrant subchondral bone remodeling and/or innervation;
inhibited or reduced cartilage degeneration; and inhibited or reduced joint destruction.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing COX-2 expression in bone cells comprising exposing bone cells characterized with increased COX-2 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing PGE2 expression in bone cells comprising exposing bone cells characterized with increased PGE2 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing EP4 expression in bone cells comprising exposing bone cells characterized with increased EP4 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing aberrant subchondral bone remodeling and/or innervation in bone cells comprising exposing bone cells characterized with aberrant subchondral bone remodeling and/or innervation a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing joint cell destruction in bone cells comprising exposing bone cells characterized with joint destruction a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing COX-2 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing PGE2 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing EP4 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing aberrant subchondral bone remodeling and/or innervation within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing joint destruction within any setting (e.g., in vitro, in vivo, in silico).
Such methods are not limited to particular types or kinds of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells. In some embodiments, such metabolic disorders include osteoarthritis (OA), rheumatoid arthritis (RA), cardiovascular disease, and diabetes.
Such methods are not limited to particular types or kinds of agents configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In some embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is a COX-2 inhibiting agent. Non-limiting examples of COX-2 inhibitors that may be used in such methods include celecoxib, rofecoxib, meloxicam, piroxicam, deracoxib, parecoxib, valdecoxib, etoricoxib, a chromene derivative, a chroman derivative, N-(2-cyclohexyloxynitrophenyl)methane sulfonamide, COX189, ABT963, JTE-522, aspirin, acetaminophen, ibuprofen, flurbiprofen, ketoprofen, naproxen, oxaprozin, etodolac, indomethacin, ketorolac, lornoxicam, nabumetone, and diclofenac, as well as pharmaceutically acceptable salts of each, pharmaceutically acceptable derivatives of each, prodrugs of each, or mixtures thereof.
Such methods are not limited to a specific meaning for a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells comprises administering approximately 8 mg/kg (e.g., 4 mg/kg, 4.5 mg/kg, 4.6 mg/kg, 5 mg/kg, 5.1 mg/kg, 5.5 mg/kg, 5.76 mg/kg, 5.9 mg/kg, 6.2 mg/kg, 6.5 mg/kg, 6.8 mg/kg, 7.2 mg/kg, 7.4 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 7.98 mg/kg, 8.0001 mg/kg, 8.2 mg/kg, 8.4 mg/kg, 8.42 mg/kg, 8.5 mg/kg, 8.8 mg/kg, 9 mg/kg, 9.2 mg/kg, 9.8 mg/kg, 9.9999 mg/kg, 10.2 mg/kg, 10.31 mg/kg, 10.5 mg/kg, 11 mg/kg, 11.3 mg/kg, 11.8 mg/kg, 12.2 mg/kg, 12.999 mg/kg) for approximately 4 weeks (e.g., 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days).
Such methods are not limited to specific bone related cells. In some embodiments, the bone related cells include osteoblast cells, osteocyte cells, and osteoclast cells. In some embodiments, the bone related cells include any bone cells having aberrant COX-2 expression, and/or PGE2 expression, and/or EP4 expression.
In some embodiments, the subject is a mammalian subject (e.g., mouse, horse, human, cat, dog, gorilla, chimpanzee, etc.). In some embodiments, the subject is a human patient suffering from or at risk of suffering from a metabolic disorder characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells.
The present invention contemplates that reducing or inhibiting overexpression of COX-2, PGE-2, and/or EP4 within bone cells satisfies an unmet need for the treatment of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells. Indeed, use of COX-2 inhibiting agents at dosage regimen of approximately 8 mg/kg for approximately 4 weeks represents a marked change for the use of COX-2 inhibiting agents presently used for pain management.
In some embodiments, the agent is formulated to be administered locally. In some embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is formulated to be administered systemically, intravenously, intraarterially, subcutaneously, or intrathecally.
In certain embodiments of the invention, combination treatment with the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells and a course of a drug known for treating metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells (e.g., a drug known for treating OA; a drug known for treating RA; a drug known for treating CVS; a drug known for treating diabetes).
The invention also provides pharmaceutical compositions comprising the agent in a pharmaceutically acceptable carrier.
The invention also provides kits comprising one or more agents configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells (e.g., agents sufficient to interfere with central nervous system related NK levels and function) and instructions for administering the agent to an animal. The kits may optionally contain one or more other therapeutic agents.
Figure. 5. Osteoblastic bone formation is blunted after sensory denervation. a Representative images of immunofluorescence staining and quantitative analysis of the CGRP+ sensory nerves in the femurs of 8-week-old iDTRAvil+/− mice injected with vehicle or 1 ug per kg per day DTX 3 time a week for four consecutive weeks. Scale bar: 100 μm. b Representative μCT images of femurs from iDTRAvil+/− mice injected with vehicle or DTX. Quantitative analysis of trabecular bone fraction and trabecular number. Scale bar: 1 mm. c Histomorphological analysis of the osteoblast (N.Ob/B.Pm) and osteoclast (N.Oc/B.Pm) numbers on the trabecular bone surface of femurs of iDTRAvil+/− mice injected with vehicle or DTX. d Representative trichrome staining and quantitative analysis of OS/BS in femoral bone tissue from iDTRAvil+/− mice injected with vehicle or DTX. Scale bar, 50 μm. e ELISA analysis of serum OCN and CTX levels in iDTRAvil+/− mice injected with vehicle or DTX. f Representative images of calcein double labeling of femoral trabecular bone with quantification of MAR and BFR in iDTRAvil+/− mice injected with vehicle or DTX. Scale bar, 20 μm. g Representative images of immunofluorescence staining and quantitative analysis of the CGRP+ sensory nerves (green) in the vertebra of iDTRAvil+/− mice injected with vehicle or DTX. DAPI stains nuclei blue. Scale bar: 100 μm. h Representative μCT images of vertebrae from iDTRAvil+/− mice injected with vehicle or DTX. Quantitative analysis of trabecular bone fraction (Tb. BV/TV) and trabecular number (Tb. N). Scale bar: 1 mm. i Histomorphological analysis of osteoblast (N.Ob/B.Pm) numbers on the trabecular bone surface of 12-week-old TrkAwt and TrkAAvil−/− mice vertebra. N≥5 per group. *P<0.05, **P<0.01 and N.S. means not significant. (Student t-test)
means not significant. (Student t-test)
Experiments conducted during the course of development embodiments for the present invention demonstrated that genetically elevated COX-2 expression in the osteocytes of subchondral bone causes both spontaneous OA and rheumatoid arthritis (RA). It was determined that knockout of COX-2 in osteocytes or COX-2 inhibitor treatment effectively rescued the structure of subchondral bone and attenuate cartilage degeneration in spontaneous OA (STR/Ort) and tumor necrosis factor-a transgenic RA. Thus, it was determined that genetically elevated COX-2 expression in subchondral bone induces both OA- and RA-associated joint cartilage degeneration. Inhibition of COX-2 expression could potentially modify joint destruction in patients with arthritis.
