Patent Application
20250136997
A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatentCenter encoded as XML in UTF-8 text. The electronic document, created on Sep. 16, 2024, is entitled “11258-037US1_ST26.xml”, and is 381,364 bytes in size.
Metabolism is a key area where the host and microbiota interact. Recent advances have clearly defined a role for gut microbiome metabolites in disease initiation and progression. Bacterial metabolites appear to have the potential to alter physiological pathways of host cells and in specific circumstances, such as in aging and cancer, to modulate the expression of genes and switch the function of a gene, such as p53, therefore affecting the disease process. However, whether bacterial metabolites can affect the expression of genes by directly modulating transcription machinery is not known.
Gut microbiota and the brain communicate with each other via various routes, involving gut microbial metabolites. The composition of altered aged gut microbiota accelerates the aging process by way of toxic gut metabolites. As key players in the brain's immune function, microglia shape neuronal wiring and activity, synaptic plasticity, and phagocytosis and support the survival of neurons and neuronal progenitors via the secretion of growth factors. During the aging process, microglia develop into a highly reactive and unbalanced state promoting cognitive dysfunction including altered brain plasticity and neurodegeneration.
Sensing changes in the brain milieu is a major microglial function that regulates the ability of these cells to perform other tasks including host defense and homeostasis. Microglia express a cluster of genes including S100A8 and S100A9 that allow them to perform their sensing functions termed the sensome. The increasing release of the heterodimer formed by S100A8 and S100A9 proteins is associated with aging. This heterodimer is a toll-like receptor 4 (TLR4) and receptor for advanced glycation end products (RAGE) ligand that is situated upstream of tumor necrosis factor alpha (TNF-α), CXCL synthesis and secretion, promotes NF-kB activation, and secretion of multiple inflammatory proteins, such as IL-6. S100A8 and S100A9 proteins are increased with aging in the mouse brain and promote microglial cell apoptosis and inflammatory cytokine induction and play a role in local and systemic inflammation. However, whether the expression of S100A8 and S100A9 is regulated by gut microbiome metabolite-mediated transcription machinery is not known.
Gene expression is regulated by the binding of transcription factors (TFs) to specific DNA sequence motifs across the genome. TFs do not always have access to these binding sites depending on the availability of these sites that are exposed to TFs. Because there is no available approach to label metabolites to demonstrate the direct interaction between the promoter region and metabolites, there is an inability to know whether gut microbiome metabolites regulate the accessibility of TFs to its regulated genes via direct binding to its motif region. Developing such technology is significant since unaccountable and numerous small molecules released from gut microbiomes regulate the expression of genes in host cells and play a physiological and pathophysiological role.
This Summary lists several embodiments of the presently disclosed subject matter, and in many cases lists variations and permutations of these embodiments of the presently disclosed subject matter. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
In one aspect, disclosed herein are methods of detecting the binding site of a small molecule to a target DNA sequence, the method comprising a) obtaining a short single-strand DNA oligonucleotide of a target DNA sequence; b) incubate DNA oligonucleotide with the small molecule creating a sample mixture; and c) performing nondenaturing polyacrylamide gel electrophoresis (PAGE) on the sample mixture, whereby a band on the gel is revealed for the sample mixture; wherein a shift in the band for the sample mixture relative to a control containing only the DNA oligonucleotide indicates the binding site for the small molecule to the target DNA sequence is present in the DNA oligonucleotide.
Also disclosed herein are methods of screening for a small molecule that binds to a target DNA sequence, the method comprising a) obtaining a short single-strand DNA oligonucleotide of a target DNA sequence; b) incubate DNA oligonucleotide with the small molecule creating a sample mixture; and c) performing nondenaturing polyacrylamide gel electrophoresis (PAGE) on the sample mixture, whereby a band on the gel is revealed for the sample mixture; wherein a shift in the band for the sample mixture relative to a control containing only the DNA oligonucleotide indicates the small molecule binds the target DNA sequence.
In some embodiments, the presently disclosed subject matter relates to compositions that include an IAA sequestration agent and methods for using the same to inhibit or treat diseases, disorders, and conditions associated with undesirable IAA biological activities.
In some embodiments, the IAA sequestration agent comprises an oligonucleotide to which IAA can bind. In some embodiments, an oligonucleotide of the presently disclosed subject matter comprises, consists essentially of, or consists of the sequence 5′-TGGGCAGCTGGCCA-3′ (SEQ ID NO: 10), optionally comprising, consisting essentially of, or consisting of the sequence 5′-CTGTGGGCAGCTGGCCAAGC-3′ (SEQ ID NO: 11). In some embodiments, the oligonucleotide further comprises a tag, optionally a biotin tag.
In some embodiments, the presently disclosed subject matter also relates to methods for reducing and/or delaying cognitive decline associated with neurodegenerative disease in subjects in need thereof. In some embodiments, the methods comprise, consist essentially of, or consist of administering to a subject in need thereof an effective amount of a composition comprising, consisting essentially of, or consisting of an IAA sequestration agent of the presently disclosed subject matter. In some embodiments, the IAA sequestration agent is an oligonucleotide that comprises an IAA binding sequence as disclosed herein.
In some embodiments, the presently disclosed subject matter also relates to methods for sequestering isoamyl alcohol (IAA) produced by microbiota in the gut of a subject. In some embodiments, the method comprising administering to the subject an effective amount of a composition comprising, consisting essentially of, or consisting of an IAA sequestration agent of the presently disclosed subject matter. In some embodiments, the IAA sequestration agent is an oligonucleotide that comprises an IAA binding sequence as disclosed herein.
In some embodiments of the presently disclosed methods, the composition is administered orally.
In some embodiments of the presently disclosed methods, the composition is administered intravenously.
In some embodiments of the presently disclosed methods, the composition is administered topically.
In some embodiments of the presently disclosed methods, the subject is a mammal. In some embodiments, the subject is a mouse. In some embodiments, the subject is a human.
Thus, it is an object of the presently disclosed subject matter to provide compositions and methods for inhibiting microglial S100A8 signaling, which in some embodiments can reduce, delay, or eliminate cognitive decline associated with microglial S100A8 signaling in neurodegenerative conditions.
An object of the presently disclosed subject matter having been stated herein above, and which is achieved in whole or in part by the presently disclosed subject matter, other objects will become evident as the description proceeds when taken in connection with the accompanying Figures as best described herein below.
The intestinal microbiome releases numerous different types of small molecules. Here, we show that the metabolite isoamylamine (IAA) released from gut bacteria Ruminococcaceae increases in aged mice and elderly people. Young mice orally administrated IAA leads to memory and learning loss. The IAA mediated induction of S100A8 promotes the apoptosis of microglial cells via recruiting p53 to S100A8 promoter region. IAA recognizes and specifically binds to this region and promotes the unwinding of its self-complementary hairpin structure that prevents the binding and activation by the transcription factor p53. The unwinding subsequently allows p53 to access the S100A8 promoter region and enhances the expression of S100A8. Thus, our finding provides evidence that small molecules released from the gut microbiome can directly bind genomic DNA, act as transcriptional coregulators, recruit sequence-specific transcription factors, and unveil a molecular mechanism that connects gut metabolism to gene expression in the brain and their implications for disease. While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.
Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10” as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings: “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
An “increase” can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.
A “decrease” can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.
“Inhibit,” “inhibiting,” and “inhibition” mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.
By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.
By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.
The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.
The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.
“Biocompatible” generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject.
“Comprising” is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. “Consisting essentially of” when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. “Consisting of” shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and/or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.
As used herein, the phrase “consisting essentially of” limits the scope of the related disclosure or claim to the specified materials and/or steps, plus those that do not materially affect the basic and novel characteristic(s) of the disclosed and/or claimed subject matter. For example, a method of the presently disclosed subject matter can “consist essentially of” one or more enumerated steps as set forth herein, which means that the one or more enumerated steps produce most or substantially all of the intended result to be produced by the claimed method. It is noted, however, that additional steps can be encompassed within the scope of such a method, provided that the additional steps do not substantially contribute to the result for which the method is intended.
As used herein, the term “and/or” when used in the context of a list of entities, refers to the entities being present singly or in any possible combination or subcombination. Thus, for example, the phrase “A, B, C, and/or D” includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be “positive” or “negative.”
“Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
A “pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation provided by the disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.
“Pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and/or human pharmaceutical or therapeutic use. The terms “carrier” or “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil/water or water/oil emulsion) and/or various types of wetting agents. As used herein, the term “carrier” encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
“Pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.
“Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
“Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g. a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of type I diabetes. In some embodiments, a desired therapeutic result is the control of obesity. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and/or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.
“Primers” are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
“Probes” are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
There is no available approach to label metabolites released from all cells and gut microbiome to demonstrate the direct interaction between the promoter DNA region and metabolites, there is an inability to know whether metabolites regulate the accessibility of transcription factors to its regulated genes via direct binding to its motif region. Developing such technology is significant since unaccountable and numerous small molecules (metabolites) released from host cell and gut microbiomes regulate the expression of genes in host cells and play a physiological and pathophysiological role.
