Compositions and methods for virus control in Varroa mite and bees

Information

  • Patent Grant
  • 10557138
  • Patent Number
    10,557,138
  • Date Filed
    Tuesday, December 9, 2014
    10 years ago
  • Date Issued
    Tuesday, February 11, 2020
    5 years ago
Abstract
Compositions and methods for providing viral control in Varroa mites and bees using RNA interference technology, and more particularly, prevention and treatment of viral infections in Varroa mites and bees by providing trigger polynucleotides targeting viral sequences is disclosed.
Description
INCORPORATION OF SEQUENCE LISTING

A computer readable form of a sequence listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The sequence listing is contained in the file named P34159US02_SEQ.txt, which is 9,785 bytes in size (measured in operating system MS windows) and was created on Jun. 10, 2016.


FIELD

The present embodiments relate generally to compositions and methods for reducing the susceptibility of bees to infectious disease using RNA interference technology, and more particularly, to the use of RNA interference technology for reducing viral load and suppressing viral replication in the Varroa mite vector and in the bees.


BACKGROUND

Honeybees, Apis mellifera, are required for the effective pollination of crops and are therefore critical to world agriculture. Honeybees also produce economically important products, including honey and bees wax. The health and vigor of honeybee colonies are threatened by numerous parasites and pathogens, including viruses, bacteria, protozoa, and mites, each with characteristic modes of transmission.


In general, transmission of viruses can occur via two pathways: horizontal and vertical transmission. In horizontal transmission, viruses are transmitted among individuals of the same generation, while vertical transmission occurs from adults to their offspring. Transmission can occur through multiple routes in social organisms (for a detailed review see Chen Y P, et al (2006) Appl Environ Microbiol. 72(1):606-11). Recently, horizontal transmission of honeybee viruses has been documented in bee colonies, for example, transmission of deformed wing virus (DWV) and Kashmir Bee Virus (KBV) by the parasitic mite Varroa destructor, as well as some evidence of virus in honeybee eggs and young larvae, life stages not parasitized by Varroa mites.



Varroa (Varroa destructor) mites are the number one parasite of managed honey bees (Apis mellifera) and the biggest global threat to commercial beekeeping (Rosenkranz et al. 2010). Varroa mites parasitize pupae and adult bees and reproduce in the pupal brood cells. The mites use their mouths to puncture the exoskeleton and feed on the bee's hemolymph. These wound sites in the exoskeleton harbor bacterial infections, such as Melissococcus pluton, which causes European foulbrood. In addition, to their parasitic effects, Varroa mites are suspected of acting as vectors for a number of honey bee pathogens, including deformed wing virus (DWV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and black queen cell virus (BQCV), and may weaken the immune systems of their hosts, leaving them vulnerable to infections. Some bee viruses are known to replicate in the mite, thus dramatically increasing the viral load. If left untreated Varroa infestations typically result in colony-level mortality.


Currently, beekeepers use a plethora of methods to control Varroa levels that include various chemical miticides, most of which have lost efficacy and are toxic and/or leave residues in wax and honey. Other methods include application of oxalic or formic acid, monoterpenes (thymol) and a variety of other management practices, with highly variable outcomes, including toxicity to the treated colonies. Breeding of bees for resistance to Varroa, such as selection for Hygienic behavior which results in the removal of infested brood, has provided a limited practical success.


Current methods of treating Varroa infestations are proving to be ineffective as the mites develop resistance to existing miticides. In addition, the use of such miticides may introduce injurious chemicals into honey that is intended for human consumption.


SUMMARY

The present embodiments relate to compositions and methods for controlling viral load and/or viral replication in Varroa mites and honeybees.


The present disclosure provides a method for reducing viral load or suppressing viral replication in a Varroa destructor mite or in a bee colony, the method comprising providing to the Varroa destructor mite or the bee colony a composition comprising an effective amount of at least one trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby reducing viral load or suppressing viral replication in the Varroa destructor mite or in the bee colony. In some embodiments, the virus is selected from the group consisting of: Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), Kakugo Virus (KV), and Laker Sinai Virus (LSV).


The present disclosure also provides a composition for providing to a Varroa destructor mite, a bee, or a bee colony, comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene. In some embodiments, the composition reduces viral load or suppresses viral replication in the Varroa destructor mite, the bee, or the bee colony. In some embodiments, the composition increases the tolerance of a bee or a bee colony to a disease caused by the bee virus.


In some embodiments, the trigger polynucleotide is single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double stranded DNA-RNA hybrid.


In some embodiments, the trigger polynucleotide downregulates the viral gene. In some embodiments, the viral gene encodes a coat protein, RdRp, VP1, VP2, or helicase. In some embodiments, the trigger polynucleotide comprises a nucleic acid sequence having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs:1-21, or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9, or 10 different trigger polynucleotides, which target different viruses, or target different genes of the same virus, or target different fragments of a viral gene.


The present disclosure also provides a method for reducing viral load in a bee colony, the method comprising reducing viral load in a parasite of the bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby suppressing viral replication in the parasite and reducing the viral load in the bee colony. In some embodiments, the parasite is a Varroa destructor mite.


The present disclosure further provides a method for reducing the susceptibility of a bee to a disease caused by a bee virus, the method comprising providing to a parasite of the bee a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby suppressing viral replication in the parasite and reducing the susceptibility of the bee to a disease caused by the bee virus. In some embodiments, the disease is Colony Collapse Disorder (CCD). In some embodiments, the parasite is a Varroa destructor mite.


In some embodiments, the composition comprising an effective amount of the trigger polynucleotide is provided by spraying the Varroa mite, by directly feeding the Varroa mite, by directly feeding the bees in a bee colony, or any combination thereof.


In some embodiments, a method for reducing viral load in Varroa mites is provided. In some embodiments the bee virus is selected from the group consisting of: Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), and Kakugo Virus (KV). According to some embodiments, a trigger polynucleotide comprising a nucleic acid sequence having essential identity or essential complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene is provided. According to some embodiments, there is provided a method for down-regulating expression of a viral gene in Varroa mites.


According to some embodiments, methods and compositions for preventing the spread of bee diseases, such as Colony Collapse Disorder through the application of RNA interference technology to Varroa mites directed to bee infectious organisms and agents, such as DWV, IAPV, Acute Bee Paralysis Virus and Kashmir Bee Paralysis Virus are provided.


According to some embodiments of the present invention there is provided a method for increasing the tolerance of a bee to a disease caused by a bee virus comprising providing an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a bee viral gene to a Varroa mite, thereby reducing the viral load in the Varroa mite and increasing the tolerance of the bee to the disease caused by the bee virus. In some embodiments, the nucleic acid is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of the bee viral gene.


According to some embodiments of the present invention there is provided a method for increasing the tolerance of a bee colony to a disease caused by a bee virus comprising providing an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a bee viral gene to a Varroa mite, thereby reducing the viral load in the Varroa mite and increasing the tolerance of the bee colony to the disease caused by the bee virus. In some embodiments, the nucleic acid is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of the bee viral gene.


In one aspect, the present disclosure provides a method for reducing viral load in a Varroa destructor mite, the method comprising providing or administering to the Varroa destructor mite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a bee viral sequence, thereby suppressing viral replication in the Varroa destructor mite. In some embodiments, the bee viral sequence is a sequence of at least 21 contiguous nucleotides of a bee viral gene.


In one aspect, the present disclosure provides method of reducing viral load in a bee colony, the method comprising reducing viral load in a parasite of the bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication in the parasite and reducing the viral load in the bee colony. In some embodiments, the parasite is Varroa destructor. In some embodiments, the bee viral sequence is a sequence of at least 21 contiguous nucleotides of a bee viral gene.


In one aspect, the present disclosure provides a method for reducing viral replication in a Varroa destructor mite, the method comprising administering to the Varroa destructor mite a composition comprising an effective amount of at least one trigger polynucleotide which comprises a nucleic acid sequence that downregulates expression of a bee viral gene in the Varroa destructor mite, thereby reducing viral replication in the Varroa destructor mite. In some embodiments, the nucleic acid sequence is a trigger polynucleotide that is essentially identical or essentially complementary to the viral gene or a fragment thereof. In some embodiments, the nucleic acid is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of the bee viral gene.


In one aspect, the present disclosure provides for reducing viral replication in a bee colony, the method comprising reducing viral replication in a parasite of the bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a bee viral sequence, thereby suppressing viral replication in the parasite and reducing viral expression in the bee colony. In some embodiments, the parasite is Varroa destructor. In some embodiments, the bee viral sequence is a sequence of at least 21 contiguous nucleotides of a bee viral gene.


In one aspect, the present disclosure provides a method for reducing the susceptibility of a bee to a disease caused by a bee virus, the method comprising providing to a parasite of the bee a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a bee viral sequence, thereby suppressing viral replication in the parasite and reducing the susceptibility of the bee to a disease caused by the bee virus. In some embodiments, the parasite is Varroa destructor. In some embodiments, the disease is Colony Collapse Disorder (CCD). In some embodiments, the bee viral sequence is a sequence of at least 21 contiguous nucleotides of a bee viral gene.


According to some embodiments of the invention the bee is a honeybee.


According to some embodiments of the invention the honeybee is a forager.


According to some embodiments of the invention the honeybee is a hive bee.


Several embodiments relate to a composition comprising an effective amount of one or more trigger polynucleotides comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene. In some embodiments, the virus is selected from the group consisting of: Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), Kakugo Virus (KV), and Lake Sinai Virus (LSV). In some embodiments, the virus is IAPV. In some embodiments, the virus is DWV. In some embodiments, the viral gene encodes a coat protein, RdRp, VP1, VP2, or helicase. In some embodiments, the trigger polynucleotide comprises a nucleic acid sequence having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs:1-21, or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9, or 10 different trigger polynucleotides, which target different viruses, or target different genes of the same virus, or target different fragments of a viral gene. In some embodiments, the composition comprises one or more trigger polynucleotides comprising a nucleic acid sequence having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a DWV sequence and one or more trigger polynucleotides comprising a nucleic acid sequence having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a IAPV sequence. Several embodiments relate to a composition comprising an effective amount of one or more trigger polynucleotides comprising a nucleic acid having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs:11, 13, 14, 17, and 18. Several embodiments relate to a composition comprising an effective amount of one or more trigger polynucleotides comprising a nucleic acid having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs:12, 15, 16, 19, and 20. In some embodiments, the trigger polynucleotide is single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double stranded DNA-RNA hybrid. In some embodiments, the composition comprises one or more trigger polynucleotides and one or more excipients. In some embodiments, the excipient comprises one or more substance selected from: a sugar, a solvent, a protein, a bee food, and any combination thereof. In some embodiments, the sugar is selected from: fructose, glucose, sucrose, trehalose, lactose, galactose, ribose and any combination thereof. In some embodiments, the bee food is selected from: honey, pollen, Wheast, soybean flour, yeast, yeast product, and any combination thereof. In some embodiments, the composition is a bee-ingestible composition selected from the group consisting of a liquid bee-ingestible composition and a solid bee-ingestible composition. In some embodiments, the liquid bee-ingestible composition is a sugar syrup. In some embodiments, the solid bee-ingestible composition is a cake or dry mix.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 depicts a phylogenetic tree of some bee viruses.



FIG. 2A depicts a graph showing the survival rate of Varroa mites after treatment with bee viruses trigger mix.



FIG. 2B depicts a graph showing DWV levels in Varroa 72 h following treatment in a Varroa direct feeding experiment, measured by Q-PCR.



FIG. 3 depicts a graph showing DWV levels in bees versus DWV levels in Varroa, at different (0-3 or 4-62) Varroa counts per 100 bees.



FIG. 4 depicts a graph showing DWV replication in bees 4 days, 8 days, and 14 days after the bees were fed with a mixture of dsRNA triggers (MIX), a non-specific dsRNA (SCR), or no dsRNA (CON).



FIG. 5A depicts a graph showing DWV levels in Varroa 3 days following treatment in a Varroa direct feeding experiment, measured by QuantiGene®.



FIG. 5B depicts a graph showing IAPV levels in Varroa 72 h following treatment in a Varroa direct feeding experiment, measured by QuantiGene®.



FIG. 6A depicts a graph showing DWV expression in honeybees 4 days following treatment of the bees, measured by QuantiGene®.



FIG. 6B depicts a graph showing DWV replication in honeybees 4 days following treatment of the bees, measured by QuantiGene®.



FIG. 7A depicts a graph showing IAPV expression in honeybees 4 days following treatment of the bees, measured by QuantiGene®.



FIG. 7B depicts a graph showing IAPV replication in honeybees 4 days following treatment of the bees, measured by QuantiGene®.



FIG. 8 depicts a graph showing LSV expression in honeybees 4 days following treatment of the bees, measured by QuantiGene®.





DETAILED DESCRIPTION

Unless defined otherwise, technical and scientific terms as used herein have the same meaning as commonly understood by one of ordinary skill in the art. One skilled in the art will recognize many methods can be used in the practice of the present disclosure. Indeed, the present disclosure is in no way limited to the methods and materials described. Any references cited herein are incorporated by reference in their entireties. For purposes of the present disclosure, the following terms are defined below.


As used herein, the term “about” refers to ±10%.


As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.


Unless otherwise stated, nucleic acid sequences in the text of this specification are given, when read from left to right, in the 5′ to 3′ direction. It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. Further, disclosure of a nucleic acid sequence discloses the sequence of its reverse complement, as one necessarily defines the other, as is known by one of ordinary skill in the art. Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term.


Bees are susceptible to a myriad of viral infections. To date, 24 bee viruses have been identified. Most are positive strand RNA viruses, which contain RNA-dependant RNA polymerase (RdRp). Two phylogenetic families of bee viruses with two main structural formats have been identified. See FIG. 1. Field samples of bees in the U.S. screened for 9 different bee viruses using QuantiGene® analysis showed a high prevalence of Deformed Wing Virus (DWV), Varroa Destructor Virus (VDV-1), Israeli Acute Paralysis Virus (IAPV), Acute Bee Paralysis Virus (ABPV) and Kashmir Bee Virus (KBV). Lake Sinai Virus (LSV), including Lake Sinai Virus-1 (LSV-1) and Lake Sinai Virus-2 (LSV-2) is another virus found in bee hives. Treatment of viral infections by down-regulation of a particular viral gene product has shown to be successful in eliminating virally induced infections in the bee (see U.S. Patent Publication 2009/0118214). The present inventors now disclose methods and compositions for the treatment of viral infection in Varroa mites and in bees. The present inventors further disclose treatment of viral infection in bees by reducing the viral load of parasitic Varroa mites.


According to some embodiments, RNA interference technology is used to reduce the viral load in Varroa destructor mites and in bees. Varroa mites parasitize pupae and adult bees and reproduce in the pupal brood cells. The mites use their mouths to puncture the exoskeleton and feed on the bee's hemolymph. Polynucleotide agents administered to the bees to treat Varroa mite infestations presented in the bee's hemolymph thereby becoming available to the mite (see U.S. Patent Publication 2012/0258646).


In several embodiments of the present disclosure, RNA interference technology is used to reduce viral replication in Varroa destructor mites and in bees. In several embodiments of the present disclosure, RNA interference technology is used to reduce or prevent transmission of bee viruses from a bee or bee larvae to a Varroa destructor mite which feeds on the bee or bee larvae. In several embodiments of the present disclosure, RNA interference technology is used to reduce or prevent transmission of bee viruses from a Varroa destructor mite to a bee or bee larvae that the mite parasitizes.


In some embodiments of the present disclosure, RNA interference technology is used to reduce viral load in a bee. In some embodiments, RNA interference technology is used to reduce viral load in a bee colony.


In some embodiments of the present disclosure, RNA interference technology is used to reduce viral replication in a bee. In some embodiments, RNA interference technology is used to reduce viral replication in a bee colony.


RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by small RNAs. The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. While not being limited to any particular theory, the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla. Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. In aspects according to the present disclosure, a nucleic acid composition results in RNA interference in a target organism. In certain aspects the nucleic acid composition results in RNA interference in Varroa destructor when present on the host organism, the bee or bee larvae.


The phrase “Varroa destructor mite” refers to the external parasitic mite that attacks honey bees Apis cerana and Apis mellifera. The mite can be at an adult stage, feeding off the bee, or at a larval stage, inside the honey bee brood cell.


In some embodiments of the present disclosure, a bee virus is selected from the group consisting of: Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), Kakugo Virus (KV), and Lake Sinai Virus (LSV).


In some embodiments of the present disclosure, the bee virus is a positive strand RNA virus. In some embodiments, the bee virus is a negative strand RNA virus. In some embodiments, the bee virus is DWV. In some embodiments, the bee virus is IAPV. In some embodiments, the bee virus is LSV.


As used herein, a measurement of “viral load,” “viral levels,” and “viral expression” refers to the detection of the sense strand of a bee virus sequence, and they are used interchangeably in the present disclosure. A number of detection methods are known in the art, including but not limited to, quantitative PCR (Q-PCR) and the QuantiGene® assay. In some embodiments, viral load or viral expression is measured as median fluorescence intensity (MFI) and normalized with MFI of housekeeping genes to represent the presence of the virus in a bee, a bee colony, or Varroa mites. In some embodiments, viral load is a measure of the severity of an active viral infection.


As used herein, a measurement of “viral replication” refers to the detection of the negative strand of a bee virus sequence. In some embodiments, viral replication is measured as median fluorescence intensity (MFI) and normalized with MFI of housekeeping genes to represent the replication of the virus in a bee, a bee colony, or Varroa mites. In some embodiments, viral replication is a measure of the severity of an active viral infection.


As used herein, the term “viral titer” refers to the concentration of viruses in a sample. In some embodiments, the viral load is measured by the viral titer. A number of methods are known in the art for calculating the viral titer, and they are emcompassed by this application.


As used herein, the term “host” or “host organism” refers to an organism that harbors a parasite and provides nourishment to the parasite. A “parasite” is an organism that has a non-mutual symbiotic relationship with a host organism and benefits at the expense of the host organism. In some embodiments, the host organism is a bee. In some embodiments, the parasite is a Varroa mite.


As used herein, the term “bee” refers to both an adult bee and pupal cells thereof. According to one aspect, the bee is in a hive. An adult bee is defined as any of several winged, hairy-bodied, usually stinging insects of the superfamily Apoidea in the order Hymenoptera, including both solitary and social species and characterized by sucking and chewing mouthparts for gathering nectar and pollen. Examples of bee species include, but are not limited to, Apis, Bombus, Trigona, Osmia and the like. In one aspect, bees include, but are not limited to bumblebees (Bombus terrestris), honeybees (Apis mellifera) (including foragers and hive bees) and Apis cerana. The present disclosure provides for, and includes, methods and compositions for treating insects as either a host or as a parasite.


According to one aspect, a bee is part of a colony. The term “colony” refers to a population of bees comprising dozens to typically several tens of thousands of bees that cooperate in nest building, food collection, and brood rearing. A colony normally has a single queen, the remainder of the bees being either “workers” (females) or “drones” (males). The social structure of the colony is maintained by the queen and workers and depends on an effective system of communication. Division of labor within the worker caste primarily depends on the age of the bee but varies with the needs of the colony. Reproduction and colony strength depend on the queen, the quantity of food stores, and the size of the worker force. Honeybees can also be subdivided into the categories of “hive bees”, usually for the first part of a workers lifetime, during which the “hive bee” performs tasks within the hive, and “forager bee”, during the latter part of the bee's lifetime, during which the “forager” locates and collects pollen and nectar from outside the hive, and brings the nectar or pollen into the hive for consumption and storage. The present disclosure provides for, and includes, methods and compositions for treating insects colonies.


As used herein, the term “parasite” refers to both adult and immature forms of organisms that directly benefit at the expense of another, host, organism, for example by feeding on the blood or fluids of the host, living intracellularly in a host organism cell, or living within a body of a host organism. The present disclosure provides for, and includes, methods and compositions for treating parasites. In an aspect, the parasite is Varroa destructor.


As used herein, the phrase “RNA silencing” refers to a group of regulatory mechanisms (e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression) mediated by RNA molecules which result in the inhibition or “silencing” of the expression of a corresponding viral gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi. In aspects according the present disclosure, nucleic acid compositions provide for RNA silencing. In certain aspects, the nucleic acid compositions provide for silencing of viral genes in a bee parasite.


The present disclosure provides a method for reducing viral load or suppressing viral replication in a Varroa destructor mite or in a bee colony, the method comprising providing to the Varroa destructor mite or the bee colony a composition comprising an effective amount of at least one trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby reducing viral load or suppressing viral replication in the Varroa destructor mite or in the bee colony. In some embodiments, the virus is selected from the group consisting of: Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), Kakugo Virus (KV), and Laker Sinai Virus (LSV).


The present disclosure also provides a composition for providing to a Varroa destructor mite, a bee, or a bee colony, comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene. In some embodiments, the composition reduces viral load or suppresses viral replication in the Varroa destructor mite, the bee, or the bee colony. In some embodiments, the composition increases the tolerance of a bee or a bee colony to a disease caused by the bee virus.


In some embodiments, the trigger polynucleotide is single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double stranded DNA-RNA hybrid.


In some embodiments, the trigger polynucleotide downregulates the viral gene. In some embodiments, the viral gene encodes a coat protein, RdRp, VP1, VP2, or helicase. In some embodiments, the trigger polynucleotide comprises a nucleic acid sequence having at least about 80%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity, or having 100% sequence identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs:1-21, or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9, or 10 different trigger polynucleotides, which target different viruses, or target different genes of the same virus, or target different fragments of a viral gene.


The present disclosure also provides a method for reducing viral load in a bee colony, the method comprising reducing viral load in a parasite of the bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby suppressing viral replication in the parasite and reducing the viral load in the bee colony. In some embodiments, the parasite is a Varroa destructor mite.


The present disclosure further provides a method for reducing the susceptibility of a bee to a disease caused by a bee virus, the method comprising providing to a parasite of the bee a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a sequence of at least 21 contiguous nucleotides of a bee viral gene, thereby suppressing viral replication in the parasite and reducing the susceptibility of the bee to a disease caused by the bee virus. In some embodiments, the disease is Colony Collapse Disorder (CCD). In some embodiments, the parasite is a Varroa destructor mite.


In some embodiments, the composition comprising an effective amount of the trigger polynucleotide is provided by spraying the Varroa mite, by directly feeding the Varroa mite, by directly feeding the bees in a bee colony, or any combination thereof.


In one aspect, the present disclosure provides a method for reducing viral load or suppressing viral replication in a Varroa destructor mite, the method comprising providing to the Varroa destructor mite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication or reducing viral load in the Varroa destructor mite.


In one aspect, the present disclosure provides a method for reducing viral load or suppressing viral replication in a bee or a bee colony, the method comprising providing to the bee or bee colony a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication or reducing viral load in the bee or bee colony.


In one aspect, the present disclosure provides a method of reducing viral load or suppressing viral replication in a bee or a bee colony, the method comprising reducing viral load or suppressing viral replication in a parasite of the bee or bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication in the parasite and reducing the viral load in the bee colony. In some embodiments, the parasite is Varroa destructor.


In one aspect, the present disclosure provides a method for reducing viral load or suppressing viral replication in a Varroa destructor mite, the method comprising administering to the Varroa destructor mite a composition comprising an effective amount of at least one trigger polynucleotide which comprises a nucleic acid sequence that downregulates expression of a viral gene in the Varroa destructor mite, thereby reducing viral load or suppressing viral replication in the Varroa destructor mite. In some embodiments, the nucleic acid sequence is a trigger polynucleotide that is essentially identical or essentially complementary to the viral gene or a fragment thereof.


In one aspect, the present disclosure provides for reducing viral load or suppressing viral replication in a bee colony, the method comprising reducing viral load or suppressing viral replication in a parasite of the bee colony by providing to the parasite a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication in the parasite and reducing viral expression in the bee colony. In some embodiments, the parasite is Varroa destructor.


In one aspect, the present disclosure provides a method for reducing the susceptibility of a bee to a disease caused by a bee virus, the method comprising providing to a parasite of the bee a composition comprising an effective amount of a trigger polynucleotide comprising a nucleic acid sequence that is essentially identical or essentially complementary to a viral sequence, thereby suppressing viral replication in the parasite and reducing the susceptibility of the bee to a disease caused by the bee virus. In some embodiments, the parasite is Varroa destructor. In some embodiments, the disease is Colony Collapse Disorder (CCD).


As used herein, the term “trigger” or “trigger polynucleotide” refers to a bioactive polynucleotide molecule that is substantially homologous or complementary to a polynucleotide sequence of a target gene or an RNA expressed from the target gene or a fragment thereof and functions to suppress the expression of the target gene or produce a knock-down phenotype. Trigger polynucleotides are capable of inhibiting or “silencing” the expression of a target gene. Trigger polynucleotides are generally described in relation to their “target sequence.” Trigger polynucleotides may be single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double-stranded DNA/RNA hybrids. Trigger polynucleotides may comprise naturally-occurring nucleotides, modified nucleotides, nucleotide analogues or any combination thereof. In some embodiments, a trigger polynucleotide may be incorporated within a larger polynucleotide, for example in a pri-miRNA molecule. In some embodiments, a trigger polynucleotide may be processed into a small interfering RNA (siRNA). In an aspect, the trigger polynucleotide is capable of inhibiting the expression of a viral gene. In another aspect, the trigger polynucleotide is capable of being used in methods to inhibit the expression of a viral gene and thereby reduce the viral load of a host organism. In certain aspects, the viral gene is a DWV, VDV-1, IAPV, ABPV, KBV, or LSV gene and the host organism is Varroa destructor.


As used herein, the term “target sequence” or “target gene” refers to a nucleotide sequence that occurs in a gene or gene product against which a trigger polynucleotide is directed. In this context, the term “gene” means a locatable region of genomic sequence, corresponding to a unit of inheritance, which includes regulatory regions, such as promoters, enhancers, 5′ untranslated regions, intron regions, 3′ untranslated regions, transcribed regions, and other functional sequence regions that may exist as native genes or transgenes in a plant genome.


Depending upon the circumstances, the term target sequence or target gene can refer to the full-length nucleotide sequence of the gene or gene product targeted for suppression or the nucleotide sequence of a portion of the gene or gene product targeted for suppression.


As used herein, the term “derived from” refers to a specified nucleotide sequence that may be obtained from a particular specified source or species, albeit not necessarily directly from that specified source or species.


