COMPOUNDS AND METHODS FOR MODULATING SPLICING

Information

  • Patent Application
  • 20250154169
  • Publication Number
    20250154169
  • Date Filed
    August 30, 2022
    3 years ago
  • Date Published
    May 15, 2025
    11 months ago
Abstract
The present disclosure features compounds and related compositions that, inter alia, modulate nucleic acid splicing, e.g., splicing of a pre-mRNA, as well as methods of use thereof.
Description
BACKGROUND

Alternative splicing is a major source of protein diversity in higher eukaryotes and is frequently regulated in a tissue-specific or development stage-specific manner. Disease associated alternative splicing patterns in pre-mRNAs are often mapped to changes in splice site signals or sequence motifs and regulatory splicing factors (Faustino and Cooper (2003), Genes Dev 17(4):419-37). Current therapies to modulate RNA expression involve oligonucleotide targeting and gene therapy; however, each of these modalities exhibit unique challenges as currently presented. As such, there is a need for new technologies to modulate RNA expression, including the development of small molecule compounds that target splicing.


SUMMARY

The present disclosure features compounds and related compositions that, inter alia, modulate nucleic acid splicing, e.g., splicing of a pre-mRNA, as well as methods of use thereof. In an embodiment, the compounds described herein are compounds of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, or stereoisomers thereof. The present disclosure additionally provides methods of using the compounds of the invention (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof), and compositions thereof, e.g., to target, and in embodiments bind or form a complex with, a nucleic acid (e.g., a pre-mRNA or nucleic acid component of a small nuclear ribonucleoprotein (snRNP) or spliceosome), a protein (e.g., a protein component of an snRNP or spliceosome, e.g., a member of the splicing machinery, e.g., one or more of the U1, U2, U4, U5, U6, U11, U12, U4atac, U6atac snRNPs), or a combination thereof. In another aspect, the compounds described herein may be used to alter the composition or structure of a nucleic acid (e.g., a pre-mRNA or mRNA (e.g., a pre-mRNA and the mRNA which arises from the pre-mRNA), e.g., by increasing or decreasing splicing at a splice site. In some embodiments, increasing or decreasing splicing results in modulating the level of a gene product (e.g., an RNA or protein) produced.


In another aspect, the compounds described herein may be used for the prevention and/or treatment of a disease, disorder, or condition, e.g., a disease, disorder or condition associated with splicing, e.g., alternative splicing. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a proliferative disease, disorder, or condition (e.g., a disease, disorder, or condition characterized by unwanted cell proliferation, e.g., a cancer or a benign neoplasm) in a subject. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a non-proliferative disease, disorder, or condition. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a neurological disease or disorder, an autoimmune disease or disorder, immunodeficiency disease or disorder, a lysosomal storage disease or disorder, a cardiovascular disease or disorder, a metabolic disease or disorder, a respiratory disease or disorder, a renal disease or disorder, or an infectious disease in a subject.


In another aspect, the present disclosure features a compound of Formula (I):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A, B, X, Y, Z, L1, L2, R2, m, and subvariables thereof are as described herein.


In another aspect, the present disclosure features a compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A, B, M, P, W, U, X, Y, Z, L1, L2, and subvariables thereof are as described herein


In another aspect, the present invention provides pharmaceutical compositions comprising a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), or (I-i)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, and optionally a pharmaceutically acceptable excipient. In an embodiment, the pharmaceutical compositions described herein include an effective amount (e.g., a therapeutically effective amount) of a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In another aspect, the present disclosure provides methods for modulating splicing, e.g., splicing of a nucleic acid (e.g., a DNA or RNA, e.g., a pre-mRNA) with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In another aspect, the present disclosure provides compositions for use in modulating splicing, e.g., splicing of a nucleic acid (e.g., a DNA or RNA, e.g., a pre-mRNA) with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. Modulation of splicing may comprise impacting any step involved in splicing and may include an event upstream or downstream of a splicing event. For example, in some embodiments, the compound of Formula (I) or (II) binds to a target, e.g., a target nucleic acid (e.g., DNA or RNA, e.g., a precursor RNA, e.g., a pre-mRNA), a target protein, or combination thereof (e.g., an snRNP and a pre-mRNA). A target may include a splice site in a pre-mRNA or a component of the splicing machinery, such as the U1 snRNP. In some embodiments, the compound of Formula (I) or (II) alters a target nucleic acid (e.g., DNA or RNA, e.g., a precursor RNA, e.g., a pre-mRNA), target protein, or combination thereof. In some embodiments, the compound of Formula (I) or (II) increases or decreases splicing at a splice site on a target nucleic acid (e.g., an RNA, e.g., a precursor RNA, e.g., a pre-mRNA) by about 0.5% or more (e.g., about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 75%, 90%, 95%, or more), relative to a reference (e.g., the absence of a compound of Formula (I) or (II), e.g., in a healthy or diseased cell or tissue). In some embodiments, the presence of a compound of Formula (I) or (II) results an increase or decrease of transcription of a target nucleic acid (e.g., an RNA) by about 0.5% or more (e.g., about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 75%, 90%, 95%, or more), relative to a reference (e.g., the absence of a compound of Formula (I) or (II), e.g., in a healthy or diseased cell or tissue).


In another aspect, the present disclosure provides methods for preventing and/or treating a disease, disorder, or condition in a subject by administering a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or related compositions. In some embodiments, the disease or disorder entails unwanted or aberrant splicing. In some embodiments, the disease or disorder is a proliferative disease, disorder, or condition. Exemplary proliferative diseases include cancer, a benign neoplasm, or angiogenesis. In other embodiments, the present disclosure provides methods for treating and/or preventing a non-proliferative disease, disorder, or condition. In still other embodiments, the present disclosure provides methods for treating and/or preventing a neurological disease or disorder, autoimmune disease or disorder, immunodeficiency disease or disorder, lysosomal storage disease or disorder, cardiovascular disease or disorder, metabolic disease or disorder, respiratory disease or disorder, renal disease or disorder, or infectious disease.


In another aspect, the present disclosure provides methods of down-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides methods of up-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides methods of altering the isoform of a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m))) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. Another aspect of the disclosure relates to methods of inhibiting the activity of a target protein in a biological sample or subject. In some embodiments, administration of a compound of Formula (I) or (II) to a biological sample, a cell, or a subject comprises inhibition of cell growth or induction of cell death.


In another aspect, the present disclosure provides compositions for use in preventing and/or treating a disease, disorder, or condition in a subject by administering a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or related compositions. In some embodiments, the disease or disorder entails unwanted or aberrant splicing. In some embodiments, the disease or disorder is a proliferative disease, disorder, or condition. Exemplary proliferative diseases include cancer, a benign neoplasm, or angiogenesis. In other embodiments, the present disclosure provides methods for treating and/or preventing a non-proliferative disease, disorder, or condition. In still other embodiments, the present disclosure provides methods for treating and/or preventing a neurological disease or disorder, autoimmune disease or disorder, immunodeficiency disease or disorder, lysosomal storage disease or disorder, cardiovascular disease or disorder, metabolic disease or disorder, respiratory disease or disorder, renal disease or disorder, or infectious disease.


In another aspect, the present disclosure provides compositions for use in down-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides compositions for use in up-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides compositions for use in altering the isoform of a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m))) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. Another aspect of the disclosure relates to compositions for use in inhibiting the activity of a target protein in a biological sample or subject. In some embodiments, administration of a compound of Formula (I) or (II) to a biological sample, a cell, or a subject comprises inhibition of cell growth or induction of cell death.


In another aspect, the present disclosure features kits comprising a container with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the kits described herein further include instructions for administering the compound of Formula (I) or (II) or the pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or the pharmaceutical composition thereof.


In any and all aspects of the present disclosure, in some embodiments, the compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described herein is a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein other than a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described one of U.S. Pat. No. 8,729,263, U.S. Publication No. 2015/0005289, WO 2014/028459, WO 2016/128343, WO 2016/196386, WO 2017/100726, WO 2018/232039, WO 2018/098446, WO 2019/028440, WO 2019/060917, WO 2019/199972, and WO 2021/174165. In some embodiments, the compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described herein is a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described one of U.S. Pat. No. 8,729,263, U.S. Publication No. 2015/0005289, WO 2014/028459, WO 2016/128343, WO 2016/196386, WO 2017/100726, WO 2018/232039, WO 2018/098446, WO 2019/028440, WO 2019/060917, WO 2019/199972, and and WO 2021/174165, each of which is incorporated herein by reference in its entirety. The details of one or more embodiments of the invention are set forth herein. Other features, objects, and advantages of the invention will be apparent from the Detailed Description, the Examples, and the Claims.







DETAILED DESCRIPTION
Selected Chemical Definitions

Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5th Edition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd Edition, Cambridge University Press, Cambridge, 1987.


The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.


When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example “C1-C6 alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6 alkyl.


The following terms are intended to have the meanings presented therewith below and are useful in understanding the description and intended scope of the present invention. As used herein, “alkyl” refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 24 carbon atoms (“C1-C24 alkyl”). In some embodiments, an alkyl group has 1 to 12 carbon atoms (“C1-C12 alkyl”). In some embodiments, an alkyl group has 1 to 8 carbon atoms (“C1-C8 alkyl”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1-C6 alkyl”). In some embodiments, an alkyl group has 2 to 6 carbon atoms (“C2-C6 alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“C1 alkyl”). Examples of C1-C6alkyl groups include methyl (C1), ethyl (C2), n-propyl (C3), isopropyl (C3), n-butyl (C4), tert-butyl (C4), sec-butyl (C4), iso-butyl (C4), n-pentyl (C5), 3-pentanyl (C5), amyl (C5), neopentyl (C5), 3-methyl-2-butanyl (C5), tertiary amyl (C5), and n-hexyl (C6). Additional examples of alkyl groups include n-heptyl (C7), n-octyl (C8) and the like. Each instance of an alkyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted alkyl”) or substituted (a “substituted alkyl”) with one or more substituents; e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkyl group is unsubstituted C1-C10 alkyl (e.g., —CH3). In certain embodiments, the alkyl group is substituted C1-C6 alkyl.


As used herein, “alkenyl” refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 24 carbon atoms, one or more carbon-carbon double bonds, and no triple bonds (“C2-C24 alkenyl”). In some embodiments, an alkenyl group has 2 to 10 carbon atoms (“C2-C10 alkenyl”). In some embodiments, an alkenyl group has 2 to 8 carbon atoms (“C2-C8 alkenyl”). In some embodiments, an alkenyl group has 2 to 6 carbon atoms (“C2-C6 alkenyl”). In some embodiments, an alkenyl group has 2 carbon atoms (“C2 alkenyl”). The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). Examples of C2-C4 alkenyl groups include ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), and the like. Examples of C2-C6 alkenyl groups include the aforementioned C2-4 alkenyl groups as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like. Each instance of an alkenyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted alkenyl”) or substituted (a “substituted alkenyl”) with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkenyl group is unsubstituted C1-C10 alkenyl. In certain embodiments, the alkenyl group is substituted C2-C6 alkenyl.


As used herein, the term “alkynyl” refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 24 carbon atoms, one or more carbon-carbon triple bonds (“C2-C24 alkenyl”). In some embodiments, an alkynyl group has 2 to 10 carbon atoms (“C2-C10 alkynyl”). In some embodiments, an alkynyl group has 2 to 8 carbon atoms (“C2-C8 alkynyl”). In some embodiments, an alkynyl group has 2 to 6 carbon atoms (“C2-C6 alkynyl”). In some embodiments, an alkynyl group has 2 carbon atoms (“C2 alkynyl”). The one or more carbon-carbon triple bonds can be internal (such as in 2-butynyl) or terminal (such as in 1-butynyl). Examples of C2-C4 alkynyl groups include ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), 2-butynyl (C4), and the like. Each instance of an alkynyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted alkynyl”) or substituted (a “substituted alkynyl”) with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkynyl group is unsubstituted C2-10 alkynyl. In certain embodiments, the alkynyl group is substituted C2-6 alkynyl.


As used herein, the term “haloalkyl,” refers to a non-cyclic stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one halogen selected from the group consisting of F, Cl, Br, and I. The halogen(s) F, Cl, Br, and I may be placed at any position of the haloalkyl group. Exemplary haloalkyl groups include, but are not limited to: —CF3, —CCl3, —CH2—CF3, —CH2—CCl3, —CH2—CBr3, —CH2—CI3, —CH2—CH2—CH(CF3)—CH3, —CH2—CH2—CH(Br)—CH3, and —CH2—CH═CH—CH2—CF3. Each instance of a haloalkyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted haloalkyl”) or substituted (a “substituted haloalkyl”) with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent


As used herein, the term “heteroalkyl,” refers to a non-cyclic stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one heteroatom selected from the group consisting of O, N, P, Si, and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) O, N, P, S, and Si may be placed at any position of the heteroalkyl group. Exemplary heteroalkyl groups include, but are not limited to: —CH2—CH2—O—CH3, —CH2—CH2—NH—CH3, —CH2—CH2—N(CH3)—CH3, —CH2—S—CH2—CH3, —CH2—CH2, —S(O)—CH3, —CH2—CH2—S(O)2—CH3, —CH═CHO—CH3, —Si(CH3)3, —CH2—CH═N—OCH3, —CH═CH—N(CH3)—CH3, —O—CH3, and —O—CH2—CH3. Up to two or three heteroatoms may be consecutive, such as, for example, —CH2—NH—OCH3 and —CH2—O—Si(CH3)3. Where “heteroalkyl” is recited, followed by recitations of specific heteroalkyl groups, such as —CH2O, —NRCRD, or the like, it will be understood that the terms heteroalkyl and —CH2O or —NRCRD are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term “heteroalkyl” should not be interpreted herein as excluding specific heteroalkyl groups, such as —CH2O, —NRCRD, or the like. Each instance of a heteroalkyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted heteroalkyl”) or substituted (a “substituted heteroalkyl”) with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent


As used herein, “aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6-C14 aryl”). In some embodiments, an aryl group has six ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14 aryl”; e.g., anthracyl). An aryl group may be described as, e.g., a C6-C10-membered aryl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety. Aryl groups include phenyl, naphthyl, indenyl, and tetrahydronaphthyl. Each instance of an aryl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted aryl”) or substituted (a “substituted aryl”) with one or more substituents. In certain embodiments, the aryl group is unsubstituted C6-C14 aryl. In certain embodiments, the aryl group is substituted C6-C14 aryl.


As used herein, “heteroaryl” refers to a radical of a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 π electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5-10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl/heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2-indolyl) or the ring that does not contain a heteroatom (e.g., 5-indolyl). A heteroaryl group may be described as, e.g., a 6-10-membered heteroaryl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety. Each instance of a heteroaryl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted heteroaryl”) or substituted (a “substituted heteroaryl”) with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent


Exemplary 5-membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7-membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Other exemplary heteroaryl groups include heme and heme derivatives.


As used herein, “cycloalkyl” refers to a radical of a non-aromatic cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3-C10 cycloalkyl”) and zero heteroatoms in the non-aromatic ring system. In some embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms (“C3-C8 cycloalkyl”). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms (“C3-C6 cycloalkyl”). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms (“C3-C6 cycloalkyl”). In some embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms (“C5-C10 cycloalkyl”). A cycloalkyl group may be described as, e.g., a C4-C7-membered cycloalkyl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety. Exemplary C3-C6 cycloalkyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like. Exemplary C3-C8 cycloalkyl groups include, without limitation, the aforementioned C3-C6 cycloalkyl groups as well as cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), cubanyl (C8), bicyclo[1.1.1]pentanyl (C5), bicyclo[2.2.2]octanyl (C8), bicyclo[2.1.1]hexanyl (C6), bicyclo[3.1.1]heptanyl (C7), and the like. Exemplary C3-C10 cycloalkyl groups include, without limitation, the aforementioned C3-C8 cycloalkyl groups as well as cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C10), cyclodecenyl (C10), octahydro-1H-indenyl (C9), decahydronaphthalenyl (C10), spiro[4.5]decanyl (C10), and the like. As the foregoing examples illustrate, in certain embodiments, the cycloalkyl group is either monocyclic (“monocyclic cycloalkyl”) or contain a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic cycloalkyl”) and can be saturated or can be partially unsaturated. “Cycloalkyl” also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is on the cycloalkyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system. Each instance of a cycloalkyl group may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted cycloalkyl”) or substituted (a “substituted cycloalkyl”) with one or more substituents. In certain embodiments, the cycloalkyl group is unsubstituted C3-C10 cycloalkyl. In certain embodiments, the cycloalkyl group is a substituted C3-C10 cycloalkyl.


“Heterocyclyl” as used herein refers to a radical of a 3- to 16-membered non-aromatic ring system having ring carbon atoms and 1 to 8 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3-16 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. A heterocyclyl group may be described as, e.g., a 3-7-membered heterocyclyl, wherein the term “membered” refers to the non-hydrogen ring atoms, i.e., carbon, nitrogen, oxygen, sulfur, boron, phosphorus, and silicon, within the moiety. Each instance of heterocyclyl may be independently optionally substituted, i.e., unsubstituted (an “unsubstituted heterocyclyl”) or substituted (a “substituted heterocyclyl”) with one or more substituents. In certain embodiments, the heterocyclyl group is unsubstituted 3-16 membered heterocyclyl. In certain embodiments, the heterocyclyl group is substituted 3-16 membered heterocyclyl.


Exemplary 3-membered heterocyclyl groups containing one heteroatom include, without limitation, azirdinyl, oxiranyl, thiorenyl. Exemplary 4-membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl. Exemplary 5-membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl and pyrrolyl-2,5-dione. Exemplary 5-membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5-membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl (e.g., 2,2,6,6-tetramethylpiperidinyl), tetrahydropyranyl, dihydropyridinyl, pyridinonyl (e.g., 1-methylpyridin2-onyl), and thianyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, pyridazinonyl (2-methylpyridazin-3-onyl), pyrimidinonyl (e.g., 1-methylpyrimidin-2-onyl, 3-methylpyrimidin-4-onyl), dithianyl, dioxanyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7-membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8-membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary 5-membered heterocyclyl groups fused to a C6 aryl ring (also referred to herein as a 5,6-bicyclic heterocyclyl ring) include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like. Exemplary 5-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to herein as a 5,5-bicyclic heterocyclyl ring) include, without limitation, octahydropyrrolopyrrolyl (e.g., octahydropyrrolo[3,4-c]pyrrolyl), and the like. Exemplary 6-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to as a 4,6-membered heterocyclyl ring) include, without limitation, diazaspirononanyl (e.g., 2,7-diazaspiro[3.5]nonanyl). Exemplary 6-membered heterocyclyl groups fused to an aryl ring (also referred to herein as a 6,6-bicyclic heterocyclyl ring) include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like. Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,7-bicyclic heterocyclyl ring) include, without limitation, azabicyclooctanyl (e.g., (1,5)-8-azabicyclo[3.2.1]octanyl). Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,8-bicyclic heterocyclyl ring) include, without limitation, azabicyclononanyl (e.g., 9-azabicyclo[3.3.1]nonanyl).


The terms “alkylene,” “alkenylene,” “alkynylene,” “haloalkylene,” “heteroalkylene,” “cycloalkylene,” or “heterocyclylene,” alone or as part of another substituent, mean, unless otherwise stated, a divalent radical derived from an alkyl, alkenyl, alkynyl, haloalkylene, heteroalkylene, cycloalkyl, or heterocyclyl respectively. For example, the term “alkenylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkene. An alkylene, alkenylene, alkynylene, haloalkylene, heteroalkylene, cycloalkylene, or heterocyclylene group may be described as, e.g., a C1-C6-membered alkylene, C2-C6-membered alkenylene, C2-C6-membered alkynylene, C1-C6-membered haloalkylene, C1-C6-membered heteroalkylene, C3-C8-membered cycloalkylene, or C3-C8-membered heterocyclylene, wherein the term “membered” refers to the non-hydrogen atoms within the moiety. In the case of heteroalkylene and heterocyclylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula —C(O)2R′— may represent both —C(O)2R′— and —R′C(O)2—.


As used herein, the terms “cyano” or “—CN” refer to a substituent having a carbon atom joined to a nitrogen atom by a triple bond, e.g., C≡N.


As used herein, the terms “halogen” or “halo” refer to fluorine, chlorine, bromine or iodine.


As used herein, the term “hydroxy” refers to —OH.


As used herein, the term “nitro” refers to a substitutent having two oxygen atoms bound to a nitrogen atom, e.g., —NO2.


As used herein, the term “nucleobase” as used herein, is a nitrogen-containing biological compounds found linked to a sugar within a nucleoside—the basic building blocks of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The primary, or naturally occurring, nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), abbreviated as C, G, A, T, and U, respectively. Because A, G, C, and T appear in the DNA, these molecules are called DNA-bases; A, G, C, and U are called RNA-bases. Adenine and guanine belong to the double-ringed class of molecules called purines (abbreviated as R). Cytosine, thymine, and uracil are all pyrimidines. Other nucleobases that do not function as normal parts of the genetic code, are termed non-naturally occurring. In an embodiment, a nucleobase may be chemically modified, for example, with an alkyl (e.g., methyl), halo, —O-alkyl, or other modification.


As used herein, the term “nucleic acid” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. The term “nucleic acid” includes a gene, cDNA, pre-mRNA, or an mRNA. In one embodiment, the nucleic acid molecule is synthetic (e.g., chemically synthesized) or recombinant. Unless specifically limited, the term encompasses nucleic acids containing analogues or derivatives of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementarity sequences as well as the sequence explicitly indicated.


As used herein “oxo” refers to a carbonyl, i.e., —C(O)—.


The symbol “custom-character” as used herein in relation to a compound of Formula (I) or (II) refers to an attachment point to another moiety or functional group within the compound. Alkyl, alkenyl, alkynyl, haloalkyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups, as defined herein, are optionally substituted. In general, the term “substituted”, whether preceded by the term “optionally” or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the same or different at each position. The term “substituted” is contemplated to include substitution with all permissible substituents of organic compounds, such as any of the substituents described herein that result in the formation of a stable compound. The present disclosure contemplates any and all such combinations in order to arrive at a stable compound. For purposes of this invention, heteroatoms such as nitrogen may have hydrogen substituents and/or any suitable substituent as described herein which satisfy the valencies of the heteroatoms and results in the formation of a stable moiety.


Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl, or heterocyclyl groups. Such so-called ring-forming substituents are typically, though not necessarily, found attached to a cyclic base structure. In one embodiment, the ring-forming substituents are attached to adjacent members of the base structure. For example, two ring-forming substituents attached to adjacent members of a cyclic base structure create a fused ring structure. In another embodiment, the ring-forming substituents are attached to a single member of the base structure. For example, two ring-forming substituents attached to a single member of a cyclic base structure create a spirocyclic structure. In yet another embodiment, the ring-forming substituents are attached to non-adjacent members of the base structure.


The compounds provided herein may exist in one or more particular geometric, optical, enantiomeric, diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric forms, including but not limited to: cis- and trans-forms; E- and Z-forms; endo- and exo-forms; R—, S—, and meso-forms; D- and L-forms; d- and l-forms; (+) and (−) forms; keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal- and anticlinal-forms; α- and β-forms; axial and equatorial forms; boat-, chair-, twist-, envelope-, and half chair-forms; and combinations thereof, hereinafter collectively referred to as “isomers” (or “isomeric forms”).


Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and/or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. In an embodiment, the stereochemistry depicted in a compound is relative rather than absolute. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high-pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). This disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.


As used herein, a pure enantiomeric compound is substantially free from other enantiomers or stereoisomers of the compound (i.e., in enantiomeric excess). In other words, an “S” form of the compound is substantially free from the “R” form of the compound and is, thus, in enantiomeric excess of the “R” form. The term “enantiomerically pure” or “pure enantiomer” denotes that the compound comprises more than 75% by weight, more than 80% by weight, more than 85% by weight, more than 90% by weight, more than 91% by weight, more than 92% by weight, more than 93% by weight, more than 94% by weight, more than 95% by weight, more than 96% by weight, more than 97% by weight, more than 98% by weight, more than 99% by weight, more than 99.5% by weight, or more than 99.9% by weight, of the enantiomer. In certain embodiments, the weights are based upon total weight of all enantiomers or stereoisomers of the compound.


In the compositions provided herein, an enantiomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising an enantiomerically pure R-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure R-compound. In certain embodiments, the enantiomerically pure R-compound in such compositions can, for example, comprise, at least about 95% by weight R-compound and at most about 5% by weight S-compound, by total weight of the compound. For example, a pharmaceutical composition comprising an enantiomerically pure S-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure S-compound. In certain embodiments, the enantiomerically pure S-compound in such compositions can, for example, comprise, at least about 95% by weight S-compound and at most about 5% by weight R-compound, by total weight of the compound.


In some embodiments, a diastereomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising a diastereometerically pure exo compound can comprise, for example, about 90% excipient and about 10% diastereometerically pure exo compound. In certain embodiments, the diastereometerically pure exo compound in such compositions can, for example, comprise, at least about 95% by weight exo compound and at most about 5% by weight endo compound, by total weight of the compound. For example, a pharmaceutical composition comprising a diastereometerically pure endo compound can comprise, for example, about 90% excipient and about 10% diastereometerically pure endo compound. In certain embodiments, the diastereometerically pure endo compound in such compositions can, for example, comprise, at least about 95% by weight endo compound and at most about 5% by weight exo compound, by total weight of the compound.


In some embodiments, an isomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising a isomerically pure exo compound can comprise, for example, about 90% excipient and about 10% isomerically pure exo compound. In certain embodiments, the isomerically pure exo compound in such compositions can, for example, comprise, at least about 95% by weight exo compound and at most about 5% by weight endo compound, by total weight of the compound. For example, a pharmaceutical composition comprising an isomerically pure endo compound can comprise, for example, about 90% excipient and about 10% isomerically pure endo compound. In certain embodiments, the isomerically pure endo compound in such compositions can, for example, comprise, at least about 95% by weight endo compound and at most about 5% by weight exo compound, by total weight of the compound.


In certain embodiments, the active ingredient can be formulated with little or no excipient or carrier.


Compound described herein may also comprise one or more isotopic substitutions. For example, H may be in any isotopic form, including 1H, 2H (D or deuterium), and 3H (T or tritium); C may be in any isotopic form, including 12C, 13C, and 14C; O may be in any isotopic form, including 16O and 18O; N may be in any isotopic form, including 14N and 15N; F may be in any isotopic form, including 18F, 19F, and the like.


The term “pharmaceutically acceptable salt” is meant to include salts of the active compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds of the present invention contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, e.g., Berge et al, Journal of Pharmaceutical Science 66: 1-19 (1977)). Certain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. These salts may be prepared by methods known to those skilled in the art. Other pharmaceutically acceptable carriers known to those of skill in the art are suitable for the present invention.


In addition to salt forms, the present disclosure provides compounds in a prodrug form. Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent.


The term “solvate” refers to forms of the compound that are associated with a solvent, usually by a solvolysis reaction. This physical association may include hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. The compounds of Formula (I) or (II) may be prepared, e.g., in crystalline form, and may be solvated. Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non-stoichiometric solvates. In certain instances, the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid. “Solvate” encompasses both solution-phase and isolable solvates. Representative solvates include hydrates, ethanolates, and methanolates.


The term “hydrate” refers to a compound which is associated with water. Typically, the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R·x H2O, wherein R is the compound and wherein x is a number greater than 0. A given compound may form more than one type of hydrates, including, e.g., monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R·0.5H2O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R·2H2O) and hexahydrates (R·6H2O)).


The term “tautomer” refers to compounds that are interchangeable forms of a particular compound structure, and that vary in the displacement of hydrogen atoms and electrons. Thus, two structures may be in equilibrium through the movement of R electrons and an atom (usually H). For example, enols and ketones are tautomers because they are rapidly interconverted by treatment with either acid or base. Another example of tautomerism is the aci- and nitro-forms of phenylnitromethane that are likewise formed by treatment with acid or base. Tautomeric forms may be relevant to the attainment of the optimal chemical reactivity and biological activity of a compound of interest.


Other Definitions

The following definitions are more general terms used throughout the present disclosure. The articles “a” and “an” refer to one or more than one (e.g., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. The term “and/or” means either “and” or “or” unless indicated otherwise.


The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.


“Acquire” or “acquiring” as used herein, refer to obtaining possession of a value, e.g., a numerical value, or image, or a physical entity (e.g., a sample), by “directly acquiring” or “indirectly acquiring” the value or physical entity. “Directly acquiring” means performing a process (e.g., performing an analytical method or protocol) to obtain the value or physical entity. “Indirectly acquiring” refers to receiving the value or physical entity from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Directly acquiring a value or physical entity includes performing a process that includes a physical change in a physical substance or the use of a machine or device. Examples of directly acquiring a value include obtaining a sample from a human subject. Directly acquiring a value includes performing a process that uses a machine or device, e.g., mass spectrometer to acquire mass spectrometry data.


The terms “administer,” “administering,” or “administration,” as used herein refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing an inventive compound, or a pharmaceutical composition thereof.


As used herein, the terms “condition,” “disease,” and “disorder” are used interchangeably.


An “effective amount” of a compound of Formula (I) or (II) refers to an amount sufficient to elicit the desired biological response, i.e., treating the condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a compound of Formula (I) or (II) may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the condition being treated, the mode of administration, and the age and health of the subject. An effective amount encompasses therapeutic and prophylactic treatment. For example, in treating cancer, an effective amount of an inventive compound may reduce the tumor burden or stop the growth or spread of a tumor.


A “therapeutically effective amount” of a compound of Formula (I) or (II) is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to delay or minimize one or more symptoms associated with the condition. In some embodiments, a therapeutically effective amount is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to minimize one or more symptoms associated with the condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the condition, or enhances the therapeutic efficacy of another therapeutic agent.


The terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprised therein. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.


“Prevention,” “prevent,” and “preventing” as used herein refers to a treatment that comprises administering a therapy, e.g., administering a compound described herein (e.g., a compound of Formula (I) or (II)) prior to the onset of a disease, disorder, or condition in order to preclude the physical manifestation of said disease, disorder, or condition. In some embodiments, “prevention,” “prevent,” and “preventing” require that signs or symptoms of the disease, disorder, or condition have not yet developed or have not yet been observed. In some embodiments, treatment comprises prevention and in other embodiments it does not.


A “subject” to which administration is contemplated includes, but is not limited to, humans (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., infant, child, adolescent) or adult subject (e.g., young adult, middle-aged adult, or senior adult)) and/or other non-human animals, for example, mammals (e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys); commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and/or dogs) and birds (e.g., commercially relevant birds such as chickens, ducks, geese, and/or turkeys). In certain embodiments, the animal is a mammal. The animal may be a male or female and at any stage of development. A non-human animal may be a transgenic animal.


As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of one or more of a symptom, manifestation, or underlying cause of a disease, disorder, or condition (e.g., as described herein), e.g., by administering a therapy, e.g., administering a compound described herein (e.g., a compound of Formula (I) or (II)). In an embodiment, treating comprises reducing, reversing, alleviating, delaying the onset of, or inhibiting the progress of a symptom of a disease, disorder, or condition. In an embodiment, treating comprises reducing, reversing, alleviating, delaying the onset of, or inhibiting the progress of a manifestation of a disease, disorder, or condition. In an embodiment, treating comprises reducing, reversing, alleviating, reducing, or delaying the onset of, an underlying cause of a disease, disorder, or condition. In some embodiments, “treatment,” “treat,” and “treating” require that signs or symptoms of the disease, disorder, or condition have developed or have been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease or condition, e.g., in preventive treatment. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. In some embodiments, treatment comprises prevention and in other embodiments it does not.


A “proliferative disease” refers to a disease that occurs due to abnormal extension by the multiplication of cells (Walker, Cambridge Dictionary of Biology; Cambridge University Press: Cambridge, UK, 1990). A proliferative disease may be associated with: 1) the pathological proliferation of normally quiescent cells; 2) the pathological migration of cells from their normal location (e.g., metastasis of neoplastic cells); 3) the pathological expression of proteolytic enzymes such as the matrix metalloproteinases (e.g., collagenases, gelatinases, and elastases); 4) the pathological angiogenesis as in proliferative retinopathy and tumor metastasis; or 5) evasion of host immune surveillance and elimination of neoplastic cells. Exemplary proliferative diseases include cancers (i.e., “malignant neoplasms”), benign neoplasms, and angiogenesis.


A “non-proliferative disease” refers to a disease that does not primarily extend through the abnormal multiplication of cells. A non-proliferative disease may be associated with any cell type or tissue type in a subject. Exemplary non-proliferative diseases include neurological diseases or disorders (e.g., a repeat expansion disease); autoimmune disease or disorders; immunodeficiency diseases or disorders; lysosomal storage diseases or disorders; inflammatory diseases or disorders; cardiovascular conditions, diseases, or disorders; metabolic diseases or disorders; respiratory conditions, diseases, or disorders; renal diseases or disorders; and infectious diseases.


Compounds

The present disclosure features a compound of Formula (I):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), C(R3a)(R3b), N, N(R3c), or O, wherein at least one of X, Y, and Z is N, N(R3c), or O, and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a and R3b are each independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; or each of R3a and R3b, together with the carbon atom to which they are attached, form an oxo group; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.


In another aspect, the present disclosure features a compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; M and P are each independently C(R2) or N; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c), O, or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1—C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R4 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2 As generally described herein for Formulas (I) and (II), A and B, are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1.


In some embodiments, each of A and B are independently a monocyclic ring, e.g., monocyclic cycloalkyl, monocyclic heterocyclyl, monocyclic aryl, or monocyclic heteroaryl. The monocyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a monocyclic ring comprising between 3 and 10 ring atoms (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 ring atoms). In some embodiments, A is a 4-membered monocyclic ring. In some embodiments, B is a 4-membered monocyclic ring. In some embodiments, A is a 5-membered monocyclic ring. In some embodiments, B is a 5-membered monocyclic ring. In some embodiments, A is a 6-membered monocyclic ring. In some embodiments, B is a 6-membered monocyclic ring. In some embodiments, A is a 7-membered monocyclic ring. In some embodiments, B is a 7-membered monocyclic ring. In some embodiments, A is an 8-membered monocyclic ring. In some embodiments, B is an 8-membered monocyclic ring. In some embodiments, A or B are independently a monocyclic ring optionally substituted with one or more R1.


In some embodiments, A or B are independently a bicyclic ring, e.g., bicyclic cycloalkyl, bicyclic heterocyclyl, bicyclic aryl, or bicyclic heteroaryl. The bicyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a bicyclic ring comprising a fused, bridged, or spiro ring system. In some embodiments, A or B are independently a bicyclic ring comprising between 4 and 18 ring atoms (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 ring atoms). In some embodiments, A is a 6-membered bicyclic ring. In some embodiments, B is a 6-membered bicyclic ring. In some embodiments, A is a 7-membered bicyclic ring. In some embodiments, B is a 7-membered bicyclic ring. In some embodiments, A is an 8-membered bicyclic ring. In some embodiments, B is an 8-membered bicyclic ring. In some embodiments, A is a 9-membered bicyclic ring. In some embodiments, B is a 9-membered bicyclic ring. In some embodiments, A is a 10-membered bicyclic ring. In some embodiments, B is a 10-membered bicyclic ring. In some embodiments, A is an 11-membered bicyclic ring. In some embodiments, B is an 11-membered bicyclic ring. In some embodiments, A is a 12-membered bicyclic ring. In some embodiments, B is a 12-membered bicyclic ring. In some embodiments, A or B are independently a bicyclic ring optionally substituted with one or more R1.


In some embodiments, A or B are independently a tricyclic ring, e.g., tricyclic cycloalkyl, tricyclic heterocyclyl, tricyclic aryl, or tricyclic heteroaryl. The tricyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a tricyclic ring that comprises a fused, bridged, or spiro ring system, or a combination thereof. In some embodiments, A or B are independently a tricyclic ring comprising between 6 and 24 ring atoms (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 ring atoms). In some embodiments, A is an 8-membered tricyclic ring. In some embodiments, B is an 8-membered tricyclic ring. In some embodiments, A is a 9-membered tricyclic ring. In some embodiments, B is a 9-membered tricyclic ring. In some embodiments, A is a 10-membered tricyclic ring. In some embodiments, B is a 10-membered tricyclic ring. In some embodiments, A or B are independently a tricyclic ring optionally substituted with one or more R1.


In some embodiments, A or B are independently monocyclic cycloalkyl, monocyclic heterocyclyl, monocyclic aryl, or monocyclic heteroaryl. In some embodiments, A or B are independently bicyclic cycloalkyl, bicyclic heterocyclyl, bicyclic aryl, or bicyclic heteroaryl. In some embodiments, A or B are independently tricyclic cycloalkyl, tricyclic heterocyclyl, tricyclic aryl, or tricyclic heteroaryl. In some embodiments, A is monocyclic heterocyclyl. In some embodiments, B is monocyclic heterocyclyl. In some embodiments, A is bicyclic heterocyclyl. In some embodiments, B is bicyclic heterocyclyl. In some embodiments, A is monocyclic heteroaryl. In some embodiments, B is monocyclic heteroaryl. In some embodiments, A is bicyclic heteroaryl. In some embodiments, B is bicyclic heteroaryl.


In some embodiments, A or B are independently a nitrogen-containing heterocyclyl, e.g., heterocyclyl comprising one or more nitrogen atom. The one or more nitrogen atom of the nitrogen-containing heterocyclyl may be at any position of the ring. In some embodiments, the nitrogen-containing heterocyclyl is monocyclic, bicyclic, or tricyclic. In some embodiments, A or B are independently heterocyclyl comprising at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 1 nitrogen atom. In some embodiments, B is heterocyclyl comprising 1 nitrogen atom. In some embodiments, A is heterocyclyl comprising 2 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 2 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 3 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 3 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 4 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 4 nitrogen atoms. In some embodiments, A or B are independently a nitrogen-containing heterocyclyl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus. In some embodiments, the one or more nitrogen of the nitrogen-containing heterocyclyl is substituted, e.g., with R1.


In some embodiments, A or B are independently a nitrogen-containing heteroaryl, e.g., heteroaryl comprising one or more nitrogen atom. The one or more nitrogen atom of the nitrogen-containing heteroaryl may be at any position of the ring. In some embodiments, the nitrogen-containing heteroaryl is monocyclic, bicyclic, or tricyclic. In some embodiments, A or B are independently heteroaryl comprising at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nitrogen atoms. In some embodiments, A is heteroaryl comprising 1 nitrogen atom. In some embodiments, B is heteroaryl comprising 1 nitrogen atom. In some embodiments, A is heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is heteroaryl comprising 2 nitrogen atoms. In some embodiments, A is heteroaryl comprising 3 nitrogen atoms. In some embodiments, B is heteroaryl comprising 3 nitrogen atoms. In some embodiments, A is heteroaryl comprising 4 nitrogen atoms. In some embodiments, B is heteroaryl comprising 4 nitrogen atoms. In some embodiments, A or B are independently a nitrogen-containing heteroaryl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus. In some embodiments, the one or more nitrogen of the nitrogen-containing heteroaryl is substituted, e.g., with R1.


In some embodiments, A is a 6-membered nitrogen-containing heterocyclyl, e.g., a 6-membered heterocyclyl comprising one or more nitrogen. In some embodiments, A is a 6-membered heterocyclyl comprising 1 nitrogen atom. In some embodiments, A is a 6-membered heterocyclyl comprising 2 nitrogen atoms. In some embodiments, A is a 6-membered heterocyclyl comprising 3 nitrogen atoms. In some embodiments, A is a 6-membered heterocyclyl comprising 4 nitrogen atoms. The one or more nitrogen atom of the 6-membered nitrogen-containing heterocyclyl may be at any position of the ring. In some embodiments, A is a 6-membered nitrogen-containing heterocyclyl optionally substituted with one or more R1. In some embodiments, the one or more nitrogen of the 6-membered nitrogen-containing heterocyclyl is substituted, e.g., with R1. In some embodiments, A is a 6-membered nitrogen-containing heterocyclyl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus.


In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl or heteroaryl, e.g., a 5-membered heterocyclyl or heteroaryl comprising one or more nitrogen. In some embodiments, B is a 5-membered heterocyclyl comprising 1 nitrogen atom. In some embodiments, B is a 5-membered heteroaryl comprising 1 nitrogen atom. In some embodiments, B is a 5-membered heterocyclyl comprising 2 nitrogen atoms. In some embodiments, B is a 5-membered heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is a 5-membered heterocyclyl comprising 3 nitrogen atoms. In some embodiments, B is a 5-membered heteroaryl comprising 3 nitrogen atoms. The one or more nitrogen atom of the 5-membered nitrogen-containing heterocyclyl or heteroaryl may be at any position of the ring. In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl optionally substituted with one or more R1. In some embodiments, B is a 5-membered nitrogen-containing heteroaryl optionally substituted with one or more R1. In some embodiments, the one or more nitrogen of the 5-membered nitrogen-containing heterocyclyl or heteroaryl is substituted, e.g., with R1. In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl or heteroaryl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus.


In some embodiments, B is a nitrogen-containing bicyclic heteroaryl (e.g., a 9-membered nitrogen-containing bicyclic heteroaryl), that is optionally substituted with one or more R1. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 1 nitrogen atom. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 3 nitrogen atoms. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 4 nitrogen atoms. The one or more nitrogen atom of the 9-membered bicyclic heteroaryl may be at any position of the ring. In some embodiments, B is a 9-membered bicyclic heteroaryl substituted with one or more R1.


In some embodiments, each of A and B are independently selected from:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


wherein each R1 is as defined herein. In an embodiment, A and B are each independently a saturated, partially saturated, or unsaturated (e.g., aromatic) derivative of one of the rings described above. In an embodiment, A and B are each independently a stereoisomer of one of the rings described above.


In some embodiments, each of A and B are independently selected from:




embedded image


embedded image


embedded image


embedded image


embedded image


wherein each R1 is as defined herein. In an embodiment, A and B are each independently a saturated, partially saturated, or unsaturated (e.g., aromatic) derivative of one of the rings described above. In an embodiment, A and B are each independently a stereoisomer of one of the rings described above.


In some embodiments, one of A and B is independently selected from




embedded image


wherein R1 is as described herein. In some embodiments, one of A and B is independently selected from




embedded image


wherein each R1a is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA, and each alkyl, heteroalkyl, and haloalkyl is optionally substituted with one or more R7. In some embodiments, one of A and B is independently




embedded image


wherein each R1a is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA, and each alkyl, heteroalkyl, and haloalkyl is optionally substituted with one or more R7.


In some embodiments, one of A and B is independently selected from N




embedded image


embedded image


embedded image


In some embodiments, one of A and B is independently selected from




embedded image


In some embodiments, one of A and B is independently




embedded image


In some embodiments, one of A and B is independently a monocyclic heterocyclyl or bicyclic heterocyclyl, each of which is optionally substituted with one or more R1. In some embodiments, one of A and B is independently a nitrogen-containing heterocyclyl optionally substituted with one or more R1. In some embodiments, one of A and B is independently a 4-8 membered heterocyclyl optionally substituted with one or more R1. In some embodiments, one of A and B is independently selected from




embedded image


wherein R1 is as described herein. In some embodiments, one of A and B is independently selected from




embedded image


wherein R1 is as described herein. In some embodiments, one of A and B is




embedded image


wherein R1 is as described herein. In some embodiments, A is selected from




embedded image


wherein R1 is as described herein. In some embodiments, B is selected from




embedded image


wherein Rt is as described herein. In some embodiments, B is selected from




embedded image


wherein Rt is as described herein. In some embodiments, A is selected




embedded image


embedded image


embedded image


In some embodiments, A is selected one of A and B is independently selected from,




embedded image


In some embodiments, one of A and Bis




embedded image


As generally described herein, for Formulas (I) and (II), L1 and L2 each independently may be absent or refer to a C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)— group, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5.


In some embodiments, L1 is absent. In some embodiments, L1 is C1-C6-alkylene (e.g., C1-alkylene, C2-alkylene, C3-alkylene, C4-alkylene, C5-alkylene, or C6-alkylene). In some embodiments, L1 is unsubstituted C1-C6 alkylene. In some embodiments, L1 is substituted C1-C6-alkylene, e.g., C1-C6 alkylene substituted with one or more R5. In some embodiments, L1 is C1-alkylene substituted with one R5. In some embodiments, L1 is —CH2— (or methylene). In some embodiments, L1 is —C(O)— (or carbonyl).


In some embodiments, L1 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5.


In some embodiments, L1 is C1-C6 heteroalkylene (e.g., C1-heteroalkylene, C2-heteroalkylene, C3-heteroalkylene, C4-heteroalkylene, C5-heteroalkylene, or C6-heteroalkylene). In some embodiments, L1 is unsubstituted C1-C6 heteroalkylene. In some embodiments, L1 is substituted heteroalkylene, e.g., C1-C6 heteroalkylene substituted with one or more R5. In some embodiments, the heteroalkylene comprises 1 or more heteroatoms. In some embodiments, the heteroalkylene comprises one or more of oxygen, sulfur, nitrogen, boron, silicon, or phosphorus. In some embodiments, L1 is —N(R4)C(O)—. In some embodiments, L1 is —C(O)N(R4)—. In some embodiments, L1 is —C(O)N(H)—.


In some embodiments, L1 is oxygen. In some embodiments, L1 is nitrogen which is optionally substituted with R4. In some embodiments, L1 is nitrogen substituted with R4. In some embodiments, L1 is —N(R4)—, e.g., —N(CH3)—. In some embodiments, L1 is —NH—. In some embodiments, L1 is —O—.


In some embodiments, L2 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5. In some embodiments, L2 is unsubstituted C1-C6 heteroalkylene. In some embodiments, L2 is substituted heteroalkylene, e.g., C1-C6 heteroalkylene substituted with one or more R5. In some embodiments, the heteroalkylene comprises 1 or more heteroatoms. In some embodiments, the heteroalkylene comprises one or more of oxygen, sulfur, nitrogen, boron, silicon, or phosphorus. In some embodiments, L2 is —N(R4)C(O)—. In some embodiments, L2 is —C(O)N(R4)—. In some embodiments, L2 is —C(O)N(H)—.


In some embodiments, L2 is nitrogen which is optionally substituted with R4. In some embodiments, L2 is nitrogen substituted with R4. In some embodiments, L2 is —N(R4)—, e.g., —N(CH3)—. In some embodiments, L2 is —NH—.


As generally described herein, for Formula (I), X, Y, and Z each independently refer to C(R3a), C(R3a)(R3b), N, or N(R3c), or O. In some embodiments, at least one of X, Y, and Z is either N or N(R3c). In some embodiments, at least one of X, Y, and Z is O. In some embodiments, at least two of X, Y, and Z is N or N(R3c). In some embodiments, X is N. In some embodiments, X is N(R3c). In some embodiments, X is O. In some embodiments, X is C(R3a) (e.g., CH). In some embodiments, X is C(R3a)(R3b). In some embodiments, Y is N. In some embodiments, Y is N(R3c). In some embodiments, Y is C(R3a) (e.g., CH). In some embodiments, Y is C(R3a)C(R3b). In some embodiments, Z is N. In some embodiments, Z is N(R3c). In some embodiments, Z is C(R3a) (e.g., CH). In some embodiments, Z is C(R3a)C(R3b) In some embodiments, two of X, Y, and Z are N, and the other of X, Y, and Z is C(R3a) (e.g., CH). In some embodiments, one of X, Y, and Z is C(R3a) (e.g., CH), and the others of X, Y, and Z are each independently N. In some embodiments, X and Y are each independently N, and Z is C(R3a) (e.g., CH). In some embodiments, X is C(R3a) (e.g., CH), and Y and Z are each independently N.


In some embodiments, X, Y, and Z are each independently N or C(R3a), wherein at least one of X, Y, and Z is N and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits.


In some embodiments, X is C(R3a), Y is C(R3a), and Z is O. In some embodiments, X is C(R3a), Y is C(R3a), Z is O, and y is 0. In some embodiments, X is C(R3a), Y is C(R3a), Z is O, and the bond between X and Y is a double bond. In some embodiments, X is C(R3a), Y is C(R3a), Z is O, and the bond between Y and Z is a single bond.


In some embodiments,




embedded image


is selected from




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments for Formulas (I) and (II), R1 is hydrogen. In some embodiments, R1 is C1-C6-alkyl. In some embodiments, R1 is C2-C6-alkenyl. In some embodiments, R1 is C2-C6-alkynyl. In some embodiments, R1 is C1-C6-heteroalkyl. In some embodiments, R1 is C1-C6-haloalkyl (e.g., —CF3). In some embodiments, R1 is C1-alkyl (e.g., methyl). In some embodiments, R1 is unsubstituted C1-C6-alkyl, unsubstituted C2-C6-alkenyl, unsubstituted C2-C6-alkynyl, unsubstituted C1-C6-heteroalkyl, or unsubstituted C1-C6-haloalkyl. In some embodiments, R1 is C1-C6-alkyl substituted with one or more R6. In some embodiments, R1 is C2-C6-alkenyl substituted with one or more R6. In some embodiments, R1 is C2-C6-alkynyl substituted with one or more R6. In some embodiments, R1 is C1-C6-heteroalkyl substituted with one or more R6. In some embodiments, R1 is C1-C6-haloalkyl substituted with one or more R6. In some embodiments, R1 is methyl.


In some embodiments, R1 is cycloalkyl (e.g., 3-7 membered cycloalkyl). In some embodiments, R1 is heterocyclyl (e.g., 3-7 membered heterocyclyl). In some embodiments, R1 is aryl. In some embodiments, R1 is C1-C6 alkylene-aryl (e.g., benzyl). In some embodiments, R1 is C1-C6 alkenylene-aryl. In some embodiments, R1 is C1-C6 alkylene-heteroaryl. In some embodiments, R1 is heteroaryl. In some embodiments, R1 is unsubstituted cycloalkyl, unsubstituted heterocyclyl, unsubstituted aryl, unsubstituted C1-C6 alkylene-aryl, unsubstituted C1-C6 alkenylene-aryl, unsubstituted C1-C6 alkylene-heteroaryl, or unsubstituted heteroaryl. In some embodiments, R1 is cycloalkyl substituted with one or more R6. In some embodiments, R1 is heterocyclyl substituted with one or more R6. In some embodiments, R1 is aryl substituted with one or more R6. In some embodiments, R1 is C1-C6 alkylene-aryl substituted with one or more R6. In some embodiments, R1 is C1-C6 alkenylene-aryl substituted with one or more R6. In some embodiments, R1 is C1-C6 alkylene-heteroaryl substituted with one or more R6. In some embodiments, R1 is heteroaryl substituted with one or more R6.


In some embodiments, R1 is —ORA. In some embodiments, R1 is —NRBRC (e.g., NH2 or NMe2). In some embodiments, R1 is —NRBC(O)RD. In some embodiments, R1 is-C(O)NRBRC. In some embodiments, R1 is —C(O)RD. In some embodiments, R1 is —C(O)ORD. In some embodiments, R1 is —SRE. In some embodiments, R1 is —S(O)xRD. In some embodiments, R1 is halo, e.g., fluoro, chloro, bromo, or iodo. In some embodiments, R1 is cyano. In some embodiments, R1 is nitro (—NO2). In some embodiments, R1 is oxo.


In some embodiments, two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl. In some embodiments, two R1 groups, together with the atoms to which they are attached, form a 3-7-membered heterocyclyl. In some embodiments, two R1 groups, together with the atoms to which they are attached, form a 5- or 6-membered aryl. In some embodiments, two R1 groups, together with the atoms to which they are attached, form a 5- or 6-membered heteroaryl. The cycloalkyl, heterocyclyl, aryl, or heteroaryl may be substituted with one or more R6.


In some embodiments for Formulas (I) and (II), R2 is hydrogen. In some embodiments, R2 is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R2 is cyano. In some embodiments, R2 is C1-C6-alkyl. In some embodiments, R2 is C2-C6-alkenyl. In some embodiments, R2 is C2-C6-alkynyl. In some embodiments, R2 is —ORA (e.g., —OH). In some embodiments, R3a, R3b, or both are independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD. In some embodiments, R3a and R3b are each independently hydrogen or C1-C6-alkyl. In some embodiments, R3a is hydrogen. In some embodiments, R3b is hydrogen. In some embodiments, R3a is C1-C6-alkyl (e.g., methyl). In some embodiments, R3b is C1-C6-alkyl (e.g., methyl). In some embodiments, R3a is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R3b is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R3a is cyano. In some embodiments, R3b is cyano. In some embodiments, R3a is —ORA (e.g., —OH). In some embodiments, R3b is —ORA (e.g., —OH). In some embodiments, R3a is —NRBRC. In some embodiments, R3b is —NRBRC. In some embodiments, R3a is —C(O)RD. In some embodiments, R3b is —C(O)RD. In some embodiments, R3a is —C(O)ORD. In some embodiments, R3b is —C(O)ORD In some embodiments, each of R3a and R3b, together with the carbon atom to which they are attached, form an oxo group.


In some embodiments, R3c is hydrogen. In some embodiments, R3c is C1-C6-alkyl. In some embodiments, R3c is methyl. In some embodiments, R3c is not hydrogen. In some embodiments, R3c is not methyl. In some embodiments, R3c is C1-C6 alkyl. In some embodiments, R3c is C1-C6 substituted with one or more R′.


In some embodiments, R4 is hydrogen. In some embodiments, R4 is C1-C6 alkyl. In some embodiments, R4 is C1-C6 haloalkyl (e.g., —CF3 or —CHF2). In some embodiments, R4 is methyl.


In some embodiments, R5 is hydrogen. In some embodiments, R5 is C1-C6-alkyl. In some embodiments, R5 is C1-C6-heteroalkyl. In some embodiments, R5 is C1-C6-haloalkyl. In some embodiments, R5 is cycloalkyl. In some embodiments, R5 is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R5 is cyano. In some embodiments, R5 is oxo. In some embodiments, R5 is —ORA. In some embodiments, R5 is —NRBRC. In some embodiments, R5 is —C(O)RD or —C(O)ORD.


In some embodiments, R6 is C1-C6-alkyl. In some embodiments, R6 is C2-C6-alkenyl. In some embodiments, R6 is C2-C6-alkynyl. In some embodiments, R6 is C1-C6-heteroalkyl. In some embodiments, R6 is C1-C6-haloalkyl. In some embodiments, R6 is unsubstituted C1-C6-alkyl, unsubstituted C2-C6-alkenyl, unsubstituted C2-C6-alkynyl, unsubstituted C1-C6-haloalkyl, or unsubstituted C1-C6-heteroalkyl. In some embodiments, R6 is C1-C6-alkyl substituted with one or more R11. In some embodiments, R6 is C2-C6-alkenyl substituted with one or more R11. In some embodiments, R6 is C2-C6-alkynyl substituted with one or more R11. In some embodiments, R6 is C1-C6-haloalkyl substituted with one or more R11. In some embodiments, R6 is C1-C6-heteroalkyl substituted with one or more R11.


In some embodiments, R6 is cycloalkyl. In some embodiments, R6 is heterocyclyl. In some embodiments, R6 is aryl. In some embodiments, R6 is heteroaryl. In some embodiments, R6 is unsubstituted cycloalkyl, unsubstituted heterocyclyl, unsubstituted aryl, or unsubstituted heteroaryl. In some embodiments, R6 is cycloalkyl substituted with one or more R11. In some embodiments, R6 is heterocyclyl substituted with one or more R11. In some embodiments, R6 is aryl substituted with one or more R11. In some embodiments, R6 is heteroaryl substituted with one or more R11.


In some embodiments, R6 is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R6 is cyano. In some embodiments, R6 is oxo. In some embodiments, R6 is —ORA. In some embodiments, R6 is —NRBRC. In some embodiments, R6 is —NRBC(O)RD. In some embodiments, R6 is —NO2. In some embodiments, R6 is —C(O)NRBRC. In some embodiments, R6 is —C(O)RD. In some embodiments, R6 is —C(O)ORD. In some embodiments, R6 is —SRE. In some embodiments, R6 is —S(O)xRD.


In some embodiments, R7 is C1-C6-alkyl. In some embodiments, R7 is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R7 is cyano. In some embodiments, R7 is oxo. In some embodiments, R7 is —ORA1 (e.g., —OH).


In some embodiments, R11 is C1-C6-alkyl. In some embodiments, R11 is C1-C6-heteroalkyl. In some embodiments, R11 is C1-C6-haloalkyl (e.g., —CF3). In some embodiments, R11 is cycloalkyl. In some embodiments, R11 is heterocyclyl. In some embodiments, R11 is aryl. In some embodiments, R11 is heteroaryl. In some embodiments, R11 is halo. In some embodiments, R11 is cyano. In some embodiments, R11 is oxo. In some embodiments, R11 is —ORA.


In some embodiments for Formulas (I) and (II), RA is hydrogen. In some embodiments, RA is C1-C6 alkyl (e.g., methyl). In some embodiments, RA is C1-C6 haloalkyl. In some embodiments, RA is aryl. In some embodiments, RA is heteroaryl. In some embodiments, RA is C1-C6 alkylene-aryl (e.g., benzyl). In some embodiments, RA is C1-C6 alkylene-heteroaryl. In some embodiments, RA is C(O)RD. In some embodiments, RA is —S(O)xRD.


In some embodiments, RB, RC, or both are independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, cycloalkyl, heterocyclyl, or —ORA. In some embodiments, each of RB and RC is independently hydrogen. In some embodiments, each of RB and RC is independently C1-C6 alkyl. In some embodiments, one of RB and RC is hydrogen, and the other of RB and RC is C1-C6 alkyl. In some embodiments, RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more of R7.


In some embodiments, RD, RE, or both are independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl (e.g., benzyl), or C1-C6 alkylene-heteroaryl. In some embodiments, each of RD and RE is independently hydrogen. In some embodiments, each of RD and RE is independently C1-C6 alkyl. In some embodiments, RD is hydrogen. In some embodiments, RE is hydrogen. In some embodiments, RD is C1-C6 alkyl (e.g., methyl). In some embodiments, RE is C1-C6 alkyl (e.g., methyl). In some embodiments, RD is C1-C6 heteroalkyl. In some embodiments, RE is C1-C6 heteroalkyl. In some embodiments, RD is C1-C6 haloalkyl. In some embodiments, RE is C1-C6 haloalkyl. In some embodiments, RD is cycloalkyl. In some embodiments, RE is cycloalkyl. In some embodiments, RD is heterocyclyl. In some embodiments, RE is heterocyclyl. In some embodiments, RD is aryl. In some embodiments, RE is aryl. In some embodiments, RD is heteroaryl. In some embodiments, RE is heteroaryl. In some embodiments, RD is C1-C6 alkylene-aryl (e.g., benzyl). In some embodiments, RE is C1-C6 alkylene-aryl (e.g., benzyl). In some embodiments, RD is C1-C6 alkylene-heteroaryl. In some embodiments, RE is C1-C6 alkylene-heteroaryl.


In some embodiments, RA1 is hydrogen. In some embodiments, RA1 is C1-C6-alkyl (e.g., methyl).


In some embodiments, m is 0, 1, or 2. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, x is 0, 1, or 2. In some embodiments, x is 0. In some embodiments, x is 1. In some embodiments, x is 2. In some embodiments y is 0 or 1. In some embodiments, y is 0.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-a):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), C(R3a)(R3b), N, N(R3c), or 0, wherein at least one of X, Y, and Z is N, N(R3c), or 0, and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; L1 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a and R3b are each independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; or each of R3a and R3b, together with the carbon atom to which they are attached, form an oxo group; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-b):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-c):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-d):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1—C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-e):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; m is 0, 1, or 2; p is 0, 1, 2, or 3; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-f):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; L2 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —N(RB)(RC), or —ORA; R3a is hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is independently C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, R2 is halo. In some embodiments, R2 is fluoro. In some embodiments, R2 is —ORA. In some embodiments, R2 is —N(RB)(RC).


In some embodiments, the compound of Formula (I) is a compound of Formula (I-g):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; L2 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —N(RB)(RC), or —ORA; R3a is hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is independently C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (I) is a compound of Formula (I-h):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; L2 is absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C1-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —N(RB)(RC), or —ORA; R3a, is hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, C1-C6 alkylene-cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, or —C(O)RD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R8 is independently C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, —SRE, or —S(O)xRD; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA is independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C1-C6 heteroalkyl, cycloalkyl, heterocyclyl, or —ORA; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD and RE is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments of any one of Formula (I), (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), and (I-g), R3c is not hydrogen or methyl. In some embodiments, R3c is not hydrogen. In some embodiments, R3c is not methyl. In some embodiments, R3c is not ethyl. In some embodiments, a compound of Formula (I) is not Compound 143, 207, 208, 209, 210, 211, 212, 228, 229, 230, 231, 234, 235, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 249, 250, 251, 252, 253, 258, 259, 260, 269, 270, 272, 273, 274, 275, 277, 278, 279, 280, 281, 284, 285, 286, or 287. In some embodiments, a compound of Formula (I) is not Compound 284.


In some embodiments, the compound of Formula (I) is selected from a compound in Table 1, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.









TABLE 1







Exemplary compounds of Formula (I)








Compound



No.
Structure











118


embedded image







119


embedded image







140


embedded image







141


embedded image







142


embedded image







143


embedded image







145


embedded image







146


embedded image







147


embedded image







148


embedded image







149


embedded image







150


embedded image







187


embedded image







188


embedded image







189


embedded image







190


embedded image







191


embedded image







192


embedded image







193


embedded image







194


embedded image







195


embedded image







196


embedded image







197


embedded image







198


embedded image







199


embedded image







200


embedded image







201


embedded image







202


embedded image







203


embedded image







204


embedded image







205


embedded image







206


embedded image







207


embedded image







208


embedded image







209


embedded image







210


embedded image







211


embedded image







212


embedded image







217


embedded image







218


embedded image







219


embedded image







228


embedded image







229


embedded image







230


embedded image







231


embedded image







234


embedded image







235


embedded image







237


embedded image







238


embedded image







239


embedded image







240


embedded image







241


embedded image







242


embedded image







243


embedded image







244


embedded image







245


embedded image







246


embedded image







247


embedded image







249


embedded image







250


embedded image







251


embedded image







252


embedded image







253


embedded image







255


embedded image







256


embedded image







257


embedded image







258


embedded image







259


embedded image







260


embedded image







261


embedded image







262


embedded image







263


embedded image







264


embedded image







265


embedded image







266


embedded image







267


embedded image







268


embedded image







269


embedded image







270


embedded image







271


embedded image







272


embedded image







273


embedded image







274


embedded image







275


embedded image







277


embedded image







278


embedded image







279


embedded image







280


embedded image







281


embedded image







282


embedded image







283


embedded image







284


embedded image







285


embedded image







286


embedded image







287


embedded image







288


embedded image







289


embedded image







290


embedded image







291


embedded image







292


embedded image







293


embedded image







294


embedded image







295


embedded image







296


embedded image







297


embedded image







298


embedded image







299


embedded image







300


embedded image







301


embedded image







302


embedded image







303


embedded image







304


embedded image







305


embedded image







306


embedded image







307


embedded image







308


embedded image







309


embedded image







310


embedded image







311


embedded image







312


embedded image







313


embedded image







314


embedded image







315


embedded image







316


embedded image







317


embedded image







318


embedded image







319


embedded image







320


embedded image







321


embedded image







322


embedded image







323


embedded image







324


embedded image







325


embedded image







326


embedded image







327


embedded image







328


embedded image







329


embedded image







330


embedded image







331


embedded image







332


embedded image







333


embedded image







334


embedded image







335


embedded image







336


embedded image







337


embedded image







338


embedded image







339


embedded image







340


embedded image







341


embedded image







342


embedded image







343


embedded image







344


embedded image







345


embedded image







346


embedded image







347


embedded image







348


embedded image







349


embedded image







350


embedded image







351


embedded image







352


embedded image







353


embedded image







354


embedded image







355


embedded image







356


embedded image







357


embedded image







358


embedded image







359


embedded image







360


embedded image







361


embedded image







362


embedded image







363


embedded image







364


embedded image







365


embedded image







366


embedded image







367


embedded image







368


embedded image







369


embedded image







370


embedded image







371


embedded image







372


embedded image







373


embedded image







374


embedded image







375


embedded image







376


embedded image







377


embedded image







378


embedded image







379


embedded image







380


embedded image







381


embedded image







382


embedded image







383


embedded image







384


embedded image







385


embedded image







386


embedded image







387


embedded image







388


embedded image







389


embedded image







390


embedded image







391


embedded image







392


embedded image







393


embedded image







394


embedded image







395


embedded image







396


embedded image







397


embedded image







398


embedded image







399


embedded image







400


embedded image







401


embedded image







402


embedded image







403


embedded image







404


embedded image







405


embedded image







406


embedded image







407


embedded image







408


embedded image







409


embedded image







410


embedded image







411


embedded image







412


embedded image







413


embedded image







414


embedded image







415


embedded image







416


embedded image







417


embedded image







418


embedded image







419


embedded image







420


embedded image







421


embedded image







422


embedded image







423


embedded image







424


embedded image







425


embedded image







426


embedded image







427


embedded image







428


embedded image







429


embedded image







430


embedded image







431


embedded image







432


embedded image







433


embedded image







434


embedded image







435


embedded image







436


embedded image







437


embedded image







438


embedded image







439


embedded image







440


embedded image







441


embedded image







442


embedded image







443


embedded image







444


embedded image







445


embedded image







446


embedded image







447


embedded image







448


embedded image







449


embedded image







450


embedded image







451


embedded image







452


embedded image







453


embedded image







454


embedded image







455


embedded image







456


embedded image







457


embedded image







458


embedded image







459


embedded image







460


embedded image







461


embedded image







462


embedded image







463


embedded image







464


embedded image







468


embedded image







469


embedded image







470


embedded image







471


embedded image







472


embedded image







473


embedded image







474


embedded image







475


embedded image







476


embedded image







477


embedded image







478


embedded image







479


embedded image







480


embedded image







481


embedded image







482


embedded image







483


embedded image







484


embedded image







485


embedded image







486


embedded image







487


embedded image







488


embedded image







489


embedded image







490


embedded image







491


embedded image







492


embedded image







493


embedded image







494


embedded image







495


embedded image







496


embedded image







497


embedded image







498


embedded image







499


embedded image







500


embedded image







501


embedded image







502


embedded image







503


embedded image







504


embedded image







505


embedded image







506


embedded image







507


embedded image







508


embedded image







509


embedded image







510


embedded image







511


embedded image







512


embedded image







513


embedded image







514


embedded image







515


embedded image







516


embedded image







517


embedded image







518


embedded image







519


embedded image







520


embedded image







521


embedded image







522


embedded image







523


embedded image







524


embedded image







525


embedded image







526


embedded image







527


embedded image







528


embedded image







529


embedded image







530


embedded image







531


embedded image







532


embedded image







533


embedded image







534


embedded image







535


embedded image







536


embedded image







537


embedded image







538


embedded image







539


embedded image







540


embedded image







541


embedded image







542


embedded image







543


embedded image







544


embedded image







545


embedded image







546


embedded image







547


embedded image







548


embedded image







549


embedded image







550


embedded image







551


embedded image







552


embedded image







553


embedded image







554


embedded image







555


embedded image







556


embedded image







557


embedded image







558


embedded image







559


embedded image







560


embedded image







561


embedded image







562


embedded image







563


embedded image







564


embedded image







565


embedded image







566


embedded image







567


embedded image







568


embedded image







569


embedded image







570


embedded image







571


embedded image







572


embedded image







573


embedded image







574


embedded image







575


embedded image







576


embedded image







577


embedded image







578


embedded image







579


embedded image







580


embedded image







581


embedded image







582


embedded image







583


embedded image







584


embedded image







585


embedded image







586


embedded image







587


embedded image







588


embedded image







589


embedded image







590


embedded image







591


embedded image







592


embedded image







593


embedded image







594


embedded image







595


embedded image







596


embedded image







597


embedded image







598


embedded image







599


embedded image







600


embedded image







601


embedded image







602


embedded image







603


embedded image







604


embedded image







605


embedded image







606


embedded image







607


embedded image







608


embedded image







609


embedded image







610


embedded image







611


embedded image







612


embedded image







613


embedded image







614


embedded image







615


embedded image







616


embedded image







617


embedded image







618


embedded image







619


embedded image







620


embedded image







621


embedded image







622


embedded image







623


embedded image







624


embedded image







625


embedded image







626


embedded image







627


embedded image







628


embedded image







629


embedded image







630


embedded image







631


embedded image







632


embedded image







633


embedded image







634


embedded image







635


embedded image







636


embedded image







637


embedded image







638


embedded image







639


embedded image







640


embedded image







641


embedded image







642


embedded image







643


embedded image







644


embedded image







645


embedded image







646


embedded image







647


embedded image







648


embedded image







649


embedded image







650


embedded image







651


embedded image







652


embedded image







653


embedded image







654


embedded image







656


embedded image







657


embedded image







658


embedded image







659


embedded image







660


embedded image







661


embedded image







664


embedded image







665


embedded image







666


embedded image







667


embedded image







668


embedded image







669


embedded image







670


embedded image







671


embedded image







672


embedded image







673


embedded image







674


embedded image







675


embedded image







676


embedded image







677


embedded image







678


embedded image







679


embedded image







680


embedded image







681


embedded image







682


embedded image







683


embedded image







684


embedded image







685


embedded image







686


embedded image







687


embedded image







688


embedded image







689


embedded image







690


embedded image







691


embedded image







692


embedded image







693


embedded image







694


embedded image







695


embedded image







696


embedded image







697


embedded image







698


embedded image







699


embedded image







700


embedded image







701


embedded image







702


embedded image







703


embedded image







704


embedded image







705


embedded image







706


embedded image







707


embedded image







708


embedded image







709


embedded image







710


embedded image







711


embedded image







712


embedded image







713


embedded image







714


embedded image







715


embedded image







716


embedded image







717


embedded image







718


embedded image







719


embedded image







720


embedded image







721


embedded image







722


embedded image







723


embedded image







724


embedded image







725


embedded image







726


embedded image







727


embedded image







728


embedded image







729


embedded image







730


embedded image







731


embedded image







732


embedded image







733


embedded image







734


embedded image







735


embedded image







736


embedded image







737


embedded image







738


embedded image







739


embedded image







740


embedded image







741


embedded image







742


embedded image







743


embedded image







744


embedded image







745


embedded image







746


embedded image







747


embedded image







748


embedded image







749


embedded image







750


embedded image







751


embedded image







752


embedded image







753


embedded image







754


embedded image







755


embedded image







756


embedded image







757


embedded image







758


embedded image







759


embedded image







760


embedded image







761


embedded image







762


embedded image







763


embedded image







764


embedded image







765


embedded image







766


embedded image







767


embedded image







768


embedded image







769


embedded image







770


embedded image







771


embedded image







772


embedded image







773


embedded image







774


embedded image







775


embedded image







776


embedded image







777


embedded image







778


embedded image







779


embedded image







780


embedded image







781


embedded image







782


embedded image







783


embedded image







784


embedded image







785


embedded image







786


embedded image







787


embedded image







788


embedded image







789


embedded image







790


embedded image







791


embedded image







792


embedded image







793


embedded image







794


embedded image







795


embedded image







796


embedded image







797


embedded image







798


embedded image







799


embedded image







800


embedded image







801


embedded image












In some embodiments, a compound of Formula (I) is selected from Compounds 288-363. In some embodiments, a compound of Formula (I) is a compound other than Compound 118, 119, 140, 141, 142, 143, 145, 146, 147, 148, 149, 150, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 217, 218, 219, 228, 229, 230, 231, 234, 235, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 249, 250, 251, 252, 253, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, or 287. In some embodiments, a compound of Formula (I) is selected from 141, 143, 190, 198, 202, 207, 208, 209, 210, 228, 229, 234, 237, 239, 240, 242, 243, 246, 250, 251, 252, 255, 258, 260, 266, 269, 272, 275, 277, 278, 279, 284, 285, 288, 293, 293, 294, 296, 298, 301, 302, 306, 310, 312, 314, 315, 350, and 351.


In some embodiments, a compound of Formula (I) is: a) Compound 288, b) Compound 289, c) Compound 290, d) Compound 291, e) Compound 292, f) Compound 293, g) Compound 294, h) Compound 295, i) Compound 296, j) Compound 297, k) Compound 298, l) Compound 299, m) Compound 300, n) Compound 301, o) Compound 302, p) Compound 303, q) Compound 304, r) Compound 305, s) Compound 306, t) Compound 307, u) Compound 308, v) Compound 309, w) Compound 310, x) Compound 311, y) Compound 312, z) Compound 313, aa) Compound 314, bb) Compound 315, cc) Compound 316, dd) Compound 317, ee) Compound 318, ff) Compound 319, gg) Compound 320, hh) Compound 321, ii) Compound 322, jj) Compound 323, kk) Compound 324, ll) Compound 325, mm) Compound 326, nn) Compound 327, oo) Compound 328, pp) Compound 329, qq) Compound 330, Compound rr) Compound 331, ss) Compound 332, tt) Compound 333, uu) Compound 334, vv) Compound 335, ww) Compound 336, xx) Compound 337, yy) Compound 338, zz) Compound 339, aaa) Compound 340, bbb) Compound 341, ccc) Compound 342, ddd) Compound 343, eee) Compound 344, fff) Compound 345, ggg) Compound 346, hhh) Compound 347, iii) Compound 348, jjj) Compound 349, kkk) Compound 350, 111) Compound 351, mmm) Compound 352, nnn) Compound 353, ooo) Compound 354, ppp) Compound 355, qqq) Compound 356, rrr) Compound 357, sss) Compound 358, ttt) Compound 359, uuu) Compound 360, vvv) Compound 361, www) Compound 362, or xxx) Compound 363.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 118, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X and Y are each independently C(R3a) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h) and (I-i) is Compound 119, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L1 is absent or —N(R4)—; and L2 is absent or —C(O)N(R4)— (e.g., —C(O)N(H)—). In some embodiments, for Formula (I), the compound is selected from Compound 118, 141, 228, 229, 242, 243, 269, and 277.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is N; Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 140, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is 0; Y is C(R3a) (e.g., C(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 141, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 142, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 143, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 145, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is N(R3c) (e.g., NH); Y is C(R3a) (e.g., C(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 146, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is N(R3c) (e.g., NH); Y is N; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 147, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 148, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 149, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is N; Y is C(R3a) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 150, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is 0; Y is C(R3a) (e.g., C(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 187, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a)(R3b) (e.g., CH2); Y is C(R3a)(R3b) (e.g., CH2); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 188, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 189, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 190, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,2-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 191, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-ethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 192, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 193, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7-diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 194, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 195, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 196, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-tert-butyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 197, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N,N-dimethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 198, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., octahydropyrrolo[1,2-a]pyrazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 199, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L1 is —N(R4)— (e.g., —N(CH3)—); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I) and (I-a) is Compound 200, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L1 is —N(R4)— (e.g., —N(CH3)—); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I) and (I-a) is Compound 201 or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N-dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 202, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-tert-butyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 203, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,3′-bipyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 204, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,6-diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 205, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g 2-methyl-2,6-diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 206, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 207, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 208, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 209, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-ethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 210, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6-dimethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 211, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 212, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 217, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]oxazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 218, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]thiazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 219, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 228, 352, 353, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,2-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 229, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 230, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 231, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]oxazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 234, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]thiazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 235, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 237, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 238, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-ethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 239, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 240, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7-diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 241, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,6-diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 242, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2-methyl-2,6-diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 243, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L1 is —N(R4)— (e.g., —N(CH3)—); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 244, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L1 is —N(R4)— (e.g., —N(CH3)—); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 245, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 246, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4,6-dimethylpyrazolo[1,5-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 247, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-tert-butyl)-aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 249, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., octahydropyrrolo[1,2-a]pyrazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 250, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N,N-dimethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 251, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 252, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethyl-[1,2,4]triazolo[1,5-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 253, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (1R,5S)-3,8-diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 255, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 256, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-ethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 257, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N-methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 258, 350, 351, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-tert-butyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 259, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (1R,5S)-3,8-diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 260, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 261, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 262, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 263, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethyl-[1,2,4]triazolo[1,5-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-g), and (I-h) is Compound 264, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4,6-dimethylpyrazolo[1,5-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-g), and (I-h) is Compound 265, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 266, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-methyl-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 267, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is monocyclic heteroaryl (e.g., pyrazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), and (I-h) is Compound 268, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 269, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is monocyclic heteroaryl (e.g., pyrazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e) is Compound 270, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 271, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,3′-bipyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 272, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 273, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2,6,6-tetramethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 274, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 275, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 277, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N-dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 278, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (1R,5S)-3,8-diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 279, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e) is Compound 280, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e is Compound 281, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), and (I-e) is Compound 282, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is C(R3a) (e.g., C(CH3)); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), and (I-e) is Compound 283, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 284, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 285, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 286, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 287, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 288, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (1R,5S)-3,8-diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 289, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH(CH3)2)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 290, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH2OH)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 291, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH2OCH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 292, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 293, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) wherein R3, is C1-C6-cycloalkyl (e.g., cyclopropyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 294, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) wherein R3c is heterocyclyl (e.g., oxetane); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 295, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-cyclopropyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 296, 371, 372, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., C(CH3)); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 297, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 298, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,6-diazaspiro[3.4]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 299, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; R2 is C1-C6 alkyl (e.g., CH3); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 300, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,7-diazaspiro[3.5]nonanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 301, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH2CH2OCH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 302, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; R2 is halo (e.g., F); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 303, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3c is tetrahydro-2H-pyranyl; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 304, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2CH2F); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 305, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2CH2OCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 306, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2CH2OCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 307, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 308, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2C(O)N(CH3)2); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 309, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-ethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2CH2OCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 310, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; R2 is —ORA (e.g., OCH3); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 311, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g, NCH2CH2CH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 312, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6-alkyl substituted with R8; R8 is heteroaryl (e.g, pyridyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 313, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-cyano-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 314, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-6-methoxy-2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 315, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CF3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 316, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heterocyclyl (e.g., oxiranyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 317, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heteroaryl (e.g., pyrimidyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 318, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 319, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 320, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 1,2,4-trimethyl-1H-benzo[d]imidazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 321, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 322, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-methoxy-2-methylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 323, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 324, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6-hydroxy-2,7-dimethyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 325, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 326, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-methanaminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 327, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-acyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 328, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH(OH)CH2(OH))); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 329, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N-diethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH2OCH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 330, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2COOH)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 331, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-1,2-dimethyl-1H-benzo[d]imidazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 332, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 333, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 334, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-methanaminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 335, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-methyl-4 aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 336, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH2Cl)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 337, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 338, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2C(O)CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 339, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heteroaryl (e.g., 1H-indazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 340, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heteroaryl (e.g., pyrazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 341, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazin-8(7H)—I); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 342, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 343, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6-methoxy-2,7-dimethyl-2H-indazolyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 344, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-cyclopropyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 345, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-fluoro-3-(N-methylamino)pyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 346, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with —N(RB)(RC) (e.g., —NH(CH2-py)); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 347, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,7-diazaspiro[3.5]nonanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 348, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,8-diazaspiro[4.5]decanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 349, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2C(CH3)2(OH))); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 354, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is cycloalkyl (e.g., cyclobutyl) substituted with R1; R8 is ORA (e.g., OH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 355, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3c is heterocyclyl (e.g., tetrahydrofuranyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 356, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH(OH)CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 357, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; one R8 is cycloalkyl (e.g., cyclobutyl) and one R8 is —ORA (e.g., —OH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 358, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-hydroxy-2-methylimidazo[1,2-a]pyrazinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 359, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH3); Z is N; R2 is ORA (e.g., OH); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 360, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH3); Z is N; R2 is halo (e.g., F); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 361, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH3); Z is N; R2 is —N(RB)(RC) (e.g., —NH(CH3)); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 362, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl (e.g., vinyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 363, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3CF2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 364, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3c is cycloalkyl (e.g., cyclobutyl) substituted with R8; R8 is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 365, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heteroaryl (e.g., oxazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 366, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH2CH(CH3)OCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 367, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c); R3, is C1-C6 alkyl substituted with R8; R8 is heteroaryl (e.g., 1H-1,2,3-triazolyl) substituted with C1-C6 alkyl; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 368, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with —NRBRC (e.g., —NHCH2CH2OH); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 369, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with —NRBRC (e.g., —NH2) and haloalkyl (e.g., —CF3); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 370, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., pyrrolidinyl) substituted with —NRBRC (e.g., —NHC(CH2CH2)CH2F); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., N(CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 373, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 374, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N-dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 375, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-cyclopropyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 376, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6-dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 377, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1-methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 378, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7-diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 379, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH2CH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 378, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L2 is —C(O)N(R4)— (e.g., —C(O)N(H)—); X is C(R3a) (e.g., CH); Y is N(R3c) (e.g., NCH3); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 381, 382, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.


The present disclosure further features compounds of Formula (II). In some embodiments, the compound of Formula (II) is a compound of Formula (II-a):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R8; M and P are each independently C(R2) or N; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments of Formula (II),




embedded image


is selected from




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments,




embedded image


is




embedded image


In some embodiments, the compound of Formula (II) is a compound of Formula (II-b):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; M and P are each independently C(R2) or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is a compound of Formula (II-c):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; M and P are each independently C(R2) or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-d):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-e):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-f):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is a compound of Formula (II-g):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-h):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-i):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —RBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2. In some embodiments, the compound of Formula (II) is a compound of Formula (II-j):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a) N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; M and P are each independently C(R2) or N; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is a compound of Formula (II-k):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; M and P are each independently C(R2) or N; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; each R2 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, or —ORA; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is a compound of Formula (II-l):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is a compound of Formula (II-m):




embedded image


or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R1; U and W are each independently C or N; X, Y, and Z are each independently C(R3a), N, N(R3c) or S, wherein at least one of X, Y, and Z is N or N(R3c), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L1 and L2 is independently absent, C1-C6-alkylene, C1-C6-heteroalkylene, —O—, —C(O)—, —N(R4)—, —N(R4)C(O)—, or —C(O)N(R4)—, wherein each alkylene and heteroalkylene is optionally substituted with one or more R5; each R1 is independently hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, C1-C6 alkylene-aryl, C2-C6 alkenylene-aryl, C1-C6 alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; or two R1 groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R6; R3a is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)ORD, or —S(O)xRD, or —C(O)RD; R3c is hydrogen, C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, —ORA, —S(O)xRD, or —C(O)RD; each R4 is independently hydrogen, C1-C6-alkyl, or C1-C6-haloalkyl; each R5 is independently hydrogen, C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, halo, cyano, oxo, —ORA, —NRBRC, —C(O)RD, or —C(O)ORD; each R6 is independently C1-C6-alkyl, C2-C6-alkenyl, C2-C6-alkynyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, —ORA, —NRBRC, —NRBC(O)RD, —NO2, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R11; each RA is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, aryl, heteroaryl, C1-C6 alkylene-aryl, C1-C6 alkylene-heteroaryl, —C(O)RD, or —S(O)xRD; each of RB and RC is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl, —ORA, —C(O)NRBRC, —C(O)RD, —C(O)ORD, or —S(O)xRD; or RB and RC together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R7; each RD is independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 heteroalkyl, C1-C6 haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C1-C6 alkylene-aryl, or C1-C6 alkylene-heteroaryl; each R7 is C1-C6-alkyl, halo, cyano, oxo, or —ORA1; each R11 is independently C1-C6-alkyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or —ORA; each RA1 is hydrogen or C1-C6-alkyl; and x is 0, 1, or 2.


In some embodiments, the compound of Formula (II) is selected from a compound in Table 2, or a pharmaceutically acceptable salt thereof.













CMPD



No.
Structure
















900


embedded image







901


embedded image







902


embedded image







903


embedded image







904


embedded image







905


embedded image







906


embedded image







907


embedded image







908


embedded image







909


embedded image







910


embedded image







911


embedded image







912


embedded image







913


embedded image







914


embedded image







915


embedded image







916


embedded image







917


embedded image







918


embedded image







919


embedded image







920


embedded image







921


embedded image







922


embedded image







923


embedded image







924


embedded image







925


embedded image







926


embedded image







927


embedded image







928


embedded image







929


embedded image







930


embedded image







931


embedded image







932


embedded image







933


embedded image







934


embedded image







935


embedded image







936


embedded image







937


embedded image







938


embedded image







939


embedded image







940


embedded image







941


embedded image







942


embedded image







943


embedded image







944


embedded image







945


embedded image







946


embedded image







947


embedded image







948


embedded image







949


embedded image







950


embedded image







951


embedded image







952


embedded image







953


embedded image







954


embedded image







955


embedded image







956


embedded image







957


embedded image







958


embedded image







959


embedded image







960


embedded image







961


embedded image







962


embedded image







963


embedded image







964


embedded image







965


embedded image







966


embedded image







967


embedded image







968


embedded image







969


embedded image







970


embedded image







971


embedded image







972


embedded image







973


embedded image







974


embedded image







975


embedded image







976


embedded image







977


embedded image







978


embedded image







979


embedded image







980


embedded image







981


embedded image







982


embedded image







983


embedded image







984


embedded image







985


embedded image







986


embedded image







987


embedded image







988


embedded image







989


embedded image







990


embedded image







991


embedded image







992


embedded image







993


embedded image







994


embedded image







995


embedded image







996


embedded image







997


embedded image







998


embedded image







999


embedded image







1000


embedded image







1001


embedded image







1002


embedded image







1003


embedded image







1004


embedded image







1005


embedded image







1006


embedded image







1007


embedded image







1008


embedded image







1009


embedded image







1010


embedded image







1011


embedded image







1012


embedded image







1013


embedded image







1014


embedded image







1015


embedded image







1016


embedded image







1017


embedded image







1018


embedded image







1019


embedded image







1020


embedded image







1021


embedded image







1022


embedded image







1023


embedded image







1024


embedded image







1025


embedded image







1026


embedded image







1027


embedded image







1028


embedded image







1029


embedded image







1030


embedded image







1031


embedded image







1032


embedded image







1033


embedded image







1034


embedded image







1035


embedded image







1036


embedded image







1037


embedded image







1038


embedded image







1039


embedded image







1040


embedded image







1041


embedded image







1042


embedded image







1043


embedded image







1044


embedded image







1045


embedded image







1046


embedded image







1047


embedded image







1048


embedded image







1049


embedded image







1050


embedded image







1051


embedded image







1052


embedded image







1053


embedded image







1054


embedded image











Pharmaceutical Compositions, Kits, and Administration

The present invention provides pharmaceutical compositions comprising a compound of Formula (I) or (II), e.g., a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer, as described herein, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition described herein comprises a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, is provided in an effective amount in the pharmaceutical composition. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount.


Pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include the steps of bringing the compound of Formula (I) or (II) (the “active ingredient”) into association with a carrier and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.


Pharmaceutical compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a “unit dose” is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.


Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.


The term “pharmaceutically acceptable excipient” refers to a non-toxic carrier, adjuvant, diluent, or vehicle that does not destroy the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable excipients useful in the manufacture of the pharmaceutical compositions of the invention are any of those that are well known in the art of pharmaceutical formulation and include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Pharmaceutically acceptable excipients useful in the manufacture of the pharmaceutical compositions of the invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.