In one aspect, disclosed herein are methods of detecting the binding site of a small molecule to a target DNA sequence. Referred to herein as single-strand gel shift (SSGS) assay, the method comprises a) obtaining a short single-strand DNA oligonucleotide of a target DNA sequence; b) incubate DNA oligonucleotide with the small molecule creating a sample mixture; and c) performing nondenaturing polyacrylamide gel electrophoresis (PAGE) on the sample mixture, whereby a band on the gel is revealed for the sample mixture; wherein a shift in the band for the sample mixture relative to a control containing only the DNA oligonucleotide indicates the binding site for the small molecule to the target DNA sequence is present in the DNA oligonucleotide.
The SSGS assay can also be used to screen for small molecules (such as metabolites) that bind to a target nucleic acid and thus have broad applications for the discovery and identification of new medicaments. Thus, also disclosed herein are methods of screening for a small molecule that binds to a target DNA sequence, the method comprising a) obtaining a short single-strand DNA oligonucleotide of a target DNA sequence; b) incubate DNA oligonucleotide with the small molecule creating a sample mixture; and c) performing nondenaturing polyacrylamide gel electrophoresis (PAGE) on the sample mixture, whereby a band on the gel is revealed for the sample mixture; wherein a shift in the band for the sample mixture relative to a control containing only the DNA oligonucleotide indicates the small molecule binds the target DNA sequence.
The single-stranded DNA oligonucleotide used in the disclosed methods can be of any length suitable to exhibit conformational differences. Thus, in one aspect, the DNA oligonucleotide can be at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more nucleotides in length.
One small molecule (i.e., metabolite) interaction identified herein related to isoamylamine (IAA) and its target the promoter region of S100A8. As disclosed herein, we developed a simple and effective strategy with the single-strand gel shift (SSGS) assay to test our hypothesis that isoamylamine (IAA), a small molecule released from gut bacteria, binds to the promoter region of S100A8 and subsequently modulates the gene expression of S100A8.
We found that IAA and expression of S100A8 are both increased in an aging-dependent manner. We further discovered that prebinding of IAA to the promoter region of S100A8 is required for subsequently recruiting of p53, which in turn leads to inducing the expression of S100A8. Our findings reveal an unexpected role of IAA as a mediator of neurodegeneration elicited by IAA and p53 jointly activating S100A8 signaling of microglia leading to cognitive decline in aged mice and provide an example of how gut microbiome metabolites can now be applied to microglial cells to define mechanisms of neurodegeneration.
The presently disclosed subject matter relates in some embodiments to agents that, when administered to a subject such as but not limited to a mouse or a human sequesters isoamyl alcohol (IAA) produced by microbiota in the gut of a subject. Such an agent is referred to herein as an IAA sequesterer or an IAA sequestration agent. Any agent that is capable of sequestering IAA produced by microbiota in the gut of a subject can be employed in the compositions and methods of the presently disclosed subject matter.
In some embodiments, an IAA sequestration agent is an oligonucleotide, which in some embodiments is an oligonucleotide that has an IAA-binding sequence. By way of example and not limitation, an oligonucleotide that has an IAA-binding sequence can be a subsequence of an S100A8 genomic sequence, particularly a promoter sequence, that comprises an IAA-binding sequence. Exemplary S100A8 promoter include the human and mouse S100A8 promoters, fragments of which are disclosed herein as SEQ ID NOs: 12 and 13. In some embodiments, an IAA-binding sequence comprises, consists essentially of, or consists of the sequence 5′-TGGGCAGCTGGCCA-3′ (SEQ ID NO: 10), which is present in both the human and mouse S100A8 promoters. In some embodiments, an IAA-binding sequence comprises, consists essentially of, or consists of the sequence 5′-CTGTGGGCAGCTGGCCAAGC-3′ (SEQ ID NO: 11), which is also present in both the human and mouse S100A8 promoters.
Thus, in some embodiments the compositions of the presently disclosed subject matter comprise, consist essentially of, or consist of oligonucleotides that comprise, consist essentially of, or consist of the sequence 5′-TGGGCAGCTGGCCA-3′ (SEQ ID NO: 10) or the sequence 5′-CTGTGGGCAGCTGGCCAAGC-3′ (SEQ ID NO: 11). Other sequences that include an IAA-binding sequence are shown in Table 5 below, including but not limited to the oligonucleotides disclosed therein as S100p1, S100p1-G, and hS100A8p.
In some embodiments, an oligonucleotide that comprises, consists essentially of, or consists of an IAA-binding sequence can further comprise a tag and/or a detectable label. An exemplary tag would be a biotin moiety. Any tag that can facilitate recovery or identification of the molecule can be employed. Representative tags are epitope tags (for example, myc tags, FLAG™ tags, His6 tags, VSV-G tags, HSV tags, V5 tags, or any other tag for which a reagent is available or can be produced to facilitate isolation of the molecule) and small molecules such as biotin. See e.g., Brenner & Lerner (1992) Proc Natl Acad Sci USA 89:5381-5383; U.S. Pat. No. 6,068,829.
The compositions of the presently disclosed subject matter can be administered in any formulation or route that would be expected to deliver the compositions to whatever target site might be appropriate.
The compositions of the presently disclosed subject matter comprise in some embodiments a composition that includes a carrier, particularly a pharmaceutically acceptable carrier, such as but not limited to a carrier pharmaceutically acceptable in humans. Any suitable pharmaceutical formulation can be used to prepare the compositions for administration to a subject.
For example, suitable formulations can include aqueous and non-aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostatics, bactericidal antibiotics, and solutes that render the formulation isotonic with the bodily fluids of the intended recipient.
It should be understood that in addition to the ingredients particularly mentioned above the formulations of the presently disclosed subject matter can include other agents conventional in the art with regard to the type of formulation in question. For example, sterile pyrogen-free aqueous and non-aqueous solutions can be used.
An effective dose of a composition of the presently disclosed subject matter is administered to a subject in need thereof. A “treatment effective amount” or a “therapeutic amount” is an amount of a therapeutic composition sufficient to produce a measurable response (e.g., a biologically or clinically relevant response in a subject being treated, such as but not limited to a reduction in seizure activity and/or in the incidence of death, particularly as compared to the same subject had the subject not received the composition). Actual dosage levels of active ingredients in the compositions of the presently disclosed subject matter can be varied so as to administer an amount of the active compound(s) that is effective to achieve the desired therapeutic response for a particular subject. The selected dosage level will depend upon the activity of the composition, the route of administration, combination with other drugs or treatments, the severity of the disease, disorder, and/or condition being treated, and the condition and prior medical history of the subject being treated. However, it is within the skill of the art to start doses of the compositions of the presently disclosed subject matter at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. The potency of a composition can vary, and therefore a “treatment effective amount” can vary. However, using the methods described herein, one skilled in the art can readily assess the potency and efficacy of a composition of the presently disclosed subject matter and adjust the therapeutic regimen accordingly.
After review of the disclosure of the presently disclosed subject matter presented herein, one of ordinary skill in the art can tailor the dosages to an individual subject, taking into account the particular formulation, method of administration to be used with the composition, and particular disease, disorder, and/or condition treated. Further calculations of dose can consider subject height and weight, severity and stage of symptoms, and the presence of additional deleterious physical conditions. Such adjustments or variations, as well as evaluation of when and how to make such adjustments or variations, are well known to those of ordinary skill in the art of medicine.
In some embodiments, a pharmaceutically or therapeutically effective amount of a IAA sequestration agent are delivered to the subject.
Suitable methods for administration of the compositions of the presently disclosed subject matter include, but are not limited to intravenous administration, oral delivery, and delivery directly to a target tissue or organ (e.g., the gut, topical application). Exemplary routes of administration include parenteral, enteral, intravenous, intraarterial, intracardiac, intrapericardial, intraosseal, intracutaneous, subcutaneous, intradermal, subdermal, transdermal, intrathecal, intramuscular, intraperitoneal, intrasternal, parenchymatous, oral, sublingual, buccal, inhalational, and intranasal. The selection of a particular route of administration can be made based at least in part on the nature of the formulation and the ultimate target site where the compositions of the presently disclosed subject matter are desired to act. In some embodiments, the method of administration encompasses features for regionalized delivery or accumulation of the compositions at the site in need of treatment. In some embodiments, the compositions are delivered directly into the site to be treated. By way of example and not limitation, in some embodiments a composition of the presently disclosed subject matter is administered to the subject via a route selected from the group consisting of intraperitoneal, intramuscular, intravenous, and intranasal, or any combination thereof.