As used herein, the terms “sequence”, “nucleotide sequence” or “polynucleotide sequence” refer to the nucleotide sequence of a DNA molecule, an RNA molecule or a portion thereof.


The term “polynucleotide” refers to any polymer of mononucleotides that are linked by internucleotide bonds. Polynucleotides may be composed of naturally-occurring ribonucleotides, naturally-occurring deoxyribonucleotides, analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or any combination thereof. Where a polynucleotide is single-stranded, its length can be described in terms of the number of nucleotides. Where a polynucleotide is double-stranded, its length can be described in terms of the number of base pairs.


As used herein, the term “non-transcribable polynucleotide” refers to a polynucleotide that does not comprise a complete polymerase II transcription unit.


The term “gene expression” refers to the process of converting genetic information encoded in genomic DNA into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through transcription of the gene via the enzymatic action of an RNA polymerase, and into protein, through translation of mRNA. Gene expression can be regulated at many stages in the process.


In the embodiments described herein, viral sequences are selected as targets for trigger polynucleotides. In some embodiments, target sequences are selected for including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55%. In some embodiments, several target sites are selected along the length of the target gene.


In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a viral gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleic acid that is essentially complementary or essentially identical to a sequence of at least 21 contiguous nucleotides of a bee viral gene. In some embodiments, the trigger polynucleotide comprises a nucleic acid that is essentially complementary or essentially identical to a sequence of at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 contiguous nucleotides of a bee viral gene. In some embodiments, the viral gene encodes a coat protein, RdRp, Viral Protein 1 (VP1), VP2, or Helicase. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a DWV or a IAPV gene, or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a LSV gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to an Acute Bee Paralysis gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a Kashmir Bee Virus gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a Black Queen Cell Virus gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a Chronic Paralysis Virus gene or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleotide sequence that is essentially complementary or essentially identical to a Cloudy Wing Virus gene or a fragment thereof.


Multiple bee-pathogen sequences can be designed to include sequences suitable for producing trigger polynucleotides effective against more than one bee virus. Such multiple bee-pathogen dsRNA can be of the long or short variety, and may include sequences corresponding to homologous sequences within a class of bee viruses. Further, multiple sequences can be designed to include two or more dsRNA sequences of the same bee-pathogen.


By “essentially identical” or “essentially complementary,” it is meant that the bioactive polynucleotide trigger (or at least one strand of a double-stranded polynucleotide or portion thereof, or a portion of a single strand polynucleotide) hybridizes under physiological conditions to the endogenous gene, an RNA transcribed there from, or a fragment thereof, to effect regulation or suppression of the endogenous gene. For example, in some embodiments, a bioactive polynucleotide trigger has 100 percent sequence identity or at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive polynucleotide trigger has 100 percent sequence complementarity or at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive polynucleotide trigger has 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene (coding or non-coding sequence of a gene). In some embodiments, a bioactive polynucleotide trigger has at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene. In some embodiments, a bioactive polynucleotide trigger has 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene.


As used herein, nucleic acid sequence molecules are said to exhibit “complete complementarity” when every nucleotide of one of the sequences read 5′ to 3′ is complementary to every nucleotide of the other sequence when read 3′ to 5′. A nucleotide sequence that is completely complementary to a reference nucleotide sequence will exhibit a sequence identical to the reverse complement sequence of the reference nucleotide sequence.


It will be appreciated that a trigger polynucleotide, for example dsRNA, of the present disclosure need not be limited to those molecules containing only natural nucleotides, but further encompasses chemically-modified nucleotides and non-nucleotides. Trigger polynucleotide agents of the present disclosure may also include base modifications or substitutions. As used herein, “unmodified” or “natural” bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified bases include but are not limited to other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further bases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-2, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Such bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi Y S et al. (1993) Antisense Research and Applications, CRC Press, Boca Raton 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.


Following synthesis, the trigger polynucleotides of the present disclosure may optionally be purified. For example, polynucleotides can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, trigger polynucleotides may be used with no, or a minimum of, purification to avoid losses due to sample processing. The trigger polynucleotides may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.


As used herein, the terms “homology” and “identity” when used in relation to nucleic acids, describe the degree of similarity between two or more nucleotide sequences. The percentage of “sequence identity” between two sequences is determined by comparing two optimally aligned sequences over a comparison window, such that the portion of the sequence in the comparison window may comprise additions or deletions (gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa. An alignment of two or more sequences may be performed using any suitable computer program. For example, a widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994).


As used herein, a “control organism” means an organism that does not contain the trigger polynucleotide, or other nucleic acid that provides for control of a viral infection or viral replication. Control organisms are generally from same species and of the same developmental stage which is grown under the same growth conditions as the treated organism. Similarly, a “control colony” means a colony of organisms that do not contain the trigger polynucleotide or other nucleic acid that provides for control of viral infection or viral replication. Control colonies of organisms are generally from same species and of the same developmental stage which are grown under the same growth conditions as the treated colony of organisms.


As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition. In an aspect according to the present disclosure, a composition may be used to treat an organism or colony of organisms for viral infection. In an aspect, a dsRNA composition may be used to treat a host organism or a parasite for viral infection. In an aspect, the host organism is a bee and the parasite is the mite, Varroa destructor. In an aspect, the present disclosure provides a method for treating Colony Collapse Disorder (CCD).


As used herein, the terms “improving,” “improved,” “increasing,” and “increased” refer to at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or greater increase in an organism or colony population, in increased productivity of an organism or colony (e.g., increased honey productions), increase growth rate of an organism or colony, or increased reproductive rate as compared to a control organism or colony. The present disclosure provides for methods of improving the health of an organism or colony by providing an antiviral composition.


As used herein, “viral load”, also known as “viral burden,” “viral titer”, “viral level” or “viral expression” in some embodiments, is a measure of the severity of a viral infection, and can be calculated by estimating the amount of virus in an infected organism, an involved body fluid, or an affected colony. It can also be calculated by estimating or measuring the amount of the sense strand of a bee virus sequence in an infected organism, an involved body fluid, or an affected colony.


As used herein, “a reduction” of the level of an agent such as a protein or mRNA means that the level is reduced relative to an organism or colony lacking a trigger polynucleotide, for example a dsRNA molecule, capable of reducing the agent. Also as used herein, “a reduction” in reference to viral load, means that the viral load is reduced relative to an organism or colony lacking a nucleic acid or other dsRNA molecule capable of reducing the viral load. The present disclosure provides for, and includes, methods and compositions for reducing the level of a viral protein or viral gene expression and reducing the viral load. The present disclosure also provides for methods and compositions for reducing the level of a viral replication in a Varroa mite or in a bee.


As used herein, the term “at least a partial reduction” of the level of an agent such as a protein or mRNA means that the level is reduced at least 25% relative to an organism or colony lacking a trigger polynucleotide, for example a dsRNA molecule, capable of reducing the agent. Also as used herein, “at least a partial reduction” in reference to viral load, means that the level is reduced at least 25% relative to an organism or colony lacking a nucleic acid or other dsRNA molecule capable of reducing the viral load. The present disclosure provides for, and includes, methods and compositions for at least partially reducing the level of a viral protein or viral gene expression and at least partially reducing the viral load.


As used herein, “a substantial reduction” of the level of an agent such as a protein or mRNA means that the level is reduced relative to an organism or colony lacking a trigger polynucleotide, for example a dsRNA molecule, capable of reducing the agent, where the reduction of the level of the agent is at least 75%. Also as used herein, “a substantial reduction” in reference to viral load, means that the viral load is reduced at least 75% relative to an organism or colony lacking a nucleic acid or other dsRNA molecule capable of reducing the viral load. The present disclosure provides for, and includes, methods and compositions for substantially reducing the level of a viral protein or viral gene expression and substantially reducing the viral load.


As used herein, “an effective elimination” of an agent such as a protein or mRNA is relative to an organism or colony lacking trigger polynucleotide, for example a dsRNA molecule, capable of reducing the agent, where the reduction of the level of the agent is greater than 95%. A trigger polynucleotide, preferably a dsRNA molecule, is preferably capable of providing at least a partial reduction, more preferably a substantial reduction, or most preferably effective elimination of another agent such as a viral protein or viral gene expression, or a virus, wherein the agent leaves the level of expression of a host gene, essentially unaffected, substantially unaffected, or partially unaffected. Also as used herein, “an effective elimination” in reference to viral load, means that the viral load is reduced at least 95% relative to an organism or colony lacking a nucleic acid or other dsRNA molecule capable of reducing the viral protein, viral gene expression or viral load. The present disclosure provides for, and includes, methods and compositions for the effective elimination of a viral protein or viral gene expression and effectively eliminating viral infection.


As used herein, the terms “suppress,” “repress,” and “downregulate” when referring to the expression or activity of a nucleic acid molecule in an organism are used equivalently herein and mean that the level of expression or activity of the nucleic acid molecule in a cell of an organism or a colony after applying a method of the present disclosure is lower than its expression or activity in the cell of an organism or a colony before applying the method, or compared to a control organism or colony lacking a nucleic acid molecule of the disclosure. The present disclosure provides for, and includes, methods and compositions for suppressing, repressing and down-regulating the level of a viral protein or viral gene expression and suppressing, repressing and down-regulating the level viral infection in an organism or colony. The present disclosure also provides for methods and compositions for suppressing, repressing and down-regulating the level of a viral replication in an organism or colony. In some embodiments, the organism is a Varroa mite. In some embodiments, the organism is a bee. In some embodiments, the colony is a bee colony.


The terms “suppressed,” “repressed” and “downregulated” as used herein are synonymous and mean herein lower, preferably significantly lower, expression or activity of the targeted nucleic acid molecule. Also as used herein, “suppressed,” “repressed” and “downregulated” in reference to viral infection or viral load, means that the level of infection or viral load is lower, preferably significantly lower relative to an organism or colony lacking a nucleic acid or other dsRNA molecule capable of reducing viral gene expression. The present disclosure provides for, and includes, methods and compositions for suppressing, repressing and down-regulating the expression or activity of a viral protein or viral gene and suppressing, repressing and down-regulating the infectivity of viruses.


In some embodiments, the trigger polynucleotide is single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double-stranded DNA/RNA hybrid. In some embodiments, the trigger polynucleotide is dsRNA.


In some embodiments, the trigger polynucleotide comprises a nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, or having 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-21, or a fragment thereof. In some embodiments, the trigger polynucleotide comprises a nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence complementarity, or having 100% sequence complementarity to a sequence selected from the group consisting of SEQ ID NOs: 1-21, or a fragment thereof. In some embodiments, the trigger polynucleotide composition comprises a nucleic acid sequence having essential identity or essential complementarity to a sequence consisting of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 contiguous nucleotides from a sequence selected from SEQ ID NOs: 1-21.


In certain aspects, the present disclosure provides a dsRNA composition comprising a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs: 1 to 21, or a fragment thereof. In certain aspects, the dsRNA composition comprises a nucleotide sequence having 100% identity or complementarity to a sequence selected from SED ID NOs: 1-21, or a fragment thereof. In another aspect, the present disclosure provides a DNA encoding at least one dsRNA precursor comprising a nucleotide sequence having 100% identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs: 1 to 21, or a fragment thereof, or having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity to a sequence selected from SEQ ID NOs: 1 to 21, or a fragment thereof. In yet another aspect, the present disclosure provides a recombinant DNA encoding at least one dsRNA precursor comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 21, or a fragment thereof, a heterologous promoter and a transcription terminator sequence are provided. In another aspect, the present disclosure provides a recombinant DNA encoding at least one dsRNA precursor comprising a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity or complementarity to a sequence selected from the group consisting of SEQ ID NOs: 1 to 21, or a fragment thereof, and further comprising a heterologous promoter and a transcription terminator.


In several embodiments, the present disclosure provides a composition comprising at least one trigger polynucleotide. In some embodiments, the composition comprises a mixture of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different trigger polynucleotides. In some embodiments, the composition comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9, or 10 different trigger polynucleotides. In some embodiments, the trigger polynucleotides can target different viruses. In some embodiments, the trigger polynucleotides can target different genes of the same virus. In some embodiments, the trigger polynucleotides can target different fragments of a viral sequence or a viral gene.


It will be appreciated that the trigger polynucleotides, for example dsRNA, can be delivered to the pest or parasite in a great variety of ways. According to one aspect, the trigger polynucleotides are delivered directly to the parasite (e.g. by spraying a mite infested hive). The trigger polynucleotides, or constructs encoding same may enter the mites' bodies by diffusion. In another aspect, the trigger polynucleotides are indirectly delivered via a host organism (e.g., by providing a bee food comprising the trigger polynucleotide to a bee). In an aspect, the parasite is Varroa destructor. In one aspect, the host organism is a bee.


It will be appreciated that since many parasites use their mouths to puncture the host arthropod exoskeleton and feed on the arthropod's hemolymph, the present disclosure contemplates delivering the trigger polynucleotides, for example dsRNA, of the present disclosure to the host arthropod, whereby they become presented in the host arthropod hemolymph thereby becoming available to the parasite. Thus, according to another aspect, the nucleic acid agents are delivered indirectly to the parasite (for example to a mite via a host bee). In certain aspects, the pest or parasite is Varroa destructor and the host arthropod is a bee.


According to one aspect, the trigger polynucleotides, for example dsRNA, are delivered to the infested hosts by spraying. The trigger polynucleotides, for example dsRNA, or constructs encoding same may enter the host's bodies by diffusion. In certain aspects, the pest or parasite is Varroa destructor and the host arthropod is a bee.


According to another aspect, the trigger polynucleotides, for example dsRNA, are delivered to the host via its food. The present inventors consider that following ingestion of the trigger polynucleotides of the present disclosure, the trigger polynucleotides can be presented, for example, in a host arthropod in the host's hemolymph, whereby it becomes available to the parasite, for example a Varroa mite.


In one aspect, the polynucleotides of the present disclosure can be synthesized in vitro and added to the food. For example double stranded RNA can be synthesized by adding two opposing promoters (e.g. T7 promoters) to the ends of the gene segments, wherein the promoter is placed immediately 5′ to the gene and the promoter is placed immediately 3′ to the gene segment in the opposite orientation. The dsRNA can then be transcribed in vitro with the T7 RNA polymerase.


Non-limiting examples of sequences for synthesizing dsRNA according to aspects of the present disclosure are provided in SEQ ID NOs: 1-21. Full length or a fragment of these sequences can be used as the template.


This application provides and discloses compositions comprising a trigger polynucleotide and an excipient substance. In an aspect, the excipient can be a combination of one or more inactive components. In some aspects, the excipient comprises a sugar. Examples of sugars include hexoses, disaccharides, trisaccharides and higher sugars. Excipient sugars include, for example, fructose, glucose, sucrose, trehalose, lactose, galactose, ribose. In other aspects the excipient comprises a sugar and a solvent. In other aspects, the excipient comprises a protein. In an aspect, the protein is a soy protein. In other aspects the excipient is pollen. In aspects according to the present disclosure, the excipient is a bee food.


In some embodiments, the excipient comprises one or more substance selected from: a sugar, a solvent, a protein, a bee food, and any combination thereof. In some embodiments, the sugar is selected from: fructose, glucose, sucrose, trehalose, lactose, galactose, ribose and any combination thereof. In some embodiments, the bee food is selected from: honey, pollen, Wheast, soybean flour, yeast, yeast product, and any combination thereof.


Bee feeding is common practice amongst bee-keepers, for providing both nutritional and other, for example, supplemental needs. Bees typically feed on honey and pollen, but have been known to ingest non-natural feeds as well. Bees can be fed various foodstuffs including, but not limited to Wheast (a dairy yeast grown on cottage cheese), soybean flour, yeast (e.g. brewer's yeast, torula yeast) and yeast products products-fed singly or in combination and soybean flour fed as a dry mix or moist cake inside the hive or as a dry mix in open feeders outside the hive. Also useful is sugar, or a sugar syrup. The addition of 10 to 12 percent pollen to a supplement fed to bees improves palatability. The addition of 25 to percent pollen improves the quality and quantity of essential nutrients that are required by bees for vital activity. Cane or beet sugar, isomerized corn syrup, and type-50 sugar syrup are satisfactory substitutes for honey in the natural diet of honey bees. The last two can be supplied only as a liquid to bees. Liquid feed can be supplied to bees inside the hive by, for example, any of the following methods: friction-top pail, combs within the brood chamber, division board feeder, boardman feeder, etc. Dry sugar may be fed by placing a pound or two on the inverted inner cover. A supply of water must be available to bees at all times. In one aspect, pan or trays in which floating supports—such as wood chips, cork, or plastic sponge—are present are envisaged. Detailed descriptions of supplemental feeds for bees can be found in, for example, USDA publication by Standifer, et al. 1977, entitled “Supplemental Feeding of Honey Bee Colonies” (USDA, Agriculture Information Bulletin No. 413).


In some embodiments, bee feeding comprises providing a bee-ingestible composition selected from the group consisting of a liquid bee-ingestible composition and a solid bee-ingestible composition to the host bee.


In aspects according to the present disclosure a trigger polynucleotide, for example a dsRNA, is combined with an excipient. In an aspect, the trigger polynucleotide, for example dsRNA, can be provided as a ratio of trigger polynucleotide to excipient. In an aspect, the ratio is one part trigger polynucleotide to 4 parts excipient. In an aspect the ratio of trigger polynucleotide to excipient is 1:1, 1:2, 1:5, or 1:10. In other aspects, the ratio of trigger polynucleotide to excipient is 1:20, 1:25, 1:30, 1:40, or more. In an aspect, ratio of trigger polynucleotide to excipient is 1:50. In aspects according to the present disclosure, the ratio can be determined as a volume to volume (v/v) ratio, a weight:weight (w/w) ratio, or a weight:volume (w/v) ratio. In certain aspects, the ratio is expressed as a volume to volume (v/v) ratio, a weight:weight (w/w) ratio, or a weight:volume (w/v) ratio.


In aspects according to the present disclosure, the composition can comprise a weight of trigger polynucleotide, for example dsRNA, combined with an excipient. In an aspect, the trigger polynucleotide comprises a percentage of the total weight of the composition. In an aspect, the trigger polynucleotide comprises about 0.1% by weight of the composition. In an aspect, the trigger polynucleotide comprises about 0.2% by weight of the composition. In an aspect, the trigger polynucleotide comprises about 0.3% by weight of the composition. In another aspect, the trigger polynucleotide comprises about 0.4% by weight of the composition. In an aspect, the trigger polynucleotide comprises up to 0.5% by weight of the composition. In an aspect, the trigger polynucleotide comprises up to 0.6% by weight of the composition. In an aspect, the trigger polynucleotide comprises up to 0.7% by weight of the composition. In an aspect, the trigger polynucleotide comprises up to 0.8% by weight of the composition. In another aspect, the trigger polynucleotide comprises up to 1.0% by weight of the composition. In other aspects, the trigger polynucleotide comprises up to 1.5% by weight of the composition. In yet other aspects, the trigger polynucleotide comprises up to 2.0% by weight, or 2.5% by weight of the composition.


The present disclosure provides for, and includes, compositions having from 0.1% to 5% by weight trigger polynucleotide. In other aspects, a composition comprises from 0.1 to 4%, 0.1 to 3%, 0.1 to 2%, 0.1 to 1%, 0.1 to 2%, 0.1 to 3%, or 0.1 to 4% by weight trigger polynucleotide. In an aspect, a composition comprises from 0.2% to 5% by weight trigger polynucleotide. In other aspects, a composition comprises from 0.2 to 4%, 0.2 to 3%, 0.2 to 2%, 0.2 to 1%, 0.2 to 2%, 0.2 to 3%, or 0.2 to 4% by weight trigger polynucleotide. In other aspects, a composition comprises up to 1%, up to 2%, up to 3%, up to 4%, or up to 5% trigger polynucleotide. In other aspects, a composition comprises up to 7.5%, up to 10%, or up to 15% trigger polynucleotide.


The present disclosure provides for, and includes, compositions having from 0.01 to 20 mg/ml trigger polynucleotide. In some aspects, a composition comprises from 0.01 to 0.1 mg/ml, 0.01 to 1.0 mg/ml, 0.01 to 2.0 mg/ml, 0.01 to 2.5 mg/ml, 0.01 to 5 mg/ml, 0.01 to 10 mg/ml, 0.01 to 15 mg/ml, or 0.01 to 20 mg/ml trigger polynucleotide. In other aspects, a composition comprises from 0.1 to 1.0 mg/ml, 0.1 to 2.0 mg/ml, 0.1 to 2.5 mg/ml, 0.1 to 5 mg/ml, 0.1 to 10 mg/ml, 0.1 to 15 mg/ml, or 0.1 to 20 mg/ml trigger polynucleotide. In certain aspects, a composition comprises at least 0.01 μg/ml trigger polynucleotide. In certain aspects, a composition comprises at least 0.1 μg/ml trigger polynucleotide. In certain other aspects, a composition comprises at least 1.0 μg/ml trigger polynucleotide. In yet other aspects, a composition comprises at least 10 μg/ml trigger polynucleotide. In yet other aspects, a composition comprises at least 15 μg/ml trigger polynucleotide. In yet other aspects, a composition comprises at least 20 μg/ml trigger polynucleotide. In an aspect, a composition comprises from 0.01 to 0.5 mg/ml trigger polynucleotide. In an aspect, a composition comprises from 0.5 to 10 mg/ml trigger polynucleotide. In other aspects, a composition comprises from 0.5 to 1.0 mg/ml, 0.5 to 2.0 mg/ml, 0.5 to 2.5 mg/ml, 0.5 to 5 mg/ml, 0.5 to 10 mg/ml, 0.5 to 15 mg/ml, or 0.5 to 20 mg/ml trigger polynucleotide. In an aspect, a composition comprises from 1.0 to 10 mg/ml trigger polynucleotide. In other aspects, In other aspects, a composition comprises from 0.01 to 0.02 mg/ml, 0.02 to 0.03 mg/ml, 0.03 to 0.04 mg/ml, 0.04 to 0.05 mg/ml, 0.05 to 0.06 mg/ml, 0.06 to 0.07 mg/ml, 0.07 to 0.08 mg/ml, 0.08 to 0.09 mg/ml, 0.09 to 0.1 mg/ml, 0.1 to 0.2 mg/ml, 0.2 to 0.3 mg/ml, 0.3 to 0.4 mg/ml, 0.4 to 0.5 mg/ml, 0.5 to 0.6 mg/ml, 0.6 to 0.7 mg/ml, 0.7 to 0.8 mg/ml, 0.8 to 0.9 mg/ml, 0.9 to 1.0 mg/ml, 1.0 to 2.0 mg/ml, 1.0 to 2.5 mg/ml, 2.0 to 3.0 mg/ml, 3.0 to 4.0 mg/ml, 4.0 to 5.0 mg/ml, 5.0 to 6.0 mg/ml, 6.0 to 7.0 mg/ml, 7.0 to 8.0 mg/ml, 8.0 to 9.0 mg/ml, 9.0 to 10.0 mg/ml, 10.0 to 12.0 mg/ml, 12.0 to 13.0 mg/ml, 13.0 to 14.0 mg/ml, 14.0 to 15.0 mg/ml, 15.0 to 16.0 mg/ml, 16.0 to 17.0 mg/ml, 17.0 to 18.0 mg/ml, 18.0 to 19.0 mg/ml, 19.0 to 20.0 mg/ml, 1.0 to 5 mg/ml, 1.0 to 10 mg/ml, 1.0 to 15 mg/ml, or 1.0 to 20 mg/ml trigger polynucleotide. In some aspects, a composition comprises about 0.1 μg/ml, about 0.2 μg/ml, about 0.5 μg/ml, about 1.0 μg/ml, about 2.0 μg/ml, about 5.0 μg/ml, about 10 μg/ml, about 0.02 mg/ml, about 0.05 mg/ml, about 0.1 mg/ml, about 0.125 mg/ml, about 0.2 mg/ml, about 0.25 mg/ml, about 0.3 mg/ml, about 0.4 mg/ml, about 0.5 mg/ml, about 0.6 mg/ml, about 0.7 mg/ml, about 0.8 mg/ml, about 0.9 mg/ml, about 1.0 mg/ml, about 1.5 mg/ml, about 2.0 mg/ml, about 2.5 mg/ml, about 3.0 mg/ml, about 3.5 mg/ml, about 4.0 mg/ml, about 4.5 mg/ml, about 5.0 mg/ml, about 5.5 mg/ml, about 6.0 mg/ml, about 6.5 mg/ml, about 7.0 mg/ml, about 7.5 mg/ml, about 8.0 mg/ml, about 8.5 mg/ml, about 9.0 mg/ml, about 9.5 mg/ml, about 10 mg/ml, about 11 mg/ml, about 12 mg/ml, about 13 mg/ml, about 14 mg/ml, about 15 mg/ml, about 16 mg/ml, about 17 mg/ml, about 18 mg/ml, about 19 mg/ml, or about 20 mg/ml trigger polynucleotide.


In some aspects, a composition comprises from about 1 mg to about 2000 mg trigger polynucleotide per bee colony. In certain aspects, a composition comprises from about 1 mg to about 100 mg, from about 1 mg to about 200 mg, from about 1 mg to about 300 mg, from about 1 mg to about 400 mg, from about 1 mg to about 500 mg, from about 1 mg to about 600 mg, from about 1 mg to about 700 mg, from about 1 mg to about 800 mg, from about 1 mg to about 900 mg, from about 1 mg to about 1000 mg, from about 1 mg to about 1200 mg, from about 1 mg to about 1500 mg, from about 1 mg to about 1800 mg, from about 10 mg to about 100 mg, from about 10 mg to about 200 mg, from about 10 mg to about 300 mg, from about 10 mg to about 400 mg, from about 10 mg to about 500 mg, from about 10 mg to about 600 mg, from about 10 mg to about 700 mg, from about 10 mg to about 800 mg, from about 10 mg to about 900 mg, from about 10 mg to about 1000 mg, from about 10 mg to about 1200 mg, from about 10 mg to about 1500 mg, from about 10 mg to about 1800 mg, or from about 10 mg to about 2000 mg trigger polynucleotide per bee colony. In other aspects, a composition comprises about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, or about 2000 mg trigger polynucleotide per bee colony.