Additional experiments investigated whether sensory nerve can sense bone density, metabolic activity, or mechanical stress to control bone homeostasis. It was found that prostaglandin E2 (PGE2) secreted by osteoblastic cells activates PGE2 receptor 4 (EP4) in sensory nerves to regulate bone formation by inhibiting sympathetic activity through the central nervous system. PGE2 secreted by osteoblasts increases when bone density decreases, as demonstrated in osteoporotic and aging animal models. Ablation of sensory nerves erodes the skeletal integrity in two sensory denervation mouse models (TrkAAvil−/− and iDTRAvilfl/−). Specifically, knockout of the EP4 gene in the sensory nerves (EP4Avil−/−) or cyclooxygenase-2 (COX2) (the rate-limiting enzyme for production of PGE2) in the osteoblastic cells (COX2OC−/−) significantly reduced bone volume in adult mice but not young mice during bone development. Sympathetic tone was increased in these two sensory denervation models, and propranolol, a β2-adrenergic antagonist, rescued the bone loss. Furthermore, injection of an inhibitor (SW033291) of PGE2 degradation enzyme 15-hydroxyprostaglandin dehydrogenase (15-PDGH) significantly boosted bone formation, whereas the effect was obstructed in EP4Avil−/− mice. Thus, such experiments demonstrated that PGE2 mediates sensory nerve to control bone homeostasis and promote regeneration.
Additional experiments determined that treatment of OA with COX-2 inhibitors is optimized with different dosage regimens than when used for pain management. For example, it was determined that effective OA treatment was observed with a COX-2 inhibitor dosage regimen of 8 mg/kg for 4 weeks. Quite the contrary, for pain management, COX-2 inhibitor dosage regimen is typically 30 mg/kg for one or two weeks are used. In brief, COX-2 inhibitor celecoxib was gavage fed at different dosages once a day for 4 weeks. Proteoglycan loss and calcification of articular cartilage were effectively attenuated by 8 mg/kg of COX-2 inhibitor in STR/Ort mice relative to controls, as indicated by safranin O and fast green staining; the OARSI score for articular cartilage also improved significantly.
Accordingly, provided herein are methods of treating, delaying progression of, or reducing the severity of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells through administration of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, such administration results in one or more of the following: inhibited or reduced COX-2 expression; inhibited or reduced PGE2 expression; inhibited or reduced EP4 expression; inhibited or reduced aberrant subchondral bone remodeling and/or innervation; inhibited or reduced cartilage degeneration; and inhibited or reduced joint destruction.
Accordingly, in certain embodiments, the present invention provides methods of treating, delaying progression of, or reducing the severity of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells, the method comprising administering to a subject in need thereof a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, such administration results in one or more of the following: inhibited or reduced COX-2 expression; inhibited or reduced PGE2 expression; inhibited or reduced EP4 expression; inhibited or reduced aberrant subchondral bone remodeling and/or innervation; inhibited or reduced cartilage degeneration; and inhibited or reduced joint destruction.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing COX-2 expression in bone cells comprising exposing bone cells characterized with increased COX-2 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing PGE2 expression in bone cells comprising exposing bone cells characterized with increased PGE2 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing EP4 expression in bone cells comprising exposing bone cells characterized with increased EP4 expression (compared to an established normal expression level) a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing aberrant subchondral bone remodeling and/or innervation in bone cells comprising exposing bone cells characterized with aberrant subchondral bone remodeling and/or innervation a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the present invention provides methods of inhibiting and/or reducing joint cell destruction in bone cells comprising exposing bone cells characterized with joint destruction a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing COX-2 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing PGE2 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing EP4 expression within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing aberrant subchondral bone remodeling and/or innervation within any setting (e.g., in vitro, in vivo, in silico).
In certain embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is administered for purposes of reducing joint destruction within any setting (e.g., in vitro, in vivo, in silico).
Such methods are not limited to particular types or kinds of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells. In some embodiments, such metabolic disorders include osteoarthritis (OA), rheumatoid arthritis (RA), cardiovascular disease, and diabetes.
Such methods are not limited to particular types or kinds of agents configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells.
In some embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is a COX-2 inhibiting agent. Non-limiting examples of COX-2 inhibitors that may be used in such methods include celecoxib, rofecoxib, meloxicam, piroxicam, deracoxib, parecoxib, valdecoxib, etoricoxib, a chromene derivative, a chroman derivative, N-(2-cyclohexyloxynitrophenyl)methane sulfonamide, COX189, ABT963, JTE-522, aspirin, acetaminophen, ibuprofen, flurbiprofen, ketoprofen, naproxen, oxaprozin, etodolac, indomethacin, ketorolac, lornoxicam, nabumetone, and diclofenac, as well as pharmaceutically acceptable salts of each, pharmaceutically acceptable derivatives of each, prodrugs of each, or mixtures thereof.
Such methods are not limited to a specific meaning for a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells. In some embodiments, a therapeutically effective amount of an agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells comprises administering approximately 8 mg/kg for approximately 4 weeks.
Such methods are not limited to specific bone related cells. In some embodiments, the bone related cells include osteoblast cells, osteocyte cells, and osteoclast cells. In some embodiments, the bone related cells include any bone cells having aberrant COX-2 expression, and/or PGE2 expression, and/or EP4 expression.
In some embodiments, the subject is a mammalian subject (e.g., mouse, horse, human, cat, dog, gorilla, chimpanzee, etc.). In some embodiments, the subject is a human patient suffering from or at risk of suffering from a metabolic disorder characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells.
The present invention contemplates that reducing or inhibiting overexpression of COX-2, PGE-2, and/or EP4 within bone cells satisfies an unmet need for the treatment of metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells. Indeed, use of COX-2 inhibiting agents at dosage regimen of approximately 8 mg/kg for approximately 4 weeks represents a marked change for the use of COX-2 inhibiting agents presently used for pain management.