The methods described herein use pharmaceutical compositions comprising the molecules described above, together with one or more pharmaceutically acceptable excipients or vehicles, and optionally other therapeutic and/or prophylactic ingredients. Such excipients include liquids such as water, saline, glycerol, polyethyleneglycol, hyaluronic acid, ethanol, cyclodextrins, modified cyclodextrins (i.e., sufobutyl ether cyclodextrins), etc. Suitable excipients for non-liquid formulations are also known to those of skill in the art. Pharmaceutically acceptable salts can be used in the compositions of the present invention and include, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
Additionally, auxiliary substances, such as wetting or emulsifying agents, biological buffering substances, surfactants, and the like, may be present in such vehicles. A biological buffer can be virtually any solution which is pharmacologically acceptable and which provides the formulation with the desired pH, i.e., a pH in the physiologically acceptable range. Examples of buffer solutions include saline, phosphate buffered saline, Tris buffered saline, Hank's buffered saline, and the like.
Depending on the intended mode of administration, the pharmaceutical compositions may be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, suspensions, creams, ointments, lotions or the like, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include an effective amount of the selected drug in combination with a pharmaceutically acceptable carrier and, in addition, may include other pharmaceutical agents, adjuvants, diluents, buffers, etc.
In some embodiments, the mode of administration is a solid dosage form, such as tablets and pills that are orally administered.
The compositions of the presently disclosed subject matter can be employed in any method or use for which sequestration of IAA could be desirable. In some embodiments, the presently disclosed subject matter thus relates to methods for reducing and/or delaying cognitive decline associated with neurodegenerative disease in a subject in need thereof. In some embodiments, the methods comprise, consist essentially of, or consist of administering to a subject in need an effective amount of a composition comprising, consisting essentially of, or consisting of an IAA sequestration agent, including but not limited to the oligonucleotides disclosed herein that comprise, consist essentially of, or consist of an IAA-binding sequence. As used herein, the phrase “reducing and/or delaying cognitive decline associated with neurodegenerative disease” refers to reducing and/or delaying any cognitive decline in the subject that is associated with (i.e., is a consequence of) a neurodegenerative disease in the subject as compared to the cognitive decline in the subject that would have occurred had the IAA sequestration agent not been administered to the subject.
In some embodiments, a neurodegenerative disease for which the compositions and methods of the presently disclosed subject matter would be appropriate is a neurodegenerative disease associated with activation of the TLR4 pathway, optionally activation of the TLR4 pathway in the brain. Although not wishing to be bound by any particular theory of operation, because IAA can induce expression of S100A8, which is involved in the TLR4 pathway, activation of the TLR4 pathway in brain, in some embodiments by IAA, can contribute to neurodegenerative disease and/or neurodegeneration. Exemplary neurodegenerative disease associated with TLR4 pathway activation include, but are not limited to stroke, ischemic reperfusion injury, age-related dementia, Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS).
Thus, in some embodiments the presently disclosed subject matter relates to methods for sequestering isoamyl alcohol (IAA) produced by microbiota in the gut of subjects. In some embodiments, the methods comprise, consist essentially of, of consist of administering to a subject in need thereof an effective amount of a composition an IAA sequestration agent, including but not limited to the oligonucleotides disclosed herein that comprise, consist essentially of, or consist of an IAA-binding sequence. As used herein, the phrase “sequestering isoamyl alcohol (IAA)” refers to any methodology wherein IAA produced by microbiota in the gut of a subject is removed from the subject's circulation or otherwise prevented from interacting with biological molecules present in the subject, particularly wherein those interactions would have negative consequences for the subject had the sequestration not taken place. An exemplary negative consequence is cognitive decline.
In some embodiments of the presently disclosed methods, the composition is administered orally.
In some embodiments of the presently disclosed methods, the composition is administered intravenously. In some embodiments, it is noted that any route of administration can be employed provided that the IAA sequestration agent can be delivered to a target in the subject, wherein the target is one where undesirable interactions between IAA produced by microbiota in the gut of the subject and a target cell, tissue, or organ occur.
In some embodiments, the subject is a mouse or a human.
The following EXAMPLES provide illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following EXAMPLES are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter.
Mice. Given women are more resilient than men in age-related cognitive decline studies, as well among men, mean age at first incidence of cognitive impairment is earlier than women, we used only male mice in this study. 6-8 weeks old (young group), 12-14 months old (middle aged group), 18-20 months old and 22-24 months old (aged group) male specific pathogen-free (SPF) C57BL/6 mice were purchased from the Jackson Laboratory (Bar Harbor, ME). 6-8 weeks old and 12-14 months old male C57BL/6 syngeneic germ-free (GF) mice were purchased from the National Gnotobiotic Rodent Resource Center (University of Northern Carolina, NC Chapel Hill, NC) and maintained in flexible film isolators (Taconic Farm) at the Clean Mouse Facility of the University of Louisville. Animal care was performed following the Institute for Laboratory Animal Research (ILAR) guidelines and all animal experiments were done in accordance with protocols approved by the University of Louisville Institutional Animal Care and Use Committee (IACUC, Louisville, KY). The mice were acclimated for at least 1 week before any experiments were conducted.
Clinical Samples. The study involved 24 healthy volunteers divided into a young group (25.6±4.2 years old, n=12) and an older group (65.3±5.6 years old, n=12) by age. The participants in the two groups were matched for age and gender. All clinical fecal samples from healthy volunteers were collected in the Department of Surgery, Huai'an First People's Hospital, Huai'an, Jiangsu, China with written informed consent from patients. Approval for the study was granted by the Institute Research Ethics Committee at the Health Department of Huai'an. All subjects provided signed informed consent to this study. Volunteers were recruited from the population in 2017 in Huai'an, Jiangsu, China. No subjects had a history of chronic gastrointestinal disease, taking antibiotics within three months of testing, alcohol abuse, or smoking.
Cell culture. The C57BL/6 syngeneic microglia BV2 cell line (American Type Culture Collection, Rockville, MD) was grown at 37° C. in 5% C02 in RPMI 1640 medium (Gibco), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, and 100 g/ml streptomycin.
Bacteria. Ruminococcaceae sp. (ATCC, TSD-27) was grown in brain heart infusion (BHI) medium at 37° C. in a BactronEZ SHEL LAB anaerobic chamber (Sheldon Manufacturing, Inc. Cornelius, OR). Lactobacillus rhamnosus GG (LGG, ATCC #53103, Manassas, VA) was grown in De Man, Rogosa and Sharpe (MRS) broth (Hardy Diagnostics, Santa Maria, CA) and incubated in anaerobic conditions also.
Isolation of microglia, neuron, astrocytes, and oligodendrocytes from the brain. Mice were anaesthetized with a mixture of ketamine (16%) and xylazine (3%) by intraperitoneal injection and then sacrificed under basal conditions by transcardial perfusion with perfusion buffer (Ca2+/Mg2+ free HBSS containing 0.5 mM EGTA, 10 mM HEPES and 4.2 mM NaHCO3; pH 7.2). The perfused brain was removed and gently mechanically disaggregated with tweezers in dissociation buffer (HBSS containing 10 mM HEPES and 4.2 mM NaHCO3 supplemented with Type I collagenase (0.05%), Dispase II (25 mg/ml), DNase I (2.5 mg/ml), trypsin inhibitor (50 g/ml); pH 7.5) followed by incubation at 37° C. for 1 hour. The tissue homogenate was centrifuged at 1,350×g for 5 minutes at 4° C. For the isolation of microglia, the digestion enzymes in the tissue homogenate were inactivated by addition of PBS/EDTA containing 5% fetal bovine serum (FBS) and the digested brain bits were triturated gently, passed over a 100 m filter (Fisher Scientific) and centrifuged. Cell pellets were resuspended in 10 ml RPMI/L glutamine, mixed gently with 4.5 ml of physiologic PERCOLL® (Sigma Aldrich), and centrifuged at 850×g for 40 minutes. The pellet of cells was rinsed in PBS. Any contaminating red blood cells (RBC) were lysed using RBC lysis buffer (Sigma) according to the manufacturer's instructions, rinsed twice with PBS and passed through a 40 m filter (Fisher Scientific). Cells were then stained for CD11b and CD45 for flow cytometry analysis. The astrocytes were isolated from mouse cortices (n=10). The tissue homogenate was centrifuged at 800×g for 10 minutes at 4° C. following digestion with type II collagenase (1 mg/ml) and type I DNase (10 U/ml) in DMEM for 10 minutes. The cells pelleted by centrifugation were plated in a 100 mm culture dish coated with poly-L-ornithine (Sigma). For the isolation of oligodendrocytes, the glial cells above were cultured in specific media containing T3 and T4 (0.5 mM) as well as platelet-derived growth factor (PDGF, 10 ng/ml) to promote the growth of the different cell types. Isolated glial cells were labelled with the following antibodies against surface markers: CD11b (Biolegend, Cat #101206), CD45 (Biolegend, Cat #147710), GFAP (Biolegend, Cat #837508) and MOG (Biorbyt, Cat #orb412341-FITC). Cells positive for CD11b and CD45Med were identified as microglia. Cells positive for GFAP and negative for CD45 and CD11b were identified as astrocytes. Cells sorted with MOG+CD11b− were identified as oligodendrocytes. Neurons were isolated from mouse brain using the Pierce Primary Neuron Isolation Kit (Thermo Scientific, Cat #88280). Briefly, the tissue homogenate from freshly dissected cortexes was suspended in an equal volume of ice cold HBSS (Sigma) and replaced with Neuronal Isolation Enzyme (with papain) in a 37° C. incubator for 30 minutes. After washing with HBSS, the tissue was cultured in a poly-D-lysine coated plate with Neuronal Culture Medium.