The present disclosure provides for, and includes, methods for reducing the viral load of an organism. In some embodiments, the organism is a parasite. In an aspect, the viral load refers to the number of viruses per individual host. In an aspect, the viral load refers to the average number of viruses per 100 host organisms. In an aspect, the viral load refers to the number of viruses per colony of parasite hosts. In another aspect, the viral load is determined by measuring the viral expression in a host, such as a bee or a Varroa mite. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera.


In one aspect, the methods of reducing viral infection comprises providing an effective amount of a trigger, for example dsRNA, composition to a host organism on which a parasite feeds. In another aspect, the methods of reducing viral infection comprises providing an effective amount of a trigger, for example dsRNA, composition directly to a parasitic organism. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera. An effective amount of a composition of the present disclosure results in a decrease in viral infection in the host and/or parasite over a period of time. In an aspect, a decrease in viral infection can be measured within one day or within two days of providing an effective amount of a trigger, for example dsRNA, composition. In an aspect, viral infection can be measured after two days. In an aspect, viral infection can be measured after 3 days. In other aspects, viral infection can be measured after 4 days, after 5 days, after 6 days, after 7 days, after 1 week, after two weeks, after 3 weeks, or after a month. In another aspect, viral infection can be measured more than one time, for example, every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a week, twice a week, three times a week, once a month, twice a month, or three times a month. In certain aspects, according to the present disclosure, a decrease in viral infection can be measured and compared to an untreated control host organism, parasite, or colony. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera.


In one aspect, the methods of reducing viral replication comprises providing an effective amount of a trigger, for example dsRNA, composition to a host organism on which a parasite feeds. In another aspect, the methods of reducing viral replication comprises providing an effective amount of a trigger, for example dsRNA, composition directly to a parasitic organism. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera. An effective amount of a composition of the present disclosure results in a decrease in viral gene expression in the host and/or parasite over a period of time. In an aspect, a decrease in viral gene expression can be measured within one day or within two days of providing an effective amount of a trigger, for example dsRNA, composition. In an aspect, viral replication can be measured after two days. In an aspect, viral replication may be measured after 3 days. In other aspects, viral replication can be measured after 4 days, after 5 days, after 6 days, after 7 days, or after 1 week, after two weeks, after 3 weeks, or after a month. In another aspect, viral replication can be measured more than one time, for example, every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a week, twice a week, three times a week, once a month, twice a month, or three times a month. In certain aspects, according to the present disclosure, a decrease in viral replication can be measured and compared to an untreated control host organism, parasite, or colony. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera.


In one aspect, the methods of reducing a viral load comprises providing an effective amount of a trigger, for example dsRNA, composition to a host organism on which a parasite feeds. In another aspect, the methods of reducing a viral load comprises providing an effective amount of a trigger, for example dsRNA, composition directly to a parasitic organism. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera. An effective amount of a composition of the present disclosure results in a decrease in the viral load in the host and/or parasite over a period of time. In an aspect, a decrease in viral load is measured within one day or within two days of providing an effective amount of a trigger, for example dsRNA, composition. In an aspect, the viral load can be measured after two days. In an aspect, the viral load can be measured after 3 days. In other aspects, the viral load can be measured after 4 days, after 5 days, after 6 days, after 7 days, after 1 week, after two weeks, after three weeks, or after a month. In another aspect, the viral load can be measured more than one time, for example, every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month. In certain aspects, according to the present disclosure, a decrease in the viral load can be measured and compared to an untreated control host organism, parasite, or colony. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera.


In some aspects according to the present disclosure, a reduction in viral load or a reduction in viral infection after a period of time means a decrease in viral titer. In an aspect, viral titer is decreased by about 10%, 20%, 30% or more between measurements. In another aspect, viral titer is decreased by about 40% or more between measurements. In another aspect, viral titer is decreased by about 50% or more between measurements. In another aspect, viral titer is decreased by about 60% or more between measurements. In another aspect, viral titer is decreased by about 70% or more between measurements. In another aspect, viral titer is decreased by about 80% or more between measurements. In another aspect, viral titer is decreased by about 90% or more between measurements. In some embodiments, the viral titer in a host organism or a parasite provided with an effective amount of a trigger polynucleotide is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared with the viral titer in a host organism or a parasite that is not provided with the trigger polynucleotide. In some embodiments, the viral titer is measured within 1 day, within 2 days, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, after 7 days, or after 1 week, after 2 weeks, after 3 weeks, or after a month of providing the trigger polynucleotide. In some embodiments, the viral titer is measured more than once. In some embodiments, the viral titer is measured every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month. In one aspect, the host organism is a bee. In one aspect, the parasite is Varroa destructor.


In some aspects according to the present disclosure, a reduction in viral load or a reduction in viral infection after a period of time means a decrease in viral expression. In an aspect, viral expression is decreased by about 10%, 20%, 30% or more between measurements. In another aspect, viral expression is decreased by about 40% or more between measurements. In another aspect, viral expression is decreased by about 50% or more between measurements. In another aspect, viral expression is decreased by about 60% or more between measurements. In another aspect, viral expression is decreased by about 70% or more between measurements. In another aspect, viral expression is decreased by about 80% or more between measurements. In another aspect, viral expression is decreased by about 90% or more between measurements. In some embodiments, the viral expression in a host organism or a parasite provided with an effective amount of a trigger polynucleotide is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared with the viral expression in a host organism or a parasite that is not provided with the trigger polynucleotide. In some embodiments, the viral expression is measured within 1 day, within 2 days, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, after 7 days, or after 1 week, after 2 weeks, after 3 weeks, or after a month of providing the trigger polynucleotide. In some embodiments, the viral expression is measured more than once. In some embodiments, the viral expression is measured every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month. In one aspect, the host organism is a bee. In one aspect, the parasite is Varroa destructor.


In some aspects according to the present disclosure, a reduction in viral load or a reduction in viral infection after a period of time means a decrease in viral replication. In an aspect, viral replication is decreased by about 10%, 20%, 30% or more between measurements. In another aspect, viral replication is decreased by about 40% or more between measurements. In another aspect, viral replication is decreased by about 50% or more between measurements. In another aspect, viral replication is decreased by about 60% or more between measurements. In another aspect, viral replication is decreased by about 70% or more between measurements. In another aspect, viral replication is decreased by about 80% or more between measurements. In another aspect, viral replication is decreased by about 90% or more between measurements. In some embodiments, the viral replication in a host organism or a parasite provided with an effective amount of a trigger polynucleotide is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared with the viral replication in a host organism or a parasite that is not provided with the trigger polynucleotide. In some embodiments, the viral replication is measured within 1 day, within 2 days, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, after 7 days, or after 1 week, after 2 weeks, after 3 weeks, or after a month of providing the trigger polynucleotide. In some embodiments, the viral replication is measured more than once. In some embodiments, the viral replication is measured every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month. In one aspect, the host organism is a bee. In one aspect, the parasite is Varroa destructor.


In aspects according to the present disclosure, a reduction in viral load after a period of time results in a decrease in bee mortality. In an aspect, bee mortality is decreased by 10%, 20%, 30% or more between measurements. In another aspect, bee mortality is decreased by 40% or more between measurements. In another aspect, bee mortality is decreased by 50% or more between measurements. In another aspect, bee mortality is decreased by 60% or more between measurements. In another aspect, bee mortality is decreased by 70% or more between measurements. In another aspect, bee mortality is decreased by 80% or more between measurements. In another aspect, bee mortality is decreased by 90% or more between measurements. In some embodiments, bee mortality in a bee colony provided with an effective amount of a trigger polynucleotide is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared with bee mortality in a bee colony that is not provided with the trigger polynucleotide. In some embodiments, bee mortality is measured within 1 day, within 2 days, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, after 7 days, or after 1 week, after 2 weeks, after 3 weeks, or after a month of providing the trigger polynucleotide. In some embodiments, bee mortality is measured more than once. In some embodiments, bee mortality is measured every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month.


In aspects according to the present disclosure, an effective amount of trigger polynucleotide, for example dsRNA, can be provided periodically or continually. In an aspect, an effective amount of a trigger, for example dsRNA, composition can be provided once, twice or three times a day. In other aspects, an effective amount of a trigger, for example dsRNA, composition can be provided once a day. In another aspect, an effective amount of a trigger, for example dsRNA, composition can be provided one or more times every other day. In an aspect, an effective amount of a trigger, for example dsRNA, composition can be provided every two days, every three days, every four days, every five days, every six days, or once a week. In an aspect, an effective amount of a trigger, for example dsRNA, composition can be provided continuously to an organism in need, for example by providing a continuous source of food. In one aspect, an effective amount of a trigger, for example dsRNA, composition can be provided continuously as a bee-ingestible composition. In one aspect, an effective amount of a trigger, for example dsRNA, composition can be provided to a host organism. In another aspect, an effective amount of a trigger, for example dsRNA, composition can be provided directly to a parasitic organism. In aspects according to the present disclosure the parasite is Varroa destructor and the host is the honey bee, Apis mellifera.


The present disclosure provides for methods of reducing the viral load of a honey bee colony comprising providing a bee colony an effective amount of a trigger, for example dsRNA, composition. An effective amount of a trigger polynucleotide composition of the present disclosure results in a reduction of viral gene expression and viral replication over a period of time. In an aspect, a reduction of viral replication or viral expression is measured within one day or within two days of providing an effective amount of a trigger, for example dsRNA, composition. In an aspect, the reduction of viral replication or viral expression can be measured after two days. In an aspect, the reduction of viral replication or viral expression can be measured after 3 days. In other aspects, the reduction of viral replication or viral expression can be measured after 4 days, after 5 days, after 6 days, after 7 days, after 1 week, after two weeks, after three weeks, or after a month. In another aspect, the reduction of viral replication or viral expression can be measured more than one time, for example every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every week, every two weeks, every three weeks, once a month, twice a month, or three times a month. In certain aspects, according to the present disclosure, a reduction of viral replication or viral expression can be measured and compared to an untreated control host organism, parasite, or colony.


In an aspect, the present disclosure provides for methods and compositions for reducing the susceptibility of bees to viral infection. In other aspects, the present disclosure provides for methods and compositions to prevent viral infection of colonies of bees. In another aspect, the present disclosure provides methods for reducing the viral infection of honeybees transmitted by the mite Varroa destructor.


The following Examples are presented for the purposes of illustration and should not be construed as limitations.


Example 1

To test the effect of dsRNA targeting bee viruses in Varroa, the mites were placed on diet plates supplemented with a mix of dsRNA triggers. A non-specific dsRNA having no sequence identity above 19 bp to Varroa genes was used as a non-specific control (SCRAM; SEQ ID NO:24). Varroa mites were collected, RNA extracted and DWV or IAPV expression analyzed using quantitative reverse transcription PCR (Q-PCR).


Experimental Process

First, an artificial diet was prepared as follows in Table 1:









TABLE 1







Artificial Diet Components










Reagent
control
Non specific control
dsRNA mix





Standard LB 1X
1X
1X
1X








Antibiotic
Diluted 1:100 to 1X


Antimycotic


Solution (100x),


Stabilized


(SIGMA A5955)


Nystatin
Diluted 1:100


[5 mg/ml]


KAN [50 mg/ml]
Diluted 1:20


1XPB
To 1 mL










Scrambled

200 μg/mL



Control dsRNA


(SCRAM)


[9 mg/ml]


dsRNA mix


200 μg/mL









In one experiment, the dsRNA trigger mix contained a mixture of SEQ ID NOs: 1-10 from the following dsRNA sequences:









TABLE 2 







dsRNA trigger sequences used in Varroa direct feeding assays








SEQ










ID
Source











NO:
Seq
Sense
Protein













1
IAPV
GAUACAUUGAAAGAUGAGCGUCGACCCAUUGAAAAAGUU
RdRp



Genome 
AAUCAAUUGAAAACACGAGUAUUCUCAAAUGGACCAAUG
(not IR)




GAUUUCUCUAUAGCUUUUCGAAUGUAUUAUUUGGGCUUU





AUAGCUCAUUUGAUGGAAAAUCGAAUUACUAAUGAGGUG





UCCAUUGGAACGAAUGUGUAUUCUCAAGACUGGAGUAAA





ACUGUUCGUAAGUUGACUAAAUUUGGAAAUAAAGUUAU





UGCAGGUGAUUUUUCAACUUUUGAUGGAUCACUGAAUGU





AUGUAUUAUGGAAAAAUUUGC






2
IAPV
GAAACUCCAAAUAGGAUCGAUACCCCCAUGGCUCAGGAU
VP2



Genome
ACUUCAUCGGCUAGGAACAUGGAUGAUAC






3
IAPV
GACGGACCUUCACAUAUAACAUACCCCGUAAUCAAUCCU
VP1 (CP)



Genome
GUGCAUGAAGUAGAAGUUCCAUUCUAUUCUCAGUAUAGG





AAAAUACCUAUCGCUUCAACAUCGGAUAAAGGUUAUGAU





UCCUCUCUAAUGUAUUUUUCAAAUACAGCAACAACUCAA





AUUGUUGCCAGAGCAGGAAACGAUGACUUUACUUUGGU





UGGAUGAUAGGUC






4
IAPV
GCCCCCUAGAUGUGCACUGGGAGACAGACAAAUCUCCCU
VP1 (CP)



Genome
AUGUAUGGCUAUAGUCUAAAUUUUUCACAAAAUUUCAGU





UUAGACCGAAAACCGACAC






5
DWV
GAAGAAAUAUAUAGCUACGUGGUGUAGUAAGCGUCGUGA
Helicase



Genome
ACAUACUGCUGACUUUGAUCUU
to VPg





6
DWV
GCUCCCAAUGCUGAAGCGGAGGAGGCAAGUGCUUGGGUA
Helicase



Genome 
UCCAUUAUUUAUAAUGGUGUGUGUAAUAUGCUUAAUGU





GGCUGCUCAAAAACCGAAACAAUUUAAAGAUUGGGUAAA





AUUAGCUACUGUAGAUUUUAGUAAUAAUUGUAGAGGUA





GUAAUCAGGUAUUUGUAUUUUUCAAGAAUACAUUUGAA





GUGUUGAAGAAAAUGUGGGGUUAUGUAUUUUGUCAGAG





UAAUCCUGCAGCGCGUUUGUUGAAAGCUGUGAAUGACGA





GCCUGAGAUUUUGAAAGC






7
DWV
GAAAGCUGUGAAUGACGAGCCUGAGAUUUUGAAAGCAUG
Helicase



Genome
GGUGAAGGAAUGUC






8
DWV
GGTACAGTTTACCATACCGTTTCGACAGTATTACTTAGACT
RdRp



Genome
TTATGGCATCCTATCGAGCTGCACGACTTAATGCTGAGCAT





GGTATTGGTATTGATGTTAACAGCTTAGAGTGGACAAATTT





GGCAAC






9
DWV
GAAUGGAUAACUCCUGUGUAUAUGGCUAACCGUCGUAAG
Helicase



Genome
GCGAAUGAAUCGUUUAAGAUGCGUGUAGAUGAAAUGCAA





AUGUUACGUAUGGAUGAACCAUUGGAAGGUGAUAAUAU





UCUCAAUAAGUAUGUUGAAGUUAAUCAGCGCUUAGUGGA





GGAAAUGAAGGCAUUUAAGGAGCGUACACUAUGGUCAGA





UUUACAUCGC






10
IAPV
GAAACACAAAAUCACAACGCUUUAAUGAAAGGAUGUGGU
VP1 



Genome
GAGUUUAUUGUAAACUUGCGAACUCUUCUCAGAACCUUU
(not CP)




AGAACAAUAACAGAUAAUUGGAUAUUACAAGC









After plates cooled down, 15 Varroa mites were placed on each plate. Then the plates were sealed with absorbance paper, parafilm and incubated for 72 h in an incubator at 29° C. Following 72 h on LB agar containing treatment, dead/alive mites were counted. As shown in FIG. 2A, the bee viruses trigger mix was not observed to have an effect on Varroa mite mortality.


Both live and dead Varroa were collected for RNA extraction and bee virus levels and replication were analyzed by Q-PCR or QuantiGene® Plex 2.0 (RNA assay platform from Affymetrix). FIG. 2B shows decreased DWV levels in Varroa 72 h following treatment with the bee viruses trigger mix compared to control, as analyzed by Q-PCR.


Example 2

To test the effect of dsRNA targeting bee viruses on viral load (IAPV or DWV) in honeybees and Varroa mites in a minihive environment, the honeybees are placed on a diet supplemented with one or more dsRNA triggers (e.g., SEQ ID NOs: 1-10 and 21) targeting bee virus genes. A non-specific dsRNA having no sequence identity above 19 bp to Varroa genes is used as a non-specific control (SCRAM, e.g., SEQ ID NOs:22, 23, or 24). The blank control contains no dsRNA.


Bee hives with high viral load and Varroa load are identified. Minihives are then assembled with 400-600 bees (2 cups) from the identified high Varroa mite and high viral load hives, foundation frames, and queen in queen-cell with a few escort-bees. The queen cell is sealed with candy. While filling the hives, time zero samples of bees and Varroa are collected (1 cup of bees from each hive). The samples are frozen (−70° C.), Varroa mites are collected from frozen cups and samples of bees and Varroa are prepared for Q-PCR or QuantiGene® analysis. The viral loads in the honey bees and the Varroa mites are determined at the initial time point.


The Mini-hives are fed with 66% sucrose solution and protein-cakes and placed in a net house under dark cover for 24 hrs to improve queen habitation. Following queen habitation, the dark cover is removed and the bees are fed with a sugar solution containing a mix of dsRNA targeting multiple bee viruses (concentration of 1 μg/bee to 10 μg/bee).


Samples of bees are collected, 10 bees from each hive every 4-5 days. The collected bees are analyzed by QG (QuantiGene® Plex 2.0 RNA assay platform from Affymetrix) to determine viral load. Viral load is decreased in bees fed dsRNA targeting bee viruses compared to bees fed a diet supplemented with non-specific dsRNA.



Varroa are collected from each hive every 4-5 days by sugar shake: one cup of bees from each minihive and two spoons of sugar powder are placed into a container with a punched sealer. The cup is shaken and turned top to bottom—the Varroa mites fall through the holes in the sealer and bees stay in the cup. Bees are returned into the minihive and Varroa are analyzed by QG (QuantiGene® Plex 2.0 RNA assay platform from Affymetrix) to determine viral load. Viral load is decreased in Varroa collected from bees fed dsRNA targeting bee viruses compared to Varroa collected from bees fed a diet supplemented with non-specific dsRNA.


Quantigene®, a quantitative, non-amplification-based nucleic acid detection analysis, is performed on total lysate from frozen honey bees or Varroa mite samples to measure viral expression and viral replication. The oligonucleotide probes used for the QuantiGene® Plex 2.0 assay are designed and supplied by Affymetrix, using the sense strand of bee virus sequences as template or negative strand for replicating virus. Housekeeping gene probes are designed from sequences of Apis mellifera Actin, Ribosomal protein subunit 5 (RPS5) and Ribosomal protein 49 (RP49). The QuantiGene® assay is performed according to the manufacturer's instructions (Affymetrix, Inc., User Manual, 2010) with the addition of a heat denaturation step prior to hybridization of the sample with the oligonucleotide probes. Samples in a 20 μL volume are mixed with 5 μl of the supplied probe set in the well of a PCR microplate followed by heating for 5 minutes at 95° C. using a thermocycler. Heat-treated samples are maintained at 46° C. until use. The 25 μl samples are transferred to an Affymetrix hybridization plate for overnight hybridization. Before removing the plate from the thermocycler, 75 μl of the hybridization buffer containing the remaining components are added to each sample well. The PCR microplate is then removed from the thermocycler and the content of each well (˜100 μl) is transferred to the corresponding well of a Hybridization Plate (Affymetrix) for overnight hybridization. After signal amplification, median fluorescence intensity (MFI) for each sample is captured on a Luminex 200 machine (Luminex Corporation).


Example 3

To test the effect of dsRNA targeting DWV or IAPV in honeybees and Varroa mites, honeybees were placed on a diet supplemented with a mixture of dsRNA triggers selected from SEQ ID NOs: 5-9 targeting DWV, and SEQ ID NOs: 1-4 and 10 targeting IAPV. A non-specific dsRNA having no sequence identity above 19 bp to Varroa genes was used as a control (SCRAM; SEQ ID NO:22 or 23).


Bee hives with high viral load and Varroa load were identified. FIG. 3 shows a sample quantification of Varroa load and DWV level. Minihives were then assembled with 400-600 bees (2 cups) from the identified high Varroa mite and high viral load hives, foundation frames, and queen in queen-cell with a few escort-bees. The queen cell was sealed with candy.


The Mini-hives were fed with 66% sucrose solution and protein-cakes and placed in a net house under dark cover for 24 hrs to improve queen habitation. After 2 days of acclimatization, bees were fed with a sugar solution only (CON), a sugar solution containing non-specific control dsRNA (SCR), or a sugar solution containing a mixture of dsRNAs targeting multiple bee viruses (SEQ ID NOs: 1-10; MIX) at concentration of 1 μg/bee to 10 μg/bee.


10 bees from each hive were collected every 4-5 days after hives were infected. The collected bees were analyzed by QuantiGene® as described in Example 2 to determine viral replication as median fluorescence intensity (MFI).



FIG. 4 shows that DWV replication was decreased in all bees fed with a mixture of virus-targeting dsRNAs (MIX) compared to bees fed with sugar solution only (CON) or a diet supplemented with non-specific dsRNA (SCR). Replication of the DWV virus was measured using QuantiGene® analysis 4, 8, and 14 days following treatment in bees. The results show that from day 8, replication of DWV increased in the two controls (CON and SCR) but not in bees treated with the virus-targeting dsRNA mixture (MIX), indicating that the virus-targeting dsRNA mixture was effective in suppressing viral replication.


Example 4

This is another example of the Varroa direct feeding experiment as described in Example 1. To test the effect of dsRNA targeting bee viruses in Varroa, the mites were placed on diet plates supplemented with a mix of dsRNA triggers. A non-specific dsRNA having no sequence identity above 19 bp to Varroa genes was used as a non-specific control (SEQ ID NO: 22 or 23). The blank control contained no dsRNA. Varroa mites were collected, RNA extracted and DWV or IAPV expression analyzed using QuantiGene® analysis Plex 2.0 (RNA assay platform from Affymetrix).


Experimental Process

First, an artificial diet was prepared as follows in Table 3:









TABLE 3







Artificial Diet Components










Reagent
control
Non specific control
dsRNA mix





Standard LB 1X
1X
1X
1X








Antibiotic
Diluted 1:100 to 1X


Antimycotic


Solution (100x),


Stabilized


(SIGMA A5955)


Nystatin
Diluted 1:100


[5 mg/ml]


KAN [50 mg/ml]
Diluted 1:20


1XPB
To 1 mL










Non-specific

1000 μg/mL



dsRNA


[10 mg/ml]


dsRNA mix


1000 μg/mL









The dsRNA trigger mix contained a mixture of SEQ ID NOs: 2-6 and 8-10 (125 μg/ml from each).


After plates cooled down, 15 Varroa mites were placed on each plate. Then the plates were sealed with absorbance paper, parafilm and incubated for 72 h in an incubator at 29° C. Live Varroa were collected for RNA extraction and bee viruses levels and replication were analyzed with QuantiGene® Plex 2.0 (RNA assay platform from Affymetrix).



FIG. 5A shows decreased DWV levels in Varroa 72 h following treatment with the bee viruses trigger mix compared to both the blank control and the non-specific dsRNA. Similarly, FIG. 5B shows decreased IAPV levels in Varroa 72 h following treatment with the bee viruses trigger mix compared to both the blank control and the non-specific dsRNA.


Example 5

To test the effect of dsRNA targeting bee viruses on DWV viral load and replication in honeybees in a bee box environment (lab conditions), the honeybees were brought from commercial hives in the field and placed in bee boxes fed with 66% sugar syrup supplemented with either individual dsRNA triggers selected from SEQ ID NOs: 5, 6, 8, and 9 targeting DMV (T1=SEQ ID NO:5, T2=SEQ ID NO:6, T3=SEQ ID NO:8, and T4=SEQ ID NO:9) or a mixture of these dsRNA triggers. A non-specific dsRNA (SEQ ID NO:22 or 23) having no sequence identity above 19 bp to honeybee's genes was used as a non-specific control. The blank control contained no dsRNA.


Bee hives with high viral load were identified. Bee boxes were then assembled with 5 bees from the identified high viral load. While filling the boxes, time zero samples of bees were collected. The samples were frozen (−70° C.). The viral loads in the honey bees were determined at the initial time point.


The bee boxes were fed with 66% sucrose solution. Following 2 days of acclimatization, bees were fed with a sugar solution containing the individual or mixture of dsRNAs targeting DMV (concentration of 1 μg/bee to 10 μg/bee), containing the non-specific dsRNA control, or containing no dsRNA. After 3 more days, bees were fed again with the same sugar solutions.


24 bees from each group of treatment were collected after 4 and 10 days from the second treatment. The collected bees were analyzed by QuantiGene® Plex 2.0 to determine viral load and viral replication.



FIG. 6A shows that both the mixture of dsRNA triggers and the individual triggers were effective in suppressing DWV load in bees compared to the two controls, with T1 and T4 showing greater effect. FIG. 6B shows similar effects on DWV replication in bees, also with T1 and T4 showing greater effect.


Example 6

To test the effect of dsRNA targeting bee viruses on IAPV viral load and replication in honeybees in a bee box environment (lab conditions), the honeybees were brought from commercial hives in the field and placed in bee boxes fed with 66% sugar syrup supplemented with either individual dsRNA triggers selected from SEQ ID NOs: 2-4 and 10 targeting IAPV (T5=SEQ ID NO:2, T6=SEQ ID NO:3, T7=SEQ ID NO:4, and T8=SEQ ID NO:10) or a mixture of these dsRNA triggers. A non-specific dsRNA (SEQ ID NO:22 or 23) having no sequence identity above 19 bp to honeybee's genes was used as a non-specific control. The blank control contained no dsRNA.


Bee hives with high viral load were identified. Bee boxes were then assembled with 5 bees from the identified high viral load. While filling the boxes, time zero samples of bees were collected. The samples were frozen (−70° C.). The viral loads in the honey bees were determined at the initial time point.


The bee boxes were fed with 66% sucrose solution. Following 2 days of acclimatization, bees were fed with a sugar solution containing the individual or mixture of dsRNAs targeting DMV (concentration of 1 μg/bee to 10 μg/bee), containing the non-specific dsRNA control, or containing no dsRNA. After 3 more days, bees were fed again with the same sugar solutions.