In some embodiments, the agent is formulated to be administered locally. In some embodiments, the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells is formulated to be administered systemically, intravenously, intraarterially, subcutaneously, or intrathecally.
In certain embodiments of the invention, combination treatment with the agent configured to inhibit and/or diminish COX-2 expression, and/or PGE2 expression, and/or EP4 expression in bone related cells and a course of a drug known for treating metabolic disorders characterized with increased COX-2 expression and/or PGE2 expression and/or EP4 expression in bone related cells.
In addition to administering the agent is administered as a raw chemical, the compounds of the invention may be administered as part of a pharmaceutical preparation containing suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the compounds into preparations which can be used pharmaceutically. The preparations, particularly those preparations which can be administered orally or topically and which can be used for one type of administration, such as tablets, dragees, slow release lozenges and capsules, mouth rinses and mouth washes, gels, liquid suspensions, hair rinses, hair gels, shampoos and also preparations which can be administered rectally, such as suppositories, as well as suitable solutions for administration by intravenous infusion, injection, topically or orally, contain from about 0.01 to 99 percent, in one embodiment from about 0.25 to 75 percent of active compound(s), together with the excipient.
The pharmaceutical compositions of the invention may be administered to any patient which may experience the beneficial effects of the compounds of the invention. Foremost among such patients are mammals, e.g., humans, although the invention is not intended to be so limited. Other patients include veterinary animals (cows, sheep, pigs, horses, dogs, cats and the like).
The agents (e.g., COX-2 inhibitors) and pharmaceutical compositions thereof may be administered by any means that achieve their intended purpose. For example, administration may be by parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, buccal, intrathecal, intracranial, intranasal or topical routes. Alternatively, or concurrently, administration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
The pharmaceutical preparations of the present invention are manufactured in a manner which is itself known, for example, by means of conventional mixing, granulating, dragee-making, dissolving, or lyophilizing processes. Thus, pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipients, optionally grinding the resulting mixture and processing the mixture of granules, after adding suitable auxiliaries, if desired or necessary, to obtain tablets or dragee cores.
Suitable excipients are, in particular, fillers such as saccharides, for example lactose or sucrose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate, as well as binders such as starch paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or polyvinyl pyrrolidone. If desired, disintegrating agents may be added such as the above-mentioned starches and also carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Auxiliaries are, above all, flow-regulating agents and lubricants, for example, silica, talc, stearic acid or salts thereof, such as magnesium stearate or calcium stearate, and/or polyethylene glycol. Dragee cores are provided with suitable coatings which, if desired, are resistant to gastric juices. For this purpose, concentrated saccharide solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, polyethylene glycol and/or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. In order to produce coatings resistant to gastric juices, solutions of suitable cellulose preparations such as acetylcellulose phthalate or hydroxypropylmethyl-cellulose phthalate, are used. Dye stuffs or pigments may be added to the tablets or dragee coatings, for example, for identification or in order to characterize combinations of active compound doses.
Other pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol. The push-fit capsules can contain the active compounds in the form of granules which may be mixed with fillers such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds are in one embodiment dissolved or suspended in suitable liquids, such as fatty oils, or liquid paraffin. In addition, stabilizers may be added.
Possible pharmaceutical preparations which can be used rectally include, for example, suppositories, which consist of a combination of one or more of the active compounds with a suppository base. Suitable suppository bases are, for example, natural or synthetic triglycerides, or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the active compounds with a base. Possible base materials include, for example, liquid triglycerides, polyethylene glycols, or paraffin hydrocarbons.
Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts and alkaline solutions. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides or polyethylene glycol-400. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers.
The topical compositions of this invention are formulated in one embodiment as oils, creams, lotions, ointments and the like by choice of appropriate carriers. Suitable carriers include vegetable or mineral oils, white petrolatum (white soft paraffin), branched chain fats or oils, animal fats and high molecular weight alcohol (greater than C12). The carriers may be those in which the active ingredient is soluble. Emulsifiers, stabilizers, humectants and antioxidants may also be included as well as agents imparting color or fragrance, if desired. Additionally, transdermal penetration enhancers can be employed in these topical formulations. Examples of such enhancers can be found in U.S. Pat. Nos. 3,989,816 and 4,444,762; each herein incorporated by reference in its entirety.
Ointments may be formulated by mixing a solution of the active ingredient in a vegetable oil such as almond oil with warm soft paraffin and allowing the mixture to cool. A typical example of such an ointment is one which includes about 30% almond oil and about 70% white soft paraffin by weight. Lotions may be conveniently prepared by dissolving the active ingredient, in a suitable high molecular weight alcohol such as propylene glycol or polyethylene glycol.
One of ordinary skill in the art will readily recognize that the foregoing represents merely a detailed description of certain preferred embodiments of the present invention. Various modifications and alterations of the compositions and methods described above can readily be achieved using expertise available in the art and are within the scope of the invention.
The following examples are illustrative, but not limiting, of the compounds, compositions, and methods of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in clinical therapy and which are obvious to those skilled in the art are within the spirit and scope of the invention.
This example demonstrates that sensory denervation reduces osteoblastic bone formation.
To investigate the effect of sensory nerve in bone, experiments were conducted that created a sensory denervation mouse model (TrkAAvil−/−) by crossing sensory nerve-specific cre (Advillin-cre) mice with nerve growth factor (NGF) receptor TrkA floxed (TrkAwt) mice. Quantitative polymerase chain reaction (qPCR) and immunofluorescent staining of TrkA in the dorsal root ganglion (DRG) neurons and the other tissues isolated from the TrkAAvil−/− mice validated the knockout efficiency and specificity of the TrkA gene in the TrkAAvil−/− mice (
To examine whether sensory nerves maintain bone homeostasis through bone remodeling in adult mice, experiments were conducted that established inducible sensory denervation in iDTRAvil+/− mice by crossing Advillin-cre mice with iDTRwt mice. Sensory denervation was effectively induced in adult iDTRAvilfl/− mice by injection of 1 ug per kg diphtheria toxin (DTX) three times a week for four weeks (
This example demonstrates that knockout of PGE2 receptor EP4 in sensory nerve induces bone loss.
Because PGE2 is known to stimulate osteoblastic bone formation, experiments were conducted that measured PGE2 levels in the serum of both global and inducible sensory denervation mice. Interestingly, PGE2 levels increased significantly in all the denervation mouse models (
Both trabecular bone and cortical bone decreased significantly in 12-week EP4-ablated mice (
This example demonstrates that PGE2 mediates sensory nerve-induced osteogenesis.