Compositions of the present invention may be administered orally, parenterally (including subcutaneous, intramuscular, intravenous and intradermal), by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. In some embodiments, provided compounds or compositions are administrable intravenously and/or orally.


The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intraocular, intravitreal, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intraperitoneal intralesional and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, subcutaneously, intraperitoneally, or intravenously. Sterile injectable forms of the compositions of this invention may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. Pharmaceutically acceptable compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, carriers commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added. In some embodiments, a provided oral formulation is formulated for immediate release or sustained/delayed release. In some embodiments, the composition is suitable for buccal or sublingual administration, including tablets, lozenges and pastilles. A provided compound can also be in micro-encapsulated form.


Alternatively, pharmaceutically acceptable compositions of this invention may be administered in the form of suppositories for rectal administration. Pharmaceutically acceptable compositions of this invention may also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.


For ophthalmic use, provided pharmaceutically acceptable compositions may be formulated as micronized suspensions or in an ointment such as petrolatum.


In order to prolong the effect of a drug, it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.


Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with ordinary experimentation.


Compounds provided herein are typically formulated in dosage unit form, e.g., single unit dosage form, for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject or organism will depend upon a variety of factors including the disease being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific active ingredient employed; the duration of the treatment; drugs used in combination or coincidental with the specific active ingredient employed; and like factors well known in the medical arts.


The exact amount of a compound required to achieve an effective amount will vary from subject to subject, depending, for example, on species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound(s), mode of administration, and the like. The desired dosage can be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage can be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).


In certain embodiments, an effective amount of a compound for administration one or more times a day to a 70 kg adult human may comprise about 0.0001 mg to about 3000 mg, about 0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg, about 0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg, of a compound per unit dosage form.


In certain embodiments, the compounds of Formula (I) or (II) may be at dosage levels sufficient to deliver from about 0.001 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more preferably from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect.


It will be appreciated that dose ranges as described herein provide guidance for the administration of provided pharmaceutical compositions to an adult. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.


It will be also appreciated that a compound or composition, as described herein, can be administered in combination with one or more additional pharmaceutical agents. The compounds or compositions can be administered in combination with additional pharmaceutical agents that improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body. It will also be appreciated that the therapy employed may achieve a desired effect for the same disorder, and/or it may achieve different effects.


The compound or composition can be administered concurrently with, prior to, or subsequent to, one or more additional pharmaceutical agents, which may be useful as, e.g., combination therapies. Pharmaceutical agents include therapeutically active agents. Pharmaceutical agents also include prophylactically active agents. Each additional pharmaceutical agent may be administered at a dose and/or on a time schedule determined for that pharmaceutical agent. The additional pharmaceutical agents may also be administered together with each other and/or with the compound or composition described herein in a single dose or administered separately in different doses. The particular combination to employ in a regimen will take into account compatibility of the inventive compound with the additional pharmaceutical agents and/or the desired therapeutic and/or prophylactic effect to be achieved. In general, it is expected that the additional pharmaceutical agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.


Exemplary additional pharmaceutical agents include, but are not limited to, anti-proliferative agents, anti-cancer agents, anti-diabetic agents, anti-inflammatory agents, immunosuppressant agents, and a pain-relieving agent. Pharmaceutical agents include small organic molecules such as drug compounds (e.g., compounds approved by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNAs, RNAs, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and cells.


Also encompassed by the invention are kits (e.g., pharmaceutical packs). The inventive kits may be useful for preventing and/or treating a proliferative disease or a non-proliferative disease, e.g., as described herein. The kits provided may comprise an inventive pharmaceutical composition or compound and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container). In some embodiments, provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of an inventive pharmaceutical composition or compound. In some embodiments, the inventive pharmaceutical composition or compound provided in the container and the second container are combined to form one-unit dosage form.


Thus, in one aspect, provided are kits including a first container comprising a compound described herein, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the kit of the disclosure includes a first container comprising a compound described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In certain embodiments, the kits are useful in preventing and/or treating a disease, disorder, or condition described herein in a subject (e.g., a proliferative disease or a non-proliferative disease). In certain embodiments, the kits further include instructions for administering the compound, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or a pharmaceutical composition thereof, to a subject to prevent and/or treat a proliferative disease or a non-proliferative disease.


METHODS OF USE

Described herein are compounds useful for modulating splicing. In some embodiments, a compound of Formula (I) or (II) may be used to alter the amount, structure, or composition of a nucleic acid (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) by increasing or decreasing splicing at a splice site. In some embodiments, increasing or decreasing splicing results in modulating the level or structure of a gene product (e.g., an RNA or protein) produced. In some embodiments, a compound of Formula (I) or (II) may modulate a component of the splicing machinery, e.g., by modulating the interaction with a component of the splicing machinery with another entity (e.g., nucleic acid, protein, or a combination thereof). The splicing machinery as referred to herein comprises one or more spliceosome components. Spliceosome components may comprise, for example, one or more of major spliceosome members (U1, U2, U4, U5, U6 snRNPs), or minor spliceosome members (U11, U12, U4atac, U6atac snRNPs) and their accessory splicing factors.


In another aspect, the present disclosure features a method of modifying of a target (e.g., a precursor RNA, e.g., a pre-mRNA) through inclusion of a splice site in the target, wherein the method comprises providing a compound of Formula (I) or (II). In some embodiments, inclusion of a splice site in a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) results in addition or deletion of one or more nucleic acids to the target (e.g., a new exon, e.g. a skipped exon). Addition or deletion of one or more nucleic acids to the target may result in an increase in the levels of a gene product (e.g., RNA, e.g., mRNA, or protein).


In another aspect, the present disclosure features a method of modifying a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) through exclusion of a splice site in the target, wherein the method comprises providing a compound of Formula (I) or (II). In some embodiments, exclusion of a splice site in a target (e.g., a precursor RNA, e.g., a pre-mRNA) results in deletion or addition of one or more nucleic acids from the target (e.g., a skipped exon, e.g. a new exon). Deletion or addition of one or more nucleic acids from the target may result in a decrease in the levels of a gene product (e.g., RNA, e.g., mRNA, or protein). In other embodiments, the methods of modifying a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) comprise suppression of splicing at a splice site or enhancement of splicing at a splice site (e.g., by more than about 0.5%, e.g., 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more), e.g., as compared to a reference (e.g., the absence of a compound of Formula (I) or (II), or in a healthy or diseased cell or tissue).


The methods described herein can be used to modulate splicing, e.g., of a nucleic acid comprising a particular sequence (e.g., a target sequence). Exemplary genes encoding a target sequence (e.g., a target sequence comprising DNA or RNA, e.g., pre-mRNA) include, inter alia, ABCA4, ABCA9, ABCB1, ABCB5, ABCC9, ABCD1, ACADL, ACADM, ACADSB, ACSS2, ACTB, ACTG2, ADA, ADAL, ADAM10, ADAMJS, ADAM22, ADAM32, ADAMTS12, ADAMTS13, ADAMTS20, ADAMTS6, ADAMTS9, ADAR, ADCY3, ADCY10, ADCY8, ADNP, ADRBK2, AFP, AGL, AGT, AHCTF1, AHR, AKAP10, AKAP3, AKNVA, ALAS1, ALS2CL, ALB, ALDH3A2, ALG6, AMBRA1, ANK3, ANTXR2, ANXA10, ANXA11, ANGPTL3, AP2A2, AP4E1, APC, APOA1, APOB, APOC3, APOH, AR, ARID2, ARID3A, ARID3B, ARFGEF1, ARFGEF2, ARHGAP1, ARHGAP8, ARHGAP18, ARHGAP26, ARHGEF18, ARHGEF2, ARPC3, ARS2, ASH1L, ASHIL-IT1, ASNSD1, ASPM, ATAD5, ATF1, ATG4A, ATG16L2, ATM, ATN1, ATP11C, ATP6VJG3, ATP13A5, ATP7A, ATP7B, ATR, ATXN2, ATXN3, ATXN7, ATXN10, AXIN1, B2M, B4GALNT3, BBS4, BCL2, BCL2L1, BCL2-like 11 (BIM), BCL11B, BBOX1, BCSIL, BEAN1, BHLHE40, BMPR2, BMP2K, BPTF, BRAF, BRCA1, BRCA2, BRCC3, BRSK1, BRSK2, BTAF1, BTK, C2orf55, C4orf29, C6orf118, C9orf43, C9orf72, C10orf137, C11orf30, C11orf65, C11orf70, C11orf87, C12orf51, C13orf1, C13orf15, C14orf1l, C14orf118, C15orf29, C15orf42, C15orf6O, C16orf33, C16orf38, C16orf48, C18orf8, C19orf42, C1orf107, C1orf114, C1orf130, C1orf149, C1orf27, C1orf71, C1orf94, C1R, C20orf74, C21orf70, C3orf23, C4orf18, C5orf34, C8B, C8orf33, C9orf114, C9orf86, C9orf98, C3, CA11, CAB39, CACHD1, CACNA1A, CACNA1B, CACNA1C, CACNA2D1, CACNA1G, CACNA1H, CALCA, CALCOCO2, CAMKID, CAMKK1, CAPN3, CAPN9, CAPSL, CARD11, CARKD, CASZl, CAT, CBLB, CBX1, CBX3, CCDC102B, CCDC11, CCDC15, CCDC18, CCDC5, CCDC81, CCDC131, CCDC146, CD4, CD274, CD1B, CDC14A, CDC16, CDC2L5, CDC42BPB, CDCA8, CDH10, CDH11, CDH24, CDH8, CDH9, CDK5RAP2, CDK6, CDK8, CDK11B, CD33, CD46, CDH1, CDH23, CDK6, CDK11B, CDK13, CEBPZ, CEL, CELSR3, CENPA, CENP1, CENPT, CENTB2, CENTG2, CEPJ10, CEP170, CEP192, CETP, CFB, CFTR, CFH, CGN, CGNL1, CHAF1A, CHD9, CHIC2, CHL1, CHN1, CHM, CLEC16A, CLIC2, CLCN1, CLINT1, CLK1, CLPB, CLP™1, CMIP, CMYA5, CNGA3, CNOT1, CNOT7, CNTN6, COG3, COLIJA1, COL11A2, COL12A1, COL14A1, COL15A1, COL17A1, COL19A1, COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A5, COL4A6, COL5A2, COL6A1, COL7A, COL9A, COL9A2, COL22A1, COL24A1, COL25A1, COL29A1, COLQ, COMTD1, COPA, COPB2, COPS7B, COPZ2, CPSF2, CPXM2, CR1, CRBN, CRYZ, CREBBP, CRKRS, CSE1L, CSTB, CSTF3, CT45-6, CTNNB1, CUBN, CUL4B, CUL5, CXorf41, CXXC1, CYBB, CYFIP2, CYP3A4, CYP3A43, CYP3A5, CYP4F2, CYP4F3, CYP17, CYP19, CYP24A1, CYP27A1, DAB1, DAZ2, DCBLD1, DCC, DCTN3, DCUN1D4, DDA1, DDEF1, DDX1, DDX24, DDX4, DENND2D, DEPDC2, DES, DGAT2, DHFR, DHRS7, DHRS9, DHX8, DIP2A, DMD, DMTF1, DNAH3, DNAH8, DNAI1, DNAJA4, DNAJC13, DNAJC7, DNMTl, DNTTIP2, DOCK4, DOCK5, DOCK10, DOCK11, DOT1L, DPP3, DPP4, DPY19L2P2, DR1, DSCC1, DVL3, DUX4, DYNC1H1, DYSF, E2F1, E2F3, E2F8, E4F1, EBF1, EBF3, ECM2, EDEM3, EFCAB3, EFCAB4B, EFNA4, EFTUD2, EGFR, EIF3A, ELA1, ELA2A, ELF2, ELF3, ELF4, EMCN, EMD, EML5, ENO3, ENPP3, EP300, EPAS1, EPB41L5, EPHA3, EPHA4, EPHB1, EPHB2, EPHB3, EPS15, ERBB4, ERCC1, ERCC8, ERGIC3, ERMN, ERMP1, ERN1, ERN2, ESR1, ESRRG, ETS2, ETV3, ETV4, ETV5, ETV6, EVC2, EWSR1, EXO1, EXOC4, F3, F11, F13A1, F5, F7, F8, FAH, FAM13A1, FAM13B1, FAM13C1, FAM134A, FAM161A, FAM176B, FAM184A, FAM19A1, FAM20A, FAM23B, FAM65C, FANCA, FANCC, FANCG, FANCM, FANK1, FAR2, FBNl, FBX015, FBX018, FBXO38, FCGBP, FECH, FEZ2, FGA, FGD6, FGFR2, FGFR10P, FGFR10P2, FGFR2, FGG, FGR, FIX, FKBP3, FLI1, FLJ35848, FLJ36070, FLNA, EN1, FNBP1L, FOLH1, FOSL1, FOSL2, FOXK1, FOAM1, FOXO1, FOXP4, FRAS1, FUT9, FXN, FZD3, FZD6, GAB1, GABPA, GALC, GALNT3, GAPDH, GART, GAS2L3, GATA3, GATAD2A, GBA, GBGT1, GCG, GCGR, GCK, GFI1, GFM1, GH1, GHR, GHV, GJA1, GLA, GLT8D1, GNA11, GNAQ, GNAS, GNB5, GOLGB1, GOLTIA, GOLT1B, GPATCH1, GPR158, GPR160, GPX4, GRAMD3, GRHL1, GRHL2, GRHPR, GRIA1, GRIA3, GRIA4, GRIN2B, GRM3, GRM4, GRN, GSDMB, GSTCD, GSTO2, GTF21, GTPBP4, HADHA, HAND2, HBA2, HBB, HCK, HDAC3, HDAC5, HDX, HEPACAM2, HERC1, HES7, HEXA, HEXB, HHEX, HIPK3, HLA-DPB1, HLA-G, HLCS, HLTF, HMBS, HMGA1, HMGCL, HNF1A, HNF1B, HNF4A, HNF4G, HNRNPH1, HOXCO, HP1BP3, HPGD, HPRT1, HPRT2, HSF1, HSF4, HSF2BP, HSPA9, HSPG2, HTT, HXA, ICA1, IDH1, IDS, IFI44L, IKBKAP, IKZF, IKZF3, ILIR2, IL5RA, IL7RA, IMAIT, INPP5D, INSR, INTS3, INTU, IP04, IP08, IQGAP2, IRF2, IRF4, IRF8, IRX3, ISL1, ISL2, ITFG1, ITGA6, ITGAL, ITGB1, ITGB2, ITGB3, ITGB4, ITIH1, ITPR2, IWS1, JAK1, JAK2, JAG1, JMJD1C, JPH3, KALRN, KAT6A, KATNAL2, KCNN2, KCNT2, KDM2A, KIAA0256, KIAA0528, KIAA0564, KIAA0586, KIAA1033, KIAA1166, KIAA1219, KIAA1409, KIAA1622, KIAA1787, KIF3B, KIF15, KIF16B, KIFSA, KIFSB, KIF9, KIN, KIR2DL5B, KIR3DL2, KIR3DL3, KIT, KLF3, KLF5, KLF7, KLF0, KLF12, KLF16, KLHL20, KLK12, KLKB1, KMT2A, KMT2B, KPNA5, KRAS, KREMEN1, KRIT1, KRT5, KRTCAP2, KYNU, LICAM, L3MBTL, L3MBTL2, LACE1, LAMA1, LAMA2, LAMA3, LAMB1, LARP7, LDLR, LEF1, LENG1, LGALS3, LGMN, LHCGR, LHX3, LHX6, LIMCH1, LIMK2, LIN28B, LIN54, LMBRD1, LMBRD2, LMLN, LMNA, LMO2, LMO7, LOC389634, LOC390110, LPA, LPCAT2, LPL, LRP4, LRPPRC, LRRK2, LRRC19, LRRC42, LRWD1, LUM, LVRN, LYN, LYST, MADD, MAGI1, MAGT1, MALT1, MAP2K1, MAP4K4, MAPK8IP3, MAPK9, MAPT, MARC, MARCH5, MATN2, MBD3, MCF2L2, MCM6, MDGA2, MDM4, ASXL1, FUS, SPR54, MECOM, MEF2C, MEF2D, MEGF0, MEGF1, MEMO1, MET, MGA, MGAM, MGAT4A, MGAT5, MGC16169, MGC34774, MKKS, MIB1, MIER2, MITF, MKL2, MLANA, MLH1, MLL5, MLXA MAE, MPDZ, MP1, MRAP2, MRPLI1, MRPL39, MRPS28, MRPS35, MS4A13, MSH2, MSH3, MSMB, MST1R, MTDH, MTERF3, MTF1, MTF2, MTIF2, MTHFR, MUC2, MUT, MVK, MYB, MYBL2, MYC, MYCBP2, MYH2, MYRF, MYT1, MY019, MY03A, MY09B, MYOM2, MYOM3, NAG, NARG1, NARG2, NCOA1, NDC80, NDFIP2, NEB, NEDD4, NEK, NEK5, NEK1, NF, NF2, NFATC2, NFE2L2, NFIA, NFIB, NFIX, NFKB1, NFKB2, NFKBIL2, NFRKB, NFYA, NFYB, NIPA2, NKAIN2, NKAP, NLRC3, NLRC5, NLRP3, NLRP7, NLRP8, NLRP13, NME1, NME1-NME2, NME2, NME7, NOLI0, NOP561, NOS1, NOS2A, NOTCH1, NPAS4, NPM1, NRID1, NRIH3, NR1H4, NR4A3, NR5A1, NRXN1, NSMAF, NSMCE2, NTSC, NT5C2, NT5C3, NUBP1, NUBPL, NUDT5, NUMA1, NUP88, NUP98, NUP160, NUPL1, OAT, OAZ1, OBFC2A, OBFC2B, OLIG2, OMA1, OPAl, OPN4, OPTN, OSBPLI1, OSBPL8, OSGEPL1, OTC, OTX2, OVOL2, OXT, PA2G4, PADI4, PAH, PAN2, PAOX, PAPOLG, PARD3, PARP1, PARVB, PAWR, PAX3, PAX8, PBGD, PBRM, PBX2, PCBP4, PCCA, PCGF2, PCNX, PCOTH, PDCD4, PDE4D, PDE8B, PDE10A, PD1A3, PDH1, PDLIM5, PDXK, PDZRN3, PELI2, PDK4, PDS5A, PDS5B, PGK1, PGM2, PHACTR4, PHEX, PHKB, PHLDB2, PHOX2B, PHTF, PIAS1, PIEZO1, PIGF, PIGN, PIGT, PIK3C2G, PIK3CA, PIK3CD, PIK3CG, PIK3R1, PIP5KIA, PITRM1, PIWIL3, PKD1, PKHDIL1, PKD2, PKIB, PKLR, PKM1, PKM2, PLAGL2, PLCB1, PLCB4, PLCG1, PLD1, PLEKHA5, PLEKHA7, PLEKHM1, PLKR, PLXNC1, PMFBP1, POLN, POLR3D, POMT2, POSTN, POU2AF1, POU2F2, POU2F3, PPARA, PPFIA2, PPPIR12A, PPP3CB, PPP4C, PPP4R1L, PPP4R2, PRAME, PRC1, PRDM1, PREX1, PREX2, PRIM1, PRIM2, PRKARIA, PRKCA, PRKG1, PRMT7, PROC, PROCR, PROSC, PRODH, PROX1, PRPF40B, PRPF4B, PRRG2, PRUNE2, PSD3, PSEN1, PSMAL, PTCH1, PTEN, PTK2, PTK2B, PTPN2, PTPN3, PTPN4, PTPNI1, PTPN22, PTPRD, PTPRK, PTPRM, PTPRN2, PTPRT, PUS10, PVRL2, PYGM, QRSL1, RABI1FIP2, RAB23, RAF1, RALBP1, RALGDS, RBICC1, RBL2, RBM39, RBM45, RBPJ, RBSN, REC8, RELB, RFC4, RFT1, RFTN1, RHOA, RHPN2, RIF1, RIT1, RLN3, RMND5B, RNFI1, RNF32, RNFT1, RNGTT, ROCK1, ROCK2, RORA, RP1, RP6KA3, RP11-265F1, RP13-36C9, RPAP3, RPN1, RPGR, RPL22, RPL22L1, RPS6KA6, RREB1, RRM1, RRPIB, RSK2, RTEL1, RTF1, RUFY1, RUNX1, RUNX2, RXRA, RYR3, SAAL1, SAE1, SALL4, SAT1, SATB2, SBCAD, SCNIA, SCN2A, SCN3A, SCN4A, SCN5A, SCN8A, SCNA, SCNIJA, SCO1, SCYL3, SDC1, SDK1, SDK2, SEC24A, SEC24D, SEC31A, SELIL, SENP3, SENP6, SENP7, SERPINA1, SETD3, SETD4, SETDB1, SEZ6, SFRS12, SGCE, SGOL2, SGPL1, SH2DIA, SH3BGRL2, SH3PXD2A, SH3PXD2B, SH3RF2, SH3TC2, SHOC2, SIPAIL2, SIPAIL3, SIVA1, SKAP1, SKIV2L2, SLC6A11, SLC6A13, SLC6A6, SLC7A2, SLC12A3, SLC13A1, SLC22A17, SLC25A14, SLC28A3, SLC33A1, SLC35F6, SLC38A1, SLC38A4, SLC39A10, SLC4A2, SLC6A8, SMARCA1, SMARCA2, SMARCA5, SMARCC2, SMC5, SMN2, SMOX SMS, SMTN, SNCAIP, SNORD86, SNRK, SNRP70, SNX5, SNX6, SOD1, SOD10, SOS, SOS2, SOX5, SOX6, SOX8, SP1, SP2, SP3, SPI10, SPAG9, SPATA13, SPATA4, SPATS1, SPECC1L, SPDEF, SPI1, SPINK5, SPP2, SPTA1, SRF, SRM, SRP72, SSX3, SSX5, SSX9, STAG1, STAG2, STAMBPL1, STARD6, STAT1, STAT3, STAT5A, STAT5B, STAT6, STK17B, STX3, STXBP1, SUCLG2, SULF2, SUPT6H, SUPT16H, SV2C, SYCP2, SYT6, SYCP1, SYTL3, SYTL5, TAF2, TARDBP, TBCID3G, TBC1D8B, TBC1D26, TBC1D29, TBCEL, TBK1, TBP, TBPL1, TBR1, TBX, TCEB3, TCF3, TCF4, TCF7L2, TCFL5, TCF12, TCPIIL2, TDRD3, TEAD1, TEAD3, TEAD4, TECTB, TEK, TERF1, TERF2, TET2, TFAP2A, TFAP2B, TFAP2C, TFAP4, TFDP1, TFRC, TG, TGM7, TGS1, THAP7, THAP12, THOC2, TIAL1, TIAM2, TIMM50, TLK2, TM4SF20, TM6SF1, TMEM27, TMEM77, TMEM156, TMEM194A, TMF1, TMPRSS6, TNFRSFIOA, TNFRSFIOB, TNFRSF8, TNK2, TNKS, TNKS2, TOMIL, TOMIL2, TOP2B, TP53, TP53INP1, TP53BP2, TP53I3, TP63, TRAF3IP3, TRAPPC2, TRIM44, TRIM65, TRIML1, TRIML2, TRPM3, TRPM5, TRPM7, TRPS1, TSC1, TSC2, TSHB, TSPAN7, TTC17, TTF1, TTLL5, TTLL9, TTN, TTPAL, TTR, TUSC3, TXNDC10, UBE3A, UCK1, UGTIA1, UHRFIBP1, UNC45B, UNC5C, USH2A, USF2, USP1, USP6, USP18, USP38, USP39, UTP20, UTP15, UTP18, UTRN, UTX, UTY, UVRAG, UXT, VAPA, VEGFA, VPS29, VPS35, VPS39, VTIA, VTIIB, VWA3B, WDFY2, WDR16, WDR17, WDR26, WDR44, WDR67, WDTC1, WRN, WRNIP1, WT1, WWC3, XBP1, XRN1, XRN2, XX—FW88277, YAP1, YARS, YBX1, YGM, YY1, ZBTB18, ZBTB20, ZC3HAV1, ZC3HC1, ZC3H7A, ZDHHC19, ZEB1, ZEB2, ZFPM1, ZFYVE1, ZFX ZIC2, ZNF37A, ZNF91, ZNF114, ZNF155, ZNF169, ZNF205, ZNF236, ZNF317, ZNF320, ZNF326, ZNF335, ZNF365, ZNF367, ZNF407, ZNF468, ZNF506, ZNF511, ZNF511-PRAP1, ZNF519, ZNF521, ZNF592, ZNF618, ZNF763, and ZWINT.


Additional exemplary genes encoding a target sequence (e.g., a target sequence comprising DNA or RNA, e.g., pre-mRNA) include genes include AICF, A4GALT, AAR2, ABAT, ABCA11P, ZNF721, ABCA5, ABHD10, ABHD13, ABHD2, ABHD6, AC0000120.3, KRIT1, AC004076.1, ZNF772, AC004076.9, ZNF772, AC004223.3, RAD51D, AC004381.6, AC006486.1, ERF, AC0007390.5, AC0007780.1, PRKAR1A, AC0007998.2, IN080C, AC0009070.1, CMC2, AC009879.2, AC009879.3, ADHFE1, AC010487.3, ZNF816-ZNF321P, ZNF816, AC010328.3, AC010522.1, ZNF587B, AC010547.4, ZNF19, AC012313.3, ZNF497, AC012651.1, CAPN3, AC013489.1, DET1, AC016747.4, C2orf74, AC020907.6, FXYD3, AC021087.5, PDCD6, AHRR, AC022137.3, ZNF761, AC025283.3, NAA60, AC027644.4, RABGEF1, AC055811.2, FLCN, AC069368.3, ANKDDIA, AC073610.3, ARF3, AC074091.1, GPN, AC079447.1, LIPT1, AC092587.1, AC079594.2, TRIM59, AC091060.1, C18orf21, AC092143.3, MC1R, AC093227.2, ZNF607, AC093512.2, ALDOA, AC098588.1, ANAPC10, AC107871.1, CALML4, AC114490.2, ZMYM6, AC138649.1, NIPA1, AC138894.1, CLN3, AC139768.1, AC242426.2, CHD1L, ACADM, ACAP3, ACKR2, RP11-141M3.5, KRBOX1, ACMSD, ACOT9, ACP5, ACPL2, ACSBG1, ACSF2, ACSF3, ACSL1, ACSL3, ACVR1, ADAL, ADAM29, ADAMTS10, ADAMTSL5, ADARB1, ADAT2, ADCK3, ADD3, ADGRG1, ADGRG2, ADHIB, ADIPOR1, ADNP, ADPRH, AGBL5, AGPAT1, AGPAT3, AGR2, AGTR1, AHDC1, AHI1, AHNAK, AIFM1, AIFM3, AIMP2, AK4, AKAP1, AKNAD1, CLCC1, AKRIA1, AKT1, AKTIS1, AKT2, AL139011.2, PEX19, AL157935.2, ST6GALNAC6, AL358113.1, TJP2, AL441992.2, KYAT1, AL449266.1, CLCC1, AL590556.3, LINC00339, CDC42, ALAS1, ALB, ALDH16A1, ALDHIB1, ALDH3A1, ALDH3B2, ALDOA, ALKBH2, ALPL, AMD1, AMICA1, AMN1, AMOTL2, AMYJB, AMY2B, ANAPC10, ANAPCI1, ANAPC15, ANG, RNASE4, AL163636.2, ANGEL2, ANGPTL1, ANKMY1, ANKRDI1, ANKRD28, ANKRD46, ANKRD9, ANKS3, ANKS3, RP11-127I20.7, ANKS6, ANKZF1, ANPEP, ANXA11, ANXA2, ANXA8L2, AL603965.1, AOC3, AP000304.12, CRYZL, AP000311.1, CRYZL, AP000893.2, RAB30, AP001267.5, ATP5MG, AP002495.2, AP003175.1, OR2AT4, AP003419.1, CLCF1, AP005263.1, ANKRD12, AP006621.5, AP006621.1, AP1G1, AP3M1, AP3M2, APBA2, APBB1, APLP2, APOA2, APOL1, APOL3, APTX, ARAP1, STARD10, ARF4, ARFIP1, ARFIP2, ARFRP1, ARHGAP11A, ARHGAP33, ARHGAP4, ARHGEF10, ARHGEF3, ARHGEF35, OR2A1-AS1, ARHGEF35, OR2A1-AS1, ARHGEF34P, ARID1B, ARHGEF35, OR2A20P, OR2A1-AS1, ARHGEF9, ARL1, ARL13B, ARL16, ARL6, ARMC6, ARMC8, ARMCX2, ARMCX5, RP4-769N13.6, ARMCX5-GPRASP2, BHLHB9, ARMCX5-GPRASP2, GPRASP1, ARMCX5-GPRASP2, GPRASP2, ARMCX6, ARNT2, ARPP19, ARRB2, ARSA, ART3, ASB3, GPR75-ASB3, ASCC2, ASNS, ASNS, AC079781.5, ASPSCR1, ASS1, ASUN, ATE1, ATF1, ATF7IP2, ATG13, ATG4D, ATG7, ATG9A, ATM, ATOX1, ATP1B3, ATP2C1, ATP5FIA, ATP5G2, ATP5J, ATP5MD, ATP5PF, ATP6AP2, ATP6VOB, ATP6V1C1, ATP6VID, ATP7B, ATXN1, ATXN1L, IST1, ATXA3, ATXA7L1, AURKA, AURKB, AXDND1, B3GALNT1, B3GALT5, AF064860.1, B3GALT5, AF064860.5, B3GNT5, B4GALT3, B4GALT4, B9D1, BACH1, BAIAP2, BANF1, BANF2, BAX, BAZ2A, BBIP1, BCHE, BCL2L14, BCL6, BCL9L, BCSIL, BDH1, BDKRB2, AL355102.2, BEST1, BEST3, BEX4, BHLHB9, BID, BIN3, BIRC2, BIVM, BIVM-ERCC5, BIVM, BLCAP, BLK, BLOC1S1, RP11-644F5.10, BLOC1S6, AC090527.2, BLOC1S6, RP11-96020.4, BLVRA, BMF, BOLA1, BORCS8-MEF2B, BORCS8, BRCA1, BRD1, BRDT, BRINP3, BROX BTBD10, BTBD3, BTBD9, BTD, BTF3L4, BTNL9, BUB1B-PAK6, PAK6, BUB3, C10orf68, C11orf1, C11orf48, C11orf54, C11orf54, AP001273.2, C11orf57, C11orf63, C11orf82, C12orf23, C12orf4, C12orf65, C12orf79, C14orf159, C14orf93, C17orf62, C18orf21, C19orf12, C19orf40, C19orf47, C19orf48, C19orf54, C1D, C1GALT1, C1QB, C1QTNF1, C1S, C1orf101, C1orf112, C1orf116, C1orf159, C1orf63, C2, C2, CFB, C20orf27, C21orf58, C2CD4D, C2orf15, LIPT1, MRPL30, C2orf80, C2orf81, C3orf14, C3orf17, C3orf18, C3orf22, C3orf33, AC104472.3, C4orf33, C5orf28, C5orf34, C6orf118, C6orf203, C6orf211, C6orf48, C7orf50, C7orf55, C7orf55-LUC7L2, LUC7L2, C8orf44-SGK3, C8orf44, C8orf59, C9, DAB2, C9orf153, C9orf9, CA5BP1, CASB, CABYR, CALCA, CALCOCO1, CALCOCO2, CALM1, CALM3, CALML4, RP11-315D16.2, CALN, CALU, CANT1, CANX, CAP1, CAPN12, CAPS2, CARD8, CARHSP1, CARNS1, CASC1, CASP3, CASP7, CBFA2T2, CBS, CBY1, CCBL1, CCBL2, RBMXL1, CCDC12, CCDC126, CCDC14, CCDC149, CCDC150, CCDC169-SOHLH2, CCDC169, CCDC171, CCDC37, CCDC41, CCDC57, CCDC63, CCDC7, CCDC74B, CCDC77, CCDC82, CCDC90B, CCDC91, CCDC92, CCNE1, CCHCR1, CCL28, CCNB1IP1, CCNC, CCND3, CCNG1, CCP110, CCR9, CCT7, CCT8, CD151, CDID, CD200, CD22, CD226, CD276, CD36, CD59, CDC26, CDC42, CDC42SE1, CDC42SE2, CDHR3, CDK10, CDK16, CDK4, CDKAL1, CDKL3, CTD-2410N18.4, CDKNIA, CDKN2A, CDNF, CEBPZOS, CELF1, CEMIP, CENPK, CEP170B, CEP250, CEP57, CEP57L1, CEP63, CERS4, CFL1, CFL2, CFLAR, CGNL1, CHCHD7, CHDIL, CHD8, CHFR, ZNF605, CHIA, CHID1, CHL1, CHM, CHMPIA, CHMP3, RNF103-CHMP3, CHRNA2, CIDEC, CIRBP, CITED1, CKLF-CMTM1, CMTM1, CKMT1B, CLDN12, CTB-13L3.1, CLDND1, AC021660.3, CLDND1, CPOX, CLHC1, CLIP1, CLUL1, CMC4, MTCP1, CNDP2, CNFN, CNOT1, CNOT6, CNOT7, CNOT8, CNR1, CNR2, CNTFR, CNTRL, COAl, COASY, COCH, COL8A1, COLCA1, COLEC11, COAMD3-BMI1, BMI1, COPS5, COPS7B, COQ8A, CORO6, COTL1, COX14, RP4-60503.4, COX7A2, COX7A2L, COX7B2, CPA4, CPA5, CPEB1, CPNE1, AL109827.1, RBM12, CPNE1, RP1-309K20.6, RBM12, CPNE3, CPSF3L, CPTIC, CREB3L2, CREM, CRP, CRYZ, CS, AC073896.1, CS, RP11-977G19.10, CSAD, CSDE, CSF2RA, CSGALNACT, CSK, CSNK2A1, CSRNP2, CT45A4, CT45A4, CT45A5, CT45A6, CTBP2, CTCFL, CTD-2116N17.1, KIAA0101, CTD-2349B8.1, SYT17, CTD-2528L19.4, ZNF607, CTD-2619J13.8, ZNF497, CTNNA1, CTNNBIP1, CTNNDl, CTPS2, CTSB, CTSL, CTTN, CUL2, CUL9, CWC5, CXorf40B, CYB561A3, CYBC1, CYLD, CYP11A1, CYP2R1, CYP4B1, CYP4F22, DAG1, DAGLB, KDELR2, DARS, DBNL, DCAF1l, DCAF8, PEX19, DCLREIC, DCTD, DCTN1, DCTN4, DCUN1D2, DDR1, DDX11, DDX19B, AC012184.2, DDX19B, RP11-529K10.3, DDX25, DDX39B, ATP6V1G2-DDX39B, SNORD84, DDX42, DDX60L, DEDD, DEDD2, DEFA1, DEFA1B, DEFA1B, DEFA3, DENNDIC, DENND2A, DENND4B, DET, DGKA, DGKZ, DGLUCY, DHRS4L2, DHRS9, DHX40, DIABLO, AC048338.1, DIAPH1, DICER1, DKKL1, DLG1, DLG3, DLST, DMC1, DMKNV, DMTF1, DMTN, DNAJC14, DNAJC19, DNAL1, DNASElL1, DNMT3A, DOC2A, DOCK8, DOK1, DOPEY1, DPAGT1, DPP8, DRAM2, DRD2, DROSHA, DSN1, DTNA, DTX2, DTX3, DUOX1, DUOXA1, DUS2, DUSP10, DUSP13, DUSP18, DUSP22, DYDC1, DYDC2, DYNLL1, DYNLT1, DYRK1A, DYRK2, DYRK4, RPL1-500M8.7, DZIP1L, E2F6, ECHDC1, ECSIT, ECT2, EDC3, EDEM1, EDEM2, MMP24-AS1, RP4-61404.11, EEF1AKNMT, EEF1D, EFEMP1, EFHC1, EGFL7, EHF, EI24, EIF1AD, EIF2B5, EIF4G1, EIF2B5, POLR2H, EIF3E, EIF3K, EIF4E3, EIF4G1, ELF1, ELMO2, ELMOD1, AP000889.3, ELMOD3, ELOC, ELOF1, ELOV1, ELOVL7, ELP1, ELP6, EML3, EMP3, ENC1, ENDOV, ENO1, ENPP5, ENTHD2, ENTPD6, EP400NL, EPB41L1, EPDR1, NME8, EPHX1, EPM2A, EPN1, EPN2, EPN3, EPS8L2, ERBB3, ERC1, ERCC1, ERG, ERI2, ERI2, DCUN1D3, ERLIN2, ERMARD, ERRFI1, ESR2, RP11-544I20.2, ESRRA, ESRRB, ESRRG, ETFA, ETFRF1, ETV1, ETV4, ETV7, EVAIA, EVC2, EVX1, EXD2, EXO5, EXOC1, EXOC2, FAAP24, FABP6, FADS1, FADS2, FAHD2B, FAM107B, FAM111A, FAMIIB, FAM114A1, FAM114A2, FAM115C, FAM115C, FAM115D, FAM120B, FAM133B, FAM135A, FAM153A, FAM153B, FAM154B, FAM156A, FAM156B, FAM168B, FAM172A, FAM182B, FAM192A, FAM19A2, FAM200B, FAM220A, FAM220A, AC009412.1, FAM222B, FAM227B, FAM234A, AC004754.1, FAM3C, FAM45A, FAM49B, FAM60A, FAM63A, FAM81A, FAM86B1, FAM86B2, FANC1, FANK1, FAR2, FAXC, FAXDC2, FBF1, FBH1, FBXL4, FBXO18, FBXO22, FBXO31, FBXO41, FBXO44, FBXO45, FBXW9, FCHO1, FCHSD2, FDFT1, FDPS, FER, FETUB, FGD4, FGF1, FGFR1, FGFRL1, FGL1, FHL2, FIBCD1, FIGNL1, FIGNL1, DDC, FKBP5, FKRP, FLRT2, FLRT3, FMC1, LUC7L2, FMC1-LUC7L2, FNDC3B, FOLH1, FOLR1, FOXP1, FOXK1, FOAM1, FOXO1, FOXP4, AC097634.4, FOXRED1, FPR1, FPR2, FRG1B, FRS2, FTO, FTSJ1, FUK, FUT10, FUT3, FUT6, FXYD3, FZD3, G2E3, GAA, GABARAPL1, GABPB1, GABRA5, GAL3ST1, GALE, GALNT1l, GALNT14, GALNT6, GAPVD1, GARNL3, GAS2L3, GAS8, GATA1, GATA2, GATA4, GBA, GCNT1, GDPD2, GDPD5, GEMIN7, MARK4, GEMIN8, GGA3, GGACT, AL356966.1, GGPS1, GHRL, GID8, GIGYF2, GIMAP8, GIPC1, GJB1, GJB6, GLBIL, GLI1, GLT8D1, GMFG, GMPR2, GNAI2, GNAQ, GNB1, GNB2, GNE, GNG2, GNGT2, GNPDA1, GNPDA2, GOLGA3, CHFR, GOLGA4, GOLPH3L, GOLT1B, GPBPL, GPER, GPR16, GPR141, EPDR1, GPR155, GPR161, GPR56, GPR63, GPR75-ASB3, ASB3, GPR85, GPSM2, GRAMD1B, GRB10, GRB7, GREM2, GRIA2, GSDMB, GSE1, GSN, GSTA4, GSTZ1, GTDC1, GTF2H1, GTF2H4, VARS2, GTF3C2, GUCY1A3, GUCYIB3, GUK1, GULP1, GYPC, GYS1, GZF1, HAGH, HA02, HAPLN3, HAVCR1, HAX1, HBG2, AC104389.4, HBG2, AC104389.4, HBE1, HBG2, AC104389.4, HBE1, OR51B5, HBG2, HBE1, AC104389.28, HBS1L, HCFC1R1, HCK, HDAC2, HDAC6, HDAC7, HDLBP, HEATR4, HECTD4, HEXIM2, HHAT, HHATL, CCDC13, HINFP, HIRA, C22orf39, HIVEP3, HJV, HKR1, HLF, HMBOX1, HMGA1, HMGB3, HMGCR, HMGN4, HMOX2, HNRNPC, HNRNPD, HNRNPH1, HNRNPH3, HNRNPR, HOMER3, HOPX HOXA3, HOXB3, HOXB3, HOXB4, HOXC4, HOXD3, HOXD3, HOXD4, HPCAL1, HPS4, HPS5, HRH1, HS3ST3A1, HSH2D, HSP90AA1, HSPD1, HTT, HUWE1, HYOU1, IAH1, ICA1L, ICAM2, ICE2, ICK, IDH2, IDH3G, IDS, IFI27, IFI44, IFT20, IFT22, IFT88, IGF2, INS-IGF2, IGF2BP3, IGFBP6, IKBKAP, IKBKB, IL11, IL18BP, IL18RAP, ILIRAP, IL1RL1, IL18R1, IL1RN, IL32, IL4I1, NUP62, AC011452.1, IL4I1, NUP62, CTC-326K19.6, IL6ST, ILVBL, IMMP1L, IMPDH1, INCA1, ING1, INIP, INPP1, INPP5J, INPP5K, INSIG2, INTS11, INTS12, INTS14, IP6K2, IP6K3, IPO11, LRRC70, IQCE, IQGAP3, IRAK4, IRF3, IRF5, IRF6, ISG20, IST1, ISYNA1, ITFG2, ITGBIBP1, ITGB7, ITIH4, RP5-966M1.6, ITPRIPL1, JADE1, JAK2, JARID2, JDP2, KANK1, KANK1, RP11-31F19.1, KANK2, KANSLIL, KAT6A, KBTBD2, KBTBD3, KCNAB2, KCNE3, KCNG1, KCNJ16, KCNJ9, KCNMB2, AC117457.1, LINC01014, KCTD20, KCTD7, RABGEF1, KDMIB, KDM4A, AL451062.3, KHNYN, KIAA0040, KIAA0125, KIAA0196, KIAA0226L, PPPIR2P4, KIAA0391, KIAA0391, AL121594.1, KIAA0391, PSMA6, KIAA0753, KIAA0895, KIAA0895L, KIAA1191, KIAA1407, KIAA1841, C2orf74, KIF12, KIF14, KIF27, KIF9, KIFC3, KIN, KIRREL1, KITLG, KLC1, APOPT1, AL139300.1, KLC4, KLHDC4, KLHDC8A, KLHL13, KLHL18, KLHL2, KLHL24, KLHL7, KLKI1, KLK2, KLK5, KLK6, KLK7, KNOP1, KRBA2, AC135178.2, KRBA2, RP11-849F2.7, KRIT1, KRT15, KRT8, KTN1, KXD1, KYAT3, RBMXL1, KYNU, L3MBTL1, LACC1, LARGE, LARP4, LARP7, LAT2, LBHD1, LCA5, LCA5L, LCTL, LEPROTL1, LGALS8, LGALS9C, LGMN, LHFPL2, LIG4, LIMCH1, LIMK2, LIMS2, LINC00921, ZNF263, LIPF, LLGL2, LMAN2L, LMCD1, LMF1, RP11-161M6.2, LMO1, LMO3, LOXHD1, LPAR1, LPAR2, LPAR4, LPAR5, LPAR6, LPHN1, LPIN2, LPIN3, LPP, LRFN5, LRIF1, LRMP, LRRC14, LRRC20, LRRC24, C8orf82, LRRC39, LRRC42, LRRC48, LRRC4C, LRRC8A, LRRC8B, LRRD1, LRTOMT, LRTOMT, AP000812.5, LSM7, LTB4R, LTBP3, LUC7L2, FMC1-LUC7L2, LUC7L3, LUZP1, LYG1, LYL1, LYPD4, LYPD6B, LYRM1, LYRM5, LYSMD4, MACC1, MADIL1, MADIL1, AC069288.1, MAEA, MAFF, MAFG, MAFK, MAGEA12, CSAG4, MAGEA2, MAGEA2B, MAGEA4, MAGEB1, MAGOHB, MAN2A2, MANBAL, MAOB, MAP2K3, MAP3K7CL, MAP3K8, MAP7, MAP9, MAPK6, MAPK7, MAPK8, MAPKAP1, 10-Mar, 7-Mar, 8-Mar, MARK2, MASP1, MATK, MATR3, MATR3, SNHG4, MB, MBD5, MBNL1, MBOAT7, MCC, MCFD2, MCM9, MCOLN3, MCRS1, MDC1, MDGA2, MDH2, MDM2, ME1, MEAK7, MECR, MED4, MEF2A, MEF2B, BORCS8-MEF2B, MEF2BNB-MEF2B, MEF2B, MEF2BNB, MEF2C, MEF2D, MEGFJO, MEIl, MEIS2, MELK, MET, METTL13, METTL23, MFF, MFN2, MFSD2A, MGST3, MIB2, MICAL1, MICAL3, MICOSO, NBL1, MICOS10-NBL1, MID1, MINA, MINOSI-NBL1, MINOS1, MIOS, MIPOL1, MIS12, MKLN1, MKNK1, MKNK1, MOB3C, MLF2, MLH1, MMP17, MOBP, MOCS1, MOGS, MOK, MORF4L1, MPC1, MPC2, MPG, MP1, MPP1, MPP2, MPPE1, MPST, MRAS, MRO, MROH1, MROH7-TTC4, MROH7, MRPL14, MRPL24, MRPL33, BABAM2, MRPL33, BRE, MRPL47, MRPL48, MRPL55, MRRF, MRTFA, MRTFB, MRVI1, MS4A1, MS4A15, MS4A3, MS4A6E, MS4A7, MS4A14, MSANTD3, MSANTD4, MSH5, MSH5-SAPCDl, MSL2, MSRB3, MSS51, MTCP1, CMC4, MTERF, MTERF1, MTERF3, MTERFD2, MTERFD3, MTF2, MTG2, MTHFD2, MTHFD2L, MTIF2, MTIF3, MTMR10, MTRF1, MTRR, MTUS2, MUTYH, MVK, MX1, MX2, MYH10, MYL12A, MYB, MYD88, MYL5, MYLIP, MYNN, MYO15A, MYOIB, MYOM2, MZF1, N4BP2L2, NAA60, NAB1, NAEl, NAGK, NAP1L1, NAPIL4, NAPG, NARFL, NARG2, NAT1, NAT10, NBPF11, WI2-3658N16.1, NBPF12, NBPF15, NBPF24, NBPF6, NBPF9, NBR1, NCAPG2, NCBP2, NCEH1, NCOA1, NCOA4, NDC1, NDRG1, NDRG2, NDRG4, NDST1, NDUFAF6, NDUFB2, NDUFC1, NDUFS1, NDUFS8, NDUFV1, NEDD1, NEIL1, NEIL2, NEK10, NEK11, NEK6, NEK9, NELFA, NEU4, NFAT5, NFE2, NFE2L2, AC019080.1, NFRKB, NFYA, NFYC, NIF3L1, NIPA2, NKIRAS1, NKX2-1, NLRC3, NME1, NME1-NME2, NME2, NME1-NME2, NME2, NME4, NME6, NME9, NOD1, NOLO, NOL8, NONO, NPAS1, NPIPA8, RP11-1212A22.1, NPIPB3, NPIPB4, NPIPB9, NPL, NPM1, NPPA, NQO2, NR1H3, NR2C2, NR2F2, NR4A1, NRDC, NREP, NRF1, NRG4, NRIP1, NSD2, NSDHL, NSG1, NSMCE2, NSRP1, NT5C2, NTF4, NTMT1, NTNG2, NUBP2, NUCB2, NUDT1, NUDT2, NUDT4, NUF2, NUMBL, NUP50, NUP54, NUP85, NVL, NXF1, NXPE1, NXPE3, OARD1, OAT, OAZ2, OCIAD1, OCLN, ODF2, OGDHL, OGFOD2, AC026362.1, OGFOD2, RP11-197N18.2, OLA1, OPRL1, OPTN, OR2H1, ORAI2, ORMDL1, ORMDL2, ORMDL3, OSBPL2, OSBPL3, OSBPL5, OSBPL9, OSER1, OSGIN1, OSR2, P2RX4, P2RY2, P2RY6, P4HA2, PABPC1, PACRGL, PACSIN3, PADI1, PAIP2, PAK1, PAK3, PAK4, PAK7, PALB2, PANK2, PAQR6, PARPH1, PARVG, PASK, PAX6, PBRM1, PBXIPl, PCBP3, PCBP4, AC115284.1, PCBP4, RP11-155D18.14, RP11-155D18.12, PCGF3, PCGF5, PCNP, PCSK9, PDCD10, PDCD6, AHRR, PDDC1, PDGFRB, PDIA6, PDIKIL, PDLIM7, PDP1, PDPK1, PDPN, PDZD11, PEA15, PEX2, PEX5, PEX5L, PFKM, PFN4, PGAP2, PGAP2, AC090587.2, PGAP3, PGM3, PGPEP1, PHB, PHC2, PHF20, PHF21A, PHF23, PHKB, PHLDB1, PHOSPHO1, PHOSPHO2, KLHL23, PI4 KB, PIAS2, PICALM, PIF1, PIGN, PIGO, PIGT, PIK3CD, PILRB, STAG3L5P-PVRIG2P-PILRB, PIP5K1B, PIR, PISD, PIWIL4, FUT4, PKD2, PKIA, PKIG, PKM, PKN2, PLA1A, PLA2G2A, PLA2G5, PLA2G7, PLAC8, PLAGL1, PLD1, PLD3, PLEKHA1, PLEKHA2, PLEKHA6, PLEKHG5, PLIN1, PLS1, PLS3, PLSCR1, PLSCR2, PLSCR4, PLXNB1, PLXNB2, PMP22, PMS1, PNISR, PNKP, AKTIS1, PNMT, PNPLA4, PNPLA8, PNPO, PNRC1, POCIB, POFUT1, POLB, POLD1, POLH, POL1, POLL, POLRIB, POM121, POM121C, AC006014.7, POM121C, AC211429.1, POMC, POMT1, POP1, PORCN, POU5F1, PSORSIC3, PPARD, PPARG, PPHLN, PPIL3, PPIL4, PPM1A, PPM1B, AC013717.1, PPPICB, PPP1R11, PPPIR13L, PPPIR26, PPPIR9A, PPP2R2B, PPP3CA, PPP6R1, PPP6R3, PPT2, PPT2-EGFL8, EGFL8, PPWD1, PRDM2, PRDM8, PRELID3A, PREPL, PRICKLE1, PRKAG1, PRMT2, PRMT5, PRMT7, PROM1, PRPS1, PRPSAP2, PRR14L, PRR15L, PRR5, PRR5-ARHGAP8, PRR5L, PRR7, PRRC2B, PRRT4, PRSS50, PRSS45, PRSS44, PRUNE, PRUNE1, PSEN1, PSMA2, PSMF1, PSORSIC1, PSPH, PSRC1, PTBP3, PTHLH, PTK2, PTPDC1, PTPRM, PUF60, PUM2, PUS1, PUS10, PXA, PXYLP1, PYCR1, QRICH1, R3HCC1L, R3HDM2, RAB17, RAB23, RAB3A, RAB3D, TMEM205, RAB4B-EGLN2, EGLN2, AC008537.1, RAB5B, RAB7L1, RABL2A, RABL2B, RABL5, RACGAP1, RAD17, RAD51L3-RFFL, RAD51D, RAD52, RAE1, RAI14, RAI2, RALBP1, RAN, RANGAP1, RAP1A, RAP1B, RAPIGAP, RAPGEF4, RAPGEFL1, RASGRP2, RASSF1, RBCK1, RBM12B, RBM14, RBM4, RBM14-RBM4, RBM23, RBM4, RBM14-RBM4, RBM47, RBM7, AP002373.1, RBM7, RP11-212D19.4, RBMS2, RBMYIE, RBP1, RBPMS, RBSN, RCBTB2, RCC1, RCC1, SNHG3, RCCD1, RECQL, RELL2, REPIN1, AC073111.3, REPIN1, ZNF775, RER1, RERE, RFWD3, RFX3, RGL2, RGMB, RGS11, RGS3, RGS5, AL592435.1, RHBDD1, RHNO1, TULP3, RHOC, AL603832.3, RHOC, RP11-426L16.10, RHOH, RIC8B, RIMKLB, RIN1, RIPK2, RIT1, RLIM, RNASE4, ANG, AL163636.6, RNASEK, RNASEK-C17orf49, RNFI1, RNF123, RNF13, RNF14, RNF185, RNF216, RNF24, RNF32, RNF34, RNF38, RNF4, RNF44, RNH1, RNMT, RNPS1, RO60, ROPN1, ROPNIB, ROR2, RP1-102H19.8, C6orf163, RP1-283E3.8, CDK11A, RP11-120M18.2,PRKARIA, RP11-133K10.2, PAK6, RP11-164J13.1, CAPN3, RP11-21JJ8.1, ANKRD12, RP11-322E10.6, INO80C, RP11-337C18.10, CHD1L, RP11-432B6.3, TRIM59, RP11-468E2.4, IRF9, RP11-484M3.5, UPKIB, RP11-517H2.6, CCR6, RP11-613M10.9, SLC25A51, RP11-659G9.3, RAB30, RP11-691N7.6, CTNND1, RP11-849H4.2, RP11-896J10.3, NKX2-1, RP11-96020.4, SQRDL, RP11-986E7.7, SERPINA3, RP4-769N13.6, GPRASP1, RP4-769N13.6, GPRASP2, RP4-798P15.3, SEC16B, RP5-1021I20.4, ZNF410, RP6-109B7.3, FLJ27365, RPE, RPH3AL, RPL15, RPL17, RPL17-C18orf32, RPL17, RPL23A, RPL36, HSDI1BIL, RPP38, RPS20, RPS27A, RPS3A, RPS6KA3, RPS6KC1, RPS6KL1, RPUSD1, RRAGD, RRAS2, RRBP1, RSLID1, RSRC2, RSRP1, RUBCNL, RUNXIT1, RUVBL2, RWDD1, RWDD4, S100A13, AL162258.1, S100A13, RP1-178F15.5, S100A16, S100A4, S100A3, S100A6, S100PBP, SAA1, SACMIL, SAMD4B, SARIA, SARAF, SARNP, RP11-762I7.5, SCAMP5, SCAP, SCAPER, SCFD1, SCGB3A2, SCIN, SCML1, SCNNID, SC02, SCOC, SCRN1, SDC2, SDC4, SEC13, SEC14L1, SEC14L2, SEC22C, SEC23B, SEC24C, SEC61G, SEMA4A, SEMA4C, SEMA4D, SEMA6C, SENP7, SEPP1, 11-Sep, 2-Sep, SERGEF, AC055860.1, SERP1, SERPINA1, SERPINA5, SERPINB6, SERPING1, SERPINH1, SERTAD3, SETD5, SFMBT1, AC096887.1, SFTPA1, SFTPA2, SFXN2, SGCD, SGCE, SGK3, SGK3, C8orf44, SH2B1, SH2D6, SH3BP1, Z83844.3, SH3BP2, SH3BP5, SH3D19, SH3YL1, SHC1, SHISA5, SHMT1, SHMT2, SHOC2, SHROOM1, SIGLEC5, SIGLEC14, SIL1, SIN3A, SIRT2, SIRT6, SKP1, STAT4, AC104109.3, SLAIN1, SLCI0A3, SLC12A9, SLC14A1, SLC16A6, SLCIA2, SLCIA6, SLC20A2, SLC25A18, SLC25A19, SLC25A22, SLC25A25, SLC25A29, SLC25A30, SLC25A32, SLC25A39, SLC25A44, SLC25A45, SLC25A53, SLC26A11, SLC26A4, SLC28A1, SLC29A1, SLC2A14, SLC2A5, SLC2A8, SLC35B2, SLC35B3, SLC35C2, SLC37A1, SLC38A1, SLC38A11, SLC39A13, SLC39A14, SLC41A3, SLC44A3, SLC4A7, SLC4A8, SLC5A10, SLC5A11, SLC6A1, SLC6A12, SLC6A9, SLC7A2, SLC7A6, SLC7A7, SLCOIA2, SLCO1C1, SLCO2B1, SLFNI1, SLFN12, SLFNL1, SLMO1, SL™, SLU7, SMAD2, SMAP2, SMARCA2, SMARCEl, AC073508.2, SMARCE1, KRT222, SMC6, SMG7, SMIM22, SMOX, SMPDL3A, SMTN, SMU1, SMUG1, SNAP25, SNCA, SNRK, SNRPC, SNRPD1, SNRPD2, SNRPN, SNRPN, SNURF, SNUPN, SNXI1, SNX16, SNX17, SOAT1, SOHLH2, CCDC169-SOHLH2, CCDC169, SORBS1, SORBS2, SOX5, SP2, SPART, SPATA20, SPATA21, SPATS2, SPATS2L, SPDYE2, SPECC1, SPECC1L, SPECC1L-ADORA2A, SPECC1L-ADORA2A, ADORA2A, SPEG, SPG20, SPG21, SPIDR, SPIN1, SPOCD1, SPOP, SPRR2A, SPRR2B, SPRR2E, SPRR2B, SPRR2F, SPRR2D, SPRR3, SPRY1, SPRY4, SPTBN2, SRC, SRGAP1, SRP68, SRSF11, SSX1, SSX2IP, ST3GAL4, ST3GAL6, ST5, ST6GALNAC6, ST7L, STAC3, STAG1, STAG2, STAMBP, STAMBPL1, STARD3NL, STAT6, STAU1, STAU2, AC022826.2, STAU2, RP11-463D19.2, STEAP2, STEAP3, STIL, STK25, STK33, STK38L, STK40, STMN1, STON1, STONI-GTF2A1L, STRAP, STRBP, STRC, AC011330.5, STRC, CATSPER2, STRC, CATSPER2, AC011330.5, STRC, STRCP1, STT3A, STX16-NPEPL1, NPEPL1, STX5, STX6, STX8, STXBP6, STYK1, SULTIA1, SULTIA2, SUMF2, SUN1, SUN2, SUN2, DNAL4, SUOX, SUPT6H, SUV39H2, SV2B, SYBU, SYNCRIP, SYNJ2, SYT1, SYTL4, TAB2, TACC1, TADA2B, TAFIC, TAF6, AC073842.2, TAF6, RP11-506M12.1, TAF9, TAGLN, TANK, TAPSAR1, PSMB9, TAPT1, TATDN1, TAZ, TBC1D1, TBCID12, HELLS, TBCID15, TBCID3H, TBCID3G, TBCID5, TBCID5, SATB1, TBCA, TBCEL, TBCEL, AP000646.1, TBL1XR1, TBP, TBX5, TBXAS1, TCAF1, TCEA2, TCEAL4, TCEAL8, TCEAL9, TCEANC, TCEB1, TCF19, TCF25, TCF4, TCP1, TCPIOL, AP000275.65, TCPI1, TCPIIL2, TCTN1, TDG, TDP1, TDRD7, TEAD2, TECR, TENC1, TENT4A, TEX264, TEX30, TEX37, TFDP1, TFDP2, TFEB, TFG, TFP1, TF, TFP1, TGIF1, THAP6, THBS3, THOC5, THRAP3, THUMPD3, TIAL1, TIMM9, TIMP1, TIRAP, TJAP1, TJP2, TK2, TLDC1, TLE3, TLE6, TLN1, TLR10, TM9SF1, TMBIM1, TMBIM4, TMBIM6, TMC6, TMCC1, TMCO4, TMEM126A, TMEM139, TMEM150B, TMEM155, TMEM161B, TMEM164, TMEM168, TMEM169, TMEM175, TMEM176B, TMEM182, TMEM199, CTB-96E2.3, TMEM216, TMEM218, TMEM230, TMEM263, TMEM45A, TMEM45B, TMEM62, TMEM63B, TMEM66, TMEM68, TMEM98, TMEM9B, TMPRSSIID, TMPRSS5, TMSB15B, TMTC4, TMUB2, TMX2-CTNND1, RP11-691N7.6, CTNND1, TNFAIP2, TNFAIP8L2, SCNM1, TNFRSF10C, TNFRSF9, TNFRSF8, TNFSF12-TNFSF3, TNFSF2, TNFSF3, TNFSF12-TNFSF3, TNFSF3, TNIP1, TNK2, TNNT, TNRC18, TNS3, TOB2, TOMIL1, TOPIMT, TOP3B, TOX2, TP53, RP11-199F1.2, TP53I1, TP53INP2, TPCN, TPM3P9, AC022137.3, TPT1, TRA2B, TRAF2, TRAF3, TRAPPC12, TRAPPC3, TREH, TREX, TREX2, TRIB2, TRIM3, TRIM36, TRIM39, TRIM46, TRIM6, TRIM6-TRIM34, TRIM6-TRIM34, TRIM34, TRIM66, TRIM73, TRIT1, TRMTIOB, TRMT2B, TRMT2B-AS1, TRNT, TRO, TROVE2, TRPS1, TRPT1, TSC2, TSGA10, TSPAN14, TSPAN3, TSPAN4, TSPAN5, TSPAN6, TSPAN9, TSPO, TTC12, TTC23, TTC3, TTC39A, TTC39C, TTLL1, TTLL7, TTPAL, TUBD1, TWNK, TXNL4A, TXNL4B, TXNRD, TYK2, U2AF1, UBA2, UBA52, UBAP2, UBE2D2, UBE2D3, UBE2E3, UBE21, UBE2J2, UBE3A, UBL7, UBXN11, UBXN7, UGDH, UGGT1, UGP2, UMAD1, AC007161.3, UNC45A, UQCC1, URGCP-MRPS24, URGCP, USMG5, USP16, USP21, USP28, USP3, USP33, USP35, USP54, USP9Y, USPL1, UTP15, VARS2, VASH2, VAV3, VDAC1, VDAC2, VDR, VEZT, VGF, VIL1, VIL1, VIPR1, VPS29, VPS37C, VPS8, VPS9D1, VRK2, VWA1, VWA5A, WARS, WASF1, WASHC5, WBP5, WDHD1, WDPCP, WDR37, WDR53, WDR6, WDR72, WDR74, WDR81, WDR86, WDYHV1, WFDC3, WHSC1, WIPF1, WSCD2, WWP2, XAGEA, XAGEIB, XKR9, XPNPEP1, XRCC3, XRN2, XXYL T1, YIFIA, YIFIB, YIPF1, YIPF5, YPEL5, YWHAB, YWHAZ, YYJAP1, ZBTB1, ZBTB14, ZBTB18, ZBTB20, ZBTB21, ZBTB25, ZBTB33, ZBTB34, ZBTB38, ZBTB43, ZBTB49, ZBTB7B, ZBTB7C, ZBTB8OS, ZC3H11A, ZBED6, ZC3H13, ZCCHC17, ZCCHC7, ZDHHC11, ZDHHC13, ZEB2, ZFAND5, ZFAND6, ZFP1, ZFP62, ZFX, ZFYVE16, ZFYVE19, ZFYVE20, ZFYVE27, ZHX2, AC016405.1, ZHX3, ZIK1, ZIM2, PEG3, ZKSCAN1, ZKSCAN3, ZKSCAN8, ZMAT3, ZMAT5, ZMIZ2, ZMYM6, ZMYND11, ZNF10, AC026786.1, ZNF133, ZNF146, ZNF16, ZNF177, ZNF18, ZNF200, ZNF202, ZNF211, ZNF219, ZNF226, ZNF227, ZNF23, AC010547.4, ZNF23, AC010547.9, ZNF239, ZNF248, ZNF25, ZNF253, ZNF254, ZNF254, AC092279.1, ZNF263, ZNF274, ZNF275, ZNF28, ZNF468, ZNF283, ZNF287, ZNF3, ZNF320, ZNF322, ZNF324B, ZNF331, ZNF334, ZNF34, ZNF350, ZNF385A, ZNF395, FBXO16, ZNF415, ZNF418, ZNF43, ZNF433-AS1, AC0008770.4, ZNF438, ZNF444, ZNF445, ZNF467, ZNF480, ZNF493, ZNF493, CTD-2561J22.3, ZNF502, ZNF507, ZNF512, AC074091.1, ZNF512, RP11-158I13.2, ZNF512B, ZNF512B, SAMD10, ZNF521, ZNF532, ZNF544, AC020915.5, ZNF544, CTD-3138B18.4, ZNF559, ZNF177, ZNF562, ZNF567, ZNF569, ZNF570, ZNF571-AS1, ZNF540, ZNF577, ZNF580, ZNF581, ZNF580, ZNF581, CCDC106, ZNF600, ZNF611, ZNF613, ZNF615, ZNF619, ZNF620, ZNF639, ZNF652, ZNF665, ZNF667, ZNF668, ZNF671, ZNF682, ZNF687, ZNF691, ZNF696, ZNF701, ZNF706, ZNF707, ZNF714, ZNF717, ZNF718, ZNF720, ZNF721, ZNF730, ZNF763, ZNF780B, AC005614.5, ZNF782, ZNF786, ZNF79, ZNF791, ZNF81, ZNF83, ZNF837, ZNF839, ZNF84, ZNF845, ZNF846, ZNF865, ZNF91, ZNF92, ZNHIT3, ZSCAN21, ZSCAN25, ZSCAN30, and ZSCAN32.


In some embodiments, the gene encoding a target sequence comprises the HTT gene. In some embodiments, the gene encoding a target sequence comprises the MYB gene. In some embodiments, the gene encoding a target sequence comprises the SMN2 gene. In some embodiments, the gene encoding a target sequence comprises the FOAM1 gene.


Exemplary genes that may be modulated by the compounds of Formula (I) or (II) described herein may also include, inter alia, AC005258.1, AC005943.1, AC007849.1, AC008770.2, AC010487.3, AC011477.4, AC012651.1, AC012531.3, AC034102.2, AC073896.4, AC104472.3, AL109811.3, AL133342.1, AL137782.1, AL157871.5, AF241726.2, AL355336.1, AL358113.1, AL360181.3, AL445423.2, AL691482.3, AP001267.5, RF01169, and RF02271.