24 bees from each group of treatment were collected after 4 and 10 days from the second treatment. The collected bees were analyzed by QuantiGene® Plex 2.0 to determine viral load and viral replication.



FIG. 7A shows that T5 and T6 were effective in suppressing IAPV load compared to the controls. FIG. 7B shows that with the exception of the mix and T8, viral replication was suppressed in all bees fed with dsRNA targeting IAPV sequences compared to bees fed with a diet supplemented with non-specific dsRNA.


Example 7

To test the effect of dsRNA targeting bee viruses on LSV viral load and replication in honeybees in a bee box environment (lab conditions), the honeybees were brought from commercial hives in the field and placed in bee boxes fed with 66% sugar syrup supplemented with a mixture of five dsRNA triggers selected from SEQ ID NOs: 11-20. Two dsRNA trigger mixes were tested. Mix A contained SEQ ID NOs:11, 13, 14, 17, and 18 and Mix B contained SEQ ID NOs:12, 15, 16, 19, and 20, having the following dsRNA sequences:









TABLE 4 







dsRNA trigger sequences targeting LSV










SEQ





ID
Source




NO:
Seq
Sense
Protein





11
LSV1
GCUUACAAUAACUUCGUUCACAGACACCGCGUUGCUGCCUAUGCUGCUGG
RdRp +



genome
CGUGCGUAUCCACCGUUACCGCACGCCGUGGUAUUGCGCCGCGUCACGGU
Capsid




CUGUUCCGGUCGUCCAUCCUCUUAACUGGUUGAUGACCCAGUACGAUCUU





ACUACUGGCCAUGUUCGUGAAUUACUGGAUCGACUGGAGGUUGUCAAUG





UUACCCUUCGUGAUGGCCUCCGCACUGUUGCUGACACUGCGUUUACAGCU





UAUAUGUACUAUCAGAUAAUGUGGUGUC






12
LSV2
GAGCAGUAUCUCCUCAAUUUAAAAUAUGUCCCCUCUACUUACCGCUAUCU
RdRp +



genome
CAAGCGCGAUCUCGACAUUGACGGUGUCCAUACCGCGUUGUUGGGUGAGU
Capsid




UUAGGUCUGUUCUUUACGCGUAAUUAAUAGAAAUUAUCACGAUGAAUCCA





CCAACUACGACUACGACUACGACGCGCACCAUCCGCGCCCCAAAAGUUCA





ACUGACGCCCAAUUCUGCUACUCGGCGUCGGCGUAAUCGUCGGCGCCGUC





GAC






13
LSV1
GCCUGACUAUUAUGAGAUUGAUUACUCCCGAUUCGACUUGUCUAUUAGU
RdRp



genome
GCUGAAGUUAUUUCACAGUACGAGCAUGCCUGGGUCUCUCUUGUUUAUCC





UCCUCUCAAUUACCCUGGCUUCUGGCAGACUCUCGUUUCGACACUCAUUA





CCUCGGGCUUUAGUGAGUACGGUAUUACUUACUCUUUGCCUGGGUCACG





UUGUAGCGGUGACCCACAUACGUCCGUUGGUAAUGGUUUGCUGAACGGG





UUCUUAAC






14
LSV1
GCCUCGUGCGGACCUCAUUUCUUCAUGUCAGUGUGUGAGCAUGAUGAGU
RdRp



genome
CAAUACCUACGGUGUUCCAUGCACACUCGGUGGGAGGUCAAGAUAUCACC





CACGACAUUGAUUCAGGUUUGGGAGCAAUUAUAUCAAAACGCUUUAGUGC





UUCGCAGCUACGCCUCCUUAGCUGGUCUAUCGACGGAAUACUCAACACUU





UAUCUCGCGCCGCCACCUCAUCGUUUGUCGAAUCGUCGCUGUUGUCCUUG





UUACGAUUUAUGC






15
LSV2
GAUUAUACCGGACUUGGGCUUCAUGCUCAAGAUCGAUCACUAUGAGCAUG
RdRp



genome
UCGACGAUUGUUCGUUUUGCGGUAUGUACUUGCUGGAUGAUCGUGGAUC





GCUCCGCAUGUACUCUGACCCGGUGCGCACACUGUCUAUGAUACAUGUGU





GCUGCGCCGAUGGUCUACCCAACAAUUUGAUCGUGGCCAAGGCUCUGAGC





CUUCUCAAUCUGAAUCCAUGUACCCCCAUCGUCACAGCCUUUUGUCGUCAC





AUAUUGC






16
LSV2
GAGCAUAAUGCCGCUGGUUUACCCUUCUUAAUUAAGGGAUGUGACAUGGC
RdRp



genome
GGCUCGUGCCGCCAAGAUGCGUGACCUCCUGGGUUGGCCUCACUAUUACG





AGAUCGACUACUCUCGUUUUGAUUUGUCGAUAAGUGCUGAGGUCAUAUC





UCAGUUUGAGCAUGCUUGGAUCUCGUUGGUCUACGCCCCCGACAUGCACC





CGCUGUUCUGGCAGACGCUGGUCGCCACGUUGGUCACUUCAGGGUUUAG





UGAGUAUGGC






17
LSV1
GAGCAGUAUCUGCUCUCAUUAUUGUUUGUUCCGUCGCGUUAUGCCUUAC
RdRp



genome
UUAAACGAGACAUUGAGCUCGACGGCCUACAGACCACCCUUCUUGGCGACU





UCAGGUCUGUUCUUUACGCGUGAACAUUAUAAAUUUACUAUCAUGAAUCA





ACAACAAAUGAACCCCGCGCAGCGAUCGUUGCGCCCCCGCGCUCAAUCUAC





UCCCUCUCGGUCCGCUCGACGACGACGCAAUCGUAGGCGCCGUAACC






18
LSV1
GCCUGGCUUCGGCAGUAUUUGAACCCUAUGGGCCCUUCUACAUCCAGUGU
RdRp



genome
GAGUGGCUUUCCUGAUGGGUCUGCUGUUACCACAUGCAUUGCCGAUUACA





CCAACACAUUCAAUAUCUCUUUCCCUCCUCGUGAGGCGAUUUAUUGUACC





GGUUCUAAUUCUGAUGAGAAACCUGUUAUGCUGGACGCCGCCACCUAUGC





UAAGAUCGACGCGUGGACUAAGUCGGAUAUCACCUUGUGCAUACUCGCCU





UGCCC






19
LSV2
GUCCUAUGUUUACUUGCCGAACGUUGACAAGCACCUUUCUGCUGCCCGGG
Capsid



genome
GAUACCGCUUACUGUCCCGCGGCAUCACUGGUAUCUUUAGUGCUCCUGCU





CUUGAGACUCAGGGAUUCGUCACAGCUUGCCAGUAUUUGGCUGAGGGGU





CUAUACAAUCUCAGUCCAUUAAGUCUGACGCUGUUCGAUCCGUCACUGUU





AACAGUGAUGGUACUGUUAAGAACGUUGAGUCUAGCUCACAAACAGUUUC





GUCUAUGC






20
LSV2
GAGGGCAUCUCACCUAAAUUUUCUCUCAAACUUAAGACUCGAACUGUAUU
Capsid



genome
GCAAUAUAUUCCCACCUCCGGCUCUGUCUUGGCUAACUUCACCAGACACGA





GCCUACUUACGAUCAGAUAGCGCUCGAUGCUGCUGAUCGUCUGCGUAACC





UGAUGCCUCACGCUUACCCUGCCGCAUACAACGAUUGGGGAUGGCUUGGU





GAUCUGCUCGAUUCUGCCAUCUCCAUGUUGCCGGGUGUAGGUACUGUGU





AUAAC









A non-specific dsRNA (SEQ ID NO:22 or 23) having no sequence identity above 19 bp to honeybee's genes was used as a control. The blank control contained no dsRNA.


Bee hives with high viral load were identified. Bee boxes were then assembled with 5 bees from the identified high viral load. While filling the boxes, time zero samples of bees were collected. The samples were frozen (−70° C.). The viral loads in the honey bees were determined at the initial time point.


The bee boxes were fed with 66% sucrose solution. Following 2 days of acclimatization, bees were fed with a sugar solution containing the individual or mixture of dsRNAs targeting DMV (concentration of 1 μg/bee to 10 μg/bee), containing the non-specific dsRNA control, or containing no dsRNA. After 3 more days, bees were fed again with the same sugar solutions.


24 bees from each group of treatment were collected after 4 and 10 days from the second treatment. The collected bees were analyzed by QuantiGene® Plex 2.0 to determine viral load.



FIG. 8 shows that both Mix A and Mix B were effective in suppressing LSV load compared to the controls, with Mix B showing greater effect. LSV load was decreased in bee hives fed with a diet supplemented with dsRNA targeting LSV sequences compared to bee hives fed with a diet supplemented with non-specific dsRNA.

Claims
  • 1. A method of reducing viral load or suppressing viral replication in a Varroa destructor mite infected by a virus, the method comprising providing to the Varroa destructor mite infected by a virus a composition comprising an effective amount of at least one double-stranded RNA (dsRNA) which comprises a nucleic acid sequence that is identical or complementary to a sequence of at least 21 contiguous nucleotides of a viral gene in said virus, wherein the dsRNA downregulates expression of said viral gene in the Varroa destructor mite, thereby reducing viral load or suppressing viral replication in the Varroa destructor mite.
  • 2. The method of claim 1, wherein said composition comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9, or 10 different dsRNAs.
  • 3. The method of claim 1, wherein said viral gene is from a virus selected from the group consisting of Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), and Kakugo Virus (KV).
  • 4. The method of claim 1, wherein said at least one dsRNA comprises a nucleic acid sequence that is identical or complementary to at least 21 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:1-21.
  • 5. A method for reducing the susceptibility of a bee to a disease caused by a virus, the method comprising providing to a Varroa destructor mite infected by said virus a composition comprising an effective amount of a double-stranded RNA (dsRNA) comprising a nucleic acid sequence that is identical or complementary to a sequence of at least 21 contiguous nucleotides of a viral gene in said virus, thereby suppressing viral replication in the Varroa destructor mite and reducing the susceptibility of the bee to the disease caused by the virus.
  • 6. The method of claim 5, wherein said bee is a honey bee.
  • 7. The method of claim 5, wherein the double-stranded RNA (dsRNA) comprises a nucleic acid sequence that is identical or complementary to at least 21 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:1-10 and 21.
  • 8. The method of claim 5, wherein the virus is selected from the group consisting of Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus (DWV), Kashmir Bee Virus (KBV), Black Queen Cell Virus (BQCV), Sacbrood Virus (SBV), Chronic Bee Paralysis Virus (CPV), Cloudy Wing Virus (CWV), Israeli Acute Paralysis Virus (IAPV), Invertebrate iridescent virus type 6 (IIV-6), Varroa Destructor Virus (VDV-1), and Kakugo Virus (KV).
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a U.S. National Stage Application of PCT/US2014/069353, filed on Dec. 9, 2014, which claims the benefit of U.S. Provisional Application No. 62/069,142, filed on Oct. 27, 2014, and also claims the benefit of U.S. Provisional Application No. 61/913,917, filed on Dec. 10, 2013, which are incorporated by reference in their entirety herein.