To examine whether PGE2 is secreted primarily by osteoblastic cells for sensory nerve regulation of bone, experiments were conducted that further generated conditional knockout COX2 mice in the osteoblastic cells (COX2OC−/−) by crossing COX2wt mice with OC-cre mice to eliminate PGE2 secretion by osteoblastic cells. Pole tests and grip strength tests showed no effect on motor activity, indicating that knockout of COX2 did not affect global neural activity (
Experiments were conducted that also deleted COX2 in osteocytes embedded in the bone matrix from terminal differentiation of osteoblasts to examine PGE2 in the osteoblastic bone-forming microenvironment essential for sensory nerve-induced osteogenesis. Crossing DMP 1 -cre mice with COX2wt mice generates COX2Dmp1−/− mice to eliminate PGE2 secretion by osteocytes. Interestingly, bone phenotype was unchanged in COX2DMP1−/− mice relative to their COX2wt littermates (
This example demonstrates that PGE2 induces hypothalamic CREB signaling through peripheral sensory nerves for osteogenesis.
CREB signaling in the hypothalamus is crucial for the regulation of skeletal homeostasis (see, Oury, F. et al. Genes Dev. 24, 2330-2342, doi:10.1101/gad.1977210 (2010)). To examine whether PGE2 could activate EP4 in sensory nerves through the ventromedial nucleus of the hypothalamus (VMH), experiments were conducted that examined the effect of PGE2 on DRG neurons and the phosphorylation of CREB in the VMH of EP4Avil−/− mice. Calcium imaging showed more illuminated DRG neurons in those pre-treated with PGE2 relative to vehicle-treated neurons, whereas DRG neuron activation was reduced significantly in EP4Avil−/− mice with or without PGE2 pre-treatment (
The activation of CREB signaling in the hypothalamus has been shown to suppress sympathetic tone (see, Oury, F. et al. Genes Dev. 24, 2330-2342, doi:10.1101/gad.1977210 (2010); Ortuno, M. J. et al. Nat. Med. 22, 1170-1179, doi:10.1038/nm.4166 (2016)). Indeed, uncoupling protein 1 gene (UCP 1) expression in adipose tissue and epinephrine concentrations in urine increased significantly in the EP4Avil−/− mice and COX2OC−/9− mice relative to their WT littermates, indicating higher sympathetic tone in these two mouse models (
Experiments were conducted that also tested if PGE2 secretion is regulated by mechanical loading as mechanical loading has been shown to regulate bone homeostasis through central regulation of sympathetic tone (see, Hino, K. et al. J. Cell Biochem. 99, 845-852 (2006); Kondo, H. et al. Unloading induces osteoblastic cell suppression and osteoclastic cell activation to lead to bone loss via sympathetic nervous system. J. Biol. Chem. 280, 30192-30200 (2005); Kondo, H. et al. J. Biol. Chem. 280, 30192-30200 (2005)). Mechanical loading was applied to C57B/L6 mice and bone marrow PGE2 levels were measured. The result showed that PGE2 levels significantly increased in the loading group compared with the control group (
This example demonstrates that PGE2 promotes skeletal regeneration through sensory nerves.
PGE2 has been reported recently to potentiate regeneration of multiple tissues (see, Zhang, Y. et al. Science 348, aaa2340, doi:10.1126/science.aaa2340 (2015)). To investigate whether PGE2 induces tissue regeneration through sensory nerves, experiments were conducted that assessed whether PGE2 induces bone regeneration. 15-PGDH inhibitor SW033291 was injected into EP4Avil−/− and EPwt mice that had undergone surgical ablation of trabecular bone to examine the effects of an increase in local PGE2 on bone regeneration. Elevation of local PGE2 boosted trabecular bone regeneration significantly in EP4wt mice injected with SW033291 relative to vehicle-treated controls, as shown by μCT (
To further investigate whether PGE2 induces regeneration by sensory nerves of tissues other than bone, experiments were conducted that performed partial hepatectomy in TrkAAvil−/− mice and their WT littermates treated with SW033291 or vehicle. BrdU and Ki67 staining of liver sections with partial hepatectomy showed that the regeneration rate decreased significantly in TrkAAvil−/− mice treated with SW033291 relative to their WT littermates (
This example provides the materials and methods for Examples I-V.
The iDTRfl/fl and Dentin matrix acidic phosphoprotein 1-Cre (DMP1-Cre) mice were purchased from the Jackson Laboratory. The Advillin-Cre (Avil-Cre) mouse strain was kindly provided by Xingzhong Dong (The Johns Hopkins University). The Osteocalcin-Cre (OC-cre) mice were obtained from Thomas J. Clemens (The Johns Hopkins University). The TrkAPfl/fl mice were obtained from David D. Ginty (Harvard Medical School). The COX2fl/fl mice were provided by Harvey Herschman (University of California, Los Angeles). The EP4fl/fl mice were obtained from Brian L. Kelsall (National Institutes of Health). Heterozygous male Avil-Cre mice (female Avil-Cre mice were not used to breed in case for the leakage of TrkA protein into the eggs) were crossed with a TrkAfl/fl, EP4fl/fl, or iDTRfl/fl mouse. The offspring were intercrossed to generate the following genotypes: wild type (referred as WT in the text), Avil-Cre (Cre recombinase expressed driven by Advillin promoter), TrkAfl/fl (mice homozygous for TrkA flox allele are referred to as TrkAwt in the text), EP4fl/fl (referred to as EP4wt in the text), iDTRfl/fl, Avil-Cres:EP4fl/fl (conditional deletion of EP4 receptor in Advillin lineage cells, referred to as EP4Avil−/− in the text), Avil-Cre:: TrkAfl/fl (referred to as TrkAAvil−/− in the text), and Avil-Cre::iDTRfl/+ mice (referred to as iDTRAvil+/− in the text). Heterozygous OC-Cre or DMP 1-Cre mice were crossed with a COX2fl/fl mouse; the offspring were intercrossed to generate the following genotypes: WT, OC-Cre, DMP1-Cre, COX2fl/fl (referred to as COX2wt in the text), OC-Cre:: COX2fl/fl (referred to as COX2OC−/− in the text), and DMP1-Cre:: COX2 fl/fl (referred to as