The compounds described herein may further be used to modulate a sequence comprising a particular splice site sequence, e.g., an RNA sequence (e.g., a pre-mRNA sequence). In some embodiments, the splice site sequence comprises a 5′ splice site sequence. In some embodiments, the splice site sequence comprises a 3′ splice site sequence. Exemplary gene sequences and splice site sequences (e.g., 5′ splice site sequences) include AAAgcaaguu (SEQ ID NO: 1), AAAguaaaaa (SEQ ID NO: 2), AAAguaaaau (SEQ ID NO: 3), AAAguaaagu (SEQ ID NO: 4), AAAguaaaua (SEQ ID NO: 5), AAAguaaaug (SEQ ID NO: 6), AAAguaaauu (SEQ ID NO: 7), AAAguaacac (SEQ ID NO: 8), AAAguaacca (SEQ ID NO: 9), AAAguaacuu (SEQ ID NO: 10), AAAguaagaa (SEQ ID NO: 11), AAAguaagac (SEQ ID NO: 12), AAAguaagag (SEQ ID NO: 13), AAAguaagau (SEQ ID NO: 14), AAAguaagca (SEQ ID NO: 15), AAAguaagcc (SEQ ID NO: 16), AAAguaagcu (SEQ ID NO: 17), AAAguaagga (SEQ ID NO: 18), AAAguaaggg (SEQ ID NO: 19), AAAguaaggu (SEQ ID NO: 20), AAAguaagua (SEQ ID NO: 21), AAAguaaguc (SEQ ID NO: 22), AAAguaagug (SEQ ID NO: 23), AAAguaaguu (SEQ ID NO: 24), AAAguaaucu (SEQ ID NO: 25), AAAguaauua (SEQ ID NO: 26), AAAguacaaa (SEQ ID NO: 27), AAAguaccgg (SEQ ID NO: 28), AAAguacuag (SEQ ID NO: 29), AAAguacugg (SEQ ID NO: 30), AAAguacuuc (SEQ ID NO: 31), AAAguacuug (SEQ ID NO: 32), AAAguagcuu (SEQ ID NO: 33), AAAguaggag (SEQ ID NO: 34), AAAguaggau (SEQ ID NO: 35), AAAguagggg (SEQ ID NO: 36), AAAguaggua (SEQ ID NO: 37), AAAguaguaa (SEQ ID NO: 38), AAAguauauu (SEQ ID NO: 39), AAAguauccu (SEQ ID NO: 40), AAAguaucuc (SEQ ID NO: 41), AAAguaugga (SEQ ID NO: 42), AAAguaugua (SEQ ID NO: 43), AAAguaugug (SEQ ID NO: 44), AAAguauguu (SEQ ID NO: 45), AAAguauugg (SEQ ID NO: 46), AAAguauuuu (SEQ ID NO: 47), AAAgucagau (SEQ ID NO: 48), AAAgucugag (SEQ ID NO: 49), AAAgugaaua (SEQ ID NO: 50), AAAgugagaa (SEQ ID NO: 51), AAAgugagac (SEQ ID NO: 52), AAAgugagag (SEQ ID NO: 53), AAAgugagau (SEQ ID NO: 54), AAAgugagca (SEQ ID NO: 55), AAAgugagcu (SEQ ID NO: 56), AAAgugaggg (SEQ ID NO: 57), AAAgugagua (SEQ ID NO: 58), AAAgugaguc (SEQ ID NO: 59), AAAgugagug (SEQ ID NO: 60), AAAgugaguu (SEQ ID NO: 61), AAAgugcguc (SEQ ID NO: 62), AAAgugcuga (SEQ ID NO: 63), AAAguggguc (SEQ ID NO: 64), AAAguggguu (SEQ ID NO: 65), AAAgugguaa (SEQ ID NO: 66), AAAguguaug (SEQ ID NO: 67), AAAgugugug (SEQ ID NO: 68), AAAguguguu (SEQ ID NO: 69), AAAguuaagu (SEQ ID NO: 70), AAAguuacuu (SEQ ID NO: 71), AAAguuagug (SEQ ID NO: 72), AAAguuaugu (SEQ ID NO: 73), AAAguugagu (SEQ ID NO: 74), AAAguuugua (SEQ ID NO: 75), AACguaaaac (SEQ ID NO: 76), AACguaaagc (SEQ ID NO: 77), AACguaaagg (SEQ ID NO: 78), AACguaagca (SEQ ID NO: 79), AACguaaggg (SEQ ID NO: 80), AACguaaguc (SEQ ID NO: 81), AACguaagug (SEQ ID NO: 82), AACguaaugg (SEQ ID NO: 83), AACguaguga (SEQ ID NO: 84), AACguaugua (SEQ ID NO: 85), AACguauguu (SEQ ID NO: 86), AACgugagca (SEQ ID NO: 87), AACgugagga (SEQ ID NO: 88), AACgugauuu (SEQ ID NO: 89), AACgugggau (SEQ ID NO: 90), AACgugggua (SEQ ID NO: 91), AACguguguu (SEQ ID NO: 92), AACguuggua (SEQ ID NO: 93), AAGgcaaauu (SEQ ID NO: 94), AAGgcaagag (SEQ ID NO: 95), AAGgcaagau (SEQ ID NO: 96), AAGgcaagcc (SEQ ID NO: 97), AAGgcaagga (SEQ ID NO: 98), AAGgcaaggg (SEQ ID NO: 99), AAGgcaagug (SEQ ID NO: 100), AAGgcaaguu (SEQ ID NO: 101), AAGgcacugc (SEQ ID NO: 102), AAGgcagaaa (SEQ ID NO: 103), AAGgcaggau (SEQ ID NO: 104), AAGgcaggca (SEQ ID NO: 105), AAGgcaggga (SEQ ID NO: 106), AAGgcagggg (SEQ ID NO: 107), AAGgcaggua (SEQ ID NO: 108), AAGgcaggug (SEQ ID NO: 109), AAGgcaucuc (SEQ ID NO: 110), AAGgcaugcu (SEQ ID NO: 111), AAGgcaugga (SEQ ID NO: 112), AAGgcauguu (SEQ ID NO: 113), AAGgcauuau (SEQ ID NO: 114), AAGgcgagcu (SEQ ID NO: 115), AAGgcgaguc (SEQ ID NO: 116), AAGgcgaguu (SEQ ID NO: 117), AAGgcuagcc (SEQ ID NO: 118), AAGguaaaaa (SEQ ID NO: 119), AAGguaaaac (SEQ ID NO: 120), AAGguaaaag (SEQ ID NO: 121), AAGguaaaau (SEQ ID NO: 122), AAGguaaaca (SEQ ID NO: 123), AAGguaaacc (SEQ ID NO: 124), AAGguaaacu (SEQ ID NO: 125), AAGguaaaga (SEQ ID NO: 126), AAGguaaagc (SEQ ID NO: 127), AAGguaaagg (SEQ ID NO: 128), AAGguaaagu (SEQ ID NO: 129), AAGguaaaua (SEQ ID NO: 130), AAGguaaauc (SEQ ID NO: 131), AAGguaaaug (SEQ ID NO: 132), AAGguaaauu (SEQ ID NO: 133), AAGguaacaa (SEQ ID NO: 134), AAGguaacau (SEQ ID NO: 135), AAGguaaccc (SEQ ID NO: 136), AAGguaacua (SEQ ID NO: 137), AAGguaacuc (SEQ ID NO: 138), AAGguaacug (SEQ ID NO: 139), AAGguaacuu (SEQ ID NO: 140), AAGguaagaa (SEQ ID NO: 141), AAGguaagac (SEQ ID NO: 142), AAGguaagag (SEQ ID NO: 143), AAGguaagau (SEQ ID NO: 144), AAGguaagca (SEQ ID NO: 145), AAGguaagcc (SEQ ID NO: 146), AAGguaagcg (SEQ ID NO: 147), AAGguaagcu (SEQ ID NO: 148), AAGguaagga (SEQ ID NO: 149), AAGguaaggc (SEQ ID NO: 150), AAGguaaggg (SEQ ID NO: 151), AAGguaaggu (SEQ ID NO: 152), AAGguaagua (SEQ ID NO: 153), AAGguaaguc (SEQ ID NO: 154), AAGguaagug (SEQ ID NO: 155), AAGguaaguu (SEQ ID NO: 156), AAGguaauaa (SEQ ID NO: 157), AAGguaauac (SEQ ID NO: 158), AAGguaauag (SEQ ID NO: 159), AAGguaauau (SEQ ID NO: 160), AAGguaauca (SEQ ID NO: 161), AAGguaaucc (SEQ ID NO: 162), AAGguaaucu (SEQ ID NO: 163), AAGguaauga (SEQ ID NO: 164), AAGguaaugc (SEQ ID NO: 165), AAGguaaugg (SEQ ID NO: 166), AAGguaaugu (SEQ ID NO: 167), AAGguaauua (SEQ ID NO: 168), AAGguaauuc (SEQ ID NO: 169), AAGguaauug (SEQ ID NO: 170), AAGguaauuu (SEQ ID NO: 171), AAGguacaaa (SEQ ID NO: 172), AAGguacaag (SEQ ID NO: 173), AAGguacaau (SEQ ID NO: 174), AAGguacacc (SEQ ID NO: 175), AAGguacacu (SEQ ID NO: 176), AAGguacagg (SEQ ID NO: 177), AAGguacagu (SEQ ID NO: 178), AAGguacaua (SEQ ID NO: 179), AAGguacaug (SEQ ID NO: 180), AAGguacauu (SEQ ID NO: 181), AAGguaccaa (SEQ ID NO: 182), AAGguaccag (SEQ ID NO: 183), AAGguaccca (SEQ ID NO: 184), AAGguacccu (SEQ ID NO: 185), AAGguaccuc (SEQ ID NO: 186), AAGguaccug (SEQ ID NO: 187), AAGguaccuu (SEQ ID NO: 188), AAGguacgaa (SEQ ID NO: 189), AAGguacggg (SEQ ID NO: 190), AAGguacggu (SEQ ID NO: 191), AAGguacguc (SEQ ID NO: 192), AAGguacguu (SEQ ID NO: 193), AAGguacuaa (SEQ ID NO: 194), AAGguacuau (SEQ ID NO: 195), AAGguacucu (SEQ ID NO: 196), AAGguacuga (SEQ ID NO: 197), AAGguacugc (SEQ ID NO: 198), AAGguacugu (SEQ ID NO: 199), AAGguacuuc (SEQ ID NO: 200), AAGguacuug (SEQ ID NO: 201), AAGguacuuu (SEQ ID NO: 202), AAGguagaaa (SEQ ID NO: 203), AAGguagaac (SEQ ID NO: 204), AAGguagaca (SEQ ID NO: 205), AAGguagacc (SEQ ID NO: 206), AAGguagacu (SEQ ID NO: 207), AAGguagagu (SEQ ID NO: 208), AAGguagaua (SEQ ID NO: 209), AAGguagcaa (SEQ ID NO: 210), AAGguagcag (SEQ ID NO: 211), AAGguagcca (SEQ ID NO: 212), AAGguagccu (SEQ ID NO: 213), AAGguagcua (SEQ ID NO: 214), AAGguagcug (SEQ ID NO: 215), AAGguagcuu (SEQ ID NO: 216), AAGguaggaa (SEQ ID NO: 217), AAGguaggag (SEQ ID NO: 218), AAGguaggau (SEQ ID NO: 219), AAGguaggca (SEQ ID NO: 220), AAGguaggcc (SEQ ID NO: 221), AAGguaggcu (SEQ ID NO: 222), AAGguaggga (SEQ ID NO: 223), AAGguagggc (SEQ ID NO: 224), AAGguagggg (SEQ ID NO: 225), AAGguagggu (SEQ ID NO: 226), AAGguaggua (SEQ ID NO: 227), AAGguagguc (SEQ ID NO: 228), AAGguaggug (SEQ ID NO: 229), AAGguagguu (SEQ ID NO: 230), AAGguaguaa (SEQ ID NO: 231), AAGguaguag (SEQ ID NO: 232), AAGguagucu (SEQ ID NO: 233), AAGguagugc (SEQ ID NO: 234), AAGguagugg (SEQ ID NO: 235), AAGguaguuc (SEQ ID NO: 236), AAGguaguuu (SEQ ID NO: 237), AAGguauaaa (SEQ ID NO: 238), AAGguauaau (SEQ ID NO: 239), AAGguauaca (SEQ ID NO: 240), AAGguauacu (SEQ ID NO: 241), AAGguauaua (SEQ ID NO: 242), AAGguauauc (SEQ ID NO: 243), AAGguauaug (SEQ ID NO: 244), AAGguauauu (SEQ ID NO: 245), AAGguaucac (SEQ ID NO: 246), AAGguaucag (SEQ ID NO: 247), AAGguauccc (SEQ ID NO: 248), AAGguauccu (SEQ ID NO: 249), AAGguaucuc (SEQ ID NO: 250), AAGguaucug (SEQ ID NO: 251), AAGguaucuu (SEQ ID NO: 252), AAGguaugaa (SEQ ID NO: 253), AAGguaugac (SEQ ID NO: 254), AAGguaugag (SEQ ID NO: 255), AAGguaugau (SEQ ID NO: 256), AAGguaugca (SEQ ID NO: 257), AAGguaugcc (SEQ ID NO: 258), AAGguaugcu (SEQ ID NO: 259), AAGguaugga (SEQ ID NO: 260), AAGguauggc (SEQ ID NO: 261), AAGguauggg (SEQ ID NO: 262), AAGguaugua (SEQ ID NO: 263), AAGguauguc (SEQ ID NO: 264), AAGguaugug (SEQ ID NO: 265), AAGguauguu (SEQ ID NO: 266), AAGguauuaa (SEQ ID NO: 267), AAGguauuac (SEQ ID NO: 268), AAGguauuag (SEQ ID NO: 269), AAGguauuau (SEQ ID NO: 270), AAGguauucc (SEQ ID NO: 271), AAGguauuga (SEQ ID NO: 272), AAGguauugu (SEQ ID NO: 273), AAGguauuua (SEQ ID NO: 274), AAGguauuuc (SEQ ID NO: 275), AAGguauuug (SEQ ID NO: 276), AAGguauuuu (SEQ ID NO: 277), AAGgucaaau (SEQ ID NO: 278), AAGgucaaga (SEQ ID NO: 279), AAGgucaagu (SEQ ID NO: 280), AAGgucacag (SEQ ID NO: 281), AAGgucagaa (SEQ ID NO: 282), AAGgucagac (SEQ ID NO: 283), AAGgucagag (SEQ ID NO: 284), AAGgucagca (SEQ ID NO: 285), AAGgucagcc (SEQ ID NO: 286), AAGgucagcg (SEQ ID NO: 287), AAGgucagcu (SEQ ID NO: 288), AAGgucagga (SEQ ID NO: 289), AAGgucaggc (SEQ ID NO: 290), AAGgucaggg (SEQ ID NO: 291), AAGgucaggu (SEQ ID NO: 292), AAGgucagua (SEQ ID NO: 293), AAGgucaguc (SEQ ID NO: 294), AAGgucagug (SEQ ID NO: 295), AAGgucaguu (SEQ ID NO: 296), AAGgucauag (SEQ ID NO: 297), AAGgucaucu (SEQ ID NO: 298), AAGguccaca (SEQ ID NO: 299), AAGguccaga (SEQ ID NO: 300), AAGguccaua (SEQ ID NO: 301), AAGgucccag (SEQ ID NO: 302), AAGgucccuc (SEQ ID NO: 303), AAGguccuuc (SEQ ID NO: 304), AAGgucgagg (SEQ ID NO: 305), AAGgucuaau (SEQ ID NO: 306), AAGgucuacc (SEQ ID NO: 307), AAGgucuaua (SEQ ID NO: 308), AAGgucuccu (SEQ ID NO: 309), AAGgucucug (SEQ ID NO: 310), AAGgucucuu (SEQ ID NO: 311), AAGgucugaa (SEQ ID NO: 312), AAGgucugag (SEQ ID NO: 313), AAGgucugga (SEQ ID NO: 314), AAGgucuggg (SEQ ID NO: 315), AAGgucugua (SEQ ID NO: 316), AAGgucuguu (SEQ ID NO: 317), AAGgucuucu (SEQ ID NO: 318), AAGgucuuuu (SEQ ID NO: 319), AAGgugaaac (SEQ ID NO: 320), AAGgugaaag (SEQ ID NO: 321), AAGgugaaau (SEQ ID NO: 322), AAGgugaacu (SEQ ID NO: 323), AAGgugaagc (SEQ ID NO: 324), AAGgugaagg (SEQ ID NO: 325), AAGgugaagu (SEQ ID NO: 326), AAGgugaaua (SEQ ID NO: 327), AAGgugaaug (SEQ ID NO: 328), AAGgugaauu (SEQ ID NO: 329), AAGgugacaa (SEQ ID NO: 330), AAGgugacag (SEQ ID NO: 331), AAGgugacau (SEQ ID NO: 332), AAGgugacug (SEQ ID NO: 333), AAGgugacuu (SEQ ID NO: 334), AAGgugagaa (SEQ ID NO: 335), AAGgugagac (SEQ ID NO: 336), AAGgugagag (SEQ ID NO: 337), AAGgugagau (SEQ ID NO: 338), AAGgugagca (SEQ ID NO: 339), AAGgugagcc (SEQ ID NO: 340), AAGgugagcg (SEQ ID NO: 341), AAGgugagcu (SEQ ID NO: 342), AAGgugagga (SEQ ID NO: 343), AAGgugaggc (SEQ ID NO: 344), AAGgugaggg (SEQ ID NO: 345), AAGgugaggu (SEQ ID NO: 346), AAGgugagua (SEQ ID NO: 347), AAGgugaguc (SEQ ID NO: 348), AAGgugagug (SEQ ID NO: 349), AAGgugaguu (SEQ ID NO: 350), AAGgugauaa (SEQ ID NO: 351), AAGgugauca (SEQ ID NO: 352), AAGgugaucc (SEQ ID NO: 353), AAGgugauga (SEQ ID NO: 354), AAGgugaugc (SEQ ID NO: 355), AAGgugaugu (SEQ ID NO: 356), AAGgugauua (SEQ ID NO: 357), AAGgugauug (SEQ ID NO: 358), AAGgugauuu (SEQ ID NO: 359), AAGgugcaca (SEQ ID NO: 360), AAGgugcauc (SEQ ID NO: 361), AAGgugcccu (SEQ ID NO: 362), AAGgugccug (SEQ ID NO: 363), AAGgugcgug (SEQ ID NO: 364), AAGgugcguu (SEQ ID NO: 365), AAGgugcucc (SEQ ID NO: 366), AAGgugcuga (SEQ ID NO: 367), AAGgugcugc (SEQ ID NO: 368), AAGgugcugg (SEQ ID NO: 369), AAGgugcuua (SEQ ID NO: 370), AAGgugcuuu (SEQ ID NO: 371), AAGguggaua (SEQ ID NO: 372), AAGguggcua (SEQ ID NO: 373), AAGguggcug (SEQ ID NO: 374), AAGguggcuu (SEQ ID NO: 375), AAGgugggaa (SEQ ID NO: 376), AAGgugggag (SEQ ID NO: 377), AAGgugggau (SEQ ID NO: 378), AAGgugggca (SEQ ID NO: 379), AAGgugggcc (SEQ ID NO: 380), AAGgugggcg (SEQ ID NO: 381), AAGgugggga (SEQ ID NO: 382), AAGguggggu (SEQ ID NO: 383), AAGgugggua (SEQ ID NO: 384), AAGgugggug (SEQ ID NO: 385), AAGguggguu (SEQ ID NO: 386), AAGgugguaa (SEQ ID NO: 387), AAGgugguac (SEQ ID NO: 388), AAGgugguau (SEQ ID NO: 389), AAGguggugg (SEQ ID NO: 390), AAGgugguua (SEQ ID NO: 391), AAGgugguuc (SEQ ID NO: 392), AAGgugguuu (SEQ ID NO: 393), AAGguguaag (SEQ ID NO: 394), AAGgugucaa (SEQ ID NO: 395), AAGgugucag (SEQ ID NO: 396), AAGgugucug (SEQ ID NO: 397), AAGgugugaa (SEQ ID NO: 398), AAGgugugag (SEQ ID NO: 399), AAGgugugca (SEQ ID NO: 400), AAGgugugga (SEQ ID NO: 401), AAGguguggu (SEQ ID NO: 402), AAGgugugua (SEQ ID NO: 403), AAGguguguc (SEQ ID NO: 404), AAGgugugug (SEQ ID NO: 405), AAGguguguu (SEQ ID NO: 406), AAGguguucu (SEQ ID NO: 407), AAGguguugc (SEQ ID NO: 408), AAGguguugg (SEQ ID NO: 409), AAGguguuug (SEQ ID NO: 410), AAGguuaaaa (SEQ ID NO: 411), AAGguuaaca (SEQ ID NO: 412), AAGguuaagc (SEQ ID NO: 413), AAGguuaauu (SEQ ID NO: 414), AAGguuacau (SEQ ID NO: 415), AAGguuagaa (SEQ ID NO: 416), AAGguuagau (SEQ ID NO: 417), AAGguuagca (SEQ ID NO: 418), AAGguuagcc (SEQ ID NO: 419), AAGguuagga (SEQ ID NO: 420), AAGguuaggc (SEQ ID NO: 421), AAGguuagua (SEQ ID NO: 422), AAGguuaguc (SEQ ID NO: 423), AAGguuagug (SEQ ID NO: 424), AAGguuaguu (SEQ ID NO: 425), AAGguuauag (SEQ ID NO: 426), AAGguuauga (SEQ ID NO: 427), AAGguucaaa (SEQ ID NO: 428), AAGguucaag (SEQ ID NO: 429), AAGguuccuu (SEQ ID NO: 430), AAGguucggc (SEQ ID NO: 431), AAGguucguu (SEQ ID NO: 432), AAGguucuaa (SEQ ID NO: 433), AAGguucuga (SEQ ID NO: 434), AAGguucuua (SEQ ID NO: 435), AAGguugaau (SEQ ID NO: 436), AAGguugacu (SEQ ID NO: 437), AAGguugagg (SEQ ID NO: 438), AAGguugagu (SEQ ID NO: 439), AAGguugaua (SEQ ID NO: 440), AAGguugcac (SEQ ID NO: 441), AAGguugcug (SEQ ID NO: 442), AAGguuggaa (SEQ ID NO: 443), AAGguuggca (SEQ ID NO: 444), AAGguuggga (SEQ ID NO: 445), AAGguugggg (SEQ ID NO: 446), AAGguuggua (SEQ ID NO: 447), AAGguugguc (SEQ ID NO: 448), AAGguuggug (SEQ ID NO: 449), AAGguugguu (SEQ ID NO: 450), AAGguuguaa (SEQ ID NO: 451), AAGguugucc (SEQ ID NO: 452), AAGguugugc (SEQ ID NO: 453), AAGguuguua (SEQ ID NO: 454), AAGguuuacc (SEQ ID NO: 455), AAGguuuaua (SEQ ID NO: 456), AAGguuuauu (SEQ ID NO: 457), AAGguuuccu (SEQ ID NO: 458), AAGguuucgu (SEQ ID NO: 459), AAGguuugag (SEQ ID NO: 460), AAGguuugca (SEQ ID NO: 461), AAGguuugcc (SEQ ID NO: 462), AAGguuugcu (SEQ ID NO: 463), AAGguuugga (SEQ ID NO: 464), AAGguuuggu (SEQ ID NO: 465), AAGguuugua (SEQ ID NO: 466), AAGguuuguc (SEQ ID NO: 467), AAGguuugug (SEQ ID NO: 468), AAGguuuuaa (SEQ ID NO: 469), AAGguuuuca (SEQ ID NO: 470), AAGguuuucg (SEQ ID NO: 471), AAGguuuugc (SEQ ID NO: 472), AAGguuuugu (SEQ ID NO: 473), AAGguuuuuu (SEQ ID NO: 474), AAUgcaagua (SEQ ID NO: 475), AAUgcaaguc (SEQ ID NO: 476), AAUguaaaca (SEQ ID NO: 477), AAUguaaaua (SEQ ID NO: 478), AAUguaaauc (SEQ ID NO: 479), AAUguaaaug (SEQ ID NO: 480), AAUguaaauu (SEQ ID NO: 481), AAUguaacua (SEQ ID NO: 482), AAUguaagaa (SEQ ID NO: 483), AAUguaagag (SEQ ID NO: 484), AAUguaagau (SEQ ID NO: 485), AAUguaagcc (SEQ ID NO: 486), AAUguaagcu (SEQ ID NO: 487), AAUguaagga (SEQ ID NO: 488), AAUguaagua (SEQ ID NO: 489), AAUguaaguc (SEQ ID NO: 490), AAUguaagug (SEQ ID NO: 491), AAUguaaguu (SEQ ID NO: 492), AAUguaauca (SEQ ID NO: 493), AAUguaauga (SEQ ID NO: 494), AAUguaaugu (SEQ ID NO: 495), AAUguacauc (SEQ ID NO: 496), AAUguacaug (SEQ ID NO: 497), AAUguacgau (SEQ ID NO: 498), AAUguacgua (SEQ ID NO: 499), AAUguacguc (SEQ ID NO: 500), AAUguacgug (SEQ ID NO: 501), AAUguacucu (SEQ ID NO: 502), AAUguaggca (SEQ ID NO: 503), AAUguagguu (SEQ ID NO: 504), AAUguaucua (SEQ ID NO: 505), AAUguaugaa (SEQ ID NO: 506), AAUguaugua (SEQ ID NO: 507), AAUguaugug (SEQ ID NO: 508), AAUguauguu (SEQ ID NO: 509), AAUgucagag (SEQ ID NO: 510), AAUgucagau (SEQ ID NO: 511), AAUgucagcu (SEQ ID NO: 512), AAUgucagua (SEQ ID NO: 513), AAUgucaguc (SEQ ID NO: 514), AAUgucagug (SEQ ID NO: 515), AAUgucaguu (SEQ ID NO: 516), AAUgucggua (SEQ ID NO: 517), AAUgucuguu (SEQ ID NO: 518), AAUgugagaa (SEQ ID NO: 519), AAUgugagca (SEQ ID NO: 520), AAUgugagcc (SEQ ID NO: 521), AAUgugagga (SEQ ID NO: 522), AAUgugagua (SEQ ID NO: 523), AAUgugaguc (SEQ ID NO: 524), AAUgugagug (SEQ ID NO: 525), AAUgugaguu (SEQ ID NO: 526), AAUgugauau (SEQ ID NO: 527), AAUgugcaua (SEQ ID NO: 528), AAUgugcgua (SEQ ID NO: 529), AAUgugcguc (SEQ ID NO: 530), AAUgugggac (SEQ ID NO: 531), AAUguggguc (SEQ ID NO: 532), AAUgugggug (SEQ ID NO: 533), AAUgugguuu (SEQ ID NO: 534), AAUgugugua (SEQ ID NO: 535), AAUguuaagu (SEQ ID NO: 536), AAUguuagaa (SEQ ID NO: 537), AAUguuagau (SEQ ID NO: 538), AAUguuagua (SEQ ID NO: 539), AAUguuggug (SEQ ID NO: 540), ACAgcaagua (SEQ ID NO: 541), ACAguaaaua (SEQ ID NO: 542), ACAguaaaug (SEQ ID NO: 543), ACAguaagaa (SEQ ID NO: 544), ACAguaagca (SEQ ID NO: 545), ACAguaagua (SEQ ID NO: 546), ACAguaaguc (SEQ ID NO: 547), ACAguaagug (SEQ ID NO: 548), ACAguaaguu (SEQ ID NO: 549), ACAguacgua (SEQ ID NO: 550), ACAguaggug (SEQ ID NO: 551), ACAguauaac (SEQ ID NO: 552), ACAguaugua (SEQ ID NO: 553), ACAgucaguu (SEQ ID NO: 554), ACAgugagaa (SEQ ID NO: 555), ACAgugagcc (SEQ ID NO: 556), ACAgugagcu (SEQ ID NO: 557), ACAgugagga (SEQ ID NO: 558), ACAgugaggu (SEQ ID NO: 559), ACAgugagua (SEQ ID NO: 560), ACAgugaguc (SEQ ID NO: 561), ACAgugagug (SEQ ID NO: 562), ACAgugaguu (SEQ ID NO: 563), ACAgugggua (SEQ ID NO: 564), ACAguggguu (SEQ ID NO: 565), ACAguguaaa (SEQ ID NO: 566), ACAguuaagc (SEQ ID NO: 567), ACAguuaagu (SEQ ID NO: 568), ACAguuaugu (SEQ ID NO: 569), ACAguugagu (SEQ ID NO: 570), ACAguuguga (SEQ ID NO: 571), ACCguaagua (SEQ ID NO: 572), ACCgugagaa (SEQ ID NO: 573), ACCgugagca (SEQ ID NO: 574), ACCgugaguu (SEQ ID NO: 575), ACCgugggug (SEQ ID NO: 576), ACGguaaaac (SEQ ID NO: 577), ACGguaacua (SEQ ID NO: 578), ACGguaagua (SEQ ID NO: 579), ACGguaagug (SEQ ID NO: 580), ACGguaaguu (SEQ ID NO: 581), ACGguaauua (SEQ ID NO: 582), ACGguaauuu (SEQ ID NO: 583), ACGguacaau (SEQ ID NO: 584), ACGguacagu (SEQ ID NO: 585), ACGguaccag (SEQ ID NO: 586), ACGguacggu (SEQ ID NO: 587), ACGguacgua (SEQ ID NO: 588), ACGguaggaa (SEQ ID NO: 589), ACGguaggag (SEQ ID NO: 590), ACGguaggug (SEQ ID NO: 591), ACGguaguaa (SEQ ID NO: 592), ACGguauaau (SEQ ID NO: 593), ACGguaugac (SEQ ID NO: 594), ACGguaugcg (SEQ ID NO: 595), ACGguaugua (SEQ ID NO: 596), ACGguauguc (SEQ ID NO: 597), ACGgugaaac (SEQ ID NO: 598), ACGgugaagu (SEQ ID NO: 599), ACGgugaauc (SEQ ID NO: 600), ACGgugacag (SEQ ID NO: 601), ACGgugacca (SEQ ID NO: 602), ACGgugagaa (SEQ ID NO: 603), ACGgugagau (SEQ ID NO: 604), ACGgugagcc (SEQ ID NO: 605), ACGgugagua (SEQ ID NO: 606), ACGgugagug (SEQ ID NO: 607), ACGgugaguu (SEQ ID NO: 608), ACGgugcgug (SEQ ID NO: 609), ACGguggcac (SEQ ID NO: 610), ACGguggggc (SEQ ID NO: 611), ACGgugggug (SEQ ID NO: 612), ACGguguagu (SEQ ID NO: 613), ACGgugucac (SEQ ID NO: 614), ACGgugugua (SEQ ID NO: 615), ACGguguguu (SEQ ID NO: 616), ACGguuagug (SEQ ID NO: 617), ACGguuaguu (SEQ ID NO: 618), ACGguucaau (SEQ ID NO: 619), ACUguaaaua (SEQ ID NO: 620), ACUguaagaa (SEQ ID NO: 621), ACUguaagac (SEQ ID NO: 622), ACUguaagca (SEQ ID NO: 623), ACUguaagcu (SEQ ID NO: 624), ACUguaagua (SEQ ID NO: 625), ACUguaaguc (SEQ ID NO: 626), ACUguaaguu (SEQ ID NO: 627), ACUguacguu (SEQ ID NO: 628), ACUguacuge (SEQ ID NO: 629), ACUguaggcu (SEQ ID NO: 630), ACUguaggua (SEQ ID NO: 631), ACUguauauu (SEQ ID NO: 632), ACUguaugaa (SEQ ID NO: 633), ACUguaugcu (SEQ ID NO: 634), ACUguaugug (SEQ ID NO: 635), ACUguauucc (SEQ ID NO: 636), ACUgucagcu (SEQ ID NO: 637), ACUgucagug (SEQ ID NO: 638), ACUgugaacg (SEQ ID NO: 639), ACUgugagca (SEQ ID NO: 640), ACUgugagcg (SEQ ID NO: 641), ACUgugagcu (SEQ ID NO: 642), ACUgugagua (SEQ ID NO: 643), ACUgugaguc (SEQ ID NO: 644), ACUgugagug (SEQ ID NO: 645), ACUgugaguu (SEQ ID NO: 646), ACUgugggua (SEQ ID NO: 647), ACUgugugug (SEQ ID NO: 648), ACUguuaagu (SEQ ID NO: 649), AGAgcaagua (SEQ ID NO: 650), AGAguaaaac (SEQ ID NO: 651), AGAguaaacg (SEQ ID NO: 652), AGAguaaaga (SEQ ID NO: 653), AGAguaaagu (SEQ ID NO: 654), AGAguaaauc (SEQ ID NO: 655), AGAguaaaug (SEQ ID NO: 656), AGAguaacau (SEQ ID NO: 657), AGAguaacua (SEQ ID NO: 658), AGAguaagaa (SEQ ID NO: 659), AGAguaagac (SEQ ID NO: 660), AGAguaagag (SEQ ID NO: 661), AGAguaagau (SEQ ID NO: 662), AGAguaagca (SEQ ID NO: 663), AGAguaagcu (SEQ ID NO: 664), AGAguaagga (SEQ ID NO: 665), AGAguaaggc (SEQ ID NO: 666), AGAguaaggg (SEQ ID NO: 667), AGAguaaggu (SEQ ID NO: 668), AGAguaaguc (SEQ ID NO: 669), AGAguaagug (SEQ ID NO: 670), AGAguaaguu (SEQ ID NO: 671), AGAguaauaa (SEQ ID NO: 672), AGAguaaugu (SEQ ID NO: 673), AGAguaauuc (SEQ ID NO: 674), AGAguaauuu (SEQ ID NO: 675), AGAguacacc (SEQ ID NO: 676), AGAguaccug (SEQ ID NO: 677), AGAguacgug (SEQ ID NO: 678), AGAguacucu (SEQ ID NO: 679), AGAguacuga (SEQ ID NO: 680), AGAguacuuu (SEQ ID NO: 681), AGAguagcug (SEQ ID NO: 682), AGAguaggaa (SEQ ID NO: 683), AGAguaggga (SEQ ID NO: 684), AGAguagggu (SEQ ID NO: 685), AGAguagguc (SEQ ID NO: 686), AGAguaggug (SEQ ID NO: 687), AGAguagguu (SEQ ID NO: 688), AGAguauaua (SEQ ID NO: 689), AGAguauauu (SEQ ID NO: 690), AGAguaugaa (SEQ ID NO: 691), AGAguaugac (SEQ ID NO: 692), AGAguaugau (SEQ ID NO: 693), AGAguauguc (SEQ ID NO: 694), AGAguaugug (SEQ ID NO: 695), AGAguauguu (SEQ ID NO: 696), AGAguauuaa (SEQ ID NO: 697), AGAguauuau (SEQ ID NO: 698), AGAgucagug (SEQ ID NO: 699), AGAgugagac (SEQ ID NO: 700), AGAgugagag (SEQ ID NO: 701), AGAgugagau (SEQ ID NO: 702), AGAgugagca (SEQ ID NO: 703), AGAgugagua (SEQ ID NO: 704), AGAgugaguc (SEQ ID NO: 705), AGAgugagug (SEQ ID NO: 706), AGAgugaguu (SEQ ID NO: 707), AGAgugcguc (SEQ ID NO: 708), AGAgugggga (SEQ ID NO: 709), AGAgugggug (SEQ ID NO: 710), AGAgugugug (SEQ ID NO: 711), AGAguguuuc (SEQ ID NO: 712), AGAguuagua (SEQ ID NO: 713), AGAguugaga (SEQ ID NO: 714), AGAguugagu (SEQ ID NO: 715), AGAguugguu (SEQ ID NO: 716), AGAguuugau (SEQ ID NO: 717), AGCguaagcu (SEQ ID NO: 718), AGCguaagug (SEQ ID NO: 719), AGCgugagcc (SEQ ID NO: 720), AGCgugagug (SEQ ID NO: 721), AGCguuguuc (SEQ ID NO: 722), AGGgcagagu (SEQ ID NO: 723), AGGgcagccu (SEQ ID NO: 724), AGGgcuagua (SEQ ID NO: 725), AGGguaaaga (SEQ ID NO: 726), AGGguaaaua (SEQ ID NO: 727), AGGguaaauc (SEQ ID NO: 728), AGGguaaauu (SEQ ID NO: 729), AGGguaacca (SEQ ID NO: 730), AGGguaacug (SEQ ID NO: 731), AGGguaacuu (SEQ ID NO: 732), AGGguaagaa (SEQ ID NO: 733), AGGguaagag (SEQ ID NO: 734), AGGguaagau (SEQ ID NO: 735), AGGguaagca (SEQ ID NO: 736), AGGguaagga (SEQ ID NO: 737), AGGguaaggc (SEQ ID NO: 738), AGGguaaggg (SEQ ID NO: 739), AGGguaagua (SEQ ID NO: 740), AGGguaaguc (SEQ ID NO: 741), AGGguaagug (SEQ ID NO: 742), AGGguaaguu (SEQ ID NO: 743), AGGguaauac (SEQ ID NO: 744), AGGguaauga (SEQ ID NO: 745), AGGguaauua (SEQ ID NO: 746), AGGguaauuu (SEQ ID NO: 747), AGGguacacc (SEQ ID NO: 748), AGGguacagu (SEQ ID NO: 749), AGGguacggu (SEQ ID NO: 750), AGGguaggac (SEQ ID NO: 751), AGGguaggag (SEQ ID NO: 752), AGGguaggca (SEQ ID NO: 753), AGGguaggcc (SEQ ID NO: 754), AGGguaggga (SEQ ID NO: 755), AGGguagggu (SEQ ID NO: 756), AGGguagguc (SEQ ID NO: 757), AGGguaggug (SEQ ID NO: 758), AGGguagguu (SEQ ID NO: 759), AGGguauaua (SEQ ID NO: 760), AGGguaugac (SEQ ID NO: 761), AGGguaugag (SEQ ID NO: 762), AGGguaugau (SEQ ID NO: 763), AGGguaugca (SEQ ID NO: 764), AGGguaugcu (SEQ ID NO: 765), AGGguauggg (SEQ ID NO: 766), AGGguauggu (SEQ ID NO: 767), AGGguaugua (SEQ ID NO: 768), AGGguauguc (SEQ ID NO: 769), AGGguaugug (SEQ ID NO: 770), AGGguauuac (SEQ ID NO: 771), AGGguauucu (SEQ ID NO: 772), AGGguauuuc (SEQ ID NO: 773), AGGgucagag (SEQ ID NO: 774), AGGgucagca (SEQ ID NO: 775), AGGgucagga (SEQ ID NO: 776), AGGgucaggg (SEQ ID NO: 777), AGGgucagug (SEQ ID NO: 778), AGGgucaguu (SEQ ID NO: 779), AGGguccccu (SEQ ID NO: 780), AGGgucggga (SEQ ID NO: 781), AGGgucugca (SEQ ID NO: 782), AGGgucuguu (SEQ ID NO: 783), AGGgugaaga (SEQ ID NO: 784), AGGgugacua (SEQ ID NO: 785), AGGgugagaa (SEQ ID NO: 786), AGGgugagac (SEQ ID NO: 787), AGGgugagag (SEQ ID NO: 788), AGGgugagca (SEQ ID NO: 789), AGGgugagcc (SEQ ID NO: 790), AGGgugagcu (SEQ ID NO: 791), AGGgugagga (SEQ ID NO: 792), AGGgugaggg (SEQ ID NO: 793), AGGgugaggu (SEQ ID NO: 794), AGGgugagua (SEQ ID NO: 795), AGGgugaguc (SEQ ID NO: 796), AGGgugagug (SEQ ID NO: 797), AGGgugaguu (SEQ ID NO: 798), AGGgugggga (SEQ ID NO: 799), AGGguggggu (SEQ ID NO: 800), AGGgugggua (SEQ ID NO: 801), AGGgugggug (SEQ ID NO: 802), AGGgugugua (SEQ ID NO: 803), AGGgugugug (SEQ ID NO: 804), AGGguuaaug (SEQ ID NO: 805), AGGguuagaa (SEQ ID NO: 806), AGGguuaguu (SEQ ID NO: 807), AGGguuggug (SEQ ID NO: 808), AGGguuugug (SEQ ID NO: 809), AGGguuuguu (SEQ ID NO: 810), AGUguaaaag (SEQ ID NO: 811), AGUguaaaua (SEQ ID NO: 812), AGUguaaauu (SEQ ID NO: 813), AGUguaagaa (SEQ ID NO: 814), AGUguaagag (SEQ ID NO: 815), AGUguaagau (SEQ ID NO: 816), AGUguaagca (SEQ ID NO: 817), AGUguaagcc (SEQ ID NO: 818), AGUguaagua (SEQ ID NO: 819), AGUguaagug (SEQ ID NO: 820), AGUguaaguu (SEQ ID NO: 821), AGUguaauug (SEQ ID NO: 822), AGUguaggac (SEQ ID NO: 823), AGUguagguc (SEQ ID NO: 824), AGUguaugag (SEQ ID NO: 825), AGUguaugua (SEQ ID NO: 826), AGUguauguu (SEQ ID NO: 827), AGUguauugu (SEQ ID NO: 828), AGUguauuua (SEQ ID NO: 829), AGUgucaguc (SEQ ID NO: 830), AGUgugagag (SEQ ID NO: 831), AGUgugagca (SEQ ID NO: 832), AGUgugagcc (SEQ ID NO: 833), AGUgugagcu (SEQ ID NO: 834), AGUgugagua (SEQ ID NO: 835), AGUgugaguc (SEQ ID NO: 836), AGUgugagug (SEQ ID NO: 837), AGUgugaguu (SEQ ID NO: 838), AGUgugggua (SEQ ID NO: 839), AGUgugggug (SEQ ID NO: 840), AGUgugugua (SEQ ID NO: 841), AGUguuccua (SEQ ID NO: 842), AGUguugggg (SEQ ID NO: 843), AGUguuucag (SEQ ID NO: 844), AUAguaaaua (SEQ ID NO: 845), AUAguaagac (SEQ ID NO: 846), AUAguaagau (SEQ ID NO: 847), AUAguaagca (SEQ ID NO: 848), AUAguaagua (SEQ ID NO: 849), AUAguaagug (SEQ ID NO: 850), AUAguaaguu (SEQ ID NO: 851), AUAguaggua (SEQ ID NO: 852), AUAguauguu (SEQ ID NO: 853), AUAgucucac (SEQ ID NO: 854), AUAgugagac (SEQ ID NO: 855), AUAgugagag (SEQ ID NO: 856), AUAgugagau (SEQ ID NO: 857), AUAgugagcc (SEQ ID NO: 858), AUAgugaggc (SEQ ID NO: 859), AUAgugagua (SEQ ID NO: 860), AUAgugaguc (SEQ ID NO: 861), AUAgugagug (SEQ ID NO: 862), AUAgugcguc (SEQ ID NO: 863), AUAgugugua (SEQ ID NO: 864), AUAguucagu (SEQ ID NO: 865), AUCguaagcc (SEQ ID NO: 866), AUCguaaguu (SEQ ID NO: 867), AUCguauucc (SEQ ID NO: 868), AUCgugagua (SEQ ID NO: 869), AUGgcaagcg (SEQ ID NO: 870), AUGgcaagga (SEQ ID NO: 871), AUGgcaaguu (SEQ ID NO: 872), AUGgcaggua (SEQ ID NO: 873), AUGgcaugug (SEQ ID NO: 874), AUGgcgccau (SEQ ID NO: 875), AUGgcuugug (SEQ ID NO: 876), AUGguaaaac (SEQ ID NO: 877), AUGguaaaau (SEQ ID NO: 878), AUGguaaacc (SEQ ID NO: 879), AUGguaaaga (SEQ ID NO: 880), AUGguaaaua (SEQ ID NO: 881), AUGguaaaug (SEQ ID NO: 882), AUGguaaauu (SEQ ID NO: 883), AUGguaacag (SEQ ID NO: 884), AUGguaacau (SEQ ID NO: 885), AUGguaacua (SEQ ID NO: 886), AUGguaacuc (SEQ ID NO: 887), AUGguaacuu (SEQ ID NO: 888), AUGguaagaa (SEQ ID NO: 889), AUGguaagac (SEQ ID NO: 890), AUGguaagag (SEQ ID NO: 891), AUGguaagau (SEQ ID NO: 892), AUGguaagca (SEQ ID NO: 893), AUGguaagcc (SEQ ID NO: 894), AUGguaagcu (SEQ ID NO: 895), AUGguaagga (SEQ ID NO: 896), AUGguaaggg (SEQ ID NO: 897), AUGguaagua (SEQ ID NO: 898), AUGguaaguc (SEQ ID NO: 899), AUGguaagug (SEQ ID NO: 900), AUGguaaguu (SEQ ID NO: 901), AUGguaauaa (SEQ ID NO: 902), AUGguaauau (SEQ ID NO: 903), AUGguaauga (SEQ ID NO: 904), AUGguaaugg (SEQ ID NO: 905), AUGguaauug (SEQ ID NO: 906), AUGguaauuu (SEQ ID NO: 907), AUGguacage (SEQ ID NO: 908), AUGguacauc (SEQ ID NO: 909), AUGguaccag (SEQ ID NO: 910), AUGguaccug (SEQ ID NO: 911), AUGguacgag (SEQ ID NO: 912), AUGguacggu (SEQ ID NO: 913), AUGguagauc (SEQ ID NO: 914), AUGguagcag (SEQ ID NO: 915), AUGguagcug (SEQ ID NO: 916), AUGguaggaa (SEQ ID NO: 917), AUGguaggau (SEQ ID NO: 918), AUGguaggca (SEQ ID NO: 919), AUGguaggcu (SEQ ID NO: 920), AUGguagggg (SEQ ID NO: 921), AUGguagggu (SEQ ID NO: 922), AUGguaggua (SEQ ID NO: 923), AUGguaggug (SEQ ID NO: 924), AUGguaguuu (SEQ ID NO: 925), AUGguauagu (SEQ ID NO: 926), AUGguauaua (SEQ ID NO: 927), AUGguaucag (SEQ ID NO: 928), AUGguaucuu (SEQ ID NO: 929), AUGguaugau (SEQ ID NO: 930), AUGguaugca (SEQ ID NO: 931), AUGguaugcc (SEQ ID NO: 932), AUGguaugcg (SEQ ID NO: 933), AUGguaugcu (SEQ ID NO: 934), AUGguaugga (SEQ ID NO: 935), AUGguauggc (SEQ ID NO: 936), AUGguaugug (SEQ ID NO: 937), AUGguauguu (SEQ ID NO: 938), AUGguauuau (SEQ ID NO: 939), AUGguauuga (SEQ ID NO: 940), AUGguauuug (SEQ ID NO: 941), AUGgucaggg (SEQ ID NO: 942), AUGgucaguc (SEQ ID NO: 943), AUGgucagug (SEQ ID NO: 944), AUGgucauuu (SEQ ID NO: 945), AUGgugaaaa (SEQ ID NO: 946), AUGgugaaac (SEQ ID NO: 947), AUGgugaaau (SEQ ID NO: 948), AUGgugaacu (SEQ ID NO: 949), AUGgugaaga (SEQ ID NO: 950), AUGgugacgu (SEQ ID NO: 951), AUGgugagaa (SEQ ID NO: 952), AUGgugagac (SEQ ID NO: 953), AUGgugagag (SEQ ID NO: 954), AUGgugagca (SEQ ID NO: 955), AUGgugagcc (SEQ ID NO: 956), AUGgugageg (SEQ ID NO: 957), AUGgugagcu (SEQ ID NO: 958), AUGgugaggc (SEQ ID NO: 959), AUGgugaggg (SEQ ID NO: 960), AUGgugagua (SEQ ID NO: 961), AUGgugaguc (SEQ ID NO: 962), AUGgugagug (SEQ ID NO: 963), AUGgugaguu (SEQ ID NO: 964), AUGgugauuu (SEQ ID NO: 965), AUGgugcgau (SEQ ID NO: 966), AUGgugcgug (SEQ ID NO: 967), AUGgugggua (SEQ ID NO: 968), AUGgugggug (SEQ ID NO: 969), AUGguggguu (SEQ ID NO: 970), AUGgugguua (SEQ ID NO: 971), AUGguguaag (SEQ ID NO: 972), AUGgugugaa (SEQ ID NO: 973), AUGgugugua (SEQ ID NO: 974), AUGgugugug (SEQ ID NO: 975), AUGguuacuc (SEQ ID NO: 976), AUGguuagca (SEQ ID NO: 977), AUGguuaguc (SEQ ID NO: 978), AUGguuagug (SEQ ID NO: 979), AUGguuaguu (SEQ ID NO: 980), AUGguucagu (SEQ ID NO: 981), AUGguucguc (SEQ ID NO: 982), AUGguuggua (SEQ ID NO: 983), AUGguugguc (SEQ ID NO: 984), AUGguugguu (SEQ ID NO: 985), AUGguuguuu (SEQ ID NO: 986), AUGguuugca (SEQ ID NO: 987), AUGguuugua (SEQ ID NO: 988), AUUgcaagua (SEQ ID NO: 989), AUUguaaaua (SEQ ID NO: 990), AUUguaagau (SEQ ID NO: 991), AUUguaagca (SEQ ID NO: 992), AUUguaagga (SEQ ID NO: 993), AUUguaaggc (SEQ ID NO: 994), AUUguaagua (SEQ ID NO: 995), AUUguaaguc (SEQ ID NO: 996), AUUguaaguu (SEQ ID NO: 997), AUUguaauua (SEQ ID NO: 998), AUUguaauuu (SEQ ID NO: 999), AUUguacaaa (SEQ ID NO: 1000), AUUguaccuc (SEQ ID NO: 1001), AUUguacgug (SEQ ID NO: 1002), AUUguacuug (SEQ ID NO: 1003), AUUguaggua (SEQ ID NO: 1004), AUUguaugag (SEQ ID NO: 1005), AUUguaugua (SEQ ID NO: 1006), AUUgucuguu (SEQ ID NO: 1007), AUUgugagcu (SEQ ID NO: 1008), AUUgugagua (SEQ ID NO: 1009), AUUgugaguc (SEQ ID NO: 1010), AUUgugaguu (SEQ ID NO: 1011), AUUgugcgug (SEQ ID NO: 1012), AUUgugggug (SEQ ID NO: 1013), AUUguuagug (SEQ ID NO: 1014), CAAguaaaaa (SEQ ID NO: 1015), CAAguaaaua (SEQ ID NO: 1016), CAAguaaauc (SEQ ID NO: 1017), CAAguaaaug (SEQ ID NO: 1018), CAAguaaccc (SEQ ID NO: 1019), CAAguaacua (SEQ ID NO: 1020), CAAguaacug (SEQ ID NO: 1021), CAAguaagaa (SEQ ID NO: 1022), CAAguaagac (SEQ ID NO: 1023), CAAguaagau (SEQ ID NO: 1024), CAAguaaggu (SEQ ID NO: 1025), CAAguaagua (SEQ ID NO: 1026), CAAguaaguc (SEQ ID NO: 1027), CAAguaagug (SEQ ID NO: 1028), CAAguaaguu (SEQ ID NO: 1029), CAAguaaucc (SEQ ID NO: 1030), CAAguaaucu (SEQ ID NO: 1031), CAAguaauua (SEQ ID NO: 1032), CAAguaauuc (SEQ ID NO: 1033), CAAguaauug (SEQ ID NO: 1034), CAAguaauuu (SEQ ID NO: 1035), CAAguacaca (SEQ ID NO: 1036), CAAguacguu (SEQ ID NO: 1037), CAAguacuuu (SEQ ID NO: 1038), CAAguagcug (SEQ ID NO: 1039), CAAguaggau (SEQ ID NO: 1040), CAAguaggua (SEQ ID NO: 1041), CAAguagguc (SEQ ID NO: 1042), CAAguaggug (SEQ ID NO: 1043), CAAguagguu (SEQ ID NO: 1044), CAAguaguuu (SEQ ID NO: 1045), CAAguauaac (SEQ ID NO: 1046), CAAguauaug (SEQ ID NO: 1047), CAAguaucuu (SEQ ID NO: 1048), CAAguaugag (SEQ ID NO: 1049), CAAguaugua (SEQ ID NO: 1050), CAAguauguc (SEQ ID NO: 1051), CAAguaugug (SEQ ID NO: 1052), CAAguauguu (SEQ ID NO: 1053), CAAguauuga (SEQ ID NO: 1054), CAAguauuuc (SEQ ID NO: 1055), CAAgucagac (SEQ ID NO: 1056), CAAgucagua (SEQ ID NO: 1057), CAAgucuaua (SEQ ID NO: 1058), CAAgucugau (SEQ ID NO: 1059), CAAgugacuu (SEQ ID NO: 1060), CAAgugagaa (SEQ ID NO: 1061), CAAgugagac (SEQ ID NO: 1062), CAAgugagca (SEQ ID NO: 1063), CAAgugaggc (SEQ ID NO: 1064), CAAgugaggg (SEQ ID NO: 1065), CAAgugagua (SEQ ID NO: 1066), CAAgugaguc (SEQ ID NO: 1067), CAAgugagug (SEQ ID NO: 1068), CAAgugaucc (SEQ ID NO: 1069), CAAgugaucu (SEQ ID NO: 1070), CAAgugauuc (SEQ ID NO: 1071), CAAgugauug (SEQ ID NO: 1072), CAAgugauuu (SEQ ID NO: 1073), CAAgugccuu (SEQ ID NO: 1074), CAAgugggua (SEQ ID NO: 1075), CAAguggguc (SEQ ID NO: 1076), CAAgugggug (SEQ ID NO: 1077), CAAgugugag (SEQ ID NO: 1078), CAAguuaaaa (SEQ ID NO: 1079), CAAguuaagu (SEQ ID NO: 1080), CAAguuaauc (SEQ ID NO: 1081), CAAguuagaa (SEQ ID NO: 1082), CAAguuaguu (SEQ ID NO: 1083), CAAguucaag (SEQ ID NO: 1084), CAAguuccgu (SEQ ID NO: 1085), CAAguuggua (SEQ ID NO: 1086), CAAguuuagu (SEQ ID NO: 1087), CAAguuucca (SEQ ID NO: 1088), CAAguuuguu (SEQ ID NO: 1089), CACguaagag (SEQ ID NO: 1090), CACguaagca (SEQ ID NO: 1091), CACguaauug (SEQ ID NO: 1092), CACguaggac (SEQ ID NO: 1093), CACguaucga (SEQ ID NO: 1094), CACgucaguu (SEQ ID NO: 1095), CACgugagcu (SEQ ID NO: 1096), CACgugaguc (SEQ ID NO: 1097), CACgugagug (SEQ ID NO: 1098), CAGgcaagaa (SEQ ID NO: 1099), CAGgcaagac (SEQ ID NO: 1100), CAGgcaagag (SEQ ID NO: 1101), CAGgcaagga (SEQ ID NO: 1102), CAGgcaagua (SEQ ID NO: 1103), CAGgcaagug (SEQ ID NO: 1104), CAGgcaaguu (SEQ ID NO: 1105), CAGgcacgca (SEQ ID NO: 1106), CAGgcagagg (SEQ ID NO: 1107), CAGgcaggug (SEQ ID NO: 1108), CAGgcaucau (SEQ ID NO: 1109), CAGgcaugaa (SEQ ID NO: 1110), CAGgcaugag (SEQ ID NO: 1111), CAGgcaugca (SEQ ID NO: 1112), CAGgcaugcg (SEQ ID NO: 1113), CAGgcaugug (SEQ ID NO: 1114), CAGgcgagag (SEQ ID NO: 1115), CAGgcgccug (SEQ ID NO: 1116), CAGgcgugug (SEQ ID NO: 1117), CAGguaaaaa (SEQ ID NO: 1118), CAGguaaaag (SEQ ID NO: 1119), CAGguaaaca (SEQ ID NO: 1120), CAGguaaacc (SEQ ID NO: 1121), CAGguaaaga (SEQ ID NO: 1122), CAGguaaagc (SEQ ID NO: 1123), CAGguaaagu (SEQ ID NO: 1124), CAGguaaaua (SEQ ID NO: 1125), CAGguaaauc (SEQ ID NO: 1126), CAGguaaaug (SEQ ID NO: 1127), CAGguaaauu (SEQ ID NO: 1128), CAGguaacag (SEQ ID NO: 1129), CAGguaacau (SEQ ID NO: 1130), CAGguaacca (SEQ ID NO: 1131), CAGguaaccg (SEQ ID NO: 1132), CAGguaacgu (SEQ ID NO: 1133), CAGguaacua (SEQ ID NO: 1134), CAGguaacuc (SEQ ID NO: 1135), CAGguaacug (SEQ ID NO: 1136), CAGguaacuu (SEQ ID NO: 1137), CAGguaagaa (SEQ ID NO: 1138), CAGguaagac (SEQ ID NO: 1139), CAGguaagag (SEQ ID NO: 1140), CAGguaagau (SEQ ID NO: 1141), CAGguaagcc (SEQ ID NO: 1142), CAGguaagga (SEQ ID NO: 1143), CAGguaaggc (SEQ ID NO: 1144), CAGguaaggg (SEQ ID NO: 1145), CAGguaaggu (SEQ ID NO: 1146), CAGguaagua (SEQ ID NO: 1147), CAGguaagug (SEQ ID NO: 1148), CAGguaaguu (SEQ ID NO: 1149), CAGguaauaa (SEQ ID NO: 1150), CAGguaauau (SEQ ID NO: 1151), CAGguaaucc (SEQ ID NO: 1152), CAGguaaugc (SEQ ID NO: 1153), CAGguaaugg (SEQ ID NO: 1154), CAGguaaugu (SEQ ID NO: 1155), CAGguaauua (SEQ ID NO: 1156), CAGguaauuc (SEQ ID NO: 1157), CAGguaauug (SEQ ID NO: 1158), CAGguaauuu (SEQ ID NO: 1159), CAGguacaaa (SEQ ID NO: 1160), CAGguacaag (SEQ ID NO: 1161), CAGguacaau (SEQ ID NO: 1162), CAGguacaca (SEQ ID NO: 1163), CAGguacacg (SEQ ID NO: 1164), CAGguacaga (SEQ ID NO: 1165), CAGguacagg (SEQ ID NO: 1166), CAGguacagu (SEQ ID NO: 1167), CAGguacaua (SEQ ID NO: 1168), CAGguacaug (SEQ ID NO: 1169), CAGguacauu (SEQ ID NO: 1170), CAGguaccac (SEQ ID NO: 1171), CAGguaccca (SEQ ID NO: 1172), CAGguacccg (SEQ ID NO: 1173), CAGguacccu (SEQ ID NO: 1174), CAGguaccgc (SEQ ID NO: 1175), CAGguaccgg (SEQ ID NO: 1176), CAGguaccuc (SEQ ID NO: 1177), CAGguaccug (SEQ ID NO: 1178), CAGguaccuu (SEQ ID NO: 1179), CAGguacgag (SEQ ID NO: 1180), CAGguacgca (SEQ ID NO: 1181), CAGguacgcc (SEQ ID NO: 1182), CAGguacggu (SEQ ID NO: 1183), CAGguacgua (SEQ ID NO: 1184), CAGguacgug (SEQ ID NO: 1185), CAGguacuaa (SEQ ID NO: 1186), CAGguacuag (SEQ ID NO: 1187), CAGguacuau (SEQ ID NO: 1188), CAGguacucc (SEQ ID NO: 1189), CAGguacucu (SEQ ID NO: 1190), CAGguacuga (SEQ ID NO: 1191), CAGguacugc (SEQ ID NO: 1192), CAGguacugu (SEQ ID NO: 1193), CAGguacuua (SEQ ID NO: 1194), CAGguacuuu (SEQ ID NO: 1195), CAGguagaaa (SEQ ID NO: 1196), CAGguagaac (SEQ ID NO: 1197), CAGguagaag (SEQ ID NO: 1198), CAGguagaca (SEQ ID NO: 1199), CAGguagacc (SEQ ID NO: 1200), CAGguagaga (SEQ ID NO: 1201), CAGguagauu (SEQ ID NO: 1202), CAGguagcaa (SEQ ID NO: 1203), CAGguagcac (SEQ ID NO: 1204), CAGguagcag (SEQ ID NO: 1205), CAGguagcca (SEQ ID NO: 1206), CAGguagcgu (SEQ ID NO: 1207), CAGguagcua (SEQ ID NO: 1208), CAGguagcuc (SEQ ID NO: 1209), CAGguagcug (SEQ ID NO: 1210), CAGguagcuu (SEQ ID NO: 1211), CAGguaggaa (SEQ ID NO: 1212), CAGguaggac (SEQ ID NO: 1213), CAGguaggag (SEQ ID NO: 1214), CAGguaggca (SEQ ID NO: 1215), CAGguaggga (SEQ ID NO: 1216), CAGguagggc (SEQ ID NO: 1217), CAGguagggg (SEQ ID NO: 1218), CAGguagggu (SEQ ID NO: 1219), CAGguaggua (SEQ ID NO: 1220), CAGguagguc (SEQ ID NO: 1221), CAGguaggug (SEQ ID NO: 1222), CAGguagguu (SEQ ID NO: 1223), CAGguaguaa (SEQ ID NO: 1224), CAGguaguau (SEQ ID NO: 1225), CAGguaguca (SEQ ID NO: 1226), CAGguagucc (SEQ ID NO: 1227), CAGguaguga (SEQ ID NO: 1228), CAGguagugu (SEQ ID NO: 1229), CAGguaguuc (SEQ ID NO: 1230), CAGguaguug (SEQ ID NO: 1231), CAGguaguuu (SEQ ID NO: 1232), CAGguauaag (SEQ ID NO: 1233), CAGguauaca (SEQ ID NO: 1234), CAGguauaga (SEQ ID NO: 1235), CAGguauauc (SEQ ID NO: 1236), CAGguauaug (SEQ ID NO: 1237), CAGguauauu (SEQ ID NO: 1238), CAGguaucag (SEQ ID NO: 1239), CAGguaucau (SEQ ID NO: 1240), CAGguauccu (SEQ ID NO: 1241), CAGguaucga (SEQ ID NO: 1242), CAGguaucgc (SEQ ID NO: 1243), CAGguaucua (SEQ ID NO: 1244), CAGguaucug (SEQ ID NO: 1245), CAGguaucuu (SEQ ID NO: 1246), CAGguaugaa (SEQ ID NO: 1247), CAGguaugac (SEQ ID NO: 1248), CAGguaugag (SEQ ID NO: 1249), CAGguaugau (SEQ ID NO: 1250), CAGguaugca (SEQ ID NO: 1251), CAGguaugcc (SEQ ID NO: 1252), CAGguaugcg (SEQ ID NO: 1253), CAGguaugcu (SEQ ID NO: 1254), CAGguaugga (SEQ ID NO: 1255), CAGguauggg (SEQ ID NO: 1256), CAGguauggu (SEQ ID NO: 1257), CAGguaugua (SEQ ID NO: 1258), CAGguauguc (SEQ ID NO: 1259), CAGguaugug (SEQ ID NO: 1260), CAGguauguu (SEQ ID NO: 1261), CAGguauuau (SEQ ID NO: 1262), CAGguauuca (SEQ ID NO: 1263), CAGguauucu (SEQ ID NO: 1264), CAGguauuga (SEQ ID NO: 1265), CAGguauugg (SEQ ID NO: 1266), CAGguauugu (SEQ ID NO: 1267), CAGguauuua (SEQ ID NO: 1268), CAGguauuuc (SEQ ID NO: 1269), CAGguauuug (SEQ ID NO: 1270), CAGguauuuu (SEQ ID NO: 1271), CAGgucaaca (SEQ ID NO: 1272), CAGgucaaug (SEQ ID NO: 1273), CAGgucacgu (SEQ ID NO: 1274), CAGgucagaa (SEQ ID NO: 1275), CAGgucagac (SEQ ID NO: 1276), CAGgucagca (SEQ ID NO: 1277), CAGgucagcc (SEQ ID NO: 1278), CAGgucagcg (SEQ ID NO: 1279), CAGgucagga (SEQ ID NO: 1280), CAGgucagua (SEQ ID NO: 1281), CAGgucaguc (SEQ ID NO: 1282), CAGgucagug (SEQ ID NO: 1283), CAGgucaguu (SEQ ID NO: 1284), CAGgucaucc (SEQ ID NO: 1285), CAGgucaugc (SEQ ID NO: 1286), CAGgucauua (SEQ ID NO: 1287), CAGgucauuu (SEQ ID NO: 1288), CAGguccacc (SEQ ID NO: 1289), CAGguccacu (SEQ ID NO: 1290), CAGguccagu (SEQ ID NO: 1291), CAGguccauc (SEQ ID NO: 1292), CAGguccauu (SEQ ID NO: 1293), CAGgucccag (SEQ ID NO: 1294), CAGgucccug (SEQ ID NO: 1295), CAGguccuga (SEQ ID NO: 1296), CAGguccugc (SEQ ID NO: 1297), CAGguccugg (SEQ ID NO: 1298), CAGgucggcc (SEQ ID NO: 1299), CAGgucggug (SEQ ID NO: 1300), CAGgucguug (SEQ ID NO: 1301), CAGgucucuc (SEQ ID NO: 1302), CAGgucucuu (SEQ ID NO: 1303), CAGgucugag (SEQ ID NO: 1304), CAGgucugcc (SEQ ID NO: 1305), CAGgucugcg (SEQ ID NO: 1306), CAGgucugga (SEQ ID NO: 1307), CAGgucuggu (SEQ ID NO: 1308), CAGgucugua (SEQ ID NO: 1309), CAGgucuguc (SEQ ID NO: 1310), CAGgucugug (SEQ ID NO: 1311), CAGgucuguu (SEQ ID NO: 1312), CAGgucuucc (SEQ ID NO: 1313), CAGgucuuuc (SEQ ID NO: 1314), CAGgugaaag (SEQ ID NO: 1315), CAGgugaaau (SEQ ID NO: 1316), CAGgugaaca (SEQ ID NO: 1317), CAGgugaaga (SEQ ID NO: 1318), CAGgugaagg (SEQ ID NO: 1319), CAGgugaaua (SEQ ID NO: 1320), CAGgugaauc (SEQ ID NO: 1321), CAGgugaauu (SEQ ID NO: 1322), CAGgugacaa (SEQ ID NO: 1323), CAGgugacau (SEQ ID NO: 1324), CAGgugacca (SEQ ID NO: 1325), CAGgugaccc (SEQ ID NO: 1326), CAGgugaccg (SEQ ID NO: 1327), CAGgugaccu (SEQ ID NO: 1328), CAGgugacgg (SEQ ID NO: 1329), CAGgugacua (SEQ ID NO: 1330), CAGgugacuc (SEQ ID NO: 1331), CAGgugacug (SEQ ID NO: 1332), CAGgugagaa (SEQ ID NO: 1333), CAGgugagac (SEQ ID NO: 1334), CAGgugagag (SEQ ID NO: 1335), CAGgugagau (SEQ ID NO: 1336), CAGgugagca (SEQ ID NO: 1337), CAGgugagcc (SEQ ID NO: 1338), CAGgugagcg (SEQ ID NO: 1339), CAGgugagcu (SEQ ID NO: 1340), CAGgugagga (SEQ ID NO: 1341), CAGgugaggc (SEQ ID NO: 1342), CAGgugaggg (SEQ ID NO: 1343), CAGgugaggu (SEQ ID NO: 1344), CAGgugagua (SEQ ID NO: 1345), CAGgugaguc (SEQ ID NO: 1346), CAGgugagug (SEQ ID NO: 1347), CAGgugaguu (SEQ ID NO: 1348), CAGgugauaa (SEQ ID NO: 1349), CAGgugaucc (SEQ ID NO: 1350), CAGgugaucu (SEQ ID NO: 1351), CAGgugaugc (SEQ ID NO: 1352), CAGgugaugg (SEQ ID NO: 1353), CAGgugaugu (SEQ ID NO: 1354), CAGgugauua (SEQ ID NO: 1355), CAGgugauuc (SEQ ID NO: 1356), CAGgugauug (SEQ ID NO: 1357), CAGgugauuu (SEQ ID NO: 1358), CAGgugcaaa (SEQ ID NO: 1359), CAGgugcaag (SEQ ID NO: 1360), CAGgugcaca (SEQ ID NO: 1361), CAGgugcacg (SEQ ID NO: 1362), CAGgugcaga (SEQ ID NO: 1363), CAGgugcagg (SEQ ID NO: 1364), CAGgugcaua (SEQ ID NO: 1365), CAGgugcauc (SEQ ID NO: 1366), CAGgugcaug (SEQ ID NO: 1367), CAGgugccaa (SEQ ID NO: 1368), CAGgugccca (SEQ ID NO: 1369), CAGgugcccc (SEQ ID NO: 1370), CAGgugcccg (SEQ ID NO: 1371), CAGgugccua (SEQ ID NO: 1372), CAGgugccug (SEQ ID NO: 1373), CAGgugcgaa (SEQ ID NO: 1374), CAGgugcgca (SEQ ID NO: 1375), CAGgugcgcc (SEQ ID NO: 1376), CAGgugcgcg (SEQ ID NO: 1377), CAGgugcgga (SEQ ID NO: 1378), CAGgugcggu (SEQ ID NO: 1379), CAGgugcgua (SEQ ID NO: 1380), CAGgugcguc (SEQ ID NO: 1381), CAGgugcgug (SEQ ID NO: 1382), CAGgugcuag (SEQ ID NO: 1383), CAGgugcuau (SEQ ID NO: 1384), CAGgugcuca (SEQ ID NO: 1385), CAGgugcucc (SEQ ID NO: 1386), CAGgugcucg (SEQ ID NO: 1387), CAGgugcugc (SEQ ID NO: 1388), CAGgugcugg (SEQ ID NO: 1389), CAGgugcuua (SEQ ID NO: 1390), CAGgugcuuc (SEQ ID NO: 1391), CAGgugcuug (SEQ ID NO: 1392), CAGguggaac (SEQ ID NO: 1393), CAGguggaag (SEQ ID NO: 1394), CAGguggaau (SEQ ID NO: 1395), CAGguggaga (SEQ ID NO: 1396), CAGguggagu (SEQ ID NO: 1397), CAGguggauu (SEQ ID NO: 1398), CAGguggcca (SEQ ID NO: 1399), CAGguggcuc (SEQ ID NO: 1400), CAGguggcug (SEQ ID NO: 1401), CAGgugggaa (SEQ ID NO: 1402), CAGgugggac (SEQ ID NO: 1403), CAGgugggag (SEQ ID NO: 1404), CAGgugggau (SEQ ID NO: 1405), CAGgugggca (SEQ ID NO: 1406), CAGgugggcc (SEQ ID NO: 1407), CAGgugggcu (SEQ ID NO: 1408), CAGgugggga (SEQ ID NO: 1409), CAGguggggc (SEQ ID NO: 1410), CAGguggggg (SEQ ID NO: 1411), CAGguggggu (SEQ ID NO: 1412), CAGgugggua (SEQ ID NO: 1413), CAGguggguc (SEQ ID NO: 1414), CAGgugggug (SEQ ID NO: 1415), CAGguggguu (SEQ ID NO: 1416), CAGguggucu (SEQ ID NO: 1417), CAGguggugg (SEQ ID NO: 1418), CAGgugguug (SEQ ID NO: 1419), CAGguguaca (SEQ ID NO: 1420), CAGguguagg (SEQ ID NO: 1421), CAGguguauc (SEQ ID NO: 1422), CAGgugucac (SEQ ID NO: 1423), CAGgugucag (SEQ ID NO: 1424), CAGgugucca (SEQ ID NO: 1425), CAGguguccu (SEQ ID NO: 1426), CAGgugucua (SEQ ID NO: 1427), CAGgugucuc (SEQ ID NO: 1428), CAGgugucug (SEQ ID NO: 1429), CAGgugugaa (SEQ ID NO: 1430), CAGgugugac (SEQ ID NO: 1431), CAGgugugag (SEQ ID NO: 1432), CAGgugugau (SEQ ID NO: 1433), CAGgugugca (SEQ ID NO: 1434), CAGgugugcc (SEQ ID NO: 1435), CAGgugugcg (SEQ ID NO: 1436), CAGgugugcu (SEQ ID NO: 1437), CAGgugugga (SEQ ID NO: 1438), CAGguguggc (SEQ ID NO: 1439), CAGgugugua (SEQ ID NO: 1440), CAGguguguc (SEQ ID NO: 1441), CAGgugugug (SEQ ID NO: 1442), CAGguguguu (SEQ ID NO: 1443), CAGguguuua (SEQ ID NO: 1444), CAGguuaaaa (SEQ ID NO: 1445), CAGguuaaua (SEQ ID NO: 1446), CAGguuaauc (SEQ ID NO: 1447), CAGguuaccu (SEQ ID NO: 1448), CAGguuagaa (SEQ ID NO: 1449), CAGguuagag (SEQ ID NO: 1450), CAGguuagau (SEQ ID NO: 1451), CAGguuagcc (SEQ ID NO: 1452), CAGguuaggg (SEQ ID NO: 1453), CAGguuaggu (SEQ ID NO: 1454), CAGguuagua (SEQ ID NO: 1455), CAGguuaguc (SEQ ID NO: 1456), CAGguuagug (SEQ ID NO: 1457), CAGguuaguu (SEQ ID NO: 1458), CAGguuauca (SEQ ID NO: 1459), CAGguuaugu (SEQ ID NO: 1460), CAGguuauua (SEQ ID NO: 1461), CAGguuauug (SEQ ID NO: 1462), CAGguucaaa (SEQ ID NO: 1463), CAGguucaac (SEQ ID NO: 1464), CAGguucaag (SEQ ID NO: 1465), CAGguucaca (SEQ ID NO: 1466), CAGguucacg (SEQ ID NO: 1467), CAGguucagg (SEQ ID NO: 1468), CAGguucaug (SEQ ID NO: 1469), CAGguuccag (SEQ ID NO: 1470), CAGguuccca (SEQ ID NO: 1471), CAGguucccg (SEQ ID NO: 1472), CAGguucgaa (SEQ ID NO: 1473), CAGguucgag (SEQ ID NO: 1474), CAGguucuau (SEQ ID NO: 1475), CAGguucugc (SEQ ID NO: 1476), CAGguucuua (SEQ ID NO: 1477), CAGguucuuc (SEQ ID NO: 1478), CAGguucuuu (SEQ ID NO: 1479), CAGguugaac (SEQ ID NO: 1480), CAGguugaag (SEQ ID NO: 1481), CAGguugagu (SEQ ID NO: 1482), CAGguugaua (SEQ ID NO: 1483), CAGguuggag (SEQ ID NO: 1484), CAGguuggca (SEQ ID NO: 1485), CAGguuggcc (SEQ ID NO: 1486), CAGguugguc (SEQ ID NO: 1487), CAGguuggug (SEQ ID NO: 1488), CAGguugguu (SEQ ID NO: 1489), CAGguuguaa (SEQ ID NO: 1490), CAGguuguac (SEQ ID NO: 1491), CAGguuguau (SEQ ID NO: 1492), CAGguuguca (SEQ ID NO: 1493), CAGguuguga (SEQ ID NO: 1494), CAGguuguug (SEQ ID NO: 1495), CAGguuuaag (SEQ ID NO: 1496), CAGguuuacc (SEQ ID NO: 1497), CAGguuuagc (SEQ ID NO: 1498), CAGguuuagu (SEQ ID NO: 1499), CAGguuucuu (SEQ ID NO: 1500), CAGguuugaa (SEQ ID NO: 1501), CAGguuugag (SEQ ID NO: 1502), CAGguuugau (SEQ ID NO: 1503), CAGguuugcc (SEQ ID NO: 1504), CAGguuugcu (SEQ ID NO: 1505), CAGguuuggg (SEQ ID NO: 1506), CAGguuuggu (SEQ ID NO: 1507), CAGguuugua (SEQ ID NO: 1508), CAGguuugug (SEQ ID NO: 1509), CAGguuuguu (SEQ ID NO: 1510), CAGguuuucu (SEQ ID NO: 1511), CAGguuuugg (SEQ ID NO: 1512), CAGguuuuuc (SEQ ID NO: 1513), CAGguuuuuu (SEQ ID NO: 1514), CAUgcagguu (SEQ ID NO: 1515), CAUguaaaac (SEQ ID NO: 1516), CAUguaacua (SEQ ID NO: 1517), CAUguaagaa (SEQ ID NO: 1518), CAUguaagag (SEQ ID NO: 1519), CAUguaagau (SEQ ID NO: 1520), CAUguaagcc (SEQ ID NO: 1521), CAUguaagua (SEQ ID NO: 1522), CAUguaagug (SEQ ID NO: 1523), CAUguaaguu (SEQ ID NO: 1524), CAUguaauua (SEQ ID NO: 1525), CAUguacaua (SEQ ID NO: 1526), CAUguaccac (SEQ ID NO: 1527), CAUguacguu (SEQ ID NO: 1528), CAUguaggua (SEQ ID NO: 1529), CAUguaggug (SEQ ID NO: 1530), CAUguagguu (SEQ ID NO: 1531), CAUguaugaa (SEQ ID NO: 1532), CAUguaugua (SEQ ID NO: 1533), CAUguaugug (SEQ ID NO: 1534), CAUguauguu (SEQ ID NO: 1535), CAUgugagaa (SEQ ID NO: 1536), CAUgugagca (SEQ ID NO: 1537), CAUgugagcu (SEQ ID NO: 1538), CAUgugagua (SEQ ID NO: 1539), CAUgugaguc (SEQ ID NO: 1540), CAUgugagug (SEQ ID NO: 1541), CAUgugaguu (SEQ ID NO: 1542), CAUgugcgua (SEQ ID NO: 1543), CAUgugggaa (SEQ ID NO: 1544), CAUguggguu (SEQ ID NO: 1545), CAUgugugug (SEQ ID NO: 1546), CAUguguguu (SEQ ID NO: 1547), CAUguuaaua (SEQ ID NO: 1548), CAUguuagcc (SEQ ID NO: 1549), CCAguaagau (SEQ ID NO: 1550), CCAguaagca (SEQ ID NO: 1551), CCAguaagcc (SEQ ID NO: 1552), CCAguaagcu (SEQ ID NO: 1553), CCAguaagga (SEQ ID NO: 1554), CCAguaagua (SEQ ID NO: 1555), CCAguaaguc (SEQ ID NO: 1556), CCAguaagug (SEQ ID NO: 1557), CCAguaaguu (SEQ ID NO: 1558), CCAguaauug (SEQ ID NO: 1559), CCAguacggg (SEQ ID NO: 1560), CCAguagguc (SEQ ID NO: 1561), CCAguauugu (SEQ ID NO: 1562), CCAgugaggc (SEQ ID NO: 1563), CCAgugagua (SEQ ID NO: 1564), CCAgugagug (SEQ ID NO: 1565), CCAguggguc (SEQ ID NO: 1566), CCAguuaguu (SEQ ID NO: 1567), CCAguugagu (SEQ ID NO: 1568), CCCguaagau (SEQ ID NO: 1569), CCCguauguc (SEQ ID NO: 1570), CCCguauguu (SEQ ID NO: 1571), CCCguccugc (SEQ ID NO: 1572), CCCgugagug (SEQ ID NO: 1573), CCGguaaaga (SEQ ID NO: 1574), CCGguaagau (SEQ ID NO: 1575), CCGguaagcc (SEQ ID NO: 1576), CCGguaagga (SEQ ID NO: 1577), CCGguaaggc (SEQ ID NO: 1578), CCGguaaugg (SEQ ID NO: 1579), CCGguacagu (SEQ ID NO: 1580), CCGguacuga (SEQ ID NO: 1581), CCGguauucc (SEQ ID NO: 1582), CCGgucagug (SEQ ID NO: 1583), CCGgugaaaa (SEQ ID NO: 1584), CCGgugagaa (SEQ ID NO: 1585), CCGgugaggg (SEQ ID NO: 1586), CCGgugagug (SEQ ID NO: 1587), CCGgugaguu (SEQ ID NO: 1588), CCGgugcgcg (SEQ ID NO: 1589), CCGgugggcg (SEQ ID NO: 1590), CCGguugguc (SEQ ID NO: 1591), CCUguaaaug (SEQ ID NO: 1592), CCUguaaauu (SEQ ID NO: 1593), CCUguaagaa (SEQ ID NO: 1594), CCUguaagac (SEQ ID NO: 1595), CCUguaagag (SEQ ID NO: 1596), CCUguaagca (SEQ ID NO: 1597), CCUguaagcg (SEQ ID NO: 1598), CCUguaagga (SEQ ID NO: 1599), CCUguaaguu (SEQ ID NO: 1600), CCUguaggua (SEQ ID NO: 1601), CCUguaggug (SEQ ID NO: 1602), CCUguaucuu (SEQ ID NO: 1603), CCUguauggu (SEQ ID NO: 1604), CCUguaugug (SEQ ID NO: 1605), CCUgugagaa (SEQ ID NO: 1606), CCUgugagca (SEQ ID NO: 1607), CCUgugaggg (SEQ ID NO: 1608), CCUgugaguc (SEQ ID NO: 1609), CCUgugagug (SEQ ID NO: 1610), CCUgugaguu (SEQ ID NO: 1611), CCUguggcuc (SEQ ID NO: 1612), CCUgugggua (SEQ ID NO: 1613), CCUgugugua (SEQ ID NO: 1614), CCUguuagaa (SEQ ID NO: 1615), CGAguaaggg (SEQ ID NO: 1616), CGAguaaggu (SEQ ID NO: 1617), CGAguagcug (SEQ ID NO: 1618), CGAguaggug (SEQ ID NO: 1619), CGAguagguu (SEQ ID NO: 1620), CGAgugagca (SEQ ID NO: 1621), CGCguaagag (SEQ ID NO: 1622), CGGgcaggca (SEQ ID NO: 1623), CGGguaagcc (SEQ ID NO: 1624), CGGguaagcu (SEQ ID NO: 1625), CGGguaaguu (SEQ ID NO: 1626), CGGguaauuc (SEQ ID NO: 1627), CGGguaauuu (SEQ ID NO: 1628), CGGguacagu (SEQ ID NO: 1629), CGGguacggg (SEQ ID NO: 1630), CGGguaggag (SEQ ID NO: 1631), CGGguaggcc (SEQ ID NO: 1632), CGGguaggug (SEQ ID NO: 1633), CGGguauuua (SEQ ID NO: 1634), CGGgucugag (SEQ ID NO: 1635), CGGgugaccg (SEQ ID NO: 1636), CGGgugacuc (SEQ ID NO: 1637), CGGgugagaa (SEQ ID NO: 1638), CGGgugaggg (SEQ ID NO: 1639), CGGgugaggu (SEQ ID NO: 1640), CGGgugagua (SEQ ID NO: 1641), CGGgugagug (SEQ ID NO: 1642), CGGgugaguu (SEQ ID NO: 1643), CGGgugauuu (SEQ ID NO: 1644), CGGgugccuu (SEQ ID NO: 1645), CGGgugggag (SEQ ID NO: 1646), CGGgugggug (SEQ ID NO: 1647), CGGguggguu (SEQ ID NO: 1648), CGGguguguc (SEQ ID NO: 1649), CGGgugugug (SEQ ID NO: 1650), CGGguguguu (SEQ ID NO: 1651), CGGguucaag (SEQ ID NO: 1652), CGGguucaug (SEQ ID NO: 1653), CGGguuugcu (SEQ ID NO: 1654), CGUguagggu (SEQ ID NO: 1655), CGUguaugca (SEQ ID NO: 1656), CGUguaugua (SEQ ID NO: 1657), CGUgucugua (SEQ ID NO: 1658), CGUgugagug (SEQ ID NO: 1659), CGUguuuucu (SEQ ID NO: 1660), CUAguaaaug (SEQ ID NO: 1661), CUAguaagcg (SEQ ID NO: 1662), CUAguaagcu (SEQ ID NO: 1663), CUAguaagua (SEQ ID NO: 1664), CUAguaaguc (SEQ ID NO: 1665), CUAguaagug (SEQ ID NO: 1666), CUAguaaguu (SEQ ID NO: 1667), CUAguaauuu (SEQ ID NO: 1668), CUAguaggua (SEQ ID NO: 1669), CUAguagguu (SEQ ID NO: 1670), CUAguaugua (SEQ ID NO: 1671), CUAguauguu (SEQ ID NO: 1672), CUAgugagua (SEQ ID NO: 1673), CUCguaagca (SEQ ID NO: 1674), CUCguaagug (SEQ ID NO: 1675), CUCguaaguu (SEQ ID NO: 1676), CUCguaucug (SEQ ID NO: 1677), CUCgucugug (SEQ ID NO: 1678), CUCgugaaua (SEQ ID NO: 1679), CUCgugagua (SEQ ID NO: 1680), CUCgugauua (SEQ ID NO: 1681), CUGguaaaaa (SEQ ID NO: 1682), CUGguaaaau (SEQ ID NO: 1683), CUGguaaacc (SEQ ID NO: 1684), CUGguaaacg (SEQ ID NO: 1685), CUGguaaagc (SEQ ID NO: 1686), CUGguaaaua (SEQ ID NO: 1687), CUGguaaauc (SEQ ID NO: 1688), CUGguaaaug (SEQ ID NO: 1689), CUGguaaauu (SEQ ID NO: 1690), CUGguaacac (SEQ ID NO: 1691), CUGguaacag (SEQ ID NO: 1692), CUGguaaccc (SEQ ID NO: 1693), CUGguaaccg (SEQ ID NO: 1694), CUGguaacug (SEQ ID NO: 1695), CUGguaacuu (SEQ ID NO: 1696), CUGguaagaa (SEQ ID NO: 1697), CUGguaagag (SEQ ID NO: 1698), CUGguaagau (SEQ ID NO: 1699), CUGguaagca (SEQ ID NO: 1700), CUGguaagcc (SEQ ID NO: 1701), CUGguaagcu (SEQ ID NO: 1702), CUGguaagga (SEQ ID NO: 1703), CUGguaaggc (SEQ ID NO: 1704), CUGguaaggg (SEQ ID NO: 1705), CUGguaaggu (SEQ ID NO: 1706), CUGguaagua (SEQ ID NO: 1707), CUGguaagug (SEQ ID NO: 1708), CUGguaaguu (SEQ ID NO: 1709), CUGguaauga (SEQ ID NO: 1710), CUGguaaugc (SEQ ID NO: 1711), CUGguaauuc (SEQ ID NO: 1712), CUGguaauuu (SEQ ID NO: 1713), CUGguacaac (SEQ ID NO: 1714), CUGguacaau (SEQ ID NO: 1715), CUGguacaga (SEQ ID NO: 1716), CUGguacaua (SEQ ID NO: 1717), CUGguacauu (SEQ ID NO: 1718), CUGguaccau (SEQ ID NO: 1719), CUGguacguu (SEQ ID NO: 1720), CUGguacuaa (SEQ ID NO: 1721), CUGguacuug (SEQ ID NO: 1722), CUGguacuuu (SEQ ID NO: 1723), CUGguagaga (SEQ ID NO: 1724), CUGguagaua (SEQ ID NO: 1725), CUGguagcgu (SEQ ID NO: 1726), CUGguaggau (SEQ ID NO: 1727), CUGguaggca (SEQ ID NO: 1728), CUGguaggua (SEQ ID NO: 1729), CUGguagguc (SEQ ID NO: 1730), CUGguaggug (SEQ ID NO: 1731), CUGguaucaa (SEQ ID NO: 1732), CUGguaugau (SEQ ID NO: 1733), CUGguauggc (SEQ ID NO: 1734), CUGguauggu (SEQ ID NO: 1735), CUGguaugua (SEQ ID NO: 1736), CUGguaugug (SEQ ID NO: 1737), CUGguauguu (SEQ ID NO: 1738), CUGguauuga (SEQ ID NO: 1739), CUGguauuuc (SEQ ID NO: 1740), CUGguauuuu (SEQ ID NO: 1741), CUGgucaaca (SEQ ID NO: 1742), CUGgucagag (SEQ ID NO: 1743), CUGgucccgc (SEQ ID NO: 1744), CUGgucggua (SEQ ID NO: 1745), CUGgucuggg (SEQ ID NO: 1746), CUGgugaagu (SEQ ID NO: 1747), CUGgugaaua (SEQ ID NO: 1748), CUGgugaauu (SEQ ID NO: 1749), CUGgugacua (SEQ ID NO: 1750), CUGgugagaa (SEQ ID NO: 1751), CUGgugagac (SEQ ID NO: 1752), CUGgugagca (SEQ ID NO: 1753), CUGgugagcu (SEQ ID NO: 1754), CUGgugagga (SEQ ID NO: 1755), CUGgugaggc (SEQ ID NO: 1756), CUGgugaggg (SEQ ID NO: 1757), CUGgugaggu (SEQ ID NO: 1758), CUGgugagua (SEQ ID NO: 1759), CUGgugaguc (SEQ ID NO: 1760), CUGgugagug (SEQ ID NO: 1761), CUGgugaguu (SEQ ID NO: 1762), CUGgugauua (SEQ ID NO: 1763), CUGgugauuu (SEQ ID NO: 1764), CUGgugcaga (SEQ ID NO: 1765), CUGgugcgcu (SEQ ID NO: 1766), CUGgugcgug (SEQ ID NO: 1767), CUGgugcuga (SEQ ID NO: 1768), CUGgugggag (SEQ ID NO: 1769), CUGgugggga (SEQ ID NO: 1770), CUGgugggua (SEQ ID NO: 1771), CUGguggguc (SEQ ID NO: 1772), CUGgugggug (SEQ ID NO: 1773), CUGguggguu (SEQ ID NO: 1774), CUGgugugaa (SEQ ID NO: 1775), CUGgugugca (SEQ ID NO: 1776), CUGgugugcu (SEQ ID NO: 1777), CUGguguggu (SEQ ID NO: 1778), CUGgugugug (SEQ ID NO: 1779), CUGguguguu (SEQ ID NO: 1780), CUGguuagcu (SEQ ID NO: 1781), CUGguuagug (SEQ ID NO: 1782), CUGguucgug (SEQ ID NO: 1783), CUGguuggcu (SEQ ID NO: 1784), CUGguuguuu (SEQ ID NO: 1785), CUGguuugua (SEQ ID NO: 1786), CUGguuuguc (SEQ ID NO: 1787), CUGguuugug (SEQ ID NO: 1788), CUUguaaaug (SEQ ID NO: 1789), CUUguaagcu (SEQ ID NO: 1790), CUUguaagga (SEQ ID NO: 1791), CUUguaaggc (SEQ ID NO: 1792), CUUguaagua (SEQ ID NO: 1793), CUUguaagug (SEQ ID NO: 1794), CUUguaaguu (SEQ ID NO: 1795), CUUguacguc (SEQ ID NO: 1796), CUUguacgug (SEQ ID NO: 1797), CUUguaggua (SEQ ID NO: 1798), CUUguagugc (SEQ ID NO: 1799), CUUguauagg (SEQ ID NO: 1800), CUUgucagua (SEQ ID NO: 1801), CUUgugagua (SEQ ID NO: 1802), CUUgugaguc (SEQ ID NO: 1803), CUUgugaguu (SEQ ID NO: 1804), CUUguggguu (SEQ ID NO: 1805), CUUgugugua (SEQ ID NO: 1806), CUUguuagug (SEQ ID NO: 1807), CUUguuugag (SEQ ID NO: 1808), GAAguaaaac (SEQ ID NO: 1809), GAAguaaagc (SEQ ID NO: 1810), GAAguaaagu (SEQ ID NO: 1811), GAAguaaaua (SEQ ID NO: 1812), GAAguaaauu (SEQ ID NO: 1813), GAAguaagaa (SEQ ID NO: 1814), GAAguaagcc (SEQ ID NO: 1815), GAAguaagcu (SEQ ID NO: 1816), GAAguaagga (SEQ ID NO: 1817), GAAguaagua (SEQ ID NO: 1818), GAAguaagug (SEQ ID NO: 1819), GAAguaaguu (SEQ ID NO: 1820), GAAguaauau (SEQ ID NO: 1821), GAAguaaugc (SEQ ID NO: 1822), GAAguaauua (SEQ ID NO: 1823), GAAguaauuu (SEQ ID NO: 1824), GAAguaccau (SEQ ID NO: 1825), GAAguacgua (SEQ ID NO: 1826), GAAguacguc (SEQ ID NO: 1827), GAAguaggca (SEQ ID NO: 1828), GAAguagguc (SEQ ID NO: 1829), GAAguauaaa (SEQ ID NO: 1830), GAAguaugcu (SEQ ID NO: 1831), GAAguaugug (SEQ ID NO: 1832), GAAguauguu (SEQ ID NO: 1833), GAAguauuaa (SEQ ID NO: 1834), GAAgucagug (SEQ ID NO: 1835), GAAgugagag (SEQ ID NO: 1836), GAAgugagcg (SEQ ID NO: 1837), GAAgugaggu (SEQ ID NO: 1838), GAAgugaguc (SEQ ID NO: 1839), GAAgugagug (SEQ ID NO: 1840), GAAgugaguu (SEQ ID NO: 1841), GAAgugauaa (SEQ ID NO: 1842), GAAgugauuc (SEQ ID NO: 1843), GAAgugcgug (SEQ ID NO: 1844), GAAguguggg (SEQ ID NO: 1845), GAAguguguc (SEQ ID NO: 1846), GAAguuggug (SEQ ID NO: 1847), GACguaaagu (SEQ ID NO: 1848), GACguaagcu (SEQ ID NO: 1849), GACguaagua (SEQ ID NO: 1850), GACguaaugg (SEQ ID NO: 1851), GACguaugcc (SEQ ID NO: 1852), GACguauguu (SEQ ID NO: 1853), GACgugagcc (SEQ ID NO: 1854), GACgugagug (SEQ ID NO: 1855), GAGgcaaaug (SEQ ID NO: 1856), GAGgcaagag (SEQ ID NO: 1857), GAGgcaagua (SEQ ID NO: 1858), GAGgcaagug (SEQ ID NO: 1859), GAGgcaaguu (SEQ ID NO: 1860), GAGgcacgag (SEQ ID NO: 1861), GAGgcaggga (SEQ ID NO: 1862), GAGgcaugug (SEQ ID NO: 1863), GAGgcgaagg (SEQ ID NO: 1864), GAGguaaaaa (SEQ ID NO: 1865), GAGguaaaac (SEQ ID NO: 1866), GAGguaaaag (SEQ ID NO: 1867), GAGguaaaau (SEQ ID NO: 1868), GAGguaaacc (SEQ ID NO: 1869), GAGguaaaga (SEQ ID NO: 1870), GAGguaaagc (SEQ ID NO: 1871), GAGguaaagu (SEQ ID NO: 1872), GAGguaaaua (SEQ ID NO: 1873), GAGguaaauc (SEQ ID NO: 1874), GAGguaaaug (SEQ ID NO: 1875), GAGguaaauu (SEQ ID NO: 1876), GAGguaacaa (SEQ ID NO: 1877), GAGguaacag (SEQ ID NO: 1878), GAGguaacca (SEQ ID NO: 1879), GAGguaaccu (SEQ ID NO: 1880), GAGguaacuu (SEQ ID NO: 1881), GAGguaagaa (SEQ ID NO: 1882), GAGguaagag (SEQ ID NO: 1883), GAGguaagau (SEQ ID NO: 1884), GAGguaagca (SEQ ID NO: 1885), GAGguaagcc (SEQ ID NO: 1886), GAGguaagcg (SEQ ID NO: 1887), GAGguaagcu (SEQ ID NO: 1888), GAGguaagga (SEQ ID NO: 1889), GAGguaaggc (SEQ ID NO: 1890), GAGguaaggg (SEQ ID NO: 1891), GAGguaaggu (SEQ ID NO: 1892), GAGguaagua (SEQ ID NO: 1893), GAGguaaguc (SEQ ID NO: 1894), GAGguaauaa (SEQ ID NO: 1895), GAGguaauac (SEQ ID NO: 1896), GAGguaauau (SEQ ID NO: 1897), GAGguaauca (SEQ ID NO: 1898), GAGguaaucu (SEQ ID NO: 1899), GAGguaaugg (SEQ ID NO: 1900), GAGguaaugu (SEQ ID NO: 1901), GAGguaauug (SEQ ID NO: 1902), GAGguaauuu (SEQ ID NO: 1903), GAGguacaaa (SEQ ID NO: 1904), GAGguacaac (SEQ ID NO: 1905), GAGguacaga (SEQ ID NO: 1906), GAGguacagc (SEQ ID NO: 1907), GAGguacagu (SEQ ID NO: 1908), GAGguacaua (SEQ ID NO: 1909), GAGguacauu (SEQ ID NO: 1910), GAGguaccag (SEQ ID NO: 1911), GAGguaccga (SEQ ID NO: 1912), GAGguaccug (SEQ ID NO: 1913), GAGguaccuu (SEQ ID NO: 1914), GAGguacuag (SEQ ID NO: 1915), GAGguacuau (SEQ ID NO: 1916), GAGguacucc (SEQ ID NO: 1917), GAGguacugc (SEQ ID NO: 1918), GAGguacugg (SEQ ID NO: 1919), GAGguacugu (SEQ ID NO: 1920), GAGguacuug (SEQ ID NO: 1921), GAGguacuuu (SEQ ID NO: 1922), GAGguagaag (SEQ ID NO: 1923), GAGguagaga (SEQ ID NO: 1924), GAGguagagg (SEQ ID NO: 1925), GAGguagagu (SEQ ID NO: 1926), GAGguagauc (SEQ ID NO: 1927), GAGguagcua (SEQ ID NO: 1928), GAGguagcug (SEQ ID NO: 1929), GAGguaggaa (SEQ ID NO: 1930), GAGguaggag (SEQ ID NO: 1931), GAGguaggca (SEQ ID NO: 1932), GAGguaggcu (SEQ ID NO: 1933), GAGguaggga (SEQ ID NO: 1934), GAGguagggc (SEQ ID NO: 1935), GAGguagggg (SEQ ID NO: 1936), GAGguaggua (SEQ ID NO: 1937), GAGguaggug (SEQ ID NO: 1938), GAGguagguu (SEQ ID NO: 1939), GAGguaguaa (SEQ ID NO: 1940), GAGguaguag (SEQ ID NO: 1941), GAGguaguau (SEQ ID NO: 1942), GAGguagucu (SEQ ID NO: 1943), GAGguagugc (SEQ ID NO: 1944), GAGguagugg (SEQ ID NO: 1945), GAGguaguua (SEQ ID NO: 1946), GAGguaguug (SEQ ID NO: 1947), GAGguauaag (SEQ ID NO: 1948), GAGguauacu (SEQ ID NO: 1949), GAGguauagc (SEQ ID NO: 1950), GAGguauaug (SEQ ID NO: 1951), GAGguauauu (SEQ ID NO: 1952), GAGguaucau (SEQ ID NO: 1953), GAGguaucug (SEQ ID NO: 1954), GAGguaucuu (SEQ ID NO: 1955), GAGguaugaa (SEQ ID NO: 1956), GAGguaugac (SEQ ID NO: 1957), GAGguaugag (SEQ ID NO: 1958), GAGguaugcc (SEQ ID NO: 1959), GAGguaugcg (SEQ ID NO: 1960), GAGguaugcu (SEQ ID NO: 1961), GAGguaugga (SEQ ID NO: 1962), GAGguauggg (SEQ ID NO: 1963), GAGguauggu (SEQ ID NO: 1964), GAGguaugua (SEQ ID NO: 1965), GAGguauguc (SEQ ID NO: 1966), GAGguaugug (SEQ ID NO: 1967), GAGguauguu (SEQ ID NO: 1968), GAGguauucc (SEQ ID NO: 1969), GAGguauuga (SEQ ID NO: 1970), GAGguauugu (SEQ ID NO: 1971), GAGguauuua (SEQ ID NO: 1972), GAGguauuuc (SEQ ID NO: 1973), GAGguauuug (SEQ ID NO: 1974), GAGguauuuu (SEQ ID NO: 1975), GAGgucaaca (SEQ ID NO: 1976), GAGgucaagg (SEQ ID NO: 1977), GAGgucaaug (SEQ ID NO: 1978), GAGgucacug (SEQ ID NO: 1979), GAGgucagaa (SEQ ID NO: 1980), GAGgucagag (SEQ ID NO: 1981), GAGgucagcu (SEQ ID NO: 1982), GAGgucagga (SEQ ID NO: 1983), GAGgucaggc (SEQ ID NO: 1984), GAGgucaggg (SEQ ID NO: 1985), GAGgucaggu (SEQ ID NO: 1986), GAGgucagua (SEQ ID NO: 1987), GAGgucauau (SEQ ID NO: 1988), GAGgucaugu (SEQ ID NO: 1989), GAGgucauuu (SEQ ID NO: 1990), GAGguccaua (SEQ ID NO: 1991), GAGguccauc (SEQ ID NO: 1992), GAGguccggg (SEQ ID NO: 1993), GAGguccggu (SEQ ID NO: 1994), GAGguccuug (SEQ ID NO: 1995), GAGgucgggg (SEQ ID NO: 1996), GAGgucucgu (SEQ ID NO: 1997), GAGgucugag (SEQ ID NO: 1998), GAGgucuggu (SEQ ID NO: 1999), GAGgucuguc (SEQ ID NO: 2000), GAGgucuguu (SEQ ID NO: 2001), GAGgucuuuu (SEQ ID NO: 2002), GAGgugaaaa (SEQ ID NO: 2003), GAGgugaaau (SEQ ID NO: 2004), GAGgugaaca (SEQ ID NO: 2005), GAGgugaagg (SEQ ID NO: 2006), GAGgugaaua (SEQ ID NO: 2007), GAGgugaauu (SEQ ID NO: 2008), GAGgugacau (SEQ ID NO: 2009), GAGgugacca (SEQ ID NO: 2010), GAGgugaccu (SEQ ID NO: 2011), GAGgugacua (SEQ ID NO: 2012), GAGgugacuu (SEQ ID NO: 2013), GAGgugagaa (SEQ ID NO: 2014), GAGgugagac (SEQ ID NO: 2015), GAGgugagag (SEQ ID NO: 2016), GAGgugagau (SEQ ID NO: 2017), GAGgugagca (SEQ ID NO: 2018), GAGgugagcc (SEQ ID NO: 2019), GAGgugagcg (SEQ ID NO: 2020), GAGgugagcu (SEQ ID NO: 2021), GAGgugagga (SEQ ID NO: 2022), GAGgugaggc (SEQ ID NO: 2023), GAGgugaggg (SEQ ID NO: 2024), GAGgugagua (SEQ ID NO: 2025), GAGgugagug (SEQ ID NO: 2026), GAGgugaguu (SEQ ID NO: 2027), GAGgugauau (SEQ ID NO: 2028), GAGgugaucc (SEQ ID NO: 2029), GAGgugaucu (SEQ ID NO: 2030), GAGgugauga (SEQ ID NO: 2031), GAGgugaugg (SEQ ID NO: 2032), GAGgugaugu (SEQ ID NO: 2033), GAGgugauuc (SEQ ID NO: 2034), GAGgugcaca (SEQ ID NO: 2035), GAGgugcaga (SEQ ID NO: 2036), GAGgugcagc (SEQ ID NO: 2037), GAGgugcagg (SEQ ID NO: 2038), GAGgugccag (SEQ ID NO: 2039), GAGgugccca (SEQ ID NO: 2040), GAGgugccuu (SEQ ID NO: 2041), GAGgugcggg (SEQ ID NO: 2042), GAGgugcgug (SEQ ID NO: 2043), GAGgugcucc (SEQ ID NO: 2044), GAGgugcugg (SEQ ID NO: 2045), GAGgugcuua (SEQ ID NO: 2046), GAGgugcuug (SEQ ID NO: 2047), GAGguggaaa (SEQ ID NO: 2048), GAGguggaau (SEQ ID NO: 2049), GAGguggacc (SEQ ID NO: 2050), GAGguggacg (SEQ ID NO: 2051), GAGguggagg (SEQ ID NO: 2052), GAGguggcug (SEQ ID NO: 2053), GAGgugggaa (SEQ ID NO: 2054), GAGgugggag (SEQ ID NO: 2055), GAGgugggau (SEQ ID NO: 2056), GAGgugggca (SEQ ID NO: 2057), GAGgugggcg (SEQ ID NO: 2058), GAGgugggcu (SEQ ID NO: 2059), GAGgugggga (SEQ ID NO: 2060), GAGguggggc (SEQ ID NO: 2061), GAGguggggg (SEQ ID NO: 2062), GAGgugggua (SEQ ID NO: 2063), GAGguggguc (SEQ ID NO: 2064), GAGgugggug (SEQ ID NO: 2065), GAGguggguu (SEQ ID NO: 2066), GAGgugguau (SEQ ID NO: 2067), GAGgugguuc (SEQ ID NO: 2068), GAGgugucau (SEQ ID NO: 2069), GAGgugugag (SEQ ID NO: 2070), GAGgugugau (SEQ ID NO: 2071), GAGgugugca (SEQ ID NO: 2072), GAGgugugcu (SEQ ID NO: 2073), GAGgugugga (SEQ ID NO: 2074), GAGguguggg (SEQ ID NO: 2075), GAGguguggu (SEQ ID NO: 2076), GAGgugugua (SEQ ID NO: 2077), GAGgugugug (SEQ ID NO: 2078), GAGguuaaau (SEQ ID NO: 2079), GAGguuaaga (SEQ ID NO: 2080), GAGguuaaua (SEQ ID NO: 2081), GAGguuaccg (SEQ ID NO: 2082), GAGguuagaa (SEQ ID NO: 2083), GAGguuagac (SEQ ID NO: 2084), GAGguuagag (SEQ ID NO: 2085), GAGguuaggu (SEQ ID NO: 2086), GAGguuagua (SEQ ID NO: 2087), GAGguuaguc (SEQ ID NO: 2088), GAGguuagug (SEQ ID NO: 2089), GAGguuaguu (SEQ ID NO: 2090), GAGguuaugu (SEQ ID NO: 2091), GAGguuauuc (SEQ ID NO: 2092), GAGguucaaa (SEQ ID NO: 2093), GAGguucaua (SEQ ID NO: 2094), GAGguucuga (SEQ ID NO: 2095), GAGguugaag (SEQ ID NO: 2096), GAGguugcag (SEQ ID NO: 2097), GAGguugcug (SEQ ID NO: 2098), GAGguuggaa (SEQ ID NO: 2099), GAGguuggag (SEQ ID NO: 2100), GAGguuggau (SEQ ID NO: 2101), GAGguuggua (SEQ ID NO: 2102), GAGguugguc (SEQ ID NO: 2103), GAGguugguu (SEQ ID NO: 2104), GAGguuguag (SEQ ID NO: 2105), GAGguuucug (SEQ ID NO: 2106), GAGguuugag (SEQ ID NO: 2107), GAGguuugga (SEQ ID NO: 2108), GAGguuuggg (SEQ ID NO: 2109), GAGguuugua (SEQ ID NO: 2110), GAGguuuguu (SEQ ID NO: 2111), GAGguuuuca (SEQ ID NO: 2112), GAGguuuuga (SEQ ID NO: 2113), GAGguuuugg (SEQ ID NO: 2114), GAGguuuuua (SEQ ID NO: 2115), GAGguuuuuc (SEQ ID NO: 2116), GAUguaaaau (SEQ ID NO: 2117), GAUguaagca (SEQ ID NO: 2118), GAUguaagcc (SEQ ID NO: 2119), GAUguaaggu (SEQ ID NO: 2120), GAUguaagua (SEQ ID NO: 2121), GAUguaagug (SEQ ID NO: 2122), GAUguaaguu (SEQ ID NO: 2123), GAUguacauc (SEQ ID NO: 2124), GAUguaggua (SEQ ID NO: 2125), GAUguauggc (SEQ ID NO: 2126), GAUguaugua (SEQ ID NO: 2127), GAUguauguu (SEQ ID NO: 2128), GAUgucagug (SEQ ID NO: 2129), GAUgugagag (SEQ ID NO: 2130), GAUgugagcc (SEQ ID NO: 2131), GAUgugagcu (SEQ ID NO: 2132), GAUgugagga (SEQ ID NO: 2133), GAUgugaguc (SEQ ID NO: 2134), GAUgugagug (SEQ ID NO: 2135), GAUgugaguu (SEQ ID NO: 2136), GAUgugggua (SEQ ID NO: 2137), GAUgugggug (SEQ ID NO: 2138), GAUguguguu (SEQ ID NO: 2139), GAUguuagcu (SEQ ID NO: 2140), GAUguucagu (SEQ ID NO: 2141), GAUguucgug (SEQ ID NO: 2142), GAUguuuguu (SEQ ID NO: 2143), GCAguaaagg (SEQ ID NO: 2144), GCAguaagaa (SEQ ID NO: 2145), GCAguaagga (SEQ ID NO: 2146), GCAguaagua (SEQ ID NO: 2147), GCAguaaguc (SEQ ID NO: 2148), GCAguaaguu (SEQ ID NO: 2149), GCAguagaug (SEQ ID NO: 2150), GCAguaggua (SEQ ID NO: 2151), GCAguaugug (SEQ ID NO: 2152), GCAguauguu (SEQ ID NO: 2153), GCAgucagua (SEQ ID NO: 2154), GCAgucagug (SEQ ID NO: 2155), GCAguccggu (SEQ ID NO: 2156), GCAgugacuu (SEQ ID NO: 2157), GCAgugagcc (SEQ ID NO: 2158), GCAgugagcg (SEQ ID NO: 2159), GCAgugagcu (SEQ ID NO: 2160), GCAgugagua (SEQ ID NO: 2161), GCAgugagug (SEQ ID NO: 2162), GCAgugaguu (SEQ ID NO: 2163), GCAgugggua (SEQ ID NO: 2164), GCAguuaagu (SEQ ID NO: 2165), GCAguugagu (SEQ ID NO: 2166), GCCguaaguc (SEQ ID NO: 2167), GCCgugagua (SEQ ID NO: 2168), GCGguaaagc (SEQ ID NO: 2169), GCGguaaaua (SEQ ID NO: 2170), GCGguaagcu (SEQ ID NO: 2171), GCGguaaggg (SEQ ID NO: 2172), GCGguaagug (SEQ ID NO: 2173), GCGguaauca (SEQ ID NO: 2174), GCGguacgua (SEQ ID NO: 2175), GCGguacuug (SEQ ID NO: 2176), GCGguagggu (SEQ ID NO: 2177), GCGguagugu (SEQ ID NO: 2178), GCGgugagca (SEQ ID NO: 2179), GCGgugagcu (SEQ ID NO: 2180), GCGgugaguu (SEQ ID NO: 2181), GCGguggcuc (SEQ ID NO: 2182), GCGgugugca (SEQ ID NO: 2183), GCGguguguu (SEQ ID NO: 2184), GCGguuaagu (SEQ ID NO: 2185), GCGguuugca (SEQ ID NO: 2186), GCUgcuguaa (SEQ ID NO: 2187), GCUguaaaua (SEQ ID NO: 2188), GCUguaagac (SEQ ID NO: 2189), GCUguaagag (SEQ ID NO: 2190), GCUguaagca (SEQ ID NO: 2191), GCUguaagga (SEQ ID NO: 2192), GCUguaagua (SEQ ID NO: 2193), GCUguaaguc (SEQ ID NO: 2194), GCUguaagug (SEQ ID NO: 2195), GCUguaaguu (SEQ ID NO: 2196), GCUguaggug (SEQ ID NO: 2197), GCUguauggu (SEQ ID NO: 2198), GCUgucagug (SEQ ID NO: 2199), GCUguccuug (SEQ ID NO: 2200), GCUgugagaa (SEQ ID NO: 2201), GCUgugagcc (SEQ ID NO: 2202), GCUgugagga (SEQ ID NO: 2203), GCUgugagua (SEQ ID NO: 2204), GCUgugaguc (SEQ ID NO: 2205), GCUgugagug (SEQ ID NO: 2206), GCUgugaguu (SEQ ID NO: 2207), GCUguggguu (SEQ ID NO: 2208), GGAguaagag (SEQ ID NO: 2209), GGAguaagca (SEQ ID NO: 2210), GGAguaagcc (SEQ ID NO: 2211), GGAguaagcu (SEQ ID NO: 2212), GGAguaagga (SEQ ID NO: 2213), GGAguaagug (SEQ ID NO: 2214), GGAguaaguu (SEQ ID NO: 2215), GGAguaauuu (SEQ ID NO: 2216), GGAguacugu (SEQ ID NO: 2217), GGAguaggaa (SEQ ID NO: 2218), GGAguaggua (SEQ ID NO: 2219), GGAguagguu (SEQ ID NO: 2220), GGAguaguau (SEQ ID NO: 2221), GGAguaugac (SEQ ID NO: 2222), GGAguauggu (SEQ ID NO: 2223), GGAgucaagu (SEQ ID NO: 2224), GGAgugaggg (SEQ ID NO: 2225), GGAgugagua (SEQ ID NO: 2226), GGAgugaguc (SEQ ID NO: 2227), GGAgugagug (SEQ ID NO: 2228), GGAgugaguu (SEQ ID NO: 2229), GGAgugcuuu (SEQ ID NO: 2230), GGAgugggca (SEQ ID NO: 2231), GGAgugggug (SEQ ID NO: 2232), GGAguuaagg (SEQ ID NO: 2233), GGAguugaga (SEQ ID NO: 2234), GGCguaagcc (SEQ ID NO: 2235), GGCguaggua (SEQ ID NO: 2236), GGCguaggug (SEQ ID NO: 2237), GGCgugagcc (SEQ ID NO: 2238), GGCgugaguc (SEQ ID NO: 2239), GGGguaaaca (SEQ ID NO: 2240), GGGguaaacc (SEQ ID NO: 2241), GGGguaaacu (SEQ ID NO: 2242), GGGguaagaa (SEQ ID NO: 2243), GGGguaagag (SEQ ID NO: 2244), GGGguaagau (SEQ ID NO: 2245), GGGguaagca (SEQ ID NO: 2246), GGGguaagcc (SEQ ID NO: 2247), GGGguaagcu (SEQ ID NO: 2248), GGGguaagga (SEQ ID NO: 2249), GGGguaaggg (SEQ ID NO: 2250), GGGguaagua (SEQ ID NO: 2251), GGGguaagug (SEQ ID NO: 2252), GGGguaaguu (SEQ ID NO: 2253), GGGguagaca (SEQ ID NO: 2254), GGGguaggag (SEQ ID NO: 2255), GGGguaggcc (SEQ ID NO: 2256), GGGguaggga (SEQ ID NO: 2257), GGGguaggua (SEQ ID NO: 2258), GGGguaggug (SEQ ID NO: 2259), GGGguagguu (SEQ ID NO: 2260), GGGguagugc (SEQ ID NO: 2261), GGGguaucug (SEQ ID NO: 2262), GGGguaugac (SEQ ID NO: 2263), GGGguaugga (SEQ ID NO: 2264), GGGguaugua (SEQ ID NO: 2265), GGGguauguc (SEQ ID NO: 2266), GGGguaugug (SEQ ID NO: 2267), GGGguauguu (SEQ ID NO: 2268), GGGgucagua (SEQ ID NO: 2269), GGGguccgug (SEQ ID NO: 2270), GGGgucggag (SEQ ID NO: 2271), GGGgucugug (SEQ ID NO: 2272), GGGgugaaca (SEQ ID NO: 2273), GGGgugaaga (SEQ ID NO: 2274), GGGgugagaa (SEQ ID NO: 2275), GGGgugagau (SEQ ID NO: 2276), GGGgugagcc (SEQ ID NO: 2277), GGGgugagcg (SEQ ID NO: 2278), GGGgugagcu (SEQ ID NO: 2279), GGGgugagga (SEQ ID NO: 2280), GGGgugaggc (SEQ ID NO: 2281), GGGgugaggg (SEQ ID NO: 2282), GGGgugaguc (SEQ ID NO: 2283), GGGgugagug (SEQ ID NO: 2284), GGGgugaguu (SEQ ID NO: 2285), GGGgugcgua (SEQ ID NO: 2286), GGGguggggu (SEQ ID NO: 2287), GGGgugggua (SEQ ID NO: 2288), GGGgugggug (SEQ ID NO: 2289), GGGguggguu (SEQ ID NO: 2290), GGGgugugcg (SEQ ID NO: 2291), GGGgugugua (SEQ ID NO: 2292), GGGguguguc (SEQ ID NO: 2293), GGGgugugug (SEQ ID NO: 2294), GGGguuacag (SEQ ID NO: 2295), GGGguuggac (SEQ ID NO: 2296), GGGguuggga (SEQ ID NO: 2297), GGGguuugcc (SEQ ID NO: 2298), GGGguuugua (SEQ ID NO: 2299), GGUguaagaa (SEQ ID NO: 2300), GGUguaagau (SEQ ID NO: 2301), GGUguaagca (SEQ ID NO: 2302), GGUguaagcc (SEQ ID NO: 2303), GGUguaagcg (SEQ ID NO: 2304), GGUguaaguc (SEQ ID NO: 2305), GGUguaagug (SEQ ID NO: 2306), GGUguagguc (SEQ ID NO: 2307), GGUguaggug (SEQ ID NO: 2308), GGUguagguu (SEQ ID NO: 2309), GGUguccgua (SEQ ID NO: 2310), GGUgugagag (SEQ ID NO: 2311), GGUgugagcc (SEQ ID NO: 2312), GGUgugagcu (SEQ ID NO: 2313), GGUgugagua (SEQ ID NO: 2314), GGUgugaguc (SEQ ID NO: 2315), GGUgugcuuc (SEQ ID NO: 2316), GGUguggcug (SEQ ID NO: 2317), GGUgugguga (SEQ ID NO: 2318), GGUgugucug (SEQ ID NO: 2319), GGUguugaaa (SEQ ID NO: 2320), GGUguugcug (SEQ ID NO: 2321), GUAguaagau (SEQ ID NO: 2322), GUAguaagua (SEQ ID NO: 2323), GUAguaagug (SEQ ID NO: 2324), GUAguagcuu (SEQ ID NO: 2325), GUAguaggua (SEQ ID NO: 2326), GUAgucagua (SEQ ID NO: 2327), GUAgugagua (SEQ ID NO: 2328), GUAguggugg (SEQ ID NO: 2329), GUAguuaagu (SEQ ID NO: 2330), GUAguuucug (SEQ ID NO: 2331), GUCguaagug (SEQ ID NO: 2332), GUCgugagug (SEQ ID NO: 2333), GUCgugaguu (SEQ ID NO: 2334), GUGgcaagua (SEQ ID NO: 2335), GUGgcuugua (SEQ ID NO: 2336), GUGguaaaau (SEQ ID NO: 2337), GUGguaaaga (SEQ ID NO: 2338), GUGguaaauu (SEQ ID NO: 2339), GUGguaacau (SEQ ID NO: 2340), GUGguaacua (SEQ ID NO: 2341), GUGguaagaa (SEQ ID NO: 2342), GUGguaagac (SEQ ID NO: 2343), GUGguaagag (SEQ ID NO: 2344), GUGguaagau (SEQ ID NO: 2345), GUGguaagca (SEQ ID NO: 2346), GUGguaagcg (SEQ ID NO: 2347), GUGguaagcu (SEQ ID NO: 2348), GUGguaagga (SEQ ID NO: 2349), GUGguaaggc (SEQ ID NO: 2350), GUGguaagua (SEQ ID NO: 2351), GUGguaaguc (SEQ ID NO: 2352), GUGguaagug (SEQ ID NO: 2353), GUGguaaguu (SEQ ID NO: 2354), GUGguaauga (SEQ ID NO: 2355), GUGguaauuc (SEQ ID NO: 2356), GUGguaauuu (SEQ ID NO: 2357), GUGguacaug (SEQ ID NO: 2358), GUGguacgau (SEQ ID NO: 2359), GUGguacuau (SEQ ID NO: 2360), GUGguacuug (SEQ ID NO: 2361), GUGguagaua (SEQ ID NO: 2362), GUGguagege (SEQ ID NO: 2363), GUGguaggga (SEQ ID NO: 2364), GUGguagguc (SEQ ID NO: 2365), GUGguaggug (SEQ ID NO: 2366), GUGguagguu (SEQ ID NO: 2367), GUGguauaaa (SEQ ID NO: 2368), GUGguaucuc (SEQ ID NO: 2369), GUGguaugaa (SEQ ID NO: 2370), GUGguaugau (SEQ ID NO: 2371), GUGguaugca (SEQ ID NO: 2372), GUGguaugua (SEQ ID NO: 2373), GUGguauguu (SEQ ID NO: 2374), GUGguccgug (SEQ ID NO: 2375), GUGgucuggc (SEQ ID NO: 2376), GUGgugaaac (SEQ ID NO: 2377), GUGgugagaa (SEQ ID NO: 2378), GUGgugagau (SEQ ID NO: 2379), GUGgugagca (SEQ ID NO: 2380), GUGgugagcu (SEQ ID NO: 2381), GUGgugagga (SEQ ID NO: 2382), GUGgugaggc (SEQ ID NO: 2383), GUGgugagug (SEQ ID NO: 2384), GUGgugaguu (SEQ ID NO: 2385), GUGgugauua (SEQ ID NO: 2386), GUGgugauuc (SEQ ID NO: 2387), GUGgugcgau (SEQ ID NO: 2388), GUGgugcuua (SEQ ID NO: 2389), GUGgugggaa (SEQ ID NO: 2390), GUGgugggua (SEQ ID NO: 2391), GUGguggguc (SEQ ID NO: 2392), GUGguguccg (SEQ ID NO: 2393), GUGguuagca (SEQ ID NO: 2394), GUGguuaggu (SEQ ID NO: 2395), GUGguuagug (SEQ ID NO: 2396), GUGguuugca (SEQ ID NO: 2397), GUGguuugua (SEQ ID NO: 2398), GUUguaaggu (SEQ ID NO: 2399), GUUguaagua (SEQ ID NO: 2400), GUUguaaguc (SEQ ID NO: 2401), GUUguaaguu (SEQ ID NO: 2402), GUUguaccac (SEQ ID NO: 2403), GUUguagcgu (SEQ ID NO: 2404), GUUguaugug (SEQ ID NO: 2405), GUUguauguu (SEQ ID NO: 2406), GUUgucugug (SEQ ID NO: 2407), GUUgugagcu (SEQ ID NO: 2408), GUUgugagug (SEQ ID NO: 2409), GUUgugaguu (SEQ ID NO: 2410), GUUgugggua (SEQ ID NO: 2411), GUUguggguu (SEQ ID NO: 2412), UAAguaaaug (SEQ ID NO: 2413), UAAguaacua (SEQ ID NO: 2414), UAAguaagaa (SEQ ID NO: 2415), UAAguaagag (SEQ ID NO: 2416), UAAguaagau (SEQ ID NO: 2417), UAAguaagca (SEQ ID NO: 2418), UAAguaagcu (SEQ ID NO: 2419), UAAguaagga (SEQ ID NO: 2420), UAAguaaggu (SEQ ID NO: 2421), UAAguaagua (SEQ ID NO: 2422), UAAguaaguc (SEQ ID NO: 2423), UAAguaagug (SEQ ID NO: 2424), UAAguaaguu (SEQ ID NO: 2425), UAAguaauaa (SEQ ID NO: 2426), UAAguacuag (SEQ ID NO: 2427), UAAguaguuu (SEQ ID NO: 2428), UAAguauaaa (SEQ ID NO: 2429), UAAguauaca (SEQ ID NO: 2430), UAAguaugua (SEQ ID NO: 2431), UAAguauuau (SEQ ID NO: 2432), UAAguauuuu (SEQ ID NO: 2433), UAAgucuuuu (SEQ ID NO: 2434), UAAgugagac (SEQ ID NO: 2435), UAAgugagga (SEQ ID NO: 2436), UAAgugaggg (SEQ ID NO: 2437), UAAgugagua (SEQ ID NO: 2438), UAAgugaguc (SEQ ID NO: 2439), UAAgugagug (SEQ ID NO: 2440), UAAgugaguu (SEQ ID NO: 2441), UAAgugaucc (SEQ ID NO: 2442), UAAgugauuc (SEQ ID NO: 2443), UAAgugcgug (SEQ ID NO: 2444), UAAguuaagu (SEQ ID NO: 2445), UAAguuccag (SEQ ID NO: 2446), UAAguucuuu (SEQ ID NO: 2447), UAAguuguaa (SEQ ID NO: 2448), UAAguuguau (SEQ ID NO: 2449), UAAguuuguu (SEQ ID NO: 2450), UACguaacug (SEQ ID NO: 2451), UACguaagaa (SEQ ID NO: 2452), UACguaagau (SEQ ID NO: 2453), UACguaagua (SEQ ID NO: 2454), UACguaagug (SEQ ID NO: 2455), UACguauccu (SEQ ID NO: 2456), UACgucuggc (SEQ ID NO: 2457), UACgugacca (SEQ ID NO: 2458), UAGgcaagac (SEQ ID NO: 2459), UAGgcaaguc (SEQ ID NO: 2460), UAGgcagguc (SEQ ID NO: 2461), UAGgcgugug (SEQ ID NO: 2462), UAGguaaaaa (SEQ ID NO: 2463), UAGguaaaac (SEQ ID NO: 2464), UAGguaaaag (SEQ ID NO: 2465), UAGguaaaau (SEQ ID NO: 2466), UAGguaaaca (SEQ ID NO: 2467), UAGguaaaga (SEQ ID NO: 2468), UAGguaaaua (SEQ ID NO: 2469), UAGguaaauc (SEQ ID NO: 2470), UAGguaaaug (SEQ ID NO: 2471), UAGguaaauu (SEQ ID NO: 2472), UAGguaacac (SEQ ID NO: 2473), UAGguaacag (SEQ ID NO: 2474), UAGguaacau (SEQ ID NO: 2475), UAGguaacca (SEQ ID NO: 2476), UAGguaacgg (SEQ ID NO: 2477), UAGguaacua (SEQ ID NO: 2478), UAGguaacuc (SEQ ID NO: 2479), UAGguaacug (SEQ ID NO: 2480), UAGguaacuu (SEQ ID NO: 2481), UAGguaagac (SEQ ID NO: 2482), UAGguaagag (SEQ ID NO: 2483), UAGguaagau (SEQ ID NO: 2484), UAGguaagca (SEQ ID NO: 2485), UAGguaagcc (SEQ ID NO: 2486), UAGguaagcu (SEQ ID NO: 2487), UAGguaagga (SEQ ID NO: 2488), UAGguaaggc (SEQ ID NO: 2489), UAGguaaggg (SEQ ID NO: 2490), UAGguaagua (SEQ ID NO: 2491), UAGguaaguc (SEQ ID NO: 2492), UAGguaagug (SEQ ID NO: 2493), UAGguaaguu (SEQ ID NO: 2494), UAGguaauag (SEQ ID NO: 2495), UAGguaauau (SEQ ID NO: 2496), UAGguaaucu (SEQ ID NO: 2497), UAGguaauga (SEQ ID NO: 2498), UAGguaaugg (SEQ ID NO: 2499), UAGguaaugu (SEQ ID NO: 2500), UAGguaauua (SEQ ID NO: 2501), UAGguaauuc (SEQ ID NO: 2502), UAGguaauuu (SEQ ID NO: 2503), UAGguacagc (SEQ ID NO: 2504), UAGguacagu (SEQ ID NO: 2505), UAGguacauu (SEQ ID NO: 2506), UAGguaccag (SEQ ID NO: 2507), UAGguaccua (SEQ ID NO: 2508), UAGguaccuu (SEQ ID NO: 2509), UAGguacgag (SEQ ID NO: 2510), UAGguacgua (SEQ ID NO: 2511), UAGguacguu (SEQ ID NO: 2512), UAGguacuau (SEQ ID NO: 2513), UAGguacuga (SEQ ID NO: 2514), UAGguacugg (SEQ ID NO: 2515), UAGguacuuc (SEQ ID NO: 2516), UAGguacuuu (SEQ ID NO: 2517), UAGguagcgg (SEQ ID NO: 2518), UAGguaggaa (SEQ ID NO: 2519), UAGguaggac (SEQ ID NO: 2520), UAGguaggau (SEQ ID NO: 2521), UAGguaggga (SEQ ID NO: 2522), UAGguagggg (SEQ ID NO: 2523), UAGguaggua (SEQ ID NO: 2524), UAGguagguc (SEQ ID NO: 2525), UAGguaggug (SEQ ID NO: 2526), UAGguagguu (SEQ ID NO: 2527), UAGguaguaa (SEQ ID NO: 2528), UAGguagucu (SEQ ID NO: 2529), UAGguagugg (SEQ ID NO: 2530), UAGguagugu (SEQ ID NO: 2531), UAGguaguuu (SEQ ID NO: 2532), UAGguauaaa (SEQ ID NO: 2533), UAGguauaac (SEQ ID NO: 2534), UAGguauaag (SEQ ID NO: 2535), UAGguauaau (SEQ ID NO: 2536), UAGguauaca (SEQ ID NO: 2537), UAGguauacu (SEQ ID NO: 2538), UAGguauaua (SEQ ID NO: 2539), UAGguauauc (SEQ ID NO: 2540), UAGguauauu (SEQ ID NO: 2541), UAGguaucag (SEQ ID NO: 2542), UAGguaucua (SEQ ID NO: 2543), UAGguaucuc (SEQ ID NO: 2544), UAGguaugaa (SEQ ID NO: 2545), UAGguaugag (SEQ ID NO: 2546), UAGguaugca (SEQ ID NO: 2547), UAGguaugga (SEQ ID NO: 2548), UAGguauggc (SEQ ID NO: 2549), UAGguauggu (SEQ ID NO: 2550), UAGguaugua (SEQ ID NO: 2551), UAGguauguc (SEQ ID NO: 2552), UAGguaugug (SEQ ID NO: 2553), UAGguauguu (SEQ ID NO: 2554), UAGguauuaa (SEQ ID NO: 2555), UAGguauuac (SEQ ID NO: 2556), UAGguauuau (SEQ ID NO: 2557), UAGguauuca (SEQ ID NO: 2558), UAGguauucc (SEQ ID NO: 2559), UAGguauucu (SEQ ID NO: 2560), UAGguauuga (SEQ ID NO: 2561), UAGguauuua (SEQ ID NO: 2562), UAGguauuuc (SEQ ID NO: 2563), UAGguauuuu (SEQ ID NO: 2564), UAGgucacuc (SEQ ID NO: 2565), UAGgucagcu (SEQ ID NO: 2566), UAGgucaggu (SEQ ID NO: 2567), UAGgucagua (SEQ ID NO: 2568), UAGgucagug (SEQ ID NO: 2569), UAGgucaguu (SEQ ID NO: 2570), UAGgucaucu (SEQ ID NO: 2571), UAGgucauug (SEQ ID NO: 2572), UAGguccaau (SEQ ID NO: 2573), UAGguccugu (SEQ ID NO: 2574), UAGgucucaa (SEQ ID NO: 2575), UAGgucucgc (SEQ ID NO: 2576), UAGgucuggc (SEQ ID NO: 2577), UAGgucuguc (SEQ ID NO: 2578), UAGgucugug (SEQ ID NO: 2579), UAGgugaagu (SEQ ID NO: 2580), UAGgugaaua (SEQ ID NO: 2581), UAGgugaaug (SEQ ID NO: 2582), UAGgugaauu (SEQ ID NO: 2583), UAGgugacau (SEQ ID NO: 2584), UAGgugacca (SEQ ID NO: 2585), UAGgugacua (SEQ ID NO: 2586), UAGgugagaa (SEQ ID NO: 2587), UAGgugagac (SEQ ID NO: 2588), UAGgugagag (SEQ ID NO: 2589), UAGgugagau (SEQ ID NO: 2590), UAGgugagcc (SEQ ID NO: 2591), UAGgugagcu (SEQ ID NO: 2592), UAGgugagga (SEQ ID NO: 2593), UAGgugaggc (SEQ ID NO: 2594), UAGgugaggu (SEQ ID NO: 2595), UAGgugagua (SEQ ID NO: 2596), UAGgugaguc (SEQ ID NO: 2597), UAGgugagug (SEQ ID NO: 2598), UAGgugauca (SEQ ID NO: 2599), UAGgugauuc (SEQ ID NO: 2600), UAGgugauuu (SEQ ID NO: 2601), UAGgugcaua (SEQ ID NO: 2602), UAGgugcauc (SEQ ID NO: 2603), UAGgugccgu (SEQ ID NO: 2604), UAGgugccug (SEQ ID NO: 2605), UAGgugcgca (SEQ ID NO: 2606), UAGgugcgua (SEQ ID NO: 2607), UAGgugcgug (SEQ ID NO: 2608), UAGgugcuga (SEQ ID NO: 2609), UAGguggaua (SEQ ID NO: 2610), UAGgugggaa (SEQ ID NO: 2611), UAGgugggac (SEQ ID NO: 2612), UAGgugggag (SEQ ID NO: 2613), UAGgugggau (SEQ ID NO: 2614), UAGgugggcc (SEQ ID NO: 2615), UAGgugggcu (SEQ ID NO: 2616), UAGguggguu (SEQ ID NO: 2617), UAGguggugu (SEQ ID NO: 2618), UAGguguaaa (SEQ ID NO: 2619), UAGgugugaa (SEQ ID NO: 2620), UAGgugugag (SEQ ID NO: 2621), UAGgugugca (SEQ ID NO: 2622), UAGgugugcc (SEQ ID NO: 2623), UAGgugugcg (SEQ ID NO: 2624), UAGguguggu (SEQ ID NO: 2625), UAGgugugua (SEQ ID NO: 2626), UAGgugugug (SEQ ID NO: 2627), UAGguguugg (SEQ ID NO: 2628), UAGguuaagc (SEQ ID NO: 2629), UAGguuagac (SEQ ID NO: 2630), UAGguuagcc (SEQ ID NO: 2631), UAGguuaggc (SEQ ID NO: 2632), UAGguuagua (SEQ ID NO: 2633), UAGguuaguc (SEQ ID NO: 2634), UAGguuagug (SEQ ID NO: 2635), UAGguucccc (SEQ ID NO: 2636), UAGguucuac (SEQ ID NO: 2637), UAGguuggua (SEQ ID NO: 2638), UAGguugguu (SEQ ID NO: 2639), UAGguugucc (SEQ ID NO: 2640), UAGguuuauu (SEQ ID NO: 2641), UAGguuugcc (SEQ ID NO: 2642), UAGguuugua (SEQ ID NO: 2643), UAGguuuguc (SEQ ID NO: 2644), UAGguuugug (SEQ ID NO: 2645), UAGguuuguu (SEQ ID NO: 2646), UAGguuuuuc (SEQ ID NO: 2647), UAGguuuuug (SEQ ID NO: 2648), UAUguaagaa (SEQ ID NO: 2649), UAUguaagau (SEQ ID NO: 2650), UAUguaagca (SEQ ID NO: 2651), UAUguaagcc (SEQ ID NO: 2652), UAUguaagua (SEQ ID NO: 2653), UAUguaaguc (SEQ ID NO: 2654), UAUguaagug (SEQ ID NO: 2655), UAUguaaguu (SEQ ID NO: 2656), UAUguacgug (SEQ ID NO: 2657), UAUguacguu (SEQ ID NO: 2658), UAUguagguc (SEQ ID NO: 2659), UAUguagguu (SEQ ID NO: 2660), UAUguauccu (SEQ ID NO: 2661), UAUguaucuc (SEQ ID NO: 2662), UAUguaugua (SEQ ID NO: 2663), UAUguauguc (SEQ ID NO: 2664), UAUguaugug (SEQ ID NO: 2665), UAUguauuau (SEQ ID NO: 2666), UAUgucagaa (SEQ ID NO: 2667), UAUgucugua (SEQ ID NO: 2668), UAUgugaaua (SEQ ID NO: 2669), UAUgugacag (SEQ ID NO: 2670), UAUgugagua (SEQ ID NO: 2671), UAUgugagug (SEQ ID NO: 2672), UAUgugaguu (SEQ ID NO: 2673), UAUgugggca (SEQ ID NO: 2674), UAUgugugua (SEQ ID NO: 2675), UAUguguuua (SEQ ID NO: 2676), UAUguuuugu (SEQ ID NO: 2677), UCAgcgacau (SEQ ID NO: 2678), UCAguaaaau (SEQ ID NO: 2679), UCAguaaaua (SEQ ID NO: 2680), UCAguaacug (SEQ ID NO: 2681), UCAguaagaa (SEQ ID NO: 2682), UCAguaagag (SEQ ID NO: 2683), UCAguaagau (SEQ ID NO: 2684), UCAguaagca (SEQ ID NO: 2685), UCAguaagcc (SEQ ID NO: 2686), UCAguaagcu (SEQ ID NO: 2687), UCAguaaggg (SEQ ID NO: 2688), UCAguaagua (SEQ ID NO: 2689), UCAguaaguc (SEQ ID NO: 2690), UCAguaagug (SEQ ID NO: 2691), UCAguaaguu (SEQ ID NO: 2692), UCAguaucuu (SEQ ID NO: 2693), UCAguaugga (SEQ ID NO: 2694), UCAguauggu (SEQ ID NO: 2695), UCAgucccca (SEQ ID NO: 2696), UCAgugagca (SEQ ID NO: 2697), UCAgugagcu (SEQ ID NO: 2698), UCAgugagua (SEQ ID NO: 2699), UCAgugagug (SEQ ID NO: 2700), UCAgugaguu (SEQ ID NO: 2701), UCAgugauug (SEQ ID NO: 2702), UCAgugggug (SEQ ID NO: 2703), UCAguugagc (SEQ ID NO: 2704), UCAguugauu (SEQ ID NO: 2705), UCAguuuagu (SEQ ID NO: 2706), UCCguaagca (SEQ ID NO: 2707), UCCguaagcu (SEQ ID NO: 2708), UCCguaaguc (SEQ ID NO: 2709), UCCguaagug (SEQ ID NO: 2710), UCCguaauag (SEQ ID NO: 2711), UCCguacuua (SEQ ID NO: 2712), UCCguaugua (SEQ ID NO: 2713), UCCguauguu (SEQ ID NO: 2714), UCCgugagau (SEQ ID NO: 2715), UCCgugaguc (SEQ ID NO: 2716), UCGguaaauu (SEQ ID NO: 2717), UCGguaagag (SEQ ID NO: 2718), UCGguaagcu (SEQ ID NO: 2719), UCGguacauc (SEQ ID NO: 2720), UCGguacucc (SEQ ID NO: 2721), UCGguagacc (SEQ ID NO: 2722), UCGguagguu (SEQ ID NO: 2723), UCGguaguaa (SEQ ID NO: 2724), UCGguaugug (SEQ ID NO: 2725), UCGguauguu (SEQ ID NO: 2726), UCGguauuga (SEQ ID NO: 2727), UCGgucagua (SEQ ID NO: 2728), UCGgucuuag (SEQ ID NO: 2729), UCGgugaagu (SEQ ID NO: 2730), UCGgugagaa (SEQ ID NO: 2731), UCGgugagca (SEQ ID NO: 2732), UCGgugaggc (SEQ ID NO: 2733), UCGgugagua (SEQ ID NO: 2734), UCGgugcgcu (SEQ ID NO: 2735), UCGgugcuuu (SEQ ID NO: 2736), UCGgugguuu (SEQ ID NO: 2737), UCGguuagcu (SEQ ID NO: 2738), UCUguaaaag (SEQ ID NO: 2739), UCUguaagaa (SEQ ID NO: 2740), UCUguaagau (SEQ ID NO: 2741), UCUguaagca (SEQ ID NO: 2742), UCUguaagcu (SEQ ID NO: 2743), UCUguaagua (SEQ ID NO: 2744), UCUguaaguc (SEQ ID NO: 2745), UCUguaagug (SEQ ID NO: 2746), UCUguaaguu (SEQ ID NO: 2747), UCUguaauaa (SEQ ID NO: 2748), UCUguaauga (SEQ ID NO: 2749), UCUguaaugu (SEQ ID NO: 2750), UCUguaggua (SEQ ID NO: 2751), UCUguagguu (SEQ ID NO: 2752), UCUguauaua (SEQ ID NO: 2753), UCUguaugac (SEQ ID NO: 2754), UCUguaugua (SEQ ID NO: 2755), UCUguccueg (SEQ ID NO: 2756), UCUgugagag (SEQ ID NO: 2757), UCUgugagcu (SEQ ID NO: 2758), UCUgugagga (SEQ ID NO: 2759), UCUgugagua (SEQ ID NO: 2760), UCUgugaguc (SEQ ID NO: 2761), UCUgugagug (SEQ ID NO: 2762), UCUgugaguu (SEQ ID NO: 2763), UCUgugcgua (SEQ ID NO: 2764), UCUgugugag (SEQ ID NO: 2765), UGAguaacuu (SEQ ID NO: 2766), UGAguaagau (SEQ ID NO: 2767), UGAguaagca (SEQ ID NO: 2768), UGAguaagcu (SEQ ID NO: 2769), UGAguaaggc (SEQ ID NO: 2770), UGAguaaggu (SEQ ID NO: 2771), UGAguaagua (SEQ ID NO: 2772), UGAguaaguc (SEQ ID NO: 2773), UGAguaagug (SEQ ID NO: 2774), UGAguaaguu (SEQ ID NO: 2775), UGAguaaucc (SEQ ID NO: 2776), UGAguaauua (SEQ ID NO: 2777), UGAguacagu (SEQ ID NO: 2778), UGAguacgua (SEQ ID NO: 2779), UGAguacguu (SEQ ID NO: 2780), UGAguacugu (SEQ ID NO: 2781), UGAguagcug (SEQ ID NO: 2782), UGAguaggua (SEQ ID NO: 2783), UGAguauaaa (SEQ ID NO: 2784), UGAguaugcu (SEQ ID NO: 2785), UGAguaugga (SEQ ID NO: 2786), UGAguaugua (SEQ ID NO: 2787), UGAguauguc (SEQ ID NO: 2788), UGAguauguu (SEQ ID NO: 2789), UGAgucagag (SEQ ID NO: 2790), UGAgucuacg (SEQ ID NO: 2791), UGAgugaaua (SEQ ID NO: 2792), UGAgugaauu (SEQ ID NO: 2793), UGAgugagaa (SEQ ID NO: 2794), UGAgugagau (SEQ ID NO: 2795), UGAgugagca (SEQ ID NO: 2796), UGAgugagcc (SEQ ID NO: 2797), UGAgugagga (SEQ ID NO: 2798), UGAgugagua (SEQ ID NO: 2799), UGAgugagug (SEQ ID NO: 2800), UGAgugaguu (SEQ ID NO: 2801), UGAgugggaa (SEQ ID NO: 2802), UGAguuaaga (SEQ ID NO: 2803), UGAguuaaug (SEQ ID NO: 2804), UGAguuacgg (SEQ ID NO: 2805), UGAguuaggu (SEQ ID NO: 2806), UGAguucuau (SEQ ID NO: 2807), UGAguugguu (SEQ ID NO: 2808), UGAguuguag (SEQ ID NO: 2809), UGAguuuauc (SEQ ID NO: 2810), UGCguaaguc (SEQ ID NO: 2811), UGCguaagug (SEQ ID NO: 2812), UGCguacggc (SEQ ID NO: 2813), UGCguacggg (SEQ ID NO: 2814), UGCguaugua (SEQ ID NO: 2815), UGGgcaaguc (SEQ ID NO: 2816), UGGgcaagug (SEQ ID NO: 2817), UGGgcacauc (SEQ ID NO: 2818), UGGgccacgu (SEQ ID NO: 2819), UGGgccccgg (SEQ ID NO: 2820), UGGguaaaau (SEQ ID NO: 2821), UGGguaaagc (SEQ ID NO: 2822), UGGguaaagg (SEQ ID NO: 2823), UGGguaaagu (SEQ ID NO: 2824), UGGguaaaua (SEQ ID NO: 2825), UGGguaaaug (SEQ ID NO: 2826), UGGguaaauu (SEQ ID NO: 2827), UGGguaacag (SEQ ID NO: 2828), UGGguaacau (SEQ ID NO: 2829), UGGguaacua (SEQ ID NO: 2830), UGGguaacuu (SEQ ID NO: 2831), UGGguaagaa (SEQ ID NO: 2832), UGGguaagac (SEQ ID NO: 2833), UGGguaagag (SEQ ID NO: 2834), UGGguaagau (SEQ ID NO: 2835), UGGguaagca (SEQ ID NO: 2836), UGGguaagcc (SEQ ID NO: 2837), UGGguaagcu (SEQ ID NO: 2838), UGGguaaggg (SEQ ID NO: 2839), UGGguaaggu (SEQ ID NO: 2840), UGGguaagua (SEQ ID NO: 2841), UGGguaaguc (SEQ ID NO: 2842), UGGguaagug (SEQ ID NO: 2843), UGGguaaguu (SEQ ID NO: 2844), UGGguaaugu (SEQ ID NO: 2845), UGGguaauua (SEQ ID NO: 2846), UGGguaauuu (SEQ ID NO: 2847), UGGguacaaa (SEQ ID NO: 2848), UGGguacagu (SEQ ID NO: 2849), UGGguacuac (SEQ ID NO: 2850), UGGguaggga (SEQ ID NO: 2851), UGGguagguc (SEQ ID NO: 2852), UGGguaggug (SEQ ID NO: 2853), UGGguagguu (SEQ ID NO: 2854), UGGguaguua (SEQ ID NO: 2855), UGGguauagu (SEQ ID NO: 2856), UGGguaugaa (SEQ ID NO: 2857), UGGguaugac (SEQ ID NO: 2858), UGGguaugag (SEQ ID NO: 2859), UGGguaugua (SEQ ID NO: 2860), UGGguauguc (SEQ ID NO: 2861), UGGguaugug (SEQ ID NO: 2862), UGGguauguu (SEQ ID NO: 2863), UGGguauuug (SEQ ID NO: 2864), UGGgucuuug (SEQ ID NO: 2865), UGGgugaccu (SEQ ID NO: 2866), UGGgugacua (SEQ ID NO: 2867), UGGgugagac (SEQ ID NO: 2868), UGGgugagag (SEQ ID NO: 2869), UGGgugagca (SEQ ID NO: 2870), UGGgugagcc (SEQ ID NO: 2871), UGGgugagga (SEQ ID NO: 2872), UGGgugaggc (SEQ ID NO: 2873), UGGgugaggg (SEQ ID NO: 2874), UGGgugagua (SEQ ID NO: 2875), UGGgugaguc (SEQ ID NO: 2876), UGGgugagug (SEQ ID NO: 2877), UGGgugaguu (SEQ ID NO: 2878), UGGgugcgug (SEQ ID NO: 2879), UGGguggagg (SEQ ID NO: 2880), UGGguggcuu (SEQ ID NO: 2881), UGGguggggg (SEQ ID NO: 2882), UGGgugggua (SEQ ID NO: 2883), UGGguggguc (SEQ ID NO: 2884), UGGgugggug (SEQ ID NO: 2885), UGGguggguu (SEQ ID NO: 2886), UGGgugugga (SEQ ID NO: 2887), UGGguguguc (SEQ ID NO: 2888), UGGgugugug (SEQ ID NO: 2889), UGGguguguu (SEQ ID NO: 2890), UGGguguuua (SEQ ID NO: 2891), UGGguuaaug (SEQ ID NO: 2892), UGGguuaguc (SEQ ID NO: 2893), UGGguuagug (SEQ ID NO: 2894), UGGguuaguu (SEQ ID NO: 2895), UGGguucaag (SEQ ID NO: 2896), UGGguucgua (SEQ ID NO: 2897), UGGguuggug (SEQ ID NO: 2898), UGGguuuaag (SEQ ID NO: 2899), UGGguuugua (SEQ ID NO: 2900), UGUgcaagua (SEQ ID NO: 2901), UGUguaaaua (SEQ ID NO: 2902), UGUguaagaa (SEQ ID NO: 2903), UGUguaagac (SEQ ID NO: 2904), UGUguaagag (SEQ ID NO: 2905), UGUguaaggu (SEQ ID NO: 2906), UGUguaagua (SEQ ID NO: 2907), UGUguaaguc (SEQ ID NO: 2908), UGUguaaguu (SEQ ID NO: 2909), UGUguacuuc (SEQ ID NO: 2910), UGUguaggeg (SEQ ID NO: 2911), UGUguaggua (SEQ ID NO: 2912), UGUguaguua (SEQ ID NO: 2913), UGUguaugug (SEQ ID NO: 2914), UGUgucagua (SEQ ID NO: 2915), UGUgucugua (SEQ ID NO: 2916), UGUgucuguc (SEQ ID NO: 2917), UGUgugaccc (SEQ ID NO: 2918), UGUgugagau (SEQ ID NO: 2919), UGUgugagca (SEQ ID NO: 2920), UGUgugagcc (SEQ ID NO: 2921), UGUgugagua (SEQ ID NO: 2922), UGUgugaguc (SEQ ID NO: 2923), UGUgugagug (SEQ ID NO: 2924), UGUgugcgug (SEQ ID NO: 2925), UGUgugggug (SEQ ID NO: 2926), UGUguggguu (SEQ ID NO: 2927), UGUgugugag (SEQ ID NO: 2928), UGUguguucu (SEQ ID NO: 2929), UGUguuuaga (SEQ ID NO: 2930), UUAguaaaua (SEQ ID NO: 2931), UUAguaagaa (SEQ ID NO: 2932), UUAguaagua (SEQ ID NO: 2933), UUAguaagug (SEQ ID NO: 2934), UUAguaaguu (SEQ ID NO: 2935), UUAguaggug (SEQ ID NO: 2936), UUAgugagca (SEQ ID NO: 2937), UUAgugaguu (SEQ ID NO: 2938), UUAguuaagu (SEQ ID NO: 2939), UUCguaaguc (SEQ ID NO: 2940), UUCguaaguu (SEQ ID NO: 2941), UUCguaauua (SEQ ID NO: 2942), UUCgugagua (SEQ ID NO: 2943), UUCgugaguu (SEQ ID NO: 2944), UUGgcaagug (SEQ ID NO: 2945), UUGgccgagu (SEQ ID NO: 2946), UUGguaaaaa (SEQ ID NO: 2947), UUGguaaaau (SEQ ID NO: 2948), UUGguaaaga (SEQ ID NO: 2949), UUGguaaagg (SEQ ID NO: 2950), UUGguaaagu (SEQ ID NO: 2951), UUGguaaauc (SEQ ID NO: 2952), UUGguaaaug (SEQ ID NO: 2953), UUGguaaauu (SEQ ID NO: 2954), UUGguaacug (SEQ ID NO: 2955), UUGguaacuu (SEQ ID NO: 2956), UUGguaagaa (SEQ ID NO: 2957), UUGguaagag (SEQ ID NO: 2958), UUGguaagcu (SEQ ID NO: 2959), UUGguaagga (SEQ ID NO: 2960), UUGguaaggg (SEQ ID NO: 2961), UUGguaagua (SEQ ID NO: 2962), UUGguaagug (SEQ ID NO: 2963), UUGguaaguu (SEQ ID NO: 2964), UUGguaauac (SEQ ID NO: 2965), UUGguaauca (SEQ ID NO: 2966), UUGguaaugc (SEQ ID NO: 2967), UUGguaaugu (SEQ ID NO: 2968), UUGguaauug (SEQ ID NO: 2969), UUGguaauuu (SEQ ID NO: 2970), UUGguacaua (SEQ ID NO: 2971), UUGguacgug (SEQ ID NO: 2972), UUGguagagg (SEQ ID NO: 2973), UUGguaggac (SEQ ID NO: 2974), UUGguaggcg (SEQ ID NO: 2975), UUGguaggcu (SEQ ID NO: 2976), UUGguaggga (SEQ ID NO: 2977), UUGguaggua (SEQ ID NO: 2978), UUGguagguc (SEQ ID NO: 2979), UUGguaggug (SEQ ID NO: 2980), UUGguauaaa (SEQ ID NO: 2981), UUGguauaca (SEQ ID NO: 2982), UUGguauauu (SEQ ID NO: 2983), UUGguaucua (SEQ ID NO: 2984), UUGguaucuc (SEQ ID NO: 2985), UUGguaugca (SEQ ID NO: 2986), UUGguaugua (SEQ ID NO: 2987), UUGguaugug (SEQ ID NO: 2988), UUGguauguu (SEQ ID NO: 2989), UUGguauugu (SEQ ID NO: 2990), UUGguauuua (SEQ ID NO: 2991), UUGguauuuu (SEQ ID NO: 2992), UUGgucagaa (SEQ ID NO: 2993), UUGgucagua (SEQ ID NO: 2994), UUGgucucug (SEQ ID NO: 2995), UUGgucugca (SEQ ID NO: 2996), UUGgugaaaa (SEQ ID NO: 2997), UUGgugacug (SEQ ID NO: 2998), UUGgugagac (SEQ ID NO: 2999), UUGgugagau (SEQ ID NO: 3000), UUGgugagca (SEQ ID NO: 3001), UUGgugagga (SEQ ID NO: 3002), UUGgugaggg (SEQ ID NO: 3003), UUGgugagua (SEQ ID NO: 3004), UUGgugaguc (SEQ ID NO: 3005), UUGgugagug (SEQ ID NO: 3006), UUGgugaguu (SEQ ID NO: 3007), UUGgugaugg (SEQ ID NO: 3008), UUGgugauua (SEQ ID NO: 3009), UUGgugauug (SEQ ID NO: 3010), UUGgugcaca (SEQ ID NO: 3011), UUGgugggaa (SEQ ID NO: 3012), UUGguggggc (SEQ ID NO: 3013), UUGgugggua (SEQ ID NO: 3014), UUGguggguc (SEQ ID NO: 3015), UUGgugggug (SEQ ID NO: 3016), UUGguggguu (SEQ ID NO: 3017), UUGguguggu (SEQ ID NO: 3018), UUGguguguc (SEQ ID NO: 3019), UUGgugugug (SEQ ID NO: 3020), UUGguguguu (SEQ ID NO: 3021), UUGguuaagu (SEQ ID NO: 3022), UUGguuagca (SEQ ID NO: 3023), UUGguuagug (SEQ ID NO: 3024), UUGguuaguu (SEQ ID NO: 3025), UUGguuggga (SEQ ID NO: 3026), UUGguugguu (SEQ ID NO: 3027), UUGguuugua (SEQ ID NO: 3028), UUGguuuguc (SEQ ID NO: 3029), UUUgcaagug (SEQ ID NO: 3030), UUUguaaaua (SEQ ID NO: 3031), UUUguaaaug (SEQ ID NO: 3032), UUUguaagaa (SEQ ID NO: 3033), UUUguaagac (SEQ ID NO: 3034), UUUguaagag (SEQ ID NO: 3035), UUUguaagca (SEQ ID NO: 3036), UUUguaaggu (SEQ ID NO: 3037), UUUguaagua (SEQ ID NO: 3038), UUUguaaguc (SEQ ID NO: 3039), UUUguaagug (SEQ ID NO: 3040), UUUguaaguu (SEQ ID NO: 3041), UUUguaauuu (SEQ ID NO: 3042), UUUguacagg (SEQ ID NO: 3043), UUUguacgug (SEQ ID NO: 3044), UUUguacuag (SEQ ID NO: 3045), UUUguacugu (SEQ ID NO: 3046), UUUguagguu (SEQ ID NO: 3047), UUUguauccu (SEQ ID NO: 3048), UUUguauguu (SEQ ID NO: 3049), UUUgugagca (SEQ ID NO: 3050), UUUgugagug (SEQ ID NO: 3051), UUUgugcguc (SEQ ID NO: 3052), UUUguguguc (SEQ ID NO: 3053), and uGGguaccug (SEQ ID NO: 3054).