PCT Information
Filing Document Filing Date Country Kind
PCT/US2014/069353 12/9/2014 WO 00
Publishing Document Publishing Date Country Kind
WO2015/089078 6/18/2015 WO A
US Referenced Citations (396)
Number Name Date Kind
3687808 Merigan et al. Aug 1972 A
3791932 Schuurs et al. Feb 1974 A
3839153 Schuurs et al. Oct 1974 A
3850578 McConnell Nov 1974 A
3850752 Schuurs et al. Nov 1974 A
3853987 Dreyer Dec 1974 A
3867517 Ling Feb 1975 A
3879262 Schuurs et al. Apr 1975 A
3901654 Gross Aug 1975 A
3935074 Rubenstein et al. Jan 1976 A
3984533 Uzgiris Oct 1976 A
3996345 Ullman et al. Dec 1976 A
4034074 Miles Jul 1977 A
4098876 Piasio et al. Jul 1978 A
4469863 Ts'o et al. Sep 1984 A
4476301 Imbach et al. Oct 1984 A
4535060 Comai Aug 1985 A
4581847 Hibberd et al. Apr 1986 A
4666828 Gusella May 1987 A
4683202 Mullis Jul 1987 A
4761373 Anderson et al. Aug 1988 A
4769061 Comai Sep 1988 A
4801531 Frossard Jan 1989 A
4810648 Stalker Mar 1989 A
4879219 Wands et al. Nov 1989 A
4940835 Shah et al. Jul 1990 A
4971908 Kishore et al. Nov 1990 A
5004863 Umbeck Apr 1991 A
5011771 Bellet et al. Apr 1991 A
5013659 Bedbrook et al. May 1991 A
5015580 Christou et al. May 1991 A
5023243 Tullis Jun 1991 A
5034506 Summerton et al. Jul 1991 A
5094945 Comai Mar 1992 A
5141870 Bedbrook et al. Aug 1992 A
5145783 Kishore et al. Sep 1992 A
5159135 Umbeck Oct 1992 A
5166315 Summerton et al. Nov 1992 A
5177196 Meyer, Jr. et al. Jan 1993 A
5185444 Summerton et al. Feb 1993 A
5188642 Shah et al. Feb 1993 A
5188897 Suhadolnik et al. Feb 1993 A
5192659 Simons Mar 1993 A
5214134 Weis et al. May 1993 A
5216141 Benner Jun 1993 A
5235033 Summerton et al. Aug 1993 A
5264423 Cohen et al. Nov 1993 A
5264562 Matteucci Nov 1993 A
5264564 Matteucci Nov 1993 A
5272057 Smulson et al. Dec 1993 A
5276019 Cohen et al. Jan 1994 A
5281521 Trojanowski et al. Jan 1994 A
5286634 Stadler et al. Feb 1994 A
5286717 Cohen et al. Feb 1994 A
5304732 Anderson et al. Apr 1994 A
5310667 Eichholtz et al. May 1994 A
5312910 Kishore et al. May 1994 A
5321131 Agrawal et al. Jun 1994 A
5331107 Anderson et al. Jul 1994 A
5339107 Henry et al. Aug 1994 A
5346107 Bouix et al. Sep 1994 A
5378824 Bedbrook et al. Jan 1995 A
5384253 Krzyzek et al. Jan 1995 A
5390667 Kumakura et al. Feb 1995 A
5392910 Bell et al. Feb 1995 A
5393175 Courville Feb 1995 A
5399676 Froehler Mar 1995 A
5405938 Summerton et al. Apr 1995 A
5405939 Suhadolnik et al. Apr 1995 A
5416011 Hinchee et al. May 1995 A
5453496 Caruthers et al. Sep 1995 A
5455233 Spielvogel et al. Oct 1995 A
5459127 Feigner et al. Oct 1995 A
5460667 Moriyuki et al. Oct 1995 A
5462910 Ito et al. Oct 1995 A
5463174 Moloney et al. Oct 1995 A
5463175 Barry et al. Oct 1995 A
5466677 Baxter et al. Nov 1995 A
5470967 Huie et al. Nov 1995 A
5476925 Letsinger et al. Dec 1995 A
5489520 Adams et al. Feb 1996 A
5489677 Sanghvi et al. Feb 1996 A
5491288 Chaubet et al. Feb 1996 A
5510471 Lebrun et al. Apr 1996 A
5518908 Corbin et al. May 1996 A
5519126 Hecht May 1996 A
5536821 Agrawal et al. Jul 1996 A
5538880 Lundquist et al. Jul 1996 A
5541306 Agrawal et al. Jul 1996 A
5541307 Cook Jul 1996 A
5550111 Suhadolnik et al. Aug 1996 A
5550318 Adams et al. Aug 1996 A
5550398 Kocian et al. Aug 1996 A
5550468 Huberlein et al. Aug 1996 A
5558071 Ward et al. Sep 1996 A
5561225 Maddry et al. Oct 1996 A
5561236 Leemans et al. Oct 1996 A
5563253 Agrawal et al. Oct 1996 A
5569834 Hinchee et al. Oct 1996 A
5571799 Tkachuk et al. Nov 1996 A
5587361 Cook et al. Dec 1996 A
5591616 Hiei et al. Jan 1997 A
5593874 Brown et al. Jan 1997 A
5596086 Matteucci et al. Jan 1997 A
5597717 Guerineau et al. Jan 1997 A
5602240 De Mesmaeker et al. Feb 1997 A
5605011 Bedbrook et al. Feb 1997 A
5608046 Cook et al. Mar 1997 A
5610289 Cook et al. Mar 1997 A
5618704 Sanghvi et al. Apr 1997 A
5623070 Cook et al. Apr 1997 A
5625050 Beaton et al. Apr 1997 A
5627061 Barry et al. May 1997 A
5633360 Bischofberger et al. May 1997 A
5633435 Barry et al. May 1997 A
5633448 Lebrun et al. May 1997 A
5639024 Mueller et al. Jun 1997 A
5646024 Leemans et al. Jul 1997 A
5648477 Leemans et al. Jul 1997 A
5663312 Chaturvedula Sep 1997 A
5677437 Teng et al. Oct 1997 A
5677439 Weis et al. Oct 1997 A
5719046 Guerineau et al. Feb 1998 A
5721138 Lawn Feb 1998 A
5731180 Dietrich Mar 1998 A
5739180 Taylor-Smith Apr 1998 A
5746180 Jefferson et al. May 1998 A
5767361 Dietrich Jun 1998 A
5767373 Ward et al. Jun 1998 A
5780708 Lundquist et al. Jul 1998 A
5804425 Barry et al. Sep 1998 A
5824877 Hinchee et al. Oct 1998 A
5837848 Ely et al. Nov 1998 A
5859347 Brown et al. Jan 1999 A
5866775 Eichholtz et al. Feb 1999 A
5874265 Adams et al. Feb 1999 A
5879903 Strauch et al. Mar 1999 A
5914451 Martinell et al. Jun 1999 A
5919675 Adams et al. Jul 1999 A
5928937 Kakefuda et al. Jul 1999 A
5939602 Volrath et al. Aug 1999 A
5969213 Adams et al. Oct 1999 A
5981840 Zhao et al. Nov 1999 A
5985793 Sandbrink et al. Nov 1999 A
RE36449 Lebrun et al. Dec 1999 E
6040497 Spencer et al. Mar 2000 A
6056938 Unger et al. May 2000 A
6069115 Pallett et al. May 2000 A
6084089 Mine et al. Jul 2000 A
6084155 Volrath et al. Jul 2000 A
6118047 Anderson et al. Sep 2000 A
6121513 Zhang et al. Sep 2000 A
6130366 Herrera-Estrella et al. Oct 2000 A
6140078 Sanders et al. Oct 2000 A
6153812 Fry et al. Nov 2000 A
6160208 Lundquist et al. Dec 2000 A
6177616 Bartsch et al. Jan 2001 B1
6194636 McElroy et al. Feb 2001 B1
6225105 Sathasivan et al. May 2001 B1
6225114 Eichholtz et al. May 2001 B1
6232526 McElroy et al. May 2001 B1
6245968 Boudec et al. Jun 2001 B1
6248876 Barry et al. Jun 2001 B1
6252138 Karimi et al. Jun 2001 B1
RE37287 Lebrun et al. Jul 2001 E
6268549 Sailland et al. Jul 2001 B1
6271359 Norris et al. Aug 2001 B1
6282837 Ward et al. Sep 2001 B1
6288306 Ward et al. Sep 2001 B1
6288312 Christou et al. Sep 2001 B1
6294714 Matsunaga et al. Sep 2001 B1
6326193 Liu et al. Dec 2001 B1
6329571 Hiei Dec 2001 B1
6348185 Piwnica-Worms Feb 2002 B1
6365807 Christou et al. Apr 2002 B1
6384301 Martinell et al. May 2002 B1
6385902 Schipper et al. May 2002 B1
6399861 Anderson et al. Jun 2002 B1
6403865 Koziel et al. Jun 2002 B1
6414222 Gengenbach et al. Jul 2002 B1
6421956 Boukens et al. Jul 2002 B1
6426446 McElroy et al. Jul 2002 B1
6433252 Kriz et al. Aug 2002 B1
6437217 McElroy et al. Aug 2002 B1
6453609 Solt et al. Sep 2002 B1
6479291 Kumagai et al. Nov 2002 B2
6506559 Fire et al. Jan 2003 B1
6642435 Rafatski et al. Nov 2003 B1
6644341 Chemo et al. Nov 2003 B1
6645914 Woznica et al. Nov 2003 B1
6768044 Boudec et al. Jul 2004 B1
6992237 Habben et al. Jan 2006 B1
7022896 Weeks et al. Apr 2006 B1
7026528 Cheng et al. Apr 2006 B2
RE39247 Barry et al. Aug 2006 E
7105724 Weeks et al. Sep 2006 B2
7119256 Shimizu et al. Oct 2006 B2
7138564 Tian et al. Nov 2006 B2
7297541 Moshiri et al. Nov 2007 B2
7304209 Zink et al. Dec 2007 B2
7312379 Andrews et al. Dec 2007 B2
7323310 Peters et al. Jan 2008 B2
7371927 Yao et al. May 2008 B2
7392379 Le Pennec et al. Jun 2008 B2
7405347 Hammer et al. Jul 2008 B2
7406981 Hemo et al. Aug 2008 B2
7462379 Fukuda et al. Dec 2008 B2
7485777 Nakajima et al. Feb 2009 B2
7525013 Hildebrand et al. Apr 2009 B2
7550578 Budworth et al. Jun 2009 B2
7622301 Ren et al. Nov 2009 B2
7657299 Huizenga et al. Feb 2010 B2
7671254 Tranel et al. Mar 2010 B2
7714188 Castle et al. May 2010 B2
7738626 Weese et al. Jun 2010 B2
7807791 Sekar et al. Oct 2010 B2
7838263 Dam et al. Nov 2010 B2
7838733 Wright et al. Nov 2010 B2
7842856 Tranel et al. Nov 2010 B2
7884262 Clemente et al. Feb 2011 B2
7910805 Duck et al. Mar 2011 B2
7935869 Pallett et al. May 2011 B2
7943819 Baum et al. May 2011 B2
7973218 McCutchen et al. Jul 2011 B2
8090164 Bullitt et al. Jan 2012 B2
8143480 Axtell et al. Mar 2012 B2
8226938 Meikle et al. Jul 2012 B1
8548778 Hart et al. Oct 2013 B1
8554490 Tang et al. Oct 2013 B2
9121022 Sammons et al. Sep 2015 B2
9422557 Ader Aug 2016 B2
9445603 Baum et al. Sep 2016 B2
9777288 Beattie et al. Oct 2017 B2
9850496 Beattie et al. Dec 2017 B2
9856495 Beattie et al. Jan 2018 B2
20010006797 Kumagai et al. Jul 2001 A1
20010042257 Connor-Ward et al. Nov 2001 A1
20020069430 Kiaska et al. Jun 2002 A1
20020114784 Li et al. Aug 2002 A1
20030150017 Mesa et al. Aug 2003 A1
20030154508 Stevens et al. Aug 2003 A1
20030167537 Jiang Sep 2003 A1
20030221211 Rottmann et al. Nov 2003 A1
20040029275 Brown et al. Feb 2004 A1
20040053289 Allen et al. Mar 2004 A1
20040055041 Labate et al. Mar 2004 A1
20040072692 Hoffman et al. Apr 2004 A1
20040082475 Hoffman et al. Apr 2004 A1
20040123347 Hinchey et al. Jun 2004 A1
20040126845 Eenennaam et al. Jul 2004 A1
20040133944 Hake et al. Jul 2004 A1
20040147475 Li et al. Jul 2004 A1
20040177399 Hammer et al. Sep 2004 A1
20040216189 Houmard et al. Oct 2004 A1
20040244075 Cai et al. Dec 2004 A1
20040250310 Shukla et al. Dec 2004 A1
20050005319 della-Cioppa et al. Jan 2005 A1
20050044591 Yao et al. Feb 2005 A1
20050215435 Menges et al. Sep 2005 A1
20050223425 Clinton et al. Oct 2005 A1
20050246784 Plesch et al. Nov 2005 A1
20050250647 Hills et al. Nov 2005 A1
20050289664 Moshiri et al. Dec 2005 A1
20060009358 Kibler et al. Jan 2006 A1
20060021087 Baum et al. Jan 2006 A1
20060040826 Eaton et al. Feb 2006 A1
20060111241 Gerwick, III et al. May 2006 A1
20060130172 Whaley et al. Jun 2006 A1
20060135758 Wu Jun 2006 A1
20060200878 Lutfiyya et al. Sep 2006 A1
20060223708 Hoffman et al. Oct 2006 A1
20060223709 Helmke et al. Oct 2006 A1
20060247197 Van De Craen et al. Nov 2006 A1
20060272049 Waterhouse et al. Nov 2006 A1
20060276339 Windsor et al. Dec 2006 A1
20070011775 Allen et al. Jan 2007 A1
20070021360 Nyce et al. Jan 2007 A1
20070050863 Tranel et al. Mar 2007 A1
20070124836 Baum et al. May 2007 A1
20070199095 Allen et al. Aug 2007 A1
20070250947 Boukharov et al. Oct 2007 A1
20070259785 Heck et al. Nov 2007 A1
20070269815 Rivory et al. Nov 2007 A1
20070281900 Cui et al. Dec 2007 A1
20070300329 Allen et al. Dec 2007 A1
20080022423 Roberts et al. Jan 2008 A1
20080050342 Fire et al. Feb 2008 A1
20080092256 Kohn Apr 2008 A1
20080113351 Naito et al. May 2008 A1
20080155716 Sonnewald et al. Jun 2008 A1
20080214443 Baum et al. Sep 2008 A1
20090011934 Zawierucha et al. Jan 2009 A1
20090018016 Duck et al. Jan 2009 A1
20090036311 Witschel et al. Feb 2009 A1
20090054240 Witschel et al. Feb 2009 A1
20090075921 Ikegawa et al. Mar 2009 A1
20090098614 Zamore et al. Apr 2009 A1
20090118214 Paldi et al. May 2009 A1
20090137395 Chicoine et al. May 2009 A1
20090165153 Wang et al. Jun 2009 A1
20090165166 Feng et al. Jun 2009 A1
20090172838 Axtell et al. Jul 2009 A1
20090188005 Boukharov et al. Jul 2009 A1
20090205079 Kumar et al. Aug 2009 A1
20090215628 Witschel et al. Aug 2009 A1
20090285784 Raemaekers et al. Nov 2009 A1
20090293148 Ren et al. Nov 2009 A1
20090298787 Raemaekers et al. Dec 2009 A1
20090306189 Raemaekers et al. Dec 2009 A1
20090307803 Baum et al. Dec 2009 A1
20100005551 Roberts et al. Jan 2010 A1
20100048670 Biard et al. Feb 2010 A1
20100068172 Van De Craen Mar 2010 A1
20100071088 Sela et al. Mar 2010 A1
20100099561 Selby et al. Apr 2010 A1
20100100988 Tranel et al. Apr 2010 A1
20100152443 Hirai et al. Jun 2010 A1
20100154083 Ross et al. Jun 2010 A1
20100192237 Ren et al. Jul 2010 A1
20100247578 Salama Sep 2010 A1
20100248373 Baba et al. Sep 2010 A1
20110015084 Christian et al. Jan 2011 A1
20110015284 Dees et al. Jan 2011 A1
20110028412 Cappello et al. Feb 2011 A1
20110035836 Eudes et al. Feb 2011 A1
20110041400 Trias Vila et al. Feb 2011 A1
20110053226 Rohayem Mar 2011 A1
20110098180 Michel et al. Apr 2011 A1
20110105327 Nelson May 2011 A1
20110105329 Song et al. May 2011 A1
20110112570 Mannava et al. May 2011 A1
20110126310 Feng et al. May 2011 A1
20110126311 Velcheva et al. May 2011 A1
20110152339 Brown et al. Jun 2011 A1
20110152346 Karleson et al. Jun 2011 A1
20110152353 Koizumi et al. Jun 2011 A1
20110160082 Woo et al. Jun 2011 A1
20110166022 Israels et al. Jul 2011 A1
20110166023 Nettleton-Hammond et al. Jul 2011 A1
20110171176 Baas et al. Jul 2011 A1
20110171287 Saarma et al. Jul 2011 A1
20110177949 Krapp et al. Jul 2011 A1
20110185444 Li et al. Jul 2011 A1
20110185445 Bogner et al. Jul 2011 A1
20110191897 Poree et al. Aug 2011 A1
20110201501 Song et al. Aug 2011 A1
20110203013 Peterson et al. Aug 2011 A1
20110296555 Ivashuta et al. Dec 2011 A1
20110296556 Sammons et al. Dec 2011 A1
20120036594 Cardoza et al. Feb 2012 A1
20120107355 Harris et al. May 2012 A1
20120108497 Paldi et al. May 2012 A1
20120137387 Baum et al. May 2012 A1
20120150048 Kang et al. Jun 2012 A1
20120156784 Adams, Jr. et al. Jun 2012 A1
20120157512 Ben-Chanoch et al. Jun 2012 A1
20120164205 Baum et al. Jun 2012 A1
20120174262 Azhakanandam et al. Jul 2012 A1
20120185967 Sela et al. Jul 2012 A1
20120198586 Narva et al. Aug 2012 A1
20120230565 Steinberg et al. Sep 2012 A1
20120258646 Sela Oct 2012 A1
20130003213 Kabelac et al. Jan 2013 A1
20130041004 Drager et al. Feb 2013 A1
20130047297 Sammons et al. Feb 2013 A1
20130047298 Tang Feb 2013 A1
20130060133 Kassab et al. Mar 2013 A1
20130067618 Ader et al. Mar 2013 A1
20130084243 Goetsch et al. Apr 2013 A1
20130096073 Sidelman Apr 2013 A1
20130097726 Ader et al. Apr 2013 A1
20130212739 Giritch et al. Aug 2013 A1
20130226003 Edic et al. Aug 2013 A1
20130247247 Ader et al. Sep 2013 A1
20130254940 Ader et al. Sep 2013 A1
20130254941 Ader et al. Sep 2013 A1
20130288895 Ader et al. Oct 2013 A1
20130289097 Paldi Oct 2013 A1
20130318657 Avniel et al. Nov 2013 A1
20130318658 Ader et al. Nov 2013 A1
20130324842 Mittal et al. Dec 2013 A1
20130326731 Ader et al. Dec 2013 A1
20140018241 Sammons et al. Jan 2014 A1
20140057789 Sammons et al. Feb 2014 A1
20140109258 Van De Craen et al. Apr 2014 A1
20140230090 Avniel et al. Aug 2014 A1
20140274712 Finnessy et al. Sep 2014 A1
20140275208 Hu et al. Sep 2014 A1
20140296503 Avniel et al. Oct 2014 A1
20150096079 Avniel et al. Apr 2015 A1
20150143580 Beattie et al. May 2015 A1
20150159156 Inberg et al. Jun 2015 A1
20150203867 Beattie et al. Jul 2015 A1
20150240258 Beattie et al. Aug 2015 A1
20160015035 Tao Jan 2016 A1
20160029644 Tao Feb 2016 A1
Foreign Referenced Citations (268)
Number Date Country
2008258254 Jul 2014 AU
2014262189 Nov 2014 AU
101279950 Oct 2008 CN
101279951 Oct 2008 CN
101892247 Nov 2010 CN
101914540 Dec 2010 CN
102154364 Aug 2011 CN
102481311 May 2012 CN
102822350 Dec 2012 CN
102906263 Jan 2013 CN
288618 Apr 1991 DE
10000600 Jul 2001 DE
10116399 Oct 2002 DE
10256353 Jun 2003 DE
10256354 Jun 2003 DE
10256367 Jun 2003 DE
10204951 Aug 2003 DE
10234875 Feb 2004 DE
10234876 Feb 2004 DE
102004054666 May 2006 DE
102005014638 Oct 2006 DE
102005014906 Oct 2006 DE
102007012168 Sep 2008 DE
102010042866 May 2011 DE
0 804 600 Nov 1997 EP
1 155 615 Nov 2001 EP
1 157 991 Nov 2001 EP
1 238 586 Sep 2002 EP
1 416 049 May 2004 EP
1 496 123 Jan 2005 EP
1 889 902 Feb 2008 EP
1 964 919 Sep 2008 EP
2 147 919 Jan 2010 EP
2 160 098 Nov 2010 EP
2 530 159 Mar 2011 EP
2 305 813 Apr 2011 EP
2 545 182 Jan 2013 EP
2001253874 Sep 2001 JP
2002080454 Mar 2002 JP
2002138075 May 2002 JP
2002145707 May 2002 JP
2002220389 Aug 2002 JP
2003064059 Mar 2003 JP
2003096059 Apr 2003 JP
2004051628 Feb 2004 JP
2004107228 Apr 2004 JP
2005008583 Jan 2005 JP
2005239675 Sep 2005 JP
2005314407 Nov 2005 JP
2006232824 Sep 2006 JP
2006282552 Oct 2006 JP
2007153847 Jun 2007 JP
2007161701 Jun 2007 JP
2007182404 Jul 2007 JP
2008074840 Apr 2008 JP
2008074841 Apr 2008 JP
2008133207 Jun 2008 JP
2008133218 Jun 2008 JP
2008169121 Jul 2008 JP
2009-508481 Mar 2009 JP
2009067739 Apr 2009 JP
2009114128 May 2009 JP
2009126792 Jun 2009 JP
2009137851 Jun 2009 JP
2 291 613 Jan 2007 RU
2 337 529 Nov 2008 RU
WO 8911789 Dec 1989 WO
WO 9534659 Dec 1995 WO
WO 9534668 Dec 1995 WO
WO 96005721 Feb 1996 WO
WO 96033270 Oct 1996 WO
WO 96038567 Dec 1996 WO
WO 96040964 Dec 1996 WO
WO 9749816 Dec 1997 WO
WO 9914348 Mar 1999 WO
WO 99024585 May 1999 WO
WO 9926467 Jun 1999 WO
WO 9927116 Jun 1999 WO
WO 9932619 Jul 1999 WO
WO 9961631 Dec 1999 WO
WO 9967367 Dec 1999 WO
WO 0032757 Jun 2000 WO
WO 00044914 Aug 2000 WO
WO 0107601 Feb 2001 WO
WO 2001085970 Nov 2001 WO
WO 0214472 Feb 2002 WO
WO 02066660 Aug 2002 WO
WO 03000679 Jan 2003 WO
WO 03004649 Jan 2003 WO
WO 03006422 Jan 2003 WO
WO 03012052 Feb 2003 WO
WO 03013247 Feb 2003 WO
WO 03016308 Feb 2003 WO
WO 2003014357 Feb 2003 WO
WO 03020704 Mar 2003 WO
WO 03022051 Mar 2003 WO
WO 03022831 Mar 2003 WO
WO 03022843 Mar 2003 WO
WO 03029243 Apr 2003 WO
WO 03037085 May 2003 WO
WO 03037878 May 2003 WO
WO 03045878 Jun 2003 WO
WO 03050087 Jun 2003 WO
WO 03051823 Jun 2003 WO
WO 03051824 Jun 2003 WO
WO 03051846 Jun 2003 WO
WO 03064625 Aug 2003 WO
WO 03076409 Sep 2003 WO
WO 03077648 Sep 2003 WO
WO 03087067 Oct 2003 WO
WO 03090539 Nov 2003 WO
WO 03091217 Nov 2003 WO
WO 03093269 Nov 2003 WO
WO 03104206 Dec 2003 WO
WO 2004002947 Jan 2004 WO
WO 2004002981 Jan 2004 WO
WO 2004005485 Jan 2004 WO
WO 2004009761 Jan 2004 WO
WO 2004011429 Feb 2004 WO
WO 2004022771 Mar 2004 WO
WO 2004029060 Apr 2004 WO
WO 2004035545 Apr 2004 WO
WO 2004035563 Apr 2004 WO
WO 2004035564 Apr 2004 WO
WO 2004037787 May 2004 WO
WO 2004049806 Jun 2004 WO
WO 2004062351 Jul 2004 WO
WO 2004067518 Aug 2004 WO
WO 2004067527 Aug 2004 WO
WO 2004074443 Sep 2004 WO
WO 2004077950 Sep 2004 WO
WO 2005000824 Jan 2005 WO
WO 2005003362 Jan 2005 WO
WO 2005007627 Jan 2005 WO
WO 2005007860 Jan 2005 WO
WO 2005040152 May 2005 WO
WO 2005047233 May 2005 WO
WO 2005047281 May 2005 WO
WO 2005061443 Jul 2005 WO
WO 2005061464 Jul 2005 WO
WO 2005068434 Jul 2005 WO
WO 2005070889 Aug 2005 WO
WO 2005089551 Sep 2005 WO
WO 2005095335 Oct 2005 WO
WO 2005107437 Nov 2005 WO
WO 2005110068 Nov 2005 WO
WO 2006006569 Jan 2006 WO
WO 2006024820 Mar 2006 WO
WO 2006029828 Mar 2006 WO
WO 2006029829 Mar 2006 WO
WO 2006037945 Apr 2006 WO
WO 2006050803 May 2006 WO
WO 2006074400 Jul 2006 WO
WO 2006090792 Aug 2006 WO
WO 2006123088 Nov 2006 WO
WO 2006125687 Nov 2006 WO
WO 2006125688 Nov 2006 WO
WO 2006132270 Dec 2006 WO
WO 2006138638 Dec 2006 WO
WO 2007003294 Jan 2007 WO
WO 2007007316 Jan 2007 WO
WO 2007024783 Mar 2007 WO
WO 2007026834 Mar 2007 WO
WO 2007035650 Mar 2007 WO
WO 2007038788 Apr 2007 WO
WO 2007039454 Apr 2007 WO
WO 2007050715 May 2007 WO
WO 2007051462 May 2007 WO
WO 2007070389 Jun 2007 WO
WO 2007071900 Jun 2007 WO
WO 2007074405 Jul 2007 WO
WO 2007077201 Jul 2007 WO
WO 2007077247 Jul 2007 WO
WO 2007080126 Jul 2007 WO
WO 2007080127 Jul 2007 WO
WO 2007083193 Jul 2007 WO
WO 2007096576 Aug 2007 WO
WO 2007051462 Oct 2007 WO
WO 2007119434 Oct 2007 WO
WO 2007134984 Nov 2007 WO
WO 2008007100 Jan 2008 WO
WO 2008009908 Jan 2008 WO
WO 2008029084 Mar 2008 WO
WO 2008042231 Apr 2008 WO
WO 2008059948 May 2008 WO
WO 2008063203 May 2008 WO
WO 2008071918 Jun 2008 WO
WO 2008074991 Jun 2008 WO
WO 2008084073 Jul 2008 WO
WO 2008100426 Aug 2008 WO
WO 2008102908 Aug 2008 WO
WO 2008148223 Dec 2008 WO
WO 2008152072 Dec 2008 WO
WO 2008152073 Dec 2008 WO
WO 2009000757 Dec 2008 WO
WO 2009005297 Jan 2009 WO
WO 2009029690 Mar 2009 WO
WO 2009035150 Mar 2009 WO
WO 2009037329 Mar 2009 WO
WO 2009046384 Apr 2009 WO
WO 2009060429 May 2009 WO
WO 2009063180 May 2009 WO
WO 2009068170 Jun 2009 WO
WO 2009068171 Jun 2009 WO
WO 2009086041 Jul 2009 WO
WO 2009090401 Jul 2009 WO
WO 2009090402 Jul 2009 WO
WO 2009115788 Sep 2009 WO
WO 2009116558 Sep 2009 WO
WO 2009125401 Oct 2009 WO
WO 2009144079 Dec 2009 WO
WO 2009152995 Dec 2009 WO
WO 2009153607 Dec 2009 WO
WO 2009158258 Dec 2009 WO
WO 2010012649 Feb 2010 WO
WO 2010026989 Mar 2010 WO
WO 2010034153 Apr 2010 WO
WO 2010049270 May 2010 WO
WO 2010049369 May 2010 WO
WO 2010049405 May 2010 WO
WO 2010049414 May 2010 WO
WO 2010056519 May 2010 WO
WO 2010063422 Jun 2010 WO
WO 2010069802 Jun 2010 WO
WO 2010078906 Jul 2010 WO
WO 2010078912 Jul 2010 WO
WO 2010093788 Aug 2010 WO
WO 2010104217 Sep 2010 WO
WO 2010108611 Sep 2010 WO
WO 2010112826 Oct 2010 WO
WO 2010116122 Oct 2010 WO
WO 2010119906 Oct 2010 WO
WO 2010130970 Nov 2010 WO
WO 2011001434 Jan 2011 WO
WO 2011003776 Jan 2011 WO
WO 2011035874 Mar 2011 WO
WO 2011045796 Apr 2011 WO
WO 2011065451 Jun 2011 WO
WO 2011067745 Jun 2011 WO
WO 2011075188 Jun 2011 WO
WO 2011080674 Jul 2011 WO
WO 2011112570 Sep 2011 WO
WO 2011132127 Oct 2011 WO
WO 2012001626 Jan 2012 WO
WO 2012056401 May 2012 WO
WO 2012092580 Jul 2012 WO
WO 2012156342 Nov 2012 WO
WO 2012164100 Dec 2012 WO
WO 2013010691 Jan 2013 WO
WO 2013025670 Feb 2013 WO
WO 2013039990 Mar 2013 WO
WO 2013040005 Mar 2013 WO
WO 2013040021 Mar 2013 WO
WO 2013040033 Mar 2013 WO
WO 2013040049 Mar 2013 WO
WO 2013040057 Mar 2013 WO
WO 2013040116 Mar 2013 WO
WO 2013040117 Mar 2013 WO
WO 2013153553 Oct 2013 WO
WO 2013175480 Nov 2013 WO
WO 2014022739 Feb 2014 WO
WO 2014106837 Jul 2014 WO
WO 2014106838 Jul 2014 WO
WO 2014151255 Sep 2014 WO
WO 2014164761 Oct 2014 WO
WO 2014164797 Oct 2014 WO
WO 2015010026 Jan 2015 WO
WO 2015200539 Dec 2015 WO
Non-Patent Literature Citations (664)
Entry
Agricultural Chemical Usage 2006 Vegetables Summary, Agricultural Statistics Board, NASS, USDA, pp. 1-372 (2007).
Agrios, Plant Pathology (Second Edition), 2:466-470 (1978).
Alarcón-Reverte et al., “Resistance to ACCase-inhibiting herbicides in the weed Lolium multiflorum,” Comm, Appl. Biol. Sci., 73(4):899-902 (2008).
Al-Kaff et al., “Plants rendered herbicide-susceptible by cauliflower mosaic virus-elicited suppression of a 35S promoter-regulated transgene,” Nature Biotechnology, 18:995-999 (2000).
Amarzguioui et al., “An algorithm for selection of functional siRNA sequences,” Biochemical and Biophysical Research Communications, 316:1050-1058 (2004).
Ambrus et al., “The Diverse Roles of RNA Helicases in RNAi,” Cell Cycle, 8(21):3500-3505 (2009).
An et al., “Transient RNAi Induction against Endogenous Genes in Arabidopsis Protoplasts Using in Vitro-Prepared Double-Stranded RNA,” Biosci Biotechnol Biochem, 69(2):415-418 (2005).
Andersen et al., “Delivery of siRNA from lyophilized polymeric surfaces,”Biomaterials, 29:506-512 (2008).
Andersson et al., “A novel selection system for potato transformation using a mutated AHAS gene,” Plant Cell Reports, 22(4):261-267 (2003).
Anonymous, “A handbook for high-level expression and purification of 6xHis-tagged proteins,” The QiaExpressionist, (2003).
Anonymous, “Agronomy Facts 37: Adjuvants for enhancing herbicide performance,” n.p., 1-8, (Jan. 26, 2000), Web, (Jan. 21, 2014).
Anonymous, “Devgen, The mini-Monsanto,” KBC Securities (2006).
Anonymous, “Do Monsanto have the next big thing?,” Austalian Herbicide Resistance Initiative (AHRI), (Apr. 23, 2013) Web. (Jan. 19, 2015).
Aoki et al., “In Vivo Transfer Efficiency of Antisense Oligonucleotides into the Myocardium Using HVJ-Liposome Method,” Biochem Biophys Res Commun, 231:540-545 (1997).
Arpaia et al., “Production of transgenic eggplant (Solanum melongena L.) resistant to Colorado Potato Beetle (Leptinotarsa decemlineata Say),” (1997) Theor. Appl. Genet., 95:329-334 (1997).
Artymovich, “Using RNA interference to increase crop yield and decrease pest damage,” MMG 445 Basic Biotech., 5(1):7-12 (2009).
Axtell et al., “A Two-Hit Trigger for siRNA Biogenesis in Plants,” Cell, 127:565-577 (2006).
Bachman et al., “Characterization of the spectrum of insecticidal activity of a double-stranded RNA with targeted activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte),” Transgenic Res., pp. 1-16 (2013).
Baerson et al., “Glyphosate-Resistant Goosegrass. Identification of a Mutation in the Target Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase,” Plant Physiol., 129(3):1265-1275 (2002).
Bai et al., “Naturally Occurring Broad-Spectrum Powdery Mildew Resistance in a Central American Tomato Accession Is Caused by Loss of Mlo Function,” MPMI, 21(I):30-39 (2008).
Balibrea et al., “Extracellular Invertase is an Essential Component of Cytokinin-Mediated Delay of Senescence,” The Plant Cell, 16(5):1276-1287 (2004).
Bannerjee et al., “Efficient production of transgenic potato (S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens-mediated transformation,” Plant Sci., 170:732 738 (2006).
Bart et al., “A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts,” Plant Methods, 2(13):1-9 (2006).
Basu et al., “Weed genomics: new tools to understand weed biology,” Trends in Plant Science, 9(8):391-398 (2004).
Baulcombe, “RNA silencing and heritable epigenetic effects in tomato and Arabidopsis,” Abstract 13th Annual Fall Symposium, Plant Genomes to Phenomes, Donald Danforth Plant Science Center, 28-30 (2011).
Bayer et al., “Programmable ligand-controlled riboregulators of eukaryotic gene expression,” Nature Biotechnol., 23(3):337-343 (2005).
Beal, et al., “Second Structural Motif for Recognition of DNA by Oligonucleotide-Directed Triple-Helix Formation,” Science, 251:1360-1363 (1992).
Becker et al., “Fertile transgenic wheat from microprojectile bombardment of scutellar tissue,” The Plant Journal, 5(2):299-307 (1994).
Bhargava et al., “Long double-stranded RNA-mediated RNA interference as a tool to achieve site-specific silencing of hypothalamic neuropeptides,” Brain Research Protocols, 13:115-125 (2004).
Boletta et al., “High Efficient Non-Viral Gene Delivery to the Rat Kidney by Novel Polycationic Vectors,” J. Am Soc. Nephrol., 7:1728 (1996).
Bolognesi et al., “Characterizing the Mechanism of Action of Double-Stranded RNA Activity against Western Corn Rootworm(Diabrotica virgifera virgifera LeConte),” PLoS ONE 7(10):e47534 (2012).
Bolter et al., “A chloroplastic inner envelope membrane protease is essential for plant development,” FEBS Letters, 580:789-794 (2006).
Bourgeois et al., “Field and producer survey of ACCase resistant wild oat in Manitoba,” Canadian Journal of Plant Science, 709-715 (1997).
Breaker et al., “A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity,” Chemistry and Biology, 2:655-660 (1995).
Brodersen et al., “The diversity of RNA silencing pathways in plants,” Trends in Genetics, 22(5):268-280 (2006).
Brugiere et al., “Glutamine Synthetase in the Phloem Plays a Major Role in Controlling Proline Production,” The Plant Cell, 11:1995-2011 (1999).
Busch et al., “RNAi for discovery of novel crop protection products,” Pflanzenschutz-Nachrichten Bayer, 58(1):34-50 (2005).
Busi et al., “Gene flow increases the initial frequency of herbicide resistance alleles in unselectedpopulations,” Agriculture, Ecosystems and Environments, Elsevier, Amsterdam, NL, 142(3):403-409 (2011).
