Compositions comprising the Tbp2 subunit of the transferrin receptor of Neisseria meningitidis

Abstract

The subject of the present invention is a DNA fragment which encodes a protein capable of being recognised by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis as well as a process for producing the said protein by a recombinant route. By way of example, such a DNA fragment encodes the tbp1 subunit of the strain IM2394 or IM2169 or the tbp2 subunit of the strain IM2394 or IM2169.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The subject of the present invention is DNA fragments of Neisseria meningitidis which encodes the transferrin receptor subunits as well as a process for producing each of the subunits by the recombinant route.

Meningitides are generally either of viral origin or of bacterial origin. The bacteria mainly responsible are: N. meningitidis and Haemophilus influenzae, which are respectively implicated in about 40 and 50% of cases of bacterial meningitides.

In France, about 600 to 800 cases of N. meningitidismeningitides are recorded per year. In the United States, the number of cases is up to about 2,500 to 3,000 per year.

The N. meningitidis species is sub-divided into serogroups according to the nature of the capsular polysaccharides. Although about twelve serogroups exist, 90% of meningitis cases can be attributed to 3 serogroups: A, B and C.

2. Description of the Related Art

Effective vaccines based on capsular polysaccharides exist for the prevention of meningitides caused by N. meningitidis serogroups A and C. These polysaccharides as they are only slightly or not at all immunogenic in children below 2 years and do not induce immunological memory. However, these disadvantages can be overcome by conjugating these polysaccharides with a carrier protein.

In contrast, the polysaccharide of N. meningitidis group B is not at all or is only slightly immunogenic in man whether it is in conjugated form or not. Thus it appears highly desirable to seek out a vaccine against meningitides induced by N. meningitidis especially of the serogroup B other than a polysaccharide-based vaccine.

To this end, various proteins of the outer membrane of N. meningitidis have already been proposed. These are in particular the membrane receptor for human transferrin.

In general, the great majority of bacteria require iron for their growth and they have developed specific systems for acquiring this metal. With regard especially to N. meningitidis which is a strict pathogen for man, the iron can only be derived from human iron transport proteins such as transferrin and lactoferrin since the quantity of iron in free form is negligible in man (of the order of 10.sup.-18 M), in any case insufficient to permit bacterial growth.

Thus, N. meningitidis has a human transferrin receptor and a human lactoferrin receptor which enable it to bind these iron-chelating proteins and subsequently to capture the iron required for its growth.

The transferrin receptor of the strain B16B6 of N. meningitidis has been purified by Schryvers et al. (WO 90/12591) from a membrane extract. This protein, as purified, appears to consist essentially of 2 types of polypeptides: a polypeptide with a high apparent molecular weight of 100 kD and a polypeptide with a lower apparent molecular weight of about 70 kD, as visualised after SDS-polyacrylamide gel electrophoresis.

The purification product especially identified by Schryvers is by arbitrary definition and for the purposes of the present patent application, called transferrin receptor and its constituent polypeptides, subunits. In the text which follows, the subunits of high molecular weight and of lower molecular weight are called Tbp1 and Tbp2 respectively.

However, the purification process described by Schryvers et al. cannot be used for the large-scale production of the transferrin receptor. The industrial preparation of this receptor in purified form necessarily involves a production step using a heterologous expression system.

SUMMARY OF THE INVENTION

To this end, the object of the invention is to provide DNA fragments which encode the transferrin receptor subunits of N. meningitidis.

Moreover, since the pioneering work of Schryvers et al., it has been discovered that there are in fact at least 2 types of strains which differ by the constitution of their respective transferrin receptors. This was demonstrated by studying membrane extracts of several tens of N. meningitidis strains of diverse origins. These membrane extracts were first subjected to an SDS-polyacrylamide gel electrophoresis and then electrotransferred onto nitrocellulose membranes. These nitrocellulose membranes were incubated:

a) in the presence of a rabbit antiserum directed against the transferrin receptor purified from the strain B16B6 of N. meningitidis, also called IM2394; b) in the presence of a rabbit antiserum directed against the transferrin receptor purified from the strain IM2169 of N. meningitidis; or c) in the presence of peroxydase-conjugated human transferrin.

With regard to a) and b), the recognition of the transferrin receptor subunits is visualised by the addition of a peroxydase-coupled anti-rabbit immunoglobulin antibody and then by the addition of the substrate for this enzyme.

Tables I and II below show the profile of some representative strains as it appears on a 7.5% polyacrylamide gel after SDS gel electrophoresis; the bands are characterised by their apparent molecular weights expressed in kilodaltons (kD):

TABLE I______________________________________ Strains 2394 (B; 2a; P1.2:12.3) 2234 (Y; nd) 2228 (B; nd) 2154 (C; nd) 550 (C; 2a:) 2170 (B; 2a:P1.2:1.3 2448 (B; nd) 179 (C; 2a:P1.2)______________________________________Detection 93 93 99withanti-2394receptorantiserum 68 69 69Detection 93 93 99withanti-2169receptorantiserumDetection 68 69 69withtransferrin-peroxydase______________________________________ N.B. in brackets are indicted in order the serogroup, the serotype, the subtype and the immunotype. TABLE II__________________________________________________________________________ Strains 2169 1000 1604 132 1001 876 1951 2449 867 (B:9:P1.9) (B:nd) (B:nd) (C:15:P1.16) (A:4:P1.9) (B:19:P1.6) (A:nd) (B:nd) (B:2b:P1.2)__________________________________________________________________________Detection with anti-2394 96 98 98 98 98 96 94 94 93receptor antiserumDetection with anti-2169 96 98 98 98 98 96 94 94 93receptor antiserum 87 85 83 81 79 88 87 85 85Detection with transferrin- 87 85 83 81 79 88 87 85 85peroxydase__________________________________________________________________________ N.B. In brackets are indicated in order the serogroup, the serotype, the subtype and the immunotype.

The results entered in the first 2 lines of the tables show that there are 2 types of strains:

The first type (Table I) corresponds to strains which possess a receptor whose 2 subunits, under the experimental conditions used, are recognised by the anti-IM2394 receptor antiserum whereas only the high molecular weight subunit is recognised by the anti-IM2169 receptor antiserum.

The second type (Table II) corresponds to strains which possess a receptor whose 2 subunits, under the experimental conditions used, are recognised by the anti-IM2169 receptor antiserum whereas only the high molecular weight subunit is recognised by the anti-IM2394 receptor antiserum.

Consequently, an antigenic diversity exists at the level of the subunit of lower molecular weight. This diversity is however limited since it is of 2 main types, contrary to what is suggested by Griffiths et al., FEMS Microbiol. Lett. (1990) 69:31.

By virtue of these observations, it could have been supposed that an effective vaccine against all N. meningitidis infections could be adequately made up of the high molecular weight subunit, irrespective of the strain from which the receptor originates, since the said subunit is recognised by the 2 types of antisera. However, it appears that this cannot be the case since the high molecular weight subunit is thought to be incapable of inducing the production of neutralising type antibodies. Only the smallest of the 2 receptor subunits is thought to be capable of performing this function. Since this subunit of lower molecular weight is characterised by a significant antigenic variation from the first type to the second type of strain, a single type of transferrin receptor could not be sufficient for vaccinating against all N. meningitidis infections. Consequently, a vaccine should contain at least the subunit of lower molecular weight of each of the strains IM2394 and IM2169 or their respective equivalents and, optionally, the high molecular weight subunit of at least one N. meningitidis strain.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 represents the structure of the phage lambda ZAP II and schematically represents the cloning methodology relating thereto. Lambda ZAP II is an insertion vector equipped with multiple cloning sites located in the plasmid portion (pBluescript SK). This plasmid portion may be excised in vivo by coinfection with a helper phage and converted into plasmid vector. If a coding sequence is fused in phase with lacZ or if a cloned DNA fragment contains a promoter which is functional in E. coli, there may be production of a protein of interest which can be connected by means of specific antibodies.

FIG. 2 represents the structure of the plasmid pTG1265. pTG1265 is derived from the plasmid pGB2 (Churchward et al., Gene (1984) 31:165) as follows: pGB2 is digested with EcoRI and HindIII, treated with Klenow polymerase and the ligated into the 1-kb SspI-PvuII fragment obtained from pT7T3 184 (Mead et al., Protein Engineering (1986) 1:67; Pharmacia) which contains f1-ori, the sequence lacZ, the promoters T3 and T7 as well as multiple cloning sites.

FIG. 3 represents the genomic map of the DNA region of the strain IM2394 containing the sequences which encode Tbp1 and Tbp2 as well as the different fragments which were cloned. B=BamHI; E=EcoRI; H=HincII; R=EcoRV; X=XbaI; C=ClaI.

FIG. 4 represents the genomic map of the DNA region of the strain IM2169 containing the sequences which encode TBP1 and TBP2 as well as the different fragments which were cloned. C=ClaI; H=HincII; M=MluI; X=XbaI; ?=imprecise position.

FIG. 5 represents the structure of the plasmid pARA13. pARA13 is a plasmid capable of replicating in E. coli which contains the promoter of the arabinose operon BAD (ParaB) of Salmonella typhimurium (modified at the level of the TATA box), as well as the AraC gene. Downstream of the promoter ParaB are multiple insertion sites. The pARA plasmid series is described by Cagnon et al., Prot. Eng. (1991) 4: 843.

FIG. 6 represents the methodology which was used to construct the expression vector pTG3749.

FIGS. 7a and 7b compare the predicted amino acid sequences of the Tbp1 subunits of the strains IM2394 (SEQ ID NO: 4) and IM2169 (SEQ ID NO: 6). The degree of homology may be estimated at about 76%.

FIG. 8 (SEQ ID NOS: 1-62) compares the predicted amino acid sequences of the Tbp subunits of the strains IM2394 (SEQ ID NO: 2) and IM2169 (SEQ ID NO: 3). The degree of homology may be estimated at about 47%.

FIG. 9 represents the methodology which was used to construct the expression vector pTG3779.

FIG. 10 represents the methodology which was used to construct the expression vector pTG4710.

FIG. 11 represents the methodology which was used to construct the expression vector pTG4764.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION

Accordingly, the invention provides an isolated DNA fragment which encodes a peptide, a polypeptide or a protein capable of being recognised by an antiserum against the receptor of the strain IM2394 or IM2169 of N. meningitidis.

Such a DNA fragment may especially comprise a nucleotide sequence which encodes an amino acid sequence, homologous to that shown:

in the sequence identifier (SEQ ID NO: 1) No. 1, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 579; in SEQ ID NO: 3, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 884; in SEQ ID NO: 5, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 887; or in SEQ ID NO: 7, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 691.

For guidance, it is specified that a DNA fragment according to the invention may furthermore comprise an additional nucleotide sequence which encodes any other amino acid sequence; the two nucleotide sequences considered forming an open reading frame so as to encode a hybrid protein or a precursor.

Advantageously, a DNA fragment according to the invention may be selected from:

i) A first isolated DNA fragment having a nucleotide sequence which encodes a protein having an amino acid sequence homologous to that shown in SEQ ID NO: 2, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 579. ii) A second isolated DNA fragment having a nucleotide sequence which encodes a protein having an amino acid sequence homologous to that shown in SEQ ID NO: 4, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 884. iii) A third isolated DNA fragment having a nucleotide sequence which encodes a protein having an amino acid sequence homologous to that shown in SEQ ID NO: 6, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 887. iv) A fourth isolated DNA fragment having a nucleotide sequence which encodes a protein having an amino acid sequence homologous to that shown in SEQ ID NO: 8, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 691.

"Homologous amino acid sequence" is understood to mean a sequence which exhibits a degree of homology of at least 75%, advantageously of at least 80%, preferably of at least 90%, most preferably of 100%, with the amino acid sequence which is cited as reference. It should be noted that the term "homologous" as defined includes the special case of the identity.

The degree of homology can be easily calculated by aligning the sequences so as to obtain the maximum degree of homology; to do this, it may be necessary to artificially introduce empty spaces as illustrated in FIG. 7. Once the optimal alignment has been achieved, the degree of homology is established by recording all the positions in which the amino acids of the two sequences coincide, relative to the total number of positions.

It would be tedious to describe homologous sequences otherwise than in a generic manner because the number of combinations is too great. However, persons skilled in the art know the general rules which make it possible to replace one amino acid with another without destroying the biological or immunological function of a protein.

An isolated and most preferred DNA fragment has a nucleotide sequence which encodes:

i) The Tbp1 subunit of the strain IM2394 whose amino acid sequence is as shown in SEQ ID NO: 4, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 884; ii) the Tbp2 subunit of the strain IM2394 whose amino acid sequence is shown in SEQ ID NO: 2, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 579; iii) the Tbp1 subunit of the strain IM2169 whose amino acid sequence is shown in SEQ ID NO: 6, starting with the glutamic acid residue in position 1 and ending with the phenylalanine residue in position 887; or iv) the Tbp2 subunit of the strain IM2169 whose amino acid sequence is shown in SEQ ID NO: 8, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 691.

The transferrin receptor being a membrane protein, each of its subunits is initially produced in the form of a precursor consisting of a signal peptide associated, in the N-terminal position, with the mature form.

Accordingly, the subject of the present invention is also an isolated DNA unit which encodes a signal peptide whose amino acid sequence exhibits a degree of homology of at least 80%, preferably of 100%, with the sequence shown in:

i) SEQ ID NO: 4, starting with the methionine residue in position -24 and ending with the alanine residue in position -1; ii) SEQ ID NO: 6, starting with the methionine residue in position -24 and ending with the alanine residue in position -1; or iii) SEQ ID NO: 8, starting with the methionine residue in position -20 and ending with the alanine residue in position -1.

A DNA fragment according to the invention may also be selected from a fifth, sixth, seventh and eighth DNA fragment which respectively encode a precursor whose amino acid sequence is homologous to the sequence presented in SEQ ID NOS: 2, 4, 6, or 8.

"Isolated DNA fragment or unit" is understood to mean a DNA fragment or unit of genomic origin which is i) inserted into a viral or plasmid vector or ii) placed under the control of a promoter which, for its part, is heterologous.

Furthermore, the DNA unit which encodes the signal peptide according to the invention is, in addition, considered as isolated when this DNA unit is associated with a DNA fragment which encodes a protein heterologous to the signal peptide so as to form an open reading frame which encodes a hybrid precursor.

The invention also relates to a cassette for expressing a peptide, a polypeptide or a protein capable of being recognised by an antiserum against the receptor of the strain IM2394 or IM2169 of N. meningitidis, which comprises at least one DNA fragment according to the invention placed under the control of elements capable of bringing about its expression in an appropriate host cell.

In the expression cassette, the first, second, third or fourth DNA fragment according to the invention which encodes a mature form may be associated or not with a DNA unit which encodes a signal peptide depending on whether or not the secretion of the protein is sought. Preferably, this secretion will be sought. In this last case, the DNA unit may encode a signal peptide homologous or heterologous to the mature form, resulting in the synthesis of a natural or hybrid precursor respectively.

The elements essential for the expression of a DNA fragment according to the invention are a transcription promoter, translational start and stop codons and optionally, a transcription terminator. The promoter may be constitutive or inducible. It should be pointed out that the DNA fragment which encodes the Tbp2 subunit of the strain IM2394 appears to be toxic for a heterologous cell, especially for E. coli. In such a case, it may be preferable to use an inducible promoter, for example the araB gene promoter of Salmonella thyphimurium.

Elements such as a DNA unit which encode a heterologous signal peptide (signal region) or a promoter already exist in fairly large number and are known to a person skilled in the art. His general expertise will enable him to choose a signal region or a specific promoter which will be adapted to the host cell in which he envisages the expression.

More particularly, it should be noted that the Tbp2 subunit appears to be a lipoprotein since its precursor contains a signal peptide characteristic of lipoprotein precursors and because it possesses a cysteine in the NH.sub.2 -terminal position and amino acids with a strong tendency to adopt a "turn" type conformation slightly downstream of the NH.sub.2 -terminal cysteine (4 glycines). For reference, see Wu & Tokunaga, Current Top. Microb. Immunol. (1986) 125: 127. The lipidation might enhance the immunogenicity of the Tbp2 subunit.

Thus, in a prokaryotic system, it would be desirable to obtain the Tbp2 subunit either from its natural precursor or from a precursor which comprises a suitable heterologous signal peptide which permits the lipidation; that is to say a signal peptide of a lipoprotein other than Tbp2. Such a signal peptide has especially the characteristic of being liberated by cleavage of the precursor with a type II signal peptidase. The sequence at the cleavage site of the signal peptide corresponds to the consensus sequence (L, V, I) (A, S, T, G) (G, A) C, cysteine (C) being the first amino acid of the mature sequence. By way of example of heterologous signal peptide, there may be mentioned especially those of the lipoproteins ColE1, ColE3, Lpp, NlpA, OsmB, Pal, RlpB and TraT whose sequences are presented in SEQ ID NO: 9 to 24 respectively, as well as the corresponding nucleotide sequences.

Consequently, according to a specific embodiment, an expression cassette according to the invention, intended for the production of a protein having an amino acid sequence homologous to that shown:

in SEQ ID NO: 2, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 579 or in SEQ ID NO: 8, starting with the cysteine residue in position 1 and ending with the glutamine residue in position 691; comprises: i) a DNA unit which encodes a signal peptide of a lipoprotein other than the Tbp2 subunit, such as the signal peptide RlpB and ii) a DNA fragment which encodes the said protein.

Finally, the invention provides (i) a process for producing a peptide, a polypeptide or a protein capable of being recognised by an antiserum against the receptor of the strain IM2394 or IM2169 of N. meningitidis, according to which a host cell containing an expression cassette according to the invention is cultured and the said peptide, polypeptide or protein is recovered from the culture; as well as (ii) the peptide, polypeptide or protein produced by this process and (iii) pharmaceutical, especially vaccinal, compositions containing them.

For the purposes of the process according to the invention, the host cell may be a mammalian cell, a yeast or a bacterium, the latter being preferred. In this case also, the choice of a specific line is within the scope of a person skilled in the art.

Alternatively, a pharmaceutical composition according to the invention may contain, as active ingredient, a viral or bacterial vector in whose genome is inserted a DNA fragment according to the invention, placed under the control of the elements required for its expression. By way of example of appropriate vector, there may be mentioned especially pox viruses, adeno-virus and lactic acid bacteria.

A pharmaceutical composition according to the invention is especially useful for the treatment or prevention of an N. meningitidis infection. It may be manufactured in a conventional manner. In particular, a therapeutically effective amount is combined with a carrier or a diluent. It may be administered by any conventional route in usage in the field of the art, e.g. in the field of vaccines, especially enterally or parenterally. The administration may be made in a single dose or repeated after a certain period of time. The route of administration may vary as a function of various parameters, for example the individual treated (condition, age and the like). A composition may, in addition, contain a pharmaceutically acceptable adjuvant.

In order to determine the object of the present invention, it should be specified that the strains IM2394 (also called B16B6) and IM2169 (also called M982) of N. meningitidis are openly available from the Collection de Institut Pasteur, 25 rue de Dr Roux 75015 Paris, under the registration numbers CIP7908 and CIP7917 respectively.