Isolation of phage from gut feces. One gram of fecal sample was weighed and homogenized in 40 mL of PBS with a benchtop homogenizer (MP Biomedical). The sample was then centrifuged at 17,000×g for 5 min and the supernatant was filtered sequentially through a 2 m and 0.45 m filter. Phages were then concentrated using a polyethylene glycol (PEG) method. Briefly, one molar solid NaCl and 10% (v/v) PEG 8000 (Sigma) were dissolved in PBS and incubated overnight at 4° C. as recommended for a constant and stable precipitation. The phages mixed in the solution were pelleted by centrifugation at 5,250×g for 1 hour at 4° C. and re-suspended in 500 μl of SM buffer (NaCl 100 mM, MgSO4·7H2O 8 mM, Tris-Cl 50 mM).
Phage DNA extraction and sequencing. Isolated phages were treated with 10 U/ml of DNase (Sigma) for 30 min at 37° C. followed by 10 min at 65° C. to inactivate the DNase. DNA was then extracted using the QIAamp DNA Microbiome Kit (Qiagen, 51704). Phage DNA was sequenced with the Illumina MiSeq Nano V2 PE_250 bases method using the Nextera XT Kit with an input of 1 ng DNA. All samples were sequenced using paired-end reads (numbers of reads mentioned in this manuscript always refer to paired-end reads). To identify viral genomes, raw sequencing fastq files were first converted to fasta files and duplicate sequences were removed using SeqKit v2.1.0. Then the viral genomes were searched to the NCBI complete RefSeq of viral sequences using BLASTn. Only perfectly matched sequences and high similarity of E-value<10-10 from BLASTn search were selected for further analysis. For taxonomic classification, sequences were assigned to different viral families according to ICTV-defined families and Virus-Host DB. Sequences assigned to multiple families were excluded and only sequences assigned to a unique family were used. Composition of taxonomic families were calculated based on the number of reads assigned to each family.
Microbiota 16S rRNA gene sequencing. Microbial genomic DNA from fecal samples was isolated with QIAamp DNA Stool Mini Kits (Qiagen), and bacterial strains were investigated using 16S rRNA gene sequencing. DNA (15 ng) was used as a template to amplify the 16S rRNA gene using a High Fidelity PCR system kit (Roche). The v1-v3 regions of 16S ribosomal RNA gene were amplified using 27f (AGAGTTTGATCCTGGCTCAG; SEQ ID NO: 1) and 534r (ATTACCGCGGCTGCTGG; SEQ ID NO: 2) primers (1 μM). The primers were anchored with adaptors (adaptor A: 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′; SEQ ID NO: 3) and adaptor B: 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3′; SEQ ID NO: 4) and Multiplex Identifiers (MIDs; 10 bp long). The multiplexed amplicons were purified using a QIAquick Gel Extraction Kit (Qiagen). The amplicon sequence was conducted using the 454 Jr. Sequencing platform. The 16S rRNA gene sequences were analyzed using QIIME platform scripts. The microbial classification was performed with the GreenGenes reference data base (gg_otus-13_8) using QIIME tools. By applying hierarchical clustering algorithms (HCAs), we determined the species clustering based on the operational taxonomic unit (OTU) using amplicon sequencing of 16S RNA. The reference sequences allowed sorting of the results into OTUs by clustering 97% sequence similarity (uclust) and classification according to various taxonomic ranks (phylum, order, class, family, genus, and species). The percentage of each bacterial species was virtualized with R software.
Quantitative Real-Time PCR (qPCR) analysis of mRNA expression. Total RNA was isolated from tissues and cells with a RNeasy mini kit (Qiagen). For analysis of gene mRNA expression, 1 g of total RNA was reverse transcribed by SuperScript III reverse transcriptase (Invitrogen) and quantitation was performed using primers (Eurofins) with SSOADVANCED™ Universal SYBR Green Supermix (BioRad); GAPDH was used for normalization. The primer sequences are listed in Table 3. qPCR was run using the BioRad CFX96 qPCR System with each reaction run in triplicate. Analysis and fold-change were determined using the comparative threshold cycle (Ct) method. The ratio of each gene to that of the internal control was calculated, and the relative expression levels are shown in the Figures. Gene expression was normalized to the control expression by calculating the Δ Ct=(Ct of control−Ct of the gene). Setting the expression value of GAPDH to 1.0, the relative expression values were calculated as 2ΔCt. The change in mRNA expression was calculated as fold-change.
Quantification of bacteria and phages by qPCR. For gut bacteria identification, qPCR was performed from gut microbiota-derived DNA extracted with QIAamp DNA Stool Mini Kit (Qiagen). All kits were used according to the manufacturer's instructions. Quantitation was performed using SSOADVANCED™ Universal SYBR Green Supermix (BioRad) and the bacterial specific primers listed. qPCR was run using the BioRad CFX96 qPCR System with each reaction run in triplicate. Analysis and fold-change were determined using the comparative threshold cycle (Ct) method.
Analysis of microbial metabolites using liquid chromatography-mass spectrometry (LC-MS). Fecal samples were suspended in PBS (1 g/ml). After centrifugation at 10,000×g for 10 min, the supernatant was collected for LC-MS analysis. LC-MS was carried out using a method as described in. Proteome Discoverer v1.4.1.114 (Thermo) was used to analyze the data collected by the mass spectrometer. The database used in Mascot v2.5.1 and SequestHT searches was the Feb. 17, 2017 version of the bacterial metabolites from UniprotKB (Proteome ID UP000000955). Scaffold was used to calculate the false discovery rate using the Peptide and Protein Prophet algorithms. Proteins were grouped to satisfy the parsimony principle. The proteins were clustered based on differential expression and heat maps representing differentially regulated proteins by GELNs were generated using software R.
High performance liquid chromatography (HPLC) analysis of microbial metabolites. The fecal samples and TSD-27 growth medium were diluted with an equal volume of methanol. After centrifugation at 10,000×g for 30 minutes, 50 μl of supernatant was used for HPLC analysis. The HPLC analysis was performed on an Agilent 1260 Infinity system equipped with an Agilent ZORBAX SB-C18 column (4.6×150 mm, 3.5 μm), having the following parameters: mobile phase A: 5 mM NH4Ac in water modified with 0.1% formic acid (v/v); mobile phase B: 5 mM NH4Ac in 90% acetonitrile modified with 0.1% formic acid (v/v); gradient: 5% B in first 5 minutes, 5-20% B for 10 minutes, hold 20% B for 5 minutes, 20%-50% B for 5 minutes, hold 50% B for 5 minutes, 50%-100% B for 5 minutes, hold 100% B for 10 minutes, 100-5% B for 5 minutes; flow rate: 1.0 ml/min; temperature: 30° C. FLD (ex=280 nm, em=350 nm) was used for detection of isoamylamine (IAA), crotonic acid (CA) and pyridoxine. The standard for IAA (cat #: 126810) and CA (cat #: 113018) were purchased from Sigma.
Interaction of S100p1-G and metabolite. Microglial BV2 cells (2×106) were transfected with biotinylated oligo S100p1-G or mutant using Lipofectamin RNAiMAX Reagent (Thermo Fisher) according to the manufacturer's instructions overnight at 37° C. 100 ml of aged mouse fecal supernatant (from one-gram feces) was added into the cell growth medium. After six hours, the cells were collected in RIPA lysis buffer. 100 mg of cell lysate was incubated with 50 ml of DYNABEADS® Streptavidin beads (Thermo Fisher) at room temperature for 1 h. The bio-oligo complex was eluted with biotin (4 mg/ml)) in 25 mM Tris-HCL containing 0.3 M NaCl (PH 8.5) at 95° C. for 5 minutes. Metabolite analysis was performed with LC-MS.
Flow cytometry. Isolated cells were incubated with blocking solution (0.5% BSA/PBS) for 15 minutes at 4° C. For surface staining, cells were stained with various antibodies at room temperature for 1 hour and then washed with PBS. Washed cells were stained for 40 minutes at 4° C. with the appropriate fluorochrome-conjugated antibodies in PBS with 2% FBS. Data were acquired using a BD FACSCalibur flow cytometer (BD Biosciences, San Jose, CA) and analyzed using FlowJo software (Tree Star Inc., Ashland, OR). The following antibodies purchased from Biolegend were used for flow cytometry: anti-CD11b (101208), anti-CD45 (103112) and FITC Annexin V (640945). For the ABs analysis, extracellular vesicles were collected. To recognize the ABs, as described previously, size gates set based on forward scatter (FSC) were applied in combination with Annexin V staining. From these vesicles total ABs were detected using Annexin V staining events.