Butler et al., “Priming and re-drying improve the survival of mature seeds of Digitalis purpurea during storage,” Annals of Botany, 103:1261-1270 (2009).
Bytebier et al., “T-DNA organization in tumor cultures and transgenic plants of the monocotyledon Asparagus officinalis,” Proc. Natl. Acad. Sci. U.S.A., 84:5345-5349 (1987).
Campbell et al., “Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione S-transferase,” Parasites & Vectors, 3(1):73, pp. 1-10 (2010).
Chabannes et al., “In situ analysis of lignins in transgenic tobacco reveals a differential impact of individual transformations on the spatial patterns of lignin deposition at the cellular and subcellular levels,” The Plant Journal, 28(3):271-282 (2001).
Chabbouh et al., “Cucumber mosaic virus in artichoke,” FAO Plant Protection Bulletin, 38:52-53 (1990).
Chakravarty et al., “Genetic Transformation in Potato: Approaches and Strategies,” Amer J Potato Res, 84:301 311 (2007).
Chang et al., “Cellular Internalization of Fluorescent Proteins via Arginine-rich Intracellular Delivery Peptide in Plant Cells,” Plant Cell Physiol., 46(3):482-488 (2005).
Chee et al., “Transformation of Soybean (Glycine max) by Infecting Germinating Seeds with Agrobacterium tumefaciens,” Plant Physiol., 91:1212-1218 (1989).
Chen et al., “In Vivo Analysis of the Role of atTic20 in Protein Import into Chloroplasts,” The Plant Cell, 14:641-654 (2002).
Chen et al., “Transfection and Expression of Plasmid DNA in Plant Cells by an Arginine-Rich Intracellular Delivery Peptide without Protoplast Preparation,” FEBS Letters 581, pp. 1891-1897 (2007).
Cheng et al., “Production of fertile transgenic peanut (Arachis hypogaea L.) plants using Agrobacterium tumefaciens,” Plant Cell Reports, 15:653-657 (1996).
Chi et al., “The Function of RH22, a DEAD RNA Helicase, in the Biogenesis of the 50S Ribosomal Subunits of Arabidopsis Chloroplasts,” Plant Physiology, 158:693-707 (2012).
Chupp et al., “Chapter 8: White Rust,” Vegetable Diseases and Their Control, The Ronald Press Company, New York, pp. 267-269 (1960).
Clough et al., “Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana,” The Plant Journal, 16(6):735-743 (1998).
CN101914540 Patent Diclosure, “Introduction of RNA into plant by interference,” (2010).
Colboume et al., “The Ecoresponsive Genome of Daphnia pulex,” Science, 331(6017):555-561 (2011).
Colliver et al., “Differential modification of flavonoid and isoflavonoid biosynthesis with an antisense chalcone synthase construct in transgenic Lotus corniculatus,” Plant Molecular Biology, 35:509-522 (1997).
Communication pursuant to Article 94(3) EPC dated Jan. 14, 2016, in European Patent Application No. 12 832 415.9.
Communication pursuant to Article 94(3) EPC dated Jun. 26, 2015, in European Patent Application No. 11 753 916.3.
Communication pursuant to Article 94(3) EPC dated Mar. 18, 2016, in European Patent Application No. 12 832 160.1.
Communication pursuant to Article 94(3) EPC dated Mar. 24, 2016, in European Patent Application No. 12 831 684.1.
Communication pursuant to Article 94(3) EPC dated Mar. 4, 2016, in European Patent Application No. 12 830 932.5.
Communication pursuant to Article 94(3) EPC dated Mar. 9, 2016, in European Patent Application No. 12 831 166.9.
Communication pursuant to Article 94(3) EPC dated Oct. 23, 2015, in European Patent Application No. 12 831 945.6.
Concise Descriptions of Relevance filed by a third party on Nov. 29, 2012, in U.S. Appl. No. 13/042,856.
Cooney et al., “Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in Vitro,” Science ,241:456-459 (1988).
COST Action FA0806 progress report “Plant virus control employing RNA-based vaccines: A novel non-transgenic strategy” (2010).
Coticchia et al., “Calmodulin modulates Akt activity in human breast cancer cell lines,” Breast Cancer Res. Treat, 115:545-560 (2009).
Dalakouras et al., “Induction of Silencing in Plants by High-Pressure Spraying of In vitro-Synthesized Small RNAs,” Frontiers in Plant Science, 7(1327):1-5 (2016).
Dalmay et al., “An RNA-Depenedent RNA Polymerase Gene in Arabidopsis Is Required for Posttranscriptional Gene Silencing Mediated by a Transgene but Not by a Virus,” Cell, 101:543-553 (2000).
Davidson et al., “Engineering regulatory RNAs,” Trends in Biotechnology, 23(3):109-112 (2005).
Dawson et al., “cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts,” Proc. Natl. Acad. Sci. USA, 83:1832-1836 (1986).
De Block, et al. “Engineering herbicide resistance in plants by expression of a detoxifying enzyme,” EMBO J. 6(9):2513-2519 (1987).
De Framond, “MINI-Ti: A New Vector Strategy for Plant Genetic Engineering,” Nature Biotechnology, 1:262-269 (1983).
Della-Cioppa et al., “Import of a precursor protein into chloroplasts is inhibited by the herbicide glyphosate,” The EMBO Journal, 7(5):1299-1305 (1988).
Desai et al., “Reduction in deformed wing virus infection in larval and adult honey bees (Apis mellifera L.) by double-stranded RNA ingestion,” Insect Molecular Biology, 21(4):446-455 (2012).
Diallo et al., “Long Endogenous dsRNAs Can Induce Complete Gene Silencing in Mammalian Cells and Primary Cultures,” Oligonucleotides, 13:381-392 (2003).
Dietemann et al., “Varroa destructor: research avenues towards sustainable control,” Journal of Apicultural Research, 51(1):125-132 (2012).
Du et al., “A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites,” Nucleic Acids Research, 33(5):1671-1677 (2005).
Dunoyer et al., “Small RNA Duplexes Function as Mobile Silencing Signals Between Plant Cells,” Science, 328:912-916 (2010).
Ellington et al., “In vitro selection of RNA molecules that bind specific ligands,” Nature, 346:818-822 (1990).
Emery et al., “Radial Patterning of Arabidopsis Shoots by Class III HD-ZIP and KANADI Genes,” Current Biology, 13:1768-1774 (2003).
European Cooperation in the field of Scientific and Technical Research—Memorandum of Understanding for COST Action FA0806 (2008).
Extended European Search Report dated Feb. 2, 2015, in European Patent Application No. 12 830 932.5.
Extended European Search Report dated Feb. 27, 2015, in European Patent Application No. 12 832 160.1.
Extended European Search Report dated Feb. 3, 2015, in European Patent Application No. 12 831 945.6.
Extended European Search Report dated Jan. 20, 2016, in European Patent Application No. 13 794 339.5.
Extended European Search Report dated Jan. 21, 2015, in European Patent Application No. 12 832 415.9.
Extended European Search Report dated Jan. 29, 2015, in European Patent Application No. 12 831 567.8.
Extended European Search Report dated Jun. 29, 2015, in European Patent Application No. 12 831 494.5.
Extended European Search Report dated Mar. 17, 2015, in European Patent Application No. 12 831 684.1.
Extended European Search Report dated Mar. 3, 2015, in European Patent Application No. 12 831 166.9.
Extended European Search Report dated Oct. 8, 2013, in European Patent Application No. 11753916.3.
Extended European Search Report dated Sep. 29, 2016, in European Patent Application No. 14778840.0.
Farooq et al., “Rice seed priming,” IPRN, 30(2):45-48 (2005).
Feuillet et al., “Crop genome sequencing: lessons and rationales,” Trends Plant Sci., 16:77-88 (2011).
Final Office Action dated Apr. 7, 2016, in U.S. Appl. No. 13/619,980.
Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/335,135.
Final Office Action dated Feb. 17, 2016, in U.S. Appl. No. 13/612,929.
Final Office Action dated Feb. 4, 2016, in U.S. Appl. No. 13/612,936.
Final Office Action dated Jun. 30, 2016, in U.S. Appl. No. 13/901,326.
Final Office Action dated Mar. 2, 2016, in U.S. Appl. No. 13/612,995.
Final Office Action dated Mar. 21, 2016, in U.S. Appl. No. 13/612,925.
Final Office Action dated May 26, 2016, in U.S. Appl. No. 14/532,596.
Final Office Action dated Nov. 10, 2015, in U.S. Appl. No. 13/612,985.
Final Office Action dated Nov. 10, 2016, in U.S. Appl. No. 13/583,302.
Final Office Action dated Nov. 19, 2015, in U.S. Appl. No. 13/612,941.
Final Office Action dated Nov. 30, 2015, in U.S. Appl. No. 13/612,948.
Final Office Action dated Nov. 7, 2013, in U.S. Appl. No. 13/042,856.
Final Office Action dated Oct. 20, 2016, in U.S. Appl. No. 14/480,199.
Final Office Action dated Oct. 22, 2015, in U.S. Appl. No. 14/608,951.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 13/612,954.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/608,951.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/603,347.
Fire et al., “Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans,” Nature, 391:806-811 (1998).
First Examination Report dated Apr. 23, 2013, in New Zealand Patent Application No. 601784.
First Examination Report dated Jul. 28, 2014, in New Zealand Patent Application No. 627060.
First Office Action dated Aug. 31, 2015, in Chinese Patent Application No. 201280053985.3.
First Office Action dated Feb. 2, 2016, in Chinese Patent Application No. 201380039346.6.
First Office Action dated Jul. 7, 2015, in Chinese Patent Application No. 201280054820.8.
First Office Action dated Mar. 12, 2015, in Chinese Patent Application No. 201280053984.9.
First Office Action dated Mar. 2, 2015, in Chinese Patent Application No. 201280054819.5.
First Office Action dated May 27, 2015, in Chinese Patent Application No. 201280054179.8.
First Office Action dated Sep. 9, 2015, in Chinese Patent Application No. 201280055409.2.
Fraley et al., “Liposome-mediated delivery of tobacco mosaic virus RNA into tobacco protoplasts: A sensitive assay for monitoring liposome-protoplast interactions,” Proc Natl Acad Sci U S A., 79(6):1859-1863 (1982).
Fukuhara et al., “Enigmatic Double-Stranded RNA in Japonica Rice,” Plant Molecular Biology, 21:1121-1130 (1993).
Fukuhara et al., “The Unusual Structure of a Novel RNA Replicon in Rice,” The Journal of Biological Chemistry, 270(30):18147-18149 (1995).
Fukuhara et al., “The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties,” Archives of Virology, 151:995-1002 (2006).
Fukunaga et al., “dsRNA with 5′ overhangs v contributes to endogenous and antiviral RNA silencing pathways in plants,” The EMBO Journal, 28(5):545-555 (2009).
Further Examination Report dated May 16, 2014, in New Zealand Patent Application No. 601784.
Gaines et al., “Gene amplification confers glyphosate resistance in Amaranthus palmeri,” Proc. Natl. Acad. Sci. USA, 107(3):1029-1034 (2010).
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV infection,” Plant Cell Rep, 11:1261-1268 (2010).
Gan et al., “Inhibition of Leaf Senescence by Autoregulated Production of Cytokinin,” Science, 270:1986-1988 (1995).
Gao et al., “Down-regulation of acetolactate synthase compromises 01-1-mediated resistance to powdery mildew in tomato,” BMC Plant Biology, 14 (2014).
Gao et al., “Nonviral Methods for siRNA Delivery,” Molecular Pharmaceutics, 6(3):651-658 (2008).
Garbian et al., “Bidirectional Transfer of RNAi between Honey Bee and Varroa destructor: Varroa Gene Silencing Reduces Varroa Population,” 8(12):1-9:e1003035 (2012).
Ge et al., “Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism,” Pest Management Sci., 66:345-348 (2010).
GenBank Accession No. AY545657.1 (2004).
GenBank Accession No. CB377464, “CmaEl_37_J02_T3 Cowpea weevil larvae Lambda Zap Express Library Callosobruchus maculatus cDNA, mRNA sequence,” (2007).
GenBank Accession No. DY640489, “PU2_plate27_F03 PU2 Prunus persica cDNA similar to expressed mRNA inferred from Prunus persica hypothetical domain/motif cant aining IPRO11005:Dihydropteroate synthase-like, MRNA sequence” (2006).
GenBank Accession No. EU024568, “Amaranthus hypochondriacus acetolactate synthase (Als) gene” (2007).
GenBank Accession No. EW765249, “ST020010B10C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone STO20010B10C 12 5-, mRNA sequence,” (2007).
GenBank Accession No. EW771198, “ST0200101310C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone ST020010BIOC12 5-, mRNA sequence,” (2007).
GenBank Accession No. FE348695, “CBIB7954.fwd CBIB_Daphnia_pulex_Chosen_One_Library_2 Daphnia pulex cDNA clone CB1B7954 5′, mRNA sequence” (2011).
GenBank Accession No. F.1972198, “Solanum lycopersicum cultivar Ailsa Craig dihydropterin pyrophosphokinase-dihydropteroate synthase (HPPK-DHPS) gene, complete cds” (2010).
GenBank Accession No. GI:186478573 (2014).
GenBank Accession No. GU120406, “Chrysomela tremulae ribosomal protein L7 (RpL7) mRNA, complete cds” (2009).
GenBank Accession No. HD315444, “Sequence 192160 from Patent EP2213738” (2010).
GenBank Accession No. Q4GXM3_B1PLU, “Ribosomal protein L7e” (2006).
GenBank Accession No. U87257.1, “Daucus carota 4-hydroxyphenylpyruvate dioxygenase mRNA, complete cds” (1997).
GenBank Accession No. XM_014456745.1, Predicted: Myotis lucifugus ribonucleoprotein, PTB-binding 2 (RAVER2), transcript variant X3, mRNA,: (2015).
GenBank Accession No. Y08611.1, “P.sativum mRNA for dihydropterin pyrophosphokinase/dihydropteroate synthase.” (2006).
GenEmbl Accession No. FJ861243 (2010).
Gong et al., “Silencing of Rieske iron-sulfur protein using chemically synthesised siRNA as a potential biopesticide against Plutella xylostella,” Pest Manag Sci, 67:514-520 (2011).
Gossamer Threads, Compendium of Herbicide Adjuvants: Organo-Silicone Surfactant, p. 1-4 (1998).
Gressel et al., “A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds,” Pest Manag Sci, 65(7):723-731 (2009).
Gudkov, “Minireview: The L7/L12 ribosomal domain of the ribosome: structural and functional studies,” FEBS Letters, 407:253-256 (1997).
Gutensohn et al., “Functional analysis of the two Arabidopsis homologues of Toc34, a component of the chloroplast protein import apparatus,” The Plant Journal, 23(6):771-783 (2000).
Haigh, “The Priming of Seeds: Investigation into a method of priming large quantities of seeds using salt solutions,” Thesis submitted to Macquarie University (1983).
Hajirezaei et al., “Impact of elevated cytosolic and apoplastic invertase activity on carbon metabolism during potato tuber development,” Journal of Experimental Botany, 51:439-445 (2000).
Hamilton et al., “Guidelines for the Identification and Characterization of Plant Viruses,” J. gen. Virol., 54:223-241 (1981).
Hamilton et al., “Two classes of short interfering RNA in RNA silencing,” EMBO J., 21(17):4671-4679 (2002).
Han et al., “Molecular Basis for the Recognition of Primary microRNAs by the Drosha-DGCR8 Complex,” Cell, 125(5):887-901 (2006).
Hannon, “RNA interference,” Nature,481:244-251 (2002).
Hardegree, “Drying and storage effects on germination of primed grass seeds,” Journal of Range Management, 47(3):196-199 (1994).
Harrison et al., “Does Lowering Glutamine Synthetase Activity in Nodules Modigy Nitrogen Metabolism and Growth of Lotus japonicus?,” Plant Physiology, 133:253-262 (2003).
Heffer et al., “Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report,” EvoDevo Journal, 2(7):1-5 (2011).
Herman et al., “A three-component dicamba O-demethylase from Pseudomonas maltophilia, strain DI-6: gene isolation, characterization, and heterologous expression,” J. Biol, Chem., 280: 24759-24767 (2005).
Hewezi et al., “Local infiltration of high- and low-molecular-weight RNA from silenced sunflower (Helianthus annuus L.) plants triggers post-transcriptional gene silencing in non-silenced plants,” Plant Biotechnology Journal, 3:81-89 (2005).
Hidayat et al., “Enhanced Metabolism of Fluazifop Acid in a Biotype of Digitaria sanguinalis Resistant to the Herbicide Fluazifop-P-Butyl,” Pesticide Biochem. Physiol., 57:137-146 (1997).
Himber et al., “Transitivity-dependant and -independent cell-to-cell movement of RNA silencing,” The EMBO Journal, 22(17):4523-4533 (2003).
Hirschberg et al., “Molecular Basis of Herbicide Resistance in Amaranthus hybridus,” Science, 222:1346-1349 (1983).
Hoekema et al., “A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid,” Nature, 303:179-180 (1983).
Hofgen et al., “Repression of Acetolactate Synthase Activity through Antisense Inhibition: Molecular and Biochemical Analysis of Transgenic Potato (Solanum tuberosum L. cv Desiree) Plants,” Plant Physiol., 107(2):469-477 (1995).
Holtra et al., “Assessment of the Physiological Condition of Salvinia natans L. Exposed to Copper(II) Ions,” Environ. Protect. Eng., 41:147-158 (2015).
Hsieh et al., “A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens,” Nucleic Acids Res., 32(3):893-901 (2004).
Huesken et al., “Design of a genome-wide siRNA library using an artificial neural network,” Nature Biotechnology, 23(8): 995-1001 (2005).
Hunter et al., “RNA Interference Strategy to suppress Psyllids & Leafhoppers,” International Plant and Animal Genome XIX, 15-19 (2011).
Ichihara et al., “Thermodynamic instability of siRNA duplex is a prerequisite for dependable prediction of siRNA activities,” Nucleic Acids Res., 35(18):e123 (2007).
International Preliminary Report on Patentability (Chapter II) dated Jul. 24, 2015, in International Application No. PCT/US2014/047204.
International Preliminary Report on Patentability dated Sep. 11, 2012, in International Application No. PCT/US2011/027528.
International Preliminary Report on Patentability dated Sep. 11, 2014, in International Application No. PCT/IL2013/050447.
International Rice Genome Sequencing Project, The map-based sequence of the rice genome, Nature, 436(11):793-800 (2005).
International Search Report and the Written Opinion dated Feb. 25, 2013, in International Application No, PCT/US2012/054883.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054814.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054842.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054862.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054894.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054974.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054980.
International Search Report and the Written Opinion dated Jul. 15 2014, in International Application No. PCT/US2014/025305.
International Search Report and the Written Opinion dated Jul. 22 2014, in International Application No. PCT/IL2013/051083.
International Search Report and the Written Opinion dated Jul. 22 2014, in International Application No. PCT/IL2013/051085.
International Search Report and the Written Opinion dated Jul. 24 2014, in International Application No. PCT/US2014/026036.
International Search Report and the Written Opinion dated May 10, 2011, in International Application No. PCT/US2011/027528.
International Search Report and the Written Opinion dated Oct. 1, 2013, in International Application No. PCT/IL2013/050447.
International Search Report and Written Opinion dated Aug. 25, 2014, in International Application No. PCT/US2014/023503.
International Search Report and Written Opinion dated Aug. 27, 2014, in International Application No. PCT/US2014/023409.
International Search Report and Written Opinion dated Feb. 23, 2015, in International Application No. PCT/US2014/063832.
International Search Report and Written Opinion dated Jul. 8, 2015, in International Application No. PCT/US2015/011408.
International Search Report and Written Opinion dated Mar. 26, 2015, in International Application No. PCT/US2014/069353.
International Search Report and Written Opinion dated May 26, 2016, in International Application No. PCT/US2016/014344.
International Search Report and Written Opinion dated Nov. 24, 2015, in International Application No. PCT/US2015/037522.
International Search Report and Written Opinion dated Nov. 27, 2015, in International Application No. PCT/US2015/037015.
International Search Report dated Mar. 12, 2013, in International Application No. PCT/US2012/054789.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051083.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051085.
Invitation to Pay Additional Fees dated Nov. 25, 2014, in International Application No. PCT/US2014/047204.
Invitation to Pay Additional Fees dated Sep. 8, 2015, in International Application No. PCT/US2015/037015.
Invitation to Pay Additional Fees dated Sep. 9, 2015, in International Application No. PCT/US2015/037522.
Isaacs et al “Engineered riboregulators enable post-transcriptional control of gene expression,” Nature Biotechnology, 22(7):841-847 (2004).
Ji et al., “Regulation of small RNA stability: methylation and beyond,” Cell Research, 22:624-636 (2012).
Jin et al., “Posttranslational Elevation of Cell Wall Invertase Activity by Silencing its Inhibitor in Tomato Delays Leaf Senescence and Increases Seed Weight and Fruit Hexose Level,” The Plant Cell, 21:2072-2089 (2009).
Jofre-Garfias et al., “Agrobacterium-mediated transformation of Amaranthus hypochondriacus: light- and tissue-specific expression of a pea chlorophyll a/b-binding protein promoter,” Plant Cell Reports, 16:847-852 (1997).
Jones-Rhoades et al., “MicroRNAs and Their Regulatory Roles in Plants,” Annu. Rev. Plant Biol., 57:19-53 (2006).
Josse et al., “A DELLA in Disguise: SPATULA Restrains the Growth of the Developing Arabidopsis Seedling,” Plant Cell, 23:1337-1351 (2011).
Kaloumenos et al., “Identification of a Johnsongrass (Sorghum halepense) Biotype Resistant to ACCase-Inhibiting Herbicides in Northern Greece,” Weed Technol, 23:470-476 (2009).
Kam et al., “Nanotube Molecular Transporters: Internalization of Carbon Nanotube—Protein Conjugates into Mammalian Cells,” J. Am. Chem. Soc., 126(22):6850-6851 (2004).
Kambiranda et al., “Relationship Between Acid Invertase Activity and Sugar Content in Grape Species,” Journal of Food Biochemistry, 35:1646-1652 (2011).
Katoh et al., “Specific residues at every third position of siRNA shape its efficient RNAi activity,” Nucleic Acids Res., 35(4): e27 (2007).
Kertbundit et al., “In vivo random β-glucuronidase gene fusions in Arabidopsis thaliana,” Proc. Natl. Acad. Sci. U S A., 88:5212-5216 (1991).
Khachigian, “DNAzymes: Cutting a path to a new class of therapeutics,” Curr Opin Mol Ther 4(2):119-121 (2002).
Khan et al., “Matriconditioning of Vegetable Seeds to Improve Stand Establishment in Early Field Plantings,” J. Amer. Soc. Hort. Sci., 117(1):41-47 (1992).
Khodakovskaya et al., “Carbon Nanotubes Are Able to Penetrate Plant Seed Coat and Dramatically Affect Seed Germination and Plant Growth,” ACS Nano, 3(10):3221-3227 (2009).
Kim et al., “Optimization of Conditions for Transient Agrobacterium-Mediated Gene Expression Assays in Arabidopsis,” Plant Cell Reports, 28:1159-1167 (2009).
Kim et al., “Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy,” Nature Biotechnology, 23(2):222-226 (2005).
Kirkwood, “Herbicides and Plants,” Botanical Journal of Scotland, 46(3):447-462 (1993).
Kirkwood, “Use and Mode of Action of Adjuvants for Herbicides: A Review of some Current Work,” Pestic Sci., 38:93-102 (1993).
Klahre et al., “High molecular weight RNAs and small interfering RNAs induce systemic posttranscriptional gene silencing in plants,” Proc. Natl. Acad. Sci. USA, PNAS, 99(18):11981-11986 (2002).
Knudsen, “Promoter2.0: for the recognition of Poll promoter sequences,” Bioniformatics, 15(5):356-361 (1999).
Kronenwett et al., “Oligodeoxyribonucleotide Uptake in Primary Human Hematopoietic Cells Is Enhanced by Cationic Lipids and Depends on the Hematopoietic Cell Subset,” Blood, 91(3):852-862 (1998).
Kusaba et al., “Low glutelin content1: A Dominant Mutation That Suppresses the Glutelin Multigene Family via RNA Silencing ni Rice,” The Plant Cell, 15(6):1455-1467 (2003).
Kusaba, “RNA interference in crop plants,” Curr Opin Biotechnol, 15(2):139-143 (2004).
Lavigne et al., “Enhanced antisense inhibition of human immunodeficiency virus type 1 in cell cultures by DLS delivery system,” Biochem Biophys Res Commun, 237:566-571 (1997).
Lee et al., “Aptamer Database,” Nucleic Acids Research, 32:D95-D100 (2004).
Lein et al., “Target-based discovery of novel herbicides,” Current Opinion in Plant Biology, 7:219-225 (2004).
Leopold et al., “Chapter 4: Moisture as a Regulator of Physiological Reaction in Seeds,” Seed Moisture, CSSA Special Publication No. 14, pp. 51-69 (1989).
Lermontova et al., “Reduced activity of plastid protoporphyrinogen oxidase causes attenuated photodynamic damage during high-light compared to low-light exposure,” The Plant Journal, 48(4):499-510 (2006).
Lesnik et al., “Prediction of rho-independent transcriptional terminators in Escherichia coli,” Nucleic Acids Research, 29(17):3583-3594 (2001).
Li et al., “Establishment of a highly efficient transformation system for pepper (Capsicum annuum L.),” Plant Cell Reports, 21: 785-788 (2003).
Li et al., “The FAST technique: a simplified Agrobacterium-based transformation method for transient gene expression analysis in seedlings of Arabidopsis and other plant species,” Plant Methods, 5(6):1-15 (2009).
Liu et al., “Carbon Nanotubes as Molecular Transporters for Walled Plant Cells,” Nano Letters, 9(3):1007-1010 (2009).
Liu et at., “Comparative study on the interaction of DNA with three different kinds of surfactants and the formation of multilayer films,” Bioelectrochemistry, 70:301-307 (2007).
Liu et al., “DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli,” BMC Biotechnology, 10:85 (2010).
Liu et al., “Identification and Application of a Rice Senescence-Associated Promoter,” Plant Physiology, 153:1239-1249 (2010).
Liu, “Influence of Sugars on the Foliar Uptake of Bentazone and Glyphosate,” New Zealand Plant Protection, 55:159-162 (2002).
Llave et al., “Endogenous and Silencing-Associated Small RNAs in Plants,” The Plant Cell, 14:1605-1619 (2002).
Lu et al., “Oligo Walk: an online siRNA design tool utilizing hybridization thermodynamics,” Nucleic Acids Research, 36:W104-W108 (2008).
Lu et al., “RNA silencing in plants by the expression of siRNA duplexes,” Nucleic Acids Res., 32(21):e171 (2004).
Luft, “Making sense out of antisense oligodeoxynucleotide delivery: getting there is half the fun,” J Mol Med, 76:75-76 (1998).
Luque et al., “Water Permeability of Isolated Cuticular Membranes: A Structural Analysis,” Archives of Biochemistry and Biophysics, 317(2):417-422 (1995).
Maas et al., “Mechanism and optimized conditions for PEG mediated DNA transfection into plant protoplasts,” Plant Cell Reports, 8:148-149 (1989).
MacKenzie et al., “Transgenic Nicotiana debneyii expressing viral coat protein are resistant to potato virus S infection,” Journal of General Virology, 71:2167-2170 (1990).