An antiserum specific for the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis may be obtained as described in the examples below.

EXAMPLE 1

Cloning of the DNA fragments which encode the Tbp1 and Tbp2 subunits of the transferrin receptor of the strain IM2394

1A--Culture of the strain and purification of the transferrin receptor

A freeze-dried product of the strain IM2394 of N. meningitidis is taken up in about 1 ml of Muller-Hinton broth (MHB, Difco). The bacterial suspension is then plated on the solid Muller-Hinton medium containing boiled blood (5%).

After incubating for 24 h at 37.degree. C. in an atmosphere containing 10% CO.sub.2, the bacterial layer is recovered in order to inoculate 150 ml of MHB, pH 7.2, distributed into 3 250-ml Erlenmayer flasks. The incubation is continued for 3 h at 37.degree. C., with stirring. Each of the 3 cultures thus produced makes it possible to inoculate 400 ml of MHB, pH 7.2, supplemented with 30 .mu.m ethylenediamine-di(o-hydroxyphenylacetic acid), (EDDHA, Sigma) which is an iron-chelating agent in free form.

After culturing for 16 h at 37.degree. C. with stirring, the cultures are checked for their purity by examination under a microscope after Gram staining. The suspension is centrifuged, the pellet containing the pathogenic microorganisms is weighed and preserved at -20.degree. C.

The purification is carried out essentially according to the method described by Schryvers et al. (supra), as follows:

The bacterial pellet is thawed and then resuspended in 200 ml of 50 mM Tris-HCl buffer, pH 8.0 (buffer A). The suspension is centrifuged for 20 min at 15,000.times.g at 4.degree. C. The pellet is recovered, then resuspended in buffer A to a final concentration of 150 g/l. 150-ml fractions are treated for 8 min at 800 bars in a cell breaking device operating under high pressure (Rannie, model 8.30 H). The cell lysate thus obtained is centrifuged for 15 min at 4.degree. C. at 15,000.times.g. The supernatant is recovered and then centrifuged for 75 min at 4.degree. C. at 200,000.times.g. After removal of the supernatant, the pellet is taken up in buffer A and after protein assay according to Lowry, the concentration of the suspension is adjusted to 5 mg/ml.

To 1.4 ml of the membrane suspension are added 1.75 mg of human tranferrin biotinylated according to the process described by Schryvers. The final concentration of the membrane fraction is 4 mg/ml. The mixture is incubated for 1 hour at 37.degree. C. and then centrifuged at 100,000.times.g for 75 minutes at 4.degree. C. The membrane pellet is taken up in buffer A containing 0.1 M NaCl and incubated for 60 minutes at room temperature.

After solubilisation, a certain volume of 30% N-lauroylsarcosine (w/v) and 500 mM EDTA is added to this suspension so that the final sarkosyl and EDTA concentrations are 0.5% and 5 mM respectively. After incubating for 15 minutes at 37.degree. C., with stirring, 1 ml of strepavidin-agarose (Pierce), previously washed in buffer A, is added. The suspension is incubated for 15 minutes at room temperature and then centrifuged at 1,000.times.g for 10 minutes. The resin is then packed into a column and the direct eluate is discarded.

The resin is washed with 3 column volumes of 50 mM Tris-HCl buffer, pH 8.0, containing 1 M NaCl, 10 mM EDTA, 0.5% sarkosyl (buffer B) and then with a column volume of buffer B containing 750 mM guanidine-HCl. The transferrin receptor is then eluted with buffer B containing 2 M guanidine-HCl. The eluate is collected as fractions, in tubes containing an identical volume of 50 mM Tris-HCl, pH 8.0, 1 M NaCl. The optical density at 280 nm of the eluate is measured at the column outlet by means of a UV detector.

The fractions corresponding to the elution peak are recovered, dialysed against 10 mM phosphate buffer, pH 8.0, containing 0.05% sarkosyl and freeze-dried. The freeze-dried product is taken up in water to a concentration 10 times higher. The solution is dialysed a second time against 50 mM phosphate buffer, pH 8.0, containing 0.05% sarkosyl (buffer C) and then the solution is filtered on a membrane of porosity 0.22 .mu.m.

The protein content is determined and adjusted to 1 mg/ml by addition of buffer C, under aseptic conditions. This preparation is preserved at -70.degree. C.

1B--Preparation of an antiserum specific for the transferrin receptor

New Zealand albino rabbits receive subcutaneously and intramuscularly 100 .mu.g of the IM2394 receptor in the presence of complete Freund's adjuvant. 21 days and 42 days after the first injection, the rabbits again receive 100 .mu.g of the purified receptor but this time in the presence of incomplete Freund's adjuvant. 15 days after the last injection, serum is collected from the animals and then decomplementised and filtered on a membrane of porosity 0.45 .mu.m. The filtrate is subsequently exhausted by contact with the strain IM2394 which, in order to do this, was cultured beforehand in the presence of iron in free form (under these conditions, the synthesis of the transferrin receptor is repressed). The conditions of contact are as follows: 10 ml of filtrate are added to 10.sup.10 cfu (colony-forming units) of a culture of the strain IM2394. The adsorption is continued overnight at 4.degree. C., with stirring. The bacteria are then removed by centrifugation. The supernatent is recovered and then again subjected to 2 successive adsorption operations as described above.

1C--Determination of the peptide sequences which permit identification of the DNA fragments.

Aliquot fractions of the material obtained in 1A are dried and then resolubilised in two times concentrated Laemmli buffer (65 mM Tris, 3% SDS, 10% glycerol, 5% 2-mercaptoethanol). An equivalent volume of water is added.

After sonication, the material is heated at 90.degree. C. for 2 minutes and then subjected to a polyacrylamide gel electrophoresis. The subunits thus separated are transferred onto PVDF membrane (Immobilon, Millipore) for 16 hours at 400 mA in 50 mM Tris-borate buffer, pH 8.3. The electrotransferred subunits are stained with amido black and the bands corresponding to Tbp1 and Tbp2 are recovered and subjected to microsequencing of the N-terminal end.

This is repeated several times in order to establish the following N-terminal consensus sequences [SEQ ID NOS. 25-26]:

Tbp1 IM2394 :EXVQAEQAQEKQLDTIQV Tbp2 IM2394 :XLXXXXSFDLDSVEXVQXMX (X=undetermined amino acid).

In order to sequence the internal regions of Tbp2, the protein on PVDF membrane is subjected to trypsin digestion in 0.1 M Tris buffer, pH 8.2. After reacting for 4 hours at 37.degree. C., the peptides are extracted with 70% formic acid and then with 0.1% trifluoroacetic acid (TFA). These peptides are then separated by HPLC.

For Tbp2 IM2394, the internal sequences [SEQ ID NOS: 27-36] which were established are the following:

S1122: NNIVLFGPDGYLYYK S1125: YTIQA S"770: DGENAAGPATEXVIDAYR S"766: XQIDSFGDVK S1126: AAFXXXI S"769: XNXXXMFLQGVR S"771: TPVSDVAAR S"767: XSPAFT S"762: NAIEMGGSFXFPGNAPEG(K) S1128: XQPESQQDVSENX

1D--Preparation of the genomic DNA

The bacterial pellet obtained in 1A is resuspended in about 25 ml of solution A (25 mM Tris-HCl, pH 8, containing 50 mM glucose and 10 mM EDTA) supplemented with 10 mg of proteinase K. The mixture is left for 10 minutes at room temperature.

Then 12.5 ml of solution A containing 10 mg of lysozyme are added. The mixture is yet again left for 10 minutes at room temperature. The mixture is then topped up with 0.5 ml of 10% sarkosyl. The mixture is incubated for 10 minutes at +4.degree. C.

2 mg of RNase are then added and the incubation is continued for 90 minutes at 37.degree. C. The DNA is purified by four successive phenol extractions. The DNA present in the final aqueous phase is precipitated with ethanol. High molecular weight DNA is obtained by CsCl gradient separation.

1E--Cloning

A first DNA library was prepared in the lambda ZAP vector (FIG. 1), as follows:

A genomic DNA preparation was fragmented by ultrasonic treatment. The ends of the fragments thus obtained were made blunt by treatment with T.sub.4 polymerase. The fragments were methylated. After methylation, the fragments were linked to EcoRI adaptors, treated with EcoRI and then inserted into the EcoRI site of phage lambda ZAP II (Stratagene).

The strain XL1-blue of E. coli (Stratagene) was infected with the DNA library thus prepared. The white lysis plaques (presence of recombinant phages) were tested using an antiserum specific for the transferrin receptor of the strain IM2394 prepared as described in 1B. This made it possible to identify two lambda ZAP II clones. The pBluescript plasmids contained in these clones were excised by coinfection with helper phage and were called pBMT1 and pBMT2.

The plasmids pBMT1 and pBMT2 each contain an EcoRI-EcoRI fragment of 3.8 kb and 1.3 kb respectively. They are presented in FIG. 3.

Sequencing of the EcoRI-EcoRI insert of pBMT1 was carried out according to the shotgun method (Bankier and Barrell, Biochemistry (1983) B5: 508), as follows:

The EcoRI-EcoRI insert of pBMT1 was purified and then fragmented by ultrasonic treatment. The ends of the fragments thus obtained were made blunt by treatment with T.sub.4 polymerase. The fragments thus treated were introduced into a site of the phage M13TG131 (described in Kieny et al., Gene (1983) 26: 91). About 200 clones obtained from this preparation were sequenced. Computer analysis of these sequences made it possible to reconstitute the complete sequence of the EcoRI-EcoRI insert of pBMT1.

The sequence encoding the N-terminal end of Tbp1 was localised as shown in FIG. 3. Given the molecular mass of Tbp1 it was clear that this insert did not contain the complete DNA fragment which encodes Tbp1. An open reading frame was identified upstream of the 5' end of the tbp1 gene but it was not possible to clearly identify the region which encodes the N-terminal end of the tbp2 gene.

Microsequencing of the internal regions of Tbp2 was therefore affirmed as reported above in 1C. The internal sequences which were localised towards the C-terminal end indeed corresponded to the 3' portion of the open reading frame upstream of tbp1.

Furthermore, the genomic DNA of the strain IM2394, previously digested with HincII, was analysed by Southern blotting using a radioactive DNA probe corresponding to the 1.5-kb HincII-HincII region of the 3.8-kb insert of pBMT1; two bands were thus visualised. This made it possible to demonstrate that the insert carried by pBMT1 resulted from an artefactual assembly of sequences obtained from two distinct loci. The 5' sequence of tbp2 was therefore absent.

The above-described genomic DNA library in lambda ZAP was again screened, this time using the EcoRI-EcoRI insert of pBMT2 as probe. 29 candidates were retained among about 200,000 plaques tested. Only the derived plasmid pTG2749 appeared to possess a new insert relative to pBMT1 and pBMT2. The insert of pTG2749 is as represented in FIG. 3. The region of the insert upstream of the EcoRV site (EcoRV-EcoRI region) was subcloned into M13TG131 and sequenced by the method of Sanger et al., PNAS (1977) 74: 5463 using synthetic primers. The sequence corresponding to the N-terminal end of Tbp2 was thus obtained.

The sequence of the DNA fagment which encodes Tbp2 of the strain IM2394 is presented in SEQ ID NO: 1 as well as the corresponding amino acid sequence.

Just upstream of the sequence which encodes mature Tbp2, the insert of pTG2749 contains a distinct genomic region obtained from another locus. In this case also, it is a cloning artefact analogous to that detected in the case of pBMT1.

Given the rearrangements observed and the absence of 3' sequences of tbp1 and 5' sequences of tbp2, the genomic DNA library constructed in lambda ZAP was judged unsuitable for continuing the cloning.

A second genomic DNA library was therefore constructed in a low-copy number plasmid as follows: a genomic DNA preparation was partially digested with Sau3A. DNA fragments of about 4 to 6 kb were purified after sucrose gradient fractionation and inserted into the BamHI site of the plasmid pTG1265. This plasmid preparation was used to transform the strain 5K of E. coli. It was estimated that this library contained about 18,000 independent clones.

About 50,000 clones from the second library were tested using a radioactive probe corresponding to the EcoRI-EcoRI insert of pBMT2. Only one clone was observed, that is to say the plasmid pTG2759 which has a 1.8-kb insert. The size of this insert was judged to be insufficient to contain the complete gene which encodes Tbp1.

A third DNA library was constructed according to the method described in the preceding paragraph except for the strain 5K of E. coli which was replaced by the strain SURE of E. coli (Stratagene). It was estimated that this library contained about 60,000 independent clones.

About 70,000 clones from the third DNA library were tested using a radioactive probe corresponding to the 2.4-kb MluI-HincII fragment obtained from the insert of pTG2754 described in Example 2 below and represented in FIG. 4. Two clones were detected, that is to say the plasmids pTG2780 and pTG2781, represented in FIG. 3.

The sequence of the inserts of pTG2780 and pTG2781 was established according to the Sanger method. It is presented in SEQ ID NO: 3 as well as the corresponding amino acid sequence.

A fourth library was constructed. The genomic DNA was digested with Sau3A and a fraction containing fragments of about 7 kb was purified on a sucrose gradient. This fraction contained a fragment corresponding to the locus tbp1,2 since it was recognised by a DNA probe specific for tbp2. After digestion with EcoRV and XbaI and ligation into pTG1265 digested with SmaI and XbaI, E. coli 5K was transformed. The clones were screened using a probe specific for tbp2. Among a series of positive clones, the plasmid pTG3791 was studied in particular and was found to contain tbp2 5' sequences including the sequence which encodes the putative signal peptide of Tbp2.

EXAMPLE 2

Cloning of the DNA fragments which encode the Tbp1 and Tbp2 subunits of the transferrin receptor of the strain IM2169

2A--The culture of the strain IM2169 and the purification of the transferrin receptor were performed under conditions identical to those described in Example 1A.

2B--The preparation of an antiserum against the receptor of the strain IM2169 was carried out according to the procedure described in Example 1B.

2C--The peptide sequences permitting the identification of the DNA fragments were determined according to the method reported in Example 1C. The microsequences which were established are the following.

Consensus sequence [SEQ ID NO. 37] of the N-terminal end of Tbp1:

ENVQAGQAQEKQLXXIQVX

Sequences [SEQ ID NOS. 38-41] of the internal peptides of Tbp1:

S1031: XLS(E,W)NAGXVLXPADX S1032: QLDTIQVK S1033: TAGSSGAINEIEYENXX S1034: YVTWENVDXXXXXX

Consensus sequence [SEQ ID NO. 42] of the N-terminal end of Tbp2:

SLVXAXSFDLXSV

Sequences [SEQ ID NOS. 43-46] of the internal peptides of Tbp2:

S1037: XXDNLSNAX S1035: XGDDGYIFYXGEKPX S1036: XQGXYGFAMX S1040: XQATGHENFQYVYSGXFYK

2D--Preparation of the genomic DNA of the strain IM2169 was carried out according to the procedure described in Example 1D.

2E--Cloning

A first genomic DNA library (fragments of partial Sau3A DNA; pTG1265; E. coli 5K) was constructed as described above in Example 1. It was estimated that this library contained about 40,000 independent clones, of which about 70% had a 4-6-kb insert.

130,000 clones from this library were tested using a radioactive probe corresponding to the EcoRI-EcoRI insert of pBMT2. 42 clones were analysed, among which 2 were retained: the plasmids pTG2753 and pTG2754 which are as shown in FIG. 4. Southern blot analyses showed that the restriction maps of the inserts of pTG2753 and pTG2754 corresponded to the restriction map of the genomic DNA.

The determination of the nucleotide sequences and the search for the regions which encode the N-terminal ends and the internal regions demonstrated that:

the 1.9-kb insert of pTG2753 contains the 3' portion of the tbp2 gene and the 5' portion of the tbp1 gene; and the insert of pTG2754 contains the 3' portion of the tbp2 gene and the 5' and 3' portions of the tbp1 gene, with phase disruption.

This first library did not therefore make it possible to clone the complete DNA fragments which encode Tbp1 or Tbp2.

A second genomic library was constructed as above but from XbaI-digested genomic DNA. The DNA fragments were purified after sucrose gradient fractionation. Each fraction (about 500 .mu.l) was tested by Southern blotting with a radioactive probe corresponding to the 3' end of tbp1 (fragment of the insert of pTG2754). The fraction exhibiting a hybridisation reaction and containing about 6-kb fragments was cloned into pTG1265. The strain 5K of E. coli was transformed.

About 2,400 clones from this library were tested using a radioactive probe corresponding to the 0.6-kb HincII-MluI fragment obtained from pTG2754. Five clones were characterised, among which 2 were retained: that is to say pTG3720 and pTG3721, as shown in FIG. 4, both of which contain the tbp1 and tbp2 genes.

In order to complete the nucleotide sequence which encodes Tbp1, the insert of pTG3720 was sequenced in the region where the phase disruption discovered in the insert of pTG2754 was situated. This sequencing made it possible to show that the phase disruption of the insert of pTG2754 was due to a 22 bp deletion. The complete sequence of the DNA fragment is as shown in SEQ ID NO: 5.

The sequencing of the insert of pTG3720 was pursued in order to establish the sequence of tbp2. The said sequence was indeed identified, but again in this case a phase disruption was observed.

Finally, the sequence of tbp2 was determined from the plasmid pTG3721. It is as shown in SEQ ID NO: 7.

EXAMPLE 3

Expression of the DNA fragment which encodes the Tbp2 subunit of the strain IM2394

3A. Construction of the expression vector pTG3749.

The SphI site of the plasmid pARA13 (FIG. 5; Cagnon et al., Prot. Eng. (1991) 4: 843) was destroyed by treatment with klenow polymerase in order to give the plasmid pTG3704. pTG3704 was linearised by NcoI cleavage, treated with Klenow polymerase in order to produce blunt ends and then digested with HindIII.

Furthermore, the oligonucleotides OTG4015 and OTG4016 [SEQ ID NOS: 47-48] were synthesised and paired.

OTG4015:5' AAATACCTATTGCCTACGGCAGCCGCTGGACTGTTATTACT CGCTGCCCAACCAGCGATGGCATGCTTTCCCACGCGTTTTCCCA 3' OTG4016:5' AGCTTGGGAAAACGCGTGGGAAAGCATGCCATCGCTGGTTGGGCA GCGAGTAATAACAGTCCAGCGGCTGCCGTAGGCAATAGGTATTT 3'

The double-stranded DNA fragment OTG4015/OTG4016 was inserted into pARA13 treated as described above, in order to give the plasmid pTG3717 in which the sequence [SEQ ID NO: 49] which encodes the N-terminal portion of the precursor of the protein PelB of Erwinia carotovora had been reconstituted (Lei et al., J. Bact. (1987) 169: 4379); that is to say:

....... ATG AAA TAC CTA CCT ACG GCA GCC GCT Met Lys Tyr Leu Leu Pro Thr Ala Ala GGA CTG Ala Gly Leu SphITTA TTA CTC GCT GCC CAA CCA GCG ATG GCA TGCTTTLeu Leu Leu Ala Ala Gln Pro Ala Met Ala MluI HindIIICCCACGCGTTTTCCCA AGCTT..... (The ends of pTG3704 are underlined)

From the plasmid pTG2749, a fragment including the region which encodes the N-terminal portion of Tbp2, up to the internal MluI site, as shown in FIG. 6, was generated by PCR using the primers OTG4011 and OTG4012 [SEQ ID NOS: 50-51].