Additional exemplary gene sequences and splice site sequences (e.g., 5′ splice site sequences) include AAGgcaagau (SEQ ID NO: 96), AUGguaugug (SEQ ID NO: 937), GGGgugaggc (SEQ ID NO: 2281), CAGguaggug (SEQ ID NO: 1222), AAGgucagua (SEQ ID NO: 293), AAGguuagag (SEQ ID NO: 3055), AUGgcacuua (SEQ ID NO: 3056), UAAguaaguc (SEQ ID NO: 2423), UGGgugagcu (SEQ ID NO: 3057), CGAgcugggc (SEQ ID NO: 3058), AAAgcacccc (SEQ ID NO: 3059), UAGguggggg (SEQ ID NO: 3060), AGAguaacgu (SEQ ID NO: 3061), UCGgugaugu (SEQ ID NO: 3062), AAUgucaguu (SEQ ID NO: 516), AGGgucugag (SEQ ID NO: 3063), GAGgugacug (SEQ ID NO: 3064), AUGguagguu (SEQ ID NO: 3065), GAGgucuguc (SEQ ID NO: 2000), CAGguaugug (SEQ ID NO: 1260), CAAguacugc (SEQ ID NO: 3066), CACgugcgua (SEQ ID NO: 3067), CCGgugagcu (SEQ ID NO: 3068), CAGguacuuc (SEQ ID NO: 3069), CAGgcgagag (SEQ ID NO: 1115), GAAgcaagua (SEQ ID NO: 3070), AGGgugagca (SEQ ID NO: 789), CAGgcaaguc (SEQ ID NO: 3071), AAGgugaggc (SEQ ID NO: 344), CAGguaagua (SEQ ID NO: 1147), CCAguugggu (SEQ ID NO: 3072), AAGguguggg (SEQ ID NO: 3073), CAGguuggag (SEQ ID NO: 1484), CCGguaugaa (SEQ ID NO: 3074), UGGguaaugu (SEQ ID NO: 2845), CAGgugaggu (SEQ ID NO: 1344), AGAguaauag (SEQ ID NO: 3075), CAGguaugag (SEQ ID NO: 1249), AUGguaaguu (SEQ ID NO: 901), UUGguggguc (SEQ ID NO: 3015), UUUguaagca (SEQ ID NO: 3036), CUCguaugcc (SEQ ID NO: 3076), UAGguaagag (SEQ ID NO: 2483), UAGgcaaguu (SEQ ID NO: 3077), GGAguuaagu (SEQ ID NO: 3078), GAGguaugcc (SEQ ID NO: 1959), AAGguguggu (SEQ ID NO: 402), CAGgugggug (SEQ ID NO: 1415), UUAguaagua (SEQ ID NO: 2933), AAGguuggcu (SEQ ID NO: 3079), UGAguaugug (SEQ ID NO: 3080), CCAgccuucc (SEQ ID NO: 3081), CCUguacgug (SEQ ID NO: 3082), CCUguaggua (SEQ ID NO: 1601), CAGguacgcu (SEQ ID NO: 3083), GAGguucuuc (SEQ ID NO: 3084), AAGguugccu (SEQ ID NO: 3085), CGUguucacu (SEQ ID NO: 3086), CGGgugggga (SEQ ID NO: 3087), UAGgugggau (SEQ ID NO: 2614), CGGguaagga (SEQ ID NO: 3088), AAGguacuau (SEQ ID NO: 195), GGGguaagcu (SEQ ID NO: 2248), ACGguagagc (SEQ ID NO: 3089), CAGgugaaga (SEQ ID NO: 1318), GCGguaagag (SEQ ID NO: 3090), CAGguguugu (SEQ ID NO: 3091), GAAguuugug (SEQ ID NO: 3092), AUGgugagca (SEQ ID NO: 955), CGGguucgug (SEQ ID NO: 3093), AUUguccggc (SEQ ID NO: 3094), GAUgugugug (SEQ ID NO: 3095), AUGgucuguu (SEQ ID NO: 3096), AAGguaggau (SEQ ID NO: 219), CCGguaagau (SEQ ID NO: 1575), AAGguaaaga (SEQ ID NO: 126), GGGgugaguu (SEQ ID NO: 2285), AGGguuggug (SEQ ID NO: 808), GGAgugagug (SEQ ID NO: 2228), AGUguaagga (SEQ ID NO: 3097), UAGguaacug (SEQ ID NO: 2480), AAGgugaaga (SEQ ID NO: 3098), UGGguaagug (SEQ ID NO: 2843), CAGguaagag (SEQ ID NO: 1140), UAGgugagcg (SEQ ID NO: 3099), GAGguaaaaa (SEQ ID NO: 1865), GCCguaaguu (SEQ ID NO: 3100), AAGguuuugu (SEQ ID NO: 473), CAGgugagga (SEQ ID NO: 1341), ACAgcccaug (SEQ ID NO: 3101), GCGgugagcc (SEQ ID NO: 3102), CAGguaugca (SEQ ID NO: 1251), AUGguaccua (SEQ ID NO: 3103), CAAguaugua (SEQ ID NO: 1050), AUGgugguge (SEQ ID NO: 3104), UAAguggcag (SEQ ID NO: 3105), UAGguauagu (SEQ ID NO: 3106), CUGguauuua (SEQ ID NO: 3107), AGGguaaacg (SEQ ID NO: 3108), AUAguaagug (SEQ ID NO: 850), UUGguacuga (SEQ ID NO: 3109), GGUguaagcc (SEQ ID NO: 2303), GAGguggaua (SEQ ID NO: 3110), GAUguaagaa (SEQ ID NO: 3111), ACGgucaguu (SEQ ID NO: 3112), UAAguaaaca (SEQ ID NO: 3113), AAGguaucug (SEQ ID NO: 251), AGGguauuug (SEQ ID NO: 3114), AAGgugaaug (SEQ ID NO: 328), CUGgugaauu (SEQ ID NO: 1749), CAGguuuuuu (SEQ ID NO: 1514), CAUguaugug (SEQ ID NO: 1534), UUGguagagg (SEQ ID NO: 2973), AAGguaugcc (SEQ ID NO: 258), CAGgugccac (SEQ ID NO: 3115), UCGguauuga (SEQ ID NO: 2727), AAGguuugug (SEQ ID NO: 468), AAUguacagg (SEQ ID NO: 3116), CAUguggguu (SEQ ID NO: 1545), CAUgugaguu (SEQ ID NO: 1542), UUGguaaugu (SEQ ID NO: 2968), AGUguaggug (SEQ ID NO: 3117), GAGguaacuc (SEQ ID NO: 3118), GAGguggcgc (SEQ ID NO: 3119), CUGguaauug (SEQ ID NO: 3120), GAGguuugcu (SEQ ID NO: 3121), UGUguacgug (SEQ ID NO: 3122), UAGguaaaga (SEQ ID NO: 2468), CUAguaggca (SEQ ID NO: 3123), UCUgugaguc (SEQ ID NO: 2761), UCUguaaggc (SEQ ID NO: 3124), CAGguuugug (SEQ ID NO: 1509), GAGguagggc (SEQ ID NO: 1935), AAGguaacca (SEQ ID NO: 3125), ACUgugaguu (SEQ ID NO: 646), UAGguaauag (SEQ ID NO: 2495), AAAguaagcu (SEQ ID NO: 17), AUGgugagug (SEQ ID NO: 963), UAGguuugug (SEQ ID NO: 2645), AACguaggac (SEQ ID NO: 3126), GUAgcaggua (SEQ ID NO: 3127), GAGgucagac (SEQ ID NO: 3128), AGGguaugaa (SEQ ID NO: 3129), GAGguuagug (SEQ ID NO: 2089), CAGgcacgug (SEQ ID NO: 3130), GGGgcaagac (SEQ ID NO: 3131), CAGguguguc (SEQ ID NO: 1441), CAGguauuga (SEQ ID NO: 1265), CAGguauguc (SEQ ID NO: 1259), AAGgcaaggu (SEQ ID NO: 3132), UUGgugagaa (SEQ ID NO: 3133), AAGguaaaau (SEQ ID NO: 122), GGGguaagua (SEQ ID NO: 2251), AAGguaucuu (SEQ ID NO: 252), GACgugaguc (SEQ ID NO: 3134), UAUguaugcu (SEQ ID NO: 3135), AAGguacugu (SEQ ID NO: 199), CAGgugaacu (SEQ ID NO: 3136), CACguaaaug (SEQ ID NO: 3137), AAGgugugau (SEQ ID NO: 3138), GAAguauuug (SEQ ID NO: 3139), AAGgucugug (SEQ ID NO: 3140), AAGguggagg (SEQ ID NO: 3141), AAGguauaug (SEQ ID NO: 244), CAGguucuua (SEQ ID NO: 1477), AGGguaacca (SEQ ID NO: 730), CAGgugucac (SEQ ID NO: 1423), AAAguucugu (SEQ ID NO: 3142), UUGgugaguu (SEQ ID NO: 3007), CAAgugaguc (SEQ ID NO: 1067), UAGguagguc (SEQ ID NO: 2525), GCGgugagcu (SEQ ID NO: 2180), AUUgugagga (SEQ ID NO: 3143), CAGgugcaca (SEQ ID NO: 1361), CAGguuggaa (SEQ ID NO: 3144), CUGgucacuu (SEQ ID NO: 3145), GGAguaagug (SEQ ID NO: 2214), GAGgugggcu (SEQ ID NO: 2059), AAGguacuug (SEQ ID NO: 201), AGGguaggau (SEQ ID NO: 3146), AAUguguguu (SEQ ID NO: 3147), ACAguuaagu (SEQ ID NO: 568), GAGgugugug (SEQ ID NO: 2078), AAGgcgggcu (SEQ ID NO: 3148), AUAgcaagua (SEQ ID NO: 3149), AAGguuguua (SEQ ID NO: 454), CAAgcaaggc (SEQ ID NO: 3150), GUGguaauua (SEQ ID NO: 3151), UCUguucagu (SEQ ID NO: 3152), AGGguaggcc (SEQ ID NO: 754), AAGguaucau (SEQ ID NO: 3153), UAGguaccuu (SEQ ID NO: 2509), AAGguaugac (SEQ ID NO: 254), GGAguaggua (SEQ ID NO: 2219), UAAguuggca (SEQ ID NO: 3154), AGUgugagge (SEQ ID NO: 3155), GAGguuugug (SEQ ID NO: 3156), UGGgucugcu (SEQ ID NO: 3157), CAGgugaucc (SEQ ID NO: 1350), CAGgucagug (SEQ ID NO: 1283), AAGguaaggg (SEQ ID NO: 151), CAGgugcagu (SEQ ID NO: 3158), GAGguggguc (SEQ ID NO: 2064), GCUgugagug (SEQ ID NO: 2206), AAGguggagu (SEQ ID NO: 3159), GGGgucaguu (SEQ ID NO: 3160), AGCguaagug (SEQ ID NO: 719), AGAguaugaa (SEQ ID NO: 691), GGGguagggu (SEQ ID NO: 3161), AAGgccagca (SEQ ID NO: 3162), CGAguaugcc (SEQ ID NO: 3163), GUGgugageg (SEQ ID NO: 3164), AAUguaaauu (SEQ ID NO: 481), CAGgugcgca (SEQ ID NO: 1375), GGUguaugaa (SEQ ID NO: 3165), CUUgugaguu (SEQ ID NO: 1804), AAGguaucuc (SEQ ID NO: 250), AGAguaagga (SEQ ID NO: 665), UAGguaagac (SEQ ID NO: 2482), GAGgugagug (SEQ ID NO: 2026), CAGguguguu (SEQ ID NO: 1443), UUGgugagua (SEQ ID NO: 3004), AGGgcgaguu (SEQ ID NO: 3166), CAGguuuugc (SEQ ID NO: 3167), UUUgugaguu (SEQ ID NO: 3168), AGGguaagca (SEQ ID NO: 736), GAGguccucu (SEQ ID NO: 3169), CCAgcaggua (SEQ ID NO: 3170), GAGguucgcg (SEQ ID NO: 3171), CAGgugaucu (SEQ ID NO: 1351), ACUguaagua (SEQ ID NO: 625), AAGguaaauc (SEQ ID NO: 131), CAGgcaaaua (SEQ ID NO: 3172), GUGguaagca (SEQ ID NO: 2346), CAGguuaaau (SEQ ID NO: 3173), UUGguaauaa (SEQ ID NO: 3174), UAUguaggua (SEQ ID NO: 3175), CAGguaguau (SEQ ID NO: 1225), AAGgugugcc (SEQ ID NO: 3176), UGGguaagag (SEQ ID NO: 2834), CAGgcaagca (SEQ ID NO: 3177), UUGguaaggg (SEQ ID NO: 2961), AAGgcaggug (SEQ ID NO: 109), ACGguaaaug (SEQ ID NO: 3178), GCUgugagca (SEQ ID NO: 3179), AUGguacaca (SEQ ID NO: 3180), GUAguguguu (SEQ ID NO: 3181), ACUguaagag (SEQ ID NO: 3182), CCCgcagguc (SEQ ID NO: 3183), GAGgugagcc (SEQ ID NO: 2019), GAGgugcugu (SEQ ID NO: 3184), UAAguaugcu (SEQ ID NO: 3185), GAGgccaucu (SEQ ID NO: 3186), UCAgugagug (SEQ ID NO: 2700), CAGgugcuac (SEQ ID NO: 3187), AAUgugggug (SEQ ID NO: 533), GAGgugugaa (SEQ ID NO: 3188), CUGguagguc (SEQ ID NO: 1730), GUGgcgcgcg (SEQ ID NO: 3189), CAGgugcaaa (SEQ ID NO: 1359), UAAguggagg (SEQ ID NO: 3190), CAUgugggua (SEQ ID NO: 3191), GAGguagggu (SEQ ID NO: 3192), AAAgugaguu (SEQ ID NO: 61), AGGguucuag (SEQ ID NO: 3193), UGUgugagcu (SEQ ID NO: 3194), AGGgugaauc (SEQ ID NO: 3195), CAGgucaggg (SEQ ID NO: 3196), AAGgucccug (SEQ ID NO: 3197), CUGguagagu (SEQ ID NO: 3198), UAGgucaguu (SEQ ID NO: 2570), AAAguaaggg (SEQ ID NO: 19), CAAguaugug (SEQ ID NO: 1052), CAGgugcuuu (SEQ ID NO: 3199), AAGguaauuc (SEQ ID NO: 169), GGGgugcacg (SEQ ID NO: 3200), ACUgugcuac (SEQ ID NO: 3201), CAGguaccua (SEQ ID NO: 3202), CAGguagcuu (SEQ ID NO: 1211), UGGgugaggc (SEQ ID NO: 2873), CUGguacauu (SEQ ID NO: 1718), AGGguaaucu (SEQ ID NO: 3203), CAGguacaag (SEQ ID NO: 1161), CAGguaauuc (SEQ ID NO: 1157), AGGgcacuug (SEQ ID NO: 3204), UAGgugagaa (SEQ ID NO: 2587), GAGguaaugc (SEQ ID NO: 3205), CCAgugaguu (SEQ ID NO: 3206), AAAguaugug (SEQ ID NO: 44), CUGgugaauc (SEQ ID NO: 3207), UAUguaugua (SEQ ID NO: 2663), CCUgcaggug (SEQ ID NO: 3208), CAGguaucug (SEQ ID NO: 1245), GAGgugaggu (SEQ ID NO: 3209), CUGguaaaac (SEQ ID NO: 3210), UGUgugugcu (SEQ ID NO: 3211), CAGguuaagu (SEQ ID NO: 3212), CAGguaaucc (SEQ ID NO: 1152), UAGguauuug (SEQ ID NO: 3213), UGGguagguc (SEQ ID NO: 2852), CAGguaacag (SEQ ID NO: 1129), AGCgugcgug (SEQ ID NO: 3214), AAGgucagga (SEQ ID NO: 289), GGUgugagcc (SEQ ID NO: 2312), CUGguaagua (SEQ ID NO: 1707), GGGgugggca (SEQ ID NO: 3215), AAGgugggaa (SEQ ID NO: 376), CAGgugagug (SEQ ID NO: 1347), CUGguuguua (SEQ ID NO: 3216), CAGguaauag (SEQ ID NO: 3217), UAGgugaguu (SEQ ID NO: 3218), AGAguaaguu (SEQ ID NO: 671), UAGguaaucc (SEQ ID NO: 3219), CCGgugacug (SEQ ID NO: 3220), GUCgugauua (SEQ ID NO: 3221), CUUguaagug (SEQ ID NO: 1794), UAGguaguca (SEQ ID NO: 3222), CUGguaaguc (SEQ ID NO: 3223), AGGgugagcg (SEQ ID NO: 3224), CAGguaugga (SEQ ID NO: 1255), AUUgugacca (SEQ ID NO: 3225), GUUgugggua (SEQ ID NO: 2411), AAGguacaag (SEQ ID NO: 173), CUAgcaagug (SEQ ID NO: 3226), CUGgugagau (SEQ ID NO: 3227), CAGgugggca (SEQ ID NO: 1406), AUGgcucgag (SEQ ID NO: 3228), CUGguacguu (SEQ ID NO: 1720), UUGgugugua (SEQ ID NO: 3229), GAGgugucug (SEQ ID NO: 3230), GAGgugggac (SEQ ID NO: 3231), GGGgugggag (SEQ ID NO: 3232), GCAgcgugag (SEQ ID NO: 3233), GAGguaaaga (SEQ ID NO: 1870), GAGguaugua (SEQ ID NO: 1965), AAGgugagac (SEQ ID NO: 336), AAGguacaau (SEQ ID NO: 174), CUGguaugag (SEQ ID NO: 3234), AACguaaaau (SEQ ID NO: 3235), GUGguaggga (SEQ ID NO: 2364), CUGguaugug (SEQ ID NO: 1737), CUUguaagca (SEQ ID NO: 3236), AAGguaggga (SEQ ID NO: 223), AUUguaagcc (SEQ ID NO: 3237), AUGguaagcu (SEQ ID NO: 895), CAGgugaauu (SEQ ID NO: 1322), UAGgugaaua (SEQ ID NO: 2581), CAAguaugga (SEQ ID NO: 3238), AUGguauggc (SEQ ID NO: 936), GAGgucaugc (SEQ ID NO: 3239), CAGguacccu (SEQ ID NO: 1174), ACAgugagac (SEQ ID NO: 3240), CAGgucugau (SEQ ID NO: 3241), GAAguugggu (SEQ ID NO: 3242), CUGgugegug (SEQ ID NO: 1767), CAGguacgag (SEQ ID NO: 1180), ACAgugagcc (SEQ ID NO: 556), AAGguaagua (SEQ ID NO: 153), GGAguaaggc (SEQ ID NO: 3243), GAGgugugua (SEQ ID NO: 2077), AAGgucauuu (SEQ ID NO: 3244), CAGguagucu (SEQ ID NO: 3245), AUGguaucug (SEQ ID NO: 3246), AAGguaaacu (SEQ ID NO: 125), GAGguaggug (SEQ ID NO: 1938), CUGguaagca (SEQ ID NO: 1700), AGGguaagag (SEQ ID NO: 734), AAAguaaagc (SEQ ID NO: 3247), CAGguuugag (SEQ ID NO: 1502), GAGgcgggua (SEQ ID NO: 3248), CGAguacgau (SEQ ID NO: 3249), CAGguuguug (SEQ ID NO: 1495), AAAguauggg (SEQ ID NO: 3250), UAGgcugguc (SEQ ID NO: 3251), AAGguaagga (SEQ ID NO: 149), AAGguuuccu (SEQ ID NO: 458), UUGguaaaac (SEQ ID NO: 3252), GAGguaagua (SEQ ID NO: 1893), CAGguucaag (SEQ ID NO: 1465), UGGguuaugu (SEQ ID NO: 3253), GAGgugaguu (SEQ ID NO: 2027), ACGgugaaac (SEQ ID NO: 598), GAUguaacca (SEQ ID NO: 3254), AAGgugcggg (SEQ ID NO: 3255), CCGguacgug (SEQ ID NO: 3256), GAUgugagaa (SEQ ID NO: 3257), GUGgegguga (SEQ ID NO: 3258), CAGguauuag (SEQ ID NO: 3259), GAGguuggga (SEQ ID NO: 3260), AAGgcuagua (SEQ ID NO: 3261), AAGgugggcg (SEQ ID NO: 381), CAGgcaggga (SEQ ID NO: 3262), AAUguuaguu (SEQ ID NO: 3263), GAGguaaagg (SEQ ID NO: 3264), CAGgugugcu (SEQ ID NO: 1437), CUGguaugau (SEQ ID NO: 1733), AUGguuaguc (SEQ ID NO: 978), CUGgugagaa (SEQ ID NO: 1751), CAGgccggcg (SEQ ID NO: 3265), CAGgugacug (SEQ ID NO: 1332), AAAguaaggu (SEQ ID NO: 20), UAAguacuug (SEQ ID NO: 3266), AAGguaaagc (SEQ ID NO: 127), UCGguagggg (SEQ ID NO: 3267), CAGguaggaa (SEQ ID NO: 1212), AGUguaagca (SEQ ID NO: 817), CCCgugagau (SEQ ID NO: 3268), GUGguuguuu (SEQ ID NO: 3269), CAGguuugcc (SEQ ID NO: 1504), AGGguauggg (SEQ ID NO: 766), UAAguaagug (SEQ ID NO: 2424), GAGguaagac (SEQ ID NO: 3270), GAUguagguc (SEQ ID NO: 3271), CAAguaggug (SEQ ID NO: 1043), AUAguaaaua (SEQ ID NO: 845), GAGguugggg (SEQ ID NO: 3272), GAGgcgagua (SEQ ID NO: 3273), CAGguagugu (SEQ ID NO: 1229), GUGguaggug (SEQ ID NO: 2366), CAAgugagug (SEQ ID NO: 1068), AAGgugacaa (SEQ ID NO: 330), CCAgcguaau (SEQ ID NO: 3274), ACGgugaggu (SEQ ID NO: 3275), GGGguauauu (SEQ ID NO: 3276), CAGgugagua (SEQ ID NO: 1345), AAGgugcgug (SEQ ID NO: 364), UAUguaaauu (SEQ ID NO: 3277), CAGgucagua (SEQ ID NO: 1281), ACGguacuua (SEQ ID NO: 3278), GAGgucagca (SEQ ID NO: 3279), UAAguaugua (SEQ ID NO: 2431), GGGgucagac (SEQ ID NO: 3280), AAUgugugag (SEQ ID NO: 3281), UCCgucagua (SEQ ID NO: 3282), CAGgugcuuc (SEQ ID NO: 1391), CCAguuagug (SEQ ID NO: 3283), CCGgugggcg (SEQ ID NO: 1590), AGGgugcaug (SEQ ID NO: 3284), GGGguaggau (SEQ ID NO: 3285), UAGgugggcc (SEQ ID NO: 2615), GAGguguucg (SEQ ID NO: 3286), UUGgcaagaa (SEQ ID NO: 3287), UCCguaagua (SEQ ID NO: 3288), CAGguguaag (SEQ ID NO: 3289), CUCgugagua (SEQ ID NO: 1680), GAGguguuuu (SEQ ID NO: 3290), GAGgugagca (SEQ ID NO: 2018), GAGguaaagu (SEQ ID NO: 1872), AAGguacguu (SEQ ID NO: 193), CAGguccagu (SEQ ID NO: 1291), AUGgugaaac (SEQ ID NO: 947), GUAgugagcu (SEQ ID NO: 3291), CAGgugaaaa (SEQ ID NO: 3292), AGGguacagg (SEQ ID NO: 3293), AAGguaacgc (SEQ ID NO: 3294), AAGguauacc (SEQ ID NO: 3295), CCUgugagau (SEQ ID NO: 3296), GGGguacgug (SEQ ID NO: 3297), GAGguauggu (SEQ ID NO: 1964), UAGguauuau (SEQ ID NO: 2557), GAAguaggag (SEQ ID NO: 3298), UCGguaaggg (SEQ ID NO: 3299), CCGguaagcg (SEQ ID NO: 3300), GAAguaauua (SEQ ID NO: 1823), CAGgugaguc (SEQ ID NO: 1346), AAGgucaaga (SEQ ID NO: 279), AUGguaaguc (SEQ ID NO: 899), CAGgugagcu (SEQ ID NO: 1340), CCAguuuuug (SEQ ID NO: 3301), CAGgugggag (SEQ ID NO: 1404), AAGguauuau (SEQ ID NO: 270), AAGguaaaua (SEQ ID NO: 130), AAGgugcugu (SEQ ID NO: 3302), AAAguacacc (SEQ ID NO: 3303), CUGguucgug (SEQ ID NO: 1783), UCAguaaguc (SEQ ID NO: 2690), GAAguacgug (SEQ ID NO: 3304), CAGgugacaa (SEQ ID NO: 1323), UGGguaagaa (SEQ ID NO: 2832), UGUguagggg (SEQ ID NO: 3305), GAGguaggca (SEQ ID NO: 1932), UUGgugaggc (SEQ ID NO: 3306), AUGgugugua (SEQ ID NO: 974), CAGguccucc (SEQ ID NO: 3307), UUGguaaaug (SEQ ID NO: 2953), GCUgugaguu (SEQ ID NO: 2207), AUGgucugua (SEQ ID NO: 3308), CAUgcaggug (SEQ ID NO: 3309), CUGguacace (SEQ ID NO: 3310), CAGguccuua (SEQ ID NO: 3311), CAAguaaucu (SEQ ID NO: 1031), AUGgcagccu (SEQ ID NO: 3312), AAGgucagaa (SEQ ID NO: 282), AACgugaggc (SEQ ID NO: 3313), CAGgcacgca (SEQ ID NO: 1106), ACGguccagg (SEQ ID NO: 3314), UCUguacaua (SEQ ID NO: 3315), GAGgugauua (SEQ ID NO: 3316), ACGguaaaua (SEQ ID NO: 3317), AUGguaacug (SEQ ID NO: 3318), CAGgcgcguu (SEQ ID NO: 3319), CAGguauaga (SEQ ID NO: 1235), AAGguuuguu (SEQ ID NO: 3320), CAGguaugaa (SEQ ID NO: 1247), UAGguuggua (SEQ ID NO: 2638), CUGgugagac (SEQ ID NO: 1752), CAGguuagga (SEQ ID NO: 3321), AUGgugacug (SEQ ID NO: 3322), UUGguauccc (SEQ ID NO: 3323), CUUguaggac (SEQ ID NO: 3324), AAAguguguu (SEQ ID NO: 69), CAGguuucuu (SEQ ID NO: 1500), GGGguauggc (SEQ ID NO: 3325), GGGguaggac (SEQ ID NO: 3326), ACUguaaguc (SEQ ID NO: 626), AUCguaagcu (SEQ ID NO: 3327), UAGguucccc (SEQ ID NO: 2636), GGUgugagca (SEQ ID NO: 3328), CUGguuggua (SEQ ID NO: 3329), GGGguuaggg (SEQ ID NO: 3330), UGAguaagaa (SEQ ID NO: 3331), GAGguauucc (SEQ ID NO: 1969), UGGguuaguc (SEQ ID NO: 2893), CAGgcucgug (SEQ ID NO: 3332), UAGguagagu (SEQ ID NO: 3333), UAGgugcccu (SEQ ID NO: 3334), AAAgugagua (SEQ ID NO: 58), GAGguucaua (SEQ ID NO: 2094), UUGguaagag (SEQ ID NO: 2958), ACCgugugua (SEQ ID NO: 3335), UAUguaguau (SEQ ID NO: 3336), UGGguaauag (SEQ ID NO: 3337), CAGgucugaa (SEQ ID NO: 3338), AAAguauaaa (SEQ ID NO: 3339), GUGgugaguc (SEQ ID NO: 3340), AGUgugauua (SEQ ID NO: 3341), UUGgugugug (SEQ ID NO: 3020), CAGgugaugg (SEQ ID NO: 1353), GCUgugagua (SEQ ID NO: 2204), CAGguacaug (SEQ ID NO: 1169), AAGguacagu (SEQ ID NO: 178), GAAguuguag (SEQ ID NO: 3342), CAGgugauua (SEQ ID NO: 1355), UAGgugaauu (SEQ ID NO: 2583), GGUguuaaua (SEQ ID NO: 3343), CAGguauuua (SEQ ID NO: 1268), CAAguacucg (SEQ ID NO: 3344), CAAguaagaa (SEQ ID NO: 1022), AAGguaccuu (SEQ ID NO: 188), ACGgugaggg (SEQ ID NO: 3345), UGAgcaggca (SEQ ID NO: 3346), GGGgugaccg (SEQ ID NO: 3347), GAGguaaaug (SEQ ID NO: 1875), CGGguuugug (SEQ ID NO: 3348), AAGgugagcg (SEQ ID NO: 341), GUGguaugga (SEQ ID NO: 3349), CUGguaagga (SEQ ID NO: 1703), GAGguaccag (SEQ ID NO: 1911), CCGgugagug (SEQ ID NO: 1587), AAGguuagaa (SEQ ID NO: 416), GAGguacuug (SEQ ID NO: 1921), AGAguaaaac (SEQ ID NO: 651), UCUgugagua (SEQ ID NO: 2760), AAGgcgggaa (SEQ ID NO: 3350), CAGguaugcg (SEQ ID NO: 1253), AGGguaaaac (SEQ ID NO: 3351), AAGgugacug (SEQ ID NO: 333), AGGguauguu (SEQ ID NO: 3352), AAGguaugua (SEQ ID NO: 263), CAGgucucuc (SEQ ID NO: 1302), CAGgcaugua (SEQ ID NO: 3353), CUGguaggua (SEQ ID NO: 1729), AAGgucaugc (SEQ ID NO: 3354), CAGguacaca (SEQ ID NO: 1163), GAUguacguu (SEQ ID NO: 3355), ACAguacgug (SEQ ID NO: 3356), ACGguaccca (SEQ ID NO: 3357), CAGguagugc (SEQ ID NO: 3358), ACAguaagag (SEQ ID NO: 3359), GGUgcacacc (SEQ ID NO: 3360), GAGguguaac (SEQ ID NO: 3361), AAGgugugua (SEQ ID NO: 403), UAGguacuua (SEQ ID NO: 3362), GCGguacugc (SEQ ID NO: 3363), UGGguaaguc (SEQ ID NO: 2842), CAUguaggua (SEQ ID NO: 1529), CAGguaggau (SEQ ID NO: 3364), CAGgucuggc (SEQ ID NO: 3365), GUGguuuuaa (SEQ ID NO: 3366), CAGgugggaa (SEQ ID NO: 1402), UGGgugagua (SEQ ID NO: 2875), CGAgugagcc (SEQ ID NO: 3367), AAGguauggc (SEQ ID NO: 261), AGUguuguca (SEQ ID NO: 3368), CAGgugauuu (SEQ ID NO: 1358), UAGguaucuc (SEQ ID NO: 2544), UAAguauguu (SEQ ID NO: 3369), AAGguugagc (SEQ ID NO: 3370), AGAguaaaga (SEQ ID NO: 653), GGUguaagua (SEQ ID NO: 3371), GGGgugagcu (SEQ ID NO: 2279), CAGguauaau (SEQ ID NO: 3372), GAGguacaaa (SEQ ID NO: 1904), AUGguaccaa (SEQ ID NO: 3373), UAGguagggg (SEQ ID NO: 2523), UGAgucagaa (SEQ ID NO: 3374), AAGgcaauua (SEQ ID NO: 3375), UUGguaagau (SEQ ID NO: 3376), CAGguacaga (SEQ ID NO: 1165), AGAguuagag (SEQ ID NO: 3377), CAGgugcguc (SEQ ID NO: 1381), GAGguauuac (SEQ ID NO: 3378), ACGguacaga (SEQ ID NO: 3379), CAGgucuucc (SEQ ID NO: 1313), AAGguaaggu (SEQ ID NO: 152), GAGguaauuu (SEQ ID NO: 1903), AGUguaggcu (SEQ ID NO: 3380), AAAguaagcg (SEQ ID NO: 3381), CCUguaagcc (SEQ ID NO: 3382), AGGgugauuu (SEQ ID NO: 3383), UGUguaugaa (SEQ ID NO: 3384), CUGguacaca (SEQ ID NO: 3385), AGGguagaga (SEQ ID NO: 3386), AUAguaagca (SEQ ID NO: 848), AGAguaugua (SEQ ID NO: 3387), UUGgucagca (SEQ ID NO: 3388), CAGgcaaguu (SEQ ID NO: 1105), AAGguauaua (SEQ ID NO: 242), AAGgucugga (SEQ ID NO: 314), CAGguacgca (SEQ ID NO: 1181), AGGgugcggg (SEQ ID NO: 3389), AUGguaagug (SEQ ID NO: 900), AAAgugauga (SEQ ID NO: 3390), UGCgugagua (SEQ ID NO: 3391), AGAguaggga (SEQ ID NO: 684), UGUguaggua (SEQ ID NO: 2912), UAGguaggau (SEQ ID NO: 2521), UAAgugagug (SEQ ID NO: 2440), GCUguaagua (SEQ ID NO: 2193), GAAguaagaa (SEQ ID NO: 1814), UCGgugaggc (SEQ ID NO: 2733), UAGguauuuu (SEQ ID NO: 2564), AAGguacaca (SEQ ID NO: 3392), AAGguaggua (SEQ ID NO: 227), UGGguagguu (SEQ ID NO: 2854), ACAgcaagua (SEQ ID NO: 541), GAGguaggag (SEQ ID NO: 1931), UGGgugaguu (SEQ ID NO: 2878), GCGgugagau (SEQ ID NO: 3393), CCUguagguu (SEQ ID NO: 3394), CAGgugugua (SEQ ID NO: 1440), CUGguaagcc (SEQ ID NO: 1701), AAGgugauuc (SEQ ID NO: 3395), CAGguagcua (SEQ ID NO: 1208), GUUguaagug (SEQ ID NO: 3396), AUGguaagca (SEQ ID NO: 893), AUAguaggga (SEQ ID NO: 3397), GGGguucgcu (SEQ ID NO: 3398), CCGgucagag (SEQ ID NO: 3399), GUAguaugag (SEQ ID NO: 3400), CGUguaagau (SEQ ID NO: 3401), UGAguaggca (SEQ ID NO: 3402), UCAguaugua (SEQ ID NO: 3403), GAGguaucug (SEQ ID NO: 1954), AGAguauuuu (SEQ ID NO: 3404), AAGguuguag (SEQ ID NO: 3405), AGUguaaguu (SEQ ID NO: 821), CGGguaaguu (SEQ ID NO: 1626), UCGgugcgga (SEQ ID NO: 3406), UAGguaagua (SEQ ID NO: 2491), GAAguuagau (SEQ ID NO: 3407), GCUgugagac (SEQ ID NO: 3408), CAGgcaggua (SEQ ID NO: 3409), CAGguagggg (SEQ ID NO: 1218), UAAguuaaga (SEQ ID NO: 3410), AUGguggguu (SEQ ID NO: 970), UAGguaaguu (SEQ ID NO: 2494), CUGguaaauu (SEQ ID NO: 1690), CCGguaagga (SEQ ID NO: 1577), GAGgcaggca (SEQ ID NO: 3411), CAUguaagug (SEQ ID NO: 1523), AAGgugccua (SEQ ID NO: 3412), UUGguaggga (SEQ ID NO: 2977), AAGguaaaca (SEQ ID NO: 123), CGGgugugag (SEQ ID NO: 3413), GGGgugugag (SEQ ID NO: 3414), UCCguggguc (SEQ ID NO: 3415), ACGguaaauc (SEQ ID NO: 3416), UCAguaggua (SEQ ID NO: 3417), CAGgucagcc (SEQ ID NO: 1278), CAGgcggugg (SEQ ID NO: 3418), CGAguaagcu (SEQ ID NO: 3419), CCCgugagca (SEQ ID NO: 3420), AAAguaauga (SEQ ID NO: 3421), CUGguaagcu (SEQ ID NO: 1702), CGGguaacca (SEQ ID NO: 3422), CAGgucgcac (SEQ ID NO: 3423), GAGguaggcc (SEQ ID NO: 3424), UAGgugagcc (SEQ ID NO: 2591), UAGguaggca (SEQ ID NO: 3425), GCGgugcgug (SEQ ID NO: 3426), AUGgugagua (SEQ ID NO: 961), GGGgugaggg (SEQ ID NO: 2282), GAGgucacac (SEQ ID NO: 3427), CAGguaggcc (SEQ ID NO: 3428), CAAgugcuga (SEQ ID NO: 3429), GUCgucuuca (SEQ ID NO: 3430), CAUguaagaa (SEQ ID NO: 1518), GUAguaagga (SEQ ID NO: 3431), UAGguuugua (SEQ ID NO: 2643), CAAguuagag (SEQ ID NO: 3432), AAGguagagu (SEQ ID NO: 208), AAGgugagau (SEQ ID NO: 338), AAAguaggua (SEQ ID NO: 37), ACAgugaauc (SEQ ID NO: 3433), CAGgugugcg (SEQ ID NO: 1436), CAGgucggcc (SEQ ID NO: 1299), AAGguaguau (SEQ ID NO: 3434), ACUgucaguc (SEQ ID NO: 3435), UCUgcagccu (SEQ ID NO: 3436), CGAguaagug (SEQ ID NO: 3437), AGAguaauua (SEQ ID NO: 3438), AGUgugagug (SEQ ID NO: 837), CCGgugagcg (SEQ ID NO: 3439), AAGguaaccu (SEQ ID NO: 3440), AAGguugugg (SEQ ID NO: 3441), AAGgcauggg (SEQ ID NO: 3442), AAGgucagag (SEQ ID NO: 284), ACGguaaggu (SEQ ID NO: 3443), GGGgugagca (SEQ ID NO: 3444), GAGguugcuu (SEQ ID NO: 3445), AAGguaucgc (SEQ ID NO: 3446), CCGguaaagg (SEQ ID NO: 3447), AAAguuaaug (SEQ ID NO: 3448), UAGguacgag (SEQ ID NO: 2510), ACCguaauua (SEQ ID NO: 3449), GGGguaagga (SEQ ID NO: 2249), CCGguaacgc (SEQ ID NO: 3450), CAGgucagaa (SEQ ID NO: 1275), AAGguacuga (SEQ ID NO: 197), GAGgugacca (SEQ ID NO: 2010), GGGgugagcc (SEQ ID NO: 2277), AAGguacagg (SEQ ID NO: 177), AUGguaauua (SEQ ID NO: 3451), CAGgugagag (SEQ ID NO: 1335), AAGgugacuc (SEQ ID NO: 3452), AUAguaagua (SEQ ID NO: 849), GAGguaaacc (SEQ ID NO: 1869), CAGgugggau (SEQ ID NO: 1405), CAGgugagaa (SEQ ID NO: 1333), AGGguaaaaa (SEQ ID NO: 3453), GAGgugugac (SEQ ID NO: 3454), CACguaagcu (SEQ ID NO: 3455), CAGguccccc (SEQ ID NO: 3456), CAGgucaggu (SEQ ID NO: 3457), CGGguaaguc (SEQ ID NO: 3458), ACGguauggg (SEQ ID NO: 3459), GAUguaaguu (SEQ ID NO: 2123), CAAguaauau (SEQ ID NO: 3460), CAGguugggg (SEQ ID NO: 3461), CCUgugcugg (SEQ ID NO: 3462), AAGguaugau (SEQ ID NO: 256), AGGguagagg (SEQ ID NO: 3463), AAGguggguu (SEQ ID NO: 386), CAGgugugaa (SEQ ID NO: 1430), UUGguaugug (SEQ ID NO: 2988), UUGguaucuc (SEQ ID NO: 2985), GGGgugagug (SEQ ID NO: 2284), CUGgugugug (SEQ ID NO: 1779), AGGguagggc (SEQ ID NO: 3464), GUGgugagua (SEQ ID NO: 3465), CAGguaugua (SEQ ID NO: 1258), AAGguacauu (SEQ ID NO: 181), UUAguaagug (SEQ ID NO: 2934), AAUguauauc (SEQ ID NO: 3466), CUUguaagua (SEQ ID NO: 1793), GAGguuagua (SEQ ID NO: 2087), CAGguaaggu (SEQ ID NO: 1146), CAGguaaugu (SEQ ID NO: 1155), AGGgugaggc (SEQ ID NO: 3467), CAGguauuuc (SEQ ID NO: 1269), CAGgucugga (SEQ ID NO: 1307), GGGgugugcu (SEQ ID NO: 3468), UAGgugagug (SEQ ID NO: 2598), AAUguaaccu (SEQ ID NO: 3469), UAAgugaguc (SEQ ID NO: 2439), CAGgugcacu (SEQ ID NO: 3470), ACGguaagua (SEQ ID NO: 579), GAGguauccu (SEQ ID NO: 3471), UCUguaaguc (SEQ ID NO: 2745), CAGguauuca (SEQ ID NO: 1263), UGUguaagug (SEQ ID NO: 3472), CCAgcaaggc (SEQ ID NO: 3473), GAGgugaagg (SEQ ID NO: 2006), AAUguggggu (SEQ ID NO: 3474), UCGgugcgug (SEQ ID NO: 3475), UUGguaaggc (SEQ ID NO: 3476), GAGguaagug (SEQ ID NO: 3477), AAAguaagau (SEQ ID NO: 14), UAGgucuuuu (SEQ ID NO: 3478), GAGgucugau (SEQ ID NO: 3479), CCAguuagag (SEQ ID NO: 3480), UGGgugaaaa (SEQ ID NO: 3481), AGAguaagau (SEQ ID NO: 662), CAGguaauug (SEQ ID NO: 1158), CAGgccgguc (SEQ ID NO: 3482), CCGguaagag (SEQ ID NO: 3483), GAGgugagcu (SEQ ID NO: 2021), CUGguaagac (SEQ ID NO: 3484), CAGgugagau (SEQ ID NO: 1336), CUGguuuguu (SEQ ID NO: 3485), UGGguaggua (SEQ ID NO: 3486), CAGguuagug (SEQ ID NO: 1457), CAGguguucg (SEQ ID NO: 3487), CGGguagguc (SEQ ID NO: 3488), GUGguacaua (SEQ ID NO: 3489), AAGguacuaa (SEQ ID NO: 194), GAUgugagua (SEQ ID NO: 3490), UGUguaagac (SEQ ID NO: 2904), GAGguagccg (SEQ ID NO: 3491), UAGgugaucu (SEQ ID NO: 3492), CAGguacgug (SEQ ID NO: 1185), CUUgucaguc (SEQ ID NO: 3493), GAGguaucac (SEQ ID NO: 3494), GAGguaauga (SEQ ID NO: 3495), AAGguaacac (SEQ ID NO: 3496), CAGguaaagc (SEQ ID NO: 1123), AAGgcaagua (SEQ ID NO: 3497), CGCgugagcc (SEQ ID NO: 3498), AGUgugcguu (SEQ ID NO: 3499), GAUguaagca (SEQ ID NO: 2118), AAGguaauag (SEQ ID NO: 159), GGAgcaguug (SEQ ID NO: 3500), AGCguaagau (SEQ ID NO: 3501), AAGgucaggc (SEQ ID NO: 290), GAGguauuca (SEQ ID NO: 3502), AAUguaaagu (SEQ ID NO: 3503), CAGguaacaa (SEQ ID NO: 3504), UCGguaggug (SEQ ID NO: 3505), AAAguaaguc (SEQ ID NO: 22), CGGgugcagu (SEQ ID NO: 3506), GGUgugugca (SEQ ID NO: 3507), UGAgugagaa (SEQ ID NO: 2794), CACguguaag (SEQ ID NO: 3508), GUGguuggua (SEQ ID NO: 3509), GCAgccuuga (SEQ ID NO: 3510), CGAgugugau (SEQ ID NO: 3511), CAGguauaua (SEQ ID NO: 3512), UAUguaugug (SEQ ID NO: 2665), CCCgugguca (SEQ ID NO: 3513), AUGguaagac (SEQ ID NO: 890), GAGgugugga (SEQ ID NO: 2074), AGUguauccu (SEQ ID NO: 3514), UGAguguguc (SEQ ID NO: 3515), UGGguaaucu (SEQ ID NO: 3516), AUGgcagguu (SEQ ID NO: 3517), GAGguaagau (SEQ ID NO: 1884), UCAgcagcgu (SEQ ID NO: 3518), AAGgugggau (SEQ ID NO: 378), CGGgugcgcu (SEQ ID NO: 3519), CAGgugucug (SEQ ID NO: 1429), AGCgugguaa (SEQ ID NO: 3520), AAUgugaaug (SEQ ID NO: 3521), UCGgugagac (SEQ ID NO: 3522), UAGguaaagc (SEQ ID NO: 3523), CUGguaaaag (SEQ ID NO: 3524), CCGgugcgga (SEQ ID NO: 3525), CAGguacuca (SEQ ID NO: 3526), CAGguagcaa (SEQ ID NO: 1203), GAAguugagu (SEQ ID NO: 3527), GAGguggagg (SEQ ID NO: 2052), AGGguaugag (SEQ ID NO: 762), UAGguaugcu (SEQ ID NO: 3528), UAGgugagac (SEQ ID NO: 2588), CAGguaauua (SEQ ID NO: 1156), CGUguaagcc (SEQ ID NO: 3529), CUUguaaguu (SEQ ID NO: 1795), AAGguaacuu (SEQ ID NO: 140), UCGgcaaggc (SEQ ID NO: 3530), GAGguucucg (SEQ ID NO: 3531), GAGgugggcg (SEQ ID NO: 2058), AAGgcaugug (SEQ ID NO: 3532), CUGguauguu (SEQ ID NO: 1738), UAAgucauuu (SEQ ID NO: 3533), CAUguaauua (SEQ ID NO: 1525), AAUguaaaga (SEQ ID NO: 3534), UAGgugcuca (SEQ ID NO: 3535), AAGguaaugg (SEQ ID NO: 166), GAGguacuga (SEQ ID NO: 3536), UGGguaagua (SEQ ID NO: 2841), UGGguaaaaa (SEQ ID NO: 3537), AAGgugagcu (SEQ ID NO: 342), UACgugaguu (SEQ ID NO: 3538), AGGgugagcc (SEQ ID NO: 790), CGGgugagga (SEQ ID NO: 3539), UGGgugagag (SEQ ID NO: 2869), GGUguaagcu (SEQ ID NO: 3540), CGGguggguu (SEQ ID NO: 1648), CCAgcuaagu (SEQ ID NO: 3541), AAGguuuguc (SEQ ID NO: 467), GAGguuagac (SEQ ID NO: 2084), GAGguaccuc (SEQ ID NO: 3542), UUUguaaguu (SEQ ID NO: 3041), GAGguuagga (SEQ ID NO: 3543), CAGguaggga (SEQ ID NO: 1216), AGGguaauac (SEQ ID NO: 744), UGCgugugua (SEQ ID NO: 3544), CCAguaacca (SEQ ID NO: 3545), AGGgucuguc (SEQ ID NO: 3546), UGGguaugua (SEQ ID NO: 2860), GUGguaagcu (SEQ ID NO: 2348), CAGguaaccu (SEQ ID NO: 3547), AAGgugaguu (SEQ ID NO: 350), UAGguucgug (SEQ ID NO: 3548), AAAguuagua (SEQ ID NO: 3549), UGGgcaaguc (SEQ ID NO: 2816), AAGgcacagu (SEQ ID NO: 3550), GUUguaaguc (SEQ ID NO: 2401), AAGguuugcc (SEQ ID NO: 462), CUUgcauggg (SEQ ID NO: 3551), GCGgugagua (SEQ ID NO: 3552), GGGguaagcg (SEQ ID NO: 3553), GCCguaagaa (SEQ ID NO: 3554), GAGgucggga (SEQ ID NO: 3555), UUGguauugu (SEQ ID NO: 2990), AGUgugagac (SEQ ID NO: 3556), CUGgugggga (SEQ ID NO: 1770), AGAguaaggu (SEQ ID NO: 668), CCGguggguc (SEQ ID NO: 3557), CAGguauucu (SEQ ID NO: 1264), UGGguaacgu (SEQ ID NO: 3558), UUGgugagag (SEQ ID NO: 3559), UAGguacccu (SEQ ID NO: 3560), GGGgugcguc (SEQ ID NO: 3561), AAGgcaggag (SEQ ID NO: 3562), ACGguacauu (SEQ ID NO: 3563), GAGguaguua (SEQ ID NO: 1946), CAGguauggg (SEQ ID NO: 1256), UUUguguguc (SEQ ID NO: 3053), CAGguacuua (SEQ ID NO: 1194), AUGguauacu (SEQ ID NO: 3564), AGUgugagcc (SEQ ID NO: 833), ACAguaacga (SEQ ID NO: 3565), CUGguaccca (SEQ ID NO: 3566), CAGguaaccc (SEQ ID NO: 3567), GGAguaagua (SEQ ID NO: 3568), GAGgugggug (SEQ ID NO: 2065), ACUguauguc (SEQ ID NO: 3569), ACGgugagua (SEQ ID NO: 606), CUGguaaugu (SEQ ID NO: 3570), AAGguaucag (SEQ ID NO: 247), CAGgugcccc (SEQ ID NO: 1370), AGUgucagug (SEQ ID NO: 3571), AAGguaggag (SEQ ID NO: 218), GGAguaugug (SEQ ID NO: 3572), UUGguauuuu (SEQ ID NO: 2992), CCUguuguga (SEQ ID NO: 3573), UUUguaagaa (SEQ ID NO: 3033), UAGguaacau (SEQ ID NO: 2475), CAGguaagca (SEQ ID NO: 3574), CAGgucacag (SEQ ID NO: 3575), CAGgugugag (SEQ ID NO: 1432), UAGguuugcg (SEQ ID NO: 3576), CUGguaagaa (SEQ ID NO: 1697), ACGguuguau (SEQ ID NO: 3577), AAGguugggg (SEQ ID NO: 446), AAGgugaauu (SEQ ID NO: 329), GGGguuaguu (SEQ ID NO: 3578), ACGguaaggc (SEQ ID NO: 3579), CAGguuuaag (SEQ ID NO: 1496), CUGguaaguu (SEQ ID NO: 1709), GGGgugagag (SEQ ID NO: 3580), UGGguggguu (SEQ ID NO: 2886), GAGguuuguu (SEQ ID NO: 2111), UGGguaaaug (SEQ ID NO: 2826), CAGgcaggcc (SEQ ID NO: 3581), CACgugcagg (SEQ ID NO: 3582), AAGgugagcc (SEQ ID NO: 340), CAAguaagug (SEQ ID NO: 1028), CAGgucaguc (SEQ ID NO: 1282), GCGguauaau (SEQ ID NO: 3583), UAGguaaagu (SEQ ID NO: 3584), UAGguggauu (SEQ ID NO: 3585), GAGgucugga (SEQ ID NO: 3586), UCGgucaguu (SEQ ID NO: 3587), UGGguaacug (SEQ ID NO: 3588), AAGguuugau (SEQ ID NO: 3589), UGUgcuggug (SEQ ID NO: 3590), UGUguaccuc (SEQ ID NO: 3591), UGGguacagu (SEQ ID NO: 2849), AUCgucagcg (SEQ ID NO: 3592), CAGgucuugg (SEQ ID NO: 3593), GAAguuggua (SEQ ID NO: 3594), GAAguaaaga (SEQ ID NO: 3595), UUGguaagcu (SEQ ID NO: 2959), UAGguaccag (SEQ ID NO: 2507), AGGguaucau (SEQ ID NO: 3596), CAGguaaaaa (SEQ ID NO: 1118), ACGguaauuu (SEQ ID NO: 583), AUUguaaguu (SEQ ID NO: 997), GAGguacagu (SEQ ID NO: 1908), CAGgugaaag (SEQ ID NO: 1315), UGGguuguuu (SEQ ID NO: 3597), GGGguaggug (SEQ ID NO: 2259), CAGgugccca (SEQ ID NO: 1369), AGCgugagau (SEQ ID NO: 3598), CCAgugagug (SEQ ID NO: 1565), AGGguagaug (SEQ ID NO: 3599), UGGguguguc (SEQ ID NO: 2888), AUCgcgugag (SEQ ID NO: 3600), AGGguaagcc (SEQ ID NO: 3601), AGGguagcag (SEQ ID NO: 3602), UUCguuuccg (SEQ ID NO: 3603), AAGguaagcg (SEQ ID NO: 147), UGGguaagcc (SEQ ID NO: 2837), CAGguauggc (SEQ ID NO: 3604), UGUguaagua (SEQ ID NO: 2907), AAGguagaga (SEQ ID NO: 3605), ACGguaauaa (SEQ ID NO: 3606), CUGguacggu (SEQ ID NO: 3607), GAGgucacag (SEQ ID NO: 3608), UAUguaaguu (SEQ ID NO: 2656), CUGguacgcc (SEQ ID NO: 3609), CAAguaagau (SEQ ID NO: 1024), CUAgugagua (SEQ ID NO: 1673), CCGguaaccg (SEQ ID NO: 3610), CUUguaaguc (SEQ ID NO: 3611), GUGgugagaa (SEQ ID NO: 2378), ACCguaugua (SEQ ID NO: 3612), GUAguaagug (SEQ ID NO: 2324), UUGgugggua (SEQ ID NO: 3014), CGGguacuuu (SEQ ID NO: 3613), UGGguaaaua (SEQ ID NO: 2825), AGAgugagua (SEQ ID NO: 704), AAGguagguu (SEQ ID NO: 230), AAGguaugcg (SEQ ID NO: 3614), CCUguaggcu (SEQ ID NO: 3615), ACAguagaaa (SEQ ID NO: 3616), CCGguuagua (SEQ ID NO: 3617), CGGguaggcg (SEQ ID NO: 3618), GCAgugagug (SEQ ID NO: 2162), GAGgugaguc (SEQ ID NO: 3619), CUGguagccu (SEQ ID NO: 3620), CAUguaugua (SEQ ID NO: 1533), GAAguaacuu (SEQ ID NO: 3621), GAAguaagau (SEQ ID NO: 3622), AAGguuagau (SEQ ID NO: 417), AAGguaauca (SEQ ID NO: 161), AAUguaugua (SEQ ID NO: 507), UGAguaagau (SEQ ID NO: 2767), AGAgugagca (SEQ ID NO: 703), GUAguucuau (SEQ ID NO: 3623), GAGguaauca (SEQ ID NO: 1898), UAGguaugga (SEQ ID NO: 2548), UAGgugggac (SEQ ID NO: 2612), GAGguacaug (SEQ ID NO: 3624), UGGguaaggc (SEQ ID NO: 3625), CAGguacgcc (SEQ ID NO: 1182), CCAguuacgc (SEQ ID NO: 3626), ACUgugguga (SEQ ID NO: 3627), GAGguaaguc (SEQ ID NO: 1894), AUUguaggug (SEQ ID NO: 3628), ACCgucagug (SEQ ID NO: 3629), AAUgugaggg (SEQ ID NO: 3630), ACUgugagug (SEQ ID NO: 645), UGGguguggu (SEQ ID NO: 3631), AAGguuggga (SEQ ID NO: 445), AAGguuugga (SEQ ID NO: 464), UCCgugagug (SEQ ID NO: 3632), CGGgugagug (SEQ ID NO: 1642), AGAguaagcu (SEQ ID NO: 664), CAGgcaagcu (SEQ ID NO: 3633), UAGguauauu (SEQ ID NO: 2541), AAAguagcag (SEQ ID NO: 3634), GAGguaaccu (SEQ ID NO: 1880), AAGgugggca (SEQ ID NO: 379), AGGgugagua (SEQ ID NO: 795), UGGguaaggu (SEQ ID NO: 2840), CUUgucagug (SEQ ID NO: 3635), UAGgugcgcu (SEQ ID NO: 3636), GAGgcaaauu (SEQ ID NO: 3637), AGGguaccuc (SEQ ID NO: 3638), CAAgugcgua (SEQ ID NO: 3639), AGAguaagac (SEQ ID NO: 660), GUGguaaaua (SEQ ID NO: 3640), GAUguaagcg (SEQ ID NO: 3641), GAGguaaagc (SEQ ID NO: 1871), UAGgugagua (SEQ ID NO: 2596), CAGguaacau (SEQ ID NO: 1130), CCUguacggc (SEQ ID NO: 3642), UAGguauguc (SEQ ID NO: 2552), UAGguccaua (SEQ ID NO: 3643), GAGgugaaaa (SEQ ID NO: 2003), AAAguacuga (SEQ ID NO: 3644), UUGguaagcg (SEQ ID NO: 3645), CAGgcaagcg (SEQ ID NO: 3646), UUUgcagguu (SEQ ID NO: 3647), CAGguuuaua (SEQ ID NO: 3648), CUGguaaagc (SEQ ID NO: 1686), AUGgugagcu (SEQ ID NO: 958), CAGgugguug (SEQ ID NO: 1419), GUAguaaguu (SEQ ID NO: 3649), CAGguaauac (SEQ ID NO: 3650), CAGgcaaggc (SEQ ID NO: 3651), AAGguaauuu (SEQ ID NO: 171), UUUguccgug (SEQ ID NO: 3652), GAGguagguu (SEQ ID NO: 1939), ACCgugagug (SEQ ID NO: 3653), CAAguaagcu (SEQ ID NO: 3654), ACAgugagua (SEQ ID NO: 560), UUGgugagau (SEQ ID NO: 3000), AAGguagucu (SEQ ID NO: 233), CAGguaaagg (SEQ ID NO: 3655), GGGguaugga (SEQ ID NO: 2264), UUUguaagug (SEQ ID NO: 3040), GUGguaagag (SEQ ID NO: 2344), AGUgugaguu (SEQ ID NO: 838), AAGgcaagcg (SEQ ID NO: 3656), UAAgugagua (SEQ ID NO: 2438), AGGgugagug (SEQ ID NO: 797), AGUguacgug (SEQ ID NO: 3657), AGGgugcgua (SEQ ID NO: 3658), GGCgugagcc (SEQ ID NO: 2238), CGAguuauga (SEQ ID NO: 3659), CAGguaaaga (SEQ ID NO: 1122), UUGgugaaga (SEQ ID NO: 3660), AGGguaaugg (SEQ ID NO: 3661), AAGguccaga (SEQ ID NO: 300), AGUgugaguc (SEQ ID NO: 836), CAGguaauuu (SEQ ID NO: 1159), CAGguaacgc (SEQ ID NO: 3662), CUGguacacu (SEQ ID NO: 3663), CUGguuagug (SEQ ID NO: 1782), CAGguacuug (SEQ ID NO: 3664), CACguaagua (SEQ ID NO: 3665), GUGgugegge (SEQ ID NO: 3666), GAGgucaguu (SEQ ID NO: 3667), AUGguaugcc (SEQ ID NO: 932), AAGgugugug (SEQ ID NO: 405), CUGguggguc (SEQ ID NO: 1772), CAGgugaggc (SEQ ID NO: 1342), AAGguuaguc (SEQ ID NO: 423), AAGguagcug (SEQ ID NO: 215), GAGgucagga (SEQ ID NO: 1983), GUUguaggua (SEQ ID NO: 3668), UGGguacaag (SEQ ID NO: 3669), AUGguaggug (SEQ ID NO: 924), GAGguaagcc (SEQ ID NO: 1886), AUGgcaagua (SEQ ID NO: 3670), AAGguauauu (SEQ ID NO: 245), GCGgugagag (SEQ ID NO: 3671), AAGgugcuuc (SEQ ID NO: 3672), UAGguacauc (SEQ ID NO: 3673), ACUgugguaa (SEQ ID NO: 3674), GAGguaggcu (SEQ ID NO: 1933), GAGguaugca (SEQ ID NO: 3675), AGGguaguuc (SEQ ID NO: 3676), CAGguauccu (SEQ ID NO: 1241), AGGguaaguc (SEQ ID NO: 741), AGGgucaguu (SEQ ID NO: 779), CAGguuggga (SEQ ID NO: 3677), CAGguggaua (SEQ ID NO: 3678), GGAguagguu (SEQ ID NO: 2220), GAGguaggau (SEQ ID NO: 3679), GGGguuugug (SEQ ID NO: 3680), UAGguaauug (SEQ ID NO: 3681), AAGguaaccc (SEQ ID NO: 136), ACGguaagaa (SEQ ID NO: 3682), GAGguagggg (SEQ ID NO: 1936), CGAguaggug (SEQ ID NO: 1619), UCCguaagug (SEQ ID NO: 2710), UCGguacagg (SEQ ID NO: 3683), CAAguaagcg (SEQ ID NO: 3684), AAGguccgcg (SEQ ID NO: 3685), AAUgugagua (SEQ ID NO: 523), CAGgugaaug (SEQ ID NO: 3686), GUGguaaggc (SEQ ID NO: 2350), AGAgugagug (SEQ ID NO: 706), UCUguauguc (SEQ ID NO: 3687), UGGgugaguc (SEQ ID NO: 2876), UCGguuagua (SEQ ID NO: 3688), GAUguaugca (SEQ ID NO: 3689), GAGguuggug (SEQ ID NO: 3690), GAGguggggc (SEQ ID NO: 2061), UGGgucaguc (SEQ ID NO: 3691), GCAgugagua (SEQ ID NO: 2161), CAGguugcuu (SEQ ID NO: 3692), AGGguagagu (SEQ ID NO: 3693), UAGgucaggu (SEQ ID NO: 2567), CGCguaugua (SEQ ID NO: 3694), GAGguauuaa (SEQ ID NO: 3695), CAGguaaacu (SEQ ID NO: 3696), AAAguaaguu (SEQ ID NO: 24), GGGgucuggc (SEQ ID NO: 3697), GCUguggggu (SEQ ID NO: 3698), UUGguaaguc (SEQ ID NO: 3699), AAGguagaag (SEQ ID NO: 3700), AAUgugaguc (SEQ ID NO: 524), AAGgucagcu (SEQ ID NO: 288), AAGguaagag (SEQ ID NO: 143), AUGgugagga (SEQ ID NO: 3701), AAGguacuuc (SEQ ID NO: 200), AAGguaagaa (SEQ ID NO: 141), CCGguacagc (SEQ ID NO: 3702), GCGgugcgga (SEQ ID NO: 3703), CAGguacaua (SEQ ID NO: 1168), CUGgugagga (SEQ ID NO: 1755), CUGguaggug (SEQ ID NO: 1731), AACguagguu (SEQ ID NO: 3704), AUGgugugug (SEQ ID NO: 975), UUGguacuau (SEQ ID NO: 3705), CAGgucggug (SEQ ID NO: 1300), CAGgcauggg (SEQ ID NO: 3706), AUGguaucuu (SEQ ID NO: 929), AAGguaacua (SEQ ID NO: 137), CAGgugggcg (SEQ ID NO: 3707), CACgugagga (SEQ ID NO: 3708), AAGgugguuc (SEQ ID NO: 392), UGGgcauucu (SEQ ID NO: 3709), AUGguaagcc (SEQ ID NO: 894), AGGgucagug (SEQ ID NO: 778), AGAguacgua (SEQ ID NO: 3710), AAGguaggca (SEQ ID NO: 220), AAGguauuca (SEQ ID NO: 3711), CAGguagauu (SEQ ID NO: 1202), GAGguauuua (SEQ ID NO: 1972), GAGgucuaca (SEQ ID NO: 3712), GUUguagguc (SEQ ID NO: 3713), CAGguacucg (SEQ ID NO: 3714), GUCguauguu (SEQ ID NO: 3715), AAGguacuuu (SEQ ID NO: 202), AGAgugagau (SEQ ID NO: 702), AGUguuggua (SEQ ID NO: 3716), AAUgugagug (SEQ ID NO: 525), AAGguagauu (SEQ ID NO: 3717), AUGguuugua (SEQ ID NO: 988), GAGgccccag (SEQ ID NO: 3718), AUGgucaguu (SEQ ID NO: 3719), UCUguaagga (SEQ ID NO: 3720), CAGgucgggc (SEQ ID NO: 3721), CAGguaagcc (SEQ ID NO: 1142), UAGgucagug (SEQ ID NO: 2569), AGAguaggaa (SEQ ID NO: 683), CUGguacuuc (SEQ ID NO: 3722), CUCguaagca (SEQ ID NO: 1674), CAGguaacua (SEQ ID NO: 1134), CAGguggcug (SEQ ID NO: 1401), UGGguccgua (SEQ ID NO: 3723), GAGguugugc (SEQ ID NO: 3724), CAGgugcgcg (SEQ ID NO: 1377), AAAguauggc (SEQ ID NO: 3725), UGAguacgua (SEQ ID NO: 2779), CUGguacgga (SEQ ID NO: 3726), CAAgugaccu (SEQ ID NO: 3727), AAGgugaugu (SEQ ID NO: 356), AAGgucugca (SEQ ID NO: 3728), AAAguuugua (SEQ ID NO: 75), AAGgugagca (SEQ ID NO: 339), GAUguaagcc (SEQ ID NO: 2119), CAAguaauuu (SEQ ID NO: 1035), CAGgugugug (SEQ ID NO: 1442), UGGgugaggg (SEQ ID NO: 2874), AAGgugaccu (SEQ ID NO: 3729), UAGgugugag (SEQ ID NO: 2621), CAGgcagguc (SEQ ID NO: 3730), UCAguaaguu (SEQ ID NO: 2692), UCAgcaguga (SEQ ID NO: 3731), AAGguaccac (SEQ ID NO: 3732), UAAguaggug (SEQ ID NO: 3733), AAGgucagcc (SEQ ID NO: 286), CAGguaacuc (SEQ ID NO: 1135), AAAguaagag (SEQ ID NO: 13), AAGguagaua (SEQ ID NO: 209), AAGgcaaggg (SEQ ID NO: 99), CAGgugucgg (SEQ ID NO: 3734), CAGguggcua (SEQ ID NO: 3735), GAGguugcca (SEQ ID NO: 3736), CAGgccgugg (SEQ ID NO: 3737), UUGguauaug (SEQ ID NO: 3738), GAGguugagu (SEQ ID NO: 3739), GAGguagguc (SEQ ID NO: 3740), GUGguaagac (SEQ ID NO: 2343), UAGguccuuc (SEQ ID NO: 3741), GAGgcaaguc (SEQ ID NO: 3742), GAGguaacau (SEQ ID NO: 3743), CAGguauauc (SEQ ID NO: 1236), UCGguugguu (SEQ ID NO: 3744), CAGgugaacc (SEQ ID NO: 3745), CAGgucuuuu (SEQ ID NO: 3746), CAGgcauggc (SEQ ID NO: 3747), AAAguacuug (SEQ ID NO: 32), CAGgugauuc (SEQ ID NO: 1356), UUGguagguu (SEQ ID NO: 3748), UAUgugagca (SEQ ID NO: 3749), CAGgugagcg (SEQ ID NO: 1339), AAUguaauaa (SEQ ID NO: 3750), AAAguaaggc (SEQ ID NO: 3751), UAGguuuguc (SEQ ID NO: 2644), UAGgugggag (SEQ ID NO: 2613), GAGguaaguu (SEQ ID NO: 3752), AAGguagccg (SEQ ID NO: 3753), CAGguggugc (SEQ ID NO: 3754), UGAgucaguu (SEQ ID NO: 3755), CUGguaggcc (SEQ ID NO: 3756), CAAguaagga (SEQ ID NO: 3757), CGGguaaggc (SEQ ID NO: 3758), AAGgcgagga (SEQ ID NO: 3759), CAGguaguuc (SEQ ID NO: 1230), CAGguaagga (SEQ ID NO: 1143), CCUgugagug (SEQ ID NO: 1610), AAGguaaaug (SEQ ID NO: 132), CCGguaauua (SEQ ID NO: 3760), CAGguaaguu (SEQ ID NO: 1149), AAGgugguca (SEQ ID NO: 3761), CAGguaccuc (SEQ ID NO: 1177), AUCguaagua (SEQ ID NO: 3762), CCGguacaua (SEQ ID NO: 3763), GCGgugagug (SEQ ID NO: 3764), GAGgugguau (SEQ ID NO: 2067), CUGgugugga (SEQ ID NO: 3765), GAGguaauuc (SEQ ID NO: 3766), CAAguacgua (SEQ ID NO: 3767), UCUguaagug (SEQ ID NO: 2746), AAUguaagug (SEQ ID NO: 491), AGGgucuguu (SEQ ID NO: 783), GAGguacugc (SEQ ID NO: 1918), AGGguaaggc (SEQ ID NO: 738), AAGgcaagag (SEQ ID NO: 95), CAGguggguu (SEQ ID NO: 1416), UAGguuagga (SEQ ID NO: 3768), UGAguaagcu (SEQ ID NO: 2769), AGAguaagag (SEQ ID NO: 661), AUGgcaggug (SEQ ID NO: 3769), UAGgcaagua (SEQ ID NO: 3770), AUGguaggua (SEQ ID NO: 923), GCAgcccgca (SEQ ID NO: 3771), ACGguaaacu (SEQ ID NO: 3772), AGGgugaguu (SEQ ID NO: 798), GUAguagucu (SEQ ID NO: 3773), GUGgcugaaa (SEQ ID NO: 3774), CAGguuaguc (SEQ ID NO: 1456), CUGgugagca (SEQ ID NO: 1753), UCAguaagug (SEQ ID NO: 2691), AAAgugauug (SEQ ID NO: 3775), UAGgucugga (SEQ ID NO: 3776), GAGguguuuc (SEQ ID NO: 3777), AAGguaaauu (SEQ ID NO: 133), CAUguacauc (SEQ ID NO: 3778), AAGguuugaa (SEQ ID NO: 3779), CCAgcaagug (SEQ ID NO: 3780), UAGguaauaa (SEQ ID NO: 3781), GAGgcaagug (SEQ ID NO: 1859), CAAgugauuc (SEQ ID NO: 1071), CAGgucgugg (SEQ ID NO: 3782), GAAguaugcc (SEQ ID NO: 3783), UCGgugcccu (SEQ ID NO: 3784), GAGgucaguc (SEQ ID NO: 3785), CAGgugagac (SEQ ID NO: 1334), UUUgucugua (SEQ ID NO: 3786), CAGguagaua (SEQ ID NO: 3787), UGGguaucag (SEQ ID NO: 3788), UAGgugggcu (SEQ ID NO: 2616), AUGgugagau (SEQ ID NO: 3789), CAGguaacac (SEQ ID NO: 3790), CCGguauccu (SEQ ID NO: 3791), UAGguaagcu (SEQ ID NO: 2487), UCAguacauc (SEQ ID NO: 3792), UAGguuugcc (SEQ ID NO: 2642), AUGguaagaa (SEQ ID NO: 889), UUGguaagac (SEQ ID NO: 3793), CCGguuaguc (SEQ ID NO: 3794), GAGguaagaa (SEQ ID NO: 1882), UGGguaaguu (SEQ ID NO: 2844), CCGgugagaa (SEQ ID NO: 1585), CCUgugaggg (SEQ ID NO: 1608), ACGguaggag (SEQ ID NO: 590), ACAguauguc (SEQ ID NO: 3795), CAGguauuaa (SEQ ID NO: 3796), CAGguggauc (SEQ ID NO: 3797), AGAgugcgua (SEQ ID NO: 3798), AAGgugaccg (SEQ ID NO: 3799), AGAguaggug (SEQ ID NO: 687), ACUguaugua (SEQ ID NO: 3800), UAGgucaauu (SEQ ID NO: 3801), AGUguguaag (SEQ ID NO: 3802), CGGguaccuu (SEQ ID NO: 3803), CUAgugaguu (SEQ ID NO: 3804), CUAguaagug (SEQ ID NO: 1666), CAGguacaac (SEQ ID NO: 3805), UAGgugugug (SEQ ID NO: 2627), CAUguacggc (SEQ ID NO: 3806), AUGgugugag (SEQ ID NO: 3807), AGGguggaag (SEQ ID NO: 3808), CAGgugcgag (SEQ ID NO: 3809), UAGgugcucc (SEQ ID NO: 3810), AAGguggugg (SEQ ID NO: 390), AAGgucuguu (SEQ ID NO: 317), CAGgugggcc (SEQ ID NO: 1407), AAGgucaguc (SEQ ID NO: 294), CAGguuuuua (SEQ ID NO: 3811), AACgugaggu (SEQ ID NO: 3812), CGGguaagag (SEQ ID NO: 3813), UUUgucggua (SEQ ID NO: 3814), UAGguuaagu (SEQ ID NO: 3815), GUGguaagaa (SEQ ID NO: 2342), CAGguauugg (SEQ ID NO: 1266), GCUguaaguu (SEQ ID NO: 2196), CUAguaagua (SEQ ID NO: 1664), UCGguaaaua (SEQ ID NO: 3816), CAGguaacuu (SEQ ID NO: 1137), CCUgugagua (SEQ ID NO: 3817), CAGguuauau (SEQ ID NO: 3818), CUGgugaaca (SEQ ID NO: 3819), AAGguauaaa (SEQ ID NO: 238), GAGguaagca (SEQ ID NO: 1885), AAGgugaagc (SEQ ID NO: 324), CAGgugaguu (SEQ ID NO: 1348), UUUgugagua (SEQ ID NO: 3820), CUUguacgcc (SEQ ID NO: 3821), AGAguaagug (SEQ ID NO: 670), UGGguaggug (SEQ ID NO: 2853), UGAgcccuge (SEQ ID NO: 3822), UGUguaugua (SEQ ID NO: 3823), AAGguagagg (SEQ ID NO: 3824), GAGguggggg (SEQ ID NO: 2062), UAGguaauuc (SEQ ID NO: 2502), AAGgcauggu (SEQ ID NO: 3825), AGAguaagca (SEQ ID NO: 663), AAGguaggaa (SEQ ID NO: 217), CAAguaagua (SEQ ID NO: 1026), ACUguaauug (SEQ ID NO: 3826), CAGgucugug (SEQ ID NO: 1311), UCGguaccga (SEQ ID NO: 3827), CUGgugagag (SEQ ID NO: 3828), AAGguuugcu (SEQ ID NO: 463), AUGguaccac (SEQ ID NO: 3829), UAAguuaguu (SEQ ID NO: 3830), CAGguaggac (SEQ ID NO: 1213), AGAgugaggc (SEQ ID NO: 3831), CGAgucagua (SEQ ID NO: 3832), CAGgucugag (SEQ ID NO: 1304), GAGguggugg (SEQ ID NO: 3833), ACGguauugg (SEQ ID NO: 3834), GCUgcgagua (SEQ ID NO: 3835), CUGguaagug (SEQ ID NO: 1708), GUGgugagau (SEQ ID NO: 2379), GGGguuugau (SEQ ID NO: 3836), UCUgugagug (SEQ ID NO: 2762), CUUgucagua (SEQ ID NO: 1801), GAGguaaaac (SEQ ID NO: 1866), UCUguaagau (SEQ ID NO: 2741), CCAguaaguu (SEQ ID NO: 1558), CAGguaaagu (SEQ ID NO: 1124), GCGgugagca (SEQ ID NO: 2179), UAAguaagag (SEQ ID NO: 2416), CUGgcaggug (SEQ ID NO: 3837), GAGguaaggg (SEQ ID NO: 1891), UGAguaaguu (SEQ ID NO: 2775), GAGgugagac (SEQ ID NO: 2015), GCUgucuguu (SEQ ID NO: 3838), AAGguaacaa (SEQ ID NO: 134), GAGguaacgg (SEQ ID NO: 3839), CUGguauucu (SEQ ID NO: 3840), CAAguaacug (SEQ ID NO: 1021), AAGguggggu (SEQ ID NO: 383), UAGguauggc (SEQ ID NO: 2549), CAGguauuuu (SEQ ID NO: 1271), GUGguaaacu (SEQ ID NO: 3841), GAGgucugag (SEQ ID NO: 1998), CUGguaaggu (SEQ ID NO: 1706), CAAguaaguu (SEQ ID NO: 1029), AAGguagacc (SEQ ID NO: 206), GAGgcgagcg (SEQ ID NO: 3842), CUGguaaaua (SEQ ID NO: 1687), UGUguaagcg (SEQ ID NO: 3843), CAGguuaggg (SEQ ID NO: 1453), GGGgugagga (SEQ ID NO: 2280), ACAguaugug (SEQ ID NO: 3844), CCGgugggga (SEQ ID NO: 3845), GAGgucagug (SEQ ID NO: 3846), AGGguaaggu (SEQ ID NO: 3847), ACAguaagua (SEQ ID NO: 546), GGUguaaggu (SEQ ID NO: 3848), GAGguaauaa (SEQ ID NO: 1895), CAGguauucc (SEQ ID NO: 3849), CUGguauaaa (SEQ ID NO: 3850), CCGgucugug (SEQ ID NO: 3851), CAGguaacug (SEQ ID NO: 1136), GCAguaagua (SEQ ID NO: 2147), AAGguagggg (SEQ ID NO: 225), CAAguccacc (SEQ ID NO: 3852), CAAguuggug (SEQ ID NO: 3853), CAGgugcggu (SEQ ID NO: 1379), CAGguaaaau (SEQ ID NO: 3854), ACGguaagga (SEQ ID NO: 3855), UGGguaauaa (SEQ ID NO: 3856), UAGguaagug (SEQ ID NO: 2493), CCGguagguu (SEQ ID NO: 3857), AGAguaugga (SEQ ID NO: 3858), CUCgugaguc (SEQ ID NO: 3859), AAAgccggug (SEQ ID NO: 3860), UUGguaauuu (SEQ ID NO: 2970), GAGguaaaag (SEQ ID NO: 1867), CCUgugugag (SEQ ID NO: 3861), AAAguaagga (SEQ ID NO: 18), UGAgugagug (SEQ ID NO: 2800), AAGguacaug (SEQ ID NO: 180), CCGguaaaug (SEQ ID NO: 3862), CAGgugaagc (SEQ ID NO: 3863), CAGguacccg (SEQ ID NO: 1173), GAGguaaggc (SEQ ID NO: 1890), UUUguauguu (SEQ ID NO: 3049), CAGgugcucc (SEQ ID NO: 1386), UCGguagguc (SEQ ID NO: 3864), CGGgugaggc (SEQ ID NO: 3865), AAGguaauua (SEQ ID NO: 168), ACUgugaguc (SEQ ID NO: 644), AAGgucagca (SEQ ID NO: 285), GUGgugagug (SEQ ID NO: 2384), CAUguccacc (SEQ ID NO: 3866), AAGgugaccc (SEQ ID NO: 3867), CGGguuagua (SEQ ID NO: 3868), GCGguaguaa (SEQ ID NO: 3869), GCUguaggua (SEQ ID NO: 3870), CCUguugagu (SEQ ID NO: 3871), UAGgucuggc (SEQ ID NO: 2577), GAUgugagcc (SEQ ID NO: 2131), CUUgugagua (SEQ ID NO: 1802), CUGguguguu (SEQ ID NO: 1780), GAGgcaugug (SEQ ID NO: 1863), CAGgcaagag (SEQ ID NO: 1101), UUGguaagaa (SEQ ID NO: 2957), GAGguguggg (SEQ ID NO: 2075), GAGguauuuu (SEQ ID NO: 1975), CAGguaguaa (SEQ ID NO: 1224), AGGguaagac (SEQ ID NO: 3872), UUUguaggca (SEQ ID NO: 3873), AGGgugagau (SEQ ID NO: 3874), GAGguuugua (SEQ ID NO: 2110), AAGgugagug (SEQ ID NO: 349), GAGgugggag (SEQ ID NO: 2055), AAGgugagaa (SEQ ID NO: 335), CUGguaagag (SEQ ID NO: 1698), AUAguaaaga (SEQ ID NO: 3875), GAUgugaguc (SEQ ID NO: 2134), AAGgugcagg (SEQ ID NO: 3876), CAGgucuguc (SEQ ID NO: 1310), GAGgugauuu (SEQ ID NO: 3877), CAGguuggcu (SEQ ID NO: 3878), CGGguauggg (SEQ ID NO: 3879), AUGguccauc (SEQ ID NO: 3880), CCGguuggug (SEQ ID NO: 3881), GGAguaaguc (SEQ ID NO: 3882), AAUguaagga (SEQ ID NO: 488), CAGguuuguu (SEQ ID NO: 1510), UAGgugugua (SEQ ID NO: 2626), UAUgucuuug (SEQ ID NO: 3883), ACGguacuuc (SEQ ID NO: 3884), AAGgcacgcg (SEQ ID NO: 3885), CUGguaaacc (SEQ ID NO: 1684), CUUgugggua (SEQ ID NO: 3886), UGAguaaguc (SEQ ID NO: 2773), CUGgugggug (SEQ ID NO: 1773), GAGguggaga (SEQ ID NO: 3887), GUGguggcug (SEQ ID NO: 3888), GUGguaagug (SEQ ID NO: 2353), AACgugagua (SEQ ID NO: 3889), GAAgcuguaa (SEQ ID NO: 3890), CGGguaucuu (SEQ ID NO: 3891), CAGgugucag (SEQ ID NO: 1424), AAUguacgca (SEQ ID NO: 3892), CCGgugggua (SEQ ID NO: 3893), UGGgugaggu (SEQ ID NO: 3894), AAGguauguu (SEQ ID NO: 266), CAGguauguu (SEQ ID NO: 1261), CAGguuugcu (SEQ ID NO: 1505), UUGguaaguu (SEQ ID NO: 2964), CAGguaguug (SEQ ID NO: 1231), CCUgugaaua (SEQ ID NO: 3895), GCUgugugug (SEQ ID NO: 3896), CAAguaauuc (SEQ ID NO: 1033), AGGguaaugu (SEQ ID NO: 3897), GCUgugaguc (SEQ ID NO: 2205), ACCguaaguu (SEQ ID NO: 3898), CGUguaagua (SEQ ID NO: 3899), GGGguaaguc (SEQ ID NO: 3900), AAUguaugau (SEQ ID NO: 3901), AAUgugauua (SEQ ID NO: 3902), UCAguaagaa (SEQ ID NO: 2682), CAGguccguc (SEQ ID NO: 3903), GAAguauuga (SEQ ID NO: 3904), UUGguaagga (SEQ ID NO: 2960), CAGgucgguu (SEQ ID NO: 3905), UAGguuagug (SEQ ID NO: 2635), ACGguaaaac (SEQ ID NO: 577), AAGguagguc (SEQ ID NO: 228), UACgugagua (SEQ ID NO: 3906), UUGguaagca (SEQ ID NO: 3907), GCGgugaguc (SEQ ID NO: 3908), GAAguaaggg (SEQ ID NO: 3909), CGCgugaguu (SEQ ID NO: 3910), CAGguacccc (SEQ ID NO: 3911), UCUguaagac (SEQ ID NO: 3912), GAGgugggca (SEQ ID NO: 2057), AAUguaagac (SEQ ID NO: 3913), CAGgcaaggg (SEQ ID NO: 3914), CAAguaacua (SEQ ID NO: 1020), AAAguuuguc (SEQ ID NO: 3915), CAGguacugu (SEQ ID NO: 1193), AAGgucccuc (SEQ ID NO: 303), UCGguaaguc (SEQ ID NO: 3916), UGGgugagug (SEQ ID NO: 2877), CUUgugagau (SEQ ID NO: 3917), AGAgugagcu (SEQ ID NO: 3918), UAAgugggga (SEQ ID NO: 3919), UAGguaggga (SEQ ID NO: 2522), CAGguuagcc (SEQ ID NO: 1452), AGGguaauca (SEQ ID NO: 3920), AAGguucagc (SEQ ID NO: 3921), UGGgugggug (SEQ ID NO: 2885), CAGguuguga (SEQ ID NO: 1494), AAGguaagug (SEQ ID NO: 155), CAUgugcgua (SEQ ID NO: 1543), CCGguauauu (SEQ ID NO: 3922), ACCguaugug (SEQ ID NO: 3923), CAGguauagu (SEQ ID NO: 3924), CAGguauuac (SEQ ID NO: 3925), CAGgugcagg (SEQ ID NO: 1364), GUGgugagcu (SEQ ID NO: 2381), AAGguaacau (SEQ ID NO: 135), CUGgugaugg (SEQ ID NO: 3926), AUGguaaaug (SEQ ID NO: 882), CCGgugagca (SEQ ID NO: 3927), AAGguaaacc (SEQ ID NO: 124), AAGguacugg (SEQ ID NO: 3928), GCGgucagga (SEQ ID NO: 3929), CUGgucaggg (SEQ ID NO: 3930), AAAguacguu (SEQ ID NO: 3931), AGAguagguu (SEQ ID NO: 688), AGGguaagcu (SEQ ID NO: 3932), AUUgugagua (SEQ ID NO: 1009), CCGgccacca (SEQ ID NO: 3933), GAGguaacuu (SEQ ID NO: 1881), GAGguaugaa (SEQ ID NO: 1956), CAGgucagac (SEQ ID NO: 1276), UAGgcgugug (SEQ ID NO: 2462), AGGguaaguu (SEQ ID NO: 743), CAGgcaugag (SEQ ID NO: 1111), CAGguaacgu (SEQ ID NO: 1133), CAGgcgagca (SEQ ID NO: 3934), UAGguauggu (SEQ ID NO: 2550), AGAguaggau (SEQ ID NO: 3935), CUGguuucaa (SEQ ID NO: 3936), GAGguaaacu (SEQ ID NO: 3937), CAGgcaugca (SEQ ID NO: 1112), UUGguaaucu (SEQ ID NO: 3938), AGGgcagaau (SEQ ID NO: 3939), AUGguaaaac (SEQ ID NO: 877), GCUgcaggug (SEQ ID NO: 3940), GAAgcacgug (SEQ ID NO: 3941), CAUguaaaca (SEQ ID NO: 3942), UGGguaagau (SEQ ID NO: 2835), AGGguagcua (SEQ ID NO: 3943), AGGguggggu (SEQ ID NO: 800), CCUguaaguu (SEQ ID NO: 1600), UGAgugaguu (SEQ ID NO: 2801), GGAguaugua (SEQ ID NO: 3944), CAGgugaccu (SEQ ID NO: 1328), AAAguacgga (SEQ ID NO: 3945), GAGguacaga (SEQ ID NO: 1906), GAUguaggua (SEQ ID NO: 2125), GGGguaauug (SEQ ID NO: 3946), UAGguggguu (SEQ ID NO: 2617), GUGguacgua (SEQ ID NO: 3947), AAGguacagc (SEQ ID NO: 3948), GAGgugaaga (SEQ ID NO: 3949), GGGguaagca (SEQ ID NO: 2246), UGAguagguc (SEQ ID NO: 3950), GGGguaaguu (SEQ ID NO: 2253), AUUgugaguu (SEQ ID NO: 1011), UCAguaagac (SEQ ID NO: 3951), AGUgugagcu (SEQ ID NO: 834), AAGgcaaaac (SEQ ID NO: 3952), CUGgugaguc (SEQ ID NO: 1760), AAGgucucug (SEQ ID NO: 310), GAGgcugugc (SEQ ID NO: 3953), AGAgugagac (SEQ ID NO: 700), GAGgugaugu (SEQ ID NO: 2033), AGAguauggu (SEQ ID NO: 3954), UGGguggguc (SEQ ID NO: 2884), GCUgcugagc (SEQ ID NO: 3955), CAGguagcug (SEQ ID NO: 1210), UAGgucagaa (SEQ ID NO: 3956), CCGguaggug (SEQ ID NO: 3957), GCAguaugau (SEQ ID NO: 3958), CAGguuucag (SEQ ID NO: 3959), GAGguuugcc (SEQ ID NO: 3960), GGGguggggg (SEQ ID NO: 3961), AAGguacaua (SEQ ID NO: 179), UGGguguguu (SEQ ID NO: 2890), AGAguaaggc (SEQ ID NO: 666), GCGguuagug (SEQ ID NO: 3962), AAGgugacuu (SEQ ID NO: 334), AUGguaagau (SEQ ID NO: 892), AUGguaguug (SEQ ID NO: 3963), CAUguaagac (SEQ ID NO: 3964), CUGguaugua (SEQ ID NO: 1736), UUCguaagga (SEQ ID NO: 3965), GAAguaugac (SEQ ID NO: 3966), CGGguaauuc (SEQ ID NO: 1627), UGGguaacuu (SEQ ID NO: 2831), CAGgugccua (SEQ ID NO: 1372), CAUguagggc (SEQ ID NO: 3967), ACCgucagga (SEQ ID NO: 3968), CGUguucgau (SEQ ID NO: 3969), GAGgcaggac (SEQ ID NO: 3970), UAGguaauau (SEQ ID NO: 2496), UCGguauacu (SEQ ID NO: 3971), UAGguugugc (SEQ ID NO: 3972), CCGgugaguc (SEQ ID NO: 3973), CAGgugccaa (SEQ ID NO: 1368), CAGgugaugc (SEQ ID NO: 1352), AAGgugagga (SEQ ID NO: 343), GUGgugaggg (SEQ ID NO: 3974), UGGgucagua (SEQ ID NO: 3975), GAGgucaggg (SEQ ID NO: 1985), UAGguacgua (SEQ ID NO: 2511), GAGgcaagag (SEQ ID NO: 1857), CCUguuggua (SEQ ID NO: 3976), GAGguaucca (SEQ ID NO: 3977), UAAguaagcu (SEQ ID NO: 2419), AAGgucaguu (SEQ ID NO: 296), AAAguuaaag (SEQ ID NO: 3978), GAGgugcuau (SEQ ID NO: 3979), ACGguaaguu (SEQ ID NO: 581), CUGgugaggg (SEQ ID NO: 1757), GAGguuaugu (SEQ ID NO: 2091), CUUgugugca (SEQ ID NO: 3980), UGAgcugggg (SEQ ID NO: 3981), AAGguauagu (SEQ ID NO: 3982), UAGguaaaac (SEQ ID NO: 2464), GGGgugaggu (SEQ ID NO: 3983), GAGgcaagca (SEQ ID NO: 3984), GGAguaacgu (SEQ ID NO: 3985), AGAguaagua (SEQ ID NO: 3986), AAAguaagua (SEQ ID NO: 21), GAGgcaacca (SEQ ID NO: 3987), UGUguaaguu (SEQ ID NO: 2909), UAGgugaggc (SEQ ID NO: 2594), ACAguaagaa (SEQ ID NO: 544), UGAguaagug (SEQ ID NO: 2774), CAAgucagua (SEQ ID NO: 1057), AGGguaaaug (SEQ ID NO: 3988), AAGguaugca (SEQ ID NO: 257), GCUgugcgug (SEQ ID NO: 3989), GAGguucgcc (SEQ ID NO: 3990), AAGgcuugca (SEQ ID NO: 3991), CAGgcaagug (SEQ ID NO: 1104), AUAguaaguc (SEQ ID NO: 3992), UUGguaggua (SEQ ID NO: 2978), GCAgcaggua (SEQ ID NO: 3993), AAGguauauc (SEQ ID NO: 243), AGCguaagcc (SEQ ID NO: 3994), CUGguucgaa (SEQ ID NO: 3995), ACGgugggug (SEQ ID NO: 612), CUGgucauug (SEQ ID NO: 3996), CAGgucagga (SEQ ID NO: 1280), CAAgugagac (SEQ ID NO: 1062), GAGguacugg (SEQ ID NO: 1919), GAGguguagu (SEQ ID NO: 3997), GAGguguccu (SEQ ID NO: 3998), CAGgugcgua (SEQ ID NO: 1380), AGUgcccuga (SEQ ID NO: 3999), AUGgugaguc (SEQ ID NO: 962), UGUgugugua (SEQ ID NO: 4000), CAGguaugcu (SEQ ID NO: 1254), CUGguacagu (SEQ ID NO: 4001), UUGguacgua (SEQ ID NO: 4002), UCUguacgua (SEQ ID NO: 4003), UAAguaauuc (SEQ ID NO: 4004), CACguaugug (SEQ ID NO: 4005), CAGgcaagua (SEQ ID NO: 1103), UCGgugagug (SEQ ID NO: 4006), GGUgugaguc (SEQ ID NO: 2315), UCUguaagcu (SEQ ID NO: 2743), AAGguucaga (SEQ ID NO: 4007), AGGguacuuc (SEQ ID NO: 4008), GCGgcagguu (SEQ ID NO: 4009), GAGgcccgug (SEQ ID NO: 4010), CAGguauaaa (SEQ ID NO: 4011), AUGgucaagu (SEQ ID NO: 4012), AAGgugagua (SEQ ID NO: 347), GUGguuuguu (SEQ ID NO: 4013), AGAgugagga (SEQ ID NO: 4014), GAGguaugac (SEQ ID NO: 1957), UAGgcgugag (SEQ ID NO: 4015), AAGguacucc (SEQ ID NO: 4016), UGAgugagga (SEQ ID NO: 2798), GAGguaugau (SEQ ID NO: 4017), GGGgucggua (SEQ ID NO: 4018), ACGguaugca (SEQ ID NO: 4019), CAGguaccac (SEQ ID NO: 1171), UAAguaccug (SEQ ID NO: 4020), AGGgugggcu (SEQ ID NO: 4021), CUGgucuguu (SEQ ID NO: 4022), UAGgucagag (SEQ ID NO: 4023), AAGguguguu (SEQ ID NO: 406), CUGgucagug (SEQ ID NO: 4024), AAGgugggac (SEQ ID NO: 4025), GUGguaguag (SEQ ID NO: 4026), CUAguuuagg (SEQ ID NO: 4027), CCCgccccau (SEQ ID NO: 4028), GCUguacugc (SEQ ID NO: 4029), GAGguaauau (SEQ ID NO: 1897), UAGguuggug (SEQ ID NO: 4030), AAGguccaac (SEQ ID NO: 4031), UAGgugagga (SEQ ID NO: 2593), GUGguaaguu (SEQ ID NO: 2354), AGUgugagag (SEQ ID NO: 831), AAUguacaug (SEQ ID NO: 497), UUGgcaggug (SEQ ID NO: 4032), UAGguuauug (SEQ ID NO: 4033), CAGguacuga (SEQ ID NO: 1191), GCGguggguc (SEQ ID NO: 4034), UGUguaagau (SEQ ID NO: 4035), GAGgugagua (SEQ ID NO: 2025), GCAgccccgg (SEQ ID NO: 4036), CAGgugcuaa (SEQ ID NO: 4037), AGUguaagag (SEQ ID NO: 815), CAGguacauc (SEQ ID NO: 4038), CAGgugggac (SEQ ID NO: 1403), AGGguaaaua (SEQ ID NO: 727), UAAguaauua (SEQ ID NO: 4039), CAGguaaccg (SEQ ID NO: 1132), AAGguuugca (SEQ ID NO: 461), UAGgugguuu (SEQ ID NO: 4040), CAGgugaccg (SEQ ID NO: 1327), UGUguaagcu (SEQ ID NO: 4041), GGAgugaguc (SEQ ID NO: 2227), AGGguaggag (SEQ ID NO: 752), AGGgugggug (SEQ ID NO: 802), AAGgucugag (SEQ ID NO: 313), GAUguaauau (SEQ ID NO: 4042), GGGguaauua (SEQ ID NO: 4043), UAGguaggua (SEQ ID NO: 2524), GAGgcaagua (SEQ ID NO: 1858), GAGguaagga (SEQ ID NO: 1889), UAGguacuac (SEQ ID NO: 4044), UCGgugggug (SEQ ID NO: 4045), AAGgugugga (SEQ ID NO: 401), CAGgucugcc (SEQ ID NO: 1305), UAAgugagcc (SEQ ID NO: 4046), GAAguaaguu (SEQ ID NO: 1820), GAAguaagcc (SEQ ID NO: 1815), UAGgugcgac (SEQ ID NO: 4047), GAGguauggc (SEQ ID NO: 4048), GCAguaagaa (SEQ ID NO: 2145), CAGgugugga (SEQ ID NO: 1438), UUGguaacgu (SEQ ID NO: 4049), GCUguaaaaa (SEQ ID NO: 4050), UUGguuagua (SEQ ID NO: 4051), AUAguaaggg (SEQ ID NO: 4052), UUGguacuag (SEQ ID NO: 4053), CGGgcagccg (SEQ ID NO: 4054), CAGgugcugg (SEQ ID NO: 1389), UAUgugaguu (SEQ ID NO: 2673), CAGgucuggg (SEQ ID NO: 4055), UAAguaagaa (SEQ ID NO: 2415), AAGguuauua (SEQ ID NO: 4056), AGAguaaagc (SEQ ID NO: 4057), AGAgugugag (SEQ ID NO: 4058), UAGgugcgag (SEQ ID NO: 4059), CAAguaaacg (SEQ ID NO: 4060), AAGguacgua (SEQ ID NO: 4061), CUGgugagua (SEQ ID NO: 1759), CCAguaugua (SEQ ID NO: 4062), UUGgugagug (SEQ ID NO: 3006), UGAguaagua (SEQ ID NO: 