COX2Dmp1−/− in the text) mice. Heterozygous OC-cre mice were crossed with a EP4fl/fl mouse, the offspring were intercrossed to generated the following genotypes: WT (referred as EP4fl/fl) and OC-cre:: EP4fl/fl (conditional deletion of EP4 receptor in osteocalcin lineage cells, referred to as EP4OC−/− in the text). The genotypes of the mice were measured by PCR analyses of genomic DNA, which was extracted from mouse tails within the following primers: Avil-Cre: forward: CCCTGTTCACTGTGAGTAGG (SEQ ID NO:1), Reverse: GCGATCCCTGAACATGTCCATC (SEQ ID NO:2), WT:AGTATCTGGTAGGTGCTTCCAG (SEQ ID NO:3); OC-Cre: forward: CAAATAGCCCTGGCAGATTC (SEQ ID NO:4), Reverse: TGATACAAGGGACATCTTCC (SEQ ID NO:5); DMP1-Cre forward: TTGCCTTTCTCTCCACAGGT (SEQ ID NO:6), Reverse: CATGTCCATCAGGTTCTTGC (SEQ ID NO:7); EP4 loxP allele forward: TCTGTGAAGCGAGTCCTTAGGCT (SEQ ID NO:8), Reverse: CGCACTCTCTCTCTCCCAAGGAA (SEQ ID NO: 9);COX2 loxP allele forward: AATTACTGCTGAAGCCCACC (SEQ ID NO:10), Reverse: GAATCTCCTAGAACTGACTGG (SEQ ID NO:11); TrkA loxP allele forward: AACAGTTTTGAGCATTTTCTATTGTTT (SEQ ID NO:12), Reverse: CAAAGAAAACAGAAGAAAAATAATAC (SEQ ID NO:13); iDTR loxP allele forward: GCGAAGAGTTTGTCCTCAACC (SEQ ID NO:14), Reverse: AAAGTCGCTCTGAGTTGTTAT (SEQ ID NO:15). 8 to 12-week-old C57BL/6 female mice (Jackson Lab) were anesthetized and underwent bilateral OVX or a sham operation from back approach. The aged mice (12 months old) were purchased from The Jackson
Laboratory. All animals were maintained at the animal facility of The Johns Hopkins University School of Medicine. All animal experimental protocols were complied with all relevant ethical regulations and approved by the Animal Care and Use Committee of The Johns Hopkins University, Baltimore, Md., USA. Whole blood samples were obtained by cardiac puncture immediately after euthanasia. Serum was collected by centrifuge at 200×g for 15 min and stored at −80° C. before analyses. Femurs, tibias, and urine of the mice were also collected.
The drugs and compounds used in this study are as follows: diphtheria toxin (DTX, Sigma-Aldrich, D0564); PGE2 (Cayman Chemical, 14010); EP1/3 agonist (Cayman Chemical, 14810); EP4 agonist (Cayman Chemical, 10580); propranolol (Sigma-Aldrich, 1576005); norepinephrine (Sigma-Aldrich, A7257); and SW033291 (Selleck, S7900). Dosages and time courses are noted in the corresponding text and figure legends.
Pole tests and grip strength tests were performed to evaluate motor neural activity changes in TrkAAvil−/−, EP4Avil+/−, and COX2OC−/− mice. All tests were performed between 10:00 and 16:00 during the lights on cycle. For the pole test, a 9-mm-diameter metric as 0.76-m metal rod wrapped with bandage gauze was used as the pole. The time for a mouse to turn and the total time for it to reach the base of the pole was recorded. Before the test, the mice were trained for three consecutive days, and each training session consisted of three test trials. For grip strength, neuromuscular strength was measured as maximum holding force generated by the mice (Biosed, USA). Mice were placed to grasp a metal grid with their forelimbs or hindlimbs. The tail was pulled gently, and the maximum holding force was recorded by the force transducer when the mice released their grasp on the grid. The peak holding strength was recorded digitally and displayed in grams.
The femurs were harvested from mice, and the soft tissue around the bone was removed, followed by fixation overnight using 4% paraformaldehyde. μCT analyses were performed by using a high-resolution μCT scanner (SkyScan, 1174). The voltage of the scanning procedure was 65 kv with a 153-μA current. The resolution was set to 8.7 μm per pixel. Reconstruction software (NRecon, v1.6, SkyScan), data analysis software (CTAn, v1.9, SkyScan), and 3D model visualization software (CTVol, v2.0, SkyScan) were used to analyze the diaphyseal cortical bone and the metaphyseal trabecular bone parameters of the femurs. Experiments were conducted that created cross-sectional images of the femur to perform 2D analyses of the cortical bone and 3D analyses of the trabecular bone. The region of interest (ROI) of the trabecular bone was drawn beginning from 5% of the femur length proximal to the distal metaphyseal growth plate and extending proximally for another 5% of the total femur length. The trabecular bone volume fraction (BV/TV), trabecular thickness (Tb. Th), trabecular number (Tb. N), and trabecular separation (Tb. Sp) were collected from the 3D analyses data and used to represent the trabecular bone parameters. The cortical bone ROI was drawn beginning from 20% of femur length proximal to distal metaphyseal growth plate and extending proximally to another 10% of the total femur length. The cortical thickness (Ct. Th), periosteal perimeter (Ps. Pm), and endosteal perimeter (Es. Pm) were collected from the 2D analyses data and used to represent the cortical bone parameters.
The femurs were collected and fixed in 4% paraformaldehyde overnight and decalcified by using 10% EDTA (pH, 7.4) (Amresco, 0105) for 21 days. The samples were then dehydrated with 30% sucrose for 24 h and embedded in paraffin or optimal cutting temperature compound (Sakura Finetek). 4-μm-thick coronal-oriented sections of the femur were prepared for hematoxylin and eosin staining. The femurs were fixed for 4 h with 4% paraformaldehyde at 4° C. and then decalcified at 4° C. using 0.5M EDTA (pH, 7.4) for 24 h with constant shaking. The samples were dehydrated in 20% sucrose and 2% polyvinylpyrrolidone (PVP) solution for 24 h and embedded in 8% gelatin (Sigma-Aldrich, G1890) in the presence of 20% sucrose and 2% PVP. Forty-μm-thick coronal-oriented sections of the femurs were obtained. For brain section preparation, the whole brain was collected from euthanized mice and fixed with 4% paraformaldehyde for 30 mins. Then, the tissue was dehydrated with 20% sucrose for 24 h and sectioned.