OTG4011 : BamHI SphI5' AAAAAGGATCC/GCA TGC CTG GGT GGC GGC GGC AGT TTC 3' Cys Leu Gly ....OTG4012 : BamHI MluI5' AAAAGGATCCG AAT GGT GTA ACG CGT AGT TTT TAT 3'

The fragment generated by PCR was digested with BamHI and then inserted into the BamHI site of the phage M13TG131 to give M13TG3724. The sequence of this fragment was checked by sequencing.

The region which encodes the N-terminal portion of Tbp2 was recovered from M13TG3724 in the form of an SphI-MluI fragment which was then inserted into pTG3717 previously digested with SphI and MluI, to give the plasmid pTG3743.

From the plasmid pBMT1, the region which encodes the C-terminal portion of Tbp2 was recovered in the form of an MluI-BanI fragment whose BanI sticky end had been made blunt by treatment with Klenow polymerase. This fragment was inserted into pTG3743 previously digested with HindIII, treated with Klenow polymerase and finally digested with MluI. The plasmid pTG3749 was thus obtained.

3B. Production of the Tbp2 subunit.

E. coli MC1061 (Casadaban & Cohen, J. Mol. Biol. (1980) 138: 179) is transformed with pTG3749 and then cultured at 37.degree. C. in LB medium supplemented with 2 g/l of glycerol and 100 .mu.g/ml of ampicillin. To the culture in exponential phase, is added 0.2 g/l of arabinose. The incubation is continued for a further 6 h. The expression was observed less than one hour after the addition of arabinose.

Polyacrylamide gel electrophoresis of a sample of the total cell lysate shows the presence of a protein of about 70 kD which is capable of binding peroxydase-labelled human transferrin.

EXAMPLE 4

Expression of the DNA fragment which encodes the Tbp2 subunit of the strain IM2169

4A. Construction of the expression vector pTG3779.

A synthetic fragment consisting of the oligonucleotides OTG4038 and OTG4039 [SEQ ID NOS: 52-53] previously paired, was inserted into the plasmid pTG3704 digested with NcoI and HindIII, thus generating the plasmid pTG3756.

OTG4038: 5' CATGGCTGCAGGRACCACGCGTGAATTCCCCGGGTCTAGA 3' OTG4039: 5' AGCTTCTAGACCCGGGGAATTCACGCGTGGTACCTGCAGC 3'

From the plasmid pTG2754, a fragment including the region which encodes the N-terminal end of the precursor of Tbp1 up to the MluI site was generated by PCR using the primers OTG4037 and OTG4014 [SEQ ID NOS: 54-55].

OTG4037 :5' TTTCCCGGATCCGC ATG CAA CAG CAA CAT TTG TTC CGA TTA 3 BamHI SphIOTG4014 : - 5' AAAAGGATCCGGGGTCGTAACGCGTCAGGTCGCGG 3' BamHI MluI

This PCR fragment was digested with BamHI and cloned into the BamHI site of M13TG131 in order to generate M13TG3738. The sequence of this fragment was checked.

M13TG3738 was then linearised with SphI, treated with T4 DNA polymerase so as to make the ends blunt, and then digested with MluI in order to isolate the fragment carrying the region which encodes the N-terminal end of the precursor of Tbp1.

This fragment was inserted into NcoI-digested pTG3756, treated with T4 DNA polymerase and then digested with MluI in order to generate the plasmid pTG3778. The sequence of the NcoI.degree./SphI.degree. junction was checked.

The MluI-XbaI fragment of pTG3720 encoding the main part of Tbp1 (3'tbp1) was inserted into the plasmid pTG3778. The final plasmid thus obtained is the plasmid pTG3779.

4B. Production of the Tbp1 subunit.

E. coli MC1061 was transformed with pTG3779 and then cultured at 37.degree. C. in LB medium. To the culture in exponential phase, is added 0.2 g/l of arabinose. The incubation was continued for 4 hours.

Polyacrylamide gel electrophoresis of a sample of the total cell lysate showed the presence of a protein of about 100 kD which is recognised by the anti-receptor antibodies.

EXAMPLE 5

Expression of the DNA fragment which encodes the Tbp2 subunit of the strain IM2394 (construct with the homologous signal sequence)

5A. Construction of the expression vector pTG4710.

From the plasmid pTG3749, a fragment which encodes the C-terminal portion of Tbp2 (from the internal BamHI site) and containing an HindIII restriction site downstream of the translational termination codon of tbp2 was generated by PCR using the primers OTG4247 and OTG4248 [SEQ ID NOS: 56-57].

OTG4247 : 5' GGCTTTGCGCTGGATCCGCAAAATACC 3' BamHIOTG4248 :5' CCCAAAAGATCTCCAAGCTTGAAGCCTTATTCTCGATTGTTCGGCAGCC 3' HindIII

The fragment generated by PCR was digested with HindIII and BamHI and inserted simultaneously with the SphI-BamHI fragment of pTG3749 which encodes the N-terminal part of mature Tbp2 into the vector pTG3743 digested with SphI and HindIII to give the plasmid pTG3786. The sequence of the PCR-amplified fragment was checked.

From the plasmid pTG3791, a fragment which encodes the N-terminal portion of the precursor of Tbp2 up to the internal EcoRV site was generated by PCR using the primers OTG4491 and OTG4494 [SEQ ID NOS: 58-59].

BspHI5' TTTTTTGGATCCTCATG AAC AAT CCA TTG GTA AAT CAG GCT Met Asn Asn Pro Leu Val Asn Glu Ala SphIGCT ATG GTG CTG CCT GTG TTT TTG TTG AGT GCA TGC CTG GGTAla Met Val Leu Pro Val Phe Leu Leu Ser Ala Cys Leu Gly Cleavage of the signal peptide OTG4494 :5' TTTTTTGGATCCGATATCCGTCAGGTCCAAAAAGAACTATATTATTC 3' EcoRV

The fragment generated by PCR was then digested with BspHI and EcoRV and ligated simultaneously into the NcoI-SstI fragments of pTG3704 containing the araC gene and the araB promoter, and into the EcoRV-Sst1 fragments of pTG3786 containing the 3' portion of the tbp2 and the araB terminator. The resulting plasmid pTG4710 was checked by sequencing (sequence of the PCR-amplified fragment).

5B. Production of the Tbp2 subunit.

E. coli Xac-I (Normanly et al., Proc. Natl. Acad. Sci. (1986) 83: 6548) is transformed with the plasmid pTG4710 and then cultured at 37.degree. C. in M9 medium+0.5% succinate+50 .mu.g/ml arginine+100 .mu.g/ml ampicillin. In the exponential phase, 0.2% arabinose is added. After various induction times (1 h to 3 h), cells are collected and extracts are prepared. Western blot analysis followed by visualisation of Tbp2 using transferrin-peroxydase made it possible to show that most of Tbp2 occurs in the form of a precursor. Analysis of the extracts by SDS-PAGE followed by staining of the proteins with Coomassie blue made it possible to detect a high production of protein (evaluated at about 5 to 10% of the total proteins). Labelling experiments in vivo with titrated palmitate and glycerol made it possible to show that only the mature form is lipidated.

EXAMPLE 6

Expression of the DNA fragment which encodes the Tbp2 subunit of the strain IM2394 (construct with the rlpB signal sequence)

6A. Construction of the expression vector pTG4764.

From pTG3786 a fragment which encodes the RlpB signal peptide (Takase et al., J. Bacteriol. (1987) 169: 5692) and the beginning of the sequence which encodes mature Tbp2 up to the internal EcoRV site was generated by PCR using the primers OTG4494 and OTG4651 [SEQ ID NO: 60].

OTG4494: cf Example 1.

OTG4651 : BspHI5' TTTTTTTCATG AGA TAC CTG GCA ACA TTG TTG TTA TCT Met Arg Tyr Leu Ala Thr Leu Leu Leu SerCTG GCG GTG TTA ATC ACC GCC GGG TGC CTG GGT GGCLeu Ala Val Leu Ile Thr Ala Gly Cys Leu Gly ...GGC GGC AGT TTC 3' cleavage of the signal peptide

GGC GGC AGT TTC 3'

The PCR fragment was then digested with BspHI and EcoRV and inserted simultaneously with the EcoRV-HindIII fragment of the pTG3786 carrying the 3' portion of the tbp2 gene, into the vector pTG3704 digested with NcoI and HindIII in order to generate the plasmid pTG4764. The sequence of the PCR-amplified fragment was checked.

6B. Production of the Tbp2 subunit.

E. coli Xac-I is transformed with the plasmid pTG4764 and then cultured at 37.degree. C. in M9 medium+0.5% succinate+50 .mu.g/ml arginine+100 .mu.g/ml ampicillin. In the exponential phase, 0.2% arabinose is added. After various induction times (1 h to 3 h), cells are collected and extracts are prepared. A Western blot analysis followed by visualisation with transferrin-peroxydase made it possible to detect a predominant band whose molecular weight corresponds to that of purified mature Tbp2. The protein is detected in the extracts after SDS-PAGE and staining of the proteins with Coomassie blue (level of production evaluated at about 2 to 5% of the total proteins). Labelling experiments in vivo with tritiated palmitate and glycerol made it possible to show that the protein thus produced is lipidated. The quantity of lipidated mature Tbp2 form produced by the strain Xac-I/pTG4764 is greater than that produced by the strain Xac-I/pTG4710.