Maher III et al., “Inhibition of DNA binding proteins by oligonucleotide-directed triple helix formation,” Science, 245(4919):725-730 (1989).
Makkouk et al., “Virus Diseases of Peas, Beans, and Faba Bean in the Mediterranean region,” Adv Virus Res, 84:367-402 (2012).
Mandal et al., “Adenine riboswitches and gene activation by disruption of a transcription terminator,” Nature Struct. Mol. Biol., 11(1):29-35 (2004).
Mandal et al., “Gene Regulation by Riboswitches,” Nature Reviews | Molecular Cell Biology, 5:451-463 (2004).
Manoharan, “Oligonucleotide Conjugates as Potential Antisense Drugs with Improved Uptake, Biodistribution, Targeted Delivery, and Mechanism of Action,” Antisense & Nucleic Acid Drug Development, 12:103-128 (2002).
Maori et al., “IAPV, a bee-affecting virus associated with Colony Collapse Disorder can be silenced by dsRNA ingestion,” Insect Molecular Biology, 18(1):55-60 (2009).
Masoud et al., “Constitutive expression of an inducible β-I,3-glucanase in alfalfa reduces disease severity caused by the oomycete pathogen Phytophthora megasperma f. sp medicaginis, but does not reduce disease severity of chitincontaining fungi,” Transge.
Matveeva et al., “Prediction of antisense oligonucleotide efficacy by in vitro methods,” Nature Biotechnology, 16:1374-1375 (1998).
Meinke, et al., “Identifying essential genes in Arabidopsis thaliana,” Trends Plant Sci., 13(9):483-491 (2008).
Meins et al., “RNA Silencing Systems and Their Relevance to Plant Development,” Annu, Rev. Cell Dev. Biol., 21:297-318 (2005).
Melnyk et al., “Intercellular and systemic movement of RNA silencing signals,” The EMBO Journal, 30:3553-3563 (2011).
Migge et al., “Greenhouse-grown conditionally lethal tobacco plants obtained by expression of plastidic glutamine synthetase antisense RNA may contribute to biological safety,” Plant Science 153:107-112 (2000).
Misawa et al., “Expression of an Erwinia phytoene desaturase gene not only confers multiple resistance to herbicides interfering with carotenoid biosynthesis but also alters xanthophyll metabolism in transgenic plants,” The Plant Journal, 6(4):481-489 (19.
Misawa et al., “Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of (β-carotene biosynthesis activity and resistance to the bleaching herbicide norflurazon,” The Plant Journal, 4(5):8.
Miura et al., “The Balance between Protein Synthesis and Degradation in Chloroplasts Determines Leaf Variegation in Arabidopsis yellow variegated Mutants,” The Plant Cell, 19:1313-1328 (2007).
Molina et al., “Inhibition of protoporphyrinogen oxidase expression in Arabidopsis causes a lesion-mimic phenotype that induces systemic acquired resistance,” The Plant Journal, 17(6):667-678 (1999).
Molnar et al., “Plant Virus-Derived Small Interfering RNAs Originate redominantly from Highly Structured Single-Stranded Viral RNAs,” Journal of Virology, 79(12):7812-7818 (2005).
Molnar et al., “Small Silencing RNAs in Plants Are Mobile and Direct Epigenetic Modification in Recipient Cells,” Science, 328:872-875 (2010).
Mora et al., “How Many Species Are There on Earth and in the Ocean?,” PLOS Biol., 9(8):e100127, p. 1-8 (2011).
Moriyama et al., “Double-stranded RNA in rice: a novel RNA replicon in plants,” Molecular & General Genetics, 248(3):364-369 (1995).
Moriyama et al., “Stringently and developmentally regulated levels of a cytoplasmic double-stranded RNA and its high-efficiency transmission via egg and pollen in rice,” Plant Molecular Biology, 31:713-719 (1996).
Morrissey et al., “Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs,” Nat Biotechnol. 23(8):1002-1007 (2005).
Moser et al., “Sequence-Specific Cleavage of Double Helical DNA by Triple Helix Formation,” Science, 238:645-646 (1987).
Mount et al., “Gene and Metabolite Regulatory Network Analysis of Early Developing Fruit Tissues Highlights New Candidate Genes for the Control of Tomato Fruit Composition and Development,” Plant Physiology, 149:1505-1528 (2009).
Non-Final Office Action dated Apr. 11, 2013, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Apr. 29, 2016, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated Aug. 10, 2016, in U.S. Appl. No. 13/612,995.
Non-Final Office Action dated Aug. 12, 2015, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Aug. 13, 2015, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Aug. 3, 2016, in U.S. Appl. No. 14/015,715.
Non-Final Office Action dated Aug. 5, 2016, in U.S. Appl. No. 14/015,785.
Non-Final Office Action dated Aug. 8, 2016, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/532,596.
Non-Final Office Action dated Feb. 10, 2016, in U.S. Appl. No. 13/901,326.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/603,347.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated Jul. 23, 2015, in U.S. Appl. No. 14/335,135.
Non-Final Office Action dated Jul. 30, 2014, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Jun. 5, 2015, in U.S. Appl. No. 13/612,948.
Non-Final Office Action dated Jun. 8, 2015, in U.S. Appl. No. 13/612,941.
Non-Final Office Action dated Mar. 1, 2016, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Mar. 30, 2015, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated May 15, 2015, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated May 22, 2015, in U.S. Appl. No. 13/612,985.
Non-Final Office Action dated Nov. 9, 2016, in U.S. Appl. No. 14/901,003.
Non-Final Office Action dated Oct. 3, 2016, in U.S. Appl. No. 14/403,491.
Non-Final Office Action dated Sep. I, 2015, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Sep. 11, 2015, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Sep. 4, 2015, in U.S. Appl. No. 13/612,995.
Non-Final Office Action dated Sep. 6, 2016, in U.S. Appl. No. 14/335,135.
Nookaraju et al., “Molecular approaches for enhancing sweetness in fruits and vegetables,” Scientia Horticulture, 127:1-15 (2010).
Nord-Larsen et al., “Cloning, characterization and expression analysis of tonoplast intrinsic proteins and glutamine synthetase in ryegrass (Lolium perenne L.),” Plant Cell Reports, 28(10):1549-1562 (2009).
Notice of Allowance dated Apr. 11, 2016, in U.S. Appl. No. 13/612,985.
Notice of Allowance dated Apr. 19, 2016, in U.S. Appl. No. 13/612,941.
Notice of Allowance dated Apr. 20, 2016, in U.S. Appl. No. 13/612,948.
Notice of Allowance dated Feb. 23, 2015, in U.S. Appl. No. 13/042,856.
Notice of Allowance dated Jun. 2, 2015, in U.S. Appl. No. 13/042,856.
Notice of Allowance dated Oct. 5, 2015, in U.S. Appl. No. 13/583,302.
Nowak et al., “A new and efficient method for inhibition of RNA viruses by DNA interference,” The FEBS Journal, 276:4372-4380 (2009).
Office Action dated Apr. 13, 2016, in Chinese Patent Application No. 201280053985.3.
Office Action dated Aug. 25, 2016, in Eurasian Patent Application No. 201201264.
Office Action dated Aug. 28, 2013, in Chinese Patent Application No. 201180012795.2.
Office Action dated Dec. 13, 2016, in Ukrainian Patent Application No. a 2014 03843.
Office Action dated Dec. 14, 2016, in Ukrainian Patent Application No. a 2014 03850.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03845.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03852.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03849.
Office Action dated Dec. 27, 2016, in Ukrainian Patent Application No. a 2012 11548.
Office Action dated Feb. 17, 2014, in Mexican Patent Application No. MX/a/2012/010479.
Office Action dated Feb. 24, 2014, in Eurasian Patent Application No. 201201264.
Office Action dated Jul. 18, 2016, in Indonesian Patent Application No. W00201203610.
Office Action dated Jul. 23, 2015, in Ukrainian Patent Application No. 201211548.
Office Action dated Jun. 20, 2016, in Chinese Patent Application No. 201280054819.5.
Office Action dated Jun. 24, 2016, in Chinese Patent Application No. 201280053984.9.
Office Action dated Nov. 15, 2016, in Mexican Patent Application. No. MX/a/2014/003068.
Office Action dated Sep. 5, 2016, in Ukrainian Patent Application No. a 2014 03846.
Office Action dated Nov. 3, 2014, in Chinese Patent Application No. 201180012795.2.
Office Action dated Jan. 6, 2015, in Japanese Patent Application No. 2012-557165.
Office Action dated Nov. 19, 2014, in Eurasian Patent Application No. 201201264/28.
Office Action dated Oct. 5, 2015, in Eurasian Patent Application No. 201201264/28.
Ongvarrasopone et al., “A Simple and Cost Effective Method to Generate dsRNA for RNAi Studies in Invertebrates,” Science Asia, 33:35-39 (2007).
Orbović et al., “Foliar-Applied Surfactants and Urea Temporarily Reduce Carbon Assimilation of Grapefruit Leaves,” J. Amer. Soc. Hort. Sci., 126(4):486-490 (2001).
Ouellet et al., “Members of the Acetohydroxyacid Synthase Muligene Family of Brassica Napus Have Divergent Patterns of Expression,” The Plant Journal, Blackwell Scientific Publications, Oxford, GB, 2(3):321-330 (1992).
Palauqui et al., “Activation of systemic acquired silencing by localised introduction of DNA,” Current Biology, 9:59-66 (1999).
Parera et al., “Dehydration Rate after Solid Matrix Priming Alters Seed Performance of Shrunken-2 Corn,” J. Amer. Soc, Hort. Sci., 119(3):629-635 (1994).
Partial Supplementary European Search Report dated Mar. 2, 2015, in European Patent Application No. 12 831 494.5.
Patent Examination Report No. 1 dated Feb. 8, 2016, in Australian Patent Application No. 2014262189.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308659.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308660.
Patent Examination Report No. 1 dated Nov. 11, 2013, in Australian Patent Application No. 2011224570.
Paungfoo-Lonhienne et al., “DNA is Taken up by Root Hairs and Pollen, and Stimulates Root and Pollen Tube Growth,” Plant Physiology, 153:799-805 (2010).
Paungfoo-Lonhienne et al., “DNA uptake by Arabidopsis induces changes in the expression of CLE peptides which control root morphology,” Plant Signaling & Behavior, 5(9):1112-1114 (2010).
Pei et al., “On the art of identifying effective and specific siRNAs,” Nature Methods, 3(9):670-676 (2006).
Peretz et al., “A Universal Expression/Silencing Vector in Plants,” Plant Physiology, 145:1251-1263 (2007).
Pornprom et al., “Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections,” Pest Manag Sci, 2009; 65(2):216-222 (2009).
Pratt et al., “Amaranthus rudis and A. tuberculatus, One Species or Two?,” Journal of the Torrey Botanical Society, 128(3):282-296 (2001).
Preston et al., “Multiple effects of a naturally occurring proline to threonine substitution within acetolactate synthase in two herbicide-resistant populations of Lactuca serriola,” Pesticide Biochem. Physiol., 84(3):227-235 (2006).
Promoter Prediction for SEQ ID No. 1702 from 13/612929/MK/, Promoter 2.0 Prediction Results, pp. 1-4 (2016).
Promoter Prediction for SEQ ID No. 4 from 13/612995/MK/, Promoter 2.0 Prediction Results, pp. 1-3 (2016).
Promoter Prediction for SEQ ID No. 7 from 13/612936/MK/, Promoter 2.0 Prediction Results, pp. 1-2 (2016).
Promoter Prediction for SEQ ID No. 8 from 13/612,925/MK/, Promoter 2.0 Prediction Results, pp. 1-6 (2016).
Qiwei,“Advance in DNA interference,” Progress in Veterinary Medicine, 30(1):71-75 (2009).
Rajur et al., “Covalent Protein—Oligonucleotide Conjugates for Efficient Delivery of Antisense Molecules,” Bioconjug Chem., 8:935-940 (1997).
Reddy et al “Organosilicone Adjuvants Increased the Efficacy of Glyphosate for Control of Weeds in Citrus (Citrus spp.)” HortScience 27(9):1003-1005 (1992).
Reddy et al., “Aminomethylphosphonic Acid Accumulation in Plant Species Treated with Glyphosate,” J. Agric. Food Chem., 56(6):2125-2130 (2008).
Reither et al., “Specificity of DNA triple helix formation analyzed by a FRET assay,” BMC Biochemistry, 3:27 (2002).
Restriction Requirement dated Apr. 21, 2015, in U.S. Appl. No. 13/612,954.
Restriction Requirement dated Feb. 12, 2015, in U.S. Appl. No. 13/612,985.
Restriction Requirement dated Jul. 15, 2016, in U.S. Appl. No. 14/143,748.
Restriction Requirement dated Jul. 18, 2016, in U.S. Appl. No. 14/143,836.
Restriction Requirement dated Mar. 12, 2015, in U.S. Appl. No. 13/612,948.
Restriction Requirement dated Mar. 4, 2015, in U.S. Appl. No. 13/612,941.
Restriction Requirement dated May 4, 2015, in U.S. Appl. No. 13/612,929.
Restriction Requirement dated May 5, 2015, in U.S. Appl. No. 13/612,936.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,925.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,995.
Restriction Requirement dated Oct. 13, 2016, in U.S. Appl. No. 14/206,707.
Restriction Requirement dated Oct. 2, 2012, in U.S. Appl. No. 13/042,856.
Restriction Requirement dated Oct. 21, 2014, in U.S. Appl. No. 13/583,302.
Restriction Requirement dated Oct. 28, 2015, in U.S. Appl. No. 14/603,347.
Restriction Requirement dated Sep. 2, 2015, in U.S. Appl. No. 14/532,596.
Rey et al., “Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands,” Viruses, 4:1753-1791 (2012).
Reynolds et al., “Rational siRNA design for RNA interference,” Nature Biotechnology, 22:326-330 (2004).
Riggins et al., “Characterization of de novo transcriptome for waterhemp (Amaranthus tuberculatus) using GS-FLX 454 pyrosequencing and its application for studies of herbicide target-site genes,” Pest Manag. Sci., 66:1042-1052 (2010).
Roberts, “Fast-track applications: The potential for direct delivery of proteins and nucleic acids to plant cells for the discovery of gene function,” Plant Methods, 1(12):1-3 (2005).
Robson et al., “Leaf senescence is delayed in maize expressing the Agrobacterium IPT gene under the control of a novel maize senescence-enhanced promoter,” Plant Biotechnology Journal, 2:101-112 (2004).
Roitsch et al., “Extracellular invertase: key metabolic enzyme and PR protein,” Journal of Experimental Botany, 54(382):513-524 (2003).
Roitsch et al., “Function and regulation of plant invertases: sweet sensations,” Trades in Plant Science, 9(12):606-613 (2004).
Rose et al., “Functional polarity is introduced by Dicer processing of short substrate RNAs,” Nucleic Acids Research, 33(13):4140-4156 (2005).
Rothnie et al., Pararetroviruses and Retroviruses: A Comparative Review of Viral Structure and Gene Expression Strategies, Advances in Virus Research, 44:1-67 (1994).
Ruan et al., “Suppression of Sucrose Synthase Gene Expression Represses Cotton Fiber Cell Initiation, Elongation, and Seed Development,” The Plant Cell; 15:952-964 (2003).
Ryabov et al., “Cell-to-Cell, but Not Long-Distance, Spread of RNA Silencing That Is Induced in Individual Epidermal Cells,” Journal of Virology, 78(6):3149-3154 (2004).
Ryan, “Human endogenous retroviruses in health and disease: a symbiotic perspective,” Journal of the Royal Society of Medicine, 97:560-565 (2004).
Salanenka et al., “Seedcoat Permeability: Uptake and Post-germination Transport of Applied Model Tracer Compounds,” HortScience, 46(4):622-626 (2011).
Santoro et al., “A general purpose RNA-cleaving DNA enzyme,” Proc. Natl. Acad. Sci. USA, 94:4262-4266 (1997).
Sathasivan et al., “Nucleotide sequence of a mutant acetolactate synthase gene from an imidazolinone-resistant Arabidopsis thaliana var. columbia,” Nucleic Acids Research, 18(8):2188-2193 (1990).
Schönherr, “Water Permeability of Isolated Cuticular Membranes: The Effect of pH and Cations on Diffusion, Hydrodynamic Permeability and Size of Polar Pores in the Cutin Matrix,” Planta, 128:113-126 (1976).
Schwab et al., “RNA silencing amplification in plants: Size matters,” PNAS, 107(34):14945-14946 (2010).
Schweizer et al., “Double-stranded RNA interferes with gene function at the single-cell level in cereals,” The Plant Journal, 24(6):895-903 (2000).
Schwember et al., “Drying Rates following Priming Affect Temperature Sensitivity of Germination and Longevity of Lettuce Seeds,” HortScience, 40(3):778-781 (2005).
Scott et al., Botanical Insecticides for Controlling Agricultural Pests: Piperamides and the Colorado Potato Beetle Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae), Archives of Insect Biochemistry and Physiology, 54:212-225 (2003).
Second Chinese Office Action dated Jun. 10, 2014, in Chinese Patent Application No. 201180012795.2.
Second Office Action dated Feb. 25, 2016, in Chinese Patent Application No. 201280054179.8.
Second Office Action dated Mar. 4, 2016, in Chinese Patent Application No. 201280054820.8.
Seidman et al., “The potential for gene repair via triple helix formation,” J Clin Invest., 112(4):487-494 (2003).
Selvarani et al., “Evaluation of seed priming methods to improve seed vigour of onion (Allium cepa cv. Aggregatum) and carrot (Daucus carota),” Journal of Agricultural Technology, 7(3):857-867 (2011).
Senthil-Kumar et al., “A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing,” New Phytologist, 176:782-791 (2007).
Shaoquan, “The action target of herbicide and the innovation of a new variety,” Chemical Industry Press, pp. 23-24 (2001).
Sharma et al., “A simple and efficient Agrobacterium-mediated procedure for transformation of tomato,” J. Biosci., 34(3):423 433 (2009).
Shintani et al., “Antisense Expression and Overexpression of Biotin Carboxylase in Tobacco Leaves,” Plant Physiol 114:881-886 (1997).
Showalter, “Structure and Function of Plant Cell Wall Proteins,” The Plant Cell, 5:9-23 (1993).
Sijen et al., “On the Role of RNA Amplification in dsRNA-Triggered Gene Silencing,” Cell, 107:465-476 (2001).
Silwet L-77 Spray Adjuvant for agricultural applications, product description from Momentive Performance Materials, Inc. (2003).
Singh et al., “Absorption and translocation of glyphosate with conventional and organosilicone adjuvants,” Weed Biology and Management, 8:104-111 (2008).
Snead et al., “Molecular basis for improved gene silencing by Dicer substrate interfering RNA compared with other siRNA variants,” Nucleic Acids Research, 41(12):6209-6221 (2013).
Song et al., “Herbicide,” New Heterocyclic Pesticide, Chemical Industry Press, 354-356 (2011).
Steeves et al., “Transgenic soybeans expressing siRNAs specific to a major sperm protein gene suppress Heterodera glycines reproduction,” Funct. Plant Biol., 33:991-999 (2006).
Stevens et al., “New Formulation Technology—Silwet® Organosilicone Surfactants Have Physical and Physiological Properties Which Enhance the Performance of Sprays,” Proceedings of the 9th Australian Weeds Conference, pp. 327-331 (1990).
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” Journal of Pesticide Science, 38:103-122 (1993).
Stock et al., “Possible Mechanisms for Surfactant-Induced Foliar Uptake of Agrochemicals,” Pestic. Sci., 38:165-177 (1993).
Strat et al., “Specific and nontoxic silencing in mammalian cells with expressed long dsRNAs,” Nucleic Acids Research, 34(13):3803-3810 (2006).
Street, “Why is DNA (and not RNA) a stable storage form for genetic information?,” Biochemistry Revisited, pp. 1-4 (2008).
Sudarsan et al., “Metabolite-binding RNA domains are present in the genes of eukaryotes,” RNA, 9:644-647 (2003).
Sun et al., “A Highly efficient Transformation Protocol for Micro-Tom, a Model Cultivar for Tomato Functional Genomics,” Plant Cell Physiol., 47(3):426-431 (2006).
Sun et al., “Antisense oligodeoxynucleotide inhibition as a potent strategy in plant biology: identification of SUSIBA2 as a transcriptional activator in plant sugar signalling,” The Plant Journal, 44:128-138 (2005).
Sun et al., “Sweet delivery—sugar translocators as ports of entry for antisense oligodeoxynucleotides in plant cells,” The Plant Journal, 52:1192-1198 (2007).
Sutton et al., “Activity of mesotrione on resistant weeds in maize,” Pest Manag. Sci., 58:981-984 (2002).
Takasaki et al., “An Effective Method for Selecting siRNA Target Sequences in Mammalian Cells,” Cell Cycle, 3:790-795 (2004).
Tang et al., “Efficient delivery of small interfering RNA to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing,” Plant Science, 171:375-381 (2006).
Tank Mixing Chemicals Applied to Peanut Crops: Are the Chemicals Compatible?, College of Agriculture & Life Sciences, NC State University, AGW-653, pp. 1-11 (2004).
Taylor, “Seed Storage, Germination and Quality,” The Physiology of Vegetable Crops, pp. 1-36 (1997).
Temple et al., “Can glutamine synthetase activity levels be modulated in transgenic plants by the use of recombinant DNA technology?” Transgenic Plants and Plant Biochemistry, 22(4):915-920 (1994).
Temple et al., “Down-regulation of specific members of the glutamine synthetase gene family in Alfalfa by antisense RNA technology,” Plant Molecular Biology, 37:535-547 (1998).
Templeton et al., “Improved DNA: liposome complexes for increased systemic delivery and gene expression,” Nature Biotechnology, 15:647-652 (1997).
Tenllado et al., “Crude extracts of bacterially expressed dsRNA can be used to protect plants against virus infection,” BMC Biotechnology, 3(3):1-11 (2003).
Tenllado et al., “Double-Stranded RNA-Mediated Interference with Plant Virus Infection,” Journal of Virology, 75(24):12288-12297 (2001).
Tenllado et al., “RNA interference as a new biotechnological tool for the control of virus diseases in plants,” Virus Research, 102:85-96 (2004).
Tepfer, “Risk assessment of virus resistant transgenic plants,” Annual Review of Phytopathology, 40:467-491 (2002).
The Seed Biology Place, Website Gerhard Leubner Lab Royal Holloway, University of London, <http://www.seedbiology.de/seedtechnology.asp.
Third Party Submission filed on Nov. 29, 2012 in U.S. Appl. No. 13/042,856.
Thomas et al., “Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector,” The Plant Journal, 25(4):417-425 (2001).
Thompson, et al., “Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice,” Nucl. Acids Res., 22(22):4673-4680 (1994).
Timmons et al., “Specific interference by ingested dsRNA,” Nature, 395:854 (1998).
Tomari et al., “Perspective: machines for RNAi,” Genes & Dev., 19:517-529 (2005).
Tomlinson et al., “Evidence that the hexose-to-sucrose ratio does not control the switch to storage product accumulation in oilseeds: analysis of tobacco seed development and effects of overexpressing apoplastic invertase,” Journal of Experimental Botany.
Töpfer et al., “Uptake and Transient Expression of Chimeric Genes in Seed-Derived Embryos,” Plant Cell, 1:133-139 (1989).
Tran et al., “Control of specific gene expression in mammalian cells by co-expression of long complementary RNAs,” FEBS Lett.;573(1-3):127-134 (2004).
Tranel et al., “Resistance of weeds to ALS-inhibiting herbicides: what have we learned?,” Weed Science, 50:700-712 (2002).
Tsugawa et al., “Efficient transformation of rice protoplasts mediated by a synthetic polycationic amino polymer,” Theor Appl Genet, 97:1019-1026 (1998).
Turina et al., “Tospoviruses in the Mediterranean Area,” Advances in Virus Research, 84:403-437 (2012).
Tuschl, “Expanding small RNA interference,” Nature Biotechnol., 20: 446-448 (2002).
Tuschl, “RNA Interference and Small Interfering RNAs,” ChemBiochem. 2(4):239-245 (2001).
Ui-Tei et al., “Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference,” Nucleic Acids Res., 32(3): 936-948 (2004).
Unnamalai et al., “Cationic oligopeptide-mediated delivery of dsRNA for post-transcriptional gene silencing in plant cells,” FEBS Letters, 566:307-310 (2004).
Unniraman et al., “Alternate Paradigm for Intrinsic Transcription Termination in Eubacteria,” The Journal of Biological Chemistry, 276(45)(9):41850-41855 (2001).
Unniraman et al., “Conserved Economics of Transcription Termination in Eubacteria,” Nucleic Acids Research, 30(3):675-684 (2002).
Urayama et al., “Knock-down of OsDCL2 in Rice Negatively Affects Maintenance of the Endogenous dsRNA Virus, Oryza sativa Endornavirus,” Plant and Cell Physiology, 51(1):58-67 (2010).
Van de Wetering et al., “Specific inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector,” EMBO Rep., 4(6):609-615 (2003).
Vasil et al., “Herbicide Resistant Fertile Transgenic Wheat Plants Obtained by Microprojectile Bombardment of Regenerable Embryogenic Callus,” Bio/Technology,10:667-674 (1992).
Vaucheret, “Post-transcriptional small RNA pathways in plants: mechanisms and regulations,” Genes Dev., 20:759-771 (2006).
Vencill et al., “Resistance of Weeds to Herbicides,” Herbicides and Environment, 29:585-594 (2011).
Verma et al., “Modified oligonucleotides: synthesis and strategy for users,” Annu. Rev. Biochem., 67:99-134 (1998).
Vermeulen et al., “The contributions of dsRNA structure to Dicer specificity and efficiency,” RNA, 11(5):674-682 (2005).
Vert et al., “An accurate and interpretable model for siRNA efficacy prediction,” BMC Bioinformatics, 7:520 (2006).
Voinnet et al., “Systemic Spread of Sequence-Specific Transgene RNA Degradation in Plants Is Initiated by Localized Introduction of Ectopic Promoterless DNA,” Cell, 95:177-187 (1998).
Wakelin et al., “A target-site mutation is present in a glyphosate-resistant Lolium rigidum population,” Weed Res. (Oxford), 46(5):432-440 (2006).
Walton et al., “Prediction of antisense oligonucleotide binding affinity to a structured RNA target,” Biotechnol Bioeng 65(1):l-9 (1999).
Wan et al., “Generation of Large Numbers of Independently Transformed Fertile Barley Plants,” Plant Physiol., 104:37-48 (1994).
Wang et al., “Foliar uptake of pesticides-Present status and future challenge,” ScienceDirect, 87:1-8 (2007).
Wardell, “Floral Induction of Vegetative Plants Supplied a Purified Fraction of Deoxyribonucleic Acid from Stems of Flowering Plants,” Plant Physiol, 60:885-891 (1977).
Wardell,“Floral Activity in Solutions of Deoxyribonucleic Acid Extracted from Tobacco Stems,” Plant Physiol, 57:855-861 (1976).
Waterhouse et al., “Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA,” Proc Natl Acad Sci USA, 95 13959-13964 (1998).
Welch et al., “Expression of ribozymes in gene transfer systems to modulate target RNA levels,” Curr Opin Biotechnol. 9(5):486-496 (1998).
Widholm et al., “Glyphosate selection of gene amplification in suspension cultures of 3 plant species,” Phyisologia Plantarum, 112:540-545 (2001).
Wiesman et al., “Novel cationic vesicle platform derived from vernonia oil for efficient delivery of DNA through plant cuticle membranes,” Journal of Biotechnology, 130:85-94 (2007).
Wild Carrot, Noxious Weed Control Board (NWCB) of Washington State (2010) <www.nwcb.wa.gov/detail.asp?weed=46>.