Immunostaining was performed using standard protocol. Briefly, the sections were incubated with primary antibodies to mouse osterix (Abcam, ab22552, 1:600), osteocalcin (Takara Bio, M173, 1:200), CD31 (Abcam, ab28326, 1:50), endomucin (Santa Cruz, V.7C7, 1:50), Ki67 (Abcam, ab16667, 1:100), CGRP (Abcam, ab81887, 1:100), COX2 (Abcam, ab15191, 1:100), EP4 (Abcam, ab92763, 1:10), CREB (Cell Signaling Technology, 9197, 1:100), p-CREB (Abcam, ab32096, 1:100), NF200 (Millipore, AB5539, 1:500), TrkA (R& D systems, AF1056, 1:1000) and IB4 (Thermo Fisher Scientific, 121411) overnight at 4° C. A horseradish peroxidase-streptavidin detection kit (Dako) was used in immunohistochemical procedures to detect immuno-activity, followed by counter staining with hematoxylin (Dako, S3309). Fluorescence-conjugated secondary antibodies were used in immunofluorescent procedures to detect fluorescent signals after counter staining with DAPI (Vector, H-1200). A Zeiss LSM 780 confocal microscope or an Olympus BX51 microscope was used for sample image capturing. A BrdU staining kit (Thermo Fisher Scientific, 8800-6599-45) was used to perform the BrdU immunostaining procedure. Quantitative histomorphometric analysis was performed by using OsteoMeasure XP Software (OsteoMetric) in a blinded fashion.
A double-labeling procedure was performed to measure dynamic bone formation. Briefly, 0.1% calcein (Sigma-Aldrich, C0875) was injected in phosphate-buffered saline at a concentration of 10mg per kg into the mice subcutaneously 7 days and 1 day before sacrifice. The double-labeling images of undecalcified bone slices were captured using a fluorescence microscope. Trabecular bone formation in four randomly selected visual fields was analyzed in the distal metaphyseal area of the femur.
Quantitative Real-Time Polymerase Reaction Chain (qPCR)
Total RNA was purified from cells in culture or tissues using TRIzol (Invitrogen, 15596026), following the manufacturer's protocol. Experiments were conducted that performed qPCR using the Taq SYBR Green Power PCR Master Mix (Invitrogen, A25777) on a CFX Connect instrument (Bio-Rad); Gapdh amplification was used as an internal control. Dissociation curves analysis was performed for every experiment. Sequences of the primers used for each gene are as listed: EP4 forward: CGGTTCCGAGACAGCAAA (SEQ ID NO:16), Reverse: CGGTTCGATCTAGGAATGG (SEQ ID NO:17). UCP 1 forward: CTTTGCCTCACTCAGGATTGG (SEQ ID NO:18), Reverse: ACTGCCACACCTCCAGTCATT (SEQ ID NO:19). TrkA: AGAGTGGCCTCCGCTTTGT (SEQ ID NO:20), Reverse: CGCATTGGAGGACAGATTCA (SEQ ID NO:21). Gapdh forward: ATGTGTCCGTCGTGGATCTGA (SEQ ID NO:22), Reverse: ATGCCTGCTTCACCACCTTCTT (SEQ ID NO:23).
Mice were euthanized, cut two ends of the tibia, and centrifuged the samples for 15 min at 800×g at 4° C. to obtain bone marrow supernatants, which were stored at −80° C. until ELISA.
PGE2 concentrations in the serum and bone marrow were determined by PGE2 ELISA kit (Cayman Chemical, 514010) according to the manufacturer's protocol. Mice serum was collected as described above. Experiments were conducted that also performed osteocalcin and CTX ELISA of serum using a mouse osteocalcin enzyme immunoassay kit (Biomedical Technologies, BT-470) and a RatLaps enzyme immunoassay kit (Immunodiagnostic Systems, ACO6F1).
Western blot analysis was conducted on the basis of the protein lysates from the hypothalamus of mice or cultured cell line. The lysates were centrifuged; the supernatants were collected and separated by SDS-PAGE PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and then blotted on the polyvinylidene fluoride membrane (Bio-Rad Laboratories). Specific antibodies were applied for incubation, and the proteins were detected by using an enhanced chemiluminescence kit (Amersham Bioscience, RNP2108). The antibodies used for western blotting were HTR2C (Abcam, ab197776, 1:500), CREB (Cell Signaling Technology, 9197, 1:500), p-CREB (Abcam, ab32096, 1:500), COX2 (Abcam, ab15191, 1:1000), and GAPDH (Cell Signaling Technology, 5174, 1:1000).
DRGs from the L2-L5 spinal levels of 4-week-old mice were isolated in cold DMEM/F12 medium (Invitrogen, 11039-021) and then treated with collagenase type A (Roche, 10103578001) at 37° C. After trituration and centrifugation, cells were resuspended and plated on glass coverslips coated with ploy-D-lysine and laminin. The cells were then cultured in an incubator at 37° C. Primary isolated DRG neurons were loaded with Fura-2-acetomethoxyl ester (Molecular Probes) for 45 min in the dark at room temperature. The cells were imaged at 340 and 380 nm after immersion in calcium-free buffer for 1 min.
In vitro-mechanical stretching assay: Osteoblastic MC3T3 cells (stored in our lab) were plated on the home-made high-extension silicone rubber dishes with 4% and 12% morphological change for 24 h and starved for 4 h. The high-extension silicone rubber dishes were fixed on the home-made mechanical stretching machine and compress the cells with different force reflected as 4% and 12% morphology change of the dishes. After 24 h, the cells lysate was harvested for western blot assays.
In vivo-treadmill assay: C57BL/6 mice were trained for 5 days on treadmill with the protocol of 8 m/min, 5° uphill for 10 min per day. Then, the protocol of 14 m/min, 14° uphill for 20 min per day for formal tests was followed. After 2 weeks, serum and bone marrow were harvested for ELISA assays.
Mice underwent general anesthesia. The bone regeneration model was established as described below. A longitudinal incision was made on each knee to expose the femoral condyle by patella dislocation. Then, a hole was made at the intercondylar notch of the femur by using a dental drill. A 0.6-mm-diameter Kirschner wire was placed from the proximal end of the femur to confirm marrow ablation by radiography. The dislocated patella was reposed, and the skin was sutured after removal of the Kirschner wire. Bone samples were harvested 7 days after bone marrow ablation, as described above.
Partial hepatectomy was used for the liver regeneration model. 10- to 12-week-old TrkAAvilF592A male mice were anesthetized, as described above. A partial (two-thirds) hepatectomy was performed by resecting the median and left lateral hepatic lobes54. The remnant livers were harvested after mice sacrifice. SW033291 was dissolved in a vehicle of 10% ethanol, 5% Cremophor EL, and 85% dextrose 5% in water.