__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 62- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1808 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA which - # encodes Tbp2 subunit of transferrin receptor (B) STRAIN: Neisseria m - #eningitidis IM2394- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..60- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 61..1797- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1797- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- ATG AAC AAT CCA TTG GTA AAT CAG GCT GCT AT - #G GTG CTG CCT GTG TTT 48Met Asn Asn Pro Leu Val Asn Gln Ala Ala Me - #t Val Leu Pro Val Phe#-510- TTG TTG AGT GCT TGT CTG GGT GGC GGC GGC AG - #T TTC GAT TTG GAC AGC 96Leu Leu Ser Ala Cys Leu Gly Gly Gly Gly Se - #r Phe Asp Leu Asp Ser# 10- GTG GAA ACC GTG CAA GAT ATG CAC TCC AAA CC - #T AAG TAT GAG GAT GAA 144Val Glu Thr Val Gln Asp Met His Ser Lys Pr - #o Lys Tyr Glu Asp Glu# 25- AAA AGC CAG CCT GAA AGC CAA CAG GAT GTA TC - #G GAA AAC AGC GGC GCG 192Lys Ser Gln Pro Glu Ser Gln Gln Asp Val Se - #r Glu Asn Ser Gly Ala# 40- GCT TAT GGC TTT GCA GTA AAA CTA CCT CGC CG - #G AAT GCA CAT TTT AAT 240Ala Tyr Gly Phe Ala Val Lys Leu Pro Arg Ar - #g Asn Ala His Phe Asn# 60- CCT AAA TAT AAG GAA AAG CAC AAA CCA TTG GG - #T TCA ATG GAT TGG AAA 288Pro Lys Tyr Lys Glu Lys His Lys Pro Leu Gl - #y Ser Met Asp Trp Lys# 75- AAA CTG CAA AGA GGA GAA CCA AAT AGT TTT AG - #T GAG AGG GAT GAA TTG 336Lys Leu Gln Arg Gly Glu Pro Asn Ser Phe Se - #r Glu Arg Asp Glu Leu# 90- GAA AAA AAA CGG GGT AGT TCT GAA CTT ATT GA - #A TCA AAA TGG GAA GAT 384Glu Lys Lys Arg Gly Ser Ser Glu Leu Ile Gl - #u Ser Lys Trp Glu Asp# 105- GGG CAA AGT CGT GTA GTT GGT TAT ACA AAT TT - #C ACT TAT GTC CGT TCG 432Gly Gln Ser Arg Val Val Gly Tyr Thr Asn Ph - #e Thr Tyr Val Arg Ser# 120- GGA TAT GTT TAC CTT AAT AAA AAT AAT ATT GA - #T ATT AAG AAT AAT ATA 480Gly Tyr Val Tyr Leu Asn Lys Asn Asn Ile As - #p Ile Lys Asn Asn Ile125 1 - #30 1 - #35 1 -#40- GTT CTT TTT GGA CCT GAC GGA TAT CTT TAC TA - #T AAA GGG AAA GAA CCT 528Val Leu Phe Gly Pro Asp Gly Tyr Leu Tyr Ty - #r Lys Gly Lys Glu Pro# 155- TCC AAG GAG CTG CCA TCG GAA AAG ATA ACT TA - #T AAA GGT ACT TGG GAT 576Ser Lys Glu Leu Pro Ser Glu Lys Ile Thr Ty - #r Lys Gly Thr Trp Asp# 170- TAT GTT ACT GAT GCT ATG GAA AAA CAA AGG TT - #T GAA GGA TTG GGT AGT 624Tyr Val Thr Asp Ala Met Glu Lys Gln Arg Ph - #e Glu Gly Leu Gly Ser# 185- GCA GCA GGA GGA GAT AAA TCG GGG GCG TTG TC - #T GCA TTA GAA GAA GGG 672Ala Ala Gly Gly Asp Lys Ser Gly Ala Leu Se - #r Ala Leu Glu Glu Gly# 200- GTA TTG CGT AAT CAG GCA GAG GCA TCA TCC GG - #T CAT ACC GAT TTT GGT 720Val Leu Arg Asn Gln Ala Glu Ala Ser Ser Gl - #y His Thr Asp Phe Gly205 2 - #10 2 - #15 2 -#20- ATG ACT AGT GAG TTT GAG GTT GAT TTT TCT GA - #T AAA ACA ATA AAG GGC 768Met Thr Ser Glu Phe Glu Val Asp Phe Ser As - #p Lys Thr Ile Lys Gly# 235- ACA CTT TAT CGT AAC AAC CGT ATT ACT CAA AA - #T AAT AGT GAA AAC AAA 816Thr Leu Tyr Arg Asn Asn Arg Ile Thr Gln As - #n Asn Ser Glu Asn Lys# 250- CAA ATA AAA ACT ACG CGT TAC ACC ATT CAA GC - #A ACT CTT CAC GGC AAC 864Gln Ile Lys Thr Thr Arg Tyr Thr Ile Gln Al - #a Thr Leu His Gly Asn# 265- CGT TTC AAA GGT AAG GCG TTG GCG GCA GAT AA - #A GGT GCA ACA AAT GGA 912Arg Phe Lys Gly Lys Ala Leu Ala Ala Asp Ly - #s Gly Ala Thr Asn Gly# 280- AGT CAT CCC TTT ATT TCC GAC TCC GAC AGT TT - #G GAA GGC GGA TTT TAC 960Ser His Pro Phe Ile Ser Asp Ser Asp Ser Le - #u Glu Gly Gly Phe Tyr285 2 - #90 2 - #95 3 -#00- GGG CCG AAA GGC GAG GAA CTT GCC GGT AAA TT - #C TTG AGC AAC GAC AAC1008Gly Pro Lys Gly Glu Glu Leu Ala Gly Lys Ph - #e Leu Ser Asn Asp Asn# 315- AAA GTT GCA GCG GTG TTT GGT GCG AAG CAG AA - #A GAT AAG AAG GAT GGG1056Lys Val Ala Ala Val Phe Gly Ala Lys Gln Ly - #s Asp Lys Lys Asp Gly# 330- GAA AAC GCG GCA GGG CCT GCA ACG GAA ACC GT - #G ATA GAT GCA TAC CGT1104Glu Asn Ala Ala Gly Pro Ala Thr Glu Thr Va - #l Ile Asp Ala Tyr Arg# 345- ATT ACC GGC GAG GAG TTT AAG AAA GAG CAA AT - #A GAC AGT TTT GGA GAT1152Ile Thr Gly Glu Glu Phe Lys Lys Glu Gln Il - #e Asp Ser Phe Gly Asp# 360- GTG AAA AAG CTG CTG GTT GAC GGA GTG GAG CT - #T TCA CTG CTG CCG TCT1200Val Lys Lys Leu Leu Val Asp Gly Val Glu Le - #u Ser Leu Leu Pro Ser365 3 - #70 3 - #75 3 -#80- GAG GGC AAT AAG GCG GCA TTT CAG CAC GAG AT - #T GAG CAA AAC GGC GTG1248Glu Gly Asn Lys Ala Ala Phe Gln His Glu Il - #e Glu Gln Asn Gly Val# 395- AAG GCA ACG GTG TGT TGT TCC AAC TTG GAT TA - #C ATG AGT TTT GGG AAG1296Lys Ala Thr Val Cys Cys Ser Asn Leu Asp Ty - #r Met Ser Phe Gly Lys# 410- CTG TCA AAA GAA AAT AAA GAC GAT ATG TTC CT - #G CAA GGT GTC CGC ACT1344Leu Ser Lys Glu Asn Lys Asp Asp Met Phe Le - #u Gln Gly Val Arg Thr# 425- CCA GTA TCC GAT GTG GCG GCA AGG ACG GAG GC - #A AAC GCC AAA TAT CGC1392Pro Val Ser Asp Val Ala Ala Arg Thr Glu Al - #a Asn Ala Lys Tyr Arg# 440- GGT ACT TGG TAC GGA TAT ATT GCC AAC GGC AC - #A AGC TGG AGC GGC GAA1440Gly Thr Trp Tyr Gly Tyr Ile Ala Asn Gly Th - #r Ser Trp Ser Gly Glu445 4 - #50 4 - #55 4 -#60- GCC TCC AAT CAG GAA GGT GGT AAT AGG GCA GA - #G TTT GAC GTG GAT TTT1488Ala Ser Asn Gln Glu Gly Gly Asn Arg Ala Gl - #u Phe Asp Val Asp Phe# 475- TCC ACT AAA AAA ATC AGT GGC ACA CTC ACG GC - #A AAA GAC CGT ACG TCT1536Ser Thr Lys Lys Ile Ser Gly Thr Leu Thr Al - #a Lys Asp Arg Thr Ser# 490- CCT GCG TTT ACT ATT ACT GCC ATG ATT AAG GA - #C AAC GGT TTT TCA GGT1584Pro Ala Phe Thr Ile Thr Ala Met Ile Lys As - #p Asn Gly Phe Ser Gly# 505- GTG GCG AAA ACC GGT GAA AAC GGC TTT GCG CT - #G GAT CCG CAA AAT ACC1632Val Ala Lys Thr Gly Glu Asn Gly Phe Ala Le - #u Asp Pro Gln Asn Thr# 520- GGA AAT TCC CAC TAT ACG CAT ATT GAA GCC AC - #T GTA TCC GGC GGT TTC1680Gly Asn Ser His Tyr Thr His Ile Glu Ala Th - #r Val Ser Gly Gly Phe525 5 - #30 5 - #35 5 -#40- TAC GGC AAA AAC GCC ATC GAG ATG GGC GGA TC - #G TTC TCA TTT CCG GGA1728Tyr Gly Lys Asn Ala Ile Glu Met Gly Gly Se - #r Phe Ser Phe Pro Gly# 555- AAT GCA CCA GAG GGA AAA CAA GAA AAA GCA TC - #G GTG GTA TTC GGT GCG1776Asn Ala Pro Glu Gly Lys Gln Glu Lys Ala Se - #r Val Val Phe Gly Ala# 570# 1808 TT GTG CAA TAAGCACGGC TLys Arg Gln Gln Leu Val Gln 575- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 599 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Met Asn Asn Pro Leu Val Asn Gln Ala Ala Me - #t Val Leu Pro Val Phe#-510- Leu Leu Ser Ala Cys Leu Gly Gly Gly Gly Se - #r Phe Asp Leu Asp Ser# 10- Val Glu Thr Val Gln Asp Met His Ser Lys Pr - #o Lys Tyr Glu Asp Glu# 25- Lys Ser Gln Pro Glu Ser Gln Gln Asp Val Se - #r Glu Asn Ser Gly Ala# 40- Ala Tyr Gly Phe Ala Val Lys Leu Pro Arg Ar - #g Asn Ala His Phe Asn# 60- Pro Lys Tyr Lys Glu Lys His Lys Pro Leu Gl - #y Ser Met Asp Trp Lys# 75- Lys Leu Gln Arg Gly Glu Pro Asn Ser Phe Se - #r Glu Arg Asp Glu Leu# 90- Glu Lys Lys Arg Gly Ser Ser Glu Leu Ile Gl - #u Ser Lys Trp Glu Asp# 105- Gly Gln Ser Arg Val Val Gly Tyr Thr Asn Ph - #e Thr Tyr Val Arg Ser# 120- Gly Tyr Val Tyr Leu Asn Lys Asn Asn Ile As - #p Ile Lys Asn Asn Ile125 1 - #30 1 - #35 1 -#40- Val Leu Phe Gly Pro Asp Gly Tyr Leu Tyr Ty - #r Lys Gly Lys Glu Pro# 155- Ser Lys Glu Leu Pro Ser Glu Lys Ile Thr Ty - #r Lys Gly Thr Trp Asp# 170- Tyr Val Thr Asp Ala Met Glu Lys Gln Arg Ph - #e Glu Gly Leu Gly Ser# 185- Ala Ala Gly Gly Asp Lys Ser Gly Ala Leu Se - #r Ala Leu Glu Glu Gly# 200- Val Leu Arg Asn Gln Ala Glu Ala Ser Ser Gl - #y His Thr Asp Phe Gly205 2 - #10 2 - #15 2 -#20- Met Thr Ser Glu Phe Glu Val Asp Phe Ser As - #p Lys Thr Ile Lys Gly# 235- Thr Leu Tyr Arg Asn Asn Arg Ile Thr Gln As - #n Asn Ser Glu Asn Lys# 250- Gln Ile Lys Thr Thr Arg Tyr Thr Ile Gln Al - #a Thr Leu His Gly Asn# 265- Arg Phe Lys Gly Lys Ala Leu Ala Ala Asp Ly - #s Gly Ala Thr Asn Gly# 280- Ser His Pro Phe Ile Ser Asp Ser Asp Ser Le - #u Glu Gly Gly Phe Tyr285 2 - #90 2 - #95 3 -#00- Gly Pro Lys Gly Glu Glu Leu Ala Gly Lys Ph - #e Leu Ser Asn Asp Asn# 315- Lys Val Ala Ala Val Phe Gly Ala Lys Gln Ly - #s Asp Lys Lys Asp Gly# 330- Glu Asn Ala Ala Gly Pro Ala Thr Glu Thr Va - #l Ile Asp Ala Tyr Arg# 345- Ile Thr Gly Glu Glu Phe Lys Lys Glu Gln Il - #e Asp Ser Phe Gly Asp# 360- Val Lys Lys Leu Leu Val Asp Gly Val Glu Le - #u Ser Leu Leu Pro Ser365 3 - #70 3 - #75 3 -#80- Glu Gly Asn Lys Ala Ala Phe Gln His Glu Il - #e Glu Gln Asn Gly Val# 395- Lys Ala Thr Val Cys Cys Ser Asn Leu Asp Ty - #r Met Ser Phe Gly Lys# 410- Leu Ser Lys Glu Asn Lys Asp Asp Met Phe Le - #u Gln Gly Val Arg Thr# 425- Pro Val Ser Asp Val Ala Ala Arg Thr Glu Al - #a Asn Ala Lys Tyr Arg# 440- Gly Thr Trp Tyr Gly Tyr Ile Ala Asn Gly Th - #r Ser Trp Ser Gly Glu445 4 - #50 4 - #55 4 -#60- Ala Ser Asn Gln Glu Gly Gly Asn Arg Ala Gl - #u Phe Asp Val Asp Phe# 475- Ser Thr Lys Lys Ile Ser Gly Thr Leu Thr Al - #a Lys Asp Arg Thr Ser# 490- Pro Ala Phe Thr Ile Thr Ala Met Ile Lys As - #p Asn Gly Phe Ser Gly# 505- Val Ala Lys Thr Gly Glu Asn Gly Phe Ala Le - #u Asp Pro Gln Asn Thr# 520- Gly Asn Ser His Tyr Thr His Ile Glu Ala Th - #r Val Ser Gly Gly Phe525 5 - #30 5 - #35 5 -#40- Tyr Gly Lys Asn Ala Ile Glu Met Gly Gly Se - #r Phe Ser Phe Pro Gly# 555- Asn Ala Pro Glu Gly Lys Gln Glu Lys Ala Se - #r Val Val Phe Gly Ala# 570- Lys Arg Gln Gln Leu Val Gln 575- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2800 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA encod - #es Tpb1 subunit of transferrin receptor (B) STRAIN: Neisseria m - #eningitidis IM2394- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 40..111- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 112..2763- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 40..2763- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- CTTCCGATGC CGTCTGAAAG CGAAGATTAG GGAAACACT ATG CAA CAG - # CAA CAT 54# Met Gln Gln Gln His20- TTG TTC CGA TTA AAT ATT TTA TGC CTG TCT TT - #A ATG ACC GCG CTG CCC 102Leu Phe Arg Leu Asn Ile Leu Cys Leu Ser Le - #u Met Thr Ala Leu Pro- GTT TAT GCA GAA AAT GTG CAA GCC GAA CAA GC - #A CAG GAA AAA CAG TTG 150Val Tyr Ala Glu Asn Val Gln Ala Glu Gln Al - #a Gln Glu Lys Gln Leu# 10- GAT ACC ATA CAG GTA AAA GCC AAA AAA CAG AA - #A ACC CGC CGC GAT AAC 198Asp Thr Ile Gln Val Lys Ala Lys Lys Gln Ly - #s Thr Arg Arg Asp Asn# 25- GAA GTG ACC GGG CTG GGC AAG TTG GTC AAG TC - #T TCC GAT ACG CTA AGT 246Glu Val Thr Gly Leu Gly Lys Leu Val Lys Se - #r Ser Asp Thr Leu Ser# 45- AAA GAA CAG GTT TTG AAT ATC CGA GAC CTG AC - #C CGT TAT GAT CCG GGT 294Lys Glu Gln Val Leu Asn Ile Arg Asp Leu Th - #r Arg Tyr Asp Pro Gly# 60- ATT GCC GTG GTC GAA CAG GGT CGG GGC GCA AG - #T TCC GGC TAT TCA ATA 342Ile Ala Val Val Glu Gln Gly Arg Gly Ala Se - #r Ser Gly Tyr Ser Ile# 75- CGC GGC ATG GAT AAA AAC CGC GTT TCC TTA AC - #G GTA GAC GGC GTT TCG 390Arg Gly Met Asp Lys Asn Arg Val Ser Leu Th - #r Val Asp Gly Val Ser# 90- CAA ATA CAG TCC TAC ACC GCG CAG GCG GCA TT - #G GGT GGG ACG AGG ACG 438Gln Ile Gln Ser Tyr Thr Ala Gln Ala Ala Le - #u Gly Gly Thr Arg Thr# 105- GCG GGT AGC AGC GGC GCA ATC AAT GAA ATC GA - #G TAT GAA AAC GTC AAG 486Ala Gly Ser Ser Gly Ala Ile Asn Glu Ile Gl - #u Tyr Glu Asn Val Lys110 1 - #15 1 - #20 1 -#25- GCC GTT GAA ATC AGC AAG GGT TCG AAT TCA TC - #A GAA TAC GGA AAC GGC 534Ala Val Glu Ile Ser Lys Gly Ser Asn Ser Se - #r Glu Tyr Gly Asn Gly# 140- GCA TTG GCA GGT TCG GTC GCA TTT CAA ACC AA - #A ACC GCA GCC GAC ATT 582Ala Leu Ala Gly Ser Val Ala Phe Gln Thr Ly - #s Thr Ala Ala Asp Ile# 155- ATC GGA GAG GGA AAA CAG TGG GGC ATT CAG AG - #T AAA ACT GCC TAT TCG 630Ile Gly Glu Gly Lys Gln Trp Gly Ile Gln Se - #r Lys Thr Ala Tyr Ser# 170- GGA AAA GAC CAT GCC CTG ACG CAA TCC CTT GC - #G CTT GCC GGA CGC AGC 678Gly Lys Asp His Ala Leu Thr Gln Ser Leu Al - #a Leu Ala Gly Arg Ser# 185- GGC GGC GCG GAA GCC CTC CTT ATT TAT ACT AA - #A CGG CGG GGT CGG GAA 726Gly Gly Ala Glu Ala Leu Leu Ile Tyr Thr Ly - #s Arg Arg Gly Arg Glu190 1 - #95 2 - #00 2 -#05- ATC CAT GCG CAT AAA GAT GCC GGC AAG GGT GT - #G CAG AGC TTC AAC CGG 774Ile His Ala His Lys Asp Ala Gly Lys Gly Va - #l Gln Ser Phe Asn Arg# 220- CTG GTG TTG GAC GAG GAC AAG AAG GAG GGT GG - #C AGT CAG TAC AGA TAT 822Leu Val Leu Asp Glu Asp Lys Lys Glu Gly Gl - #y Ser Gln Tyr Arg Tyr# 235- TTC ATT GTC GAA GAA GAA TGC CAC AAT GGA TA - #T GCG GCC TGT AAA AAC 870Phe Ile Val Glu Glu Glu Cys His Asn Gly Ty - #r Ala Ala Cys Lys Asn# 250- AAG CTG AAA GAA GAT GCC TCG GTC AAA GAT GA - #G CGC AAA ACC GTC AGC 918Lys Leu Lys Glu Asp Ala Ser Val Lys Asp Gl - #u Arg Lys Thr Val Ser# 265- ACG CAG GAT TAT ACC GGC TCC AAC CGC TTA CT - #T GCG AAC CCG CTT GAG 966Thr Gln Asp Tyr Thr Gly Ser Asn Arg Leu Le - #u Ala Asn Pro Leu Glu270 2 - #75 2 - #80 2 -#85- TAT GGC AGC CAA TCA TGG CTG TTC CGA CCG GG - #T TGG CAT TTG GAC AAC1014Tyr Gly Ser Gln Ser Trp Leu Phe Arg Pro Gl - #y Trp His Leu Asp Asn# 300- CGC CAT TAT GTC GGA GCC GTT CTC GAA CGT AC - #G CAG CAG ACC TTT GAT1062Arg His Tyr Val Gly Ala Val Leu Glu Arg Th - #r Gln Gln Thr Phe Asp# 315- ACA CGG GAT ATG ACT GTT CCT GCC TAT TTT AC - #C AGT GAA GAT TAT GTA1110Thr Arg Asp Met Thr Val Pro Ala Tyr Phe Th - #r Ser Glu Asp Tyr Val# 330- CCC GGT TCG CTG AAA GGT CTT GGC AAA TAT TC - #G GGC GAT AAT AAG GCA1158Pro Gly Ser Leu Lys Gly Leu Gly Lys Tyr Se - #r Gly Asp Asn Lys Ala# 345- GAA AGG CTG TTT GTT CAG GGA GAG GGC AGT AC - #A TTG CAG GGT ATC GGT1206Glu Arg Leu Phe Val Gln Gly Glu Gly Ser Th - #r Leu Gln Gly Ile Gly350 3 - #55 3 - #60 3 -#65- TAC GGT ACC GGC GTG TTT TAT GAT GAA CGC CA - #T ACT AAA AAC CGC TAC1254Tyr Gly Thr Gly Val Phe Tyr Asp Glu Arg Hi - #s Thr Lys Asn Arg Tyr# 380- GGG GTC GAA TAT GTT TAC CAT AAT GCT GAT AA - #G GAT ACC TGG GCC GAT1302Gly Val Glu Tyr Val Tyr His Asn Ala Asp Ly - #s Asp Thr Trp Ala Asp# 395- TAC GCC CGA CTT TCT TAT GAC CGG CAA GGT AT - #A GAT TTG GAC AAC CGT1350Tyr Ala Arg Leu Ser Tyr Asp Arg Gln Gly Il - #e Asp Leu Asp Asn Arg# 410- TTG CAG CAG ACG CAT TGC TCT CAC GAC GGT TC - #G GAT AAA AAT TGC CGT1398Leu Gln Gln Thr His Cys Ser His Asp Gly Se - #r Asp Lys Asn Cys Arg# 425- CCC GAC GGC AAT AAA CCG TAT TCT TTC TAT AA - #A TCC GAC CGG ATG ATT1446Pro Asp Gly Asn Lys Pro Tyr Ser Phe Tyr Ly - #s Ser Asp Arg Met Ile430 4 - #35 4 - #40 4 -#45- TAT GAA GAA AGC CGA AAC CTG TTC CAA GCA GT - #A TTT AAA AAG GCA TTT1494Tyr Glu Glu Ser Arg Asn Leu Phe Gln Ala Va - #l Phe Lys Lys Ala Phe# 460- GAT ACG GCC AAA ATC CGT CAC AAT TTG AGT AT - #C AAT CTA GGG TAC GAC1542Asp Thr Ala Lys Ile Arg His Asn Leu Ser Il - #e Asn Leu Gly Tyr Asp# 475- CGC TTT AAG TCG CAA TTG TCC CAC AGC GAT TA - #T TAT CTT CAA AAC GCA1590Arg Phe Lys Ser Gln Leu Ser His Ser Asp Ty - #r Tyr Leu Gln Asn Ala# 490- GTT CAG GCA TAT GAT TTG ATA ACC CCG AAA AA - #G CCT CCG TTT CCC AAC1638Val Gln Ala Tyr Asp Leu Ile Thr Pro Lys Ly - #s Pro Pro Phe Pro Asn# 505- GGA AGC AAA GAC AAC CCG TAT AGG GTG TCT AT - #C GGC AAG ACC ACG GTC1686Gly Ser Lys Asp Asn Pro Tyr Arg Val Ser Il - #e Gly Lys Thr Thr Val510 5 - #15 5 - #20 5 -#25- AAT ACA TCG CCG ATA TGC CGT TTC GGC AAT AA - #C ACC TAT ACA GAC TGC1734Asn Thr Ser Pro Ile Cys Arg Phe Gly Asn As - #n Thr Tyr Thr Asp Cys# 540- ACA CCG AGG AAT ATC GGC GGC AAC GGT TAT TA - #T GCA GCC GTT CAA GAC1782Thr Pro Arg Asn Ile Gly Gly Asn Gly Tyr Ty - #r Ala Ala Val Gln Asp# 555- AAT GTC CGT TTG GGC AGG TGG GCG GAT GTC GG - #A GCA GGC ATA CGT TAC1830Asn Val Arg Leu Gly Arg Trp Ala Asp Val Gl - #y Ala Gly Ile Arg Tyr# 570- GAT TAC CGC AGC ACG CAT TCG GAA GAT AAG AG - #T GTC TCT ACC GGC ACT1878Asp Tyr Arg Ser Thr His Ser Glu Asp Lys Se - #r Val Ser Thr Gly Thr# 585- CAC CGC AAC CTT TCT TGG AAC GCG GGC GTA GT - #C CTC AAA CCT TTC ACC1926His Arg Asn Leu Ser Trp Asn Ala Gly Val Va - #l Leu Lys Pro Phe Thr590 5 - #95 6 - #00 6 -#05- TGG ATG GAT TTG ACT TAT CGC GCT TCT ACG GG - #C TTC CGT CTG CCG TCG1974Trp Met Asp Leu Thr Tyr Arg Ala Ser Thr Gl - #y Phe Arg Leu Pro Ser# 620- TTT GCC GAA ATG TAT GGC TGG AGA GCC GGG GA - #G TCT TTG AAA ACG TTG2022Phe Ala Glu Met Tyr Gly Trp Arg Ala Gly Gl - #u Ser Leu Lys Thr Leu# 635- GAT CTG AAA CCG GAA AAA TCC TTT AAT AGA GA - #G GCA GGT ATT GTA TTT2070Asp Leu Lys Pro Glu Lys Ser Phe Asn Arg Gl - #u Ala Gly Ile Val Phe# 650- AAA GGG GAC TTC GGC AAT TTG GAA GCC AGC TA - #T TTC AAC AAT GCC TAT2118Lys Gly Asp Phe Gly Asn Leu Glu Ala Ser Ty - #r Phe Asn Asn Ala Tyr# 665- CGC GAC CTG ATT GCA TTC GGT TAT GAA ACC CG - #A ACT CAA AAC GGG CAA2166Arg Asp Leu Ile Ala Phe Gly Tyr Glu Thr Ar - #g Thr Gln Asn Gly Gln670 6 - #75 6 - #80 6 -#85- ACT TCG GCT TCT GGC GAC CCC GGA TAC CGA AA - #T GCC CAA AAT GCA CGG2214Thr Ser Ala Ser Gly Asp Pro Gly Tyr Arg As - #n Ala Gln Asn Ala Arg# 700- ATA GCC GGT ATC AAT ATT TTG GGT AAA ATC GA - #T TGG CAC GGC GTA TGG2262Ile Ala Gly Ile Asn Ile Leu Gly Lys Ile As - #p Trp His Gly Val Trp# 715- GGC GGG TTG CCG GAC GGG TTG TAT TCC ACG CT - #T GCC TAT AAC CGT ATC2310Gly Gly Leu Pro Asp Gly Leu Tyr Ser Thr Le - #u Ala Tyr Asn Arg Ile# 730- AAG GTC AAA GAT GCC GAT ATA CGC GCC GAC AG - #G ACG TTT GTA ACT TCA2358Lys Val Lys Asp Ala Asp Ile Arg Ala Asp Ar - #g Thr Phe Val Thr Ser# 745- TAT CTC TTT GAT GCC GTC CAA CCT TCA CGA TA - #T GTA TTG GGT TTG GGT2406Tyr Leu Phe Asp Ala Val Gln Pro Ser Arg Ty - #r Val Leu Gly Leu Gly750 7 - #55 7 - #60 7 -#65- TAC GAC CAT CCT GAC GGA ATA TGG GGC ATC AA - #T ACG ATG TTT ACT TAT2454Tyr Asp His Pro Asp Gly Ile Trp Gly Ile As - #n Thr Met Phe Thr Tyr# 780- TCC AAG GCA AAA TCT GTT GAC GAA CTG CTC GG - #C AGC CAG GCG CTG TTG2502Ser Lys Ala Lys Ser Val Asp Glu Leu Leu Gl - #y Ser Gln Ala Leu Leu# 795- AAC GGT AAT GCC AAT GCT AAA AAA GCA GCA TC - #A CGG CGG ACG CGG CCT2550Asn Gly Asn Ala Asn Ala Lys Lys Ala Ala Se - #r Arg Arg Thr Arg Pro# 810- TGG TAT GTT ACG GAT GTT TCC GGA TAT TAC AA - #T ATC AAG AAA CAC CTG2598Trp Tyr Val Thr Asp Val Ser Gly Tyr Tyr As - #n Ile Lys Lys His Leu# 825- ACC CTG CGC GCA GGT GTG TAC AAC CTC CTC AA - #C TAC CGC TAT GTT ACT2646Thr Leu Arg Ala Gly Val Tyr Asn Leu Leu As - #n Tyr Arg Tyr Val Thr830 8 - #35 8 - #40 8 -#45- TGG GAA AAT GTG CGG CAA ACT GCC GGC GGC GC - #A GTC AAC CAA CAC AAA2694Trp Glu Asn Val Arg Gln Thr Ala Gly Gly Al - #a Val Asn Gln His Lys# 860- AAT GTC GGC GTT TAC AAC CGA TAT GCC GCC CC - #C GGC CGA AAC TAC ACA2742Asn Val Gly Val Tyr Asn Arg Tyr Ala Ala Pr - #o Gly Arg Asn Tyr Thr# 875- TTT AGC TTG GAA ATG AAG TTT TAAACGTCCA AACGCCGCA - #A ATGCCGTCTG2793Phe Ser Leu Glu Met Lys Phe 880# 2800- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 908 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Met Gln Gln Gln His Leu Phe Arg Leu Asn Il - #e Leu Cys Leu Ser Leu10- Met Thr Ala Leu Pro Val Tyr Ala Glu Asn Va - #l Gln Ala Glu Gln Ala# 5 1- Gln Glu Lys Gln Leu Asp Thr Ile Gln Val Ly - #s Ala Lys Lys Gln Lys# 20- Thr Arg Arg Asp Asn Glu Val Thr Gly Leu Gl - #y Lys Leu Val Lys Ser# 40- Ser Asp Thr Leu Ser Lys Glu Gln Val Leu As - #n Ile Arg Asp Leu Thr# 55- Arg Tyr Asp Pro Gly Ile Ala Val Val Glu Gl - #n Gly Arg Gly Ala Ser# 70- Ser Gly Tyr Ser Ile Arg Gly Met Asp Lys As - #n Arg Val Ser Leu Thr# 85- Val Asp Gly Val Ser Gln Ile Gln Ser Tyr Th - #r Ala Gln Ala Ala Leu# 100- Gly Gly Thr Arg Thr Ala Gly Ser Ser Gly Al - #a Ile Asn Glu Ile Glu105 1 - #10 1 - #15 1 -#20- Tyr Glu Asn Val Lys Ala Val Glu Ile Ser Ly - #s Gly Ser Asn Ser Ser# 135- Glu Tyr Gly Asn Gly Ala Leu Ala Gly Ser Va - #l Ala Phe Gln Thr Lys# 150- Thr Ala Ala Asp Ile Ile Gly Glu Gly Lys Gl - #n Trp Gly Ile Gln Ser# 165- Lys Thr Ala Tyr Ser Gly Lys Asp His Ala Le - #u Thr Gln Ser Leu Ala# 180- Leu Ala Gly Arg Ser Gly Gly Ala Glu Ala Le - #u Leu Ile Tyr Thr Lys185 1 - #90 1 - #95 2 -#00- Arg Arg Gly Arg Glu Ile His Ala His Lys As - #p Ala Gly Lys Gly Val# 215- Gln Ser Phe Asn Arg Leu Val Leu Asp Glu As - #p Lys Lys Glu Gly Gly# 230- Ser Gln Tyr Arg Tyr Phe Ile Val Glu Glu Gl - #u Cys His Asn Gly Tyr# 245- Ala Ala Cys Lys Asn Lys Leu Lys Glu Asp Al - #a Ser Val Lys Asp Glu# 260- Arg Lys Thr Val Ser Thr Gln Asp Tyr Thr Gl - #y Ser Asn Arg Leu Leu265 2 - #70 2 - #75 2 -#80- Ala Asn Pro Leu Glu Tyr Gly Ser Gln Ser Tr - #p Leu Phe Arg Pro Gly# 295- Trp His Leu Asp Asn Arg His Tyr Val Gly Al - #a Val Leu Glu Arg Thr# 310- Gln Gln Thr Phe Asp Thr Arg Asp Met Thr Va - #l Pro Ala Tyr Phe Thr# 325- Ser Glu Asp Tyr Val Pro Gly Ser Leu Lys Gl - #y Leu Gly Lys Tyr Ser# 340- Gly Asp Asn Lys Ala Glu Arg Leu Phe Val Gl - #n Gly Glu Gly Ser Thr345 3 - #50 3 - #55 3 -#60- Leu Gln Gly Ile Gly Tyr Gly Thr Gly Val Ph - #e Tyr Asp Glu Arg His# 375- Thr Lys Asn Arg Tyr Gly Val Glu Tyr Val Ty - #r His Asn Ala Asp Lys# 390- Asp Thr Trp Ala Asp Tyr Ala Arg Leu Ser Ty - #r Asp Arg Gln Gly Ile# 405- Asp Leu Asp Asn Arg Leu Gln Gln Thr His Cy - #s Ser His Asp Gly Ser# 420- Asp Lys Asn Cys Arg Pro Asp Gly Asn Lys Pr - #o Tyr Ser Phe Tyr Lys425 4 - #30 4 - #35 4 -#40- Ser Asp Arg Met Ile Tyr Glu Glu Ser Arg As - #n Leu Phe Gln Ala Val# 455- Phe Lys Lys Ala Phe Asp Thr Ala Lys Ile Ar - #g His Asn Leu Ser Ile# 470- Asn Leu Gly Tyr Asp Arg Phe Lys Ser Gln Le - #u Ser His Ser Asp Tyr# 485- Tyr Leu Gln Asn Ala Val Gln Ala Tyr Asp Le - #u Ile Thr Pro Lys Lys# 500- Pro Pro Phe Pro Asn Gly Ser Lys Asp Asn Pr - #o Tyr Arg Val Ser Ile505 5 - #10 5 - #15 5 -#20- Gly Lys Thr Thr Val Asn Thr Ser Pro Ile Cy - #s Arg Phe Gly Asn Asn# 535- Thr Tyr Thr Asp Cys Thr Pro Arg Asn Ile Gl - #y Gly Asn Gly Tyr Tyr# 550- Ala Ala Val Gln Asp Asn Val Arg Leu Gly Ar - #g Trp Ala Asp Val Gly# 565- Ala Gly Ile Arg Tyr Asp Tyr Arg Ser Thr Hi - #s Ser Glu Asp Lys Ser# 580- Val Ser Thr Gly Thr His Arg Asn Leu Ser Tr - #p Asn Ala Gly Val Val585 5 - #90 5 - #95 6 -#00- Leu Lys Pro Phe Thr Trp Met Asp Leu Thr Ty - #r Arg Ala Ser Thr Gly# 615- Phe Arg Leu Pro Ser Phe Ala Glu Met Tyr Gl - #y Trp Arg Ala Gly Glu# 630- Ser Leu Lys Thr Leu Asp Leu Lys Pro Glu Ly - #s Ser Phe Asn Arg Glu# 645- Ala Gly Ile Val Phe Lys Gly Asp Phe Gly As - #n Leu Glu Ala Ser Tyr# 660- Phe Asn Asn Ala Tyr Arg Asp Leu Ile Ala Ph - #e Gly Tyr Glu Thr Arg665 6 - #70 6 - #75 6 -#80- Thr Gln Asn Gly Gln Thr Ser Ala Ser Gly As - #p Pro Gly Tyr Arg Asn# 695- Ala Gln Asn Ala Arg Ile Ala Gly Ile Asn Il - #e Leu Gly Lys Ile Asp# 710- Trp His Gly Val Trp Gly Gly Leu Pro Asp Gl - #y Leu Tyr Ser Thr Leu# 725- Ala Tyr Asn Arg Ile Lys Val Lys Asp Ala As - #p Ile Arg Ala Asp Arg# 740- Thr Phe Val Thr Ser Tyr Leu Phe Asp Ala Va - #l Gln Pro Ser Arg Tyr745 7 - #50 7 - #55 7 -#60- Val Leu Gly Leu Gly Tyr Asp His Pro Asp Gl - #y Ile Trp Gly Ile Asn# 775- Thr Met Phe Thr Tyr Ser Lys Ala Lys Ser Va - #l Asp Glu Leu Leu Gly# 790- Ser Gln Ala Leu Leu Asn Gly Asn Ala Asn Al - #a Lys Lys Ala Ala Ser# 805- Arg Arg Thr Arg Pro Trp Tyr Val Thr Asp Va - #l Ser Gly Tyr Tyr Asn# 820- Ile Lys Lys His Leu Thr Leu Arg Ala Gly Va - #l Tyr Asn Leu Leu Asn825 8 - #30 8 - #35 8 -#40- Tyr Arg Tyr Val Thr Trp Glu Asn Val Arg Gl - #n Thr Ala Gly Gly Ala# 855- Val Asn Gln His Lys Asn Val Gly Val Tyr As - #n Arg Tyr Ala Ala Pro# 870- Gly Arg Asn Tyr Thr Phe Ser Leu Glu Met Ly - #s Phe# 880- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2809 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA which - # encodes Tbp1 subunit of transferrin receptor (B) STRAIN: Neisseria m - #eningitidis IM2169- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 71..142- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 143..2803- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 71..2803- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- ATCAAGAATA AGGCTTCAGA CGGCATCGCT CCTTCCGATA CCGTCTGAAA GC - #GAAGATTA 60- GGGAAACATT ATG CAA CAG CAA CAT TTG TTC CGA TT - #A AAT ATT TTA TGC 109#His Leu Phe Arg Leu Asn Ile Leu Cys15- CTG TCG CTG ATG ACT GCG CTG CCT GCT TAT GC - #A GAA AAT GTG CAA GCC 157Leu Ser Leu Met Thr Ala Leu Pro Ala Tyr Al - #a Glu Asn Val Gln Ala# 5 1- GGA CAA GCA CAG GAA AAA CAG TTG GAT ACC AT - #A CAG GTA AAA GCC AAA 205Gly Gln Ala Gln Glu Lys Gln Leu Asp Thr Il - #e Gln Val Lys Ala Lys# 20- AAA CAG AAA ACC CGC CGC GAT AAC GAA GTA AC - #C GGT CTG GGC AAA TTG 253Lys Gln Lys Thr Arg Arg Asp Asn Glu Val Th - #r Gly Leu Gly Lys Leu# 35- GTC AAA ACC GCC GAC ACC CTC AGC AAG GAA CA - #G GTA CTC GAT ATC CGC 301Val Lys Thr Ala Asp Thr Leu Ser Lys Glu Gl - #n Val Leu Asp Ile Arg# 50- GAC CTG ACG CGT TAC GAC CCC GGC ATC GCC GT - #G GTC GAA CAG GGG CGC 349Asp Leu Thr Arg Tyr Asp Pro Gly Ile Ala Va - #l Val Glu Gln Gly Arg# 65- GGC GCA AGT TCG GGC TAC TCG ATA CGC GGT AT - #G GAC AAA AAC CGC GTT 397Gly Ala Ser Ser Gly Tyr Ser Ile Arg Gly Me - #t Asp Lys Asn Arg Val# 85- TCC TTG ACG GTG GAC GGC TTG GCG CAA ATA CA - #G TCC TAC ACC GCG CAG 445Ser Leu Thr Val Asp Gly Leu Ala Gln Ile Gl - #n Ser Tyr Thr Ala Gln# 100- GCG GCA TTG GGC GGG ACG AGG ACG GCG GGC AG - #C AGC GGC GCA ATC AAT 493Ala Ala Leu Gly Gly Thr Arg Thr Ala Gly Se - #r Ser Gly Ala Ile Asn# 115- GAA ATC GAG TAT GAA AAC GTC AAA GCT GTC GA - #A ATC AGC AAA GGC TCA 541Glu Ile Glu Tyr Glu Asn Val Lys Ala Val Gl - #u Ile Ser Lys Gly Ser# 130- AAC TCG GTC GAA CAA GGC AGC GGC GCA TTG GC - #G GGT TCG GTC GCA TTT 589Asn Ser Val Glu Gln Gly Ser Gly Ala Leu Al - #a Gly Ser Val Ala Phe# 145- CAA ACC AAA ACC GCC GAC GAT GTT ATC GGG GA - #A GGC AGG CAG TGG GGC 637Gln Thr Lys Thr Ala Asp Asp Val Ile Gly Gl - #u Gly Arg Gln Trp Gly150 1 - #55 1 - #60 1 -#65- ATT CAG AGT AAA ACC GCC TAT TCC GGC AAA AA - #C CGG GGG CTT ACC CAA 685Ile Gln Ser Lys Thr Ala Tyr Ser Gly Lys As - #n Arg Gly Leu Thr Gln# 180- TCC ATC GCG CTG GCG GGG CGC ATC GGC GGT GC - #G GAG GCT TTG CTG ATC 733Ser Ile Ala Leu Ala Gly Arg Ile Gly Gly Al - #a Glu Ala Leu Leu Ile# 195- CAC ACC GGG CGG CGC GCG GGG GAA ATC CGC GC - #A CAC GAA GAT GCC GGA 781His Thr Gly Arg Arg Ala Gly Glu Ile Arg Al - #a His Glu Asp Ala Gly# 210- CGC GGC GTT CAG AGC TTT AAC AGG CTG GTG CC - #G GTT GAA GAC AGC AGC 829Arg Gly Val Gln Ser Phe Asn Arg Leu Val Pr - #o Val Glu Asp Ser Ser# 225- GAA TAC GCC TAT TTC ATC GTT GAA GAT GAA TG - #C GAA GGC AAA AAT TAC 877Glu Tyr Ala Tyr Phe Ile Val Glu Asp Glu Cy - #s Glu Gly Lys Asn Tyr230 2 - #35 2 - #40 2 -#45- GAA ACG TGT AAA AGC AAA CCG AAA AAA GAT GT - #T GTC GGC AAA GAC GAA 925Glu Thr Cys Lys Ser Lys Pro Lys Lys Asp Va - #l Val Gly Lys Asp Glu# 260- CGT CAA ACG GTT TCC ACC CGA GAC TAC ACG GG - #C CCC AAC CGC TTC CTC 973Arg Gln Thr Val Ser Thr Arg Asp Tyr Thr Gl - #y Pro Asn Arg Phe Leu# 275- GCC GAT CCG CTT TCA TAC GAA AGC CGA TCG TG - #G CTG TTC CGC CCG GGT1021Ala Asp Pro Leu Ser Tyr Glu Ser Arg Ser Tr - #p Leu Phe Arg Pro Gly# 290- TTT CGT TTT GAA AAC AAA CGG CAC TAC ATC GG - #C GGC ATA CTC GAA CAC1069Phe Arg Phe Glu Asn Lys Arg His Tyr Ile Gl - #y Gly Ile Leu Glu His# 305- ACG CAA CAA ACT TTC GAC ACG CGC GAT ATG AC - #G GTT CCG GCA TTC CTG1117Thr Gln Gln Thr Phe Asp Thr Arg Asp Met Th - #r Val Pro Ala Phe Leu310 3 - #15 3 - #20 3 -#25- ACC AAG GCG GTT TTT GAT GCA AAT TCA AAA CA - #G GCG GGT TCT TTG CCC1165Thr Lys Ala Val Phe Asp Ala Asn Ser Lys Gl - #n Ala Gly Ser Leu Pro# 340- GGC AAC GGC AAA TAC GCG GGC AAC CAC AAA TA - #C GGC GGA CTG TTT ACC1213Gly Asn Gly Lys Tyr Ala Gly Asn His Lys Ty - #r Gly Gly Leu Phe Thr# 355- AAC GGC GAA AAC GGT GCG CTG GTG GGC GCG GA - #A TAC GGT ACG GGC GTG1261Asn Gly Glu Asn Gly Ala Leu Val Gly Ala Gl - #u Tyr Gly Thr Gly Val# 370- TTT TAC GAC GAG ACG CAC ACC AAA AGC CGC TA - #C GGT TTG GAA TAT GTC1309Phe Tyr Asp Glu Thr His Thr Lys Ser Arg Ty - #r Gly Leu Glu Tyr Val# 385- TAT ACC AAT GCC GAT AAA GAC ACT TGG GCG GA - #T TAT GCC CGC CTC TCT1357Tyr Thr Asn Ala Asp Lys Asp Thr Trp Ala As - #p Tyr Ala Arg Leu Ser390 3 - #95 4 - #00 4 -#05- TAC GAC CGG CAG GGC ATC GGT TTG GAC AAT CA - #T TTT CAG CAG ACG CAC1405Tyr Asp Arg Gln Gly Ile Gly Leu Asp Asn Hi - #s Phe Gln Gln Thr His# 420- TGT TCT GCC GAC GGT TCG GAC AAA TAT TGC CG - #C CCG AGT GCC GAC AAG1453Cys Ser Ala Asp Gly Ser Asp Lys Tyr Cys Ar - #g Pro Ser Ala Asp Lys# 435- CCG TTT TCC TAT TAC AAA TCC GAC CGC GTG AT - #T TAC GGG GAA AGC CAC1501Pro Phe Ser Tyr Tyr Lys Ser Asp Arg Val Il - #e Tyr Gly Glu Ser His# 450- AGG CTC TTG CAG GCG GCA TTC AAA AAA TCC TT - #C GAT ACC GCC AAA ATC1549Arg Leu Leu Gln Ala Ala Phe Lys Lys Ser Ph - #e Asp Thr Ala Lys Ile# 465- CGC CAC AAC CTG AGC GTG AAT CTC GGG TTT GA - #C CGC TTT GAC TCT AAT1597Arg His Asn Leu Ser Val Asn Leu Gly Phe As - #p Arg Phe Asp Ser Asn470 4 - #75 4 - #80 4 -#85- CTC CGC CAT CAG GAT TAT TAT TAT CAA CAT GC - #C AAC CGC GCC TAT TCG1645Leu Arg His Gln Asp Tyr Tyr Tyr Gln His Al - #a Asn Arg Ala Tyr Ser# 500- TCG AAA ACG CCC CCT AAA ACC GCC AAC CCC AA - #C GGC GAC AAG AGC AAA1693Ser Lys Thr Pro Pro Lys Thr Ala Asn Pro As - #n Gly Asp Lys Ser Lys# 515- CCC TAT TGG GTC AGC ATA GGC GGG GGA AAT GT - #G GTT ACG GGG CAA ATC1741Pro Tyr Trp Val Ser Ile Gly Gly Gly Asn Va - #l Val Thr Gly Gln Ile# 530- TGC CTC TTT GGC AAC AAT ACT TAT ACG GAC TG - #C ACG CCG CGC AGC ATC1789Cys Leu Phe Gly Asn Asn Thr Tyr Thr Asp Cy - #s Thr Pro Arg Ser Ile# 545- AAC GGC AAA AGC TAT TAC GCG GCA GTT CGG GA - #C AAT GTC CGT TTG GGC1837Asn Gly Lys Ser Tyr Tyr Ala Ala Val Arg As - #p Asn Val Arg Leu Gly550 5 - #55 5 - #60 5 -#65- AGG TGG GCG GAT GTC GGC GCG GGG TTG CGC TA - #C GAC TAC CGC AGC ACG1885Arg Trp Ala Asp Val Gly Ala Gly Leu Arg Ty - #r Asp Tyr Arg Ser Thr# 580- CAT TCG GAC GAC GGC AGC GTT TCC ACC GGC AC - #G CAC CGC ACC CTG TCC1933His Ser Asp Asp Gly Ser Val Ser Thr Gly Th - #r His Arg Thr Leu Ser# 595- TGG AAC GCC GGC ATC GTC CTC AAA CCT GCC GA - #C TGG CTG GAT TTG ACT1981Trp Asn Ala Gly Ile Val Leu Lys Pro Ala As - #p Trp Leu Asp Leu Thr# 610- TAC CGC ACT TCA ACC GGC TTC CGC CTG CCC TC - #G TTT GCG GAA ATG TAC2029Tyr Arg Thr Ser Thr Gly Phe Arg Leu Pro Se - #r Phe Ala Glu Met Tyr# 625- GGC TGG CGG TCG GGT GTT CAA AGC AAG GCG GT - #C AAA ATC GAT CCG GAA2077Gly Trp Arg Ser Gly Val Gln Ser Lys Ala Va - #l Lys Ile Asp Pro Glu630 6 - #35 6 - #40 6 -#45- AAA TCG TTC AAC AAA GAA GCC GGC ATC GTG TT - #T AAA GGC GAT TTC GGC2125Lys Ser Phe Asn Lys Glu Ala Gly Ile Val Ph - #e Lys Gly Asp Phe Gly# 660- AAC TTG GAG GCA AGT TGG TTC AAC AAT GCC TA - #C CGC GAT TTG ATT GTC2173Asn Leu Glu Ala Ser Trp Phe Asn Asn Ala Ty - #r Arg Asp Leu Ile Val# 675- CGG GGT TAT GAA GCG CAA ATT AAA AAC GGC AA - #A GAA GAA GCC AAA GGC2221Arg Gly Tyr Glu Ala Gln Ile Lys Asn Gly Ly - #s Glu Glu Ala Lys Gly# 690- GAC CCG GCT TAC CTC AAT GCC CAA AGC GCG CG - #G ATT ACC GGC ATC AAT2269Asp Pro Ala Tyr Leu Asn Ala Gln Ser Ala Ar - #g Ile Thr Gly Ile Asn# 705- ATT TTG GGC AAA ATC GAT TGG AAC GGC GTA TG - #G GAT AAA TTG CCC GAA2317Ile Leu Gly Lys Ile Asp Trp Asn Gly Val Tr - #p Asp Lys Leu Pro Glu710 7 - #15 7 - #20 7 -#25- GGT TGG TAT TCT ACA TTT GCC TAT AAT CGT GT - #C CAT GTC CGC GAC ATC2365Gly Trp Tyr Ser Thr Phe Ala Tyr Asn Arg Va - #l His Val Arg Asp Ile# 740- AAA AAA CGC GCA GAC CGC ACC GAT ATT CAA TC - #A CAC CTG TTT GAT GCC2413Lys Lys Arg Ala Asp Arg Thr Asp Ile Gln Se - #r His Leu Phe Asp Ala# 755- ATC CAA CCC TCG CGC TAT GTC GTC GGC TTG GG - #C TAT GAC CAA CCG GAA2461Ile Gln Pro Ser Arg Tyr Val Val Gly Leu Gl - #y Tyr Asp Gln Pro Glu# 770- GGC AAA TGG GGT GTG AAC GGT ATG CTG ACT TA - #T TCC AAA GCC AAG GAA2509Gly Lys Trp Gly Val Asn Gly Met Leu Thr Ty - #r Ser Lys Ala Lys Glu# 785- ATC ACA GAG TTG TTG GGC AGC CGG GCT TTG CT - #C AAC GGC AAC AGC CGC2557Ile Thr Glu Leu Leu Gly Ser Arg Ala Leu Le - #u Asn Gly Asn Ser Arg790 7 - #95 8 - #00 8 -#05- AAT ACA AAA GCC ACC GCG CGC CGT ACC CGC CC - #T TGG TAT ATT GTG GAT2605Asn Thr Lys Ala Thr Ala Arg Arg Thr Arg Pr - #o Trp Tyr Ile Val Asp# 820- GTG TCC GGT TAT TAC ACG ATT AAA AAA CAC TT - #C ACC CTC CGT GCG GGC2653Val Ser Gly Tyr Tyr Thr Ile Lys Lys His Ph - #e Thr Leu Arg Ala Gly# 835- GTG TAC AAC CTC CTC AAC TAC CGC TAT GTT AC - #T TGG GAA AAT GTG CGG2701Val Tyr Asn Leu Leu Asn Tyr Arg Tyr Val Th - #r Trp Glu Asn Val Arg# 850- CAA ACT GCC GGC GGC GCA GTC AAC CAA CAC AA - #A AAT GTC GGC GTT TAC2749Gln Thr Ala Gly Gly Ala Val Asn Gln His Ly - #s Asn Val Gly Val Tyr# 865- AAC CGA TAT GCC GCC CCC GGC CGA AAC TAC AC - #A TTT AGC TTG GAA ATG2797Asn Arg Tyr Ala Ala Pro Gly Arg Asn Tyr Th - #r Phe Ser Leu Glu Met870 8 - #75 8 - #80 8 -#85# 2809Lys Phe- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 911 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Gln Gln Gln His Leu Phe Arg Leu Asn Il - #e Leu Cys Leu Ser Leu10- Met Thr Ala Leu Pro Ala Tyr Ala Glu Asn Va - #l Gln Ala Gly Gln Ala# 5 1- Gln Glu Lys Gln Leu Asp Thr Ile Gln Val Ly - #s Ala Lys Lys Gln Lys# 20- Thr Arg Arg Asp Asn Glu Val Thr Gly Leu Gl - #y Lys Leu Val Lys Thr# 40- Ala Asp Thr Leu Ser Lys Glu Gln Val Leu As - #p Ile Arg Asp Leu Thr# 55- Arg Tyr Asp Pro Gly Ile Ala Val Val Glu Gl - #n Gly Arg Gly Ala Ser# 70- Ser Gly Tyr Ser Ile Arg Gly Met Asp Lys As - #n Arg Val Ser Leu Thr# 85- Val Asp Gly Leu Ala Gln Ile Gln Ser Tyr Th - #r Ala Gln Ala Ala Leu# 100- Gly Gly Thr Arg Thr Ala Gly Ser Ser Gly Al - #a Ile Asn