Isolation of apoptotic bodies. Apoptotic bodies (ABs) were isolated from culture supernatants as previously described. Briefly, cell culture medium was harvested and cells were removed by pelleting at 335×g for 10 minutes. To remove cell-debris, supernatants were centrifuged at 1,000×g for 10 minutes, followed by another centrifugation at 2,000×g for 30 minutes to pellet ABs. Pelleted ABs were resuspended and washed with PBS.
Western blotting. Cells were treated as indicated in individual Figure legends and whole cell extracts (WCE) were prepared in the radioimmunoprecipitation assay (RIPA) buffer (Sigma) with addition of protease and phosphatase inhibitors (Roche). Proteins were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories, Inc., Hercules, CA). Dual color precision protein MW markers (BioRad) were separated in parallel. Antibodies were purchased as follows: cleaved-caspase-3 (ab214430), cleaved PARP (ab203467) and GAPDH (ab9657, Abcam) from Abcam; S100A8 (47310) and S100a9 (72590) from Cell Signaling; and Ltf (GTX81085) from GeneTex. The secondary antibodies conjugated to Fluors Alex-488 (A32723) or Alex-594 (A11012) were purchased from Invitrogen (Eugene, OR). The bands were visualized on the Odyssey Imager (LiCor Inc, Lincoln, NE).
Histological analysis. For hematoxylin and eosin (H&E) staining, tissues were fixed with buffered 10% formalin solution (SF93-20; Fisher Scientific, Fair Lawn, NJ) overnight at 4° C. Dehydration was achieved by immersion in a graded ethanol series of 70%, 80%, 95%, and 100% ethanol for 40 minutes each. Tissues were embedded in paraffin and subsequently cut into ultra-thin slices (5 μm) using a microtome. Tissues were deparaffinized by xylene (Fisher) and rehydrated by decreasing concentrations of ethanol and PBS. Tissue sections were stained with H&E and slides were scanned with an Aperio ScanScope. For frozen sections, tissues were fixed with periodate-lysine-paraformaldehyde (PLP) and dehydrated with 30% sucrose in PBS at 4° C. overnight. The sections were incubated overnight at 4° C. with anti-Iba1 (FujiFilm, #019-19741) and anti-CD-11b (Biolegend, #101204) diluted 1:100. The signal was visualized with the secondary antibodies conjugated to Fluors Alex-488 or Alex-594 (Invitrogen) and nuclei were stained with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI). The slides were scanned using an Aperio ScanScope or visualized using confocal laser scanning microscopy (Nikon, Melville, NY).
Apoptosis analysis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL). Formalin-fixed mouse lung tissues were embedded in paraffin and sectioned. TUNEL was used to detect apoptosis in the sections placed on slides according to the manufacturer's protocol. Tissue sections were analyzed to detect localized green fluorescence (GFP) of apoptotic cells using an in situ Cell Death Detection kit (Roche) and DAPI blue fluorescence to detect cell nuclei. The signal was visualized using confocal laser scanning microscopy (Nikon, Melville, NY).
Morris water maze (MWM) test. Mice were trained in a 122 cm diameter, 50 cm height open-field water maze with non-reflective interior surfaces. The pool water was filled with water maintained at 25±1° C. and mixed with non-toxic white tempera paint. Distinctive and extra-maze cues were marked on the wall at specific locations and were visible to the mice in the maze. Mice were removed from cages, placed into the water from quasi-random start points and allowed a maximum of 60 seconds to probe the escape platform. The inter interval of each trail remained for 15 seconds. For four consecutive days, four trials (training) were recorded each day with a final test on day 5 (
Novel object recognition (NOR) test. During the habituation phase, mice were allowed free exploration of a 40×40 cm open-field box for 5 min. The arena was thoroughly cleaned with 70% (v/v) ethanol between mouse use. On the first training run, two identical objects were placed in opposite quadrants of the box and the mice were allowed to familiarize themselves with the objects for 10 min. After 24 h, one of the objects was replaced by a novel one of different color and shape but in in the same location. Mice were removed from the cages and placed in the box. The time that mice spent in discovery of the familiar and the new object was recorded over a 10 min period. For four consecutive days, four trials (training) were recorded each day with a final test on day 5 (
T-maze test. To evaluate the cognitive impairment without requirement of full motor function, modified T-Maze test (Deacon and Rawlins, 2006) was carried out. Mice were gently handled, habituated to the T-Maze apparatus, and subjected to food deprivation. On the forced alternation sample trial (T1), the animals were exposed to the T-maze with one of the arms opened and rewarded with pellet at end of the arm. The opposite arm was blocked by a guillotine door. The mouse was allowed to explore the open arm and consume the reward. Ten consecutive trials were performed, then the mouse was removed. After 30 min, retrieval testing (T2) was performed. The blocked arm was opened and the mouse was placed in the same start position. If the mouse entered the previously blocked arm the response was recorded as “correct” and the animal received a reward. If the mouse entered the same arm as in T1, the mouse was confined for 10 seconds and this response was marked as an “Error”. Each mouse was subjected to 10 consecutive runs. Forced Alternation [%] was defined as the percent of mice first entering the novel arm during T2. For four consecutive days, four trials (training) were recorded each day with a final test on day 5 (
Electroencephalography (EEG) recording in mice. Groups of mice were anesthetized by peritoneal administration of ketamine (90 mg/kg) and xylazine (10 mg/kg) mixture. Mice that were not responsive to nociceptive stimuli were consider anesthetized and were administered the analgesic buprenorphine (0.1 mg/kg). The fur of the skull area was removed, placed on surgical bench and skin area were cleaned with betadine and 70% ethyl alcohol. The midline scalp skin was lifted using forceps and an incision made from the frontal cranial bone to the back of the parietal cranial bones. The skin was push aside and cleaned with betadine using cotton swabs. The skull was cleaned and marked for placement of electrodes. Two craniotomies 0.25-0.5 mm in diameter on the side of each hemisphere were established a 3 mm distance from the midline vertical fissure in the frontal and occipital regions; a hand-held drill (Kopf) with matching drill bits (0.5 mm) was used for the craniotomies. Four electrodes were placed in appropriate skull holes over the frontal cortex (FC) and occipital cortex (OC). A ground/reference electrode was also implanted in the most anterior region of cerebellum. Thus, two independent EEG channels were created for FC and OC on each side of the hemisphere. Tissue adhesive (Vetbond) was applied to fix the electrodes on the skull and dental acrylic cement (Fixodent ultra) was used to cover the entire open skull area to secure the electrodes. The mice were allowed to wake-up in a clean cage pre-warmed on a heating pad. EEG recordings were conducted spontaneously and simultaneously for 10-20 minutes when the subjects were awake using the Cascade PRO IONM system (Cadwell). EEG signals were amplified 1,000× and digitized at 1 kHz. Data was collected using a standard PC computer (Optiplex GX620, Dell) running CASCADE® IDNM software (Cadwell).
Single-strand gel shift (SSGS) assay. To identify the metabolite binding site of S100A8, we synthesized a series of oligonucleotides (oligos) (Eurofins Genomics LLC, KY) specific to the response putative IAA binding site at the promoter region of S100A8. The sequences of the oligos are listed in Table 5. The oligos (10 μmol) were incubated with 1 nM of IAA at 37° C. for 30 minutes following electrophoresis on a 15% native PAGE without SDS in 0.5×TBE buffer. The oligos were stained with ethidium bromide (0.5 g/ml) and visualized under ultraviolet (UV) light.
Surface plasmon resonance (SPR). To identify the binding activity of the metabolite IAA and S100A8 promoter sequence, SPR experiments were conducted on an OPENSPR™ (Nicoya, Lifesciences, CA). Experiments were performed on a streptavidin sensor (Nicoya, Lifesciences). SPR was run at a flow rate of 20 μl/min using HBS running buffer (20 mM HEPES, 150 mM NaCl, pH 7.4). First, the streptavidin sensor chip was cleaned with octyl β-D-glucopyranoside (40 mM) and CHAPS (20 mM). 200 μl of biotin-conjugated oligos (1 μg/ml, Table 5) were injected on the sensor chip for 10 minutes until a stable resonance was obtained. After immobilization of bio-oligo, the surface was blocked with BSA (3%) in running buffer. After a stable signal was obtained, IAA (10 nM) was run over the immobilized bio-oligo until a stable resonance was obtained. A negative control test was also performed by injecting IAA onto a blank sensor chip to check for non-specific binding. The sensograms were analyzed using TraceDrawer kinetic analysis software.