All data analyses were performed using SPSS, version 15.0, software (IBM Corp.). Data are presented as means±standard error of mean (SEM). For comparisons between two groups, two-tailed Student t-tests was used. For comparisons among multiple groups, one-way ANOVA was used. All inclusion/exclusion criteria were pre-established, and no samples or animals were excluded from the analysis. No statistical method was used to predetermine the sample size. The experiments were randomized. The investigators were not blinded to allocation during experiments and outcome assessment. All relevant data are available from the authors.
This example describes aberrant subchondral bone formation in spontaneous OA mice.
To examine the pathogenesis of spontaneous OA, experiments were conducted that sectioned knee joints of STR/Ort mice at different ages for immunostaining analysis. The results showed that significant proteoglycan loss occurred at the deeper zone of cartilage adjacent to the subchondral bone from 4 months of age and became aggravated over time relative to the age-matched control CBA mice (
Experiments next examined tibial subchondral bone using 3-dimensional microcomputed tomography (μCT) analysis because aberrant subchondral bone formation causes OA (see, Zhen, G., et al. Nature medicine 19, 704-712 (2013)). The sectional, coronal, and sagittal views of tibial subchondral bone showed an uneven distribution of bone mass in STR/Ort mice relative to CBA controls, indicating uncoupled bone formation (
This example demonstrates elevated COX-2 activity in the subchondral bone of spontaneous OA.
Because PGE2 stimulates bone formation without osteoclast bone remodeling (see, Blackwell, K. A., Raisz, L. G. & Pilbeam, C. C. Trends in endocrinology and metabolism: TEM 21, 294-301 (2010)), experiments examined whether COX-2 is elevated in subchondral bone formation in STR/Ort mice. Immunostaining showed a significant increase in COX-2+ osteocytes in the subchondral bone starting at 4 months of age (
This example demonstrates elevated COX-2 activity in the subchondral bone of genetically modified RA and both human OA and RA.
Experiments also examined COX-2 levels in the subchondral bone of 2 different RA mouse models. Interestingly, COX-2 levels were increased in TNF-α transgenic RA mice (TNF-α Tg+/−), but not in type II collagen-induced RA mice (CIA) compared with controls (
This example demonstrates that inhibition of COX-2 or conditional knockout of COX-2 in osteocytes attenuates progression of RA.
Dentin matrix protein 1 (DMP1) is a matrix protein, expressed in odontoblasts, preosteocytes, and osteocytes. DMP1-Cre transgenes are widely used to target osteocytes (see, Lu, Y., et al. Journal of dental research 86, 320-325 (2007); Kalajzic, I., et al. Bone 54, 296-306 (2013)). To specific knock out COX-2 in osteocytes in TNF-α transgenic mice, experiments crossed DMP1-Cre mice with TNF-α transgenic mice, and their progeny DMP1-Cre::TNF-α transgenic mice were further crossed with COX-2flox/flox mice. Articular cartilage degeneration was attenuated in COX-2−/− RA mice (TNF-α DMP1-Cre:: COX-2−/−) relative to the TNF-α COX-2flox/flox mice (
To further validate whether genetically elevated COX-2 expression caused arthritis, experiments were conducted that gavage fed COX-2 inhibitor celecoxib to TNF-α transgenic mice at a dose of 8 mg/kg daily for 4 weeks. The serum PGE2 level decreased significantly with the administration of COX-2 inhibitor (
Thus, the fact that inhibition or knockout of COX-2 attenuated RA validates that COX-2 is a heritable factor causing RA.
This example demonstrates that inhibition of COX-2 attenuates spontaneous OA.
Experiments were conducted that examined whether inhibition of COX-2 also attenuates spontaneous OA. COX-2 inhibitor celecoxib was gavage fed at different dosages once a day for 4 weeks. Proteoglycan loss and calcification of articular cartilage were effectively attenuated by 8 mg/kg of COX-2 inhibitor in STR/Ort mice relative to controls, as indicated by safranin 0 and fast green staining (
This example describes the materials and methods for Examples VII through XI.
Human subchondral bone samples were obtained from 43 patients with OA and 9 patients with RA undergoing knee joint replacement or open reduction and internal fixation at The First Affiliated Hospital of Xinjiang Medical University or The Johns Hopkins University School of Medicine. All subjects were screened using a detailed questionnaire, disease history, and physical examination.
Mouse studies were conducted in the animal facility of The Johns Hopkins University School of Medicine, and procedures were performed under a protocol approved by the Institutional Animal Care and Use Committee of The Johns Hopkins University (Baltimore, Md., USA). STR/Ort mice were bought from Harlan Laboratories (Frederick, Md., USA), CBA/J mice and DMP1-Cre mice were bought from the Jackson Laboratory (Bar Harbor, Me., USA), TNF-α transgenic (hemizygous) mice were obtained from Taconic Biosciences (Hudson, N.Y., USA), and COX-2flox/flox mice were provided by Harvey Herschman, PhD, at the University of California-Los Angeles (Los Angeles, Calif., USA).
To knock out COX-2 in the osteocytes of TNF-α transgenic mice, experiments were conducted that first crossed TNF-α transgenic mice with DMP1-Cre mice to create DMP-1Cre::TNF-α transgenic offspring. Then DMP-1Cre::TNF-α transgenic mice were crossed with COX-2flox/flox mice to create TNF-α DMP1-Cre:: COX-2flox/flox experimental mice and COX-2flox/flox littermate controls.
CIA procedures were performed on 2-month-old mice using the methods described by Brand and colleagues (27). For the time-course experiments, CIA mice or the non-immunized controls were euthanized at 100 days after initial immunization.
Experiments isolated primary osteocytes from different mouse models using a protocol described previously (see, Watters, J. W., et al. Arthritis and rheumatism 56, 2999-3009 (2007)). Experiments collected subchondral bone from mice by carefully removing the attached soft tissue, then washing the bones with a-minimum essential medium (MEM)+ 10% penicillin and streptomycin to remove contaminants. Experiments were conducted that cut the bone into 1- to 2-mm lengths and used warmed collagenase solution (4 mg/ml type IA collagenase in α-MEM) to incubate bone pieces 3 times at 25° C. for 25 minutes. Then experiments were conducted that used warmed collagenase solution (4 mg/ml type IA collagenase in α-MEM) and ethylenediaminetetraacetic acid (EDTA) solution (5 mMEDTA solution in Dulbecco's phosphate-buffered saline [PBS] with 1% bovine serum albumin) to incubate bone pieces 2 times at 25° C. alternatively; experiments aspirated the solution and retained it for cell plating. The isolated primary osteocytes and minced bone pieces were cultured with primary bone cell culture medium (α-MEM with 5% fetal bovine serum, 5% calf serum, and 1% penicillin and streptomycin) in collagen-coated plates. Experiments were conducted that collected protein and the culture medium for Western blot and enzyme-linked immunosorbent assay (ELISA) analysis at 72 hours.