Glu Ile Glu105 1 - #10 1 - #15 1 -#20- Tyr Glu Asn Val Lys Ala Val Glu Ile Ser Ly - #s Gly Ser Asn Ser Val# 135- Glu Gln Gly Ser Gly Ala Leu Ala Gly Ser Va - #l Ala Phe Gln Thr Lys# 150- Thr Ala Asp Asp Val Ile Gly Glu Gly Arg Gl - #n Trp Gly Ile Gln Ser# 165- Lys Thr Ala Tyr Ser Gly Lys Asn Arg Gly Le - #u Thr Gln Ser Ile Ala# 180- Leu Ala Gly Arg Ile Gly Gly Ala Glu Ala Le - #u Leu Ile His Thr Gly185 1 - #90 1 - #95 2 -#00- Arg Arg Ala Gly Glu Ile Arg Ala His Glu As - #p Ala Gly Arg Gly Val# 215- Gln Ser Phe Asn Arg Leu Val Pro Val Glu As - #p Ser Ser Glu Tyr Ala# 230- Tyr Phe Ile Val Glu Asp Glu Cys Glu Gly Ly - #s Asn Tyr Glu Thr Cys# 245- Lys Ser Lys Pro Lys Lys Asp Val Val Gly Ly - #s Asp Glu Arg Gln Thr# 260- Val Ser Thr Arg Asp Tyr Thr Gly Pro Asn Ar - #g Phe Leu Ala Asp Pro265 2 - #70 2 - #75 2 -#80- Leu Ser Tyr Glu Ser Arg Ser Trp Leu Phe Ar - #g Pro Gly Phe Arg Phe# 295- Glu Asn Lys Arg His Tyr Ile Gly Gly Ile Le - #u Glu His Thr Gln Gln# 310- Thr Phe Asp Thr Arg Asp Met Thr Val Pro Al - #a Phe Leu Thr Lys Ala# 325- Val Phe Asp Ala Asn Ser Lys Gln Ala Gly Se - #r Leu Pro Gly Asn Gly# 340- Lys Tyr Ala Gly Asn His Lys Tyr Gly Gly Le - #u Phe Thr Asn Gly Glu345 3 - #50 3 - #55 3 -#60- Asn Gly Ala Leu Val Gly Ala Glu Tyr Gly Th - #r Gly Val Phe Tyr Asp# 375- Glu Thr His Thr Lys Ser Arg Tyr Gly Leu Gl - #u Tyr Val Tyr Thr Asn# 390- Ala Asp Lys Asp Thr Trp Ala Asp Tyr Ala Ar - #g Leu Ser Tyr Asp Arg# 405- Gln Gly Ile Gly Leu Asp Asn His Phe Gln Gl - #n Thr His Cys Ser Ala# 420- Asp Gly Ser Asp Lys Tyr Cys Arg Pro Ser Al - #a Asp Lys Pro Phe Ser425 4 - #30 4 - #35 4 -#40- Tyr Tyr Lys Ser Asp Arg Val Ile Tyr Gly Gl - #u Ser His Arg Leu Leu# 455- Gln Ala Ala Phe Lys Lys Ser Phe Asp Thr Al - #a Lys Ile Arg His Asn# 470- Leu Ser Val Asn Leu Gly Phe Asp Arg Phe As - #p Ser Asn Leu Arg His# 485- Gln Asp Tyr Tyr Tyr Gln His Ala Asn Arg Al - #a Tyr Ser Ser Lys Thr# 500- Pro Pro Lys Thr Ala Asn Pro Asn Gly Asp Ly - #s Ser Lys Pro Tyr Trp505 5 - #10 5 - #15 5 -#20- Val Ser Ile Gly Gly Gly Asn Val Val Thr Gl - #y Gln Ile Cys Leu Phe# 535- Gly Asn Asn Thr Tyr Thr Asp Cys Thr Pro Ar - #g Ser Ile Asn Gly Lys# 550- Ser Tyr Tyr Ala Ala Val Arg Asp Asn Val Ar - #g Leu Gly Arg Trp Ala# 565- Asp Val Gly Ala Gly Leu Arg Tyr Asp Tyr Ar - #g Ser Thr His Ser Asp# 580- Asp Gly Ser Val Ser Thr Gly Thr His Arg Th - #r Leu Ser Trp Asn Ala585 5 - #90 5 - #95 6 -#00- Gly Ile Val Leu Lys Pro Ala Asp Trp Leu As - #p Leu Thr Tyr Arg Thr# 615- Ser Thr Gly Phe Arg Leu Pro Ser Phe Ala Gl - #u Met Tyr Gly Trp Arg# 630- Ser Gly Val Gln Ser Lys Ala Val Lys Ile As - #p Pro Glu Lys Ser Phe# 645- Asn Lys Glu Ala Gly Ile Val Phe Lys Gly As - #p Phe Gly Asn Leu Glu# 660- Ala Ser Trp Phe Asn Asn Ala Tyr Arg Asp Le - #u Ile Val Arg Gly Tyr665 6 - #70 6 - #75 6 -#80- Glu Ala Gln Ile Lys Asn Gly Lys Glu Glu Al - #a Lys Gly Asp Pro Ala# 695- Tyr Leu Asn Ala Gln Ser Ala Arg Ile Thr Gl - #y Ile Asn Ile Leu Gly# 710- Lys Ile Asp Trp Asn Gly Val Trp Asp Lys Le - #u Pro Glu Gly Trp Tyr# 725- Ser Thr Phe Ala Tyr Asn Arg Val His Val Ar - #g Asp Ile Lys Lys Arg# 740- Ala Asp Arg Thr Asp Ile Gln Ser His Leu Ph - #e Asp Ala Ile Gln Pro745 7 - #50 7 - #55 7 -#60- Ser Arg Tyr Val Val Gly Leu Gly Tyr Asp Gl - #n Pro Glu Gly Lys Trp# 775- Gly Val Asn Gly Met Leu Thr Tyr Ser Lys Al - #a Lys Glu Ile Thr Glu# 790- Leu Leu Gly Ser Arg Ala Leu Leu Asn Gly As - #n Ser Arg Asn Thr Lys# 805- Ala Thr Ala Arg Arg Thr Arg Pro Trp Tyr Il - #e Val Asp Val Ser Gly# 820- Tyr Tyr Thr Ile Lys Lys His Phe Thr Leu Ar - #g Ala Gly Val Tyr Asn825 8 - #30 8 - #35 8 -#40- Leu Leu Asn Tyr Arg Tyr Val Thr Trp Glu As - #n Val Arg Gln Thr Ala# 855- Gly Gly Ala Val Asn Gln His Lys Asn Val Gl - #y Val Tyr Asn Arg Tyr# 870- Ala Ala Pro Gly Arg Asn Tyr Thr Phe Ser Le - #u Glu Met Lys Phe# 885- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2230 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (vi) ORIGINAL SOURCE: (A) ORGANISM: DNA which - # encodes Tbp2 subunit of transferrin receptor (B) STRAIN: Neisseria m - #eningitidis IM2169- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 60..119- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 120..2192- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 60..2192- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- ATTTGTTAAA AATAAATAAA ATAATAATCC TTATCATTCT TTAATTGAAT TG - #GGTTTAT 59- ATG AAC AAT CCA TTG GTA AAT CAG GCT GCT AT - #G GTG CTG CCT GTG TTT 107Met Asn Asn Pro Leu Val Asn Gln Ala Ala Me - #t Val Leu Pro Val Phe#-510- TTG TTG AGT GCC TGT CTG GGC GGC GGC GGC AG - #T TTC GAT CTT GAT TCT 155Leu Leu Ser Ala Cys Leu Gly Gly Gly Gly Se - #r Phe Asp Leu Asp Ser# 10- GTC GAT ACC GAA GCC CCG CGT CCC GCG CCA AA - #G TAT CAA GAT GTT TCT 203Val Asp Thr Glu Ala Pro Arg Pro Ala Pro Ly - #s Tyr Gln Asp Val Ser# 25- TCC GAA AAA CCG CAA GCC CAA AAA GAC CAA GG - #C GGA TAC GGT TTT GCG 251Ser Glu Lys Pro Gln Ala Gln Lys Asp Gln Gl - #y Gly Tyr Gly Phe Ala# 40- ATG AGG TTG AAA CGG AGG AAT TGG TAT CCG GG - #G GCA GAA GAA AGC GAG 299Met Arg Leu Lys Arg Arg Asn Trp Tyr Pro Gl - #y Ala Glu Glu Ser Glu# 60- GTT AAA CTG AAC GAG AGT GAT TGG GAG GCG AC - #G GGA TTG CCG ACA AAA 347Val Lys Leu Asn Glu Ser Asp Trp Glu Ala Th - #r Gly Leu Pro Thr Lys# 75- CCC AAG GAA CTT CCT AAA CGG CAA AAA TCG GT - #T ATT GAA AAA GTA GAA 395Pro Lys Glu Leu Pro Lys Arg Gln Lys Ser Va - #l Ile Glu Lys Val Glu# 90- ACA GAC GGC GAC AGC GAT ATT TAT TCT TCC CC - #C TAT CTC ACA CCA TCA 443Thr Asp Gly Asp Ser Asp Ile Tyr Ser Ser Pr - #o Tyr Leu Thr Pro Ser# 105- AAC CAT CAA AAC GGC AGC GCT GGC AAC GGT GT - #A AAT CAA CCT AAA AAT 491Asn His Gln Asn Gly Ser Ala Gly Asn Gly Va - #l Asn Gln Pro Lys Asn# 120- CAG GCA ACA GGT CAC GAA AAT TTC CAA TAT GT - #T TAT TCC GGT TGG TTT 539Gln Ala Thr Gly His Glu Asn Phe Gln Tyr Va - #l Tyr Ser Gly Trp Phe125 1 - #30 1 - #35 1 -#40- TAT AAA CAT GCA GCG AGT GAA AAA GAT TTC AG - #T AAC AAA AAA ATT AAG 587Tyr Lys His Ala Ala Ser Glu Lys Asp Phe Se - #r Asn Lys Lys Ile Lys# 155- TCA GGC GAC GAT GGT TAT ATC TTC TAT CAC GG - #T GAA AAA CCT TCC CGA 635Ser Gly Asp Asp Gly Tyr Ile Phe Tyr His Gl - #y Glu Lys Pro Ser Arg# 170- CAA CTT CCT GCT TCT GGA AAA GTT ATC TAC AA - #A GGT GTG TGG CAT TTT 683Gln Leu Pro Ala Ser Gly Lys Val Ile Tyr Ly - #s Gly Val Trp His Phe# 185- GTA ACC GAT ACA AAA AAG GGT CAA GAT TTT CG - #T GAA ATT ATC CAG CCT 731Val Thr Asp Thr Lys Lys Gly Gln Asp Phe Ar - #g Glu Ile Ile Gln Pro# 200- TCA AAA AAA CAA GGC GAC AGG TAT AGC GGA TT - #T TCT GGT GAT GGC AGC 779Ser Lys Lys Gln Gly Asp Arg Tyr Ser Gly Ph - #e Ser Gly Asp Gly Ser205 2 - #10 2 - #15 2 -#20- GAA GAA TAT TCC AAC AAA AAG GAA TCC ACG CT - #G AAA GAT GAT CAC GAG 827Glu Glu Tyr Ser Asn Lys Lys Glu Ser Thr Le - #u Lys Asp Asp His Glu# 235- GGT TAT GGT TTT ACC TCG AAT TTA GAA GTG GA - #T TTC GGC AAT AAG AAA 875Gly Tyr Gly Phe Thr Ser Asn Leu Glu Val As - #p Phe Gly Asn Lys Lys# 250- TTG ACG GGT AAA TTA ATA CGC AAT AAT GCG AG - #C CTA AAT AAT AAT ACT 923Leu Thr Gly Lys Leu Ile Arg Asn Asn Ala Se - #r Leu Asn Asn Asn Thr# 265- AAT AAT GAC AAA CAT ACC ACC CAA TAC TAC AG - #C CTT GAT GCA CAA ATA 971Asn Asn Asp Lys His Thr Thr Gln Tyr Tyr Se - #r Leu Asp Ala Gln Ile# 280- ACA GGC AAC CGC TTC AAC GGC ACG GCA ACG GC - #A ACT GAC AAA AAA GAG1019Thr Gly Asn Arg Phe Asn Gly Thr Ala Thr Al - #a Thr Asp Lys Lys Glu285 2 - #90 2 - #95 3 -#00- AAT GAA ACC AAA CTA CAT CCC TTT GTT TCC GA - #C TCG TCT TCT TTG AGC1067Asn Glu Thr Lys Leu His Pro Phe Val Ser As - #p Ser Ser Ser Leu Ser# 315- GGC GGC TTT TTC GGC CCG CAG GGT GAG GAA TT - #G GGT TTC CGC TTT TTG1115Gly Gly Phe Phe Gly Pro Gln Gly Glu Glu Le - #u Gly Phe Arg Phe Leu# 330- AGC GAC GAT CAA AAA GTT GCC GGT GTC GGC AG - #C GCG AAA ACC AAA GAC1163Ser Asp Asp Gln Lys Val Ala Gly Val Gly Se - #r Ala Lys Thr Lys Asp# 345- AAA CTG GAA AAT GGC GCG GCG GCT TCA GGC AG - #C ACA GGT GCG GCA GCA1211Lys Leu Glu Asn Gly Ala Ala Ala Ser Gly Se - #r Thr Gly Ala Ala Ala# 360- TCG GGC GGT GCG GCA GGC ACG TCG TCT GAA AA - #C AGT AAG CTG ACC ACG1259Ser Gly Gly Ala Ala Gly Thr Ser Ser Glu As - #n Ser Lys Leu Thr Thr365 3 - #70 3 - #75 3 -#80- GTT TTG GAT GCG GTT GAA TTG ACA CTA AAC GA - #C AAG AAA ATC AAA AAT1307Val Leu Asp Ala Val Glu Leu Thr Leu Asn As - #p Lys Lys Ile Lys Asn# 395- CTC GAC AAC TTC AGC AAT GCC GCC CAA CTG GT - #T GTC GAC GGC ATT ATG1355Leu Asp Asn Phe Ser Asn Ala Ala Gln Leu Va - #l Val Asp Gly Ile Met# 410- ATT CCG CTC CTG CCC AAG GAT TCC GAA AGC GG - #G AAC ACT CAG GCA GAT1403Ile Pro Leu Leu Pro Lys Asp Ser Glu Ser Gl - #y Asn Thr Gln Ala Asp# 425- AAA GGT AAA AAC GGC GGA ACA GAA TTT ACC CG - #C AAA TTT GAA CAC ACG1451Lys Gly Lys Asn Gly Gly Thr Glu Phe Thr Ar - #g Lys Phe Glu His Thr# 440- CCG GAA AGT GAT AAA AAA GAC GCC CAA GCA GG - #T ACG CAG ACG AAT GGG1499Pro Glu Ser Asp Lys Lys Asp Ala Gln Ala Gl - #y Thr Gln Thr Asn Gly445 4 - #50 4 - #55 4 -#60- GCG CAA ACC GCT TCA AAT ACG GCA GGT GAT AC - #C AAT GGC AAA ACA AAA1547Ala Gln Thr Ala Ser Asn Thr Ala Gly Asp Th - #r Asn Gly Lys Thr Lys# 475- ACC TAT GAA GTC GAA GTC TGC TGT TCC AAC CT - #C AAT TAT CTG AAA TAC1595Thr Tyr Glu Val Glu Val Cys Cys Ser Asn Le - #u Asn Tyr Leu Lys Tyr# 490- GGA ATG TTG ACG CGC AAA AAC AGC AAG TCC GC - #G ATG CAG GCA GGA GGA1643Gly Met Leu Thr Arg Lys Asn Ser Lys Ser Al - #a Met Gln Ala Gly Gly# 505- AAC AGT AGT CAA GCT GAT GCT AAA ACG GAA CA - #A GTT GAA CAA AGT ATG1691Asn Ser Ser Gln Ala Asp Ala Lys Thr Glu Gl - #n Val Glu Gln Ser Met# 520- TTC CTC CAA GGC GAG CGT ACC GAT GAA AAA GA - #G ATT CCA ACC GAC CAA1739Phe Leu Gln Gly Glu Arg Thr Asp Glu Lys Gl - #u Ile Pro Thr Asp Gln525 5 - #30 5 - #35 5 -#40- AAC GTC GTT TAT CGG GGG TCT TGG TAC GGG CA - #T ATT GCC AAC GGC ACA1787Asn Val Val Tyr Arg Gly Ser Trp Tyr Gly Hi - #s Ile Ala Asn Gly Thr# 555- AGC TGG AGC GGC AAT GCT TCT GAT AAA GAG GG - #C GGC AAC AGG GCG GAA1835Ser Trp Ser Gly Asn Ala Ser Asp Lys Glu Gl - #y Gly Asn Arg Ala Glu# 570- TTT ACT GTG AAT TTT GCC GAT AAA AAA ATT AC - #C GGC AAG TTA ACC GCT1883Phe Thr Val Asn Phe Ala Asp Lys Lys Ile Th - #r Gly Lys Leu Thr Ala# 585- GAA AAC AGG CAG GCG CAA ACC TTT ACC ATT GA - #G GGA ATG ATT CAG GGC1931Glu Asn Arg Gln Ala Gln Thr Phe Thr Ile Gl - #u Gly Met Ile Gln Gly# 600- AAC GGC TTT GAA GGT ACG GCG AAA ACT GCT GA - #G TCA GGT TTT GAT CTC1979Asn Gly Phe Glu Gly Thr Ala Lys Thr Ala Gl - #u Ser Gly Phe Asp Leu605 6 - #10 6 - #15 6 -#20- GAT CAA AAA AAT ACC ACC CGC ACG CCT AAG GC - #A TAT ATC ACA GAT GCC2027Asp Gln Lys Asn Thr Thr Arg Thr Pro Lys Al - #a Tyr Ile Thr Asp Ala# 635- AAG GTA AAG GGC GGT TTT TAC GGG CCT AAA GC - #C GAA GAG TTG GGC GGA2075Lys Val Lys Gly Gly Phe Tyr Gly Pro Lys Al - #a Glu Glu Leu Gly Gly# 650- TGG TTT GCC TAT CCG GGC GAT AAA CAA ACG GA - #A AAG GCA ACA GCT ACA2123Trp Phe Ala Tyr Pro Gly Asp Lys Gln Thr Gl - #u Lys Ala Thr Ala Thr# 665- TCC AGC GAT GGA AAT TCA GCA AGC AGC GCG AC - #C GTG GTA TTC GGT GCG2171Ser Ser Asp Gly Asn Ser Ala Ser Ser Ala Th - #r Val Val Phe Gly Ala# 680- AAA CGC CAA CAG CCT GTG CAA TAAGCACGGT TGCCGAACA - #A TCAAGAATAA2222Lys Arg Gln Gln Pro Val Gln685 6 - #90# 2230- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 711 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met Asn Asn Pro Leu Val Asn Gln Ala Ala Me - #t Val Leu Pro Val Phe#-510- Leu Leu Ser Ala Cys Leu Gly Gly Gly Gly Se - #r Phe Asp Leu Asp Ser# 10- Val Asp Thr Glu Ala Pro Arg Pro Ala Pro Ly - #s Tyr Gln Asp Val Ser# 25- Ser Glu Lys Pro Gln Ala Gln Lys Asp Gln Gl - #y Gly Tyr Gly Phe Ala# 40- Met Arg Leu Lys Arg Arg Asn Trp Tyr Pro Gl - #y Ala Glu Glu Ser Glu# 60- Val Lys Leu Asn Glu Ser Asp Trp Glu Ala Th - #r Gly Leu Pro Thr Lys# 75- Pro Lys Glu Leu Pro Lys Arg Gln Lys Ser Va - #l Ile Glu Lys Val Glu# 90- Thr Asp Gly Asp Ser Asp Ile Tyr Ser Ser Pr - #o Tyr Leu Thr Pro Ser# 105- Asn His Gln Asn Gly Ser Ala Gly Asn Gly Va - #l Asn Gln Pro Lys Asn# 120- Gln Ala Thr Gly His Glu Asn Phe Gln Tyr Va - #l Tyr Ser Gly Trp Phe125 1 - #30 1 - #35 1 -#40- Tyr Lys His Ala Ala Ser Glu Lys Asp Phe Se - #r Asn Lys Lys Ile Lys# 155- Ser Gly Asp Asp Gly Tyr Ile Phe Tyr His Gl - #y Glu Lys Pro Ser Arg# 170- Gln Leu Pro Ala Ser Gly Lys Val Ile Tyr Ly - #s Gly Val Trp His Phe# 185- Val Thr Asp Thr Lys Lys Gly Gln Asp Phe Ar - #g Glu Ile Ile Gln Pro# 200- Ser Lys Lys Gln Gly Asp Arg Tyr Ser Gly Ph - #e Ser Gly Asp Gly Ser205 2 - #10 2 - #15 2 -#20- Glu Glu Tyr Ser Asn Lys Lys Glu Ser Thr Le - #u Lys Asp Asp His Glu# 235- Gly Tyr Gly Phe Thr Ser Asn Leu Glu Val As - #p Phe Gly Asn Lys Lys# 250- Leu Thr Gly Lys Leu Ile Arg Asn Asn Ala Se - #r Leu Asn Asn Asn Thr# 265- Asn Asn Asp Lys His Thr Thr Gln Tyr Tyr Se - #r Leu Asp Ala Gln Ile# 280- Thr Gly Asn Arg Phe Asn Gly Thr Ala Thr Al - #a Thr Asp Lys Lys Glu285 2 - #90 2 - #95 3 -#00- Asn Glu Thr Lys Leu His Pro Phe Val Ser As - #p Ser Ser Ser Leu Ser# 315- Gly Gly Phe Phe Gly Pro Gln Gly Glu Glu Le - #u Gly Phe Arg Phe Leu# 330- Ser Asp Asp Gln Lys Val Ala Gly Val Gly Se - #r Ala Lys Thr Lys Asp# 345- Lys Leu Glu Asn Gly Ala Ala Ala Ser Gly Se - #r Thr Gly Ala Ala Ala# 360- Ser Gly Gly Ala Ala Gly Thr Ser Ser Glu As - #n Ser Lys Leu Thr Thr365 3 - #70 3 - #75 3 -#80- Val Leu Asp Ala Val Glu Leu Thr Leu Asn As - #p Lys Lys Ile Lys Asn# 395- Leu Asp Asn Phe Ser Asn Ala Ala Gln Leu Va - #l Val Asp Gly Ile Met# 410- Ile Pro Leu Leu Pro Lys Asp Ser Glu Ser Gl - #y Asn Thr Gln Ala Asp# 425- Lys Gly Lys Asn Gly Gly Thr Glu Phe Thr Ar - #g Lys Phe Glu His Thr# 440- Pro Glu Ser Asp Lys Lys Asp Ala Gln Ala Gl - #y Thr Gln Thr Asn Gly445 4 - #50 4 - #55 4 -#60- Ala Gln Thr Ala Ser Asn Thr Ala Gly Asp Th - #r Asn Gly Lys Thr Lys# 475- Thr Tyr Glu Val Glu Val Cys Cys Ser Asn Le - #u Asn Tyr Leu Lys Tyr# 490- Gly Met Leu Thr Arg Lys Asn Ser Lys Ser Al - #a Met Gln Ala Gly Gly# 505- Asn Ser Ser Gln Ala Asp Ala Lys Thr Glu Gl - #n Val Glu Gln Ser Met# 520- Phe Leu Gln Gly Glu Arg Thr Asp Glu Lys Gl - #u Ile Pro Thr Asp Gln525 5 - #30 5 - #35 5 -#40- Asn Val Val Tyr Arg Gly Ser Trp Tyr Gly Hi - #s Ile Ala Asn Gly Thr# 555- Ser Trp Ser Gly Asn Ala Ser Asp Lys Glu Gl - #y Gly Asn Arg Ala Glu# 570- Phe Thr Val Asn Phe Ala Asp Lys Lys Ile Th - #r Gly Lys Leu Thr Ala# 585- Glu Asn Arg Gln Ala Gln Thr Phe Thr Ile Gl - #u Gly Met Ile Gln Gly# 600- Asn Gly Phe Glu Gly Thr Ala Lys Thr Ala Gl - #u Ser Gly Phe Asp Leu605 6 - #10 6 - #15 6 -#20- Asp Gln Lys Asn Thr Thr Arg Thr Pro Lys Al - #a Tyr Ile Thr Asp Ala# 635- Lys Val Lys Gly Gly Phe Tyr Gly Pro Lys Al - #a Glu Glu Leu Gly Gly# 650- Trp Phe Ala Tyr Pro Gly Asp Lys Gln Thr Gl - #u Lys Ala Thr Ala Thr# 665- Ser Ser Asp Gly Asn Ser Ala Ser Ser Ala Th - #r Val Val Phe Gly Ala# 680- Lys Arg Gln Gln Pro Val Gln685 6 - #90- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..51- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..51- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- ATG AGG AAA AGA TTT TTT GTG GGA ATA TTC GC - #G ATA AAC CTC CTT GTT 48Met Arg Lys Arg Phe Phe Val Gly Ile Phe Al - #a Ile Asn Leu Leu Val# 15# 51Gly- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 17 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Arg Lys Arg Phe Phe Val Gly Ile Phe Al - #a Ile Asn Leu Leu Val# 15- Gly- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 57 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..57- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..57- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- ATG AAA AAA ATA ACA GGG ATT ATT TTA TTG CT - #T CTT GCA GTC ATT ATT 48Met Lys Lys Ile Thr Gly Ile Ile Leu Leu Le - #u Leu Ala Val Ile Ile# 15# 57Leu Ser Ala- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 19 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Met Lys Lys Ile Thr Gly Ile Ile Leu Leu Le - #u Leu Ala Val Ile Ile# 15- Leu Ser Ala- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..60- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..60- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- ATG AAA GCT ACT AAA CTG GTA CTG GGC GCG GT - #A ATC CTG GGT TCT ACT 48Met Lys Ala Thr Lys Leu Val Leu Gly Ala Va - #l Ile Leu Gly Ser Thr# 15# 60Leu Leu Ala Gly 20- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 20 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Met Lys Ala Thr Lys Leu Val Leu Gly Ala Va - #l Ile Leu Gly Ser Thr# 15- Leu