2772), GAGguuagca (SEQ ID NO: 4063), GUGguaagcc (SEQ ID NO: 4064), CUGguauggc (SEQ ID NO: 1734), AAAguaacac (SEQ ID NO: 8), CAGguacuaa (SEQ ID NO: 1186), UCUguaaguu (SEQ ID NO: 2747), GAGgugaggg (SEQ ID NO: 2024), ACUgugggua (SEQ ID NO: 647), GAUguuugug (SEQ ID NO: 4065), CAGgugucaa (SEQ ID NO: 4066), CAGgucacca (SEQ ID NO: 4067), CCGgugagua (SEQ ID NO: 4068), UUGguaaaua (SEQ ID NO: 4069), CAGguggggg (SEQ ID NO: 1411), ACUgcaggug (SEQ ID NO: 4070), UAGguauguu (SEQ ID NO: 2554), GGAgcaagug (SEQ ID NO: 4071), UCGgugccuc (SEQ ID NO: 4072), CAAguaacuu (SEQ ID NO: 4073), GAGguaacca (SEQ ID NO: 1879), CAGguaauau (SEQ ID NO: 1151), GGAguaagaa (SEQ ID NO: 4074), GAGguaccuu (SEQ ID NO: 1914), AGGguaagga (SEQ ID NO: 737), CCUgugaguc (SEQ ID NO: 1609), GAGguaaugg (SEQ ID NO: 1900), AUGguguguc (SEQ ID NO: 4075), GGGgugagua (SEQ ID NO: 4076), AGGgucaggu (SEQ ID NO: 4077), UGGguaaggg (SEQ ID NO: 2839), AGGguagguu (SEQ ID NO: 759), AUAgugaguu (SEQ ID NO: 4078), CCCguaggcu (SEQ ID NO: 4079), ACAguaugua (SEQ ID NO: 553), GACgugugua (SEQ ID NO: 4080), GCGgugagga (SEQ ID NO: 4081), CAGgugaccc (SEQ ID NO: 1326), UAAguuuagu (SEQ ID NO: 4082), ACAguugagu (SEQ ID NO: 570), CGGgugaggg (SEQ ID NO: 1639), CAGguggauu (SEQ ID NO: 1398), CGGguagagg (SEQ ID NO: 4083), UAGgugcgug (SEQ ID NO: 2608), GGGguaagaa (SEQ ID NO: 2243), GAGguggggu (SEQ ID NO: 4084), CACguggguu (SEQ ID NO: 4085), ACGguaauug (SEQ ID NO: 4086), AGAgugaguc (SEQ ID NO: 705), UUGgcuccaa (SEQ ID NO: 4087), AAGgugaugc (SEQ ID NO: 355), AAGguugguc (SEQ ID NO: 448), AGCguaaguu (SEQ ID NO: 4088), AUUguaugua (SEQ ID NO: 1006), UCAguuaagu (SEQ ID NO: 4089), CAAguacgug (SEQ ID NO: 4090), CAGgugcgug (SEQ ID NO: 1382), CAGguaggua (SEQ ID NO: 1220), AUGguggggu (SEQ ID NO: 4091), AUGgugaguu (SEQ ID NO: 964), CAGguaauca (SEQ ID NO: 4092), AAGguagggu (SEQ ID NO: 226), CAGgccaagg (SEQ ID NO: 4093), GUGgugagag (SEQ ID NO: 4094), AAGguuggug (SEQ ID NO: 449), CAGguacucu (SEQ ID NO: 1190), UAGgcaugug (SEQ ID NO: 4095), UUGguaccuu (SEQ ID NO: 4096), CUGgugugcc (SEQ ID NO: 4097), ACAguugcca (SEQ ID NO: 4098), UUGguaauau (SEQ ID NO: 4099), GAGgugcaug (SEQ ID NO: 4100), UUGguuugua (SEQ ID NO: 3028), UUGguaagug (SEQ ID NO: 2963), UGUgugugug (SEQ ID NO: 4101), GUGguuugua (SEQ ID NO: 2398), GCGguacaca (SEQ ID NO: 4102), AGAguaugcu (SEQ ID NO: 4103), UUUguaagua (SEQ ID NO: 3038), UCUgugcggg (SEQ ID NO: 4104), AAGgucagug (SEQ ID NO: 295), GAGguaggaa (SEQ ID NO: 1930), GCGguuagca (SEQ ID NO: 4105), AGGgugaggg (SEQ ID NO: 793), GAAgugagua (SEQ ID NO: 4106), CAGgugacag (SEQ ID NO: 4107), AAGgugauua (SEQ ID NO: 357), GAGgccagcc (SEQ ID NO: 4108), GAGgucuccu (SEQ ID NO: 4109), UAGguauuac (SEQ ID NO: 2556), CAUguaagag (SEQ ID NO: 1519), CUGguagggc (SEQ ID NO: 4110), GAAguaagua (SEQ ID NO: 1818), CGGguaagug (SEQ ID NO: 4111), CAGguaaucu (SEQ ID NO: 4112), GUGguaggua (SEQ ID NO: 4113), CAGgugggua (SEQ ID NO: 1413), AAGgccagug (SEQ ID NO: 4114), AAAgugaauc (SEQ ID NO: 4115), ACGguuacgu (SEQ ID NO: 4116), AUGguaggaa (SEQ ID NO: 917), CGGgugagac (SEQ ID NO: 4117), GAGguuggaa (SEQ ID NO: 2099), UGGgugagcc (SEQ ID NO: 2871), CCAgugagua (SEQ ID NO: 1564), CUAguacgag (SEQ ID NO: 4118), CAGguaugac (SEQ ID NO: 1248), GCUgugaggu (SEQ ID NO: 4119), CUGguaugaa (SEQ ID NO: 4120), GGUguacgac (SEQ ID NO: 4121), CUUgugagug (SEQ ID NO: 4122), GUGgugagca (SEQ ID NO: 2380), CUGguaacuu (SEQ ID NO: 1696), CAGguacuau (SEQ ID NO: 1188), AGGguaaggg (SEQ ID NO: 739), UUGguuaguu (SEQ ID NO: 3025), GGUguaagca (SEQ ID NO: 2302), UCGgugagga (SEQ ID NO: 4123), UGGguaaaca (SEQ ID NO: 4124), UCGguacgug (SEQ ID NO: 4125), UAGguagcag (SEQ ID NO: 4126), CUGguaaggc (SEQ ID NO: 1704), GUGguaagga (SEQ ID NO: 2349), UAAguaagca (SEQ ID NO: 2418), GAGguuccaa (SEQ ID NO: 4127), CUGguaugga (SEQ ID NO: 4128), GGGgugggua (SEQ ID NO: 2288), CAGguuuccc (SEQ ID NO: 4129), CAGgucucug (SEQ ID NO: 4130), GAGgugagga (SEQ ID NO: 2022), CUUguggguu (SEQ ID NO: 1805), AUGgugagac (SEQ ID NO: 953), CAGgugaagg (SEQ ID NO: 1319), GCGguagggg (SEQ ID NO: 4131), GUUguuuccc (SEQ ID NO: 4132), AAAgcaucca (SEQ ID NO: 4133), GUGguagguu (SEQ ID NO: 2367), AAGgugugaa (SEQ ID NO: 398), CAGguacagu (SEQ ID NO: 1167), AAGguaccaa (SEQ ID NO: 182), UUGguaauug (SEQ ID NO: 2969), AAGgugcuca (SEQ ID NO: 4134), AAGguucaac (SEQ ID NO: 4135), CAGguuuaca (SEQ ID NO: 4136), GCUguaagug (SEQ ID NO: 2195), AGGguauguc (SEQ ID NO: 769), GAGgucgggg (SEQ ID NO: 1996), AAGgugccug (SEQ ID NO: 363), AAGguaaaaa (SEQ ID NO: 119), GUGgugaguu (SEQ ID NO: 2385), UAGguaagaa (SEQ ID NO: 4137), AGGguauccu (SEQ ID NO: 4138), GUGguaauau (SEQ ID NO: 4139), UCUguaagua (SEQ ID NO: 2744), UGGguaugga (SEQ ID NO: 4140), AUGguaugga (SEQ ID NO: 935), GACgugagcc (SEQ ID NO: 1854), CUGguuuggc (SEQ ID NO: 4141), AUGguauauc (SEQ ID NO: 4142), AAAguaaacu (SEQ ID NO: 4143), AGCgugagug (SEQ ID NO: 721), CUGguauaga (SEQ ID NO: 4144), CAGgugggga (SEQ ID NO: 1409), AGAguauguu (SEQ ID NO: 696), UAGguacuug (SEQ ID NO: 4145), GCAguaggug (SEQ ID NO: 4146), AGUguauguc (SEQ ID NO: 4147), AAGguuaagc (SEQ ID NO: 413), CUGguggccu (SEQ ID NO: 4148), GAAgugaguc (SEQ ID NO: 1839), UUGguguaag (SEQ ID NO: 4149), CAGguaagaa (SEQ ID NO: 1138), CGGgucucgg (SEQ ID NO: 4150), GAGgugcaca (SEQ ID NO: 2035), CUCguuaguu (SEQ ID NO: 4151), AAGgugauca (SEQ ID NO: 352), UAUguaagaa (SEQ ID NO: 2649), GAGgugcuug (SEQ ID NO: 2047), CAGgugguca (SEQ ID NO: 4152), ACGguaaguc (SEQ ID NO: 4153), ACAguaaugu (SEQ ID NO: 4154), CCUguaaggu (SEQ ID NO: 4155), GAGguuaagu (SEQ ID NO: 4156), UCGguaugug (SEQ ID NO: 2725), UGGguauguu (SEQ ID NO: 2863), AAGguauuac (SEQ ID NO: 268), CAGgugaggg (SEQ ID NO: 1343), UUGguaaaca (SEQ ID NO: 4157), AAGguagugu (SEQ ID NO: 4158), GAGguguggc (SEQ ID NO: 4159), CAGguacgga (SEQ ID NO: 4160), AAGgucauca (SEQ ID NO: 4161), CAAguaggca (SEQ ID NO: 4162), CAGgugaaac (SEQ ID NO: 4163), CAGguacugc (SEQ ID NO: 1192), AAUgcaagug (SEQ ID NO: 4164), CAUguaauuc (SEQ ID NO: 4165), AAGguaugcu (SEQ ID NO: 259), CUGgugaguu (SEQ ID NO: 1762), CAGgugguuu (SEQ ID NO: 4166), UGUgugagua (SEQ ID NO: 2922), AAGgucggug (SEQ ID NO: 4167), AUGguaaauu (SEQ ID NO: 883), AGGguauuac (SEQ ID NO: 771), AGUguaugga (SEQ ID NO: 4168), AACguaagau (SEQ ID NO: 4169), GUGguaaggu (SEQ ID NO: 4170), ACUguuagua (SEQ ID NO: 4171), CAGguaucag (SEQ ID NO: 1239), AAGguuaguu (SEQ ID NO: 425), CUGgugagcu (SEQ ID NO: 1754), UUGgugagcu (SEQ ID NO: 4172), UGUguacgua (SEQ ID NO: 4173), GAGgucagcc (SEQ ID NO: 4174), GAGguagaau (SEQ ID NO: 4175), AAGguaugag (SEQ ID NO: 255), UAGguauuuc (SEQ ID NO: 2563), UGUguaacac (SEQ ID NO: 4176), AGUguaaggc (SEQ ID NO: 4177), GAGgucugcu (SEQ ID NO: 4178), AAGguuagca (SEQ ID NO: 418), CAGguaaaug (SEQ ID NO: 1127), AACguaagcu (SEQ ID NO: 4179), CAGgucugca (SEQ ID NO: 4180), CAGguauugu (SEQ ID NO: 1267), GUGguaauuc (SEQ ID NO: 2356), GAGguauaug (SEQ ID NO: 1951), GCCgugagcc (SEQ ID NO: 4181), GAGguaagag (SEQ ID NO: 1883), UGAguaugua (SEQ ID NO: 2787), CAGguaaggg (SEQ ID NO: 1145), GAGguaaauu (SEQ ID NO: 1876), CAGgcaacuu (SEQ ID NO: 4182), UGUguaaguc (SEQ ID NO: 2908), CAGgugcgcu (SEQ ID NO: 4183), CGGguaaacc (SEQ ID NO: 4184), CCGgucaguc (SEQ ID NO: 4185), UAGgugggcg (SEQ ID NO: 4186), GCGgucaguu (SEQ ID NO: 4187), GGGguggguc (SEQ ID NO: 4188), AGCguaauag (SEQ ID NO: 4189), ACGgugaguc (SEQ ID NO: 4190), CUGguacuug (SEQ ID NO: 1722), CAGguuggua (SEQ ID NO: 4191), AGAguaugug (SEQ ID NO: 695), CUGgugggua (SEQ ID NO: 1771), GAGguggcuu (SEQ ID NO: 4192), AUAguauuga (SEQ ID NO: 4193), UGAgucguce (SEQ ID NO: 4194), CAGgugcucu (SEQ ID NO: 4195), UACguaauau (SEQ ID NO: 4196), GCUguccuga (SEQ ID NO: 4197), CAGgcugcac (SEQ ID NO: 4198), CUGgugcgcu (SEQ ID NO: 1766), GCGguaagaa (SEQ ID NO: 4199), UAAguuacuu (SEQ ID NO: 4200), GAAgugagug (SEQ ID NO: 1840), UAGgcaaguc (SEQ ID NO: 2460), UAAguaaaua (SEQ ID NO: 4201), ACGgugagug (SEQ ID NO: 607), CAGguagguu (SEQ ID NO: 1223), GGGguauaac (SEQ ID NO: 4202), GUUgugaguu (SEQ ID NO: 2410), CAUgugagua (SEQ ID NO: 1539), GAGgugcauu (SEQ ID NO: 4203), AAGguuugua (SEQ ID NO: 466), UCGguaaugu (SEQ ID NO: 4204), CGAguaaggg (SEQ ID NO: 1616), GAGgcacgga (SEQ ID NO: 4205), AGGgugugga (SEQ ID NO: 4206), CAGguauggu (SEQ ID NO: 1257), AAGguagaaa (SEQ ID NO: 203), CAGgugccug (SEQ ID NO: 1373), UGGguauaug (SEQ ID NO: 4207), UGAgugagac (SEQ ID NO: 4208), UGGguaauuu (SEQ ID NO: 2847), AUGguaaaua (SEQ ID NO: 881), AAGgcaaagg (SEQ ID NO: 4209), AGUguuuguu (SEQ ID NO: 4210), AUGguauugg (SEQ ID NO: 4211), CUGgugagge (SEQ ID NO: 1756), UUGguaaaau (SEQ ID NO: 2948), ACAgugaguu (SEQ ID NO: 563), CAGgugcugu (SEQ ID NO: 4212), GAGguuaaga (SEQ ID NO: 2080), AGAguaagaa (SEQ ID NO: 659), GAGguccgcg (SEQ ID NO: 4213), GUGgugagga (SEQ ID NO: 2382), CAGgugagcc (SEQ ID NO: 1338), CAGgugacau (SEQ ID NO: 1324), AUGgcaagcu (SEQ ID NO: 4214), UCGguaauau (SEQ ID NO: 4215), CAGgcaacaa (SEQ ID NO: 4216), GGGguaggga (SEQ ID NO: 2257), CUGgucucgc (SEQ ID NO: 4217), UAGguaacga (SEQ ID NO: 4218), CGGguaaggu (SEQ ID NO: 4219), UAGguaaugc (SEQ ID NO: 4220), CAGgcaagaa (SEQ ID NO: 1099), ACAguaggua (SEQ ID NO: 4221), CAAguaugag (SEQ ID NO: 1049), GCUguucgaa (SEQ ID NO: 4222), AAGguuaugc (SEQ ID NO: 4223), GAUgugaguu (SEQ ID NO: 2136), CAGguggaga (SEQ ID NO: 1396), AGAguuaguu (SEQ ID NO: 4224), UGAgugugcg (SEQ ID NO: 4225), GAGguacagc (SEQ ID NO: 1907), CAGguaagac (SEQ ID NO: 1139), CAUgugcuuu (SEQ ID NO: 4226), AGGguguguu (SEQ ID NO: 4227), ACAguuaagg (SEQ ID NO: 4228), ACAgugaggg (SEQ ID NO: 4229), GAUguauacc (SEQ ID NO: 4230), UUAguaagcu (SEQ ID NO: 4231), CAGguaagau (SEQ ID NO: 1141), AGAgcugcgu (SEQ ID NO: 4232), GAGgcaaguu (SEQ ID NO: 1860), GAAguaagug (SEQ ID NO: 1819), AAGgugaaaa (SEQ ID NO: 4233), AAGguaccua (SEQ ID NO: 4234), GAGguaucag (SEQ ID NO: 4235), AUGguaugua (SEQ ID NO: 4236), AAGguaugaa (SEQ ID NO: 253), UUGgugagcc (SEQ ID NO: 4237), AAGguuagga (SEQ ID NO: 420), AGGguaugua (SEQ ID NO: 768), CAGguaccga (SEQ ID NO: 4238), AGAguaaacu (SEQ ID NO: 4239), AAGgugcaua (SEQ ID NO: 4240), AAGguaaugu (SEQ ID NO: 167), CCGgugugug (SEQ ID NO: 4241), AGGguaaauu (SEQ ID NO: 729), GGGguuuggc (SEQ ID NO: 4242), CAGguacacg (SEQ ID NO: 1164), UUGguaacca (SEQ ID NO: 4243), GAGgucaggu (SEQ ID NO: 1986), UCUguuggua (SEQ ID NO: 4244), CAGguuaguu (SEQ ID NO: 1458), UUGguauguc (SEQ ID NO: 4245), AAGgugcguc (SEQ ID NO: 4246), AGGguaagaa (SEQ ID NO: 733), UUUguaagcc (SEQ ID NO: 4247), AAGgucaggu (SEQ ID NO: 292), CUGguaaacu (SEQ ID NO: 4248), UCGguaauuu (SEQ ID NO: 4249), CUGguaggcu (SEQ ID NO: 4250), GAGgucugua (SEQ ID NO: 4251), GAGguacuuu (SEQ ID NO: 1922), CUGguaaagg (SEQ ID NO: 4252), CGGgugugug (SEQ ID NO: 1650), CAGguguggu (SEQ ID NO: 4253), UCGguacguc (SEQ ID NO: 4254), CAGgugccag (SEQ ID NO: 4255), GGGgugagaa (SEQ ID NO: 2275), ACAgcuagua (SEQ ID NO: 4256), AAGguauagc (SEQ ID NO: 4257), CUGguaggag (SEQ ID NO: 4258), GCUguacgua (SEQ ID NO: 4259), AAGguaaagg (SEQ ID NO: 128), CAAgcacgag (SEQ ID NO: 4260), CUAguaagac (SEQ ID NO: 4261), CCCguaagcg (SEQ ID NO: 4262), CAAgugugag (SEQ ID NO: 1078), AUGguaaggg (SEQ ID NO: 897), AAGgugaggg (SEQ ID NO: 345), CAAguaggua (SEQ ID NO: 1041), GGUguugcug (SEQ ID NO: 2321), GAGguacugu (SEQ ID NO: 1920), UAGguaagau (SEQ ID NO: 2484), CAGgugcgaa (SEQ ID NO: 1374), GAGguccagg (SEQ ID NO: 4263), UUGguauaca (SEQ ID NO: 2982), GGAgugagua (SEQ ID NO: 2226), GAGgugagau (SEQ ID NO: 2017), AAGguggggc (SEQ ID NO: 4264), CAGguaaacg (SEQ ID NO: 4265), UCGguaacuu (SEQ ID NO: 4266), CAGguaaauu (SEQ ID NO: 1128), GAGgugcgca (SEQ ID NO: 4267), ACUgugagua (SEQ ID NO: 643), ACGgugugac (SEQ ID NO: 4268), GUGguaaguc (SEQ ID NO: 2352), CAGguaggca (SEQ ID NO: 1215), CAGgucagca (SEQ ID NO: 1277), GUGguaugug (SEQ ID NO: 4269), AAAguaucug (SEQ ID NO: 4270), CGGguaugua (SEQ ID NO: 4271), AAGguaauaa (SEQ ID NO: 157), GAGgugggga (SEQ ID NO: 2060), GCUguaggug (SEQ ID NO: 2197), GAAgugaguu (SEQ ID NO: 1841), AAAguauuua (SEQ ID NO: 4272), UAUguaagua (SEQ ID NO: 2653), ACGguaugag (SEQ ID NO: 4273), CUGgugagug (SEQ ID NO: 1761), AGAguaaaau (SEQ ID NO: 4274), GCUguauggc (SEQ ID NO: 4275), AUGguaaacc (SEQ ID NO: 879), GCAguaauaa (SEQ ID NO: 4276), UAAguauuua (SEQ ID NO: 4277), AAUgucagug (SEQ ID NO: 515), AUUgcaggag (SEQ ID NO: 4278), CCGguaagaa (SEQ ID NO: 4279), AAGgcaaguu (SEQ ID NO: 101), GAGguuuguc (SEQ ID NO: 4280), AAGguaacug (SEQ ID NO: 139), AAAguaugag (SEQ ID NO: 4281), GAUguuagua (SEQ ID NO: 4282), CAGguggguc (SEQ ID NO: 1414), AAGguaccga (SEQ ID NO: 4283), CCAguaauua (SEQ ID NO: 4284), GUGguaugcg (SEQ ID NO: 4285), AUGgugcgcu (SEQ ID NO: 4286), CAGgucuaug (SEQ ID NO: 4287), AAGguauuua (SEQ ID NO: 274), CUAguaagau (SEQ ID NO: 4288), AGAguaauuu (SEQ ID NO: 675), GAGguaacgu (SEQ ID NO: 4289), AAGguagcca (SEQ ID NO: 212), CUGgucccgg (SEQ ID NO: 4290), GAGguccuuc (SEQ ID NO: 4291), ACGgucaccc (SEQ ID NO: 4292), AAGguaauac (SEQ ID NO: 158), CAGgugcaug (SEQ ID NO: 1367), AUGguaauag (SEQ ID NO: 4293), UUUguaacac (SEQ ID NO: 4294), UGGguaugau (SEQ ID NO: 4295), CAGgcccccc (SEQ ID NO: 4296), AGAguaguaa (SEQ ID NO: 4297), AGUguaagaa (SEQ ID NO: 814), GAAguauguu (SEQ ID NO: 1833), CAGgugugca (SEQ ID NO: 1434), UUGgugaggg (SEQ ID NO: 3003), UGGguugguu (SEQ ID NO: 4298), CAGguacgua (SEQ ID NO: 1184), GAGgugcggc (SEQ ID NO: 4299), UCUguacggg (SEQ ID NO: 4300), CGGgugcgug (SEQ ID NO: 4301), UACguaagug (SEQ ID NO: 2455), CAUguaagga (SEQ ID NO: 4302), CAGgugacgg (SEQ ID NO: 1329), GAUguaugcu (SEQ ID NO: 4303), UCUgcaauuc (SEQ ID NO: 4304), UGAguaaggc (SEQ ID NO: 2770), GAGguauauu (SEQ ID NO: 1952), AGAgugaguu (SEQ ID NO: 707), AAGguaagcu (SEQ ID NO: 148), UAGgugaagu (SEQ ID NO: 2580), CAGguuagua (SEQ ID NO: 1455), UAUguaagug (SEQ ID NO: 2655), UUGguggggg (SEQ ID NO: 4305), UGAgcucaaa (SEQ ID NO: 4306), UCGguaugua (SEQ ID NO: 4307), UAAguaugcc (SEQ ID NO: 4308), AAUguaagua (SEQ ID NO: 489), CAGguuugca (SEQ ID NO: 4309), ACGgugagag (SEQ ID NO: 4310), CAGguguuuu (SEQ ID NO: 4311), GUGgugagcc (SEQ ID NO: 4312), AGGguacaua (SEQ ID NO: 4313), UAGguaaccc (SEQ ID NO: 4314), GUGgucagua (SEQ ID NO: 4315), CUGgugagcc (SEQ ID NO: 4316), CAGgugcuua (SEQ ID NO: 1390), AUAgucguga (SEQ ID NO: 4317), AUAgugagug (SEQ ID NO: 862), GAGgucaaaa (SEQ ID NO: 4318), CGUguagcuu (SEQ ID NO: 4319), CAGguguuug (SEQ ID NO: 4320), CAGguuggac (SEQ ID NO: 4321), CAGguaagcu (SEQ ID NO: 4322), AGGgucagaa (SEQ ID NO: 4323), CACguauguc (SEQ ID NO: 4324), CACgugagug (SEQ ID NO: 1098), GGGguacgga (SEQ ID NO: 4325), AAGgcaggac (SEQ ID NO: 4326), GAGgugaagc (SEQ ID NO: 4327), GAGguuugaa (SEQ ID NO: 4328), CAGguaagug (SEQ ID NO: 1148), CAGguaacca (SEQ ID NO: 1131), CAGguacucc (SEQ ID NO: 1189), AAGgugcuuu (SEQ ID NO: 371), GAGguaaaua (SEQ ID NO: 1873), GAGgcaggug (SEQ ID NO: 4329), GAGguucgga (SEQ ID NO: 4330), CAGguauuug (SEQ ID NO: 1270), CAGguaaaua (SEQ ID NO: 1125), CAGgugaugu (SEQ ID NO: 1354), CAGgugauac (SEQ ID NO: 4331), GAGgugaggc (SEQ ID NO: 2023), AGGguggggg (SEQ ID NO: 4332), UAAguaaguu (SEQ ID NO: 2425), UGGgugaaca (SEQ ID NO: 4333), UAGguacugc (SEQ ID NO: 4334), CAGgcuccug (SEQ ID NO: 4335), AGGguaggca (SEQ ID NO: 753), CAGgugcccg (SEQ ID NO: 1371), GAGguacauc (SEQ ID NO: 4336), AGGgugugug (SEQ ID NO: 804), AAGguaguaa (SEQ ID NO: 231), UGGguaugag (SEQ ID NO: 2859), GGGgugugug (SEQ ID NO: 2294), CUAguaggug (SEQ ID NO: 4337), GAGgcaagga (SEQ ID NO: 4338), AAGgcaagac (SEQ ID NO: 4339), AAAgugcggu (SEQ ID NO: 4340), AAGguugguu (SEQ ID NO: 450), GAGguuaaug (SEQ ID NO: 4341), UUGgugaguc (SEQ ID NO: 3005), UCGguuagcu (SEQ ID NO: 2738), GCAguaagca (SEQ ID NO: 4342), AAGgcaagca (SEQ ID NO: 4343), ACAguaagcu (SEQ ID NO: 4344), GAGguaacag (SEQ ID NO: 1878), AAAguacgua (SEQ ID NO: 4345), GAGguaauac (SEQ ID NO: 1896), UUGguaggug (SEQ ID NO: 2980), CUGguuaguc (SEQ ID NO: 4346), GAGgugacgc (SEQ ID NO: 4347), ACAguaagga (SEQ ID NO: 4348), AAUguacuua (SEQ ID NO: 4349), GGGguacagu (SEQ ID NO: 4350), CGUguaugug (SEQ ID NO: 4351), UCCguagguu (SEQ ID NO: 4352), GAGguggucg (SEQ ID NO: 4353), UCAgugaguc (SEQ ID NO: 4354), AAAguaagca (SEQ ID NO: 15), GAGgucuggu (SEQ ID NO: 1999), GAGguaauua (SEQ ID NO: 4355), GUAguaagua (SEQ ID NO: 2323), AAGgugggga (SEQ ID NO: 382), UCUgugagca (SEQ ID NO: 4356), GAAguucgug (SEQ ID NO: 4357), ACGgugaggc (SEQ ID NO: 4358), UCAgugagua (SEQ ID NO: 2699), UAGguaguug (SEQ ID NO: 4359), GGUgucuggg (SEQ ID NO: 4360), GGGguaagug (SEQ ID NO: 2252), GAGguggguu (SEQ ID NO: 2066), UGUgugaguu (SEQ ID NO: 4361), CAUguaagua (SEQ ID NO: 1522), AAGguaggug (SEQ ID NO: 229), AAUguaggag (SEQ ID NO: 4362), GAGgcacguc (SEQ ID NO: 4363), CAAguacauu (SEQ ID NO: 4364), UUGguacaga (SEQ ID NO: 4365), GAGguaguag (SEQ ID NO: 1941), AAAgugaggg (SEQ ID NO: 57), UUGgucagug (SEQ ID NO: 4366), AGGgugaguc (SEQ ID NO: 796), CAGgugaaca (SEQ ID NO: 1317), GGUgugggcc (SEQ ID NO: 4367), CGGgugagcu (SEQ ID NO: 4368), GGGgugaguc (SEQ ID NO: 2283), ACAgugagag (SEQ ID NO: 4369), AGGgugaggu (SEQ ID NO: 794), GCUguaaguc (SEQ ID NO: 2194), AUAguagguu (SEQ ID NO: 4370), CAGgcaugug (SEQ ID NO: 1114), AAGguaaguu (SEQ ID NO: 156), CAGguccgug (SEQ ID NO: 4371), GAGgcaggua (SEQ ID NO: 4372), AUGguggaag (SEQ ID NO: 4373), AUGgugggcg (SEQ ID NO: 4374), GAGgugagaa (SEQ ID NO: 2014), AGUgugagca (SEQ ID NO: 832), UUGguaagua (SEQ ID NO: 2962), CAAguaagca (SEQ ID NO: 4375), GGUgugagcu (SEQ ID NO: 2313), CCCgugggua (SEQ ID NO: 4376), CAGguagaau (SEQ ID NO: 4377), CAGgcugagc (SEQ ID NO: 4378), CUGguggece (SEQ ID NO: 4379), UGAguaagag (SEQ ID NO: 4380), CACguuagcu (SEQ ID NO: 4381), AAGgugaguc (SEQ ID NO: 348), AAGguagcuc (SEQ ID NO: 4382), UCGgugaguu (SEQ ID NO: 4383), GAGgcccuuc (SEQ ID NO: 4384), CAGguuaugc (SEQ ID NO: 4385), CCUguaagcu (SEQ ID NO: 4386), CAGgucuccu (SEQ ID NO: 4387), UAGguaggcu (SEQ ID NO: 4388), GGGguagggg (SEQ ID NO: 4389), AAGguaguga (SEQ ID NO: 4390), GAGguuguug (SEQ ID NO: 4391), CAGguugguu (SEQ ID NO: 1489), AAAguaagcc (SEQ ID NO: 16), ACAgugagug (SEQ ID NO: 562), UGGgugugau (SEQ ID NO: 4392), CCCguaacua (SEQ ID NO: 4393), AAGguguugc (SEQ ID NO: 408), AAAgcuggug (SEQ ID NO: 4394), GAGguauagu (SEQ ID NO: 4395), ACGguaagag (SEQ ID NO: 4396), AUGguacggu (SEQ ID NO: 913), GAGgccaguu (SEQ ID NO: 4397), GAGguaugcg (SEQ ID NO: 1960), UCGgugggag (SEQ ID NO: 4398), AAGguggaua (SEQ ID NO: 372), CCAguguggc (SEQ ID NO: 4399), AGGguaagug (SEQ ID NO: 742), UCUguagguc (SEQ ID NO: 4400), CAGgcaagga (SEQ ID NO: 1102), CGGguaauuu (SEQ ID NO: 1628), AUUgugaguc (SEQ ID NO: 1010), CAGguaaacc (SEQ ID NO: 1121), AAGgucaauu (SEQ ID NO: 4401), AAGgugaaua (SEQ ID NO: 327), GUCguaagaa (SEQ ID NO: 4402), GCGguaaguc (SEQ ID NO: 4403), CUGguagagc (SEQ ID NO: 4404), GAGgucgguc (SEQ ID NO: 4405), CAGguaaaca (SEQ ID NO: 1120), AAGgcaagga (SEQ ID NO: 98), CAGgucgucu (SEQ ID NO: 4406), GGGguagggc (SEQ ID NO: 4407), CUGguacuaa (SEQ ID NO: 1721), GAGguagcug (SEQ ID NO: 1929), CUUgucagcu (SEQ ID NO: 4408), UAGguaaggc (SEQ ID NO: 2489), CUGguauuac (SEQ ID NO: 4409), UAAguacguc (SEQ ID NO: 4410), AAGguaagcc (SEQ ID NO: 146), ACGgugaaag (SEQ ID NO: 4411), CCAgccaaua (SEQ ID NO: 4412), CAGguuuguc (SEQ ID NO: 4413), AAGguauaau (SEQ ID NO: 239), AAGgucuuag (SEQ ID NO: 4414), AGGgugagcu (SEQ ID NO: 791), AAGguuaggg (SEQ ID NO: 4415), CGGguaaauu (SEQ ID NO: 4416), CAGguaacgg (SEQ ID NO: 4417), AGAgugugua (SEQ ID NO: 4418), ACAguaaguu (SEQ ID NO: 549), GAUguaauuu (SEQ ID NO: 4419), GAGguaggga (SEQ ID NO: 1934), UUGgcaagug (SEQ ID NO: 2945), AAAgugagga (SEQ ID NO: 4420), AAGguagugc (SEQ ID NO: 234), AGAguaauuc (SEQ ID NO: 674), GGAguaaaua (SEQ ID NO: 4421), GUGguaccca (SEQ ID NO: 4422), CAGguauugc (SEQ ID NO: 4423), GAUgugaggg (SEQ ID NO: 4424), CAAguaaauc (SEQ ID NO: 1017), CAGgugucuc (SEQ ID NO: 1428), AAGguaacag (SEQ ID NO: 4425), UUGguaaaag (SEQ ID NO: 4426), CAGguaucau (SEQ ID NO: 1240), ACGgugagac (SEQ ID NO: 4427), CUGguaugac (SEQ ID NO: 4428), CAGguucacu (SEQ ID NO: 4429), GAGgugauca (SEQ ID NO: 4430), AGUguaaguc (SEQ ID NO: 4431), AACguaagua (SEQ ID NO: 4432), AAAgugagug (SEQ ID NO: 60), GAGguacagg (SEQ ID NO: 4433), CAAguaauga (SEQ ID NO: 4434), GAUguaagga (SEQ ID NO: 4435), UCAguucccc (SEQ ID NO: 4436), GCGguaagga (SEQ ID NO: 4437), UAGguacuaa (SEQ ID NO: 4438), AAGgugaaag (SEQ ID NO: 321), ACUguaagug (SEQ ID NO: 4439), UGGguaugug (SEQ ID NO: 2862), AUGguaacag (SEQ ID NO: 884), CAGguagggu (SEQ ID NO: 1219), ACAguaagug (SEQ ID NO: 548), AAGgugcucc (SEQ ID NO: 366), AAGgugugcu (SEQ ID NO: 4440), AAGgugguga (SEQ ID NO: 4441), ACGgugcgcc (SEQ ID NO: 4442), AAGguauugc (SEQ ID NO: 4443), GGGguaugug (SEQ ID NO: 2267), CAGgugggcu (SEQ ID NO: 1408), GAGguauguu (SEQ ID NO: 1968), AACgugaaua (SEQ ID NO: 4444), CAGguaaugg (SEQ ID NO: 1154), UAGguaugau (SEQ ID NO: 4445), CAGgcaggug (SEQ ID NO: 1108), GGGguugguc (SEQ ID NO: 4446), AAGguauggg (SEQ ID NO: 262), UAAgugaggc (SEQ ID NO: 4447), CAAgugaucg (SEQ ID NO: 4448), AAAguacggg (SEQ ID NO: 4449), AGAgcuacag (SEQ ID NO: 4450), GAGgugggaa (SEQ ID NO: 2054), CAGguacuuu (SEQ ID NO: 1195), GAGgugagag (SEQ ID NO: 2016), CAGguagguc (SEQ ID NO: 1221), UGGguacagc (SEQ ID NO: 4451), AAGgugucag (SEQ ID NO: 396), AAGgcaagaa (SEQ ID NO: 4452), GAGguaaaca (SEQ ID NO: 4453), AAGguaaagu (SEQ ID NO: 129), AAGguaguca (SEQ ID NO: 4454), CUGguauguc (SEQ ID NO: 4455), GAGguauggg (SEQ ID NO: 1963), AAGguauugu (SEQ ID NO: 273), CUGguacuga (SEQ ID NO: 4456), GAGguaagcu (SEQ ID NO: 1888), UGGgugggua (SEQ ID NO: 2883), CAGguucgug (SEQ ID NO: 4457), AAGguauggu (SEQ ID NO: 4458), CAGgugagca (SEQ ID NO: 1337), UGGguaaauu (SEQ ID NO: 2827), UGUguaggug (SEQ ID NO: 4459), UGUgugagcc (SEQ ID NO: 2921), CUGguaauau (SEQ ID NO: 4460), AAAguauguu (SEQ ID NO: 45), UGUguaagaa (SEQ ID NO: 2903), CUAgugagaa (SEQ ID NO: 4461), AGGguagguc (SEQ ID NO: 757), AAGgugggug (SEQ ID NO: 385), UCGguaagug (SEQ ID NO: 4462), AGUguaaaua (SEQ ID NO: 812), GAUguaagug (SEQ ID NO: 2122), AAGguuagug (SEQ ID NO: 424), UAGguaagca (SEQ ID NO: 2485), CAAgugagaa (SEQ ID NO: 1061), AGUguaagua (SEQ ID NO: 819), CAGgugaauc (SEQ ID NO: 1321), UGGgugagac (SEQ ID NO: 2868), AAGguagggc (SEQ ID NO: 224), CUGguuugug (SEQ ID NO: 1788), GCGguagggc (SEQ ID NO: 4463), GAGguaaucc (SEQ ID NO: 4464), AUUguaauaa (SEQ ID NO: 4465), CUGgugaaua (SEQ ID NO: 1748), AAGguuuaaa (SEQ ID NO: 4466), CCUguacugu (SEQ ID NO: 4467), GCGgugagcg (SEQ ID NO: 4468), AAGguaaucc (SEQ ID NO: 162), UAUgugagua (SEQ ID NO: 2671), CCCgugagug (SEQ ID NO: 1573), CAGgugcaga (SEQ ID NO: 1363), CAGgucaguu (SEQ ID NO: 1284), CAGguaggcu (SEQ ID NO: 4469), AAAguaagug (SEQ ID NO: 23), UAGguugguc (SEQ ID NO: 4470), CAGguugccu (SEQ ID NO: 4471), AAGguaugga (SEQ ID NO: 260), GGUguggacg (SEQ ID NO: 4472), AAAgugagaa (SEQ ID NO: 51), AGGgugagag (SEQ ID NO: 788), GAUguggcau (SEQ ID NO: 4473), UCGguaaggu (SEQ ID NO: 4474), GAGgugcguc (SEQ ID NO: 4475), CGGgugaguc (SEQ ID NO: 4476), AAGguacggg (SEQ ID NO: 190), GAGguucuug (SEQ ID NO: 4477), AAGgugcuug (SEQ ID NO: 4478), UAGguaugua (SEQ ID NO: 2551), AUGgucagca (SEQ ID NO: 4479), CGGguacuca (SEQ ID NO: 4480), AGGgugagga (SEQ ID NO: 792), AUCgugagua (SEQ ID NO: 869), UCAguaagua (SEQ ID NO: 2689), UAGguaaaua (SEQ ID NO: 2469), AAGguaauug (SEQ ID NO: 170), GAAgucagug (SEQ ID NO: 1835), CAGguacaaa (SEQ ID NO: 1160), AAAguuaauc (SEQ ID NO: 4481), AGCgugagcg (SEQ ID NO: 4482), CCGgcuggug (SEQ ID NO: 4483), AGUguaauuu (SEQ ID NO: 4484), UGAgccacuc (SEQ ID NO: 4485), GGGgucugua (SEQ ID NO: 4486), AUGgcauguc (SEQ ID NO: 4487), CGGguaaaga (SEQ ID NO: 4488), AGGguagcau (SEQ ID NO: 4489), CGGguaggag (SEQ ID NO: 1631), GAGguucgug (SEQ ID NO: 4490), UAAguuauuc (SEQ ID NO: 4491), UAUguaagau (SEQ ID NO: 2650), AAGguaguuu (SEQ ID NO: 237), CAGgugguau (SEQ ID NO: 4492), GUGguaauga (SEQ ID NO: 2355), AAGgugauuu (SEQ ID NO: 359), CAGgugaagu (SEQ ID NO: 4493), GUAguaauua (SEQ ID NO: 4494), AUGguuggug (SEQ ID NO: 4495), CCAguaagug (SEQ ID NO: 1557), UAGgugagag (SEQ ID NO: 2589), AUGgugaggc (SEQ ID NO: 959), AAAguuagug (SEQ ID NO: 72), AAGgugccuu (SEQ ID NO: 4496), UAGguaugag (SEQ ID NO: 2546), CAGgugugac (SEQ ID NO: 1431), CUGguggguu (SEQ ID NO: 1774), AUGguaagga (SEQ ID NO: 896), UCUguaagaa (SEQ ID NO: 2740), UCCgugaguu (SEQ ID NO: 4497), AAAgcaggua (SEQ ID NO: 4498), UAUgugagug (SEQ ID NO: 2672), CAGguggagg (SEQ ID NO: 4499), CAGguuagac (SEQ ID NO: 4500), AUAguaagac (SEQ ID NO: 846), AAGguguugu (SEQ ID NO: 4501), GAGgucugug (SEQ ID NO: 4502), AAGguaagau (SEQ ID NO: 144), CAUguaaguu (SEQ ID NO: 1524), CUGguaauua (SEQ ID NO: 4503), CAGguaggcg (SEQ ID NO: 4504), AGAguaaguc (SEQ ID NO: 669), UGGgugagga (SEQ ID NO: 2872), AAUguaggua (SEQ ID NO: 4505), UAGguuagca (SEQ ID NO: 4506), GGGguaggua (SEQ ID NO: 2258), GAGguauugc (SEQ ID NO: 4507), AUUguacaca (SEQ ID NO: 4508), GAAguaggua (SEQ ID NO: 4509), GGAguaagcu (SEQ ID NO: 2212), UAGguaugug (SEQ ID NO: 2553), GAGgugaaua (SEQ ID NO: 2007), GAGgugggau (SEQ ID NO: 2056), AAGguaaucu (SEQ ID NO: 163), GGUgugaguu (SEQ ID NO: 4510), AACgugaguu (SEQ ID NO: 4511), GAGguaaccg (SEQ ID NO: 4512), UAGguaagga (SEQ ID NO: 2488), AUUguaagaa (SEQ ID NO: 4513), UGGgugagca (SEQ ID NO: 2870), AAGguaaggc (SEQ ID NO: 150), CCAguaucgu (SEQ ID NO: 4514), CCGgugggug (SEQ ID NO: 4515), GAGguagugu (SEQ ID NO: 4516), ACGgugggaa (SEQ ID NO: 4517), GAGgugaccu (SEQ ID NO: 2011), CACguaugua (SEQ ID NO: 4518), AGGgugggga (SEQ ID NO: 799), AAUguaaguc (SEQ ID NO: 490), AAAguuaagu (SEQ ID NO: 70), CAUgugagug (SEQ ID NO: 1541), AGAguauguc (SEQ ID NO: 694), GCGguaugac (SEQ ID NO: 4519), CGGgugaguu (SEQ ID NO: 1643), CCGguauuuu (SEQ ID NO: 4520), GAGguagaac (SEQ ID NO: 4521), UAGguaugaa (SEQ ID NO: 2545), CAGgcgcgug (SEQ ID NO: 4522), CAAguaaguc (SEQ ID NO: 1027), AGUguaagau (SEQ ID NO: 816), AAGguucuac (SEQ ID NO: 4523), CCAguaagua (SEQ ID NO: 1555), GAGguagcag (SEQ ID NO: 4524), CAGgucuguu (SEQ ID NO: 1312), CAGguacaau (SEQ ID NO: 1162), CCGguaaaga (SEQ ID NO: 1574), UAAgugcugu (SEQ ID NO: 4525), AGGgugagaa (SEQ ID NO: 786), CUCguaaggu (SEQ ID NO: 4526), CAGgucagcu (SEQ ID NO: 4527), CAGguaaggc (SEQ ID NO: 1144), AGGgugcagg (SEQ ID NO: 4528), GAGgugaaac (SEQ ID NO: 4529), AGGguaagua (SEQ ID NO: 740), AAUguaugcc (SEQ ID NO: 4530), AAGguaagca (SEQ ID NO: 145), ACGguacggu (SEQ ID NO: 587), AAGguaauga (SEQ ID NO: 164), UCUgcucaau (SEQ ID NO: 4531), ACGguaaugu (SEQ ID NO: 4532), AAGguaguug (SEQ ID NO: 4533), ACGguaagug (SEQ ID NO: 580), CAGgugauga (SEQ ID NO: 4534), GAGguaacac (SEQ ID NO: 4535), GAGguaggua (SEQ ID NO: 1937), CAGguaccuu (SEQ ID NO: 1179), CAGguaauaa (SEQ ID NO: 1150), UUGgugggug (SEQ ID NO: 3016), CUGguaauga (SEQ ID NO: 1710), UAGguaaguc (SEQ ID NO: 2492), AGGgugugac (SEQ ID NO: 4536), GAGgcaauaa (SEQ ID NO: 4537), GUGguaaagc (SEQ ID NO: 4538), CUGgugggcg (SEQ ID NO: 4539), GAUguauguu (SEQ ID NO: 2128), AGGgugagac (SEQ ID NO: 787), UCGgucagca (SEQ ID NO: 4540), AUGgugauua (SEQ ID NO: 4541), CGAgugugua (SEQ ID NO: 4542), CAGguuggug (SEQ ID NO: 1488), AGCgcaagua (SEQ ID NO: 4543), UGGguacguu (SEQ ID NO: 4544), GAGguauuug (SEQ ID NO: 1974), AGUguacaua (SEQ ID NO: 4545), AUGguaagua (SEQ ID NO: 898), ACAguagguu (SEQ ID NO: 4546), AAGgugagag (SEQ ID NO: 337), UUGgugaagu (SEQ ID NO: 4547), AAAguaugua (SEQ ID NO: 43), UGGguaagga (SEQ ID NO: 4548), UAGgugccuu (SEQ ID NO: 4549), and CCUgugggug (SEQ ID NO: 4550). Additional exemplary gene sequences and splice site sequences (e.g., 5′ splice site sequences) include UCCguaaguu (SEQ ID NO: 4551), GUGguaaacg (SEQ ID NO: 4552), CGGgugcggu (SEQ ID NO: 4553), CAUguacuuc (SEQ ID NO: 4554), AGAguaaagg (SEQ ID NO: 4555), CGCgugagua (SEQ ID NO: 4556), AGAgugggca (SEQ ID NO: 4557), AGAguaagcc (SEQ ID NO: 4558), AGAguaaaca (SEQ ID NO: 4559), GUGguuauga (SEQ ID NO: 4560), AGGguaauaa (SEQ ID NO: 4561), UGAguaagac (SEQ ID NO: 4562), AGAguuuguu (SEQ ID NO: 4563), CGGgucugca (SEQ ID NO: 4564), CAGguaaguc (SEQ ID NO: 4565), AAGguagaau (SEQ ID NO: 4566), CAGgucccuc (SEQ ID NO: 4567), AGAguaaugg (SEQ ID NO: 4568), GAGgucuaag (SEQ ID NO: 4569), AGAguagagu (SEQ ID NO: 4570), AUGgucagua (SEQ ID NO: 4571), GAGgccuggg (SEQ ID NO: 4572), AAGguguggc (SEQ ID NO: 4573), AGAgugaucu (SEQ ID NO: 4574), AAGguaucca (SEQ ID NO: 4575), UUCguaagua (SEQ ID NO: 4576), UAAgugggug (SEQ ID NO: 4577), GCCgugaacg (SEQ ID NO: 4578), GAGguugugg (SEQ ID NO: 4579), UAUguaugca (SEQ ID NO: 4580), UGUguaacaa (SEQ ID NO: 4581), AGGguauuag (SEQ ID NO: 4582), UGAguauauc (SEQ ID NO: 4583), AGAguuugug (SEQ ID NO: 4584), GAGgucgcug (SEQ ID NO: 4585), GAGgucaucg (SEQ ID NO: 4586), ACGguaaagc (SEQ ID NO: 4587), UGAguacuug (SEQ ID NO: 4588), CGAgucgccg (SEQ ID NO: 4589), CUGguacguc (SEQ ID NO: 4590), AGGguauugc (SEQ ID NO: 4591), GAAgugaaug (SEQ ID NO: 4592), CAGaugaguc (SEQ ID NO: 4593), UGGguauugg (SEQ ID NO: 4594), UGAguaaaga (SEQ ID NO: 4595), GUGguuccug (SEQ ID NO: 4596), UGAgcaagua (SEQ ID NO: 4597), UAUguaagag (SEQ ID NO: 4598), AAGgucuugc (SEQ ID NO: 4599), AAAgcaugug (SEQ ID NO: 4600), AGAguacagu (SEQ ID NO: 4601), GUGguaaucc (SEQ ID NO: 4602), CAGguagagg (SEQ ID NO: 4603), AAGguacaac (SEQ ID NO: 4604), UGGgcagcau (SEQ ID NO: 4605), CCGgucauca (SEQ ID NO: 4606), CCGguuugua (SEQ ID NO: 4607), UGAguaaggg (SEQ ID NO: 4608), GAAguaugua (SEQ ID NO: 4609), GGGguagcuc (SEQ ID NO: 4610), GCUguacaua (SEQ ID NO: 4611), CUGgucucuu (SEQ ID NO: 4612), GUGguaaaug (SEQ ID NO: 4613), AUCguaagug (SEQ ID NO: 4614), GAGgcaugua (SEQ ID NO: 4615), AAGgucuccc (SEQ ID NO: 4616), UGGgugcguu (SEQ ID NO: 4617), UGUguagguu (SEQ ID NO: 4618), GAAgugagca (SEQ ID NO: 4619), GGUguaauuu (SEQ ID NO: 4620), CUGgugaaau (SEQ ID NO: 4621), AUCguaaguc (SEQ ID NO: 4622), AGAguaaucc (SEQ ID NO: 4623), GGAguagguc (SEQ ID NO: 4624), GAGguaccaa (SEQ ID NO: 4625), CUUguaggug (SEQ ID NO: 4626), AAGguauaag (SEQ ID NO: 4627), AGAguuggua (SEQ ID NO: 4628), AUGguuugug (SEQ ID NO: 4629), UGGgucagau (SEQ ID NO: 4630), AGAguaggac (SEQ ID NO: 4631), AGAguagugu (SEQ ID NO: 4632), AGAguaggag (SEQ ID NO: 4633), CAGgucucua (SEQ ID NO: 4634), AAGguggaug (SEQ ID NO: 4635), UGGguaucaa (SEQ ID NO: 4636), GAUguaugga (SEQ ID NO: 4637), AAGguguuuc (SEQ ID NO: 4638), GCAguguaaa (SEQ ID NO: 4639), UUAguaugua (SEQ ID NO: 4640), UCUguaugca (SEQ ID NO: 4641), AAUguaaaau (SEQ ID NO: 4642), AGAguaaauu (SEQ ID NO: 4643), GGGguacuuu (SEQ ID NO: 4644), GAAguuugau (SEQ ID NO: 4645), AAAguagauu (SEQ ID NO: 4646), UGUguagagu (SEQ ID NO: 4647), UGGguaagcg (SEQ ID NO: 4648), CGGguucagg (SEQ ID NO: 4649), AGGguacgac (SEQ ID NO: 4650), UCGguaagaa (SEQ ID NO: 4651), AGGguuggca (SEQ ID NO: 4652), AAAguacagu (SEQ ID NO: 4653), UAAguuaagg (SEQ ID NO: 4654), AUGguaaugu (SEQ ID NO: 4655), GUGguuuuac (SEQ ID NO: 4656), AGAguaacaa (SEQ ID NO: 4657), AAGguagccc (SEQ ID NO: 4658), GCGgugaggc (SEQ ID NO: 4659), AUGguucagc (SEQ ID NO: 4660), AAGguacuua (SEQ ID NO: 4661), AAGguccgug (SEQ ID NO: 4662), UAGguaagcg (SEQ ID NO: 4663), AUGguaccuu (SEQ ID NO: 4664), GCCguggugg (SEQ ID NO: 4665), CUGgugeguc (SEQ ID NO: 4666), CAGguggaaa (SEQ ID NO: 4667), AAAgucugua (SEQ ID NO: 4668), GAGguaaccc (SEQ ID NO: 4669), AGAguauggg (SEQ ID NO: 4670), UAUgccccug (SEQ ID NO: 4671), AAGgugccag (SEQ ID NO: 4672), ACGgugcggc (SEQ ID NO: 4673), AGGguacuga (SEQ ID NO: 4674), AGAguaagcg (SEQ ID NO: 4675), CUGgcaaggg (SEQ ID NO: 4676), CCAgugugug (SEQ ID NO: 4677), GAGguagacg (SEQ ID NO: 4678), CGGgugcggg (SEQ ID NO: 4679), GAUguaagcu (SEQ ID NO: 4680), AUUguauuua (SEQ ID NO: 4681), UGCgugagug (SEQ ID NO: 4682), CUGgucuaua (SEQ ID NO: 4683), GAGgugcuag (SEQ ID NO: 4684), GAGgugccau (SEQ ID NO: 4685), CAGguacguc (SEQ ID NO: 4686), GAGguucagc (SEQ ID NO: 4687), AACguaagaa (SEQ ID NO: 4688), AGAguaguac (SEQ ID NO: 4689), AAGguaacgg (SEQ ID NO: 4690), UAGgugugac (SEQ ID NO: 4691), CCGguaauag (SEQ ID NO: 4692), CAGguaccag (SEQ ID NO: 4693), UUUguaauug (SEQ ID NO: 4694), AAUguacgaa (SEQ ID NO: 4695), CAGguaauga (SEQ ID NO: 4696), AUCgucaagg (SEQ ID NO: 4697), CUGguagaug (SEQ ID NO: 4698), GGGgugcagu (SEQ ID NO: 4699), AGUgugagaa (SEQ ID NO: 4700), GGGguuuuau (SEQ ID NO: 4701), CCUguccccu (SEQ ID NO: 4702), AUUgugaagu (SEQ ID NO: 4703), AAGguaaacg (SEQ ID NO: 4704), UACgucgugg (SEQ ID NO: 4705), AAGgugccau (SEQ ID NO: 4706), GGGgucccag (SEQ ID NO: 4707), UAUguauggu (SEQ ID NO: 4708), CGGguaauua (SEQ ID NO: 4709), CGGguacucc (SEQ ID NO: 4710), CAGgugacuu (SEQ ID NO: 4711), AGUguggguu (SEQ ID NO: 4712), AGAguauggc (SEQ ID NO: 4713), AAGgccaaca (SEQ ID NO: 4714), AAAgcaagua (SEQ ID NO: 4715), UCAguagguc (SEQ ID NO: 4716), GUGguggcgg (SEQ ID NO: 4717), CAUguauccu (SEQ ID NO: 4718), UCGgugagcc (SEQ ID NO: 4719), AUAguugggu (SEQ ID NO: 4720), AAUguuagcu (SEQ ID NO: 4721), AUGgugaaug (SEQ ID NO: 4722), CGGguaaugu (SEQ ID NO: 4723), UCUguaggug (SEQ ID NO: 4724), CCGgugaggc (SEQ ID NO: 4725), UGAguccacu (SEQ ID NO: 4726), CUAguaagag (SEQ ID NO: 4727), CGGguggggc (SEQ ID NO: 4728), CGAguaagca (SEQ ID NO: 4729), UGUgccaauu (SEQ ID NO: 4730), UCGguaagcc (SEQ ID NO: 4731), UAUguaggug (SEQ ID NO: 4732), UUGgugggcc (SEQ ID NO: 4733), GAGgcugggc (SEQ ID NO: 4734), AGAguaacuu (SEQ ID NO: 4735), ACGguagguc (SEQ ID NO: 4736), CAGgcccaga (SEQ ID NO: 4737), CCGguggguu (SEQ ID NO: 4738), AAGgugacgg (SEQ ID NO: 4739), GGGguacagc (SEQ ID NO: 4740), CAUguaaguc (SEQ ID NO: 4741), AUUgugagaa (SEQ ID NO: 4742), UGUguaagga (SEQ ID NO: 4743), UUUguaagau (SEQ ID NO: 4744), AGGgucauuu (SEQ ID NO: 4745), UGGguuuguu (SEQ ID NO: 4746), CGAguaagcc (SEQ ID NO: 4747), GUGgugugua (SEQ ID NO: 4748), AUGguauaac (SEQ ID NO: 4749), UGGguacgua (SEQ ID NO: 4750), AAAguagagu (SEQ ID NO: 4751), UCGguaacug (SEQ ID NO: 4752), AGAguaauga (SEQ ID NO: 4753), AUGguggguc (SEQ ID NO: 4754), AGAguaauau (SEQ ID NO: 4755), CAGguacugg (SEQ ID NO: 4756), UAAgucaguu (SEQ ID NO: 4757), GCGguagaga (SEQ ID NO: 4758), AAGgugaugg (SEQ ID NO: 4759), ACAguauguu (SEQ ID NO: 4760), GAUguacguc (SEQ ID NO: 4761), UAGguuucuc (SEQ ID NO: 4762), GAGgcauggg (SEQ ID NO: 4763), AUAgcuaagu (SEQ ID NO: 4764), GUAgucugua (SEQ ID NO: 4765), AAGgugaacg (SEQ ID NO: 4766), GUGguggucg (SEQ ID NO: 4767), GAGguugauc (SEQ ID NO: 4768), UGAguggguu (SEQ ID NO: 4769), ACUguacgug (SEQ ID NO: 4770), CUGgugacug (SEQ ID NO: 4771), CAAguuaagc (SEQ ID NO: 4772), GAGguaccca (SEQ ID NO: 4773), AACguaacuu (SEQ ID NO: 4774), CAGguuacua (SEQ ID NO: 4775), AGAguuaguc (SEQ ID NO: 4776), UGGgcacguc (SEQ ID NO: 4777), AGUguauggu (SEQ ID NO: 4778), AAGguugcaa (SEQ ID NO: 4779), CAGguuguua (SEQ ID NO: 4780), AAGgcauccc (SEQ ID NO: 4781), GAUguaaggc (SEQ ID NO: 4782), AGGguacggg (SEQ ID NO: 4783), GAGgucaaag (SEQ ID NO: 4784), CAAgugagcg (SEQ ID NO: 4785), AGAguaaucu (SEQ ID NO: 4786), UCGguagcug (SEQ ID NO: 4787), AAAguaguag (SEQ ID NO: 4788), CAGguucguc (SEQ ID NO: 4789), CGUguaugaa (SEQ ID NO: 4790), AGUguaaaaa (SEQ ID NO: 4791), AAGgucucac (SEQ ID NO: 4792), UAGguggagc (SEQ ID NO: 4793), UGAguaggug (SEQ ID NO: 4794), AGAguaugcc (SEQ ID NO: 4795), GAGguugcau (SEQ ID NO: 4796), CAAguaagag (SEQ ID NO: 4797), UCUgugugcc (SEQ ID NO: 4798), GAGgugaugc (SEQ ID NO: 4799), GGGgugauaa (SEQ ID NO: 4800), CCCgugagcc (SEQ ID NO: 4801), AGAguaacug (SEQ ID NO: 4802), GCGguaagua (SEQ ID NO: 4803), AGAguacauc (SEQ ID NO: 4804), UCGgucuggg (SEQ ID NO: 4805), UAAguaucuc (SEQ ID NO: 4806), GGCguagguu (SEQ ID NO: 4807), AGAguacgcc (SEQ ID NO: 4808), GAUgucuucu (SEQ ID NO: 4809), AGGgcaaggu (SEQ ID NO: 4810), CGAguaugau (SEQ ID NO: 4811), AUGguagagu (SEQ ID NO: 4812), CAAguacgag (SEQ ID NO: 4813), UCGguaugau (SEQ ID NO: 4814), CCGguguguu (SEQ ID NO: 4815), AGGgucugug (SEQ ID NO: 4816), GGAguaggcu (SEQ ID NO: 4817), AAGgucuaug (SEQ ID NO: 4818), GCAgugcgug (SEQ ID NO: 4819), UGGgugagaa (SEQ ID NO: 4820), AGGguaaagu (SEQ ID NO: 4821), GAGguaggac (SEQ ID NO: 4822), CUAguaagca (SEQ ID NO: 4823), UUAguaggcu (SEQ ID NO: 4824), CUGgugggau (SEQ ID NO: 4825), CUGguuagua (SEQ ID NO: 4826), AAGguacgug (SEQ ID NO: 4827), CGGgugagau (SEQ ID NO: 4828), AAGgugcaug (SEQ ID NO: 4829), AAUgugggcu (SEQ ID NO: 4830), CAGguugacu (SEQ ID NO: 4831), CAGguuacag (SEQ ID NO: 4832), GCGguaacau (SEQ ID NO: 4833), AUUgucaguc (SEQ ID NO: 4834), CAAguauaca (SEQ ID NO: 4835), GAUgucegcc (SEQ ID NO: 4836), AAGgugcgga (SEQ ID NO: 4837), AACguaagag (SEQ ID NO: 4838), UGGguuggua (SEQ ID NO: 4839), CAAguguaag (SEQ ID NO: 4840), GUGguaacgu (SEQ ID NO: 4841), CUGgugauca (SEQ ID NO: 4842), AGGguggggc (SEQ ID NO: 4843), UCGguaaaga (SEQ ID NO: 4844), CAGguacacc (SEQ ID NO: 4845), CGGguaaggg (SEQ ID NO: 4846), CAAguuugcu (SEQ ID NO: 4847), ACAgugcgug (SEQ ID NO: 4848), UUGguauggg (SEQ ID NO: 4849), GAGgcucauc (SEQ ID NO: 4850), CUGguaauag (SEQ ID NO: 4851), AUGguggaua (SEQ ID NO: 4852), UCAgugaauu (SEQ ID NO: 4853), AAUguaauua (SEQ ID NO: 4854), GCAgucuaaa (SEQ ID NO: 4855), AAGguauucu (SEQ ID NO: 4856), GAGgucauca (SEQ ID NO: 4857), UGGguccaug (SEQ ID NO: 4858), AGAguuugua (SEQ ID NO: 4859), AGGguagacu (SEQ ID NO: 4860), AAGguaggac (SEQ ID NO: 4861), UGUguguuga (SEQ ID NO: 4862), UCAguacgug (SEQ ID NO: 4863), AUGgucucuc (SEQ ID NO: 4864), UGAguuagua (SEQ ID NO: 4865), UGAguaaagu (SEQ ID NO: 4866), GAGgugaccg (SEQ ID NO: 4867), GAGguauauc (SEQ ID NO: 4868), CAGgugccau (SEQ ID NO: 4869), AGAgugguga (SEQ ID NO: 4870), GUUguaagaa (SEQ ID NO: 4871), AGAguaaaua (SEQ ID NO: 4872), AGGgugaagg (SEQ ID NO: 4873), CUGguagauu (SEQ ID NO: 4874), GAGguucagg (SEQ ID NO: 4875), AGGgucuuca (SEQ ID NO: 4876), CUGguaaccu (SEQ ID NO: 4877), ACAguacuga (SEQ ID NO: 4878), AGAguggguc (SEQ ID NO: 4879), AUGguaugag (SEQ ID NO: 4880), AAGguuauau (SEQ ID NO: 4881), AGAguauagu (SEQ ID NO: 4882), AAAguaugaa (SEQ ID NO: 4883), UAGguggcua (SEQ ID NO: 4884), ACCguauggg (SEQ ID NO: 4885), AAAguauaau (SEQ ID NO: 4886), UUUguauggc (SEQ ID NO: 4887), GGGgucgcgu (SEQ ID NO: 4888), GUGgugguuu (SEQ ID NO: 4889), CAGguuugac (SEQ ID NO: 4890), GGAguaggcg (SEQ ID NO: 4891), GAGguacccu (SEQ ID NO: 4892), AUGgugugca (SEQ ID NO: 4893), GUGguuggug (SEQ ID NO: 4894), AAAguaugcu (SEQ ID NO: 4895), UAAguuacau (SEQ ID NO: 4896), ACAguaugag (SEQ ID NO: 4897), GGAguauguu (SEQ ID NO: 4898), UUUgugagaa (SEQ ID NO: 4899), AAUgugcguu (SEQ ID NO: 4900), CAGguagagu (SEQ ID NO: 4901), AUGguguuaa (SEQ ID NO: 4902), CAUgugeguc (SEQ ID NO: 4903), AUAguuggau (SEQ ID NO: 4904), GAGguacgua (SEQ ID NO: 4905), GUUgugagaa (SEQ ID NO: 4906), CAAguacauc (SEQ ID NO: 4907), GAGguaguuu (SEQ ID NO: 4908), ACUguacaga (SEQ ID NO: 4909), CCGguuguga (SEQ ID NO: 4910), UGGgucagug (SEQ ID NO: 4911), GUAguaagaa (SEQ ID NO: 4912), GACguacuuu (SEQ ID NO: 4913), AGAgucaguc (SEQ ID NO: 4914), UAGguuaguu (SEQ ID NO: 4915), AGGgcagcag (SEQ ID NO: 4916), AAGguccuac (SEQ ID NO: 4917), AAUguaauug (SEQ ID NO: 4918), CAGgugcggg (SEQ ID NO: 4919), CUGguaaugg (SEQ ID NO: 4920), CAAguagccc (SEQ ID NO: 4921), GAAgucaguu (SEQ ID NO: 4922), ACAguaauug (SEQ ID NO: 4923), UUAguuagua (SEQ ID NO: 4924), CCUguauuuu (SEQ ID NO: 4925), AUCguaagaa (SEQ ID NO: 4926), CCAgugagca (SEQ ID NO: 4927), GAAguaaggc (SEQ ID NO: 4928), UGAgugggua (SEQ ID NO: 4929), UCAgugguag (SEQ ID NO: 4930), UCUguacagg (SEQ ID NO: 4931), CGAgugagug (SEQ ID NO: 4932), UCCguaugug (SEQ ID NO: 4933), CAUgccguuu (SEQ ID NO: 4934), AAAgugacuu (SEQ ID NO: 4935), AGAguaggca (SEQ ID NO: 4936), GAAguaagag (SEQ ID NO: 4937), CAGgcagguu (SEQ ID NO: 4938), UUGguagagc (SEQ ID NO: 4939), AAGguggaaa (SEQ ID NO: 4940), GAGgcagguc (SEQ ID NO: 4941), AUGguacgac (SEQ ID NO: 4942), AGGguaggaa (SEQ ID NO: 4943), AGGguaggua (SEQ ID NO: 4944), UUGguaaggu (SEQ ID NO: 4945), AUGguacaga (SEQ ID NO: 4946), CAGguagagc (SEQ ID NO: 4947), UAGguaaggu (SEQ ID NO: 4948), GGGguuagag (SEQ ID NO: 4949), AAGguaucaa (SEQ ID NO: 4950), GAGguagccc (SEQ ID NO: 4951), CAGgugccuc (SEQ ID NO: 4952), GCAguaagag (SEQ ID NO: 4953), ACGguagagu (SEQ ID NO: 4954), UGGguaaugg (SEQ ID NO: 4955), CUGgucaguu (SEQ ID NO: 4956), GUGguacauu (SEQ ID NO: 4957), AAAguagguu (SEQ ID NO: 4958), AAGgccaaga (SEQ ID NO: 4959), CGGgugggca (SEQ ID NO: 4960), ACGguccggg (SEQ ID NO: 4961), CGAguaugag (SEQ ID NO: 4962), CUGguaugcc (SEQ ID NO: 4963), GAGguggaug (SEQ ID NO: 4964), CAGgccuuuc (SEQ ID NO: 4965), AAAguacauc (SEQ ID NO: 4966), AAAguaauca (SEQ ID NO: 4967), GAGguaacug (SEQ ID NO: 4968), CUGguaaaga (SEQ ID NO: 4969), CGUguaagca (SEQ ID NO: 4970), UGGgcaagua (SEQ ID NO: 4971), GCGguggcga (SEQ ID NO: 4972), GAGguggccg (SEQ ID NO: 4973), AUUgcaugca (SEQ ID NO: 4974), ACGgugacug (SEQ ID NO: 4975), CAGgucagau (SEQ ID NO: 4976), AGAguaacuc (SEQ ID NO: 4977), UGAguaacag (SEQ ID NO: 4978), AAGguacccg (SEQ ID NO: 4979), AGGguaggcu (SEQ ID NO: 4980), GGGgcaggac (SEQ ID NO: 4981), CCUguaagug (SEQ ID NO: 4982), AUUguaagug (SEQ ID NO: 4983), ACUguacgag (SEQ ID NO: 4984), GUAguagugu (SEQ ID NO: 4985), AGAguaugag (SEQ ID NO: 4986), UCAguguggg (SEQ ID NO: 4987), UGGguauaua (SEQ ID NO: 4988), UAGguagcua (SEQ ID NO: 4989), GGGguaaaga (SEQ ID NO: 4990), AGGguuacuu (SEQ ID NO: 4991), CAUguaaaug (SEQ ID NO: 4992), GGAguaguaa (SEQ ID NO: 4993), CAGgucaauc (SEQ ID NO: 4994), CGGguuagug (SEQ ID NO: 4995), UAGguacaug (SEQ ID NO: 4996), UAGguuaaga (SEQ ID NO: 4997), UGGguaccuu (SEQ ID NO: 4998), CGGguggaca (SEQ ID NO: 4999), CAGgucuuac (SEQ ID NO: 5000), AAGguggagc (SEQ ID NO: 5001), AUGguaacca (SEQ ID NO: 5002), UCGguaaguu (SEQ ID NO: 5003), UAUguacaaa (SEQ ID NO: 5004), AAUguagauu (SEQ ID NO: 5005), GUAgcuagua (SEQ ID NO: 5006), AAGguauugg (SEQ ID NO: 5007), GAGgucuuug (SEQ ID NO: 5008), GAAguucagg (SEQ ID NO: 5009), UGGguaucac (SEQ ID NO: 5010), AGAguacugg (SEQ ID NO: 5011), CAGguuaaug (SEQ ID NO: 5012), AGGguacgug (SEQ ID NO: 5013), AGGgcacagg (SEQ ID NO: 5014), CUGguuaguu (SEQ ID NO: 5015), UUGguacgag (SEQ ID NO: 5016), ACGgugauca (SEQ ID NO: 5017), CCUgugagag (SEQ ID NO: 5018), GAGgugaagu (SEQ ID NO: 5019), AAGguacauc (SEQ ID NO: 5020), UCUguaugug (SEQ ID NO: 5021), UUGguggaag (SEQ ID NO: 5022), UGGgcagguu (SEQ ID NO: 5023), GAAguggagc (SEQ ID NO: 5024), ACAguaagac (SEQ ID NO: 5025), CGGguaccaa (SEQ ID NO: 5026), CAAguacguc (SEQ ID NO: 5027), AGAgugaggg (SEQ ID NO: 5028), CGGguaagaa (SEQ ID NO: 5029), AAUguaggug (SEQ ID NO: 5030), AUCgugugcu (SEQ ID NO: 5031), UAGgucaugg (SEQ ID NO: 5032), CAGguuuuga (SEQ ID NO: 5033), AAGgcaugca (SEQ ID NO: 5034), GAGgugcugc (SEQ ID NO: 5035), AAGguuaaua (SEQ ID NO: 5036), CAGguucauc (SEQ ID NO: 5037), GCGguaggug (SEQ ID NO: 5038), GACgugagua (SEQ ID NO: 5039), CAGgucuacu (SEQ ID NO: 5040), UUGguaugag (SEQ ID NO: 5041), AGCgugggca (SEQ ID NO: 5042), AUGguaaggu (SEQ ID NO: 5043), AUGguaccuc (SEQ ID NO: 5044), UUGguauggu (SEQ ID NO: 5045), UAUguaugaa (SEQ ID NO: 5046), UGGguauggg (SEQ ID NO: 5047), GAUguaaaua (SEQ ID NO: 5048), CCGguaaguu (SEQ ID NO: 5049), GAGgucugaa (SEQ ID NO: 5050), GAGgugcgag (SEQ ID NO: 5051), CUGgucagcc (SEQ ID NO: 5052), CAGguuuugu (SEQ ID NO: 5053), CGGguggugu (SEQ ID NO: 5054), UAAguuagua (SEQ ID NO: 5055), UUUgugugug (SEQ ID NO: 5056), CAGguuaacc (SEQ ID NO: 5057), UUGguacuuu (SEQ ID NO: 5058), GCUguaaggc (SEQ ID NO: 5059), AGGguggcug (SEQ ID NO: 5060), GAUguaaaaa (SEQ ID NO: 5061), AAGgucaaaa (SEQ ID NO: 5062), CAGguagcgc (SEQ ID NO: 5063), CAGguuuggc (SEQ ID NO: 5064), GAGgugguuu (SEQ ID NO: 5065), CGGguaaaua (SEQ ID NO: 5066), CUGguucggu (SEQ ID NO: 5067), GGAgugagcc (SEQ ID NO: 5068), AAGgugcgcg (SEQ ID NO: 5069), GAAguacauc (SEQ ID NO: 5070), AGUgucugua (SEQ ID NO: 5071), CCCgugagcu (SEQ ID NO: 5072), GAGguucaca (SEQ ID NO: 5073), CUAgugggua (SEQ ID NO: 5074), GAGguaacua (SEQ ID NO: 5075), UCGguauguc (SEQ ID NO: 5076), UAAguauuug (SEQ ID NO: 5077), CAGguaagcg (SEQ ID NO: 5078), GAGgugguaa (SEQ ID NO: 5079), CGAguaagag (SEQ ID NO: 5080), CCGguaagcu (SEQ ID NO: 5081), GAGgucuugu (SEQ ID NO: 5082), AAGguggguc (SEQ ID NO: 5083), CACguaagug (SEQ ID NO: 5084), AGUguaauga (SEQ ID NO: 5085), AAAgugugua (SEQ ID NO: 5086), GGAgugccaa (SEQ ID NO: 5087), CACgugaguu (SEQ ID NO: 5088), AAGguuggau (SEQ ID NO: 5089), UAUguaaaua (SEQ ID NO: 5090), CUGguaggaa (SEQ ID NO: 5091), UAUguaaacu (SEQ ID NO: 5092), AAUguauuuu (SEQ ID NO: 5093), CUGgcaagug (SEQ ID NO: 5094), UGUgugguau (SEQ ID NO: 5095), UAUguauguu (SEQ ID NO: 5096), UUGgugacuc (SEQ ID NO: 5097), GGAguaaggu (SEQ ID NO: 5098), AAGguagaug (SEQ ID NO: 5099), UGGguagggu (SEQ ID NO: 5100), AAUguaauuc (SEQ ID NO: 5101), GUGguauggc (SEQ ID NO: 5102), GGAguggguu (SEQ ID NO: 5103), AGGguaccac (SEQ ID NO: 5104), UAGgugacag (SEQ ID NO: 5105), ACAguaggca (SEQ ID NO: 5106), AUGguuugaa (SEQ ID NO: 5107), GCAguaacua (SEQ ID NO: 5108), CCGguaggua (SEQ ID NO: 5109), AGAguaggcc (SEQ ID NO: 5110), AAGguugaca (SEQ ID NO: 5111), CUGgugugua (SEQ ID NO: 5112), GAAgucuguc (SEQ ID NO: 5113), UGGgcucgga (SEQ ID NO: 5114), CAGguagccu (SEQ ID NO: 5115), AGAguaggua (SEQ ID NO: 5116), UAAguauguc (SEQ ID NO: 5117), CUGguauauc (SEQ ID NO: 5118), GAGguguguu (SEQ ID NO: 5119), AUGgugcaug (SEQ ID NO: 5120), AAGguacgcc (SEQ ID NO: 5121), UGAguaacua (SEQ ID NO: 5122), GAGgugacag (SEQ ID NO: 5123), GUUguccugu (SEQ ID NO: 5124), UUGgugucuu (SEQ ID NO: 5125), AAUgugaagg (SEQ ID NO: 5126), UUGguggaua (SEQ ID NO: 5127), UAGguguguu (SEQ ID NO: 5128), CUGgcaaguu (SEQ ID NO: 5129), GCAguaagau (SEQ ID NO: 5130), GCGguggaaa (SEQ ID NO: 5131), UGCguccagc (SEQ ID NO: 5132), AAAguggagu (SEQ ID NO: 5133), CGUgugagcc (SEQ ID NO: 5134), AGAguacugu (SEQ ID NO: 5135), CAGguauagc (SEQ ID NO: 5136), UACguaagga (SEQ ID NO: 5137), AAGgucuuua (SEQ ID NO: 5138), AAGguggucu (SEQ ID NO: 5139), GGGguaaauu (SEQ ID NO: 5140), UCAgugagga (SEQ ID NO: 5141), AGAguacguu (SEQ ID NO: 5142), GAGgucguca (SEQ ID NO: 5143), UAGguuugau (SEQ ID NO: 5144), CAUguaaacc (SEQ ID NO: 5145), AAGguggcac (SEQ ID NO: 5146), CAGguagaug (SEQ ID NO: 5147), AACguaaaag (SEQ ID NO: 5148), UAGgucucug (SEQ ID NO: 5149), AUAguaggug (SEQ ID NO: 5150), UAGgcaagag (SEQ ID NO: 5151), UAGgcacggc (SEQ ID NO: 5152), AAGgucuuca (SEQ ID NO: 5153), CCAguaugcu (SEQ ID NO: 5154), CAAgugaguu (SEQ ID NO: 5155), CAGgucucaa (SEQ ID NO: 5156), CAGguuacau (SEQ ID NO: 5157), GGAgugagca (SEQ ID NO: 5158), AGAguacgca (SEQ ID NO: 5159), CUGguguugg (SEQ ID NO: 5160), AAGguacuca (SEQ ID NO: 5161), CUAguaaggg (SEQ ID NO: 5162), AGAguaaaag (SEQ ID NO: 5163), AAGguaacga (SEQ ID NO: 5164), CUGguccccg (SEQ ID NO: 5165), UAAguauggg (SEQ ID NO: 5166), GAGgucgagc (SEQ ID NO: 5167), UUGguauaua (SEQ ID NO: 5168), AAAgucaagg (SEQ ID NO: 5169), AAGgucuagg (SEQ ID NO: 5170), CGAguagguc (SEQ ID NO: 5171), AGGguucguu (SEQ ID NO: 5172), GAGgcaggcc (SEQ ID NO: 5173), CUAguauuac (SEQ ID NO: 5174), ACGguaugug (SEQ ID NO: 5175), UAGgugguuc (SEQ ID NO: 5176), AGAguauaac (SEQ ID NO: 5177), UUGgugcguc (SEQ ID NO: 5178), ACCguuaucu (SEQ ID NO: 5179), CCAgugauga (SEQ ID NO: 5180), GAAguaugca (SEQ ID NO: 5181), GAAguauggc (SEQ ID NO: 5182), CCGguaggac (SEQ ID NO: 5183), AAUguaagca (SEQ ID NO: 5184), AGAguaauug (SEQ ID NO: 5185), AGGguugguu (SEQ ID NO: 5186), GUGguaggag (SEQ ID NO: 5187), AAGgcaguuu (SEQ ID NO: 5188), CAAguaagcc (SEQ ID NO: 5189), CUGgcaagua (SEQ ID NO: 5190), CAGgcaugau (SEQ ID NO: 5191), AGGguaauug (SEQ ID NO: 5192), GGGguaaccu (SEQ ID NO: 5193), AAAguaacua (SEQ ID NO: 5194), UAGgucugcc (SEQ ID NO: 5195), ACGguaugaa (SEQ ID NO: 5196), AGUguauggg (SEQ ID NO: 5197), UGGguuggca (SEQ ID NO: 5198), UAGguaaacu (SEQ ID NO: 5199), AGAgugggua (SEQ ID NO: 5200), AGAguauuug (SEQ ID NO: 5201), AGUguaggaa (SEQ ID NO: 5202), CUUguacgua (SEQ ID NO: 5203), GAUgugagau (SEQ ID NO: 5204), CAGgcagcca (SEQ ID NO: 5205), AAGgucacug (SEQ ID NO: 5206), AAGgucugac (SEQ ID NO: 5207), UAGguuccuu (SEQ ID NO: 5208), CUGgugcuuu (SEQ ID NO: 5209), UGAguuggug (SEQ ID NO: 5210), UUGgugggau (SEQ ID NO: 5211), UGAguagggu (SEQ ID NO: 5212), UCGgugaggu (SEQ ID NO: 5213), AAAguaaaga (SEQ ID NO: 5214), AAGgcaaguc (SEQ ID NO: 5215), CGGguaaagc (SEQ ID NO: 5216), AAAguuaguu (SEQ ID NO: 5217), UUAguaagca (SEQ ID NO: 5218), GAGgucacau (SEQ ID NO: 5219), UAAgugguau (SEQ ID NO: 5220), UAGgugcuuu (SEQ ID NO: 5221), GGAguaggca (SEQ ID NO: 5222), UGAguaagga (SEQ ID NO: 5223), CAGguggagc (SEQ ID NO: 5224), GAUguagaag (SEQ ID NO: 5225), AAUgccugcc (SEQ ID NO: 5226), AUGguaaggc (SEQ ID NO: 5227), UGGguaauau (SEQ ID NO: 5228), CUGguaccuc (SEQ ID NO: 5229), CACgugagcc (SEQ ID NO: 5230), UGAguuugug (SEQ ID NO: 5231), CCGguagugu (SEQ ID NO: 5232), AAAgugacaa (SEQ ID NO: 5233), GAAguggguu (SEQ ID NO: 5234), CAGgugcagc (SEQ ID NO: 5235), GAGgugggcc (SEQ ID NO: 5236), UAUgugcguc (SEQ ID NO: 5237), GGGguacugg (SEQ ID NO: 5238), CUGguagguu (SEQ ID NO: 5239), UUGgcauguu (SEQ ID NO: 5240), AAUguaauac (SEQ ID NO: 5241), UAGgccggug (SEQ ID NO: 5242), AGAgucagua (SEQ ID NO: 5243), UAAguaaauc (SEQ ID NO: 5244), CAGguuccuc (SEQ ID NO: 5245), UAGguacgau (SEQ ID NO: 5246), AGAguuagug (SEQ ID NO: 5247), GCAguaagug (SEQ ID NO: 5248), AGGgugguag (SEQ ID NO: 5249), GGAguaaugu (SEQ ID NO: 5250), GAUguaaguc (SEQ ID NO: 5251), CCAguuucgu (SEQ ID NO: 5252), AAGguucggg (SEQ ID NO: 5253), AUGguggagu (SEQ ID NO: 5254), AAGguaccgg (SEQ ID NO: 5255), GAAgugcgaa (SEQ ID NO: 5256), UGGgucaguu (SEQ ID NO: 5257), AAGguguaga (SEQ ID NO: 5258), UGGguaggcc (SEQ ID NO: 5259), CCAgugaguc (SEQ ID NO: 5260), AAGgucacuu (SEQ ID NO: 5261), AGCgugaggc (SEQ ID NO: 5262), UCCgugguaa (SEQ ID NO: 5263), AGAguacuua (SEQ ID NO: 5264), GGGgucagau (SEQ ID NO: 5265), AAGguggacc (SEQ ID NO: 5266), AGAgugagcg (SEQ ID NO: 5267), AGAgucagau (SEQ ID NO: 5268), UAAguauuac (SEQ ID NO: 5269), AGAguauuuc (SEQ ID NO: 5270), AGAguucagc (SEQ ID NO: 5271), AUGgugaagu (SEQ ID NO: 5272), UAGgugaucc (SEQ ID NO: 5273), GGAguaagau (SEQ ID NO: 5274), UAGguaccaa (SEQ ID NO: 5275), AGAguugguc (SEQ ID NO: 5276), GAAgugagac (SEQ ID NO: 5277), AUCguagguu (SEQ ID NO: 5278), GAGguacgcu (SEQ ID NO: 5279), ACGguaaggg (SEQ ID NO: 5280), CAGgcauguc (SEQ ID NO: 5281), UUAguaagau (SEQ ID NO: 5282), UGAguagguu (SEQ ID NO: 5283), AGGguacgaa (SEQ ID NO: 5284), ACGguauguu (SEQ ID NO: 5285), AGGguacugu (SEQ ID NO: 5286), UUGguaugga (SEQ ID NO: 5287), UAAguaacug (SEQ ID NO: 5288), GCGgucagcc (SEQ ID NO: 5289), UUUgugaguc (SEQ ID NO: 5290), GUGgucagug (SEQ ID NO: 5291), CUGgucugua (SEQ ID NO: 5292), GAGguucuua (SEQ ID NO: 5293), AUGguacuga (SEQ ID NO: 5294), AAUgugcuuu (SEQ ID NO: 5295), AGGguggcgu (SEQ ID NO: 5296), CCGgcaggaa (SEQ ID NO: 5297), CAUguggguc (SEQ ID NO: 5298), UUGguuuguu (SEQ ID NO: 5299), CAGguucugu (SEQ ID NO: 5300), ACGguaagcg (SEQ ID NO: 5301), CUGgucagua (SEQ ID NO: 5302), UCAguaggcu (SEQ ID NO: 5303), UGAguaggac (SEQ ID NO: 5304), CAGguuuuaa (SEQ ID NO: 5305), GAGguguccc (SEQ ID NO: 5306), AGGguggguu (SEQ ID NO: 5307), GUGgugagac (SEQ ID NO: 5308), CACguaggga (SEQ ID NO: 5309), GUGguauuuu (SEQ ID NO: 5310), GAGauauccu (SEQ ID NO: 5311), AAGgugaaca (SEQ ID NO: 5312), UAAguagggc (SEQ ID NO: 5313), CUGgugcggg (SEQ ID NO: 5314), CUGgucaaua (SEQ ID NO: 5315), AGAguaaaaa (SEQ ID NO: 5316), AAGgugcagu (SEQ ID NO: 5317), CGGguaagca (SEQ ID NO: 5318), AAAgugagcc (SEQ ID NO: 5319), AUGguaauca (SEQ ID NO: 5320), GCAguacgug (SEQ ID NO: 5321), AUGguacaug (SEQ ID NO: 5322), AAGguuaaga (SEQ ID NO: 5323), CGGguaaaug (SEQ ID NO: 5324), GAGguucgca (SEQ ID NO: 5325), GAGgcucugg (SEQ ID NO: 5326), AUGgugggac (SEQ ID NO: 5327), AACgugguag (SEQ ID NO: 5328), AAGgugauag (SEQ ID NO: 5329), GGGguuugca (SEQ ID NO: 5330), CAUguaaggg (SEQ ID NO: 5331), UCAguugagu (SEQ ID NO: 5332), AAAgugcggc (SEQ ID NO: 5333), AGAgugagcc (SEQ ID NO: 5334), AUGgcaagaa (SEQ ID NO: 5335), ACAguaaggu (SEQ ID NO: 5336), AAGgucucua (SEQ ID NO: 5337), GUGguaaaaa (SEQ ID NO: 5338), AAAguaggug (SEQ ID NO: 5339), UAGgugcacu (SEQ ID NO: 5340), GUCgugguau (SEQ ID NO: 5341), CAGguauagg (SEQ ID NO: 5342), UGAgugagag (SEQ ID NO: 5343), ACUgugagcc (SEQ ID NO: 5344), AUCguuaguu (SEQ ID NO: 5345), UUUguaccaa (SEQ ID NO: 5346), UGGgugagau (SEQ ID NO: 5347), AGAgugagaa (SEQ ID NO: 5348), AGAguagggg (SEQ ID NO: 5349), AGGgcaagua (SEQ ID NO: 5350), CGGgucagua (SEQ ID NO: 5351), UUGguaugcc (SEQ ID NO: 5352), CGGguuagau (SEQ ID NO: 5353), GGGgugaagu (SEQ ID NO: 5354), CCCgugugaa (SEQ ID NO: 5355), GCAguuugga (SEQ ID NO: 5356), UGCguaagac (SEQ ID NO: 5357), AGAgucugua (SEQ ID NO: 5358), CACgugagca (SEQ ID NO: 5359), AGGguaaaag (SEQ ID NO: 5360), CAGgcugggu (SEQ ID NO: 5361), GAAgucuuca (SEQ ID NO: 5362), AAGgcaaaaa (SEQ ID NO: 5363), GUAguaaaua (SEQ ID NO: 5364), CUAgugagag (SEQ ID NO: 5365), GAAguuucug (SEQ ID NO: 5366), CCUguacgua (SEQ ID NO: 5367), GAGgugcgcg (SEQ ID NO: 5368), AAGguguaaa (SEQ ID NO: 5369), CCAguauguu (SEQ ID NO: 5370), CCGgucagcu (SEQ ID NO: 5371), AUGguuccug (SEQ ID NO: 5372), CAAguuaaau (SEQ ID NO: 5373), AGAguaggcu (SEQ ID NO: 5374), AUGgugggca (SEQ ID NO: 5375), GGAguaagac (SEQ ID NO: 5376), AGGgucacga (SEQ ID NO: 5377), UAGgugauau (SEQ ID NO: 5378), GAAguaaguc (SEQ ID NO: 5379), CGGguaagau (SEQ ID NO: 5380), CAAguagcua (SEQ ID NO: 5381), UGAguaaaau (SEQ ID NO: 5382), GUCguacgug (SEQ ID NO: 5383), AUGguacgua (SEQ ID NO: 5384), CAGgucucgg (SEQ ID NO: 5385), GAGgcauguc (SEQ ID NO: 5386), AGAgugggau (SEQ ID NO: 5387), GUGguuagag (SEQ ID NO: 5388), UGGgugguga (SEQ ID NO: 5389), AAGguuaaac (SEQ ID NO: 5390), CUUguuagcu (SEQ ID NO: 5391), AAAguaggaa (SEQ ID NO: 5392), UAGguuguau (SEQ ID NO: 5393), AGGgugcgcc (SEQ ID NO: 5394), AAGgugggcu (SEQ ID NO: 5395), UAAguaucug (SEQ ID NO: 5396), AAGguaacgu (SEQ ID NO: 5397), AUGguggggc (SEQ ID NO: 5398), CAAguacacg (SEQ ID NO: 5399), GGCguaagug (SEQ ID NO: 5400), AUAguaggac (SEQ ID NO: 5401), AGAgugaggu (SEQ ID NO: 5402), UUUguaaaaa (SEQ ID NO: 5403), GAAguuugua (SEQ ID NO: 5404), CUAguaaucu (SEQ ID NO: 5405), AAGguuuuua (SEQ ID NO: 5406), GAGgugcguu (SEQ ID NO: 5407), UAGgcgagua (SEQ ID NO: 5408), ACCgugagua (SEQ ID NO: 5409), CAGgucccga (SEQ ID NO: 5410), AUGguacugg (SEQ ID NO: 5411), UGAguucagu (SEQ ID NO: 5412), AAUguguggu (SEQ ID NO: 5413), UCCguugguu (SEQ ID NO: 5414), CAGgucagag (SEQ ID NO: 5415), CAGgucccua (SEQ ID NO: 5416), UAGguagacu (SEQ ID NO: 5417), CAAguuaagg (SEQ ID NO: 5418), GAGgugugcg (SEQ ID NO: 5419), GAAgcugccc (SEQ ID NO: 5420), CGAguacgug (SEQ ID NO: 5421), CGGguaggua (SEQ ID NO: 5422), UUGguauuga (SEQ ID NO: 5423), AUUguaugau (SEQ ID NO: 5424), UUGguaugaa (SEQ ID NO: 5425), GAGgugguca (SEQ ID NO: 5426), GCUguaugaa (SEQ ID NO: 5427), CAGguguugc (SEQ ID NO: 5428), CAGguaaaac (SEQ ID NO: 5429), AUAguaaggu (SEQ ID NO: 5430), CUGguuagag (SEQ ID NO: 5431), AGCgugugag (SEQ ID NO: 5432), AAGguuaucu (SEQ ID NO: 5433), CACgugagua (SEQ ID NO: 5434), AGGgucagua (SEQ ID NO: 5435), GAGguauaau (SEQ ID NO: 5436), CAGguuauuu (SEQ ID NO: 5437), AGGguggacu (SEQ ID NO: 5438), AUUguaauuc (SEQ ID NO: 5439), UUUguggguu (SEQ ID NO: 5440), AUGguacgug (SEQ ID NO: 5441), AAGguguucc (SEQ ID NO: 5442), CAGgugacgc (SEQ ID NO: 5443), GAGguacuaa (SEQ ID NO: 5444), ACAguucagu (SEQ ID NO: 5445), GAGgucacgg (SEQ ID NO: 5446), CAAguaaggc (SEQ ID NO: 5447), AAGguuuggg (SEQ ID NO: 5448), AAAgugggcu (SEQ ID NO: 5449), GCGguucuug (SEQ ID NO: 5450), GAGguggagc (SEQ ID NO: 5451), UGAgucagug (SEQ ID NO: 5452), CAGgucaagg (SEQ ID NO: 5453), AGUguaagcu (SEQ ID NO: 5454), GAGgcagaaa (SEQ ID NO: 5455), AAGgucacac (SEQ ID NO: 5456), GAAguagguu (SEQ ID NO: 5457), GUCguaaguu (SEQ ID NO: 5458), AGAguaugca (SEQ ID NO: 5459), CCUgugcaaa (SEQ ID NO: 5460), ACGgugaaaa (SEQ ID NO: 5461), CAGguacgaa (SEQ ID NO: 5462), CAUgugagga (SEQ ID NO: 5463), AGCgugagua (SEQ ID NO: 5464), GGUguguagg (SEQ ID NO: 5465), AACgugagcu (SEQ ID NO: 5466), GAGgugaacu (SEQ ID NO: 5467), AGAguucagu (SEQ ID NO: 5468), AACgugugua (SEQ ID NO: 5469), CAGguugugg (SEQ ID NO: 5470), AAGguacuag (SEQ ID NO: 5471), UCAgugaaaa (SEQ ID NO: 5472), AAUgucuggu (SEQ ID NO: 5473), ACGguaaaau (SEQ ID NO: 5474), CUGguguaag (SEQ ID NO: 5475), GAGgugcgaa (SEQ ID NO: 5476), AGGguuucuc (SEQ ID NO: 5477), CAGguagccc (SEQ ID NO: 5478), AUUguauugg (SEQ ID NO: 5479), AUGguacuua (SEQ ID NO: 5480), GAGgcccgac (SEQ ID NO: 5481), UCGguaagac (SEQ ID NO: 5482), CGGgcuguag (SEQ ID NO: 5483), UAUgugugug (SEQ ID NO: 5484), UAGguagaaa (SEQ ID NO: 5485), GUGgucauua (SEQ ID NO: 5486), UAGgugaaag (SEQ ID NO: 5487), ACUguaauuc (SEQ ID NO: 5488), GCAguacagg (SEQ ID NO: 5489), UCGgugaguc (SEQ ID NO: 5490), UAUguaggga (SEQ ID NO: 5491), AUGguauguc (SEQ ID NO: 5492), GUGgugugug (SEQ ID NO: 5493), CUGgugaccu (SEQ ID NO: 5494), AAUgugaaua (SEQ ID NO: 5495), UAGgucucac (SEQ ID NO: 5496), GAGguuauug (SEQ ID NO: 5497), UGAguaggcu (SEQ ID NO: 5498), CGGgcacgua (SEQ ID NO: 5499), GCAguaaaua (SEQ ID NO: 5500), CCGgugagag (SEQ ID NO: 5501), UAAguugguc (SEQ ID NO: 5502), CCGgugagcc (SEQ ID NO: 5503), AAGguuguca (SEQ ID NO: 5504), CUGguauuau (SEQ ID NO: 5505), GGGguauggg (SEQ ID NO: 5506), AAAgucagua (SEQ ID NO: 5507), UUUguaugua (SEQ ID NO: 5508), UAAguacugc (SEQ ID NO: 5509), CAGguaccaa (SEQ ID NO: 5510), GAAguucaga (SEQ ID NO: 5511), AUGgugcggu (SEQ ID NO: 5512), GUGgugaggu (SEQ ID NO: 5513), UGAguaagcc (SEQ ID NO: 5514), UAUguaaggg (SEQ ID NO: 5515), GUGguggaaa (SEQ ID NO: 5516), GAGgugauug (SEQ ID NO: 5517), GGAguuugua (SEQ ID NO: 5518), AAGgucacga (SEQ ID NO: 5519), GUGguagagg (SEQ ID NO: 5520), UAAguauauc (SEQ ID NO: 5521), AAGgugucca (SEQ ID NO: 5522), UAUgugguau (SEQ ID NO: 5523), GAGguacaau (SEQ ID NO: 5524), AAGguggggg (SEQ ID NO: 5525), GGAguaggug (SEQ ID NO: 5526), and UAGgugacuu (SEQ ID NO: 5527).