Wilson, et al., “Transcription termination at intrinsic terminators: The role of the RNA hairpin,” Proc. Natl. Acad. Sci. USA, 92:8793-8797 (1995).
Winkler et al., “Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression,” Nature, 419:952-956 (2002).
Written Opinion dated Apr. 7, 2016, in Singapore Patent Application No. 201206152-9.
Written Opinion dated May 8, 2014, in International Application No. PCT/IL2013/050447.
Written Opinion dated Sep. 1, 2014, in Singapore Patent Application No. 201206152-9.
Xu et al., Characterization and Functional Analysis of the Calmodulin-Sinding Domain of Rac1 GTPase, Plos One, 7(8)1-12:e42975 (2012).
Yin et al., “Production of double-stranded RNA for interference with TMV infection utilizing a bacterial prokaryotic expression system,” Appl. Microbiol. Biotechnol., 84(2):323-333 (2009).
YouTube video by General Electric Company “Silwet Surfactants,” screen shot taken on Jan. 11, 2012 of video of www.youtube.com/watch?v=WBw7nXMqHk8 (uploaded Jul. 13, 2009).
Zagnitko, “Lolium regidum clone LS1 acetyl-CoA carboxylase mRNA, partial cds; nuclear gene for plastid product,” GenBank: AF359516.1, 2 pages (2001).
Zagnitko, et al., “An isoleucine/leucine residue in the carboxyltransferase domain of acetyl-CoA carboxylase is critical for interaction with aryloxyphenoxypropionate and cyclohexanedione inhibitors,” PNAS, 98(12):6617-6622 (2001).
Zhang et al., “A novel rice gene, NRR responds to macronutrient deficiency and regulates root growth,” Mol Plant, 5(1):63-72 (2012).
Zhang et al., “Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method,” Nature Protocols, 1(2):1-6 (2006).
Zhang et al., “Cationic lipids and polymers mediated vectors for delivery of siRNA,” Journal of Controlled Release, 123:1-10 (2007).
Zhang et al., “Chapter 10: New Characteristics of Pesticide Research & Development,” New Progress of the world agriculture chemicals, p. 209 (2010).
Zhang et al., “DEG: a database of essential genes,” Nucleic Acids Res., 32:D271-D272 (2004).
Zhang et al., “Development arid Validation of Endogenous Reference Genes for Expression Profiling of Medaka (Oryzias latipes) Exposed to Endocrine Disrupting Chemicals by Quantitative Real-Time RT-PCR,” Toxicological Sciences, 95(2):356-368 (2007).
Zhang et al., “Transgenic rice plants produced by electroporation-mediated plasmid uptake into protoplasts,” The Plant Cell Rep., 7:379-384 (1988).
Zhao et al., “Phyllotreta striolata (Coleoptera: Chrysomelidae):Arginine kinase cloning and RNAi-based pest control,” European Journal of Entomology, 105(5):815-822 (2008).
Zhu et al., “Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata,” Pest Manag Sci, 67:175-182 (2010).
Ascencio-Ibanez et al., “DNA abrasion onto plants is an effective method for geminivirus infection and virus-induced gene silencing,” Journal of Virological Methods, 142:198-203 (2007).
Bedell et al., “Sorghum Genome Sequencing by Methylation Filtration,” PLOS Biology, 3(1):E13/104-115 (2005).
Burgos et al., “Review: Confirmation of Resistance to Herbicides and Evaluation of Resistance Levels,” Weed Science, 61 (1):4-20 (2013).
Chen et al., “Exploring MicroRNA-Like Small RNAs in the Filamentous Fungus Fusarium oxysporum,” PLOS One, 9(8):e104956:1-10 (2014).
Constan et al.,“An outer envelope membrane component of the plastid protein import apparatus plays an essential role in Arabidopsis,” The Plant Journal, 38:93-106 (2004).
Di Stilio et al., “Virus-Induced Gene Silencing as a Tool for Comparative Functional Studies in Thalictrum,” PLoS One, 5(8):e12064 (2010).
Eamens et al., “RNA Silencing in Plants: Yesterday, Today, and Tomorrow,” Plant Physiology, 147(2):456-468 (2008).
Fassler, BLAST Glossary, National Center for Biotechnology Information (2011).
Fernandez et al., “Uptake of Hydrophilic Solutes Through Plant Leaves: Current State of Knowledge and Perspectives of Foliar Fertilization,” Critical Reviews in Plant Sciences, 28:36-38 (2009).
Friedberg, “Automated protein function prediction—the genomic challenge,” Briefings in Bioinformatics, 7(3):225-242 (2006).
Funke et al., “Molecular basis for herbicide resistance in Roundup Ready crops,” PNAS, 103:13010-13015 (2006).
Gallie et al., “Identification of the motifs within the tobacco mosaic virus 5′-leader responsible for enhancing translation,” Nucleic Acids Res., 20(17):4631-4638 (1992).
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV infection,” Plant Cell Rep, 29(11):1261-1268 (2010).
Gaskin et al., “Novel organosillicone adjuvants to reduce agrochemical spray volumes on row crops,” New Zealand Plant Protection, 53:350-354 (2000).
GenBank Accession No. EF143582 (2007).
Hagio, “Chapter 25: Direct Gene Transfer into Plant Mature Seeds via Electroporation After Vacuum Treatment,” Electroporation and Sonoporation in Developmental Biology, p. 285-293 (2009).
Hess, “Surfactants and Additives,” 1999 Proceedings of the California Weed Science Society, 51:156-172 (1999).
Huang et al., “In Vivo Analyses of the Roles of Essential Omp85-Related Proteins in the Chloroplast Outer Envelope Membrane,” Plant Physiol., 157:147-159 (2011).
Ivanova et al., “Members of the Toc159 Import Receptor Family Represent Distinct Pathways for Protein Targeting to Plastids,” Molecular Biology of the Cell, 15:3379-3392 (2004).
Jacque et al., “Modulation of HIV-1 replication by RNA interference,” Nature, 418, 435-438 (2002).
Jang et al., “Resistance to herbicides caused by single amino acid mutations in acetyl-CoA carboxylase in resistant populations of grassy weeds,” New Phytologist, 197(4):1110-1116 (2013).
Kikkert et al., “Stable Transformation of Plant Cells by Particle Bombardment/Biolistics,” Methods in Molecular Biology, 286:61-78 (2005).
Kumar et al., “Sequencing, De Novo Assembly and Annotation of the Colorado Potato Beetle, Leptinotarsa decemlineata, Transcriptome,” PLoS One, 9(1):e86012 (2014).
Li et al., “A Simplified Seed Transformation Method for Obtaining Transgenic Brassica napus Plants,” Agricultural Sciences in China, 8(6):658-663 (2009).
Liu et al, “The Helicase and RNasellla Domains of Arabidopsis Dicer-Like1 Modulate Catalytic Parameters during MicroRNA Biogenesis,” Plant Physiology, 159:748-758 (2012).
McGinnis, “RNAi for functional genomics in plants,” Brief Funct Genomics, 9(2):111-7 (2010).
Office Action dated Aug. 1, 2017, in European Patent Application No. 12 830 932.5.
Office Action dated Aug. 14, 2017, in Israeli Patent Application No. 235878.
Office Action dated Aug. 22, 2017, in Korean Patent Application No. 10-2012-7023415.
Office Action dated Aug. 3, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Office Action dated Aug. 3, 2017, in European Patent Application No. 12 831 684.1.
Office Action dated Aug. 8, 2017, in Chilean Patent Application No. 201501874.
Office Action dated Jul. 11, 2017, in Mexican Patent Application No. MX/a/2015/013118 (with English translation).
Office Action dated Jul. 3, 2017, in Mexican Patent Application No. MX/a/2015/012632 (with English translation).
Office Action dated Jul. 6, 2017, in Mexican Patent Application No. MX/a/2015/013103 (with English translation).
Office Action dated Mar. 16, 2017, in Chinese Patent Application No. 201280054819.5.
Office Action dated May 3, 2016, in Chilean Patent Application No. 201601057.
Office Action dated Nov. 15, 2016, in Mexican Patent Application No. MX/a/2014/003068 (with English translation).
Office Action dated Sep. 6, 2017, in Chinese Patent Application No. 2014800154012 (with English translation).
Paddison et al., “Stable suppression of gene expression by RNAi in mammalian cells,” Proc. Natl Acad. Sci. USA, 99(3):1443-1448 (2002).
Patent Examination Report No. 1 dated Jun. 8, 2017, in Australian Patent Application No. 2012308686.
Powles et al., “Evolution in Action: Plants Resistant to Herbicides,” Annual Review of Plant Biology, 61(1):317-347 (2010).
Rakoczy-Trojanowska, “Alternative Methods of Plant Transformation—a short review,” Cellular & Molecular Biology Letters, 7:849-858 (2002).
Regalado, “The Next Great GMO Debate,” MIT Technology Review,pp. 1-19 (2015) <https://www.technologyreview.com/s/540136/the-next-great-gmo-debate/>.
Richardson et al., “Targeting and assembly of components of the TOC protein import complex at the chloroplast outer envelope membrane,” Frontiers in Plant Science, 5:1-14 (2014).
Search Report dated Jul. 24, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Small, “RNAi for revealing and engineering plant gene functions,” Current Opinion in Biotechnology, 18:148-153 (2007).
Statement of Grounds and Particulars dated Sep. 1, 2017, in Australian Patent No. 2014262189.
Stevens, “Formulation of Sprays to Improve the Efficacy of Foliar Fertilisers,” New Zealand Journal of Forestry Science, 24(1):27-34 (1994).
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” New Zealand Journal of Forestry Science, 24:27-34 (1994).
Summons to Attend Oral Proceedings Pursuant to Rule 115(1) EPC, dated Aug. 7, 2017, in European Patent Application No. 12832160.1.
Toriyama et al., “Transgenic Rice Plants After Direct Gene Transfer Into Protoplasts,” Bio/Technology, 6:1072-1074 (1988).
Trucco et al.,“ Amaranthus hybridus can be pollinated frequently by A. tuberculatus under filed conditions,” Heredity, 94:64-70 (2005).
Voinnet, “Origin, Biogenesis, and Activity of Plant MicroRNAs,” Cell, 136:669-687 (2009).
Wool et al., “Structure and evolution of mammalian ribosomal proteins,” Biochem. Cell Biol., 73:933-947 (1995).
Written Opinion dated Mar. 6, 2017, in Singaporean Patent Application No. 2012061529.
Xu et al., “Characterization and Functional Analysis of the Calmodulin-Binding Domain of Rac1 GTPase,” PLoS One, 7(8):e42975 (2012).
Zhang et al., “Development and Validation of Endogenous Reference Genes for Expression Profiling of Medaka (Oryzias latipes) Exposed to Endocrine Disrupting Chemicals by Quantitative Real-Time RT-PCR,” Toxicological Sciences, 95(2):356-368 (2007).
Zhang, “Artificial trans-acting small interfering RNA: a tool for plant biology study and crop improvements,” Planta, 239:1139-1146 (2014).
Zhang, Chapter 10: New Characteristics of Pesticide Research & Development, p. 209 (2010).
Zhong et al., “A forward genetic screen to explore chloroplast protein import in vivo identifies Moco sulfurase, pivotal for ABA and IAA biosynthesis and purine turnover,” The Plant Journal, 63:44-59 (2010).
Yue et al., “Vertical-transmission routes for deformed wing virus of honeybees (Apis mellifera),” Journal of General Virology, 88:2329-2336 (2007).
Anonymous, “Resistant Weeds Spur Research Into New Technologies,” Grains Research & Development Corporation, 2013.
Asad et al., “Silicon Carbide Whisker-mediated Plant Transformation,” Properties and Applications of Silicon Carbide, pp. 345-358 (2011).
Baker, “Chlorophyll Fluorescence: A Probe of Photosynthesis In Vivo,” Annu. Rev. Plant Biol., 59:89-113 (2008).
Bauer et al., “The major protein import receptor of plastids is essential for chloroplast biogenesis,” Nature, 403:203-207 (2000).
Baulcombe, “RNA silencing in plants,” Nature, 431:356-363 (2004).
Baum et al., “Progress Towards RNAi-Mediated Insect Pest Management,” Advances in Insect Physiology, 47:249-295 (2014).
Belhadj et al., “Methyl Jasmonate Induces Defense Responses in Grapevine and Triggers Protection against Erysiphe necator,” J. Agric Food Chem., 54:9119-9125 (2006).
Burleigh, “Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas,” Plant Science, 160:899-904 (2001).
Chang et al., “Dual-target gene silencing by using long, sythetic siRNA duplexes without triggering antiviral responses,” Molecules and Cells, 27(6)689-695 (2009).
Cheng et al., “Transient Expression of Minimum Linear Gene Cassettes in Onion Epidermal Cells Via Direct Transformation,” Appl Biochem Biotechnol, 159:739-749 (2009).
Christiaens et al., “The challenge of RNAi-mediated control of hemipterans,” Current Opinion in Insect Science, 6:15-21 (2014).
Communication Pursuant to Article 94(3) EPC dated Sep. 5, 2018, in European Patent Application No. 17152830.0.
Cong et al., “Multiplex Genome Engineering Using CRISPR/Cas Systems,” Science, 339:819-823 (2013).
Danka et al., “Field Test of Resistance to Acarapis woodi (Acari: Tarsonemidae) and of Colony Production by Four Stocks of Honey Bees (Hymenoptera apidae)” Journal of Economic Entomology, 88(3):584-591 (1995).
Database EMBL XP-002781749(BG442539) dated Mar. 20, 2001.
Declaration of Jerzy Zabkiewicz executed Nov. 28, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-73.
Declaration of Jerzy Zabkiewicz executed Nov. 28, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-4.
Declaration of Neena Mitter executed Nov. 30, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-114.
Declaration of Neena Mitter executed Nov. 30, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-25.
Delye et al., “PCR-based detection of resistance to acetyl-CoA carboxylase-inhibiting herbicides in black-grass (Alopecurus myosuroides Huds) and ryegrass (Lolium rigidum Gaud),” Pest Management Science, 58:474-478 (2002).
Delye et al., “Variation in the gene encoding acetolactate-synthase in Lolium species and proactive detection of mutant, herbicide-resistant alleles,” Weed Research, 49:326-336 (2009).
Desveaux et al., “PBF-2 Is a Novel Single-Stranded DNA Binding Factor Implicated in PR-10a Gene Activation in Potato,” The Plant Cell, 12:1477-1489 (2000).
Dietzgen et al., “Transgenic gene silencing strategies for virus control,” Australasian Plant Pathology, 35:605-618 (2006).
Dilpreet et al., “Glyphosate Rsistance in a Johnsongrass (Sorghum halepense) Biotype from Arkansas,” Weed Science, 59(3):299-304 (2011).
Downey et al., “Single and dual parasitic mite infestations on the honey bee, Apis mellifera L.,” Insectes Sociaux, 47(2):171-176 (2000).
Drobyazko R.V., “Reliable and environmentally friendly insecticide,” Protection and quarantine of plants, 2012 (pp. 52, 53) (in Russian).
Duhoux et al., “Reference Genes to Study Herbicide Stress Response in Lolium sp.: Up-Regulation of P3450 Genes in Plants Resistant to Acetolactate-Synthase Inhibitors,” Plos One, 8(5):e63576 (2013).
Egli et al., “A Maize Acetyl-Coenzyme A Carboxylase cDNA Sequence,” Plant Physiol., 108: 1299-1300 (1995).
Eudes et al., “Cell-penetrating peptides,” Plant Signaling & Behavior, 3(8):549-5550 (2008).
European Search Report dated Sep. 7, 2017, in European Patent Application No. 17152830.0.
Examination Report dated Mar. 1, 2018, in Australian Patent Application No. 2013264742.
Extended European Search Report dated Dec. 19, 2018, in European Patent Application No. 16804395.8.
Extended European Search Report dated Nov. 16, 2018, in European Patent Application No. 18182238.8.
Extended European Search Report dated Nov. 21, 2018, in European Patent Application No. 18175809.5.
Extended European Search Report dated Nov. 7, 2017, in European Patent Application No. 15811092.4.
Extended European Search Report dated Nov. 8, 2017, in European Patent Application No. 15737282.2.
Extended European Search Report dated Sep. 28, 2018, in European Patent Application No. 16740770.9.
Extended European Search Report dated Apr. 13, 2018, in European Patent Application No. 15812530.0.
Extended European Search Report dated Mar. 15, 2018, in European Patent Application No. 17181861.0.
Gao et al., “DNA-guided genome editing using the Natronobacterium gregoryi Argonaute,” Nature Biotechnology, 34(7):768-773 (2016).
Gasser et al., “Structure, Expression, and Evolution of the 5-Enolpyruvylshikimate-3-phosphate Synthase Genes of Petunia and Tomato,” J. Biol. Chem., 263: 4280-4287 (1988).
Gilmer et al., “Latent Viruses of Apple I. Detection with Woody Indicators,” Plant Pathology, 1(10):1-9 (1971).
Gomez-Zurita et al., “Recalibrated Tree of Leaf Beetles (Chrysomelidae) Indicates Independent Diversification of Angiosperms and Their Insect Herbivores,” PLoS One, 4(e360):1-8 (2007).
Guttieri et al., “DNA Sequence Variation in Domain A of the Acetolactate Synthase Genes of Herbicide-Resistant and -Susceptible Weed Biotypes,” Weed Science, 40:670-679 (1992).
Hörmann et al., “Tic32, as Essential Component in Chloroplast Biogenesis,” The Journal of Biological Chemistry, 279(33):34756-34762 (2004).
Horsch et al., “Inheritance of Functional Foreign Genes in Plants ,” Science, 223:496-498 (1984).
Hsu et al., “DNA targeting specificity of RNA-guided Cas9 nucleases,” Nature Biotechnology, 31:827-832 (2013).
Hu et al., “High efficiency transport of quantum dots into plant roots with the aid of silwet L-77,” Plant Physiology and Biochemistry, 48:703-709 (2010).
Huggett et al., “Real-time RT-PCR normalisation; strategies and considerations,” Genes and Immunity, 6:279-284 (2005).
Inaba et al., “Arabidopsis Tic110 Is Essential for the Assembly and Function of the Protein Import Machinery of Plastids,” The Plant Cell, 17:1482-1496 (2005).
International Search Report dated Oct. 13, 2016, in International Patent Application No. PCT/US2016/35500.
Jarvis et al, “An arabidopsis mutant defective in the plastid general protein import apparatus,” Science, 282:100-103 (1998).
Jiang et al., Chapter III Seeds and Seedlings, Botany, Northwest A&F University Press, pp. 87-92 (2009).
Khanbekova et al., The defeat of the honey bee Apis melifera caucasica Gorb. By viruses and parasites, and condition of bee colonies in different ecogeographical conditions of Greater Caucasus, Agricultural Biology. 2013 (p. 43) (in Russian).
Kim et al., “Synthesis and characterization of mannosylated pegylated polyethylenimine as a carrier for siRNA,” International Journal of Pharmaceutics, 427:123-133 (2012).
Kirkwood, “Recent developments in our understanding of the plant cuticle as a barrier to the foliar uptake of pesticides,” Pestic Sci, 55:69-77 (1999).
Kovacheva et al., “Further in vivo studies on the role of the molecular chaperone, Hsp93, in plastid protein import,” The Plant Journal, 50:364-379 (2007).
Kovacheva et al., “In vivo studies on the roles of Tic100, Tic40 and Hsp93 during chloroplast protein import,” The Plant Journal, 41:412-428 (2005).
Li et at., “Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults,” Journal of Applied Entomology, 139(6):432-445 (2015).
Liu, “Calmodulin and Cell Cycle,” Foreign Medical Sciences Section of Pathophysiology and Clinical Medicine, 18(4):322-324 (1998).
Liu, “Confocal laser scanning microscopy—an attractive tool for studying the uptake of xenobiotics into plant foliage,” Journal of Microscopy, 213(Pt 2):87-93 (2004).
Liu, “The Transformation of Nucleic Acid Degradants in Plants,” China Organic Fertilizers, Agriculture Press, ISBN: 7-1091634 (1991) (with English translation).
Lodish et al., Molecular Cell Biology, Fourth Edition, p. 210 (2000).
Lucas et al., “Plasmodesmata—bridging the gap between neighboring plant cells,” Trends in Cell Biology, 19:495-503 (2009).
Masoud, “Constitutive expression of an inducible β-1,3-glucanase in alfalfa reduces disease severity caused by the oomycete pathogen Phytophthora megasperma f. sp medicaginis . . . ,” Trans Res, 5:313-323 (1996).
Misawa, “Expression of an Erwinia phytoene desaturase gene not only confers multiple resistance to herbicides interfering with carotenoid biosynthesis but also alters xanthophyll metabolism . . . ,” The Plant Jrnl, 6(4):481-489 (1994).
Misawa, “Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of β-carotene biosynthesis activity and resistance . . . ,” The Plant Jrnl, 4(5):833-840 (1993).
Morozov et al., “Evaluation of Preemergence Herbicides for Control of Diclofop-resistant Italian Ryegrass (Lolium multiflorum) in Virginia,” Virginia Polytechnic Institute and State University, pp. 43-71 (2004).
Nemeth, “Virus, mycoplasma and rickettsia diseases of fruit trees,” Martinus Nijhoff Publishers, 197-204 (1986).
Non-Final Office Action dated Mar. 21, 2018, in U.S. Appl. No. 13/619,980.
N-TER Nanoparticle siRNA, Sigma Aldrich TM website, Web. Nov. 20, 2018 <https://www.sigmaaldrich.com/life-science/custom-oligos/sirna-oligos/n-ter-nanoparticle.html>.
Office Action dated Aug. 9, 2018, in Canadian Patent Application No. 2,848,371.
Office Action dated Dec. 5, 2017, in Japanese Patent Application No. 2016-502033.
Office Action dated Feb. 21, 2018, in Mexican Patent Application No. MX/a/2015/012632 (with English translation).
Office Action dated Jul. 30, 2018, in Canadian Patent Application No. 2,848,576.
Office Action dated Mar. 8, 2018 (with English translation), in Chilean Patent Application No. 201403192.
Office Action dated Sep. 20, 2018, in Chilean Patent Application No. 201601440 (with English translation).
Partial European Search Report dated Jun. 29, 2018, in European Patent Application No. 18157745.3.
Partial European Search Report dated Dec. 6, 2017, in European Patent Application No. 17181861.0.
Partial Supplementary European Search Report dated Jan. 11, 2018, in European Patent Application No. 15812530.2.
Partial Supplementary European Search Report dated Jan. 11, 2018, in European Patent Application No. 15812530.0.
Pratt et al., “Sorghum Expressed Sequence Tags Identify Signature Genes for Drought, Pathogenesis, and Skotomorphogenesis from a Milestone Set of 16,801 Unique Transcripts,” Plant Physiology, 139:869-884 (2005).
Qi et al., “RNA processing enables predictable programming of gene expression,” Nature Biotechnology, 30:1002-1007 (2012).
Reverdatto et al., “A Multisubunit Acetyl Coenzyme A Carboxylase from Soybean,” Plant Physiol., 119: 961-978 (1999).
Riar et al., “Glyphosate Resistance in a Johnsongrass (Sorghum halepense) Biotype from Arkansas,” Weed Science, 59:299-304 (2011).
Sammataro et al., “Some Volatile Plant Oils as Potential Control Agents for Varroa Mites (Acari varroidae) in Honey Bee Colonies (Hymenoptera apidae),” American Bee Journal, 138(9):681-685 (1998).
Schönherr et al., “Size selectivity of aqueous pores in astomatous cuticular membranes isolated from Populus canescens (Aiton) Sm. Leaves,” Planta, 219:405-411 (2004).
Search Report dated Oct. 20, 2017, in Chinese Patent Application No. 201380039346.6.
Simeoni et al., “Insight into the mechanism of the peptide-based gene delivery system MPG: implications for delivery of siRNA into mammalian cells,” Nucleic Acids Research, 31(11):2717-2724 (2003).
Sun, “Characterization of Organosilicone Surfactants and Their Effects on Sulfonylurea Herbicide Activity,” Thesis Submitted to the Faculty of the Virginia Polytechnic Institute and State University dated Apr. 5, 1996.
Swans et al., “Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA,” Nucleic Acid Res., 43(10):5120-5129 (2015).
Swans et al., “DNA-guided DNA interference by a prokaryotic Argonaute,” Nature, 507(7491):258-61 (2014).
Teng et al., “Tic21 Is an Essential Translocon Component for Protein Translocation across the Chloroplast Inner Envelope Membrane,” The Plant Cell, 18:2247-2257 (2006).
Tenllado et al., “Crude extracts of bacterially expressed dsRNA can be used to protect plants against virus infections,” BMC Biotechnology, 3:1-11 (2003).
Tice, “Selecting the right compounds for screening: does Lipinski's Rule of 5 for pharmaceuticals apply to agrochemicals?” Pest Management Science, 57(1):3-16 (2001).
Tomlinson, “Evidence that the hexose-to-sucrose ratio does not control the switch to storage product accumulation in oilseeds: analysis of tobacco seed development and effects . . . ,” Jrnl of Exper Bot, 55(406):2291-2303 (2004).
Townsend et al., “High frequency modification of plant genes using engineered zinc finger nucleases,” Nature, 459:442-445 (2009).
TransIT-TKO® Transfection Reagent, Frequently Asked Questions, Web. 2019 <https://www.mirusbio.com/tech-resources/fags/transit-tko-faqs>.
Ulrich et al., “Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target,” BMC genomics, 16(1):671 (2015).
Van der Meer et al., “Promoted analysis of the chalcone synthase (chs A) gene of Petunia hybrid: a 67 bp promoter region directs flower-specific expression,” Plant Mol. Biol., 15:95-109 (1990).
Vila-Aiub et al., “Glyphosate resistance in perennial Sorghum halepense (Johnsongrass), endowed by reduced glyphosate translocation and leaf uptake,” Pest Manag Sci, 68:430-436 (2012).
Wang et al., “Principle and technology of genetic engineering in plants,” in Plant genetic engineering principles and techniques, Beijing: Science Press, pp. 313-315 (1998).
Watson et al., “RNA silencing platforms in plants,” FEBS Letters, 579:5982-5987 (2005).
Yan et al., Seed Science, China Agriculture Press, pp. 101-103, Tables 2-37 (2001).
Yu et al., “Diversity of Acetyl-Coenzyme A Carboxylase Mutations in Resistant Lolium Populations: Evaluation Using Clethodim,” Plant Physiology, 145:547-558 (2007).
Yu et al., “Glyphosate, paraquat and ACCase multiple herbicide resistance evolved in a Lolium rigidum biotype,” Planta, 225:499-513 (2007).
Zabkiewicz, “Adjuvants and herbicidal efficacy—present status and future prospects,” Weed Research, 40:139-149 (2000).
Zhang et al., “Progress in research of honey bee mite Varro destructor,” Journal of Environmental Entomology, 34(3):345-353 (2012).
Zhao et al., “Ps0r1, a potential target for RNA interference-based pest management,” Insect Molecular Biology, 20(1):97-104 (2011).
Zhao et al., “Vegetable Statdardized Production Technology,” Hangzhou: Zhejiang Science and Technology Press, p. 19 (2008).
Zhong et al., “A pea antisense gene for the chloroplast stromal processing peptidase yields seedling lethals in Arabidopsis: survivors show defective GFP import in vivo,” The Plant Journal, 34:802-812 (2003).
Zidack et al., “Promotion of Bacterial Infection of Leaves by an Organosilicone Surfactant: Implications for Biological Weed Control,” Biological Control, 2:111-117 (1992).
Zipperian et al., “Silicon Carbide Abrasive Grinding,” Quality Matters Newsletter, PACE Technologies 1(2):1-3 (2002).
Zotti et al., “RNAi technology for insect management and protection of beneficial insects from diseases: lessons, challenges and risk assessments,” Neotropical Entomology, 44(3):197-213 (2015).
Related Publications (1)
Number Date Country
20170037407 A1 Feb 2017 US
Provisional Applications (2)
Number Date Country
62069142 Oct 2014 US
61913917 Dec 2013 US