Chromatin immunoprecipitation assay. To identify the interaction of IAA and promoter of S100A8, 1 mg of IAA was labeled with biotin using the EZ-Link NHS-PEG4 Biotinylation kit (Thermo Fisher Sci., #21455) and excess biotin was removed using a desalting column. Biotinylated IAA was incubated with microglia BV2 cells for 3 h at 37° C. following 37% formaldehyde (final 1%) in 1 ml PBS for one more hour for cross-linking. The cell lysate was collected in 1 ml of RIPA buffer and sonication was used to shear the chromatin into 0.5˜1 kb fragment. Streptavidin Dynabeads (50 ml) were added to the DNA samples for 1 h at room temperature. PBS replaced the DNA and was incubated with the beads as the control to exclude non-specific interactions. After washing beads with PBS, biotinylated IAA was eluted from the beads with the biotin (4 mg/ml) in 25mMTris-HCL containing 0.3MNaCl (pH 8.5) as the elution buffer at room temperature for 1 h or 95° C. for 5 min. The supernatant was collected and the DNA was purified with acetic acid (2%, v/v) and dissolved into 10 ml of H2O. Two ml of DNA was used in quantitative PCR reactions using the primers of S100A8-ChIP in Table 3.
Construction of the S100A8 promoter into the luciferase plasmid vector. To determine the activity of IAA on the promoter of S100A8, a sequence containing 1,037 bp of S100A8 promoter (GENBANK® Accession #: L76381) upstream −1,037 to −1 from transcription start site (TSS) was constructed into the luciferase C1 vector (Addgene, #163523). A DNA fragment was generated by PCR amplification with genomic DNA extracted from mouse liver tissue using DNeasy Blood & Tissue Kits (Qiagen, #69504). PCR was conducted using Q5 High-Fidelity PCR kit (New England Biolabs® Inc.) with the primers 51008A-prom, pLuc163523 and genomic DNA, and luciferase C1 plasmid as the template, respectively. The primer sequences are listed in Table 3. The two PCR products purified using the Gel extraction kit (Qiagen) were seamlessly assembled into the pLuc-S100p using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs® Inc.). The plasmid pLuc-S100p was transformed into DH5a and selected using kanamycin resistance. The DNA sequence was confirmed by DNA sequencing.
Site-directed mutagenesis within the S100A8 promoter. A mutant of IAA with the potential binding site on the S100A8 promoter was generated with the oligonucleotide primer S1008A-prom-Mut, which was designed to specifically disrupt the putative S100A8 binding site at its promoter (
Ruminococcaceae
Clostridiaceae
Lachnospiraceae
Nucleic acid unwinding assay. Helicase reactions were carried out in triplicate in 96-well plates. To prepare DNA substrate, 20 μM single strand DNA (WT: 5′-Cy3-GTGGGCAGCTGGCCAA-BHQ1-3′ (SEQ ID NO: 5); Mutant: 5′-Cy3-GTATGCAGCTGGATAA-BHQ1-3′ (SEQ ID NO: 6; Eurofins Genomics LLC, KY) were denatured at 95° C. for 5 minutes in the reaction buffer (25 mM Tris HCl pH 7.5, 100 mM NaCl, 15 mM MgCl2, 1 mM DTT, 0.1 mg/ml BSA) and cooled slowly to room temperature before add IAA (100 nM) and/or helicase (100 g/ml). After ATP (2 mM) was added to initiate the helicase activity, the fluorescence value was recorded using a microplate reader with an excitation wavelength of 550 and an emission wavelength of 570. BHQ: black-hole quencher.
IAA depletion from gut supernatant. To remove the IAA from gut fecal supernatant, biotin-binding oligo S1001p-G (1 nM/ml, Eurofins) was incubated with fecal supernatant (1 g feces/ml) in PBS for 1 hour at room temperature. 100 μl of Dynabeads MYONE™ streptavidin (Thermo fisher) were incubated with the oligo/supernatant for 30 minutes and the tube containing the solution was place on a magnet for 1 minute. The supernatant was collected and the IAA level was estimated by HPLC.
Quantification and statistical analysis. Unless otherwise indicated, all statistical analyses in this study were performed using SPSS 16.0 software (Gouda, 2015). The data are presented as values with standard deviation (as the mean±SD). The significance of differences in mean values between two groups was analyzed using the Student's t-test. Differences between individual groups were analyzed via one- or two-way ANOVA. Differences between percentages of bacterial composition were analyzed with a chi-square test. Differences were considered significant when the P-value was less than 0.05 or 0.01. A P value greater than 0.05 was considered non-significant (NS). Both animals and human subjects were randomly assigned to a control group and different experimental condition groups matched for age and sex using simple randomization. Double-blinded studies were used for animal and human subject studies. Unless otherwise indicated, the mice used in the in vivo study were male C57BL/6 mice. Using one-way ANOVA comparing up to four groups, for a power of 0.7, a large effect size (0.75) and a significance level of 0.05, the minimum sample size needed in each group was 4.992 (rounded=5; Festing and Aktnab, 2002). The reported “n” in animal and human studies represents the number of animals and human subjects. Data are representative of at least three independent experiments.
Given the death of brain cells including neuron, oligodendrocytes, microglia, and astrocytes is one of hallmark of cognitive decline in aging, and apoptotic cells (Annexin V+7−AAD−) were quantitatively analyzed from mice at different ages from 2 to 24 months. We found that microglia exhibited significant earlier apoptosis, starting in 12-month-old mice, whereas this phenomenon was not seen in neurons, astrocytes, and oligodendrocytes until approximately 18 months (
Microglia, the principal sentinels of the brain, sense changes in their environment and respond to invading pathogens, toxins, and cellular debris via expressing a cluster of genes that allow them to perform their sensing functions termed the sensome. With aging, the expression of sensome transcripts are altered. Thus, the sensome expressed in the microglia of brain from 2 months (young) and 12 months (aged) old mice was quantitively analyzed (
-GMP
indicates data missing or illegible when filed
Sequence identifiers for primers in Table 1: P2ry12 (Forward primer: SEQ ID NO: 40; reverse primer SEQ ID NO: 41), P2ryl3 (Forward primer: SEQ ID NO: 42; reverse primer SEQ ID NO: 4), P2ry6 (Forward primer: SEQ ID NO: 44; reverse primer SEQ ID NO: 45), Gpr34 (Forward primer: SEQ ID NO: 46; reverse primer SEQ ID NO: 47), Adora3 (Forward primer: SEQ ID NO: 48; reverse primer SEQ ID NO: 49), Entpd1 (Forward primer: SEQ ID NO: 50; reverse primer SEQ ID NO: 51), Tmem173 (Forward primer: SEQ ID NO: 52; reverse primer SEQ ID NO: 53), Csf1r (Forward primer: SEQ ID NO: 54; reverse primer SEQ ID NO: 55), Csf3r (Forward primer: SEQ ID NO: 56; reverse primer SEQ ID NO: 57), Tgfbr1 (Forward primer: SEQ ID NO: 58; reverse primer SEQ ID NO: 59), Tgfbr2 (Forward primer: SEQ ID NO: 60; reverse primer SEQ ID NO: 61), Jfngr1 (Forward primer: SEQ ID NO: 62; reverse primer SEQ ID NO: 63), I110ra (Forward primer: SEQ ID NO: 64; reverse primer SEQ ID NO: 65), I16ra (Forward primer: SEQ ID NO: 66; reverse primer SEQ ID NO: 67), I121r (Forward primer: SEQ ID NO: 68; reverse primer SEQ ID NO: 69), Tnfrsf17 (Forward primer: SEQ ID NO: 70; reverse primer SEQ ID NO: 71), Tnfrsf1b (Forward primer: SEQ ID NO: 72; reverse primer SEQ ID NO: 73), Cx3cr1 (Forward primer: SEQ ID NO: 74; reverse primer SEQ ID NO: 75), Ccr5 (Forward primer: SEQ ID NO: 76; reverse primer SEQ ID NO: 77), C3ar1 (Forward primer: SEQ ID NO: 78; reverse primer SEQ ID NO: 79), Ptafr (Forward primer: SEQ ID NO: 80; reverse primer SEQ ID NO: 81), Gpr77 (Forward primer: SEQ ID NO: 82; reverse primer SEQ ID NO: 83), Cmk1r1 (Forward primer: SEQ ID NO: 84; reverse primer SEQ ID NO: 85), Cys1tr1 (Forward primer: SEQ ID NO: 86; reverse primer SEQ ID NO: 87), Ccr12 (Forward primer: SEQ ID NO: 88; reverse primer SEQ ID NO: 89), Cmtm6 (Forward primer: SEQ ID NO: 90; reverse primer SEQ ID NO: 91), C5ar1 (Forward primer: SEQ ID NO: 92; reverse primer SEQ ID NO: 93), Fcgr3 (Forward primer: SEQ ID NO: 94; reverse primer SEQ ID NO: 95), Fcer1g (Forward primer: SEQ ID NO: 96; reverse primer SEQ ID NO: 97), Fcgr2b (Forward primer: SEQ ID NO: 98; reverse primer SEQ ID NO: 99), Fcgr1 (Forward primer: SEQ ID NO: 100; reverse primer SEQ ID NO: 101), Cmtm7 (Forward primer: SEQ ID NO: 