In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AGA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AAA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AAC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AAU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AAG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises ACA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AUA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AUU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AUG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AUC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CAA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CAU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CAC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CAG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GAA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GAC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GAU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GAG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GGA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GCA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GGG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GGC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GUU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GGU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GUC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GUA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GUG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UCU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UCC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UCA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UCG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UUU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UUC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UUA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UUG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UGU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UAU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises GGA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CUU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CUC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CUA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CUG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CCU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CCC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CCA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CCG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises ACU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises ACC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises ACG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AGC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AGU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises AGG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CGU. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UAC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UAA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises UAG. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CGC. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CGA. In some embodiments, the splice site sequence (e.g., 5′ splice site sequence) comprises CGG. In some embodiments, the splice site sequence comprises AGAguaaggg (SEQ ID NO: 667). In some embodiments, the splice site sequence comprises UGAguaagca (SEQ ID NO: 2768).


In an embodiment, a gene sequence or splice site sequence provided herein is related to a proliferative disease, disorder, or condition (e.g., cancer, benign neoplasm, or inflammatory disease). In an embodiment, a gene sequence or splice site sequence provided herein is related to a non-proliferative disease, disorder, or condition. In an embodiment, a gene sequence or splice site sequence provided herein is related to a neurological disease or disorder; autoimmune disease or disorder; immunodeficiency disease or disorder; lysosomal storage disease or disorder; cardiovascular condition, disease or disorder; metabolic disease or disorder; respiratory condition, disease, or disorder; renal disease or disorder; or infectious disease in a subject. In an embodiment, a gene sequence or splice site sequence provided herein is related to a neurological disease or disorder (e.g., Huntington's disease). In an embodiment, a gene sequence or splice site sequence provided herein is related to an immunodeficiency disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a lysosomal storage disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a cardiovascular condition, disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a metabolic disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a respiratory condition, disease, or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a renal disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to an infectious disease.


In an embodiment, a gene sequence or splice site sequence provided herein is related to a mental retardation disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a mutation in the SETD5 gene. In an embodiment, a gene sequence or splice site sequence provided herein is related to an immunodeficiency disorder. In an embodiment, a gene sequence and splice site sequence provided herein is related to a mutation in the GATA2 gene. In an embodiment, a gene sequence or splice site sequence provided herein is related to a lysosomal storage disease.


In some embodiments, a compound of Formula (I) or (II) described herein interacts with (e.g., binds to) a splicing complex component (e.g., a nucleic acid (e.g., an RNA) or a protein). In some embodiments, the splicing complex component is selected from 9G8, A1 hnRNP, A2 hnRNP, ASD-1, ASD-2b, ASF, BRR2, B1 hnRNP, C1 hnRNP, C2 hnRNP, CBP20, CBP80, CELF, F hnRNP, FBP11, Fox-1, Fox-2, G hnRNP, H hnRNP, hnRNP 1, hnRNP 3, hnRNP C, hnRNP G, hnRNP K, hnRNP M, hnRNP U, Hu, HUR, I hnRNP, K hnRNP, KH-type splicing regulatory protein (KSRP), L hnRNP, LUC7L, M hnRNP, mBBP, muscle-blind like (MBNL), NF45, NFAR, Nova-1, Nova-2, nPTB, P54/SFRS11, polypyrimidine tract binding protein (PTB), a PRP protein (e.g., PRP8, PRP6, PRP31, PRP4, PRP3, PRP28, PRP5, PRP2, PRP19), PRP19 complex proteins, RBM42, R hnRNP, RNPC1, SAD1, SAM68, SC35, SF, SF1/BBP, SF2, SF3A complex, SF3B complex, SFRS10, an Sm protein (such as B, D1, D2, D3, F, E, G), SNU17, SNU66, SNU114, an SR protein, SRm300, SRp20, SRp30c, SRP35C, SRP36, SRP38, SRp40, SRp55, SRp75, SRSF, STAR, GSG, SUP-12, TASR-1, TASR-2, TIA, TIAR, TRA2, TRA2a/b, U hnRNP, Ul snRNP, U11 snRNP, U12 snRNP, U1-70K, U1-A, U1-C, U2 snRNP, U2AF1-RS2, U2AF35, U2AF65, U4 snRNP, U5 snRNP, U6 snRNP, Urp, and YB1.


In some embodiments, the splicing complex component comprises RNA (e.g., snRNA). In some embodiments, a compound described herein binds to a splicing complex component comprising snRNA. The snRNA may be selected from, e.g., U1 snRNA, U2 snRNA, U4 snRNA, U5 snRNA, U6 snRNA, U11 snRNA, U12 snRNA, U4atac snRNA, and any combination thereof.


In some embodiments, the splicing complex component comprises a protein, e.g., a protein associated with an snRNA. In some embodiments, the protein comprises SC35, SRp55, SRp40, SRm300, SFRS10, TASR-1, TASR-2, SF2/ASF, 9G8, SRp75, SRp30c, SRp20 and P54/SFRS11. In some embodiments, the splicing complex component comprises a U2 snRNA auxiliary factor (e.g., U2AF65, U2AF35), Urp/U2AF1-RS2, SF1/BBP, CBP80, CBP 20, SF1 or PTB/hnRNP1. In some embodiments, the hnRNP protein comprises A1, A2/B1, L, M, K, U, F, H, G, R, I or C1/C2. Human genes encoding hnRNPs include HNRNPA0, HNRNPA1, HNRNPA1L1, HNRNPA1L2, HNRNPA3, HNRNPA2B1, HNRNPAB, HNRNPBI, HNRNPC, HNRNPCL1, HNRNPD, HNRPDL, HNRNPF, HNRNPH1, HNRNPH2, HNRNPH3, HNRNPK, HNRNPL, HNRPLL, HNRNPM, HNRNPR, HNRNPU, HNRNPUL1, HNRNPUL2, HNRNPUL3, and FMR1.


In one aspect, the compounds of Formula (I) or (II) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers, and compositions thereof, may modulate (e.g., increase or decrease) a splicing event of a target nucleic acid sequence (e.g., DNA, RNA, or a pre-mRNA), for example, a nucleic acid encoding a gene described herein, or a nucleic acid encoding a protein described herein, or a nucleic acid comprising a splice site described herein. In an embodiment, the splicing event is an alternative splicing event.


In an embodiment, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, and compositions thereof increases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by a known method in the art, e.g., qPCR. In an embodiment, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, and compositions thereof decreases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7% 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by a known method in the art, e.g., qPCR.


In another aspect, the present disclosure features a method of forming a complex comprising a component of a spliceosome (e.g., a major spliceosome component or a minor spliceosome component), a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA), and a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof, comprising contacting the nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) with said compound of Formula (I) or (II). In an embodiment, the component of a spliceosome is selected from the U1, U2, U4, U5, U6, U11, U12, U4atac, U6atac small nuclear ribonucleoproteins (snRNPs), or a related accessory factor. In an embodiment, the component of a spliceosome is recruited to the nucleic acid in the presence of the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof.


In another aspect, the present disclosure features a method of altering the conformation of a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) comprising contacting the nucleic acid with a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof. In an embodiment, the altering comprises forming a bulge or kink in the nucleic acid. In an embodiment, the altering comprises stabilizing a bulge or a kink in the nucleic acid. In an embodiment, the altering comprises reducing a bulge or a kink in the nucleic acid. In an embodiment, the nucleic acid comprises a splice site. In an embodiment, the compound of Formula (I) or (II) interacts with a nucleobase, ribose, or phosphate moiety of a nucleic acid (e.g., a DNA, RNA, e.g., pre-mRNA).


The present disclosure also provides methods for the treatment or prevention of a disease, disorder, or condition. In an embodiment, the disease, disorder or condition is related to (e.g., caused by) a splicing event, such as an unwanted, aberrant, or alternative splicing event. In an embodiment, the disease, disorder or condition comprises a proliferative disease (e.g., cancer, benign neoplasm, or inflammatory disease) or non-proliferative disease. In an embodiment, the disease, disorder, or condition comprises a neurological disease, autoimmune disorder, immunodeficiency disorder, cardiovascular condition, metabolic disorder, lysosomal storage disease, respiratory condition, renal disease, or infectious disease in a subject. In another embodiment, the disease, disorder, or condition comprises a haploinsufficiency disease, an autosomal recessive disease (e.g., with residual function), or a paralogue activation disorder. In another embodiment, the disease, disorder, or condition comprises an autosomal dominant disorder (e.g., with residual function). Such methods comprise the step of administering to the subject in need thereof an effective amount of a compound of Formula (I) or (II), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the methods described herein include administering to a subject an effective amount of a compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.


In certain embodiments, the subject being treated is a mammal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a domesticated animal, such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal such as a dog or cat. In certain embodiments, the subject is a livestock animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In another embodiment, the subject is a research animal such as a rodent, dog, or non-human primate. In certain embodiments, the subject is a non-human transgenic animal such as a transgenic mouse or transgenic pig.


A proliferative disease may also be associated with inhibition of apoptosis of a cell in a biological sample or subject. All types of biological samples described herein or known in the art are contemplated as being within the scope of the disclosure. The compounds of Formula (I) or (II) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers, and compositions thereof, may induce apoptosis, and therefore, be useful in treating and/or preventing proliferative diseases.


In certain embodiments, the proliferative disease to be treated or prevented using the compounds of Formula (I) or (II) is cancer. As used herein, the term “cancer” refers to a malignant neoplasm (Stedman's Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990). All types of cancers disclosed herein or known in the art are contemplated as being within the scope of the disclosure. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer), e.g., adenoid cystic carcinoma (ACC)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom's macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma/leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungoides, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia/lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendocrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g., Paget's disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g., prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget's disease of the vulva).


In some embodiments, the cancer is selected from adenoid cystic carcinoma (ACC), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), non-Hodgkin lymphoma (NHL), Burkitt lymphoma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), prostate cancer (e.g., prostate adenocarcinoma), ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), and myelodysplastic syndrome (MDS).


In some embodiments, the proliferative disease is associated with a benign neoplasm. For example, a benign neoplasm may include adenoma, fibroma, hemangioma, tuberous sclerosis, and lipoma. All types of benign neoplasms disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In some embodiments, the proliferative disease is associated with angiogenesis. All types of angiogenesis disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In some embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a non-proliferative disease. Exemplary non-proliferative diseases include a neurological disease, autoimmune disorder, immunodeficiency disorder, lysosomal storage disease, cardiovascular condition, metabolic disorder, respiratory condition, inflammatory disease, renal disease, or infectious disease.


In certain embodiments, the non-proliferative disease is a neurological disease. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a neurological disease, disorder, or condition. A neurological disease, disorder, or condition may include a neurodegenerative disease, a psychiatric condition, or a musculoskeletal disease. A neurological disease may further include a repeat expansion disease, e.g., which may be characterized by the expansion of a nucleic acid sequence in the genome. For example, a repeat expansion disease includes myotonic dystrophy, amyotrophic lateral sclerosis, Huntington's disease, a trinucleotide repeat disease, or a polyglutamine disorder (e.g., ataxia, fragile X syndrome). In some embodiments, the neurological disease comprises a repeat expansion disease, e.g., Huntington's disease. Additional neurological diseases, disorders, and conditions include Alzheimer's disease, Huntington's chorea, a prion disease (e.g., Creutzfeld-Jacob disease, bovine spongiform encephalopathy, Kuru, or scrapie), a mental retardation disorder (e.g., a disorder caused by a SETD5 gene mutation, e.g., intellectual disability-facial dysmorphism syndrome, autism spectrum disorder), Lewy Body disease, diffuse Lewy body disease (DLBD), dementia, progressive supranuclear palsy (PSP), progressive bulbar palsy (PBP), psuedobulbar palsy, spinal and bulbar muscular atrophy (SBMA), primary lateral sclerosis, Pick's disease, primary progressive aphasia, corticobasal dementia, Parkinson's disease, Down's syndrome, multiple system atrophy, spinal muscular atrophy (SMA), progressive spinobulbar muscular atrophy (e.g., Kennedy disease), post-polio syndrome (PPS), spinocerebellar ataxia, pantothenate kinase-associated neurodegeneration (PANK), spinal degenerative disease/motor neuron degenerative diseases, upper motor neuron disorder, lower motor neuron disorder, Hallervorden-Spatz syndrome, cerebral infarction, cerebral trauma, chronic traumatic encephalopathy, transient ischemic attack, Lytigo-bodig (amyotrophic lateral sclerosis-parkinsonism dementia), Guam-Parkinsonism dementia, hippocampal sclerosis, corticobasal degeneration, Alexander disease, Apler's disease, Krabbe's disease, neuroborreliosis, neurosyphilis, Sandhoff disease, Tay-Sachs disease, Schilder's disease, Batten disease, Cockayne syndrome, Kearns-Sayre syndrome, Gerstmann-Straussler-Scheinker syndrome and other transmissible spongiform encephalopathies, hereditary spastic paraparesis, Leigh's syndrome, a demyelinating diseases, neuronal ceroid lipofuscinoses, epilepsy, tremors, depression, mania, anxiety and anxiety disorders, sleep disorders (e.g., narcolepsy, fatal familial insomnia), acute brain injuries (e.g., stroke, head injury), autism, Machado-Joseph disease, or a combination thereof. In some embodiments, the neurological disease comprises Friedrich's ataxia or Sturge Weber syndrome. In some embodiments, the neurological disease comprises Huntington's disease. In some embodiments, the neurological disease comprises spinal muscular atrophy. All types of neurological diseases disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is an autoimmune disorder or an immunodeficiency disorder. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autoimmune disease, disorder, or condition, or an immunodeficiency disease, disorder, or condition. Exemplary autoimmune and immunodeficiency diseases, disorders, and conditions include arthritis (e.g., rheumatoid arthritis, osteoarthritis, gout), Chagas disease, chronic obstructive pulmonary disease (COPD), dermatomyositis, diabetes mellitus type 1, endometriosis, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), Hashiomoto's disease, Hidradenitis suppurativa, Kawasaki disease, ankylosing spondylitis, IgA nephropathy, idiopathic thrombocytopenic purpura, inflammatory bowel disease, Crohn's disease, ulcerative colitis, collagenous colitis, lymphocytic colitis, ischemic colitis, diversion colitis, Behcet's syndrome, infective colitis, indeterminate colitisinterstitial cystitis, lupus (e.g., systemic lupus erythematosus, discoid lupus, drug-induced lupus, neonatal lupus), mixed connective tissue disease, morphea, multiple sclerosis, myasthenia gravis, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary cirrhosis, relapsing polychondritis, scleroderma, Sjögren's syndrome, Stiff person syndrome, vasculitis, vitiligo, a disorder caused by a GATA2 mutation (e.g., GATA2 deficiency; GATA2 haploinsufficiency; Emberger syndrome; monocytopenia and Mycobacterium avium complex/dendritic cell, monocyte, B and NK lymphocyte deficiency; familial myelodysplastic syndrome; acute myeloid leukemia; chronic myelomonocytic leukemia), neutropenia, aplastic anemia, and Wegener's granulomatosis. In some embodiments, the autoimmune or immunodeficiency disorder comprises chronic mucocutaneous candidiasis. All types of autoimmune disorders and immunodeficiency disorders disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is a cardiovascular condition. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a cardiovascular disease, disorder, or condition. A cardiovascular disease, disorder, or condition may include a condition relating to the heart or vascular system, such as the arteries, veins, or blood. Exemplary cardiovascular diseases, disorders, or conditions include angina, arrhythmias (atrial or ventricular or both), heart failure, arteriosclerosis, atheroma, atherosclerosis, cardiac hypertrophy, cardiac or vascular aneurysm, cardiac myocyte dysfunction, carotid obstructive disease, endothelial damage after PTCA (percutaneous transluminal coronary angioplasty), hypertension including essential hypertension, pulmonary hypertension and secondary hypertension (renovascular hypertension, chronic glomerulonephritis), myocardial infarction, myocardial ischemia, peripheral obstructive arteriopathy of a limb, an organ, or a tissue; peripheral artery occlusive disease (PAOD), reperfusion injury following ischemia of the brain, heart or other organ or tissue, restenosis, stroke, thrombosis, transient ischemic attack (TIA), vascular occlusion, vasculitis, and vasoconstriction. All types of cardiovascular diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is a metabolic disorder. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a metabolic disease, disorder, or condition. A metabolic disease, disorder, or condition may include a disorder or condition that is characterized by abnormal metabolism, such as those disorders relating to the consumption of food and water, digestion, nutrient processing, and waste removal. A metabolic disease, disorder, or condition may include an acid-base imbalance, a mitochondrial disease, a wasting syndrome, a malabsorption disorder, an iron metabolism disorder, a calcium metabolism disorder, a DNA repair deficiency disorder, a glucose metabolism disorder, hyperlactatemia, a disorder of the gut microbiota. Exemplary metabolic conditions include obesity, diabetes (Type I or Type II), insulin resistance, glucose intolerance, lactose intolerance, eczema, hypertension, Hunter syndrome, Krabbe disease, sickle cell anemia, maple syrup urine disease, Pompe disease, and metachromatic leukodystrophy. All types of metabolic diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is a respiratory condition. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a respiratory disease, disorder, or condition. A respiratory disease, disorder, or condition can include a disorder or condition relating to any part of the respiratory system, such as the lungs, alveoli, trachea, bronchi, nasal passages, or nose. Exemplary respiratory diseases, disorders, or conditions include asthma, allergies, bronchitis, allergic rhinitis, chronic obstructive pulmonary disease (COPD), lung cancer, oxygen toxicity, emphysema, chronic bronchitis, and acute respiratory distress syndrome. All types of respiratory diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is a renal disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a renal disease, disorder, or condition. A renal disease, disorder, or condition can include a disease, disorder, or condition relating to any part of the waste production, storage, and removal system, including the kidneys, ureter, bladder, urethra, adrenal gland, and pelvis. Exemplary renal diseases include acute kidney failure, amyloidosis, Alport syndrome, adenovirus nephritis, acute lobar nephronia, tubular necrosis, glomerulonephritis, kidney stones, urinary tract infections, chronic kidney disease, polycystic kidney disease, and focal segmental glomerulosclerosis (FSGS). In some embodiments, the renal disease, disorder, or condition comprises HIV-associated nephropathy or hypertensive nephropathy. All types of renal diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the non-proliferative disease is an infectious disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an infectious disease, disorder, or condition. An infectious disease may be caused by a pathogen such as a virus or bacteria. Exemplary infectious diseases include human immunodeficiency syndrome (HIV), acquired immunodeficiency syndrome (AIDS), meningitis, African sleeping sickness, actinomycosis, pneumonia, botulism, chlamydia, Chagas disease, Colorado tick fever, cholera, typhus, giardiasis, food poisoning, ebola hemorrhagic fever, diphtheria, Dengue fever, gonorrhea, streptococcal infection (e.g., Group A or Group B), hepatitis A, hepatitis B, hepatitis C, herpes simplex, hookworm infection, influenza, Epstein-Barr infection, Kawasaki disease, kuru, leprosy, leishmaniasis, measles, mumps, norovirus, meningococcal disease, malaria, Lyme disease, listeriosis, rabies, rhinovirus, rubella, tetanus, shingles, scarlet fever, scabies, Zika fever, yellow fever, tuberculosis, toxoplasmosis, or tularemia. In some embodiments, the infectious disease comprises cytomegalovirus. All types of infectious diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.