Experiments detected the concentration of serum and medium PGE2 level using a PGE2 ELISA kit (514010, Cayman Chemical, Ann Arbor, Mich., USA) according to the manufacturer's instructions. Total cell lysates were separated by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) blotted on polyvinylidene fluoride membranes (MilliporeSigma, Temecula, Calif., USA). The membranes were blocked with 5% milk (170-6404, Bio-Rad Laboratories, Inc., Hercules, Calif., USA) and incubated with specific antibodies to COX-2 (ab15191, 1:20000, Abcam, Cambridge, Mass., USA), then reprobed with appropriate horseradish peroxidase-conjugated secondary antibodies. Blots were developed using a SuperSignal West Femto Maximum Sensitivity Substrate Kit (QJ222305, Thermo Fisher Scientific, Inc., Waltham, Md., USA) and exposed to x-ray films.
Knee joints were dissected from mice, carefully removing the attached muscle, fixed for 4 hours with 4% paraformaldehyde at 4° C., and washed 3 times with ice-cold PBS. Experiments were then performed μCT analysis using high-resolution μCT (Skyscan 1172, Bruker microCT, Kontich, Belgium). The scanner was set at a voltage of 65 kV, a current of 154 μA, and a resolution of 5.8 μm per pixel. The image reconstruction software (NRecon, version 1.6, Bioz, Inc., Palo Alto, Calif., USA), data analysis software (CT Analyser, version 1.9, Bruker microCT) and 3-dimensional model visualization software (μCT Volume, version 2.0, Bruker microCT) were used to analyze the parameters of the distal femoral metaphyseal trabecular bone. Experiments were conducted that selected the trabecular bone of subchondral bone as the region of interest for analysis. Trabecular BV per TV and TBPf were measured.
Knee joints were dissected from mice, carefully removing the attached muscle and fixed overnight with 10% formalin at 4° C. After washing 3 times with ice-cold PBS, the samples were decalcified at 4° C. using 10% EDTA (pH 7.4) for 21 days and then embedded in paraffin. Four-micrometer-thick sagittal-oriented sections of the knee joint medial compartment were used for staining. The slides were processed for H&E, safranin O, and fast green staining. TRAP staining was performed using a standard protocol (Sigma-Aldrich, St. Louis, Mo., USA).
Knee joints were dissected from mice, carefully removing the attached muscle and fixed overnight with 10% formalin at 4° C. After washing 3 times with ice-cold PBS, the samples were decalcified at 4° C. using 10% EDTA (pH 7.4) for 21 days and then embedded in paraffin. Four-micrometer-thick sagittal-oriented sections of the knee joint medial compartment were used for staining. The sections were stained with individual primary antibodies to COX-2 (ab15191, 1:100, Abcam), osterix (ab22552, 1:100, Abcam), OCN (M137, 1:100, Takara Bio Inc., Kusatsu, Shiga Prefecture, Japan), pSmad2/3 (sc-11769, 1:50, Santa Cruz Biotechnology Inc., Dallas, Tex., USA), MMP13 (ab3208, 1:50, Abcam) at 4° C. overnight. Experiments were conducted that used the horseradish peroxidase-streptavidin detection system (Dako) to detect immunoactivity. Then experiments were conducted that counterstained the sections with hematoxylin (Sigma-Aldrich). Experiments were conducted that counted the numbers of positively stained cells in 4 random visual fields in subchondral bone in 5 sequential sections per mouse in each group. For OCN staining experiments were conducted that normalized them to the number per millimeter of adjacent bone surface (N mm-1) in subchondral bone.
Immunofluorescence staining was performed as described previously (see, Myers, L. K., et al. Arthritis & Rheumatism 43, 2687-2693 (2000)). Knee joints were dissected from mice, carefully removing the attached muscle, and fixed for 4 hours with 4% paraformaldehyde at 4° C. After washing 3 times with ice-cold PBS, the samples were decalcified at 4° C. using 0.5M EDTA (pH 7.4) for 24 h (2-month-old mice) and 48 h (4- and 6-month-old mice) with constant shaking. Then experiments were conducted that incubated the decalcified bones in 20% sucrose and 2% polyvinylpyrrolidone (PVP) solution for 24 h and embedded the tissues in 8% gelatin (porcine) in the presence of 20% sucrose and 2% PVP. Forty-micrometer-thick sagittal-oriented sections of the knee joint medial compartment were used for staining. The slides were stained with individual primary antibodies to CD31 (ab28364, 1:100, Abcam), endomucin (V.7C7, 1:50, Santa Cruz Biotechnology, Inc.) at 4° C. overnight. Then secondary antibodies conjugated with fluorescence were added, and slides were incubated at room temperature for 1 h while avoiding light. The sections were observed under a confocal microscope (LSM 780, Zeiss, Oberkochen, Germany, USA)
To examine dynamic bone formation, mice were injected intraperitoneally with 0.08% calcein (Sigma-Aldrich, 20 mg/kg b.w.) 8 and 2 days before euthanasia. Calcein double-labeling in undecalcified bone slices was observed under a fluorescence microscope. Four randomly selected visual fields in the distal metaphysis of the femur were measured to test trabecular bone formation in subchondral bone.
Experiments were conducted that detected mechanical sensitivity by applying 0.008-g von Frey filaments (Stoelting Co., Wood Dale, Ill., USA) on the plantar surface of mouse hind paws. Experiments were conducted that used the number of paw withdrawals in 3 sets of 10 stimulations each to represent the mechanical allodynia level.
Data are presented as means±standard deviations. For comparisons between 2 groups, 2-tailed Student t tests were used. For comparisons among multiple groups (e.g., OARSI scores, bone mass, and microarchitecture among groups), 1-way ANOVA was used. All experiments were repeated at least 3 times, and representative experiments are shown. Differences were considered significant at P<0.05. All data analyses were performed using SPSS, version 15.0, software (IBM Corp., Armonk, N.Y., USA).
Having now fully described the invention, it will be understood by those of skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations, and other parameters without affecting the scope of the invention or any embodiment thereof. All patents, patent applications and publications cited herein are fully incorporated by reference herein in their entirety.
The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.
The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/052195 | 9/20/2019 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62734604 | Sep 2018 | US |