102; reverse primer SEQ ID NO: 103), Fer11 (Forward primer: SEQ ID NO: 104; reverse primer SEQ ID NO: 105), Fcgr4 (Forward primer: SEQ ID NO: 106; reverse primer SEQ ID NO: 107), Se1p1g (Forward primer: SEQ ID NO: 108; reverse primer SEQ ID NO: 109), Ly86 (Forward primer: SEQ ID NO: 110; reverse primer SEQ ID NO: 111), Cd68 (Forward primer: SEQ ID NO: 112; reverse primer SEQ ID NO: 113), Trem2 (Forward primer: SEQ ID NO: 114; reverse primer SEQ ID NO: 115), Cd180 (Forward primer: SEQ ID NO: 116; reverse primer SEQ ID NO: 117), Tlr2 (Forward primer: SEQ ID NO: 118; reverse primer SEQ ID NO: 119), Cd37 (Forward primer: SEQ ID NO: 120; reverse primer SEQ ID NO: 121), Tlr7 (Forward primer: SEQ ID NO: 122; reverse primer SEQ ID NO: 123), Cd14 (Forward primer: SEQ ID NO: 124; reverse primer SEQ ID NO: 125), Clec4a3 (Forward primer: SEQ ID NO: 126; reverse primer SEQ ID NO: 127), Tlr4 (Forward primer: SEQ ID NO: 128; reverse primer SEQ ID NO: 129), Tlr13 (Forward primer: SEQ ID NO: 130; reverse primer SEQ ID NO: 131), Clec5a (Forward primer: SEQ ID NO: 132; reverse primer SEQ ID NO: 133), Havcr2 (Forward primer: SEQ ID NO: 134; reverse primer SEQ ID NO: 135), Clec7a (Forward primer: SEQ ID NO: 136; reverse primer SEQ ID NO: 137), Cxcl16 (Forward primer: SEQ ID NO: 138; reverse primer SEQ ID NO: 139), Cd48 (Forward primer: SEQ ID NO: 140; reverse primer SEQ ID NO: 141), Ltf (Forward primer: SEQ ID NO: 142; reverse primer SEQ ID NO: 143), Cd74 (Forward primer: SEQ ID NO: 144; reverse primer SEQ ID NO: 145), Upk1b (Forward primer: SEQ ID NO: 146; reverse primer SEQ ID NO: 147), Tlr12 (Forward primer: SEQ ID NO: 148; reverse primer SEQ ID NO: 149), Tlr1 (Forward primer: SEQ ID NO: 150; reverse primer SEQ ID NO: 151), Tlr6 (Forward primer: SEQ ID NO: 152; reverse primer SEQ ID NO: 153), Ifitm6 (Forward primer: SEQ ID NO: 154; reverse primer SEQ ID NO: 155), Itgam (Forward primer: SEQ ID NO: 156; reverse primer SEQ ID NO: 157), Itgb2 (Forward primer: SEQ ID NO: 158; reverse primer SEQ ID NO: 159), Itgb5 (Forward primer: SEQ ID NO: 160; reverse primer SEQ ID NO: 161), Emr1 (Forward primer: SEQ ID NO: 162; reverse primer SEQ ID NO: 163), Ecscr (Forward primer: SEQ ID NO: 164; reverse primer SEQ ID NO: 165), Lair1 (Forward primer: SEQ ID NO: 166; reverse primer SEQ ID NO: 167), Siglech (Forward primer: SEQ ID NO: 168; reverse primer SEQ ID NO: 169), Slco2b1 (Forward primer: SEQ ID NO: 170; reverse primer SEQ ID NO: 171), Slc2a5 (Forward primer: SEQ ID NO: 172; reverse primer SEQ ID NO: 173), S100a8 (Forward primer: SEQ ID NO: 174; reverse primer SEQ ID NO: 175), S100a9 (Forward primer: SEQ ID NO: 176; reverse primer SEQ ID NO: 177), Lgals9 (Forward primer: SEQ ID NO: 178; reverse primer SEQ ID NO: 179), Gpr183 (Forward primer: SEQ ID NO: 180; reverse primer SEQ ID NO: 181), Tmem37 (Forward primer: SEQ ID NO: 182; reverse primer SEQ ID NO: 183), Cd33 (Forward primer: SEQ ID NO: 184; reverse primer SEQ ID NO: 185), Gpr84 (Forward primer: SEQ ID NO: 186; reverse primer SEQ ID NO: 187), Slc7a7 (Forward primer: SEQ ID NO: 188; reverse primer SEQ ID NO: 189), Cd52 (Forward primer: SEQ ID NO: 190; reverse primer SEQ ID NO: 191), Siglec5 (Forward primer: SEQ ID NO: 192; reverse primer SEQ ID NO: 193), Cd79b (Forward primer: SEQ ID NO: 194; reverse primer SEQ ID NO: 195), Slc16a3 (Forward primer: SEQ ID NO: 196; reverse primer SEQ ID NO: 197), Icam1 (Forward primer: SEQ ID NO: 198; reverse primer SEQ ID NO: 199), Icam4 (Forward primer: SEQ ID NO: 200; reverse primer SEQ ID NO: 201), Cd84 (Forward primer: SEQ ID NO: 202; reverse primer SEQ ID NO: 203), Lag-3 (Forward primer: SEQ ID NO: 204; reverse primer SEQ ID NO: 205), Cd86 (Forward primer: SEQ ID NO: 206; reverse primer SEQ ID NO: 207), Ptprc (Forward primer: SEQ ID NO: 208; reverse primer SEQ ID NO: 209), Dap12 (Forward primer: SEQ ID NO: 210; reverse primer SEQ ID NO: 211), Tnfrsf13b (Forward primer: SEQ ID NO: 212; reverse primer SEQ ID NO: 213), Tnfrsf17 (Forward primer: SEQ ID NO: 214; reverse primer SEQ ID NO: 215), Cd22 (Forward primer: SEQ ID NO: 216; reverse primer SEQ ID NO: 217), Tmem119 (Forward primer: SEQ ID NO: 218; reverse primer SEQ ID NO: 219), Cd53 (Forward primer: SEQ ID NO: 220; reverse primer SEQ ID NO: 221), Slamf9 (Forward primer: SEQ ID NO: 222; reverse primer SEQ ID NO: 223), Clec4b1 (Forward primer: SEQ ID NO: 224; reverse primer SEQ ID NO: 225), Lilra5 (Forward primer: SEQ ID NO: 226; reverse primer SEQ ID NO: 227), mGapdh (Forward primer: SEQ ID NO: 228; reverse primer SEQ ID NO: 229), mActb (Forward primer: SEQ ID NO: 230; reverse primer SEQ ID NO: 231), and mRn18s (Forward primer: SEQ ID NO: 232; reverse primer SEQ ID NO: 233)
Although the role of S100A8/A9 in the regulation of amyloid peptide and Tau phosphorylation (Cristóvão and Gomes, 2019) has been reported, the relationship between S100A8/S100A9 and microglia death was not clear. We transfected CRISPR activation plasmid and CRISPR-Cas9 knockout (KO) plasmid to overexpress and KO the expression of S100A8 and S100A9 in microglial BV2 cells. We found that the cleaved caspase-3, a marker of a dying cell, was induced by the overexpression of S100A8 but not S100A9. Knockout of S100A8 but not S100A9 caused a reduction of cleaved caspase-3 (
The gut microbiota can help to modulate homeostasis and behavior in its animal host through chemical communication with the nervous system. To determine whether gut microbe metabolites contribute to the modulation of microglia death in aging, we performed a comparative metabolomics analysis of the gut microbe from specific pathogen-free (SPF) and germ-free (GF) mice at different ages. A total of 442 microbial metabolites were identified in the murine gut based on the MetAboliC pAthways DAtabase for Microbial taxonomic groups (MACADAM) and MetaCyc database (
To determine whether IAA and CA have direct effects on the induction of apoptosis of microglial cells, the microglial cells were isolated from mice brains. We found that adding IAA and CA to the ex vivo cultured microglial cells isolated from young mice led to increasing the cleaved caspase-3 and cleaved poly(-ADP-ribose) polymerase (PARP) (
To determine whether specific bacteria contribute to the apoptosis of microglia in aging, the composition of gut bacteria in humans at different ages was assessed using next generation sequencing (NGS) of 16s ribosomal RNA (rRNA). We applied principal coordinates analyses (PCoA) to UniFrac distances of 16S rRNA amplicon profiles generated from fecal samples collected from young (25.6±4.2 years old, n=12) and old (65.3±5.6 years old, n=12) healthy human subjects (
composition
(%)
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
—
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
_
indicates data missing or illegible when filed
Differences in microbiome composition between the two groups were observed by PCoA analysis (
Given induction of bacterial metabolite IAA causes the degeneration of microglia by elevation of S100A8 at both the transcription and protein level, we hypothesized that IAA might directly target the promoter of S100A8 and regulate the expression of S100A8. Studying the interaction of metabolites, particularly small molecules, with nucleic acid is challenging due to a lack of appropriate tags for the metabolites. Because of this challenge, we developed a strategy raising the possibility to investigate the interaction of small molecules and nucleic acid. Considering that the single strand nucleic acid chain exhibits conformational differences on nondenaturing polyacrylamide gel electrophoresis (PAGE), we assumed that single-strand DNA will display an electrophoretic mobility shift on native PAGE when the small molecules bind to DNA, which is named as single-strand gel shift (SSGS;
To test our hypothesis, we first synthesized short single-DNA strains (around 60 mer length each) whose sequences spanned the promoter of S100A8 (
This finding was significant in that it provided a basis for developing mechanism-driven novel approaches for studying gut metabolites as signaling conduits that interconnect extrinsic microbial presence with activity of brain microglial cells and provided the foundation for further studying whether other gut microbiome derived small molecules are also capable of regulating the activity of transcription machinery in general.