In certain embodiments, the disease, disorder, or condition is a haploinsufficiency disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a haploinsufficiency disease, disorder, or condition. A haploinsufficiency disease, disorder, or condition may refer to a monogenic disease in which an allele of a gene has a loss-of-function lesion, e.g., a total loss of function lesion. In an embodiment, the loss-of-function lesion is present in an autosomal dominant inheritance pattern or is derived from a sporadic event. In an embodiment, the reduction of gene product function due to the altered allele drives the disease phenotype despite the remaining functional allele (i.e. said disease is haploinsufficient with regard to the gene in question). In an embodiment, a compound of Formula (I) or (II) increases expression of the haploinsufficient gene locus. In an embodiment, a compound of Formula (I) or (II) increases one or both alleles at the haploinsufficient gene locus. Exemplary haploinsufficiency diseases, disorders, and conditions include Robinow syndrome, cardiomyopathy, cerebellar ataxia, pheochromocytoma, Charcot-Marie-Tooth disease, neuropathy, Takenouchi-Kosaki syndrome, Coffin-Siris syndrome 2, chromosome 1p35 deletion syndrome, spinocerebellar ataxia 47, deafness, seizures, dystonia 9, GLUT1 deficiency syndrome 1, GLUT1 deficiency syndrome 2, stomatin-deficient cryohydrocytosis, basal cell carcinoma, basal cell nevus syndrome, medulloblastoma, somatic, brain malformations, macular degeneration, cone-rod dystrophy, Dejerine-Sottas disease, hypomyelinating neuropathy, Roussy-Levy syndrome, glaucoma, autoimmune lymphoproliferative syndrome, pituitary hormone deficiency, epileptic encephalopathy, early infantile, popliteal pterygium syndrome, van der Woude syndrome, Loeys-Dietz syndrome, Skraban-Deardorff syndrome, erythrocytosis, megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome, mental retardation, CINCA syndrome, familial cold inflammatory syndrome 1, keratoendothelitis fugax hereditaria, Muckle-Wells syndrome, Feingold syndrome 1, Acute myeloid leukemia, Heyn-Sproul-Jackson syndrome, Tatton-Brown-Rahman syndrome, Shashi-Pena syndrome, Spastic paraplegia, autosomal dominant, macrophthalmia, colobomatous, with microcornea, holoprosencephaly, schizencephaly, endometrial cancer, familial, colorectal cancer, hereditary nonpolyposis, intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, ovarian hyperstimulation syndrome, schizophrenia, Dias-Logan syndrome, premature ovarian failure, dystonia, dopa-responsive, due to sepiapterin reductase deficiency, Beck-Fahrner syndrome, chromosome 2p12-p11.2 deletion syndrome, neuronopathy, spastic paraplegia, familial adult myoclonic, colorectal cancer, hypothyroidism, Culler-Jones syndrome, holoprosencephaly, myelokathexis, WHIM syndrome, Mowat-Wilson syndrome, mental retardation, an intellectual developmental disorder, autism spectrum disorder, epilepsy, epileptic encephalopathy, Dravet syndrome, migraines, a mental retardation disorder (e.g., a disorder caused by a SETD5 gene mutation, e.g., intellectual disability-facial dysmorphism syndrome, autism spectrum disorder), a disorder caused by a GATA2 mutation (e.g., GATA2 deficiency; GATA2 haploinsufficiency; Emberger syndrome; monocytopenia and Mycobacterium avium complex/dendritic cell, monocyte, B and NK lymphocyte deficiency; familial myelodysplastic syndrome; acute myeloid leukemia; chronic myelomonocytic leukemia), and febrile seizures.


In certain embodiments, the disease, disorder, or condition is an autosomal recessive disease, e.g., with residual function. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autosomal recessive disease, disorder, or condition. An autosomal recessive disease with residual function may refer to a monogenic disease with either homozygous recessive or compound heterozygous heritability. These diseases may also be characterized by insufficient gene product activity (e.g., a level of gene product greater than 0%). In an embodiment, a compound of Formula (I) or (II) may increase the expression of a target (e.g., a gene) related to an autosomal recessive disease with residual function. Exemplary autosomal recessive diseases with residual function include Friedreich's ataxia, Stargardt disease, Usher syndrome, chlorioderma, fragile X syndrome, achromatopsia 3, Hurler syndrome, hemophilia B, alpha-1-antitrypsin deficiency, Gaucher disease, X-linked retinoschisis, Wiskott-Aldrich syndrome, mucopolysaccharidosis (Sanfilippo B), DDC deficiency, epidermolysis bullosa dystrophica, Fabry disease, metachromatic leukodystrophy, and odontochondrodysplasia.


In certain embodiments, the disease, disorder, or condition is an autosomal dominant disease. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autosomal dominant disease, disorder, or condition. An autosomal dominant disease may refer to a monogenic disease in which the mutated gene is a dominant gene. These diseases may also be characterized by insufficient gene product activity (e.g., a level of gene product greater than 0%). In an embodiment, a compound of Formula (I) or (II) may increase the expression of a target (e.g., a gene) related to an autosomal dominant disease. Exemplary autosomal dominant diseases include Huntington's disease, achondroplasia, antithrombin III deficiency, Gilbert's disease, Ehlers-Danlos syndrome, hereditary hemorrhagic telangiectasia, intestinal polyposis, hereditary elliptosis, hereditary spherocytosis, marble bone disease, Marfan's syndrome, protein C deficiency, Treacher Collins syndrome, Von Willebrand's disease, tuberous sclerosis, osteogenesis imperfecta, polycystic kidney disease, neurofibromatosis, and idiopathic hypoparathyroidism.


In certain embodiments, the disease, disorder, or condition is a paralogue activation disorder. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a paralogue activation disease, disorder, or condition. A paralogue activation disorder may comprise a homozygous mutation of genetic locus leading to loss-of-function for the gene product. In these disorders, there may exist a separate genetic locus encoding a protein with overlapping function (e.g. developmental paralogue), which is otherwise not expressed sufficiently to compensate for the mutated gene. In an embodiment, a compound of Formula (I) or (II) activates a gene connected with a paralogue activation disorder (e.g., a paralogue gene).


The cell described herein may be an abnormal cell. The cell may be in vitro or in vivo. In certain embodiments, the cell is a proliferative cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a non-proliferative cell. In certain embodiments, the cell is a blood cell. In certain embodiments, the cell is a lymphocyte. In certain embodiments, the cell is a benign neoplastic cell. In certain embodiments, the cell is an endothelial cell. In certain embodiments, the cell is an immune cell. In certain embodiments, the cell is a neuronal cell. In certain embodiments, the cell is a glial cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a fibroblast. In certain embodiment, the cell is a primary cell, e.g., a cell isolated from a subject (e.g., a human subject).


In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has improved cell permeability over a reference compound, e.g., in a standard assay for measuring cell permeability. Cell permeability may be investigated, for example, using a standard assay run in either Madin-Darby Canine Kidney (MDCK) cells expressing Breast Cancer Resistance Protein (BCRP) or subclone MDCKII cells expressing Multidrug Resistance Protein 1 (MDR1); see, e.g., Drug Metabolism and Disposition 36, 268-275 (2008) and Journal of Pharmaceutical Sciences 107 2225-2235 (2018). In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of <2×10−6 cm s−1. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of between 2-6×10−6 cm s−1 In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of Papp greater than 6×10−6 cm s−1. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.


In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits decreased cell efflux, e.g., over a reference compound, e.g., in a standard assay for measuring cell efflux. Cell efflux may be investigated, for example, using a standard assay run in either Madin-Darby Canine Kidney (MDCK) cells expressing Breast Cancer Resistance Protein (BCRP) or subclone MDCKII cells expressing Multidrug Resistance Protein 1 (MDR1); see, e.g., Drug Metabolism and Disposition 36, 268-275 (2008) and Journal of Pharmaceutical Sciences 107 2225-2235 (2018). In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio of less than 1.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio of between 1.5 and 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio greater than 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.


In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, increases the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, decreases the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. The effect of an exemplary compound of Formula (I) or (II) on protein abundance may be measured using a standard assay for measuring protein abundance, such as the HiBit-assay system (Promega). In this assay, percent response for each respective cell line may be as calculated at each compound concentration as follows: % response=100*(S−PC)/(NC−PC). For the normalized response at each concentration, a four-parameter logistical regression may be fit to the data and the response may be interpolated at the 50% value to determine a concentration for protein abundance at 50% (IC50) an untreated control. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response less than 100 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response between 100-1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response greater than 1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response greater than 10 uM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the protein abundance of a target protein by about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.


In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, increases the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, decreases the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, does not impact the viability of a cell (e.g., is non-toxic) in a subject or sample. The effect an exemplary compound of Formula (I) or (II) on cell viability may be measured using a standard assay for measuring cell toxicity, such as the Cell Titer Glo 2.0 assay in either K562 (human chronic myelogenous leukemia) or SH-SY5Y (human neuroblastoma) cells. The concentration at which cell viability is measured may be based on the particular assay used. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of less than 100 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of between 100-1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of greater than 1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of greater than 10 uM. In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has improved brain permeability over a reference compound, e.g., in a standard assay for measuring brain permeability. Brain permeability may be measured, for example, by determining the unbound partition coefficient (Kpuu), brain. In such an assay, the unbound brain partition coefficient (Kp,uu,bmin) may be defined as the ratio of unbound brain-free compound concentration to unbound plasma concentration. It is calculated using the following equation







K

p
,
uu
,
brain


=



f

u
,
brain


×

C
brain




f

u
,
plasma


×

C
plasma







Cbrain and Cplasma represent the total concentrations in brain and plasma, respectively. In this assay, the fu,brain and fu,plasma may be the unbound fraction of the compound in brain and plasma, respectively. Both fu,brain and fu,plasma may be determined in vitro via equilibrium dialysis. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value of greater than 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value between 1 and 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value between 0.2-1.


In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value of less than 0.2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value of greater than 2.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value between 0.5-2.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value between 0.1-0.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value of less than 0.1. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a brain permeability greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.


In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for one target nucleic acid sequence, e.g., pre-mRNA transcript sequence or bulge, compared to another target nucleic acid sequence, e.g., pre-mRNA transcript sequence or bulge. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for HTT, e.g., an HTT-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for SMN2, e.g., an SMN2-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for Target C, e.g., a Target C-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for MYB, e.g., a MYB-related nucleic acid sequence. Selectivity for one target nucleic acid sequence over another may be measured using any number of methods known in the art. In an embodiment, selectivity may be measured by determining the ratio of derived qPCR values (e.g., as described herein) for one target nucleic acid sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for one target nucleic acid sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over another target nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over another target nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for Target C sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a selectivity for one target nucleic acid sequence that is greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more, e.g., compared with a second nucleic acid sequence.


In certain embodiments, the methods described herein comprise the additional step of administering one or more additional pharmaceutical agents in combination with the compound of Formula (I) or (II), a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof. Such additional pharmaceutical agents include, but are not limited to, anti-proliferative agents, anti-cancer agents, anti-diabetic agents, anti-inflammatory agents, immunosuppressant agents, and a pain-relieving agent. The additional pharmaceutical agent(s) may synergistically augment the modulation of splicing induced by the inventive compounds or compositions of this disclosure in the biological sample or subject. Thus, the combination of the inventive compounds or compositions and the additional pharmaceutical agent(s) may be useful in treating, for example, a cancer or other disease, disorder, or condition resistant to a treatment using the additional pharmaceutical agent(s) without the inventive compounds or compositions.


EXAMPLES

In order that the invention described herein may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the compounds, pharmaceutical compositions, and methods provided herein and are not to be construed in any way as limiting their scope.


The compounds provided herein can be prepared from readily available starting materials using modifications to the specific synthesis protocols set forth below that would be well known to those of skill in the art. It will be appreciated that where typical or preferred process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by those skilled in the art by routine optimization procedures.


Additionally, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. The choice of a suitable protecting group for a particular functional group as well as suitable conditions for protection and deprotection are well known in the art. For example, numerous protecting groups, and their introduction and removal, are described in Greene et al., Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991, and references cited therein.


Reactions can be purified or analyzed according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance (NMR) spectroscopy (e.g., 1H or 13C), infrared (IR) spectroscopy, spectrophotometry (e.g., UV-visible), mass spectrometry (MS), or by chromatographic methods such as high performance liquid chromatography (HPLC) or thin layer chromatography (TLC).


Proton NMR: 1H NMR spectra were recorded in CDCl3 solution in 5-mm o.d. tubes (Wildmad) at 24° C. and were collected on a BRUKER AVANCE NEO 400 at 400 MHz for 1H. The chemical shifts (6) are reported relative to tetramethylsilane (TMS=0.00 ppm) and expressed in ppm.


LC/MS: Liquid chromatography-mass spectrometry (LC/MS) was performed on Shimadzu-2020EV using column: Shim-pack XR-ODS (C18, Ø4.6×50 mm, 3 m, 120 Å, 40° C.) operating in ESI(+) ionization mode; flow rate=1.2 Ml/min. Mobile phase=0.05% TFA in water or CH3CN; or on Shimadzu-2020EV using column: Poroshell HPH—C18 (C18, Ø4.6×50 mm, 3 m, 120 Å, 40° C.) operating in ESI(+) ionization mode; flow rate=1.2 Ml/min. Mobile phase A: Water/5Mm NH4HCO3, Mobile phase B: CH3CN.) Analytical chiral HPLC: Analytical chiral HPLC was performed on a Agilent 1260 using column: CHIRALPAK IG-3, CHIRALPAK IC-3 or CH IRALPAK OJ-3, with flow rate=1.2 Ml/min. Mobile phase=MTBE(DEA):EtOH=50:50).


Analytical chiral HPLC: Analytical chiral HPLC was performed on a Agilent 1260 using column: CHLRALPAK IG-3, CHIRALPAK IC-3 or CHIRALPAK OJ-3, with flow rate=1.2 Ml/min. Mobile phase=MTBE(DEA):EtOH=50:50).


Preparative HPLC purification: prep-HPLC purification was performed using one of the following HPLC conditions:


Condition 1: Shimadzu, Column: Xbridge Prep OBD C18 Column, 30A 150 mm 5 μm; Mobile Phase A: water (10 mmol/L NH4HCO3) Mobile Phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1: 3 B to 3 B in 2 min; Gradient 2: 5% B to 35% B in 6 min; Gradient 3: 3 B to 33 B in 6 min; Gradient 4: 5% B up to 45% in 6 min; Gradient 5: 3% B to 23% B in 6 min; Gradient 6: 10% B to 60% B in 8 min; Gradient 7: 5 B to 45 B in 10 min; Gradient 8: 10% B up to 47% B in 10 min; Gradient 9: 10% B up to 50% B in 8 min; Gradient 9: 5% B to 35% B in 8 min; Gradient 10: 10% B to 48% B in 10 min; Gradient 11: 20% B to 52% B in 8 min; Gradient 12: 20% B to 50% B in 6 min; Gradient 13: 20% B to 43% B in 8 min; Gradient 14: 15% B to 45% B in 8 min; Gradient 14: 10% B to 55% B in 8 min; Gradient 15: 5% B to 38% B in 10 min; Gradient 16: 10% B to 35% B in 8 min; Gradient 17: 5% B to 42% B in 8 min; Gradient 18: 5% B to 30% B in 8 min; Gradient 18: 5% B to 40% B in 8 min; Gradient 19: 5% B to 45% B in 8 min; Gradient 21: 5% B to 37% B in 8 min; Gradient 22: 5% B to 65% B in 8 min; Gradient 23: 10% B to 65% B in 8 min; Gradient 24: 5% B to 50% B in 8 min.


Condition 2: Column: Xselect CSH OBD Column 30*150 mm 5 μm, n; Mobile Phase A: water (10 mmol/L NH4HCO3); Mobile Phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1: 10 B to 55 B in 8 min; Gradient 2: 5 B to 50 B in 8 min; Gradient 3: 10 B to 60 B in 10 min; Gradient 4: 10 B to 40 B in 8 min; Gradient 5: 5 B to 65 B in 8 min; Gradient 6: 3% B to 63% B in 6 min; Gradient 7: 10% B to 52% B in 8 min; Gradient 8: 5% B to 37% B in 8 min; Gradient 9: 10% B to 38% B in 8 min; Gradient 10: 3% B to 75% B in 8 min; Gradient 11: 10% B to 42% B in 8 min; Gradient 12: 15% B to 40% B in 10 min; Gradient 13: 10% B to 60% B in 8 min; Gradient 14: 5% B to 35% B in 8 min; Gradient 15: 15% B to 36% B in 8 min.


Condition 3: Column: EP-C18M 10 μm 120A; Mobile Phase A: water (1 mmol/L HCl); Mobile Phase B: acetonitrile; Flow rate: 100 Ml/min; Gradient: 40% B to 70% B in 35 min.


Condition 4: Column: Poroshell HPH—C18, 3.0*50 mm, 2.7 um; Mobile Phase A: water (5 Mm NH4HCO3); Mobile Phase B: acetonitrile; Flow rate: 1.2 Ml/min; Gradient 1:10% B to 95% B in 1.2 min, hold 0.5 min.


Condition 5: Column: X Select CSH OBD 30×150 mm 5 μm; Mobile phase A: water (0.1% formic acid); Mobile phase B: acetonitrile; Gradient 1: 3% phase B up to 18% in 6 min.


Condition 6: Column: X Select CSH OBD 30×150 mm 5 μm; Mobile phase A: water (0.05% HCl); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1: 3% phase B up to 3% in 2 min; Gradient 2: 3% B to 18% B in 8 min.


Condition 7: Column: X Select CSH OBD 30×150 mm 5 μm; Mobile phase A: water (0.05% formic acid); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1: 3% phase B up to 20% in 8 min.


Condition 8: Column: YMC-Actus Triart C18, 30 mm×150 mm, 5 μm; Mobile phase A: water (0.05% HCl); Mobile phase B: acetonitrile; Gradient 1: 5% B to 35% B in 8 min.


Condition 9: Column: YMC-Actus Triart C18, 30 mm×150 mm, 5 μm; Mobile phase A: water (10 mmol/L NH4HCO3); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min Gradient 1: 10% B to 70% B in 8 min; Gradient 2: 15% B to 55% B in 8 min; Gradient 3: 5% B to 65% B in 8 min; Gradient 4: 5% B to 45% B in 8 min; Gradient 5:15% B to 45% B in 10 min; Gradient 6: 15% B to 70% B in 8 min; Gradient 7: 5% B to 50% B in 8 min; Gradient 8: 15% B to 50% B in 8 min; Gradient 9: 20% B to 44% B in 10 min.


Condition 10: XBridge Prep OBD Column 19×150 mm 8 μm; Mobile Phase A: Water (0.05% NH3·H2O), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient 1: 20% B to 50% B in 8 min; Gradient 2: 25% B to 55% B in 8 min; Gradient 3: 35% B to 65% B in 14 min; Gradient 4: 10% B to 45% B in 12 min; Gradient 5: 24% B to 54% B in 8 min; Gradient 6: 45% B to 65% B in 14 min; Gradient 7: 55% B to 82% B in 9 min; Gradient 8: 20% B to 50% B in 7 min; Gradient 9: 56% B to 76% B in 8 min; Gradient 10: 24% B to 47% B in 8 min; Gradient 11: 30% B to 60% B in 8 min; Gradient 12: 15% B to 45% B in 8 min; Gradient 13: 20% B to 45% B in 8 min; Gradient 14: 50% B to 70% B in 12 min; Gradient 15: 50% B to 80% B in 8 min; Gradient 16: 40% B to 75% B in 7 min.


Condition 11: Column: YMC-Actus Triart C18 ExRS, 30×250 mm, 5 m; Mobile Phase A: Water (10 mmol/L NH4HCO3+0.1% NH3·H2O); Mobile Phase B: Acetonitrile; Flow rate: 35 mL/min; Gradient 1: 33% B to 74% B in 7 min


Condition 12: Column: Welch Ultimate XB—C18, 50×250 mm, 10 μm; Mobile Phase A: Water (0.1% NH3·H2O), Mobile Phase B: Acetonitrile; Gradient 1: 5% B to 45% B in 10 min; Gradient 2: 5% B to 35% B in 10 min; Gradient 3: 10% B to 55% B in 10 min;


Condition 13: SunFire Prep Column 19×150 mm, 10 μm, Mobile Phase A: Water (0.05% NH4OH), Mobile Phase B: Acetonitrile, Gradient 1: 30% B to 50% B in 7 min;


Condition 14: SunFire Prep Column 19×150 mm, 10 μm, Mobile Phase A: Water (0.05% TFA), Mobile Phase B: Acetonitrile, Gradient 1: 21% B to 35% B in 14 min; Gradient 2: 10% B to 20% B in 7 min


Condition 15: Welch Ultimate XB—C18, 50×250 mm, 10 μm; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile; Gradient 1: 10% B to 50% B in 12 min; Gradient 2: 30% B to 60% B in 10 min; Gradient 3: 10% B to 45% B in 12 min; Gradient 4: 35% B to 70% B in 10 min;


Condition 16: Welch Ultimate XB—C18, 50×250 mm, 10 μm; Mobile Phase A: Water (0.1% NaHCO3), Mobile Phase B: Acetonitrile; Gradient 1: 35% B to 75% B in 10 min.


Condition 17: Column: Xselect C18, 19×150 mm, 5 m; Mobile Phase A: 0.1% TFA, Mobile Phase B: Acetonitrile; Flow rate: 20 mL/min; Gradient 1: 5% B to 40% B in 7 min.


Condition 18: Column, C18 silica gel, XBridge, 19×150 mm; Mobile Phase A: Water (0.05% HCl), Mobile Phase B: Acetonitrile, Gradient 1: 20% B to 30% B in 14 min Preparative chiral HPLC: purification by chiral HPLC was performed on a Gilson-GX 281 using column: CHIRALPAK IG-3, CHIRALPAK IC-3 or CHIRALPAK OJ-3.


Condition 1: Column: CHIRALPAK IG, 3×25 cm, 5 μm; Mobile Phase A: MTBE (0.1% DEA), Mobile Phase B: ethanol; Flow rate: 20 Ml/min; Gradient 1: 50 B to 50 B in 18 min.


Condition 2: Column: CHIRAL ART Cellulose-SC, 3×25 cm, 5 m; Mobile Phase A: MTBE (0.1% DEA)-HPLC, Mobile Phase B: MeOH—-HPLC; Flow rate: 35 mL/min; Gradient 1: to 30% B isocratic in 22 min, Gradient 2: 50% B isocratic in 36 min.


Condition 3: Column: CHIRAL ART Cellulose-SC, 3×25 cm, 5 m; Mobile Phase A: HEX:DCM=3:1 (0.2% DEA), Mobile Phase B: Ethanol; Flow rate: 35 mL/min; Gradient 1: 50% B to 50% B in 22 min;


Condition 4: Column: CHIRALPAK IH, 3×25 cm, 5 m; Mobile Phase A: MTBE(2 mM NH3-MEOH), Mobile Phase B: IPA:DCM=1:1; Flow rate: 35 mL/min; Gradient 1: 25% B to 25% B in 12 min


Condition 5: Column, CHIRAL ART Cellulose-SC, 3×25 cm, 5 m; Mobile Phase A: MTBE (0.5% 2M NH3-MeOH), Mobile Phase B: IPA:ACN=2: 1; Flow rate: 35 mL/min; Gradient 1: 30% B isocratic


Condition 6: Column: CHIRAL ART Cellulose-SB, 3×25 cm, 5 m; Mobile Phase A: Hex (0.2% IPAmine), Mobile Phase B: EtOH:DCM=1:1; Flow rate: 35 mL/min; Gradient 1: 20% B isocratic


Condition 7: Column: CHIRALPAK IA, 2*25 cm, 5 m; Mobile Phase A: Hex:DCM=5: 1, Mobile Phase B: EtOH (0.1% 2M NH3-MeOH); Flow rate: 25 mL/min; Gradient 1: 45% B isocratic in 18 min;


Condition 8: Column: CHIRALPAK IF, 3×25 cm, 5 m; Mobile Phase A: HEX:DCM=3:1-HPLC, Mobile Phase B: EtOH (0.1% DEA)-HPLC; Flow rate: 35 mL/min; Gradient 1: 50% B isocratic in 40 min


Condition 9: Column: CHIRALPAK IC, 2×25 cm, 5 m; Mobile Phase A: Hex:DCM=1:1-HPLC, Mobile Phase B: EtOH (0.1% DEA)-HPLC; Flow rate: 23 mL/min; Gradient 1: 50% B isocratic in 90 min.


Condition 10: Column: CHIRAL ART Cellulose-SZ, 3×25 cm, 5 m; Mobile Phase A: Hex:DCM=1:1-HPLC, Mobile Phase B: EtOH (0.1% DEA)-HPLC; Flow rate: 30 mL/min; Gradient 1: 50% B isocratic in 12 min.


Condition 11: Column: CHIRAL ART Amylose-C NEO, 3×25 cm, 5 am; Mobile Phase A: EtOH (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH (0.5% 2M NH3-MeOH)—HPLC; Flow rate: 28 mL/min; Gradient 1: 50% B isocratic in 15 min.


Condition 12: Column: CHIRALPAK IG, 3×25 cm, 5 m; Mobile Phase A: HEX:DCM=3:1-HPLC, Mobile Phase B: EtOH (0.5% 2M NH3-MeOH)-HPLC; Flow rate: 30 mL/min; Gradient 1: 50% B isocratic in 16 min.


Reverse flash chromatography: purification by reverse flash chromatography was performed using one of the following conditions:


Condition 1: Column, C18; Mobile phase: MeOH in water; Gradient 1, 10% to 50% in 10 min; Detector, UV 254 nm.


Condition 2: Column, silica gel; Mobile phase: MeOH in water; Gradient 1: 10% to 50% in 10 min; Detector, UV 254 nm.


Condition 3: Column, C18 silica gel; mobile phase A: Water (0.1% NH3H2O), Mobile Phase B: ACN; Gradient 1: 30% B to 80% B gradient in 12 min; Gradient 2: 20% B to 60% B in 12 min; Gradient 3: 10% B to 80% B in 15 min; Gradient 4: 5% B to 40% B in 12 min; Gradient 5: 20% B to 50% B in 12 min; Gradient 6: 30% B to 60% B in 10 min; Gradient 7: 20% B to 50% B in 7 min; Gradient 8: 20% B to 70% B in 12 min; Gradient 9: 10% B to 100% B in 15 min; Gradient 10: 5% B to 35% B in 10 min.


Condition 4: Column: ACE 5AQ, 21.2×150 mm, 5 m; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile/Methanol (1:1); Flow rate: 20 mL/min; Gradient: 5% B to 40% B in 8 min


Condition 5: Column: C18 silica gel; Mobile Phase A: Water (0.1% FA), Mobile Phase B: Acetonitrile. Gradient 1: 30% B to 70% B in 12 min; Gradient 2: 30% B to 80% B in 12 min; Gradient 3: 20% B to 60% B in 10 min; Gradient 4: 24% B to 40% B in 7 min; Gradient 5: 40% B to 80% B in 10 min; Gradient 6: 10% B to 50% B in 10 min; Gradient 7: 5% B to 35% B in 10 min.


Condition 6: Column: C18 silica gel; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile; Gradient 1: 20% B to 50% B in 10 min; Gradient 2: 10% B to 35% B in 10 min; Gradient 3: 20% B to 70% B in 12 min.


Condition 7: Column: C18 silica gel; Mobile Phase A: Water (0.5% NH3) Mobile Phase B: Acetonitrile; Gradient 1: 40% B to 70% B in 10 min; Gradient 2: 30% B to 50% B in 12 min; Gradient 3: 30% B to 60% B in 12 min;


Condition 8: Column: C18 silica gel, XBridge, 19×150 mm; Mobile Phase A: Water (0.05% NH3·H2O), Mobile Phase B: Acetonitrile, Gradient 1: 20% B to 50% B in 7 min;


Condition 9: Column: C18 silica gel, XBridge, 19×150 mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: Acetonitrile, Gradient 1: 20% B to 50% B in 7 min.


Condition 10: Column: C18 silica gel; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: Acetonitrile; Gradient 1: 10% B to 50% B in 10 min.


Thin Layer chromatography: purification by thin layer chromatography was performed using one of the following conditions:


Condition 1: Column: YMC-Actus Triart C18 ExRS, 30×250 mm, 5 m; Mobile Phase A: Water (10 mmol/L NH4HCO3+0.1% NH3·H2O), Mobile Phase B: Acetonitrile; Flow rate: 35 mL/min; Gradient 1: 15% B to 70% B in 8 min; Gradient 2: 16% B to 64% B in 8 min


General Synthetic Schemes

Compounds of the present disclosure may be prepared using a synthetic protocol illustrated in one of Schemes A, B, or C.


General Synthetic Schemes

Compounds of the present disclosure may be prepared using a synthetic protocol illustrated in one of Schemes A, B, or C.




embedded image


Scheme A. An exemplary method of preparing a compound of Formula (I); wherein A, B, W, X, Y, Z, R2, and m are as defined herein; and LG1, LG2, and LG3 are each independently a leaving group (e.g., halo, —B(OR12)2). In some embodiments of the application, y is 0.


An exemplary method of preparing a compound described herein, e.g., a compound of Formula (II-I) is provided in Scheme A. In Step 1, B-2 is prepared by treating B-1 with a mixture of 2,2,6,6-tetramethylpiperidine, isopropylmagnesium chloride (iPrMgCl), lithium chloride (LiCl), iodine (I2), and zinc chloride (ZnCl2) in tetrahydrofuran (THF), or with a similar combination of reagents or solvent. In Step 2, B-3 is prepared by incubating B2 with 1,1′-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (Pd(dppf)Cl2), carbon monoxide (CO), and triethylamine (TEA), in a mixture of methanol (MeOH) and dichloromethane (CH2Cl2) or a similar mixture of solvents. Alternative catalysts to Pd(dppf)Cl2 may also be used, such as a suitable palladium catalyst, and/or using alternative reagents sufficient to provide B-3.


In Step 3, B-5 is prepared by incubating B-3 with B-4 in the presence of RuPhos-Pd(II) (e.g., RuPhos-Pd(II)-G2 or RuPhos-Pd(II)-G3), and cesium carbonate (Cs2CO3) or a similar reagent. Step 3 may also be carried out using an alternative catalyst to RuPhos-Pd(II), such as another ruthenium catalyst. The reaction may be conducted in dioxane or a similar solvent, at 100° C. or a temperature sufficient to provide B-5. B-5 is then converted to B-6 by treatment with a mixture of ammonia and methanol, at 100° C. or a temperature sufficient to provide B-6.


B-6 and B-7 are coupled to provide a compound of Formula (II-I) in Step 5. This coupling reaction may be conducted in the presence of tris(dibenzylideneacetone)dipalladium(0) (Pd2(dba)3, XantPhos, and cesium carbonate or a suitable alternative. Step 5 may also be carried out using an alternative catalyst to Pd2(dba)3, such as another palladium catalyst, and/or an alternative ligand to XantPhos (e.g., a different phosphine ligand). The reaction may be conducted in dioxane or a similar solvent, at 100° C. or a temperature sufficient to provide the compound of Formula (II-I). Each starting material and/or intermediate in Scheme B may be protected and deprotected using standard protecting group methods. In addition, purification and characterization of each intermediate as well as the final compound of Formula (II) may be afforded by any accepted procedure.




embedded image


Scheme B. An exemplary method of preparing a compound of Formula (I); wherein A is as defined herein.




embedded image


Scheme C. An exemplary method of preparing a compound of Formula (I); wherein B is as defined herein.


Exemplary protocols for the synthesis of compounds in Tables 1 and 2, e.g., Compounds 1-287, can be found in Examples 1-41 in WO 2021/174165, which is incorporated herein by reference in its entirety.


Example 42: Synthesis of Compound 303
Synthesis of Intermediate C1



embedded image


Methyl 2-amino-4-bromo-5-fluorobenzoate (100.0 mg, 0.403 mmol, 1.0 equiv), methanol (1 mL), water (1 mL), 1,1-dioxo-1-sulfonylidenedisilver (201.1 mg, 0.645 mmol, 1.6 equiv), iodine (163.7 mg, 0.645 mmol, 1.6 equiv) and tetrahydrofuran (1 mL) were combined at 25° C. The resulting mixture was stirred for 5 h at 25° C., then diluted with water (20 mL) and extracted with ethyl acetate (2×20 mL). The organic layers were combined, dried by Na2SO4, filtered and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford methyl 2-amino-4-bromo-5-fluoro-3-iodobenzoate (70 mg, 45.5%) as a solid. LCMS (ES, m/z): 373 [M+H]+.


Synthesis of Intermediate C2



embedded image


To a mixture of methyl 2-amino-4-bromo-5-fluoro-3-iodobenzoate (2.8 g, 7.488 mmol, 1.0 equiv) and methylboronic acid (2.6 g, 44.928 mmol, 6.0 equiv) in DME (40 mL) and H2O (10 mL) was added K2CO3 (2.07 g, 14.976 mmol, 2.0 equiv) and Pd(PPh3)2Cl2 (0.5 g, 0.749 mmol, 0.1 equiv). The reaction mixture was stirred for 6 h at 80° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford methyl 2-amino-4-bromo-5-fluoro-3-methylbenzoate (1.2 g, 46%) as a solid. LCMS (ES, m/z): 262 [M+H]+.


Synthesis of Intermediate C3



embedded image


Methyl 2-amino-4-bromo-5-fluoro-3-methylbenzoate (1.2 g, 4.579 mmol, 1.0 equiv) and Ac2O (0.6 g, 5.953 mmol, 1.3 equiv) were combined at 25° C. The resulting mixture was stirred for 1 h at 25° C. To the reaction mixture was added potassium acetate (0.13 g, 1.374 mmol, 0.3 equiv) and isoamyl nitrite (1.1 g, 10.074 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 80° C., then quenched with water (100 mL) at 25° C. and extracted with CH2C12 (2×100 mL). The organic layers were combined, dried by Na2SO4, filtered, and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-5-fluoro-1H-indazole-7-carboxylate (0.18 g, 12%) as a solid. LCMS (ES, m/z): 273 [M+H]+.


Synthesis of Intermediate C4



embedded image


Methyl 4-bromo-5-fluoro-1H-indazole-7-carboxylate (50.0 mg, 0.183 mmol, 1.0 equiv), ethyl acetate (2 mL), and boron trifluoride trimethyloxidanium fluoride (108.3 mg, 0.732 mmol, 4.0 equiv) were combined at room temperature. The resulting mixture was stirred for 16 h at room temperature, then quenched with water and extracted with ethyl acetate (2×5 mL). The organic layers were combined, dried by Na2SO4, filtered, and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-5-fluoro-2-methylindazole-7-carboxylate (51 mg, 87%) as a solid. LCMS (ES, m/z): 287 [M+H]+.


Synthesis of Intermediate C5



embedded image


Methyl 4-bromo-5-fluoro-2-methylindazole-7-carboxylate (180.0 mg, 0.627 mmol, 1.0 equiv), Cs2CO3 (409.8 mg, 1.254 mmol, 2.0 equiv), tert-butyl piperazine-1-carboxylate (233.5 mg, 1.254 mmol, 2.0 equiv), XPhos (59.7 mg, 0.125 mmol, 0.2 equiv), Pd2(dba)3 (57.4 mg, 0.063 mmol, 0.1 equiv) and dioxane (5 mL) were combined at room temperature. The resulting mixture was stirred for 3 h at 70° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (12:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-fluoro-2-methylindazole-7-carboxylate (230 mg, 93%) as a solid. LCMS (ES, m/z): 393 [M+H]+.


Synthesis of Intermediate C6



embedded image


Methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-fluoro-2-methylindazole-7-carboxylate (230.0 mg, 0.586 mmol, 1.0 equiv), tetrahydrofuran (2 mL), water (2 mL) and LiOH (140.3 mg, 5.860 mmol, 10.0 equiv) were combined at room temperature. The resulting mixture was stirred for 3 h at 50° C., then diluted with water (30 mL), acidified to pH 5 with HCl (aq.), and extracted with ethyl acetate (2×50 mL). The organic layers were combined, dried by Na2SO4, filtered, and the filtrate concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-fluoro-2-methylindazole-7-carboxylic acid (150 mg, 62%) as a solid. LCMS (ES, m/z): 385 [M+H]+.


Synthesis of Intermediate C7



embedded image


A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-fluoro-2-methylindazole-7-carboxylic acid (70.0 mg, 0.185 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (39.7 mg, 0.240 mmol, 1.3 equiv), HATU (140.6 mg, 0.370 mmol, 2.0 equiv), DMF (3 mL), and DIEA (95.6 mg, 0.740 mmol, 4.0 equiv) was stirred for 2 h at room temperature, then diluted with water (10 mL) at room temperature and extracted with ethyl acetate (2×10 mL). The organic layers were combined, dried over Na2SO4, filtered, and the filtrate concentrated under reduced pressure to afford tert-butyl 4-[5-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (75 mg, 71%) as a solid. LCMS (ES, m/z): 526 [M+H]+.


Synthesis of Compound 303




embedded image


A mixture of tert-butyl 4-[5-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.133 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford 5-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl)indazole-7-carboxamide (32.1 mg, 56.37%) as a solid. LCMS (ES, m/z): 426 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.11 (m, 1H), 9.37 (d, J=1.6 Hz, 1H), 8.91 (s, 3H), 8.07 (d, J=2.6 Hz, 1H), 7.86 (d, J=14.1 Hz, 1H), 7.67 (d, J=12.1 Hz, 1H), 4.34 (s, 3H), 3.68 (d, J=5.1 Hz, 4H), 3.32 (s, 4H), 2.42 (s, 3H)


Example 43: Synthesis of Compound 290
Synthesis of Intermediate C8



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (2.0 g, 7.841 mmol, 1.0 equiv) and K2CO3 (1625.4 mg, 11.761 mmol, 1.5 equiv) in DMF (20 mL) was added 2-iodopropane (2.0 g, 11.761 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80° C., then cooled to room temperature, diluted with water (60 mL), and extracted with ethyl acetate (2×50 mL). The organic layers were combined, washed with water (1×100 mL) and brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford methyl 4-bromo-2-isopropylindazole-7-carboxylate (450 mg, 19.31%) as an oil. LCMS (ES, m/z): 297 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 8.66 (s, 1H), 7.83 (d, J=7.6 Hz, 1H), 7.41 (d, J=7.6 Hz, 1H), 4.93 (p, J=6.7 Hz, 1H), 3.89 (s, 3H), 1.59 (d, J=6.7 Hz, 6H).


Synthesis of Intermediate C9



embedded image


To a mixture of methyl 4-bromo-2-isopropylindazole-7-carboxylate (200.0 mg, 0.673 mmol, 1.0 equiv), tert-butyl piperazine-1-carboxylate (250.7 mg, 1.346 mmol, 2.0 equiv), and Cs2CO3 (659.9 mg, 2.019 mmol, 3.0 equiv) in dioxane (2 mL) was added RuPhos (62.8 mg, 0.135 mmol, 0.2 equiv) and RuPhos G3 Pd (56.3 mg, 0.067 mmol, 0.1 equiv). After stirring for 3 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-isopropylindazole-7-carboxylate (250 mg, 92%) as a solid. LCMS (ES, m/z): 403 [M+H]+.


Synthesis of Intermediate C10



embedded image


A mixture of methyl 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-isopropylindazole-7-carboxylate (250 mg, 0.621 mmol, 1.00 equiv), tetrahydrofuran (1.2 mL), water (1.2 mL), and LiOH—H2O (39.1 mg, 0.931 mmol, 1.5 equiv) was stirred for 1 h at room temperature. The reaction mixture was acidified to pH 6 with HCl (1 N, aq.) in ice-water bath, then extracted with ethyl acetate (3×3 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-isopropylindazole-7-carboxylic acid (100 mg, 41%) as a solid. LCMS (ES, m/z): 389 [M+H]+.


Synthesis of Intermediate C11



embedded image


A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-isopropylindazole-7-carboxylic acid (70 mg, 0.180 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (29.8 mg, 0.180 mmol, 1.0 equiv), DMF (1 mL), DIEA (46.6 mg, 0.360 mmol, 2.0 equiv) and HATU (82.2 mg, 0.217 mmol, 1.2 equiv) was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×4 mL). The organic layers were combined, washed with water (2×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-isopropylindazol-4-yl]piperazine-1-carboxylate (60 mg, 62%) as an oil. LCMS (ES, m/z): 536 [M+H]+.


Synthesis of Compound 290



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-isopropylindazol-4-yl]piperazine-1-carboxylate (60.0 mg, 0.112 mmol, 1.0 equiv), DCM (1 mL) and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-isopropyl-4-(piperazin-1-yl)indazole-7-carboxamide (15 mg, 28%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.15 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 8.82 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.92 (d, J=3.0 Hz, 1H), 7.44-6.97 (m, 1H), 6.49 (d, J=8.2 Hz, 1H), 5.13-4.87 (m, 1H), 3.38-3.34 (m, 4H), 2.94-2.90 (m, 4H), 2.36 (s, 3H), 1.67 (d, J=6.7 Hz, 6H).


Example 44: Synthesis of Compound 295
Synthesis of Intermediate C12



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (650 mg, 2.54 mmol, 1.0 equiv) and 3-iodooxetane (937.6 mg, 5.09 mmol, 2 equiv) in DMF (6.5 mL) was added K2CO3 (704.3 mg, 5.09 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (6 mL) and extracted with ethyl acetate (3×6 mL). The organic layers were combined, washed with brine (lx 10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-2-(oxetan-3-yl)indazole-7-carboxylate (200 mg, 25%) as a solid. LCMS (ES, m/z): 311 [M+H]+.


Synthesis of Intermediate C13



embedded image


To a stirred mixture of methyl 4-bromo-2-(oxetan-3-yl)indazole-7-carboxylate (200 mg, 0.64 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (239.4 mg, 1.28 mmol, 2 equiv) in 1,4-dioxane (2 mL) was added Cs2CO3 (628.3 mg, 1.93 mmol, 3 equiv), RuPhos (59.9 mg, 0.13 mmol, 0.2 equiv), and RuPhos G3 Pd (53.7 mg, 0.06 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (5 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (lx 5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(oxetan-3-yl)indazole-7-carboxylate (220 mg, 82%) as a solid. LCMS (ES, m/z): 417 [M+H]+.


Synthesis of Intermediate C14



embedded image


A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(oxetan-3-yl)indazole-7-carboxylate (200 mg, 0.4 mmol, 1.0 equiv) in tetrahydrofuran (2 mL) was treated with lithiumol hydrate (80.6 mg, 1.9 mmol, 4.0 equiv) in water (2 mL) at room temperature. The resulting mixture was stirred for 2 h at 50° C. under nitrogen atmosphere, then cooled to 0° C. The resulting mixture was acidified to pH 4 with HCl (1 M) and extracted with ethyl acetate (2×10 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(oxetan-3-yl)indazole-7-carboxylic acid (160 mg, 83%) as a solid. LCMS (ES, m/z): 403 [M+H]+.


Synthesis of Intermediate C15



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(oxetan-3-yl)indazole-7-carboxylic acid (160 mg, 0.39 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (72.2 mg, 0.43 mmol, 1.1 equiv) in DMF (1 mL) was added DIEA (154.1 mg, 1.19 mmol, 3.0 equiv) and HATU (226.7 mg, 0.59 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere, then quenched with water and extracted with ethyl acetate (2×10 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-yl)indazol-4-yl]piperazine-1-carboxylate (100 mg, 46%) as a solid. LCMS (ES, m/z): 550 [M+H]+.


Synthesis of Compound 295



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-yl)indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.18 mmol, 1.0 equiv) in DCM (1 mL) was treated with TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxetan-3-yl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (23.3 mg, 28%) as a solid. LCMS (ES, m/z): 450 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.17 (s, 1H), 9.38 (s, 1H), 9.16 (s, 1H), 8.85 (s, 2H), 8.27-8.02 (m, 2H), 7.50 (d, J=11.8 Hz, 1H), 6.66 (d, J=8.1 Hz, 1H), 6.12-5.95 (m, 1H), 5.25-5.08 (m, 4H), 3.66-3.58 (m, 4H), 3.37 (s, 4H), 2.41 (s, 3H).


Example 45: Synthesis of Compound 299
Synthesis of Intermediate C16



embedded image


A mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (150.0 mg, 0.037 mmol, 1.0 equiv), tert-butyl 1,6-diazaspiro[3.4]octane-1-carboxylate (153.8 mg, 0.724 mmol, 1.3 equiv), Ruphos (26.0 mg, 0.056 mmol, 0.1 equiv), Dioxane (4 mL), Cs2CO3 (363.2 mg, 1.114 mmol, 2.0 equiv) and RuPhos G3 Pd (6.2 mg, 0.007 mmol, 0.2 equiv) was stirred for 2 h at 85° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[1-(tert-butoxycarbonyl)-1,6-diazaspiro[3.4]octan-6-yl]-2-methylindazole-7-carboxylate (170 mg, 70%) as a solid. LCMS (ES, m/z): 401 [M+H]+.


Synthesis of Intermediate C17



embedded image


A mixture of methyl 4-[1-(tert-butoxycarbonyl)-1,6-diazaspiro[3.4]octan-6-yl]-2-methylindazole-7-carboxylate (170.0 mg, 0.424 mmol, 1.0 equiv), NaOH (169.7 mg, 4.240 mmol, 10.0 equiv), methanol (3 mL), and water (3 mL) was stirred for 5 h at 50° C. The resulting mixture was dilute d with water (50 mL), acidified to pH 5 with 1 N of HCl, and extracted with ethyl acetate (2×50 mL). The resulting mixture was concentrated under reduced pressure to afford 4-I[1-(tert-butoxycarbonyl)-1,6-diazaspiro[3.4]octan-6-yl]-2-methylindazole-7-carboxylic acid (160 mg, 88%) as a solid. LCMS (ES, m/z): 387 [M+H]+.


Synthesis of Intermediate C18



embedded image


A mixture of 4-[1-(tert-butoxycarbonyl)-1,6-diazaspiro[3.4]octan-6-yl]-2-methylindazole-7-carboxylic acid (50.0 mg, 0.052 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (27.7 mg, 0.168 mmol, 1.3 equiv), HATU (98.3 mg, 0.258 mmol, 2.0 equiv), DMF (2.0 mL), and DIEA (50.1 mg, 0.387 mmol, 3.0 equiv) was stirred for 5 h at 50° C. The resulting mixture was diluted with water (20 mL) and extracted with ethyl acetate (2×20 mL). The organic layer were combined, washed with water (1×40 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 6-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,6-diazaspiro[3.4]octane-1-carboxylate (65 mL, 94%) as a solid. LCMS (ES, m/z): 534 [M+H]+.


Synthesis of Compound 299



embedded image


A mixture of tert-butyl 6-[7-({8-fluoroimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,6-diazaspiro[3.4]octane-1-carboxylate (80.0 mg, 0.154 mmol, 1.0 equiv), DCM (1 mL), an d TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford 4-{1,6-diazaspiro[3.4]octan-6-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (45.3 mg, 66%) as a solid. LCMS (ES, m/z): 434 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.18 (s, 1H), 9.41 (d, J=1.6 Hz, 1H), 9.10-9.09 (m, 1H), 9.00-8.97 (m, 1H), 8.90 (s, 1H), 8.09 (s, 1H), 7.99 (d, J=8.2 Hz, 1H), 7.73 (d, J=12.0 Hz, 1H), 6.10 (d, J=8.4 Hz, 1H), 4.44 (d, J=12.4 Hz, 1H), 4.31 (s, 3H), 4.00-3.53 (m, 5H), 2.81 (dd, J=13.6, 5.8 Hz, 1H), 2.66 (t, J=8.1 Hz, 2H), 2.43 (s, 4H).


Example 46: Synthesis of Compound 316
Synthesis of Intermediate C19



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2,2,2-trifluoroethyl trifluoromethanesulfonate (70.5 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 5 h at room temperature, then quenched with water (2 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2,2,2-trifluoroethyl)indazol-4-yl]piperazine-1-carboxylate (52 mg, 44.59%) as a solid. LCMS (ES, m/z): 576 [M+H]+.


Synthesis of Compound 316



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2,2,2-trifluoroethyl)indazol-4-yl]piperazine-1-carboxylate (47.0 mg, 0.08 mmol, 1 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(2,2,2-trifluoroethyl)indazole-7-carboxamide trifluoroacetic acid salt (6 mg, 15%) as a solid. LCMS (ES, m/z): 476 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.15 (s, 1H), 9.43 (s, 1H), 9.31 (s, 2H), 9.14 (s, 1H), 8.18-8.00 (m, 2H), 7.64 (d, J=11.8 Hz, 1H), 6.65 (d, J=8.1 Hz, 1H), 5.69 (q, J=9.0 Hz, 2H), 3.67 (s, 4H), 3.36 (s, 4H), 2.42 (s, 3H).


Example 47: Synthesis of Compound 304
Synthesis of Intermediate C20



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.20 mmol, 1.0 equiv) and 4-iodooxane (64.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then quenched with water at room temperature and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxan-4-yl)indazol-4-yl]piperazine-1-carboxylate (41 mg, 35%) as a solid. LCMS (ES, m/z): 578 [M+H]+.


Synthesis of Compound 394



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxan-4-yl)indazol-4-yl]piperazine-1-carboxylate (40 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 4) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxan-4-yl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (22.8 mg, 50%) as a solid. LCMS (ES, m/z): 478 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.17 (s, 1H), 9.44 (d, J=1.6 Hz, 1H), 9.15 (s, 2H), 9.00 (s, 1H), 8.13 (d, J=2.6 Hz, 1H), 8.04 (d, J=8.0 Hz, 1H), 7.71 (dd, J=11.8, 1.6 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.95 (tt, J=10.4, 5.5 Hz, 1H), 4.10 (dt, J=11.2, 3.2 Hz, 2H), 3.69-3.51 (m, 6H), 3.37-3.35 (m, 4H), 2.44 (s, 3H), 2.25 (td, J=10.3, 9.5, 4.1 Hz, 4H).


Example 48: Synthesis of Compound 357
Synthesis of Intermediate C22



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl)indazol-4-yl]piperazine-1-carboxylate (90.0 mg, 0.16 mmol, 1.0 equiv) in methanol (1 mL) was treated with NaBH4 (7.4 mg, 0.19 mmol, 1.2 equiv) at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature, then quenched with sat. NH4Cl (aq.) at 0° C. and extracted with ethyl acetate (2×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl)indazol-4-yl]piperazine-1-carboxylate (57 mg, 63%) as a solid. LCMS (ES, m/z): 552 [M+H]+.


Synthesis of Compound 357



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl)indazol-4-yl]piperazine-1-carboxylate (57.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.6 mL) was treated with TFA (0.6 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-oxopropyl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (1.7 mg, 3%) as a solid. LCMS (ES, m/z): 452 [M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.54 (s, 1H), 8.66 (s, 1H), 8.19 (d, J=7.9 Hz, 1H), 8.09 (s, 1H), 8.02 (d, J=11.3 Hz, 1H), 6.69 (d, J=8.0 Hz, 1H), 4.73-4.60 (m, 1H), 4.48 (dd, J=23.1, 10.0 Hz, 2H), 3.71 (t, J=5.0 Hz, 4H), 3.52 (t, J=5.1 Hz, 4H), 2.59 (s, 3H), 1.35 (d, J=6.1 Hz, 3H).


Example 49: Synthesis of Compound 354
Synthesis of Intermediate C23



embedded image


A mixture of 1-chloro-2-methyl-2-propanol (1.5 g, 13.816 mmol, 1.0 equiv), DCM (15 mL), imidazole (1.8 g, 27.615 mmol, 2.0 equiv), and t-butyldimethylchlorosilane (3.1 g, 20.701 mmol, 1.5 equiv) was stirred for 3 h at room temperature. The reaction mixture was quenched with water (100 mL) at room temperature and extracted with CH2Cl2 (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford tert-butyl[(1-chloro-2-methylpropan-2-yl)oxy]dimethylsilane (1.2 g, 35%) as an oil.


Synthesis of Intermediate C24



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.203 mmol, 1.0 equiv), Cs2CO3 (198.66 mg, 0.609 mmol, 3 equiv), dimethylformamide (2 mL), and tert-butyl[(1-chloro-2-methylpropan-2-yl)oxy]dimethylsilane (135.4 mg, 0.609 mmol, 3.0 equiv) was stirred for 48 h at 50° C. The reaction was quenched with water (5 mL) at room temperature and extracted with ethyl acetate (2×5 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-hydroxy-2-methylpropyl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 79%) as a solid. LCMS (ES, m/z): 566 [M+H]+.


Synthesis of Compound 354



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-hydroxy-2-methylpropyl)indazol-4-yl]piperazine-1-carboxylate (60.0 mg, 0.106 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-hydroxy-2-methylpropyl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (37.1 mg, 75%) as a solid. LCMS (ES, m/z): 466 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.41 (s, 1H), 9.46 (d, J=1.6 Hz, 1H), 9.03 (s, 2H), 8.82 (s, 1H), 8.16-8.09 (m, 1H), 8.04 (d, J=8.0 Hz, 1H), 7.60 (d, J=11.9 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.51 (s, 2H), 3.66-3.57 (m, 4H), 3.37-3.36 (m, 4H), 2.43 (s, 3H), 1.23 (s, 6H).


Example 50: Synthesis of Compound 358
Synthesis of Intermediate C25



embedded image


Methyl 1-hydroxycyclopropane-1-carboxylate (2.0 g, 17.224 mmol, 1.0 equiv), DCM (30 mL), PPTS (1.3 g, 5.167 mmol, 0.3 equiv), and dihydropyran (2.1 g, 25.836 mmol, 1.5 equiv) were combined at 0° C. The resulting mixture was stirred for 5 h at room temperature, then quenched with water (100 mL) at room temperature and extracted with CH2Cl2 (2×100 mL). The organic layers were combined, dried by Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford methyl 1-(oxan-2-yloxy)cyclopropane-1-carboxylate (2.5 g, 65%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 4.83-4.81 (m, 1H), 3.79-3.71 (m, 1H), 3.64 (s, 3H), 3.52-3.36 (m, 1H), 1.84-1.62 (m, 2H), 1.61-1.32 (m, 5H), 1.27-1.08 (m, 3H).


Synthesis of Intermediate C26



embedded image


Methyl 1-(oxan-2-yloxy)cyclopropane-1-carboxylate (400.0 mg, 1.998 mmol, 1.0 equiv), tetrahydrofuran (10 mL), and LiAlH4 (113.7 mg, 2.997 mmol, 1.5 equiv) were combined at 0° C. The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere, quenched with water (100 mL) at 0° C. and extracted with ethyl acetate (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The resulting mixture was concentrated under reduced pressure to give a solid.


Synthesis of Intermediate C27



embedded image


[1-(oxan-2-yloxy)cyclopropyl]methanol (300 mg, 1.742 mmol, 1.0 equiv), DCM (6 mL), triethylamine (352.5 mg, 3.484 mmol, 2.0 equiv), and methanesulfonyl chloride (399.0 mg, 3.484 mmol, 2.0 equiv) were combined at 0° C. The resulting mixture was stirred for 2 h at 0° C., then quenched with water (50 mL) at 0° C. and extracted with CH2Cl2 (2×50 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a solid.


Synthesis of Intermediate C28



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.203 mmol, 1.0 equiv), Cs2CO3 (198.6 mg, 0.609 mmol, 3.0 equiv), dimethylformamide (2 mL), and [1-(oxan-2-yloxy)cyclopropyl]methyl methanesulfonate (152.1 mg, 0.609 mmol, 3.0 equiv) was stirred overnight at 50° C. The reaction mixture was quenched with water (10 mL) at room temperature and extracted with ethyl acetate (2×10 mL). The organic layer were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-{[1-(oxan-2-yloxy)cyclopropyl]methyl}indazol-4-yl]piperazine-1-carboxylate (100 mg, 70%) as a solid. LCMS (ES, m/z): 648 [M+H]+.


Synthesis of Compound 358



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(1-hydroxycyclopropyl)methyl]indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.177 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(1-hydroxycyclopropyl)methyl]-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (29.4 mg, 35%) as a solid. LCMS (ES, m/z): 464 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.42 (s, 1H), 9.46 (d, J=1.6 Hz, 1H), 9.01 (s, 2H), 8.88 (s, 1H), 8.12 (d, J=2.7 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.61 (d, J=11.7 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 4.63 (s, 2H), 3.62 (t, J=5.1 Hz, 4H), 3.373.36 (m, 4H), 2.42 (s, 3H), 1.00-0.83 (m, 2H), 0.83-0.74 (m, 2H).


Example 51: Synthesis of Compound 305
Synthesis of Intermediate C29



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1 equiv) and 1-fluoro-2-iodo-ethane, (52.8 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-fluoroethyl)indazol-4-yl]piperazine-1-carboxylate (41 mg, 38%) as a solid. LCMS (ES, m/z): 540 [M+H]+.


Synthesis of Compound 305



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-fluoroethyl)indazol-4-yl]piperazine-1-carboxylate (41.0 mg, 0.07 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 6) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-fluoroethyl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid (24.3 mg, 49%) as a solid. LCMS (ES, m/z): 440 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.19 (s, 1H), 9.43 (d, J=1.5 Hz, 1H), 9.01 (s, 1H), 8.95 (s, 2H), 8.10 (s, 1H), 8.06 (d, J=8.0 Hz, 1H), 7.70 (d, J=12.0 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 5.16 (t, J=4.6 Hz, 1H), 5.01 (t, J=4.6 Hz, 1H), 4.96 (t, J=4.7 Hz, 1H), 4.84 (t, J=4.7 Hz, 1H), 3.61 (t, J=5.2 Hz, 4H), 3.37 (s, 4H), 2.42 (d, J=0.9 Hz, 3H).


Example 52: Synthesis of Compound 302
Synthesis of Intermediate C30



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (10 g, 39.2 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (10.9 g, 58.8 mmol, 1.5 equiv) in toluene (100 mL) was added K2CO3 (16.2 g, 117.6 mmol, 3 equiv), BINAP (4.8 g, 7.8 mmol, 0.2 equiv), and Pd(AcO)2 (0.8 g, 3.9 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (100 mL) and extracted with ethyl acetate (2×100 mL). The organic layers were combined, washed with brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2H-indazole-7-carboxylate (10.4 g, 74%) as a solid. LCMS (ES, m/z): 361 [M+H]+.


Synthesis of Intermediate C31



embedded image


A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-211-indazole-7-carboxylate (10.4 g, 28.8 mmol, 1 equiv) in THE (100 mL) was treated with LiOH·H2O (2.7 g, 115.4 mmol, 4 equiv) in water (100 mL) at room temperature. The resulting mixture was stirred for 2 h at 50° C. under nitrogen atmosphere, then cooled to 0° C. The resulting mixture was acidified to pH 4 with HCl (1 M) and extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (15:1) to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2H-indazole-7-carboxylic acid (9.6 g, 96%) as a solid. LCMS (ES, m/z): 347 [M+H]f.


Synthesis of Intermediate C32



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2H-indazole-7-carboxylic acid (9.6 g, 27.7 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (5.0 g, 30.4 mmol, 1.1 equiv), and NMI (9.1 g, 110.8 mmol, 4 equiv) in acetonitrile (100 mL) was added TCFH (9.3 g, 33.2 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere, then diluted with water and extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (10.6 g, 77%) as a solid. LCMS (ES, m/z): 494 [M+H]f.


Synthesis of Intermediate C33



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (60 mg, 0.12 mmol, 1 equiv) and 1-bromo-3-methoxypropane (27.9 mg, 0.18 mmol, 1.5 equiv) in DMF (0.6 mL) was added Cs2CO3 (118.8 mg, 0.37 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-methoxypropyl)indazol-4-yl]piperazine-1-carboxylate (34 mg, 49%) as a solid. LCMS (ES, m/z): 566 [M+H]+.


Synthesis of Compound 302



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-methoxypropyl)indazol-4-yl]piperazine-1-carboxylate (34 mg, 0.06 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 7) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(3-methoxypropyl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (14.1 mg, 50%) as a solid. LCMS (ES, m/z): 466 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.19 (s, 1H), 9.39 (d, J=1.6 Hz, 1H), 8.96-8.93 (m, 3H), 8.09 (d, J=2.1 Hz, 1H), 8.04 (d, J=8.0 Hz, 1H), 7.62 (d, J=12.0 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.63 (t, J=7.1 Hz, 2H), 3.59-3.57 (m, 4H), 3.42 (t, J=6.1 Hz, 2H), 3.36-3.34 (m, 4H), 3.28 (s, 3H), 2.42 (s, 3H), 2.30 (q, J=6.5 Hz, 2H).


Example 53: Synthesis of Compound 338
Synthesis of Intermediate C34



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (110 mg, 0.223 mmol, 1.0 equiv) and 3-(iodomethyl)oxetane (66.20 mg, 0.335 mmol, 1.5 equiv) in DMF (2.2 mL) was added Cs2CO3 (217.8 mg, 0.669 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3×10 mL). The organic layer were combined, washed with water (3×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (65 mg, 52%) as a solid. LCMS (ES, m/z): 423.2 [M+H]+.


Synthesis of Compound 338



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (20 mg, 0.035 mmol, 1.0 equiv) in DCM (0.5 mL) was added ZnBr2 (79.91 mg, 0.350 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature, then diluted with water (2 mL) and extracted with CH2Cl2 (2×2 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxetan-3-ylmethyl)-4-(piperazin-1-yl)indazole-7-carboxamide (5.6 mg, 34%) as a solid. LCMS (ES, m/z): 403.2 [M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.02 (s, 1H), 8.55 (s, 1H), 8.06 (d, J=8.0 Hz, 1H), 7.69-7.63 (m, 1H), 7.14 (d, J=11.8 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.95-4.82 (m, 4H), 4.71 (t, J=6.1 Hz, 2H), 3.82-3.72 (m, 1H), 3.42 (t, J=4.9 Hz, 4H), 3.07 (m, 4H), 2.42 (s, 3H)).


Example 54: Synthesis of Compound 317
Synthesis of Intermediate C35



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and epibromohydrin (41.6 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (2 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxiran-2-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (55 mg, 49%) as a solid. LCMS (ES, m/z): 550 [M+H]+.


Synthesis of Compound 317



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxiran-2-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (55 mg, 0.10 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.1 mL) at 0° C. The resulting mixture was stirred for 30 min at 0° C., then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxiran-2-ylmethyl)-4-(piperazin-1-yl)indazole-7-carboxamide (2 mg, 4%) as a solid. LCMS (ES, m/z): 450 [M+H]+.


Example 55: Synthesis of Compound 339
Synthesis of Intermediate C21



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (300.0 mg, 0.61 mmol, 1.0 equiv) and 1-chloropropan-2-one (67.4 mg, 0.73 mmol, 1.2 equiv) in DMF (3 mL) was added Cs2CO3 (594.1 mg, 1.82 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water and extracted with ethyl acetate (3×6 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl)indazol-4-yl]piperazine-1-carboxylate (135 mg, 40%) as a solid. LCMS (ES, m/z): 550 [M+H]+.


Synthesis of Compound 339



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl)indazol-4-yl]piperazine-1-carboxylate (50 mg, 0.09 mmol, 1 equiv) in DCM (0.5 mL) and TFA (0.5 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-oxopropyl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (21.8 mg, 44%) as a solid. LCMS (ES, m/z): 450 [M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 11.42 (s, 1H), 9.48 (d, J=1.7 Hz, 1H), 8.62 (s, 1H), 8.20 (d, J=8.0 Hz, 1H), 8.03 (d, J=1.9 Hz, 1H), 7.91 (dd, J=11.5, 1.5 Hz, 1H), 6.71 (d, J=8.0 Hz, 1H), 5.65 (s, 2H), 3.71 (dd, J=6.7, 3.8 Hz, 4H), 3.52 (dd, J=6.7, 3.7 Hz, 4H), 2.63-2.49 (m, 3H), 2.36 (s, 3H).


Example 56: Synthesis of Compound 308
Synthesis of Intermediate C36



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.20 mmol, 1 equiv) and 3-(bromomethyl)-3-methyloxetane (50.1 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (2 mL) and extracted with ethyl acetate (3×2 mL). The organic layers were combined, washed with brine (1×2 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(3-methyloxetan-3-yl)methyl] indazol-4-yl]piperazine-1-carboxylate (42 mg, 36%) as a solid. LCMS (ES, m/z): 578 [M+H]+.


Synthesis of Compound 308



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(3-methyloxetan-3-yl)methyl]indazol-4-yl]piperazine-1-carboxylate (42 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 8) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(3-methyloxetan-3-yl)methyl]-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (20.1 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 10.87 (s, 1H), 9.63 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 9.16 (s, 2H), 8.20 (d, J=8.2 Hz, 1H), 8.08 (d, J=2.9 Hz, 1H), 7.53 (d, J=12.3 Hz, 1H), 6.98 (d, J=8.3 Hz, 1H), 4.76 (dd, J=12.3, 5.4 Hz, 2H), 4.56 (dd, J=12.3, 7.5 Hz, 2H), 3.67 (t, J=5.5 Hz, 4H), 3.52 (s, 2H), 3.39 (s, 4H), 2.40 (s, 3H), 1.32 (s, 3H).


Example 57: Synthesis of Compound 331
Synthesis of Intermediate C37



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (120.0 mg, 0.24 mmol, 1.0 equiv) and methyl chloroacetate (39.5 mg, 0.36 mmol, 1.5 equiv) in DMF (1.2 mL) was added Cs2CO3 (237.6 mg, 0.73 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×2 mL). The organic layers were combined, washed with brine (1×2 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxy-2-oxoethyl)indazol-4-yl]piperazine-1-carboxylate (48 mg, 35%) as a solid. LCMS (ES, m/z): 566 [M+H]+.


Synthesis of Intermediate C38



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxy-2-oxoethyl)indazol-4-yl]piperazine-1-carboxylate (48.0 mg, 0.08 mmol, 1.0 equiv) in tetrahydrofuran (0.5 mL) was treated with LiOH·H2O (10.1 mg, 0.42 mmol, 5.0 equiv) in water (0.5 mL) at room temperature. The resulting mixture was stirred for 2 h at 50° C. under nitrogen atmosphere, then cooled to 0° C., acidified to pH 4 with HCl (1 M), and extracted with ethyl acetate (2×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford {4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-2-yl}acetic acid (34 mg, 73%) as a solid. LCMS (ES, m/z): 552 [M+H]+.


Synthesis of Compound 331



embedded image


A solution of {4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-2-yl}acetic acid (34 mg, 0.06 mmol, 1.0 equiv) in DCM (0.4 mL) was treated with TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 9) to afford [7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-4-(piperazin-1-yl)indazol-2-yl]acetic acid trifluoroacetic acid salt (2.5 mg, 7%) as a solid. LCMS (ES, m/z): 452 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.17 (s, 1H), 9.39 (s, 1H), 8.96 (s, 1H), 8.89 (s, 2H), 8.15-8.01 (m, 2H), 7.66 (d, J=12.2 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 5.54 (s, 2H), 3.60 (d, J=5.7 Hz, 4H), 3.37 (s, 4H), 2.40 (s, 3H).


Example 58: Synthesis of Compound 309
Synthesis of Intermediate C39



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2-chloro-N,N-dimethylacetamide (36.9 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-{2-[(dimethylcarbamoyl)methyl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl}piperazine-1-carboxylate (45 mg, 38%) as a solid. LCMS (ES, m/z): 579 [M+H]+.


Synthesis of Compound 309



embedded image


To a stirred solution of tert-butyl 4-{2-[(dimethylcarbamoyl)methyl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl}piperazine-1-carboxylate (47 mg, 0.081 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 10) to afford 2-[(dimethylcarbamoyl)methyl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (24.1 mg, 62%) as a solid. LCMS (ES, m/z): 479 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.26 (s, 1H), 9.51 (d, J=1.6 Hz, 1H), 9.14 (s, 2H), 8.86 (s, 1H), 8.15 (d, J=2.6 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.82 (d, J=11.8 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 5.68 (s, 2H), 3.62 (t, J=5.1 Hz, 4H), 3.36 (s, 4H), 3.18 (s, 3H), 2.93 (s, 3H), 2.47 (s, 3H).


Example 59: Synthesis of Compound 355
Synthesis of Intermediate C40



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (150.0 mg, 0.304 mmol, 1.0 equiv), dimethylformamide (3 mL), caesio methaneperoxoate caesium (297.9 mg, 0.912 mmol, 3.0 equiv) and 3-bromocyclobutan-1-one (58.8 mg, 0.395 mmol, 1.3 equiv) was stirred for 1 h at room temperature. The reaction was quenched with water (10 mL) and extracted with ethyl acetate (2×10 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (40:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-oxocyclobutyl)indazol-4-yl] piperazine-1-carboxylate (70 mg, 37%) as a solid. LCMS (ES, m/z): 562 [M+H]+.


Synthesis of Intermediate C41



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-oxocyclobutyl)indazol-4-yl]piperazine-1-carboxylate (50.0 mg, 0.089 mmol, 1.0 equiv), methanol (1 mL), and NaBH4 (6.7 mg, 0.178 mmol, 2.0 equiv) was stirred for 1 h at 0° C. under nitrogen atmosphere. The reaction was quenched with water (5 mL) and extracted with ethyl acetate (2×5 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-hydroxycyclobutyl)indazol-4-yl]piperazine-1-carboxylate (45 mg, 81%) as a solid. LCMS (ES, m/z): 564 [M+H]+.


Synthesis of Compound 355



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-hydroxycyclobutyl)indazol-4-yl]piperazine-1-carboxylate (40.0 mg, 0.071 mmol, 1.0 equiv), DCM (1 mL) and trifluoroacetaldehyde (4 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 4, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(3-hydroxycyclobutyl)-4-(piperazin-1-yl)indazole-7-carboxamide (5 mg, 15.00%) as a solid. LCMS (ES, m/z): 463 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.27 (s, 1H), 9.28 (d, J=1.6 Hz, 1H), 8.85 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.95-7.88 (m, 1H), 7.27 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 5.53 (d, J=6.1 Hz, 1H), 4.87 (t, J=8.0 Hz, 1H), 4.14 (q, J=7.0 Hz, 1H), 3.37-3.36 (m, 4H), 2.92-2.90 (m, 6H), 2.72-2.59 (m, 2H), 2.35 (s, 3H).


Example 60: Synthesis of Compound 311
Synthesis of Intermediate C42



embedded image


A mixture of methyl 2-amino-4-bromo-5-fluoro-3-methylbenzoate (1.2 g, 4.579 mmol, 1.0 equiv) and Ac2O (0.6 g, 5.953 mmol, 1.3 equiv) was stirred for 1 h at 25° C. To the reaction mixture was added potassium acetate (0.13 g, 1.374 mmol, 0.3 equiv) and isoamyl nitrite (1.1 g, 10.074 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 80° C., then quenched with water (100 mL) and extracted with CH2Cl2 (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl methyl 5-(acetyloxy)-4-bromo-1H-indazole-7-carboxylate (800 g, 50%) as a solid. LCMS (ES, m/z): 313 [M+H]+.


Synthesis of Intermediate C43



embedded image


A mixture of methyl 5-(acetyloxy)-4-bromo-2H-indazole-7-carboxylate (0.8 g, 2.555 mmol, 1.0 equiv), ethyl acetate (15 mL), and (CH3)3O+BF4 (1.5 g, 10.220 mmol, 4.0 equiv) was stirred for 16 h at room temperature. The reaction mixture was quenched with water (50 mL) and extracted with ethyl acetate (2×50 mL). The organic layer were combined, dried over Na2SO4, and concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 5-(acetyloxy)-4-bromo-2-methylindazole-7-carboxylate (780 mg, 84%) as a solid. LCMS (ES, m/z): 327 [M+H]+.


Synthesis of Intermediate C44



embedded image


A mixture of methyl 5-(acetyloxy)-4-bromo-2-methylindazole-7-carboxylate (0.8 g, 2.445 mmol, 1.0 equiv), methanol (10 mL), water (5 mL), and K2CO3 (1.0 g, 7.335 mmol, 3.0 equiv) was stirred for 1 h at room temperature. The reaction mixture was quenched with water (100 mL) and extracted with ethyl acetate (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-5-hydroxy-2-methylindazole-7-carboxylate (410 mg, 53%) as a solid. LCMS (ES, m/z): 285 [M+H]+.


Synthesis of Intermediate C45



embedded image


A mixture of methyl 4-bromo-5-hydroxy-2-methylindazole-7-carboxylate (0.8 g, 2.806 mmol, 1.0 equiv), K2CO3 (0.8 g, 5.612 mmol, 2.0 equiv), DMF (15 mL), and methyl iodide (0.8 g, 5.612 mmol, 2.0 equiv) was stirred for 1 h at room temperature. The reaction mixture was quenched with water (100 mL) and extracted with ethyl acetate (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-5-methoxy-2-methylindazole-7-carboxylate (750 mg, 79%) as a solid. LCMS (ES, m/z): 299 [M+H]+.


Synthesis of Intermediate C46



embedded image


A mixture of methyl 4-bromo-5-methoxy-2-methylindazole-7-carboxylate (0.7 g, 2.340 mmol, 1.0 equiv), Cs2CO3 (1.5 g, 4.680 mmol, 2.0 equiv), tert-butyl piperazine-1-carboxylate (0.8 g, 4.680 mmol, 2.0 equiv), XPhos (0.2 g, 0.468 mmol, 0.2 equiv), Pd2(dba)3 (0.2 g, 0.234 mmol, 0.1 equiv), and dioxane (10 mL) was stirred for 3 h at 70° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-methoxy-2-methylindazole-7-carboxylate (0.9 g, 86%) as a solid. LCMS (ES, m/z): 405 [M+H]+.


Synthesis of Intermediate C47



embedded image


A mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-methoxy-2-methylindazole-7-carboxylate (0.9 g, 2.225 mmol, 1.0 equiv), THE (10 mL), water (5 mL), and LiOH (0.5 g, 22.250 mmol, 10.0 equiv) was stirred for 3 h at 50° C. The resulting mixture was diluted with water (100 mL), acidified to pH 5 with HCl (aq.), and extracted with ethyl acetate (2×100 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-methoxy-2-methylindazole-7-carboxylic acid (0.63 g, 73%) as a solid. LCMS (ES, m/z): 391 [M+H]+.


Synthesis of Intermediate C48



embedded image


A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-5-methoxy-2-methylindazole-7-carboxylic acid (250.0 mg, 0.640 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (137.4 mg, 0.832 mmol, 1.3 equiv), HATU (486.9 mg, 1.280 mmol, 2.0 equiv), DIEA (248.2 mg, 1.920 mmol, 3.0 equiv) and DMF (6 mL) was stirred for 3 h at 50° C. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (2×50 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-5-methoxy-2-methylindazol-4-yl]piperazine-1-carboxylate (350 mg, 92%) as a solid. LCMS (ES, m/z): 538 [M+H]+.


Synthesis of Compound 311



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-5-methoxy-2-methylindazol-4-yl]piperazine-1-carboxylate (90.0 mg, 0.167 mmol, 1.0 equiv), DCM (1 m L), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-5-methoxy-2-methyl-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (32 mg, 42%) as a solid. LC MS (ES, m/z): 526 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.24 (m, 1H), 9.44 (d, J=1.5 Hz, 1H), 9.18 (s, 2H), 8.79 (s, 1H), 8.15 (d, J=2.6 Hz, 1H), 7.91 (s, 1H), 7.85 (d, J=12.3 Hz, 1H), 4.33 (d, J=4.4 Hz, 3H), 3.88 (s, 3H), 3.63 (t, J=5.0 Hz, 4H), 3.28-3.27 (m, 4H), 2.49 (s, 3H).


Example 61: Synthesis of Compound 312
Synthesis of Intermediate C49



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.20 mmol, 1 equiv) and butyl iodide (55.9 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[2-butyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (42 mg, 38%) as a solid. LCMS (ES, m/z): 550 [M+H]+.


Synthesis of Compound 312



embedded image


To a stirred solution of tert-butyl 4-[2-butyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (42 mg, 0.07 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 11) to afford 2-butyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (23.6 mg, 56%) as a solid. LCMS (ES, m/z): 450 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.25 (s, 1H), 9.45 (d, J=1.6 Hz, 1H), 9.05 (s, 2H), 8.96 (s, 1H), 8.14 (s, 1H), 8.04 (d, J=8.0 Hz, 1H), 7.73 (d, J=11.9 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.59 (t, J=7.0 Hz, 2H), 3.61 (s, 4H), 3.36 (s, 4H), 2.46-2.41 (m, 3H), 2.03 (p, J=7.1 Hz, 2H), 1.35 (q, J=7.5 Hz, 2H), 0.97 (t, J=7.4 Hz, 3H).


Example 62: Synthesis of Compound 313
Synthesis of Intermediate C50



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (90.0 mg, 0.182 mmol, 1.0 equiv), Cs2CO3 (178.8 mg, 0.546 mmol, 3.0 equiv), 4-(chloromethyl)pyridine (25.5 mg, 0.200 mmol, 1.1 equiv), and DMF (2 mL) was stirred for 3 h at room temperature. The reaction was quenched with water (10 mL) and extracted with ethyl acetate (2×10 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated in vacuo to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(pyridin-4-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (60 mg, 51%) as a solid. LCMS (ES, m/z): 585 [M+H]+.


Synthesis of Compound 313



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(pyrid in-4-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.120 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(pyridin-4-ylmethyl)indazole-7-carboxamide trifluoroacetic acid salt (22 mg, 36%) as a solid. LCMS (ES, m/z): 485 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.19 (s, 1H), 9.48 (d, J=1.5 Hz, 1H), 9.17 (s, 1H), 9.11 (s, 2H), 8.73-8.65 (m, 2H), 8.20-8.13 (m, 1H), 8.07 (d, J=8.0 Hz, 1H), 7.74 (dd, J=11.9, 1.6 Hz, 1H), 7.56-7.48 (m, 2H), 6.66 (d, J=8.1 Hz, 1H), 5.98 (s, 2H), 3.68-3.59 (m, 4H), 3.36-3.35 (m, 4H), 2.45 (s, 3H).


Example 63: Synthesis of Compound 318
Synthesis of Intermediate C51



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (90.0 mg, 0.182 mmol, 1.0 equiv), Cs2CO3 (178.8 mg, 0.546 mmol, 3.0 equiv), DMF (2 mL), and 5-(chloromethyl)pyrimidine (28.1 mg, 0.218 mmol, 1.2 equiv) was stirred for 1 h at room temperature. The reaction was quenched with water (20 mL) and extracted with ethyl acetate (2×20 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(pyrimidin-5-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (50 mg, 44%) as an oil. LCMS (ES, m/z): 586 [M+H]+.


Synthesis of Compound 318



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(pyrimidin-5-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (80.0 mg, 0.137 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(pyrimidin-5-ylmethyl)indazole-7-carboxamide trifluoroacetic acid salt (17.2 mg, 25%) as a solid. LCMS (ES, m/z): 486 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.08 (s, 1H), 9.42 (d, J=1.6 Hz, 1H), 9.21 (s, 1H), 9.10 (d, J=20.0 Hz, 3H), 8.91 (d, J=6.1 Hz, 2H), 8.12-8.00 (m, 2H), 7.58 (d, J=12.0 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 5.89 (s, 2H), 3.62-3.61 (m, 4H), 3.36-3.35 (m, 4H), 2.42 (s, 3H).


Example 64: Synthesis of Compound 341
Synthesis of Intermediate C52



embedded image


Tert-butyl 4-(hydroxymethyl)pyrazole-1-carboxylate (400 mg, 2.018 mmol, 1.0 equiv), DCM (8 mL), triethylamine (408.40 mg, 4.036 mmol, 2 equiv), and methanesulfonyl chloride (300.48 mg, 2.623 mmol, 1.3 equiv) were combined at 0° C. The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere, then quenched with water (50 mL) at 0° C. and extracted with DCM (2×50 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a solid.


Synthesis of Intermediate C53



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (65.0 mg, 0.132 mmol, 1.0 equiv), caesio methaneperoxoate caesium (129.1 mg, 0.396 mmol, 3.0 equiv), dimethylformamide (2 mL) and tert-butyl 4-[(methanesulfonyloxy)methyl]pyrazole-1-carboxylate (54.5 mg, 0.198 mmol, 1.5 equiv) was stirred for 5 h at 50° C. The reaction mixture was cooled to room temperature, diluted with water (10 mL), and extracted with ethyl acetate (2×10 mL). The organic layers were combined, dried over Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl 4-(2-{[1-(tert-butoxycarbonyl)pyrazol-4-yl]methyl}-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl)piperazine-1-carboxylate (45 mg, 47%) as a solid. LCMS (ES, m/z): 673 [M+H]+.


Synthesis of Compound 341



embedded image


A mixture of tert-butyl 4-(2-{[1-(tert-butoxycarbonyl)pyrazol-4-yl]methyl}-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl)piperazine-1-carboxylate (40.0 mg, 0.059 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL, 10.202 mmol, 171.8 equiv) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(1H-pyrazol-4-ylmethyl)indazole-7-carboxamide trifluoroacetic acid salt (18 mg, 64%) as a solid. LCMS (ES, m/z): 473 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 9.40 (d, J=1.6 Hz, 1H), 8.96 (s, 1H), 8.92 (s, 2H), 8.09 (d, J=2.7 Hz, 1H), 8.03 (d, J=8.0 Hz, 1H), 7.85 (s, 2H), 7.61 (d, J=11.8 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 5.69 (s, 2H), 3.60 (t, J=5.1 Hz, 4H), 3.36 (s, 4H), 2.43 (s, 3H).


Example 65: Synthesis of Compound 326
Synthesis of Intermediate C54



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (1.6 g, 5.946 mmol, 1 equiv) in THE (1.5 mL) and water (0.5 mL) was added lithiumol hydrate (0.50 g, 11.892 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting solution was concentrated under reduced pressure and acidified to pH 6 with citric acid to afford a precipitate. The precipitated solid was collected by filtration and dried under infrared light to afford 4-bromo-2-methylindazole-7-carboxylic acid (1.3 g, 86%) as a solid. LCMS (ES, m/z): 255 [M+H]+.


Synthesis of Intermediate C55



embedded image


To a stirred mixture of 4-bromo-2-methylindazole-7-carboxylic acid (500 mg, 1.960 mmol, 1 equiv) and DIEA (760.06 mg, 5.880 mmol, 3 equiv) in DMF (10 mL) was added HATU (968.96 mg, 2.548 mmol, 1.3 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (420.91 mg, 2.548 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature and filtrated. The filter cake was dried under infrared light to afford 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (600 mg, 76%) as a solid. LCMS (ES, m/z): 402 [M+H]+.


Synthesis of Intermediate C56



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (44.76 mg, 0.209 mmol, 1.2 equiv) in 1,4-dioxane (1.4 mL) was added Cs2CO3 (170.11 mg, 0.522 mmol, 3.0 equiv), RuPhos (8.12 mg, 0.017 mmol, 0.1 equiv), and RuPhos Palladacycle Gen.3 (14.56 mg, 0.017 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (70 mg, 56%) as a solid. LCMS (ES, m/z): 536 [M+H]+.


Synthesis of Compound 326



embedded image


To a stirred solution of tert-butyl(2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (70 mg, 0.131 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 103.02 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (11.1 mg, 20%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.08 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.35 (d, J=12.6 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.79 (d, J=11.7 Hz, 2H), 2.95 (s, 3H), 2.49-2.44 (m, 2H), 2.35 (s, 3H), 1.07 (d, J=6.2 Hz, 6H).


Example 66: Synthesis of Compound 345
Synthesis of Intermediate C57



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-(piperidin-4-yl)carbamate (43.02 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (6.96 mg, 0.015 mmol, 0.1 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-cyclopropyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (50 mg, 42%) as an oil. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 345



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (50 mg, 0.089 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 151.23 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 2) to afford 4-[4-(cyclopropylamino)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (3.6 mg, 9%) as solid. LCMS (ES, m/z): 462 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.34 (dd, J=12.4, 1.6 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J=12.6 Hz, 2H), 3.11-3.02 (m, 2H), 2.79 (s, 1H), 2.35 (s, 3H), 2.13 (dt, J=6.6, 3.1 Hz, 1H), 2.01 (d, J=12.6 Hz, 2H), 1.48 (q, J=10.7, 9.9 Hz, 2H), 0.40 (dt, J=6.3, 3.0 Hz, 2H), 0.24 (p, J=3.9 Hz, 2H).


Example 67: Synthesis of Compound 335
Synthesis of Intermediate C58



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4-ylmethyl)carbamate (38.36 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-({1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}methyl)carbamate (60 mg, 75%) as a solid. LCMS (ES, m/z): 536 [M+H]+.


Synthesis of Compound 335



embedded image


To a stirred solution of tert-butyl N-({1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}methyl)carbamate (60 mg, 0.112 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 120.19 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-[4-(aminomethyl)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (30.5 mg, 63%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.76 (d, J=3.0 Hz, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.97 (d, J=11.7 Hz, 2H), 2.96 (s, 3H), 2.38-2.32 (m, 3H), 1.83 (t, J=15.5 Hz, 2H), 1.60 (d, J=44.4 Hz, 1H), 1.41-1.27 (m, 2H).


Example 68: Synthesis of Compound 327
Synthesis of Intermediate C59



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(pyrrolidin-3-ylmethyl)carbamate (35.85 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-({1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}methyl)carbamate (70 mg, 90%) as a solid. LCMS (ES, m/z): 522 [M+H]+.


Synthesis of Compound 327



embedded image


To a stirred solution of tert-butyl N-({1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}methyl)carbamate (70 mg, 0.134 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 100.32 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 3) to afford 4-[3-(aminomethyl)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (16.2 mg, 29%) as a solid. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.82 (d, J=11.3 Hz, 1H), 7.96-7.86 (m, 2H), 7.30 (dd, J=12.5, 1.7 Hz, 1H), 6.02 (dd, J=8.4, 2.2 Hz, 1H), 4.27 (s, 3H), 3.82-3.57 (m, 3H), 3.19-3.04 (m, 1H), 2.69 (d, J=6.6 Hz, 1H), 2.39 (t, J=7.4 Hz, 1H), 2.35 (s, 3H), 2.14 (s, 1H), 1.81 (q, J=11.3, 9.3 Hz, 1H).


Example 69: Synthesis of Compound 328
Synthesis of Compound 328



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and N-(piperidin-4-yl)acetamide (25.45 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1), followed by Prep-HPLC (Condition 5, Gradient 4) to afford 4-(4-acetamidopiperidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (15 mg, 21.69%) as a solid. LCMS (ES, m/z): 464 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.79 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.90 (t, J=4.9 Hz, 2H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.94-3.78 (m, 3H), 3.12 (t, J=12.0 Hz, 2H), 2.35 (s, 3H), 1.90 (d, J=12.5 Hz, 2H), 1.83 (s, 3H), 1.57 (q, J=10.6 Hz, 2H).


Example 70: Synthesis of Compound 336
Synthesis of Intermediate C60



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(4-methylpiperidin-4-yl)carbamate (38.36 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-4-methylpiperidin-4-yl}carbamate (65 mg, 81%) as a solid. LCMS (ES, m/z): 536 [M+H]+.


Synthesis of Compound 336



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-4-methylpiperidin-4-yl}carbamate (65 mg, 0.121 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 110.94 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-(4-amino-4-methylpiperidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (15.5 mg, 29%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J=8.2 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.34 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.29 (s, 3H), 3.53 (s, 4H), 2.35 (d, J=0.9 Hz, 3H), 1.68-1.55 (m, 4H), 1.17 (s, 3H).


Example 71: Synthesis of Compound 346
Synthesis of Intermediate C61



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(4-fluoropyrrolidin-3-yl)-N-methylcarbamate (39.07 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 100° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-{4-fluoro-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (70 mg, 87%) as a solid. LCMS (ES, m/z): 540 [M+H]+.


Synthesis of Compound 346



embedded image


To a stirred solution of tert-butyl N-{4-fluoro-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (70 mg, 0.130 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 103.78 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 4) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-fluoro-4-(methylamino)pyrrolidin-1-yl]-2-methylindazole-7-carboxamide (3.4 mg, 6%) as a solid. LCMS (ES, m/z): 440 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.86 (s, 1H), 7.95 (d, J=8.2 Hz, 1H), 7.92-7.86 (m, 1H), 7.32 (dd, J=12.4, 1.7 Hz, 1H), 6.06 (d, J=8.4 Hz, 1H), 5.40 (d, J=54.5 Hz, 1H), 4.28 (s, 3H), 3.94 (td, J=25.2, 21.2, 9.8 Hz, 3H), 2.44 (s, 3H), 2.37-2.33 (m, 3H).