Leu Ala Gly 20- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 69 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..69- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..69- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- ATG AAA CTG ACA ACA CAT CAT CTA CGG ACA GG - #G GCC GCA TTA TTG GTG 48Met Lys Leu Thr Thr His His Leu Arg Thr Gl - #y Ala Ala Leu Leu Val# 15#69 TG GCA GGTAla Gly Ile Leu Leu Ala Gly 20- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 23 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Met Lys Leu Thr Thr His His Leu Arg Thr Gl - #y Ala Ala Leu Leu Val# 15- Ala Gly Ile Leu Leu Ala Gly 20- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 69 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..69- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..69- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- ATG TTT GTA ACG AGC AAA AAA ATG ACC GCG GC - #T GTT CTG GCA ATT ACT 48Met Phe Val Thr Ser Lys Lys Met Thr Ala Al - #a Val Leu Ala Ile Thr# 15#69 TG AGT GCALeu Ala Met Ser Leu Ser Ala 20- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 23 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Met Phe Val Thr Ser Lys Lys Met Thr Ala Al - #a Val Leu Ala Ile Thr# 15- Leu Ala Met Ser Leu Ser Ala 20- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 63 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..63- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..63- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- ATG CAA CTG AAC AAA GTG CTG AAA GGG CTG AT - #G ATT GCT CTG CCT GTT 48Met Gln Leu Asn Lys Val Leu Lys Gly Leu Me - #t Ile Ala Leu Pro Val# 15# 63 CAMet Ala Ile Ala Ala 20- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Met Gln Leu Asn Lys Val Leu Lys Gly Leu Me - #t Ile Ala Leu Pro Val# 15- Met Ala Ile Ala Ala 20- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 54 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..54- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..54- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- ATG AGA TAC CTG GCA ACA TTG TTG TTA TCT CT - #G GCG GTG TTA ATC ACC 48Met Arg Tyr Leu Ala Thr Leu Leu Leu Ser Le - #u Ala Val Leu Ile Thr# 15# 54Ala Gly- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 18 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Met Arg Tyr Leu Ala Thr Leu Leu Leu Ser Le - #u Ala Val Leu Ile Thr# 15- Ala Gly- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 66 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..66- (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 1..66- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- ATG AAA CAT AAC GTT AAG CTG ATG GCA ATG AC - #T GCC GTT TTA TCC TCT 48Met Lys His Asn Val Lys Leu Met Ala Met Th - #r Ala Val Leu Ser Ser# 15# 66 CC GGGVal Leu Val Leu Ser Gly 20- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 22 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Met Lys His Asn Val Lys Leu Met Ala Met Th - #r Ala Val Leu Ser Ser# 15- Val Leu Val Leu Ser Gly 20- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 18 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- Glu Xaa Val Gln Ala Glu Gln Ala Gln Glu Ly - #s Gln Leu Asp Thr Ile# 15- Gln Val- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 20 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Xaa Leu Xaa Xaa Xaa Xaa Ser Phe Asp Leu As - #p Ser Val Glu Xaa Val# 15- Gln Xaa Met Xaa 20- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- Asn Asn Ile Val Leu Phe Gly Pro Asp Gly Ty - #r Leu Tyr Tyr Lys# 15- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 5 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Tyr Thr Ile Gln Ala1 5- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 18 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- Asp Gly Glu Asn Ala Ala Gly Pro Ala Thr Gl - #u Xaa Val Ile Asp Ala# 15- Tyr Arg- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 10 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- Xaa Gln Ile Asp Ser Phe Gly Asp Val Lys# 10- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 7 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- Ala Ala Phe Xaa Xaa Xaa Ile1 5- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 12 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- Xaa Asn Xaa Xaa Xaa Met Phe Leu Gln Gly Va - #l Arg# 10- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 9 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- Thr Pro Val Ser Asp Val Ala Ala Arg1 5- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 6 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- Xaa Ser Pro Ala Phe Thr1 5- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 19 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- Asn Ala Ile Glu Met Gly Gly Ser Phe Xaa Ph - #e Pro Gly Asn Ala Pro# 15- Glu Gly Lys- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 13 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- Xaa Gln Pro Glu Ser Gln Gln Asp Val Ser Gl - #u Asn Xaa# 10- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 19 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:- Glu Asn Val Gln Ala Gly Gln Ala Gln Glu Ly - #s Gln Leu Xaa Xaa Ile# 15- Gln Val Xaa- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: Protein (B) LOCATION: 4#/note= "Amino acid 4 is E or W."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:- Xaa Leu Ser Xaa Asn Ala Gly Xaa Val Leu Xa - #a Pro Ala Asp Xaa# 15- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 8 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:- Gln Leu Asp Thr Ile Gln Val Lys1 5- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 17 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:- Thr Ala Gly Ser Ser Gly Ala Ile Asn Glu Il - #e Glu Tyr Glu Asn Xaa# 15- Xaa- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 14 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- Tyr Val Thr Trp Glu Asn Val Asp Xaa Xaa Xa - #a Xaa Xaa Xaa# 10- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 13 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:- Ser Leu Val Xaa Ala Xaa Ser Phe Asp Leu Xa - #a Ser Val# 10- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 9 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:- Xaa Xaa Asp Asn Leu Ser Asn Ala Xaa1 5- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:- Xaa Gly Asp Asp Gly Tyr Ile Phe Tyr Xaa Gl - #y Glu Lys Pro Xaa# 15- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 10 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:- Xaa Gln Gly Xaa Tyr Gly Phe Ala Met Xaa# 10- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 19 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:- Xaa Gln Ala Thr Gly His Glu Asn Phe Gln Ty - #r Val Tyr Ser Gly Xaa# 15- Phe Tyr Lys- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 85 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:- AAATACCTAT TGCCTACGGC AGCCGCTGGA CTGTTATTAC TCGCTGCCCA AC - #CAGCGATG 60# 85 GTTT TCCCA- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 89 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:- AGCTTGGGAA AACGCGTGGG AAAGCATGCC ATCGCTGGTT GGGCAGCGAG TA - #ATAACAGT 60# 89 GCAA TAGGTATTT- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 93 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..66- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:- ATG AAA TAC CTA TTG CCT ACG GCA GCC GCT GG - #A CTG TTA TTA CTC GCT 48Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gl - #y Leu Leu Leu Leu Ala# 15- GCC CAA CCA GCG ATG GCA TGCTTTCCCA CGCGTTTTCC CA - #AGCTT#93Ala Gln Pro Ala Met Ala 20- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 38 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:# 38 CCTG GGTGGCGGCG GCAGTTTC- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 35 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 35 TGTA ACGCGTAGTT TTTAT- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 40 ACGC GTGAATTCCC CGGGTCTAGA- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 40 GAAT TCACGCGTGG TACCTGCAGC- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 41 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 15..26- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 41 TG CAA CAG CAA CATTTGTTCC GATTA- Met G - #ln Gln Gln#1- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 35 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 35 GTAA CGCGTCAGGT CGCGG- (2) INFORMATION FOR SEQ ID NO:56:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:# 27 CGCA AAATACC- (2) INFORMATION FOR SEQ ID NO:57:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 49 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:# 49AGCTT GAAGCCTTAT TCTCGATTGT TCGGCAGCC- (2) INFORMATION FOR SEQ ID NO:58:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 83 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 15..83- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:- TTTTTTGGAT CCTC ATG AAC AAT CCA TTG GTA AAT C - #AG GCT GCT ATG GTG 50 Met A - #sn Asn Pro Leu Val Asn Gln Ala Ala Met Va - #l# 10# 83G TTT TTG TTG AGT GCA TGC CTG GG - #TLeu Pro Val Phe Leu Leu Ser Ala Cys Leu Gl - #y# 20- (2) INFORMATION FOR SEQ ID NO:59:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 47 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:# 47TCCG TCAGGTCCAA AAAGAACTAT ATTATTC- (2) INFORMATION FOR SEQ ID NO:60:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 74 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 9..71- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:#TCT CTG GCG GTG TTA 50CA ACA TTG TTG TTA Met Arg Tyr Leu Ala T - #hr Leu Leu Leu Ser Leu Ala Val Leu# 10# 74GC CTG GGT GGCIle Thr Ala Gly Cys Leu Gly# 20- (2) INFORMATION FOR SEQ ID NO:61:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 578 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:- Cys Leu Gly Gly Gly Gly Ser Phe Asp Leu As - #p Ser Val Glu Thr Val# 15- Gln Asp Met His Ser Lys Pro Lys Tyr Glu As - #p Glu Lys Ser Gln Pro# 30- Glu Ser Gln Gln Asp Val Ser Glu Asn Ser Gl - #y Ala Ala Tyr Gly Phe# 45- Ala Val Lys Leu Pro Arg Arg Asn Ala His Ph - #e Asn Pro Lys Tyr Lys# 60- Glu Lys His Lys Pro Leu Gly Ser Met Asp Tr - #p Lys Lys Leu Gln Arg#80- Gly Glu Pro Asn Ser Phe Ser Glu Arg Asp Gl - #u Leu Glu Lys Lys Arg# 95- Gly Ser Ser Glu Leu Ile Glu Ser Lys Trp Gl - #u Asp Gly Gln Ser Arg# 110- Val Val Gly Tyr Thr Asn Phe Thr Tyr Val Ar - #g Ser Gly Tyr Val Tyr# 125- Leu Asn Lys Asn Asn Ile Asp Ile Lys Asn As - #n Ile Val Leu Phe Gly# 140- Pro Asp Gly Tyr Leu Tyr Tyr Lys Gly Lys Gl - #u Pro Ser Lys Glu Leu145 1 - #50 1 - #55 1 -#60- Pro Ser Glu Lys Ile Thr Tyr Lys Gly Thr Tr - #p Asp Tyr Val Thr Asp# 175- Ala Met Glu Lys Gln Arg Phe Glu Gly Gly Se - #r Ala Ala Gly Gly Asp# 190- Lys Ser Gly Ala Leu Ser Ala Leu Glu Glu Gl - #y Val Leu Arg Asn Gln# 205- Ala Glu Ala Ser Ser Gly His Thr Asp Phe Gl - #y Met Thr Ser Glu Phe# 220- Glu Val Asp Phe Ser Asp Lys Thr Ile Lys Gl - #y Thr Leu Tyr Arg Asn225 2 - #30 2 - #35 2 -#40- Asn Arg Ile Thr Gln Asn Asn Ser Glu Asn Ly - #s Gln Ile Lys Thr Thr# 255- Arg Tyr Thr Ile Gln Ala Thr Leu His Gly As - #n Arg Phe Lys Gly Lys# 270- Ala Leu Ala Ala Asp Lys Gly Ala Thr Asn Gl - #y Ser His Pro Phe Ile# 285- Ser Asp Ser Asp Ser Leu Glu Gly Gly Phe Ty - #r Gly Pro Lys Gly Glu# 300- Glu Leu Ala Gly Lys Phe Leu Ser Asn Asp As - #n Lys Val Ala Ala Val305 3 - #10 3 - #15 3 -#20- Phe Gly Ala Lys Gln Lys Asp Lys Lys Asp Gl - #y Glu Asn Ala Ala Gly# 335- Pro Ala Thr Glu Thr Val Ile Asp Ala Tyr Ar - #g Ile Thr Gly Glu Glu# 350- Phe Lys Lys Glu Gln Ile Asp Ser Phe Gly As - #p Val Lys Lys Leu Leu# 365- Val Asp Gly Val Glu Leu Ser Leu Leu Pro Se - #r Glu Gly Asn Lys Ala# 380- Ala Phe Gln His Glu Ile Glu Gln Asn Gly Va - #l Lys Ala Thr Val Cys385 3 - #90 3 - #95 4 -#00- Cys Ser Asn Leu Asp Tyr Met Ser Phe Gly Ly - #s Leu Ser Lys Glu Asn# 415- Lys Asp Asp Met Phe Leu Gln Gly Val Arg Th - #r Pro Val Ser Asp Val# 430- Ala Ala Arg Thr Glu Ala Asn Ala Lys Tyr Ar - #g Gly Thr Trp Tyr Gly# 445- Tyr Ile Ala Asn Gly Thr Ser Trp Ser Gly Gl - #u Ala Ser Asn Gln Glu# 460- Gly Gly Asn Arg Ala Glu Phe Asp Val Asp Ph - #e Ser Thr Lys Lys Ile465 4 - #70 4 - #75 4 -#80- Ser Gly Thr Leu Thr Ala Lys Asp Arg Thr Se - #r Pro Ala Phe Thr Ile# 495- Thr Ala Met Ile Lys Asp Asn Gly Phe Ser Gl - #y Val Ala Lys Thr Gly# 510- Glu Asn Gly Phe Ala Leu Asp Pro Gln Asn Th - #r Gly Asn Ser His Tyr# 525- Thr His Ile Glu Ala Thr Val Ser Gly Gly Ph - #e Tyr Gly Lys Asn Ala# 540- Ile Glu Met Gly Gly Ser Phe Ser Phe Pro Gl - #y Asn Ala Pro Glu Gly545 5 - #50 5 - #55 5 -#60- Lys Gln Glu Lys Ala Ser Val Val Phe Gly Al - #a Lys Arg Gln Gln Leu# 575- Val Gln- (2) INFORMATION FOR SEQ ID NO:62:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 692 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:- Cys Leu Gly Gly Gly Gly Ser Phe Asp Leu As - #p Ser Val Asp Thr Glu# 15- Ala Arg Pro Arg Pro Ala Pro Lys Tyr Gln As - #p Val Ser Ser Glu Lys# 30- Pro Gln Ala Gln Lys Asp Gln Gly Gly Tyr Gl - #y Phe Ala Met Arg Leu# 45- Lys Arg Arg Asn Trp Tyr Pro Gly Ala Glu Gl - #u Ser Glu Val Lys Leu# 60- Asn Glu Ser Asp Trp Glu Ala Thr Gly Leu Pr - #o Thr Lys Pro Lys Glu#80- Leu Pro Lys Arg Gln Lys Ser Val Ile Glu Ly - #s Val Glu Thr Asp Gly# 95- Asp Ser Asp Ile Tyr Ser Ser Pro Tyr Leu Th - #r Pro Ser Asn His Gln# 110- Asn Gly Ser Ala Gly Asn Gly Val Asn Gln Pr - #o Lys Asn Gln Ala Thr# 125- Gly His Glu Asn Phe Gln Tyr Val Tyr Ser Gl - #y Trp Phe Tyr Lys His# 140- Ala Ala Ser Glu Lys Asp Phe Ser Asn Lys Ly - #s Ile Lys Ser Gly Asp145 1 - #50 1 - #55 1 -#60- Asp Gly Tyr Ile Phe Tyr His Gly Glu Lys Pr - #o Ser Arg Gln Leu Pro# 175- Ala Ser Gly Lys Val Ile Tyr Lys Gly Val Tr - #p His Phe Val Thr Asp# 190- Thr Lys Lys Gly Gln Asp Phe Arg Glu Ile Il - #e Gln Pro Ser Lys Lys# 205- Gln Gly Asp Arg Tyr Ser Gly Phe Ser Gly As - #p Gly Ser Glu Glu Tyr# 220- Ser Asn Lys Asn Glu Ser Thr Leu Lys Asp As - #p His Glu Gly Tyr Gly225 2 - #30 2 - #35 2 -#40- Phe Thr Ser Asn Leu Glu Val Asp Phe Gly As - #n Lys Lys Leu Thr Gly# 255- Lys Leu Ile Arg Asn Asn Ala Ser Leu Asn As - #n Asn Thr Asn Asn Asp# 270- Lys His Thr Thr Gln Tyr Tyr Ser Leu Asp Al - #a Gln Ile Thr Gly Asn# 285- Arg Phe Asn Gly Thr Ala Thr Ala Thr Asp Ly - #s Lys Glu Asn Glu Thr# 300- Lys Leu His Pro Phe Val Ser Asp Ser Ser Se - #r Leu Ser Gly Gly Phe305 3 - #10 3 - #15 3 -#20- Phe Gly Pro Gln Gly Glu Glu Leu Gly Phe Ar - #g Phe Leu Ser Asp Asp# 335- Gln Lys Val Ala Val Val Gly Ser Ala Lys Th - #r Lys Asp Lys Leu Glu# 350- Asn Gly Ala Ala Ala Ser Gly Ser Thr Gly Al - #a Ala Ala Ser Gly Gly# 365- Ala Ala Gly Thr Ser Ser Glu Asn Ser Lys Le - #u Thr Thr Val Leu Asp# 380- Ala Val Glu Leu Thr Leu Asn Asp Lys Lys Il - #e Lys Asn Leu Asp Asn385 3 - #90 3 - #95 4 -#00- Phe Ser Asn Ala Ala Gln Leu Val Val Asp Gl - #y Ile Met Ile Pro Leu# 415- Leu Pro Lys Asp Ser Glu Ser Gly Asn Thr Gl - #n Ala Asp Lys Gly Lys# 430- Asn Gly Gly Thr Glu Phe Thr Arg Lys Phe Gl - #u His Thr Pro Glu Ser# 445- Asp Lys Lys Asp Ala Gln Ala Gly Thr Gln Th - #r Asn Gly Ala Gln Thr# 460- Ala Ser Asn Thr Ala Gly Asp Thr Asn Gly Ly - #s Thr Lys Thr Tyr Glu465 4 - #70 4 - #75 4 -#80- Val Glu Val Cys Cys Ser Asn Leu Asn Tyr Le - #u Lys Tyr Gly Met Leu# 495- Thr Arg Lys Asn Ser Lys Ser Ala Met Gln Al - #a Gly Gly Asn Ser Ser# 510- Gln Ala Asp Ala Lys Thr Glu Gln Val Glu Gl - #n Ser Met Phe Leu Gln# 525- Gly Glu Arg Thr Asp Glu Lys Glu Ile Pro Th - #r Asp Gln Asn Val Val# 540- Tyr Arg Gly Ser Trp Tyr Gly His Ile Ala As - #n Gly Thr Ser Trp Ser545 5 - #50 5 - #55 5 -#60- Gly Asn Ala Ser Asp Lys Glu Gly Gly Asn Ar - #g Ala Glu Phe Thr Val# 575- Asn Phe Ala Asp Lys Lys Ile Thr Gly Lys Le - #u Thr Ala Glu Asn Arg# 590- Gln Ala Gln Thr Phe Thr Ile Glu Gly Met Il - #e Gln Gly Asn Gly Phe# 605- Glu Gly Thr Ala Lys Thr Ala Glu Ser Gly Ph - #e Asp Leu Asp Gln Lys# 620- Asn Thr Thr Arg Thr Pro Lys Ala Tyr Ile Th - #r Asp Ala Lys Val Lys625 6 - #30 6 - #35 6 -#40- Gly Gly Phe Tyr Gly Pro Lys Ala Glu Glu Le - #u Gly Gly Trp Phe Ala# 655- Tyr Pro Gly Asp Lys Gln Thr Glu Lys Ala Th - #r Ala Thr Ser Ser Asp# 670- Gly Asn Ser Ala Ser Ser Ala Thr Val Val Ph - #e Gly Ala Lys Arg Gln# 685- Gln Pro Val Gln 690__________________________________________________________________________