Next, we addressed how a small molecule like IAA could activate the expression of S100A8. The prediction of transcription factor binding sites using PROMO 3.0 indicated that the binding sequence resides at a p53 binding motif (GGGCAGC). Although IAA activates the transcription of S100A8 (
To ascertain the effect of IAA or Ruminococcaceae targeting phage on microglia and brain function in vivo, the young or aged mice were treated with IAA or phageTSD-27 respectively, for two months via oral gavage prior to behavioral testing (
To verify the finding in the MWM test, we next estimated the cognitive ability of mice using the TMSA. For the purposes of analysis, the percentage of correct choices was used to distinguish the difference between aged mice and young mice as well as treatment groups (
Electroencephalography (EEG) is widely utilized for behavioral and pharmacological studies in animal models as well as in humans because it is noninvasive, provides high performance, and is convenient. To determine whether EEG phenotypes between young and aged mice are different and if the IAA or phage treatment influences EEG phenotypes, we captured the epidural EEG from multiple cortical surface loci in mice using a modified method. By designing an epidural EEG electrode, we simplified the surgical procedure to minimize brain damage and optimized the experimental setup for EEG in mice (
Next, we determined whether depletion of gut bacterial metabolite IAA would prevent gut metabolite mediated induction of cognitive dysfunction. Given that S100p1-G can specifically bind to IAA, we hypothesized that IAA from gut fecal supernatant could be depleted with oligo S100p1-G (
Beyond verifying the biological role of IAA in induction of cognitive dysfunction, S100p1-G-based therapy may be beneficial for improving or reversing the cognitive decline. To estimate the stability of small DNA oligo in stomach and intestine, the 20 nt oligo S100p1-G was exposed to gastric and intestine juice collected from mouse for 3 h. The electrophoresis indicated that the oligo is stable in gastric and intestine juice. This result is also supported by others. HPLC analysis suggested that the majority of the IAA (78.4%±8.2%) in the gut supernatant (Sup) of aged mice could be depleted by biotin-S100p1-G pull-down using streptavidin beads (IAAdep) but not by control S100p1-G mutant (Ctrldep) (
From a therapeutic standard point, we next sought to determine whether oligo S100p1-G could reverse the brain cognitive dysfunction in aged mice by blocking IAA. S100p1-G was administered to aged mice via an intravenous route twice a week for 2 months. Memory and spatial learning were recovered by treatment with S100p1-G (
Despite advances in metabolic techniques, a complete portrait of the metabolism and its complement of dynamic interactions with DNA remains unrealized. Specifically, traditional biological and analytical approaches have not been able to address key questions relating to the interactions of DNA with small molecules, including drugs, drug candidates, and metabolites. The introduction of a simple and effective strategy such as the SSGS technology we developed in this study in combination with other metabolic technologies to parse and enrich subsets of the “functional” small molecules that bind to DNA will allow scientists to delve more deeply and precisely into the gene expression state of cells. Additionally, this technology will facilitate researchers to explore perturbations by small molecules to overcome limitations of biological approaches to enable the selective marking and functional investigation of critical DNA-small-molecule interactions in biological environments such as a gut microbiome-enriched environment.
Recent advances in metabolic technologies have greatly enhanced our understanding of metabolites as a complement to the genome and have provided valuable insight into numerous physiological processes and disease mechanisms. However, such methods alone do not capture the myriad of post-metabolite events such as gut microbiome-derived metabolites and molecular interactions that can affect gene expression. The dramatic contextual and temporal variability of metabolites is part of what sets it apart from the relatively stable genome, limiting the reach of genome-based strategies to study metabolites and their interactions. Our approach as described in this study provides a foundation for further studying the mechanism underlying how temporal variability of the metabolites, such as gut metabolites generated under physiological versus pathophysiological conditions, has an effect on gene expression.
Traditional biological approaches, including the genetic incorporation of affinity tags and the creation of selective antibodies, have been transformative for the detection of protein-protein interactions. However, this approach does not apply to small molecules because unlike proteins that are relatively large, when a tag is incorporated into a small molecule, like a drug or metabolite, the tag likely perturbs the ability of the small molecule to interact with DNA. Investigating small molecules without labeling them as with the SSGS technology we developed in this study has bridged this experimental gap to demonstrate small molecule binding to DNA. This technology allows for the screening of many small molecules that potentially bind to DNA in a DNA sequencing-specific manner for downstream investigations.
With this technology, it was discovered that IAA and p53 jointly activate S100A8 signaling of microglia leading to cognitive decline in aged mice. p53, a TF discovered 40 years ago, is one of the most extensively studied genes (Levine and Oren, 2009) and has previously been implicated in neurodegeneration. A significant increase in (Levine and Oren, 2009) p53 levels and activity was detected in postmortem CNS tissues of patients with ALS as well as in other neurodegenerative diseases, including Alzheimer disease, Parkinson disease, and Huntington disease. As disclosed herein, we uncovered aging-dependent induction of IAA that advances p53 accessibility to the promoter region of S100A8 by shaping the hairpin structure of S100A8 promoter region.
Using IAA as a proof of concept, we have demonstrated that shifting gut metabolites can be a signaling conduit that interconnects the extrinsic microbial environment with activity of brain microglial cells and provides a foundation for further studying whether other gut microbiome-derived metabolites are also capable of regulating the activity of TFs in general.
Unlike a standard ChIP assay that generates background noises/off-target signals, with PCR technology in combination with the ChIP assay, we can not only confirm the specific interaction of S100A8 promoter with IAA, but this method also provides a strategy to investigate whether other detected signals generated from the ChIP assay are actually signals due to IAA treatment.
The present disclosure also demonstrated that specific sequencing of S100A8 promoter is required for IAA binding. The docking analysis indicated that the IAA butan-1-amine carrying a methyl substituent at position 3 is required for the recognition of the oligo S100p1-G binding motif (-NTGGNCAGCTGNCCA-) via binding to the 4th and 11th guanine base of S100p1-G with the hydrogen bonds. This docking analysis also agrees with our experimental data presented in
The G-rich DNA oligo is able to distinguish one atomic difference between small molecule ochratoxin analogs A (OTA) and OTB, showing specificity recognition and affinity among hundreds of aptamers for small molecules. Given the S100p1-G is G enriched, the selectivity of interaction between S100A8 and IAA could be contributed by specific tertiary (3D) structure of DNA and a high level of G enrichment.
Additionally, we also found that the microbiome-bacteriophage-metabolite axis is dysregulated during aging, leading to induction of IAA that impairs microglial cell function, contributing to exacerbated brain memory loss. In this study, we show that the IAA-mediated pathological effect can be prevented. We have demonstrated that S100p1-G oligo prevents the IAA-induced memory loss. The significance of this finding lies not only in developing personalized oligo therapy to delay aging but also holds the potential to change the therapeutic landscape for many neurological and non-neurological conditions by oligo-mediated manipulation of gut metabolite activity.
The presently disclosed subject matter focused on exploring the effects of the microbiome/bacteriophage-regulated IAA on microglial cell activation including apoptosis and inflammation, which may impact downstream neuron function in both direct and indirect manners. The pathways regulated by IAA in neuron cells and microglial cells in the later stages of aging may necessitate cross talk to have an effect on downstream brain function and inflammation.
All references listed throughout the instant disclosure, including but not limited to all patents, patent applications and publications thereof, scientific journal articles, and database entries (e.g., GENBANK® biosequence database) are incorporated herein by reference in their entireties to the extent that they supplement, explain, and/or teach methodology, techniques, and/or compositions employed herein.
It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.
ca
agctttcctctataaaagcagctgacacttagcctcacat
This application claims the benefit of U.S. Provisional Application No. 63/505,372, filed on May 31, 2023, which is incorporated herein by reference in its entirety.
This invention was made with government support under grant number AT008617 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63505372 | May 2023 | US |