Claims

1. A composition of matter comprising two proteins and a carrier therefor, wherein said proteins are recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis, wherein said proteins are obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 2, from position -20 to position 579; and further comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 8, from position -20 to position 691; further wherein said expression cassette does not comprise the DNA sequence encoding the amino acid sequence of SEQ ID NO: 4, from position -24 to position 884, nor the DNA sequence encoding the amino acid sequence of SEQ ID NO: 6 from position -24 to position 887;

said DNA sequences being placed under the control of elements required for their expression; and

recovering the proteins from the culture.

2. A composition of matter comprising two proteins and a carrier therefor, wherein said proteins are recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitides, wherein said proteins are obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 2, from position 1 to position 579; and further comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 8, from position 1 to position 691; further wherein said expression cassette does not comprise the DNA sequence encoding the amino acid sequence of SEQ ID NO: 4, from position 1 to position 884, nor the DNA sequence encoding the amino acid sequence of SEQ ID NO: 6 from position 1 to position 887;

said DNA sequences being placed under the control of elements required for their expression; and

recovering the proteins from the culture.

3. A composition of matter comprising a protein and a carrier therefor, wherein said protein is recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis, and further wherein said protein is obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the Tbp2 subunit of N. meningitidis, and does not encode the Tbp1 subunit, wherein said Tbp2 subunit has an amino acid sequence selected from the group consisting of:

SEQ ID NO: 2, from position -20 to position 579; and

SEQ ID NO: 8, from position -20 to position 691,

said DNA sequence being placed under the control of the elements required for its expression; and

recovering the protein from the culture.

4. A composition of matter comprising a protein and a carrier therefor, wherein said protein is recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis, and further wherein said protein is obtained by:

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the Tbp2 subunit of N. meningitidis, and does not encode the Tbp1 subunit, wherein said Tbp2 subunit has an amino acid sequence selected from the group consisting of:

SEQ ID NO: 2, from position 1 to position 579; and

SEQ ID NO: 8, from position 1 to position 691,

said DNA sequence being placed under the control of the elements required for its expression; and

recovering the protein from the culture.

5. A pharmaceutical composition comprising as an active ingredient two proteins capable of being recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis, and a carrier therefor, wherein said proteins are obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 2, from position -20 to position 579; and further comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 8, from position -20 to position 691; further wherein said expression cassette does not comprise the DNA sequence encoding the amino acid sequence of SEQ ID NO: 4, from position -24 to position 884, nor the DNA sequence encoding the amino acid sequence of SEQ ID NO: 6 from position -24 to position 887;

said DNA sequences being placed under the control of elements required for its expression;

and recovering the proteins from the culture.

6. A pharmaceutical composition comprising as an active ingredient two proteins capable of being recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitides, and a carrier therefor, wherein said proteins are obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 2, from position 1 to position 579; and further comprises a DNA sequence which encodes the amino acid sequence of SEQ ID NO: 8, from position 1 to position 691; further wherein said expression cassette does not comprise the DNA sequence encoding the amino acid sequence of SEQ ID NO: 4, from position 1 to position 884, nor the DNA sequence encoding the amino acid sequence of SEQ ID NO: 6 from position 1 to position 887;

said DNA sequences being placed under the control of elements required for its expression;

and recovering the proteins from the culture.

7. A pharmaceutical composition comprising as an active ingredient a protein capable of being recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis and a carrier therefor, wherein said protein is obtained by culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the Tbp2 subunit of N. meningitidis, and does not encode the Tbp1 subunit, wherein said Tbp2 subunit has an amino acid sequence selected from the group consisting of:

SEQ ID NO: 2, from position -20 to position 579; and

SEQ ID NO: 8, from position -20 to position 691,

said DNA sequence being placed under the control of the elements required for its expression;

and recovering the protein from the culture.

8. A pharmaceutical composition comprising as an active ingredient a protein capable of being recognized by an antiserum against the transferrin receptor of the strain IM2394 or IM2169 of N. meningitidis, and a carrier therefor, wherein said protein is obtained by

culturing a host cell transformed by an expression cassette which comprises a DNA sequence which encodes the Tbp2 subunit of N. meningitidis, and does not encode the Tbp1 subunit, wherein said Tbp2 subunit has an amino acid sequence selected from the group consisting of:

SEQ ID NO: 2, from position 1 to position 579; and

SEQ ID NO: 8, from position 1 to position 691,

said DNA sequence being placed under the control of the elements required for its expression;

and recovering the protein from the culture.