Example 72: Synthesis of Compound 329
Synthesis of Compound 329



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxiran-2-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (38.0 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was treated with TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 30 min at 0° C., then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 12) to afford 2-(2,3-dihydroxypropyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (10.8 mg, 28%) as a solid. LCMS (ES, m/z): 468 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.32 (s, 1H), 9.44 (s, 1H), 9.07 (s, 2H), 8.88 (s, 1H), 8.11 (d, J=2.7 Hz, 1H), 8.03 (d, J=7.9 Hz, 1H), 7.66 (d, J=11.7 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.69 (dd, J=13.5, 3.7 Hz, 1H), 4.48 (dd, J=13.5, 7.7 Hz, 1H), 4.14 (d, J=6.4 Hz, 1H), 3.62 (d, J=5.5 Hz, 4H), 3.48 (td, J=11.0, 10.3, 5.5 Hz, 2H), 3.37 (s, 4H), 2.43 (s, 3H).


Example 73: Synthesis of Compound 356
Synthesis of Intermediate C62



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.2 mmol, 1.0 equiv), 3-bromooxolane (45.8 mg, 0.3 mmol, 1.5 equiv), and Cs2CO3 (198.0 mg, 0.6 mmol, 3.0 equiv) in DMF (1 mL) was stirred for 1 h at room temperature under nitrogen atmosphere. The reaction mixture was diluted with water (3 mL) and extracted with ethyl acetate (2×5 mL). The organic layers were combined, washed with brine (1×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxolan-3-yl)indazol-4-yl]piperazine-1-carboxylate (52.0 mg, 46%) as a solid. LCMS (ES, m/z): 564 [M+H]+.


Synthesis of Compound 356



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxolan-3-yl)indazol-4-yl]piperazine-1-carboxylate (52.0 mg, 0.09 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with DCM (0.5 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 13) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxolan-3-yl)-4-(piperazin-1-yl)indazole-7-carboxamide trifluoroacetic acid salt (17.1 mg, 33%) as a solid. LCMS (ES, m/z): 464 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.32 (s, 1H), 9.47 (s, 1H), 9.07 (s, 2H), 8.94 (s, 1H), 8.17 (s, 1H), 8.04 (d, J=7.9 Hz, 1H), 7.63 (d, J=11.7 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 5.52 (ddt, J=9.3, 6.8, 3.4 Hz, 2H), 4.33-4.09 (m, 3H), 3.98 (td, J=8.2, 5.3 Hz, 1H), 3.77-3.57 (m, 4H), 3.37 (s, 4H), 2.63 (dq, J=15.4, 7.7 Hz, 1H), 2.45 (s, 3H).


Example 74: Synthesis of Compounds 350 and 351 Synthesis of Compounds 350 and 351



embedded image


4-[3-(dimethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (20 mg) was purified by PREP-CHIRAL-HPLC (Condition 1, Gradient 1) to afford Compound 350 (First peak: RT (min): 5.9) (5 mg) and Compound 351 (Second peak: RT (min): 6.4) (5 mg) as solids. Compound 350: LCMS: (ES, m/z): 436 [M+H]+. 1H NMR: (400 MHz, DMSO-d6) δ 11.02 (d, J=2.4 Hz, 1H), 9.20 (t, J=2.1 Hz, 1H), 8.87 (d, J=2.4 Hz, 1H), 7.97-7.86 (m, 2H), 7.36-7.28 (m, 1H), 6.05 (dd, J=8.3, 2.4 Hz, 1H), 4.28 (d, J=2.4 Hz, 3H), 3.85 (s, 1H), 3.77 (s, 1H), 3.65 (d, J=9.3 Hz, 1H), 3.46 (s, 2H), 2.89 (s, 1H), 2.35 (d, J=2.4 Hz, 6H), 2.29 (s, 3H), 1.92 (s, 1H). Compound 351: LCMS: (ES, m/z): 436 [M+H]+. 1H NMR: (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.87 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.05 (d, J=8.4 Hz, 1H), 4.28 (s, 3H), 3.85 (t, J=8.6 Hz, 1H), 3.77 (t, J=9.4 Hz, 1H), 3.64 (q, J=8.9 Hz, 1H), 3.48 (d, J=9.0 Hz, 2H), 2.91 (s, 1H), 2.37-2.33 (m, 3H), 2.29 (s, 6H), 1.92 (t, J=10.3 Hz, 1H).


Example 75: Synthesis of Compound 288
Synthesis of Intermediate C63



embedded image


To a stirred mixture of 2-amino-4-bromo-3-methylbenzoic acid (10 g, 43.467 mmol, 1.0 equiv) and Cs2CO3 (21.2 g, 65.201 mmol, 1.5 equiv) in DMF (100 mL) was added CH3I (7.4 g, 52.160 mmol, 1.2 equiv) in portions at 0° C. under N2 atmosphere. The resulting mixture was stirred for 2 h at room temperature under N2 atmosphere. The resulting mixture was diluted with water (300 mL) and extracted with ethyl acetate (2×300 mL). The organic layers were combined, washed with water (3×400 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 2-amino-4-bromo-3-methylbenzoate (10.4 g, 98%) as a solid. LCMS (ES, m/z): 244 [M+H]+.


Synthesis of Intermediate C64



embedded image


A mixture of methyl 2-amino-4-bromo-3-methylbenzoate (10 g, 40.969 mmol, 1.00 equiv) and Ac2O (5.02 g, 49.163 mmol, 1.2 equiv) in CHCl3 (200 mL) was stirred for 1 h at room temperature under N2 atmosphere. To the reaction mixture was added AcOK (1.21 g, 12.291 mmol, 0.3 equiv) and aspiral (1.056 mg, 90.132 mmol, 2.2 equiv). The resulting mixture was stirred for 16 h at 80° C. under N2 atmosphere. The precipitate formed that was collected by filtration and washed with isopropanol (2×50 mL). The resulting solid was dried to afford methyl 4-bromo-2H-indazole-7-carboxylate (10.1 g, 97%) as a solid. LCMS (ES, m/z): 255 [M+H]+.


Synthesis of Intermediate C65



embedded image


To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1.00 equiv) in ethyl acetate (7.5 mL) was added Et3O+BF4 (3724.20 mg, 19.600 mmol, 5.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (10 mL) and extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (2×20 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-2-ethylindazole-7-carboxylate (610 mg, 55%) as a solid. LCMS (ES, m/z): 283 [M+H]+.


Synthesis of Intermediate C66



embedded image


To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (250 mg, 0.883 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (328.9 mg, 1.766 mmol, 2.0 equiv) in dioxane (5 mL) was added Cs2CO3 (575.4 mg, 1.766 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (73.9 mg, 0.088 mmol, 0.1 equiv), and RuPhos (82.4 mg, 0.177 mmol, 0.2 equiv) at room temperature under N2 atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere, then concentrated under reduced pressure and purified by silica gel column chromatography, eluted with ethyl acetate to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylate (240 mg, 70%) as a solid. LCMS (ES, m/z): 389 [M+H]+.


Synthesis of Intermediate C67



embedded image


To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylate (210 mg, 0.541 mmol, 1.00 equiv) in THE (1.1 mL) and water (0.55 mL) was added LiOH (51.78 mg, 2.164 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at 50° C. The resulting mixture was concentrated under reduced pressure, diluted with water (2 mL), acidified to pH 7 with HCl (1 N), and extracted with ethyl acetate (3×3 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylic acid (200 mg, 99%) as a solid. LCMS (ES, m/z): 375 [M+H]+.


Synthesis of Intermediate C68



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylic acid (50 mg, 0.134 mmol, 1.00 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (22.06 mg, 0.134 mmol, 1.0 equiv) in DMF (1 mL) was added DIEA (34.5 mg, 0.268 mmol, 2.0 equiv) and HATU (60.9 mg, 0.161 mmol, 1.2 equiv) dropwise at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (3 mL) and extracted with ethyl acetate (3×3 mL). The organic layers were combined, washed with water (3×3 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (58 mg, 83%) as a solid. LCMS (ES, m/z): 522 [M+H]+.


Synthesis of Compound 288



embedded image


To a stirred solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (58 mg, 1.0 equiv) in DCM (1.8 mL) was added TFA (0.6 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)indazole-7-carboxamide (9.8 mg, 21%) as a solid. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 8.86 (s, 1H), 8.00 (d, J=8.0 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.32 (dd, J=12.3, 1.7 Hz, 1H), 6.54 (d, J=8.1 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.44 (t, J=5.1 Hz, 4H), 3.07 (t, J=5.1 Hz, 4H), 2.36 (s, 3H), 1.63 (t, J=7.3 Hz, 3H).


Example 76: Synthesis of Compound 289
Synthesis of Intermediate C69



embedded image


To a stirred solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (250 mg, 0.883 mmol, 1.0 equiv) and tert-butyl (1R,5S)-3,8-diazabicyclo[3.2.1]octane-8-carboxylate (374.9 mg, 1.766 mmol, 2.0 equiv) in dioxane (5 mL) was added Cs2CO3 (575.40 mg, 1.766 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (73.9 mg, 0.088 mmol, 0.1 equiv), and RuPhos (82.4 mg, 0.177 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[(1R,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethylindazole-7-carboxylate (300 mg, 82%) as a solid. LCMS (ES, m/z): 415 [M+H]+.


Synthesis of Intermediate C70



embedded image


To a stirred solution of methyl 4-[(1R,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethylindazole-7-carboxylate (280 mg, 0.676 mmol, 1.0 equiv) in THE (1.4 mL) and water (1.4 mL) was added LiOH·H2O (113.4 mg, 2.702 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50° C., then concentrated under reduced pressure to give a residue. The resulting mixture was diluted with water (2 mL) and extracted with ethyl acetate (3×3 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(1R,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethylindazole-7-carboxylic acid (250 mg, 92%) as a solid. LCMS (ES, m/z): 401 [M+H]+.


Synthesis of Intermediate C71



embedded image


To a stirred solution of 4-[(1R,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethylindazole-7-carboxylic acid (50.0 mg, 0.125 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (20.6 mg, 0.125 mmol, 1.0 equiv) in DMF (1 mL) was added DIEA (48.4 mg, 0.375 mmol, 3.0 equiv) and HATU (85.5 mg, 0.225 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×3 mL). The organic layers were combined, washed with water (3×3 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl (1R,5S)-3-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-3,8-diazabicyclo[3.2.1]octane-8-carboxylate (60 mg, 88%) as a solid. LCMS (ES, m/z): 548 [M+H]+.


Synthesis of Compound 289



embedded image


To a stirred solution of tert-butyl (1R,5S)-3-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-3,8-diazabicyclo[3.2.1]octane-8-carboxylate (60 mg, 1.0 equiv) in DCM (1.8 mL) was added TFA (0.6 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 4-[(1R,5S)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (17.7 mg, 36%) as a solid. LCMS (ES, m/z): 448 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.15 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.87 (s, 1H), 7.99-7.87 (m, 2H), 7.29 (dd, J=12.4, 1.7 Hz, 1H), 6.37 (d, J=8.4 Hz, 1H), 4.58 (q, J=7.2 Hz, 2H), 3.72 (d, J=11.0 Hz, 2H), 3.57 (s, 2H), 3.15 (d, J=10.8 Hz, 2H), 2.52-2.51 (m, 1H), 2.35 (s, 3H), 1.78-1.74 (m, 4H), 1.62 (t, J=7.3 Hz, 3H).


Example 77: Synthesis of Compound 293
Synthesis of Intermediate C72



embedded image


A mixture of 3-methylpyrazin-2-amine (2.00 g, 18.326 mmol, 1.0 equiv) and NBS (3.59 g, 20.159 mmol, 1.1 equiv) in DMF (40 mL) was stirred for 1.5 h at room temperature. The resulting mixture was diluted with water (100 mL) and extracted with ethyl acetate (3×80 mL). The organic layers were combined, washed with brine (3×80 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 5-bromo-3-methylpyrazin-2-amine (2.13 g, 62%) as a solid. LCMS (ES, m/z): 188.1 [M+H]+.


Synthesis of Intermediate C73



embedded image


To a stirred mixture of 5-bromo-3-methylpyrazin-2-amine (2.1 g, 11.169 mmol, 1.0 equiv) and 1-bromo-2,2-dimethoxypropane (2.45 g, 13.403 mmol, 1.2 equiv) in isopropanol (41 mL) was added PPTS (196.5 mg, 0.782 mmol, 0.07 equiv) in portions at room temperature. The resulting mixture was stirred for 16 h at 80° C., then diluted with water (40 mL) and extracted with ethyl acetate (4×40 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford 6-bromo-2,8-dimethylimidazo[1,2-a]pyrazine (890 mg, 35%) as a solid. LCMS (ES, m/z): 226 [M+H]+. Synthesis of Intermediate C74




embedded image


To a stirred mixture of 6-bromo-2,8-dimethylimidazo[1,2-a]pyrazine (500.0 mg, 2.212 mmol, 1.0 equiv) and diphenylmethanimine (400.8 mg, 2.212 mmol, 1.0 equiv) in toluene (7.5 mL) was added t-BuONa (637.6 mg, 6.636 mmol, 3.0 equiv), Pd2(dba)3 (202.5 mg, 0.221 mmol, 0.1 equiv), and t-BuXPhos (187.8 mg, 0.442 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 60° C. under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-1,1-diphenylmethanimine (630 mg, 87%) as a oil. LCMS (ES, m/z): 327 [M+H]+.


Synthesis of Intermediate C75



embedded image


To a stirred solution of N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-1,1-diphenylmethanimine (620 mg, 1.899 mmol, 1.0 equiv) in THE (12 mL) was added HCl (6 mL, con) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with water (15 mL), basified to pH 8 with saturated Na2CO3 (aq.), and extracted with ethyl acetate (3×20 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (160 mg, 52%) as a solid. LCMS (ES, m/z): 163 [M+H]+.


Synthesis of Intermediate C76



embedded image


To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (500 mg, 1.960 mmol, 1.00 equiv) and in ethyl acetate (7.5 mL) was added Me3OBF4 (1449.67 mg, 9.800 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with water (2×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-bromo-2-methylindazole-7-carboxylate (410 mg, 78%) as a solid. LCMS (ES, m/z): 269 [M+H]+.


Synthesis of Intermediate C77



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (410.0 mg, 1.524 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (567.6 mg, 3.048 mmol, 2.0 equiv) in dioxane (8.2 mL) was added Cs2CO3 (1.49 g, 4.572 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (127.4 mg, 0.152 mmol, 0.1 equiv), and RuPhos (142.2 mg, 0.305 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (700 mg, 98%) as a solid. LCMS (ES, m/z): 375 [M+H]+.


Synthesis of Intermediate C78



embedded image


To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (300 mg, 0.801 mmol, 1.00 equiv) in THE (1.5 mL) and water (1.5 mL) was added LiOH·H2O (95.9 mg, 4.005 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50° C., then concentrated under vacuum. The resulting mixture was diluted with water (6 mL), acidified to pH 7 with concentrated HCl, and extracted with ethyl acetate (4×10 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (200 mg, 69%) as a solid. LCMS (ES, m/z): 361 [M+H]+.


Synthesis of Intermediate C79



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (80.0 mg, 0.222 mmol, 1.0 equiv) and 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (36.0 mg, 0.222 mmol, 1.0 equiv) in DMF (1.6 mL) was added DIEA (86.1 mg, 0.666 mmol, 3.0 equiv) and HATU (151.9 mg, 0.400 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 7 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with water (3×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (60 mg, 54%) as a solid. LCMS (ES, m/z): 505 [M+H]+. Synthesis of Compound 293




embedded image


To a stirred solution of tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (60 mg, 0.119 mmol, 1 equiv) in DCM (0.6 mL) was added TFA (1.8 mL) dropwise at 0° C. The resulting mixture was stirred for 1 h at 0° C., then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-1-yl)indazole-7-carboxamide (5.9 mg, 12%) as a solid. LCMS (ES, m/z): 405 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.27 (s, 1H), 9.30 (s, 1H), 8.81 (s, 1H), 8.07-7.95 (m, 2H), 6.50 (d, J=8.2 Hz, 1H), 4.28 (s, 3H), 3.37 (s, 4H), 2.93 (d, J=4.7 Hz, 4H), 2.73 (s, 3H), 2.39 (s, 3H).


Example 78: Synthesis of Compound 291
Synthesis of Compound 291



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-1-carboxylate (90.0 mg, 0.163 mmol, 1.0 equiv) in DCM (1.8 mL) was added BBr3 (163.5 mg, 0.652 mmol, 4.0 equiv) dropwise at 0° C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-hydroxyethyl)-4-(piperazin-1-yl)indazole-7-carboxamide hydrochloride (4.3 mg, 6%) as a solid. LCMS (ES, m/z): 438 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.43 (s, 1H), 9.63 (d, J=1.6 Hz, 1H), 9.38-9.37 (m, 2H), 8.93 (s, 1H), 8.33-8.28 (m, 1H), 8.10 (d, J=11.6 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.63 (t, J=5.4 Hz, 2H), 4.02 (t, J=5.4 Hz, 2H), 3.66 (t, J=5.1 Hz, 4H), 3.33-3.32 (m, 4H), 2.51 (s, 3H).


Example 79: Synthesis of Compound 292
Synthesis of Intermediate C80



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (600.0 mg, 2.352 mmol, 1.0 equiv) and K2CO3 (650.0 mg, 4.704 mmol, 2.0 equiv) in DMF (6 mL) was added 2-bromoethyl methyl ether (490.4 mg, 3.528 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 16 h at 80° C., then diluted with water (15 mL) and extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (3×15 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (200 mg, 27%) as a solid. LCMS (ES, m/z): 312 [M+H]+.


Synthesis of Intermediate C81



embedded image


To a stirred mixture of methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (200.0 mg, 0.639 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (237.9 mg, 1.278 mmol, 2.0 equiv) in dioxane (4 mL) was added Cs2CO3 (624.3 mg, 1.917 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (53.4 mg, 0.064 mmol, 0.1 equiv), and RuPhos (59.61 mg, 0.128 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethyl)indazole-7-carboxylate (320 mg, 99%) as an oil. LCMS (ES, m/z): 419 [M+H]+.


Synthesis of Intermediate C82



embedded image


To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethyl)indazole-7-carboxylate (320.0 mg, 0.765 mmol, 1.0 equiv) in THE (1.6 mL) and water (1.6 mL) was added LiOH·H2O (91.6 mg, 3.825 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then concentrated under vacuum. The resulting mixture was diluted with water (5 mL), acidified to pH 6 with HCl (1 N), and extracted with ethyl acetate (4×30 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure. to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethyl)indazole-7-carboxylic acid (220 mg, 71%) as a solid. LCMS (ES, m/z): 405 [M+H]+.


Synthesis of Intermediate C83



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethyl)indazole-7-carboxylic acid (220.0 mg, 0.544 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (89.8 mg, 0.544 mmol, 1.0 equiv) in DMF (4.4 mL) was added DIEA (210.9 mg, 1.632 mmol, 3.0 equiv) and HATU (372.3 mg, 0.979 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature, then diluted with water (12 mL) and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (3×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-1-carboxylate (170 mg, 34%) as a solid. LCMS (ES, m/z): 552 [M+H]+.


Synthesis of Compound 292



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.076 mmol, 1.0 equiv) in DCM (1.5 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl)-4-(piperazin-1-yl)indazole-7-carboxamide hydrochloride (17.9 mg, 52%) as a solid. LCMS (ES, m/z): 452 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.40 (s, 1H), 9.65 (d, J=1.5 Hz, 1H), 9.50-9.49 (m, 2H), 8.97 (s, 1H), 8.31 (s, 1H), 8.12 (d, J=11.6 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.75 (t, J=5.2 Hz, 2H), 3.98 (t, J=5.2 Hz, 2H), 3.66 (t, J=5.0 Hz, 4H), 3.32-3.31 (m, 4H), 3.29 (s, 3H), 2.50 (s, 3H).


Example 80: Synthesis of Compound 296
Synthesis of Intermediate C84



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (220.0 mg, 0.818 mmol, 1.0 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3-yl)carbamate (370.1 mg, 1.636 mmol, 2.0 equiv) in dioxane (4 mL) was added Cs2CO3 (532.7 mg, 1.636 mmol, 2.0 equiv), Pd2(dba)3 (74.8 mg, 0.082 mmol, 0.1 equiv), and X-Phos (77.9 mg, 0.164 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (290 mg, 86%) as a solid. LCMS (ES, m/z): 415 [M+H]+.


Synthesis of Intermediate C85



embedded image


To a stirred solution of methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (100.0 mg, 0.241 mmol, 1.0 equiv) in THE (1.25 mL) and water (1.25 mL) was added LiOH·H2O (81.0 mg, 1.928 mmol, 8.0 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50° C., then concentrated under vacuum. The resulting mixture was diluted with water (2 mL), acidified to pH 7 with HCl (1 N), and extracted with ethyl acetate (3×2 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylic acid (80 mg, 83%) as a solid. LCMS (ES, m/z): 401 [M+H]+.


Synthesis of Intermediate C86



embedded image


To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylic acid (80.0 mg, 0.200 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (33.0 mg, 0.200 mmol, 1.0 equiv) in DMF (1.4 mL) was added DIEA (77.5 mg, 0.600 mmol, 3.0 equiv) and HATU (113.9 mg, 0.300 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50° C., then diluted with water (1 mL) and extracted with ethyl acetate (3×2 mL). The organic layers were combined, washed with water (3×2 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl N-cyclopropyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}carbamate (80 mg, 73%) as an oil. LCMS (ES, m/z): 548 [M+H]+.


Synthesis of Compound 296



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}carbamate (80.0 mg, 0.088 mmol, 1.0 equiv) in DCM (2.4 mL) was added TFA (0.8 mL) dropwise at 0° C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 4-[3-(cyclopropylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (9.8 mg, 25%) as a solid. LCMS (ES, m/z): 448 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.82 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.71 (m, 2H), 3.64 (d, J=8.1 Hz, 1H), 3.56 (q, J=5.4 Hz, 1H), 3.51-3.44 (m, 1H), 2.35 (s, 3H), 2.17 (dt, J=7.2, 4.5 Hz, 2H), 1.98 (dq, J=12.6, 6.4 Hz, 1H), 0.49-0.36 (m, 2H), 0.32-0.20 (m, 2H).


Example 81: Synthesis of Compound 298
Synthesis of Intermediate C87



embedded image


To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (0.5 g, 1.960 mmol, 1.0 equiv) in ethyl acetate (7.5 mL) was added tetrafluoroboranuide; trimethyloxidanium (1.45 g, 9.800 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with water (2×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-bromo-2-methylindazole-7-carboxylate (560 mg, 99%) as a solid. LCMS (ES, m/z): 269 [M+H]+.


Synthesis of Intermediate C88



embedded image


To a stirred solution of methyl 4-bromo-2-methylindazole-7-carboxylate (200.0 mg, 0.743 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (297.7 mg, 1.486 mmol, 2.0 equiv) in dioxane (4 mL) was added Cs2CO3 (726.5 mg, 2.229 mmol, 3.0 equiv), RuPhos (69.4 mg, 0.149 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (62.2 mg, 0.074 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (280 mg, 97%) as a solid. LCMS (ES, m/z): 389 [M+H]+.


Synthesis of Intermediate C89



embedded image


To a stirred solution of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (290.0 mg, 0.747 mmol, 1.0 equiv) in THF (3.7 mL) was added water (3.7 mL) and lithiumol hydrate (156.6 mg, 3.735 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 50° C. The resulting mixture was concentrated under vacuum, diluted with water (10 mL), acidified to pH 7 with concentrated HCl, and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (3×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylic acid (270 mg, 97%) as a solid. LCMS (ES, m/z): 375 [M+H]+.


Synthesis of Intermediate C90



embedded image


To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylic acid (70.0 mg, 0.187 mmol, 1.0 equiv) in DMF (1.4 mL) was added HATU (106.6 mg, 0.280 mmol, 1.5 equiv), DIEA (72.5 mg, 0.561 mmol, 3.0 equiv), and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (30.9 mg, 0.187 mmol, 1 equiv) in portions at room temperature. The resulting mixture was stirred for 7 h at room temperature, then diluted with water (5 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with water (3×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (77 mg, 79%) as a solid. LCMS (ES, m/z): 522 [M+H]+.


Synthesis of Compound 298



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (77.0 mg, 0.148 mmol, 1.0 equiv) in DCM (2.1 mL) was added TFA (0.7 mL) dropwise at 0° C. The resulting mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide trifluoroacetic acid salt (30.3 mg, 49%) as a solid. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.18 (s, 1H), 9.39 (s, 1H), 8.90-8.89 (m, 3H), 8.08 (s, 1H), 7.99 (d, J=8.2 Hz, 1H), 7.70 (d, J=11.9 Hz, 1H), 6.13 (d, J=8.4 Hz, 1H), 4.31 (s, 3H), 3.99-3.97 (m, 2H), 3.89-3.73 (m, 3H), 2.73-2.67 (m, 3H), 2.49-2.48 (m, 1H), 2.42 (s, 3H), 2.28-2.25 (m, 1H).


Example 82: Synthesis of Compound 301
Synthesis of Intermediate C91



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (120.0 mg, 0.446 mmol, 1.0 equiv) and tert-butyl 1,7-diazaspiro[3.5]nonane-1-carboxylate (201.8 mg, 0.892 mmol, 2.0 equiv) in dioxane (2.5 mL) was added Cs2CO3 (435.9 mg, 1.338 mmol, 3.0 equiv), RuPhos (41.6 mg, 0.089 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (37.3 mg, 0.045 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85° C. under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 7-[7-(methoxycarbonyl)-2-methylindazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (180 mg, 97%) as a solid. LCMS (ES, m/z): 415 [M+H]+.


Synthesis of Intermediate C92



embedded image


To a stirred mixture of tert-butyl 7-[7-(methoxycarbonyl)-2-methylindazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (180.0 mg, 0.434 mmol, 1.0 equiv) in THE (2.5 mL) and water (2.5 mL) was added LiOH·H2O (52.0 mg, 2.170 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 4 h at 50° C., then concentrated under vacuum, diluted with water (5 mL), acidified to pH 6 with HCl (1 N), and extracted with ethyl acetate (3×5 mL). The organic layers were combined, dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[1-(tert-butoxycarbonyl)-1,7-diazaspiro[3.5]nonan-7-yl]-2-methylindazole-7-carboxylic acid (160 mg, 92%) as a solid. LCMS (ES, m/z): 401 [M+H]+.


Synthesis of Intermediate C93



embedded image


To a stirred solution of 4-[1-(tert-butoxycarbonyl)-1,7-diazaspiro[3.5]nonan-7-yl]-2-methylindazole-7-carboxylic acid (160.0 mg, 0.400 mmol, 1.0 equiv) in DMF (3.2 mL) was added DIEA (206.5 mg, 1.600 mmol, 4.0 equiv), HATU (227.8 mg, 0.600 mmol, 1.5 equiv), and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (66.0 mg, 0.400 mmol, 1.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at 50° C., then diluted with water (10 mL) and extracted with EtOAc (3×10 mL). The organic layers were combined, washed with water (3×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 7-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (140 mg, 64%) as a solid. LCMS (ES, m/z): 548 [M+H]+.


Synthesis of Compound 301



embedded image


To a stirred solution of tert-butyl 7-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (140.0 mg, 0.205 mmol, 1.0 equiv) in DCM (3 mL) was added TFA (1 mL) dropwise at 0° C. The resulting mixture was stirred for 1 h at 0° C., then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford 4-{1,7-diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide trifluoroacetic acid salt (11.9 mg, 13%) as a solid. LCMS (ES, m/z): 448 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.22 (s, 1H), 9.42 (d, J=1.5 Hz, 1H), 8.86-8.85 (m, 3H), 8.10 (d, J=2.7 Hz, 1H), 8.00 (d, J=8.1 Hz, 1H), 7.75 (d, J=12.0 Hz, 1H), 6.57 (d, J=8.2 Hz, 1H), 4.32 (s, 3H), 3.93 (t, J=7.3 Hz, 2H), 3.65-3.54 (m, 2H), 3.38 (dd, J=13.5, 6.9 Hz, 2H), 2.42-2.35 (m, 5H), 2.19-2.18 (m, 4H).


Example 83: Synthesis of Compound 337
Synthesis of Intermediate C94



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (150 mg, 0.304 mmol, 1 equiv), 1-chloro-2-iodoethane (69.44 mg, 0.365 mmol, 1.2 equiv), and K2CO3 (63.01 mg, 0.456 mmol, 1.5 equiv) in DMF (2 mL) was stirred for 12 h at room temperature. The solids were removed by filtration. The filtrate was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[2-(2-chloroethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (60 mg, 36%) as a solid. LCMS (ES, m/z): 556 [M+H]+.


Synthesis of Compound 337



embedded image


A mixture of tert-butyl 4-[2-(2-chloroethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]piperazine-1-carboxylate (80 mg, 0.144 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 N NH3 (gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash (Condition 1, Gradient 2) to afford 2-(2-chloroethyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)indazole-7-carboxamide (18 mg, 27%) as a solid. LCMS (ES, m/z): 456 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.25 (d, J=1.7 Hz, 1H), 8.92 (s, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.91 (dd, J=3.2, 1.0 Hz, 1H), 7.39 (dd, J=12.5, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.91 (t, J=5.7 Hz, 2H), 4.33 (t, J=5.7 Hz, 2H), 3.45-3.31 (m, 4H), 2.94 (t, J=5.0 Hz, 4H), 2.35 (d, J=0.8 Hz, 3H).


Example 84: Synthesis of Compound 338
Synthesis of Intermediate C95



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.203 mmol, 1 equiv), 2-(iodomethyl)oxetane (48.14 mg, 0.244 mmol, 1.2 equiv), and Cs2CO3 (198.05 mg, 0.609 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 3 h at room temperature. The reaction mixture was filtered to remove solids. The filtrate was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-2-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (70 mg, 61%) as a solid. LCMS (ES, m/z): 564 [M+H]+.


Synthesis of Compound 338



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-2-ylmethyl)indazol-4-yl]piperazine-1-carboxylate (60 mg, 0.106 mmol, 1 equiv) and TFA (97.10 mg, 0.848 mmol, 8 equiv) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 N NH3 (gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxetan-2-ylmethyl)-4-(piperazin-1-yl)indazole-7-carboxamide (18 mg, 36%) as a solid. LCMS (ES, m/z): 464 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.14 (s, 1H), 9.25 (d, J=1.6 Hz, 1H), 8.81 (s, 1H), 8.00 (d, J=8.1 Hz, 1H), 7.95-7.88 (m, 1H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 5.29 (t, J=6.0 Hz, 1H), 4.88 (dd, J=13.9, 6.6 Hz, 1H), 4.79 (dd, J=13.8, 4.3 Hz, 1H), 4.64-4.51 (m, 1H), 4.43 (dt, J=9.0, 6.0 Hz, 1H), 3.37 (d, J=5.0 Hz, 4H), 2.94 (s, 4H), 2.78 (dd, J=11.4, 7.4 Hz, 1H), 2.56 (dd, J=9.2, 2.3 Hz, 1H), 2.35 (d, J=0.8 Hz, 3H).


Example 85: Synthesis of Compound 306
Synthesis of Intermediate C96



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (100 mg, 0.392 mmol, 1 equiv) and 2-bromoethyl methyl ether (81.74 mg, 0.588 mmol, 1.5 equiv) in DMF (2.5 mL) was added K2CO3 (108.37 mg, 0.784 mmol, 2 equiv) at room temperature. The resulting mixture was stirred for 5 h at 80° C., then cooled to room temperature. The resulting mixture was quenched with water (5 mL) and extracted with ethyl acetate (2×3 mL). The organic layers were combined, washed with brine (2×2 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (93.5 mg, 76%) as a solid. LCMS (ES, m/z): 313 [M+H]+.


Synthesis of Intermediate C97



embedded image


A mixture of methyl 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylate (20 mg, 0.064 mmol, 1 equiv) and LiOH (5 mg, 0.192 mmol, 3 equiv) in water (0.25 mL), THF (0.5 mL) and methanol (0.5 mL) was stirred for 3 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was acidified to pH 3 with 1 N HCl. A solid precipitated that was collected by filtration, then washed with water (0.25 mL) to afford 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylic acid (10 mg, 52%) as a solid. LCMS (ES, m/z): 299 [M+H]+.


Synthesis of Intermediate C98



embedded image


To a stirred of mixture of 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylic acid (550 mg, 1.839 mmol, 1 equiv), DIEA (712 mg, 5.517 mmol, 3 equiv), and HATU (839 mg, 2.207 mmol, 1.2 equiv) in DMF (15 mL) was added 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (364 mg, 2.207 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (2×20 mL). The organic layers were combined, washed with brine (1×20 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (350 mg, 43%) as a solid. LCMS (ES, m/z): 446 [M+H]+.


Synthesis of Intermediate C99



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), rac-tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (96 mg, 0.448 mmol, 2 equiv), and Cs2CO3 (219 mg, 0.672 mmol, 3 equiv) in dioxane (5 mL) as added RuPhos (20 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (18 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80° C. under nitrogen atmosphere, then quenched with water (10 mL) and extracted with ethyl acetate (2×10 mL). The organic layers were combined, washed with water (2×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford rac-tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (60 mg, 46%) as a solid. LCMS (ES, m/z): 580 [M+H]+.


Synthesis of Compound 306



embedded image


A mixture of tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (50 mg, 0.086 mmol, 1 equiv) and TFA (1 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was adjusted to pH 8 with ammonia and purified by Prep-HPLC (Condition 5, Gradient 5) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (12 mg, 24%) as a solid. LCMS (ES, m/z): 479.56 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.12 (s, 1H), 9.23 (d, J=1.6 Hz, 1H), 8.81 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.4 Hz, 1H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.74 (t, J=5.2 Hz, 2H), 3.95 (t, J=5.2 Hz, 2H), 3.83-3.73 (m, 2H), 3.30 (s, 3H), 2.94 (d, J=8.0 Hz, 2H), 2.45 (d, J=11.0 Hz, 1H), 2.35 (s, 3H), 2.29 (s, 1H), 1.07 (d, J=6.2 Hz, 6H). 19F NMR (282.3 MHz, DMSO-d6) δ −132.011.


Example 86: Synthesis of Compound 294
Synthesis of Intermediate C100



embedded image


To a stirred mixture of 2-amino-4-bromo-3-methylbenzoic acid (5.00 g, 21.73 mmol, 1.00 equiv) and Cs2CO3 (10.62 g, 32.6 mmol, 1.50 equiv) in DMF (50 mL) was added methyl iodide (3.70 g, 26.08 mmol, 1.20 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 8 h at room temperature under nitrogen atmosphere, then diluted with water and extracted with ethyl acetate (3×200 mL). The organic layers were combined, washed with half saturated aqueous NaCl (3×100 mL), followed by saturated aqueous NaCl (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 2-amino-4-bromo-3-methylbenzoate (5 g, 94%) as a solid. LCMS (ES, m/z): 244 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 7.57-7.50 (m, 1H), 6.86-6.78 (m, 3H), 3.80 (s, 3H), 2.24 (s, 3H).


Synthesis of Intermediate C101



embedded image


Methyl 2-amino-4-bromo-3-methylbenzoate (3.60 g, 14.75 mmol, 1.00 equiv), m-CPBA (10.18 g, 59.00 mmol, 4.00 equiv) and DCE (80 mL) were combined at room temperature. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere, then quenched with water at 0° C., and purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford methyl 4-bromo-3-methyl-2-nitrobenzoate (3.5 g, 87%) as a solid.


Synthesis of Intermediate C102



embedded image


Methyl 4-bromo-3-methyl-2-nitrobenzoate (3.50 g, 12.77 mmol, 1.00 equiv), NBS (2.27 g, 12.77 mmol, 1.00 equiv), BPO (0.33 g, 1.28 mmol, 0.10 equiv), and CCl4 (70 mL) were combined at room temperature. The resulting mixture was stirred for 16 h at 80° C. under nitrogen atmosphere, then purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford 3 g methyl 4-bromo-3-(bromomethyl)-2-nitrobenzoate.


Synthesis of Intermediate C103



embedded image


Methyl 4-bromo-3-(bromomethyl)-2-nitrobenzoate (3.00 g, 8.5 mmol, 1.00 equiv), aminocyclopropane (0.73 g, 12.75 mmol, 1.50 equiv), K2CO3 (2.35 g, 16.99 mmol, 2.00 equiv), and acetonitrile (60 mL) were combined at room temperature. The resulting mixture was stirred for 16 h at room temperature under nitrogen atmosphere, then purified by Chiral-Prep-HPLC (Condition 2, Gradient 1) to afford methyl 4-bromo-3-[(cyclopropylamino)methyl]-2-nitrobenzoate (400 mg, 14%) as a solid. LCMS (ES, m/z): 329 [M+H]+.


Synthesis of Intermediate C104



embedded image


Methyl 4-bromo-3-[(cyclopropylamino)methyl]-2-nitrobenzoate (300 mg, 0.91 mmol, 1.00 equiv), SnCl2·2H2O (411.3 mg, 1.82 mmol, 2.00 equiv), and ethanol (10 mL) were combined at room temperature. The resulting mixture was stirred for 4 h at 40° C. under nitrogen atmosphere, then purified by reverse flash chromatography (Condition 4, Gradient 1) to afford 4-bromo-2-cyclopropylindazole-7-carboxylic acid (160 mg, 62%) as a solid. LCMS (ES, m/z): 281 [M+H]+.


Synthesis of Intermediate C105



embedded image


To a stirred solution of 4-bromo-2-cyclopropylindazole-7-carboxylic acid (150 mg, 0.53 mmol, 1.00 equiv) and Cs2CO3 (260.8 mg, 0.8 mmol, 1.50 equiv) in DMF (2 mL) was added CH3I (90.89 mg, 0.64 mmol, 1.20 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 8 h at room temperature under nitrogen atmosphere. The resulting mixture was extracted with EtOAc (3×40 mL). The combined organic layers were washed with half saturated aqueous NaCl (3×20 mL) and 1×50 ml of saturated aqueous NaCl, dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in methyl 4-bromo-2-cyclopropylindazole-7-carboxylate (150 mg, 95%) as a solid. LCMS (ES, m/z): 295 [M+H]+.


Synthesis of Intermediate C106



embedded image


Methyl 4-bromo-2-cyclopropylindazole-7-carboxylate (140 mg, 0.47 mmol, 1.00 equiv), tert-butyl piperazine-1-carboxylate (106.02 mg, 0.57 mmol, 1.20 equiv), Cs2CO3 (463.67 mg, 1.42 mmol, 3.00 equiv), RuPhos Palladacycle Gen.3 (39.67 mg, 0.05 mmol, 0.10 equiv), and dioxane (2 mL) were combined at room temperature. The resulting mixture was stirred for 1 overnight at 60° C. under nitrogen atmosphere, then purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford methyl 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-cyclopropylindazole-7-carboxylate (87 mg, 46%) as a solid. LCMS (ES, m/z): 401 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 8.64 (s, 1H), 7.84 (d, J=8.1 Hz, 1H), 6.36 (d, J=8.2 Hz, 1H), 4.09 (tt, J=7.6, 3.9 Hz, 1H), 3.80 (s, 3H), 3.57-3.50 (m, 4H), 3.36 (dd, J=6.4, 3.8 Hz, 4H), 1.44 (s, 9H), 1.31 (td, J=4.7, 4.3, 3.1 Hz, 2H), 1.19-1.07 (m, 2H).


Synthesis of Intermediate C107



embedded image


Methyl 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-cyclopropylindazole-7-carboxylate (60 mg, 0.15 mmol, 1.00 equiv), LiOH (14.35 mg, 0.6 mmol, 4.00 equiv) and THF (2 mL) were combined at room temperature. The resulting mixture was stirred for 4 h at 60° C. under nitrogen atmosphere, then acidified to pH 6 with HCl (aq.) and extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (3×20 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-cyclopropylindazole-7-carboxylic acid (54 mg, 93%) as a solid. LCMS (ES, m/z): 387 [M+H]+.


Synthesis of Intermediate C108



embedded image


A mixture of 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-cyclopropylindazole-7-carboxylic acid (30 mg, 0.08 mmol, 1.00 equiv), 8-fluoro-2-methylimidazo[1,2-a] pyridin-6-amine (19.23 mg, 0.12 mmol, 1.50 equiv), EDCI (17.86 mg, 0.09 mmol, 1.20 equiv), HOBT (12.59 mg, 0.09 mmol, 1.20 equiv), DIEA (30.1 mg, 0.23 mmol, 3.00 equiv), and DMF (1 mL) was stirred for 16 h at 50° C. under nitrogen atmosphere. The resulting mixture was extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (3×20 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 4-[2-cyclopropyl-7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}carbamoyl) indazol-4-yl] piperazine-1-carboxylate (35 mg, 84%) as a solid. LCMS (ES, m/z): 534 [M+H]+.


Synthesis of Compound 294



embedded image


A mixture of tert-butyl 4-[2-cyclopropyl-7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (33 mg, 0.06 mmol, 1.00 equiv) and ZnBr2 (139.28 mg, 0.62 mmol, 10.00 equiv) in DCM (0.5 mL) was stirred for 30 min at 40° C. under nitrogen atmosphere. To the reaction mixture was added ethanol (0.5 mL), and the resulting mixture was stirred for an additional 10 min. The resulting product was purified by Prep-HPLC (Condition 6, Gradient 1) to afford 2-cyclopropyl-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (16.5 mg, 60.93%) as a solid. LCMS (ES, m/z): 434 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 10.93 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.85 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.18 (dd, J=12.2, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.28 (tt, J=7.6, 3.9 Hz, 1H), 3.34 (d, J=9.9 Hz, 4H), 2.91 (t, J=5.0 Hz, 4H), 2.35 (d, J=0.9 Hz, 3H), 1.47 (td, J=5.2, 4.4, 3.1 Hz, 2H), 1.25-1.12 (m, 2H).


Example 87: Synthesis of Compound 275
Synthesis of Intermediate C109



embedded image


A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (100.0 mg, 0.27 mmol, 1.00 equiv), 6-bromo-2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (93.1 mg, 0.33 mmol, 1.2 equiv), Cs2CO3 (226.6 mg, 0.69 mmol, 2.50 equiv), BrettPhos (29.8 mg, 0.05 mmol, 0.2 equiv), BrettPhos-Pd-G3 (25.2 mg, 0.02 mmol, 0.1 equiv) and dioxane (5 mL) was evacuated and flushed three times with nitrogen. The resulting solution was stirred for 16 h at 100° C., then quenched with water and extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with saturated aqueous NaCl (1×50 mL), dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated under vacuum to give a residue. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether to afford tert-butyl 4-(2-methyl-7-{[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]carbamoyl}indazol-4-yl)piperazine-1-carboxylate (100 mg, 64%) as a solid. LCMS (ES, m/z): 558 [M+H]+.


Synthesis of Compound 275



embedded image


A mixture of tert-butyl 4-(2-methyl-7-{[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]carbamoyl} indazol-4-yl)piperazine-1-carboxylate (100.0 mg, 0.18 mmol, 1.00 equiv), DCM (2.0 mL), and TFA (0.5 mL) was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 6, Gradient 2) to afford 2-methyl-N-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4-(piperazin-1-yl) indazole-7-carboxamide (36.7 mg, 44.2%) as a solid. LCMS (ES, m/z): 458 [M+H]+. 1H-NMR (400 MHz, DMSO-d6) δ 11.09 (s, 1H), 9.51 (d, J=1.9 Hz, 1H), 8.81 (s, 1H), 8.02-7.94 (m, 2H), 7.83-7.78 (m, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.29 (s, 3H), 3.39-3.32 (m, 4H), 2.95-2.88 (m, 4H), 2.39 (s, 3H).


Example 88: Synthesis of Compound 307
Synthesis of Intermediate C110



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (102 mg, 0.448 mmol, 2 equiv), and Cs2CO3 (219 mg, 0.672 mmol, 3 equiv) in dioxane (6 mL) was added RuPhos (21 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (18 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80° C. under nitrogen atmosphere, then quenched with water (10 mL) and extracted with ethyl acetate (2×10 mL). The organic layers were combined, washed with brine (2×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]piperidin-4-yl}carbamate (45 mg, 34%) as a solid. LCMS (ES, m/z): 594.0 [M+H]+.


Synthesis of Compound 307



embedded image


A mixture of tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]piperidin-4-yl}carbamate (50 mg, 0.084 mmol, 1 equiv) and TFA (2 mL) in DCM (4 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was neutralized to pH 8 with 7 N NH3(g) in methanol, then purified by Prep-HPLC (Condition 2, Gradient 6) to afford 4-[4-(ethylamino)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (15 mg, 36%) as a solid. LCMS (ES, m/z): 494 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.23 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.5 Hz, 1H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.73 (t, J=5.1 Hz, 2H), 3.95 (t, J=5.2 Hz, 2H), 3.91 (s, 2H), 3.86 (s, 1H), 3.30 (s, 3H), 3.07 (t, J=11.5 Hz, 2H), 2.72-2.54 (m, 3H), 2.35 (s, 3H), 1.97 (d, J=12.5 Hz, 2H), 1.61 (s, 1H), 1.44 (q, J=10.1 Hz, 2H), 1.04 (t, J=7.1 Hz, 3H). 19F NMR (282 MHz, DMSO-d6) δ −132.01, −132.02.


Example 89: Synthesis of Compounds 310 and 330
Synthesis of Intermediate C111



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), tert-butyl pyrrolidin-3-ylcarbamate (83 mg, 0.448 mmol, 2 equiv), and Cs2CO3 (219 mg, 0.672 mmol, 3 equiv) in 1,4-dioxane (6 mL) was added RuPhos (21 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (19 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80° C. under nitrogen atmosphere, then quenched with water (10 mL) at room temperature and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with water (2×5 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl (1-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-(2-methoxyethyl)-2H-indazol-4-yl)pyrrolidin-3-yl)carbamate (50 mg, 40%) as a solid. LCMS (ES, m/z): 552.0 [M+H]+.


Synthesis of Intermediate C112

A mixture of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (100 mg, 0.181 mmol, 1 equiv) and TFA (0.8 mL) in DCM (2 mL) was stirred for 1 h at room temperate. The resulting mixture was concentrated under vacuum to give a residue. The residue was basified to pH 8 with 7 M NH3(g) in methanol, then purified by reverse flash chromatography (Condition 1, Gradient 4) to afford 4-(3-aminopyrrolidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (36 mg, 44%) as a solid. LCMS (ES, m/z): 452 [M+H]+.


Synthesis of Compounds 310 and 330



embedded image


To a stirred solution of 4-(3-aminopyrrolidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (100 mg, 0.221 mmol, 1 equiv) and DIEA (129 mg, 0.996 mmol, 4.5 equiv) in DMF (5 mL) was added iodoethane (62 mg, 0.398 mmol, 1.8 equiv) dropwise at 0° C. The resulting mixture was stirred for 2 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 6) to afford 4-(3-(ethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxyethyl)-2H-indazole-7-carboxamide (6 mg, 5%) and 4-(3-(diethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxyethyl)-2H-indazole-7-carboxamide as solids. 4-(3-(diethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxyethyl)-2H-indazole-7-carboxamide was further purified by prep-HPLC (Condition 7, Gradient 1) to afford 4-(3-(diethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxyethyl)-2H-indazole-7-carboxamide compound with 2,2,2-trifluoro-113-ethan-1-one (5 mg, 4%) as a solid. Compound 310: LCMS (ES, m/z): 480 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 8.84 (s, 1H), 7.96 (d, J=8.2 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.29 (dd, J=12.4, 1.7 Hz, 1H), 6.06 (d, J=8.4 Hz, 1H), 4.72 (t, J=5.1 Hz, 2H), 3.95 (t, J=5.1 Hz, 2H), 3.82 (d, J=16.1 Hz, 2H), 3.70 (s, 2H), 3.31 (s, 3H), 2.83 (s, 2H), 2.35 (s, 3H), 2.07 (s, 1H), 1.13 (t, J=7.0 Hz, 3H). 19F NMR (282 MHz, DMSO-d6) δ −132.117. Compound 330: LCMS: (ES, m/z): 508 [M+H]+. 1H NMR (300 MHz, Methanol-d4) δ 9.46-9.36 (m, 1H), 8.71 (d, J=1.6 Hz, 1H), 8.12-7.93 (m, 3H), 7.85 (d, J=10.5 Hz, 1H), 6.23-6.12 (m, 1H), 4.75 (t, J=5.0 Hz, 2H), 4.29 (t, J=8.2 Hz, 1H), 4.18 (t, J=8.9 Hz, 1H), 4.02 (d, J=12.1 Hz, 1H), 4.02 (s, 3H), 3.95-3.79 (m, 2H), 3.42 (dd, J=11.0, 5.1 Hz, 7H), 2.73-2.63 (m, 1H), 2.53 (d, J=3.2 Hz, 3H), 2.40 (q, J=10.8, 10.2 Hz, 1H), 1.41 (t, J=7.2 Hz, 6H). 19F NMR (282 MHz, Methanol-d4) δ −76.86, −133.40-−134.87 (m).


Example 90: Synthesis of Compound 340
Synthesis of Intermediate C113



embedded image


To a stirred solution of 5-methyl-1H-indazole (500 mg, 3.783 mmol, 1 equiv) in DCM (10 mL) was added Et3N (1.15 g, 11.349 mmol, 3 equiv), Boc2O (908.2 mg, 4.161 mmol, 1.1 equiv), and DMAP (46.2 mg, 0.378 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 16 h at room temperature, then washed with water (2×10 mL). The organic layer was dried over anhydrous Na2SO4 and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl 5-methylindazole-1-carboxylate (500 mg, 57%) as a solid. LCMS (ES, m/z): 233 [M+H]+.


Synthesis of Intermediate C114



embedded image


To a stirred solution of tert-butyl 5-methylindazole-1-carboxylate (200.0 mg, 0.861 mmol, 1 equiv) in CCl4 (6 mL) was added NBS (183.9 mg, 1.033 mmol, 1.2 equiv) and AIBN (14.1 mg, 0.086 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 24 h at 50° C., then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 5-(bromomethyl) indazole-1-carboxylate (65 mg, 24%) as a solid. LCMS (ES, m/z): 311 [M+H]+.


Synthesis of Intermediate C115



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.142 mmol, 1.0 equiv) and tert-butyl 5-(bromomethyl) indazole-1-carboxylate (66.2 mg, 0.213 mmol, 1.5 equiv) in DMF (1.7 mL) was added Cs2CO3 (138.6 mg, 0.426 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water (6 mL) and extracted with ethyl acetate (3×6 mL). The organic layers were combined, washed with water (3×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 5-({4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-2-yl}methyl) indazole-1-carboxylate (40 mg, 39%) as a solid. LCMS (ES, m/z): 724 [M+H]+.


Synthesis of Compound 340



embedded image


To a stirred solution of tert-butyl 5-({4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-2-yl}methyl) indazole-1-carboxylate (35.0 mg, 0.048 mmol, 1.0 equiv) in DCM (1 mL) was added TFA (0.3 mL) dropwise at 0° C. The resulting mixture was stirred for 1 h at 0° C., then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(1H-indazol-5-ylmethyl)-4-(piperazin-1-yl) indazole-7-carboxamide trifluoroacetate (7.8 mg, 31%) as a solid. LCMS (ES, m/z): 524 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 13.15-13.14 (m, 1H), 11.25 (s, 1H), 9.36 (s, 1H), 9.10 (s, 1H), 8.99-8.98 (m, 2H), 8.10 (s, 1H), 8.08 (d, J=7.6 Hz, 1H), 8.02 (d, J=8.0 Hz, 1H), 7.98 (s, 1H), 7.61-7.51 (m, 2H), 7.48 (d, J=11.9 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 5.89 (s, 2H), 3.64-3.57 (m, 4H), 3.36-3.35 (m, 4H), 2.42 (s, 3H).


Example 91: Synthesis of Compound 314
Synthesis of Intermediate C116



embedded image


To a mixture of 4-[4-(2,2-dimethylpropanoyl)piperazin-1-yl]-2-methylindazole-7-carboxamide (60 mg, 0.167 mmol, 1 equiv), 6-bromo-2,8-dimethylimidazo[1,2-a]pyrazine (45.34 mg, 0.200 mmol, 1.2 equiv), and Cs2CO3 (108.91 mg, 0.334 mmol, 2.0 equiv) in dioxane (2 mL) was added Xantphos (9.67 mg, 0.017 mmol, 0.1 equiv) and Pd2(dba)3 (7.65 mg, 0.008 mmol, 0.05 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-4-[4-(2,2-dimethylpropanoyl)piperazin-1-yl]-2-methylindazole-7-carboxamide (40 mg, 49%) as a solid. LCMS (ES, m/z): 515 [M+H]+.


Synthesis of Compound 314



embedded image


A solution of tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (40 mg, 0.078 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 86.60 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 8, Gradient 1) to afford N-{8-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (20.7 mg, 58%) as a solid. LCMS (ES, m/z): 415 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.37 (s, 1H), 9.92 (d, J=1.8 Hz, 1H), 9.60 (s, 2H), 8.95 (s, 1H), 8.57 (s, 1H), 8.24 (s, 1H), 8.02 (d, J=8.0 Hz, 1H), 6.60 (d, J=8.1 Hz, 1H), 4.33 (s, 3H), 3.66 (t, 4H), 3.31 (t, 4H), 2.45 (s, 3H).


Example 92: Synthesis of Compound 359
Synthesis of Intermediate C117



embedded image


To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (5.0 g, 19.602 mmol, 1 equiv) in ethyl acetate (150 mL) was added tetrafluoroboranuide; trimethyloxidanium (14.50 g, 98.010 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with ethyl acetate (150 mL) and washed with water (3×200 mL). The organic phase was dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-methylindazole-7-carboxylate (4.8 g, 91%) as a solid. LCMS (ES, m/z): 269[M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 8.62 (s, 1H), 7.84 (d, J=7.6 Hz, 1H), 7.42 (d, J=7.7 Hz, 1H), 4.25 (s, 3H), 3.89 (s, 3H).


Synthesis of Intermediate C118



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (4.5 g, 16.723 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (6.23 g, 33.446 mmol, 2 equiv) in dioxane (90 mL) was added Cs2CO3 (16.35 g, 50.169 mmol, 3 equiv), RuPhos (1.56 g, 3.345 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (1.40 g, 1.672 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (5.2 g, 83%) as a solid. LCMS (ES, m/z): 375[M+H]+.


Synthesis of Intermediate C119



embedded image


A mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (2.5 g, 6.677 mmol, 1 equiv) and NH3(g) in methanol (70 mL) was stirred for 2 days at 100° C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (1.35 g, 56%) as a solid. LCMS (ES, m/z): 360 [M+H]+.


Synthesis of Intermediate C120



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv), 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv), and Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (35 mg, 40%) as a solid. LCMS (ES, m/z): 521 [M+H]+.


Synthesis of Compound 359



embedded image


A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-dioxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv). The reaction mixture was stirred for 2 h at 80° C., then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 9, Gradient 1) to afford N-{8-hydroxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (6.5 mg, 31%) as a solid. LCMS (ES, m/z): 407 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 10.94 (s, 1H), 8.90 (s, 3H), 8.33 (s, 1H), 8.01 (d, J=8.0 Hz, 1H), 7.78 (s, 1H), 6.61 (d, J=8.1 Hz, 1H), 4.30 (s, 3H), 3.62 (t, 4H), 3.35 (t, 4H), 2.34 (s, 3H). 19F NMR (400 MHz, DMSO-d6) δ −73.89.


Example 93: Synthesis of Compound 332
Synthesis of Intermediate C121



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv), 6-bromo-4-fluoro-1,2-dimethyl-1,3-benzodiazole (48.69 mg, 0.200 mmol, 1.2 equiv), and Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-{7-[(7-fluoro-2,3-dimethyl-1,3-benzodiazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (43 mg, 49%) as a solid. LCMS (ES, m/z): 522[M+H]+.


Synthesis of Compound 332



embedded image


A solution of tert-butyl 4-{7-[(7-fluoro-2,3-dimethyl-1,3-benzodiazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (41 mg, 0.079 mmol, 1 equiv) in DCM was added TFA (0.5 mL, 6.732 mmol, 85.64 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-(7-fluoro-2,3-dimethyl-1,3-benzodiazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (26.9 mg, 64%) as a solid. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.34 (s, 1H), 8.96 (s, 2H), 8.91 (s, 1H), 8.05 (d, J=8.1 Hz, 1H), 8.00 (s, 1H), 7.55 (d, J=12.4 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.34 (s, 3H), 3.81 (s, 3H), 3.59 (t, 4H), 3.36 (t, 4H), 2.63 (s, 3H). 19F NMR (300 MHz, DMSO-d6) δ −74.09, −128.50.


Example 94: Synthesis of Compound 343
Synthesis of Intermediate C122



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (86.50 mg, 0.334 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (271.95 mg, 0.834 mmol, 3 equiv), XantPhos (16.10 mg, 0.028 mmol, 0.1 equiv), and Pd2(dba)3CHCl3 (14.40 mg, 0.014 mmol, 0.05 equiv). The reaction mixture was stirred for 16 h at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE/THF (60%) to afford tert-butyl 4-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (50 mg, 33%) as a solid. LCMS (ES, m/z): 538 [M+H]+.


Synthesis of Compound 343



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (50 mg, 0.093 mmol, 1 equiv), TFA (1 mL, 13.463 mmol), and DCM (3 mL) was stirred for 1 h at 25° C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-{8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (35 mg, 86%) as a solid. LCMS (ES, m/z): 438 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.73 (s, 1H), 9.79 (s, 1H), 8.94 (s, 1H), 8.15-8.04 (m, 2H), 6.64-6.62 (m, 1H), 4.71 (s, 3H), 4.32 (s, 3H), 3.76-6.60 (m, 4H), 3.42-3.19 (m, 4H) 2.44 (s, 3H).


Example 95: Synthesis of Compound 319
Synthesis of Intermediate C123



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-7-fluoro-2-methylindazole (45.88 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) and Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv). The reaction mixture was stirred for 1 h at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-{7-[(7-fluoro-2-methylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (35 mg, 41%) as a solid. LCMS (ES, m/z): 508 [M+H]+.


Synthesis of Compound 319



embedded image


To a solution of tert-butyl 4-{7-[(7-fluoro-2-methylindazol-5-yl)carbamoyl]-2-methyl-octahydroindazol-4-yl}piperazine-1-carboxylate (30 mg, 0.058 mmol, 1 equiv) in DCM was added HCl (gas) in 1,4-dioxane (0.5 mL, 16.456 mmol, 282.85 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(7-fluoro-2-methylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (12.7 mg, 49%) as a solid. LCMS (ES, m/z): 408 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.17 (s, 1H), 9.27 (s, 2H), 8.90 (s, 1H), 8.44 (d, J=2.9 Hz, 1H), 8.08 (d, J=1.6 Hz, 1H), 8.03 (d, J=7.9 Hz, 1H), 7.44 (dd, J=13.2, 1.6 Hz, 1H), 6.61 (d, J=8.1 Hz, 1H), 4.32 (s, 3H), 4.20 (s, 3H), 3.60 (t, 4H), 3.33 (t, 4H). 19F NMR (300 MHz, DMSO-d6) δ −128.029.


Example 96: Synthesis of Compound 320
Synthesis of Intermediate C124



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-2,7-dimethylindazole (45.09 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-{7-[(2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (36 mg, 43%) as a solid. LCMS (ES, m/z): 504[M+H]+.


Synthesis of Compound 320



embedded image


A solution of tert-butyl 4-{7-[(2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (35 mg, 0.069 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 96.86 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-(2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (19.3 mg, 53%) as a solid. LCMS (ES, m/z): 404 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 8.88 (m, 3H), 8.27 (s, 1H), 8.21 (s, 1H), 8.03 (d, J=7.9 Hz, 1H), 7.15 (s, 1H), 6.61 (d, J=8.0 Hz, 1H), 4.33 (s, 3H), 4.16 (s, 3H), 3.57 (t, 4H), 3.36 (t, 4H), 2.54 (s, 3H). 19F NMR (300 MHz, DMSO-d6) δ −74.21.


Example 97: Synthesis of Compound 321
Synthesis of Intermediate C125



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-1,2,4-trimethyl-1,3-benzodiazole (47.90 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-{2-methyl-7-[(2,3,7-trimethyl-1,3-benzodiazol-5-yl)carbamoyl]indazol-4-yl}piperazine-1-carboxylate (51 mg, 59%) as a solid. LCMS (ES, m/z): 518[M+H]+.


Synthesis of Compound 321



embedded image


A solution of tert-butyl 4-{2-methyl-7-[(2,3,7-trimethyl-1,3-benzodiazol-5-yl)carbamoyl]indazol-4-yl}piperazine-1-carboxylate (50 mg, 0.097 mmol, 1 equiv) in DCM (1.0 mL) was treated with TFA (0.5 mL, 6.732 mmol, 69.69 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-methyl-4-(piperazin-1-yl)-N-(2,3,7-trimethyl-1,3-benzodiazol-5-yl) indazole-7-carboxamide trifluoroacetate (26.6 mg, 51%) as a solid. LCMS (ES, m/z): 418 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.38 (s, 1H), 9.00 (s, 2H), 8.93 (s, 1H), 8.41 (s, 1H), 8.06 (d, J=8.0 Hz, 1H), 7.51 (s, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.34 (s, 3H), 3.91 (s, 3H), 3.59 (t, 4H), 3.34 (t, 4H), 2.81 (s, 3H), 2.61 (s, 3H).


Example 98: Synthesis of Compound 322
Synthesis of Intermediate C126



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-2,8-dimethylimidazo[1,2-b]pyridazine (45.29 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL, 23.608 mmol, 141.42 equiv) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-b]pyridazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (28 mg, 33%) as a solid. LCMS (ES, m/z): 505 [M+H]+.


Synthesis of Compound 322



embedded image


A solution of tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-b]pyridazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (28 mg, 0.055 mmol, 1 equiv) in DCM was treated with HCl (gas) in 1,4-dioxane (0.5 mL, 54.855 mmol, 988.55 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{2,8-dimethylimidazo[1,2-b]pyridazin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (14.2 mg, 58%) as a solid. LCMS (ES, m/z): 405 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.79 (s, 1H), 9.56 (s, 2H), 9.00 (s, 1H), 8.65 (s, 1H), 8.37 (s, 1H), 8.10 (d, J=8.1, 1.5 Hz, 1H), 6.64 (d, J=8.2 Hz, 1H), 4.29 (s, 3H), 3.70 (t, 4H), 3.32 (t, 4H), 2.72 (s, 3H), 2.55 (s, 3H).


Example 99: Synthesis of Compound 323
Synthesis of Intermediate C127



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (35 mg, 40%) as a solid. LCMS (ES, m/z): 521 [M+H]+.


Synthesis of Compound 323



embedded image


A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-dioxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv). The reaction mixture was stirred for 2 h at 80° C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{8-hydroxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (6.5 mg, 31%) as a solid. LCMS (ES, m/z): 421 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.48 (s, 1H), 9.40 (brs, 2H), 9.23 (s, 1H), 8.95 (s, 1H), 8.21 (s, 1H), 8.07 (d, J=8.0 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.29 (s, 3H), 4.21 (s, 3H), 3.66 (t, 4H), 3.32 (t, 4H), 2.46 (s, 3H).


Example 100: Synthesis of Compound 324
Synthesis of Intermediate C128



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv), 5-bromo-2-methylindazole (52.85 mg, 0.251 mmol, 1.5 equiv) and Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred for 30 seconds at room temperature under nitrogen atmosphere, then overnight at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl 4-{2-methyl-7-[(2-methylindazol-5-yl) carbamoyl]indazol-4-yl} piperazine-1-carboxylate (30 mg, 33%) as a solid. LCMS (ES, m/z): 490 [M+H]+.


Synthesis of Compound 324



embedded image


To a mixture of tert-butyl 4-{2-methyl-7-[(2-methylindazol-5-yl) carbamoyl] indazol-4-yl}piperazine-1-carboxylate (30 mg, 0.061 mmol, 1 equiv) in DCM (1.0 mL) was added TFA (0.5 mL, 6.732 mmol, 109.85 equiv). The reaction mixture was stirred for 1 hour at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford 2-methyl-N-(2-methylindazol-5-yl)-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (7.6 mg, 28%) as a solid. LCMS (ES, m/z): 390 [M+H]. 1H NMR (300 MHz, DMSO-d6) δ 11.15 (s, 1H), 9.40 (s, 2H), 8.90 (s, 1H), 8.38 (d, J=1.9 Hz, 1H), 8.31 (s, 1H), 8.03 (d, J=7.9 Hz, 1H), 7.63 (d, J=9.1 Hz, 1H), 7.40 (dd, J=9.1, 2.0 Hz, 1H), 6.61 (d, J=8.0 Hz, 1H), 4.32 (s, 3H), 4.16 (s, 3H), 3.60 (t, 4H), 3.32 (t, 4H).


Example 101: Synthesis of Compound 325
Synthesis of Intermediate C129



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1.00 equiv), 5-bromo-6-(methoxymethoxy)-2,7-dimethylindazole (57.12 mg, 0.200 mmol, 1.2 equiv), and Cs2CO3 (108.78 mg, 0.334 mmol, 2.0 equiv) in dioxane (2 mL) was added XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.10 equiv). The reaction mixture was stirred for 16 h at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-(7-{[6-(methoxymethoxy)-2,7-dimethylindazol-5-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (40 mg, 43%) as a solid. LCMS (ES, m/z): 564 [M+H]+.


Synthesis of Compound 325



embedded image


A solution of tert-butyl 4-(7-{[6-(methoxymethoxy)-2,7-dimethylindazol-5-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (40 mg, 0.071 mmol, 1 equiv) in DCM was treated with HCl (gas) in 1,4-dioxane (0.3 mL, 32.913 mmol, 463.79 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(6-hydroxy-2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (12.1 mg, 36%). LCMS (ES, m/z): 420 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.60 (s, 1H), 9.22 (br, 3H), 8.86 (s, 1H), 8.61 (s, 1H), 8.17 (s, 1H), 8.05 (d, J=7.9 Hz, 1H), 6.60 (d, J=8.0 Hz, 1H), 4.29 (s, 3H), 4.10 (s, 3H), 3.44 (t, 4H), 3.34 (t, 4H), 2.43 (s, 3H).


Example 102: Synthesis of Compound 315
Synthesis of Intermediate C130



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-7-fluoro-6-methoxy-2-methylindazole (51.90 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred for 1 h at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-{7-[(7-fluoro-6-methoxy-2-methylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (32 mg, 36%) as a solid. LCMS (ES, m/z): 538 [M+H]+. Synthesis of Compound 315




embedded image


A solution of tert-butyl 4-{7-[(7-fluoro-6-methoxy-2-methylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (32 mg, 0.060 mmol, 1 equiv) in DCM was treated with HCl (gas) in 1,4-dioxane (0.5 mL, 16.456 mmol, 276.47 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(7-fluoro-6-methoxy-2-methylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide hydrochloride (13.5 mg, 47%) as a solid. LCMS (ES, m/z): 438 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.58 (s, 1H), 9.29 (s, 2H), 8.90 (s, 1H), 8.69 (s, 1H), 8.40 (s, 1H), 8.06 (d, J=8.0 Hz, 1H), 6.61 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 4.18-4.11 (m, 6H), 3.60 (t, 4H), 3.32 (t, 4H). 19F NMR (300 MHz, DMSO-d6) δ 149.08.


Example 103: Synthesis of Compound 344
Synthesis of Intermediate C131



embedded image


To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (86.50 mg, 0.334 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (271.95 mg, 0.834 mmol, 3 equiv), XantPhos (16.10 mg, 0.028 mmol, 0.1 equiv), and Pd2(dba)3CHCl3 (14.40 mg, 0.014 mmol, 0.05 equiv). The reaction mixture was stirred for 16 h at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE/THF (60%) to afford tert-butyl 4-{7-[(6-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (53 mg, 36%) as a solid. LCMS (ES, m/z): 534 [M+H]+.


Synthesis of Compound 344



embedded image


A mixture of tert-butyl 4-{7-[(6-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (50 mg, 0.094 mmol, 1 equiv) and TFA (1 mL, 13.463 mmol, 143.69 equiv) in DCM (3 mL) was stirred for 1 h at 25° C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2, Gradient 4) to afford N-(6-methoxy-2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide trifluoroacetate (37 mg, 91%) as a solid. LCMS (ES, m/z): 434 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.51 (s, 1H), 8.87 (s, 1H), 8.75 (s, 1H), 8.25 (s, 1H), 8.07 (d, J=8.0 Hz, 1H), 6.62 (d, J=8.0 Hz, 1H), 4.32 (s, 3H), 4.14 (s, 3H), 3.94 (s, 3H), 3.62-3.53 (m, 4H), 3.43-3.19 (m, 4H), 2.50 (s, 3H).


Example 104: Synthesis of Compound 333
Synthesis of Intermediate C132



embedded image


To a mixture of Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) and 6-bromo-7-fluoro-2-methylimidazo[1,2-a]pyridine (45.88 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100° C. under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({7-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (45 mg, 53%) as a solid. LCMS (ES, m/z): 508 [M+H]+.


Synthesis of Compound 333



embedded image


A solution of tert-butyl 4-[7-({7-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (41 mg, 0.081 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 83.33 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-{7-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide trifluoroacetate (25.6 mg, 61%) as a solid. LCMS (ES, m/z): 408 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.59 (d, J=3.1 Hz, 1H), 9.98 (d, J=6.6 Hz, 1H), 9.04 (s, 2H), 8.96 (s, 1H), 8.16 (s, 1H), 8.08 (dd, J=9.1, 5.1 Hz, 2H), 6.64 (d, J=8.1 Hz, 1H), 4.27 (s, 3H), 3.64 (t, 4H), 3.27 (t, 4H), 2.45 (s, 3H). 19F NMR (300 MHz, DMSO-d6) δ −73.71, −117.21.


Example 105: Synthesis of Compound 334
Synthesis of Intermediate C133



embedded image


To a stirred mixture of 4-bromo-2-methylindazole-7-carboxylic acid (80 mg, 0.314 mmol, 1 equiv) and HATU (155.03 mg, 0.408 mmol, 1.3 equiv) in DMF (2 mL) was added DIEA (121.61 mg, 0.942 mmol, 3 equiv) and 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (66.13 mg, 0.408 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. A precipitate formed that was collected by filtration. The resulting solid was dried under infrared light to afford 4-bromo-N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 48%) as a solid. LCMS (ES, m/z): 399[M+H]+.


Synthesis of Intermediate C134



embedded image


To a stirred mixture of 4-bromo-N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.150 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (38.65 mg, 0.180 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (146.89 mg, 0.450 mmol, 3 equiv), RuPhos (14.03 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.57 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl (2R,6S)-4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (70 mg, 66%) as a solid. LCMS (ES, m/z): 533[M+H]+.


Synthesis of Compound 334



embedded image


To a stirred solution of tert-butyl (2R,6S)-4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (70 mg, 0.131 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 102.44 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-methylindazole-7-carboxamide (11.3 mg, 20%) as a solid. LCMS (ES, m/z): 433 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 9.36 (s, 1H), 9.17 (d, J=10.6 Hz, 1H), 8.94 (s, 1H), 8.59 (d, J=10.8 Hz, 1H), 8.11-8.05 (m, 2H), 6.66 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 4.03 (d, J=13.2 Hz, 2H), 3.00-2.89 (m, 2H), 2.76 (s, 3H), 2.43 (s, 3H), 1.33 (d, J=6.4 Hz, 6H).


Example 106: Synthesis of Compound 347
Synthesis of Intermediate C135



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4-yl)-N-(pyridin-2-ylmethyl)carbamate (52.16 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(pyridin-2-ylmethyl)carbamate (70 mg, 77%) as solid. LCMS (ES, m/z): 613[M+H]+.


Synthesis of Compound 347



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(pyridin-2-ylmethyl)carbamate (70 mg, 0.114 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 117.84 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 7) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-{4-[(pyridin-2-ylmethyl)amino]piperidin-1-yl}indazole-7-carboxamide (13.1 mg, 22%) as a solid. LCMS (ES, m/z): 513 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.78 (s, 1H), 8.51 (d, J=4.8 Hz, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.77 (td, J=7.6, 1.8 Hz, 1H), 7.49 (d, J=7.8 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 7.29-7.22 (m, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J=9.2 Hz, 4H), 3.06 (t, J=11.8 Hz, 2H), 2.79-2.63 (m, 1H), 2.38-2.33 (m, 3H), 2.01 (d, J=12.3 Hz, 2H), 1.52 (d, J=11.4 Hz, 2H). Example 107: Synthesis of Compound 360


Synthesis of Intermediate C136



embedded image


A mixture of sodium sulfate (111.38 g, 784.152 mmol, 8 equiv), hydroxylamine hydrochloride (23.84 g, 343.067 mmol, 3.5 equiv), and chloral (21.67 g, 147.029 mmol, 1.5 equiv) was dissolved in water (500 mL). To the reaction mixture was added a solution of 3-bromo-5-fluoro-2-methylaniline (20 g, 98.019 mmol, 1 equiv) in a mixture of water (540 mL), ethanol (70 mL), and concentrated HCl (17 mL). The reaction mixture was stirred overnight at 60° C., then cooled to room temperature. A precipitate formed that was collected by filtration and washed with water (2×50 mL). The resulting solid was dried in an oven under reduced pressure to afford (2E)-N-(3-bromo-5-fluoro-2-methylphenyl)-2-(N-hydroxyimino)acetamide (22 g, 82%) as a solid. LCMS (ES, m/z): 275[M+H]+.


Synthesis of Intermediate C137



embedded image


(2E)-N-(3-bromo-5-fluoro-2-methylphenyl)-2-(N-hydroxyimino)acetamide (22 g, 79.978 mmol, 1 equiv) was added to sulfuric acid (170 mL) in portions at 60° C. The resulting mixture was stirred for 1 h at 60° C., then cooled to room temperature and slowly added to ice water. A precipitate formed that was collected by filtration and washed with water (2×20 mL). The resulting solid was dried under vacuum to afford 6-bromo-4-fluoro-7-methyl-1H-indole-2,3-dione (18.5 g, 90%) as a solid. LCMS (ES, m/z): 258[M+H]+.


Synthesis of Intermediate C138



embedded image


To a mixture of 6-bromo-4-fluoro-7-methyl-1H-indole-2,3-dione (18.5 g, 71.693 mmol, 1 equiv) and NaOH (2 M) (91 mL, 645.237 mmol, 9 equiv) was added H2O2 (15.4 mL, 358.465 mmol, 5 equiv) dropwise over 15 min at room temperature. The resulting mixture was stirred for an additional 3 h at room temperature, then quenched with saturated sodium sulfite (aq.) at room temperature and neutralized to pH 7 with HCl (2 M). The resulting mixture was filtered, and the filter cake washed with water (2×20 mL). The filtrate was concentrated under reduced pressure to give a residue. The residue was acidified to pH 4 with HCl (2 M). The precipitated solids were collected by filtration and washed with water (2×20 mL). The resulting solid was dried under infrared light to afford 2-amino-4-bromo-6-fluoro-3-methylbenzoic acid (16 g, 90%) as a solid. LCMS (ES, m/z): 249[M+H]+.


Synthesis of Intermediate C139



embedded image


To a stirred solution of 2-amino-4-bromo-6-fluoro-3-methylbenzoic acid (6 g, 24.189 mmol, 1 equiv) in methanol (60 mL) was added sulfuric acid (23.72 g, 241.890 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80° C., then concentrated under reduced pressure to give a residue. The residue was quenched with a mixture of water and ice (50 mL) at room temperature. The resulting mixture was extracted with DCM (3×50 mL). The organic layers were combined, washed with brine (lx 50 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 2-amino-4-bromo-6-fluoro-3-methylbenzoate (2.48 g, 39%) as an oil. LCMS (ES, m/z): 262[M+H]+.


Synthesis of Intermediate C140



embedded image


To a stirred solution of methyl 2-amino-4-bromo-6-fluoro-3-methylbenzoate (2.35 g, 8.967 mmol, 1 equiv) and KOAc (0.97 g, 9.864 mmol, 1.1 equiv) in CHCl3 (50 mL) was added Ac20 (1.83 g, 17.934 mmol, 2 equiv) dropwise at 0° C. The resulting mixture was stirred for 20 min at room temperature. To the reaction mixture was added 18-Crown-6 (0.43 g, 1.614 mmol, 0.18 equiv) and tBuONO (2.03 g, 19.727 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 65° C. The resulting mixture was diluted with saturated NaHCO3 (aq.) (20 mL) and extracted with DCM (2×50 mL). The organic layers were combined, washed with brine (30 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was triturated with diethyl ether (10 mL) to afford methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (1.8 g, 74%) as a solid. LCMS (ES, m/z): 273 M+H]+.


Synthesis of Intermediate C141



embedded image


To a stirred solution of methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (1.7 g, 6.226 mmol, 1 equiv) in ethyl acetate (50 mL) was added trimethyloxonium tetrafluoroborate (1.38 g, 9.339 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with ethyl acetate (50 mL) and washed with brine (3×50 mL). The organic phase was concentrated under reduced pressure to afford methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (1.7 g, 95%) as a solid. LCMS (ES, m/z): 287[M+H]+.


Synthesis of Intermediate C142



embedded image


To a stirred mixture of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (1.6 g, 5.573 mmol, 1 equiv) in THF (12 mL) and water (4 mL) was added lithiumol hydrate (0.47 g, 11.146 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature, then concentrated under reduced pressure, diluted with water (20 mL), and acidified to pH 3 with citric acid. A precipitate formed that was collected by filtration and washed with water (2×10 mL) to afford 4-bromo-6-fluoro-2-methylindazole-7-carboxylic acid (1.5 g, 99%) as a solid. LCMS (ES, m/z): 273[M+H]+.


Synthesis of Intermediate C143



embedded image


To a stirred mixture of 4-bromo-6-fluoro-2-methylindazole-7-carboxylic acid (500 mg, 1.831 mmol, 1 equiv) and HATU (835.49 mg, 2.197 mmol, 1.2 equiv) in DMF (15 mL) was added DIEA (946.65 mg, 7.324 mmol, 4 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (369.20 mg, 1.831 mmol, 1 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature, then diluted with tert-butyl methyl ether (40 mL). A precipitate formed that was collected by filtration and washed with tert-butyl methyl ether (2×10 mL) to afford 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (530 mg, 69%) as a solid. LCMS (ES, m/z): 420[M+H]+.


Synthesis of Intermediate C144



embedded image


To a mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (200 mg, 0.476 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (177.29 mg, 0.952 mmol, 2 equiv) in 1,4-dioxane (6 mL) was added Cs2CO3 (465.21 mg, 1.428 mmol, 3 equiv), Ruphos (44.42 mg, 0.095 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (39.81 mg, 0.048 mmol, 0.1 equiv). The reaction mixture was stirred for 4 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (230 mg, 92%) as a solid. LCMS (ES, m/z): 526[M+H]+.


Synthesis of Compound 360



embedded image


To a stirred solution of tert-butyl 4-{6-fluoro-7-[({8-fluoro-2-methyl-octahydroimidazo[1,2-a]pyridin-6-yl}amino)(hydroxy)methyl]-2-methyl-octahydroindazol-4-yl}piperazine-1-carboxylate (70 mg, 0.129 mmol, 1 equiv) in DMSO (28 mL) and water (0.7 mL) was added potassium hydroxide (72.23 mg, 1.290 mmol, 10 equiv). The resulting mixture was stirred for 2 days at 110° C. The product was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 7-[({8-fluoro-2-methyl-octahydroimidazo[1,2-a]pyridin-6-yl}amino)(hydroxy)methyl]-2-methyl-4-(piperazin-1-yl)-octahydroindazol-6-ol (3.1 mg, 5%) as a solid. LCMS (ES, m/z): 424 [M+H]+. 1H NMR (300 MHz, Methanol-d4) δ 9.37 (s, 1H), 8.43 (s, 1H), 7.99 (s, 1H), 7.82 (d, J=11.4 Hz, 1H), 6.17 (s, 1H), 4.24 (s, 3H), 3.64 (d, J=5.5 Hz, 4H), 3.47 (d, J=5.4 Hz, 4H), 2.54 (s, 3H).


Example 108: Synthesis of Compound 348
Synthesis of Intermediate C145



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl 2,7-diazaspiro[3.5]nonane-2-carboxylate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford 4-{2,7-diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 81%) as a solid. LCMS (ES, m/z): 548[M+H]+.


Synthesis of Compound 348



embedded image


To a stirred solution of tert-butyl 7-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2,7-diazaspiro[3.5]nonane-2-carboxylate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 122.88 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-{2,7-diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (22.1 mg, 45%) as a solid. LCMS (ES, m/z): 448 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.50 (d, J=8.3 Hz, 1H), 4.30 (s, 3H), 3.63 (s, 2H), 3.40-3.35 (m, 6H), 2.35 (s, 3H), 1.89 (t, J=5.5 Hz, 4H).


Example 109: Synthesis of Compound 349
Synthesis of Intermediate C146



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl 1,8-diazaspiro[4.5]decane-1-carboxylate (43.02 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl 8-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,8-diazaspiro[4.5]decane-1-carboxylate (70 mg, 84%) as a solid. LCMS (ES, m/z): 562[M+H]+.


Synthesis of Compound 349



embedded image


To a stirred solution of tert-butyl 8-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-1,8-diazaspiro[4.5]decane-1-carboxylate (70 mg, 0.125 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 108.02 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-{1,8-diazaspiro[4.5]decan-8-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (23.8 mg, 41%) as a solid. LCMS (ES, m/z): 462 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.21 (s, 1H), 8.77 (s, 1H), 7.96 (d, J=7.9 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.33 (d, J=12.2 Hz, 1H), 6.49 (d, J=7.9 Hz, 1H), 4.29 (s, 3H), 3.59-3.42 (m, 4H), 2.91-2.83 (m, 3H), 1.76-1.65 (m, 6H), 1.56 (t, J=7.4 Hz, 2H).


Example 110: Synthesis of Compound 361
Synthesis of Compound 361



embedded image


To a stirred solution of tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (50 mg, 0.095 mmol, 1 equiv) in methanol (1 mL) was added HCl (g) in methanol (1 mL, 32.913 mmol, 345.95 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC with the following conditions (Condition 5, Gradient 1) to afford 6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (18.7 mg, 46%) as a solid. LCMS (ES, m/z): 426 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 10.90 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.28-7.21 (m, 1H), 6.24 (d, J=15.0 Hz, 1H), 4.20 (s, 3H), 3.31 (s, 4H), 2.90 (s, 4H), 2.35 (s, 3H).


Example 111: Synthesis of Compound 362
Synthesis of Intermediate C147



embedded image


A solution of tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (60 mg, 0.114 mmol, 1 equiv) and DIEA (29.51 mg, 0.228 mmol, 2 equiv) in Methylamine (2M in THF, 5 mL) was stirred overnight at 80° C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-6-(methylamino) indazol-4-yl]piperazine-1-carboxylate (60 mg, 98%) as a solid. LCMS (ES, m/z): 537[M+H]+.


Synthesis of Compound 362



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-6-(methylamino) indazol-4-yl]piperazine-1-carboxylate (60 mg, 0.112 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 10.202 mmol, 91.24 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-6-(methylamino)-4-(piperazin-1-yl) indazole-7-carboxamide (27.2 mg, 56%) as a solid. LCMS (ES, m/z): 437 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.58 (s, 1H), 9.56 (q, J=4.9 Hz, 1H), 9.10 (d, J=1.6 Hz, 1H), 8.52 (s, 1H), 7.85 (d, J=3.4 Hz, 1H), 7.24 (dd, J=12.5, 1.7 Hz, 1H), 5.90 (s, 1H), 4.15 (s, 3H), 3.45 (t, J=5.0 Hz, 4H), 3.14 (d, J=6.0 Hz, 4H), 2.98 (d, J=5.0 Hz, 3H), 2.34 (s, 3H).


Example 112: Synthesis of Compound 363
Synthesis of Intermediate C148



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.203 mmol, 1 equiv), 1-chloro-2-iodoethane (57.87 mg, 0.304 mmol, 1.5 equiv), and KOH (68.21 mg, 1.218 mmol, 6.0 equiv) in DMF (2 mL) was stirred for 12 h at 90° C. The mixture was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (100 mg) as a solid. LCMS (ES, m/z): 520 [M+H]+.


Synthesis of Compound 363




embedded image


A mixture of tert-butyl 4-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.192 mmol, 1 equiv) and TFA (0.3 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 M NH3(gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 5) to afford 2-ethenyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (24 mg, 30%) as a solid. LCMS (ES, m/z): 420 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 10.91 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 9.10 (s, 1H), 8.04 (d, J=8.1 Hz, 1H), 7.95-7.87 (m, 1H), 7.67 (dd, J=15.5, 8.8 Hz, 1H), 7.35 (dd, J=12.3, 1.6 Hz, 1H), 6.52 (d, J=8.2 Hz, 1H), 6.26 (d, J=15.3 Hz, 1H), 5.36 (d, J=8.6 Hz, 1H), 3.39 (d, J=5.3 Hz, 4H), 2.94 (s, 4H), 2.39-2.32 (m, 3H).


Example 113: Synthesis of Compounds 352 and 353
Synthesis of Compounds 352 and 353



embedded image


Compounds 352 and 353 were isolated by Chiral Prep-HPLC (Condition 3, Gradient 1) Compound 352: RT=4.680 min. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.06 (d, J=1.8 Hz, 1H), 8.49 (d, J=2.0 Hz, 1H), 8.08 (dd, J=8.2, 1.1 Hz, 1H), 7.70 (t, J=2.2 Hz, 1H), 7.22 (dq, J=11.8, 1.7 Hz, 1H), 6.53 (dd, J=8.2, 1.5 Hz, 1H), 4.32 (s, 3H), 3.82 (d, J=11.7 Hz, 2H), 3.20-2.93 (m, 4H), 2.66 (dd, J=12.3, 10.3 Hz, 1H), 2.43 (s, 3H), 1.21 (d, J=6.4 Hz, 3H). Compound 353: RT=5.317 min. LCMS (ES, m/z): 422 [M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.04 (s, 1H), 8.47 (d, J=3.8 Hz, 1H), 8.06 (dd, J=8.9, 1.8 Hz, 1H), 7.68 (d, J=3.3 Hz, 1H), 7.22-7.18 (m, 1H), 6.51 (dd, J=8.2, 3.0 Hz, 1H), 4.31 (d, J=1.6 Hz, 3H), 3.81 (dd, J=11.0, 5.2 Hz, 2H), 3.15-2.96 (m, 4H), 2.65 (dd, J=12.5, 10.3 Hz, 1H), 2.43 (d, J=1.0 Hz, 3H), 1.21 (d, J=6.4 Hz, 3H).


Example 114: Synthesis of Compound 364
Synthesis of Intermediate C149



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl) indazol-4-yl]piperazine-1-carboxylate (60.0 mg, 0.10 mmol, 1.0 equiv) in DCM (2 mL) was treated with DAST (35.1 mg, 0.21 mmol, 2.0 equiv) at 0° C. The resulting mixture was stirred for 3 h at room temperature, then quenched with ice-water at 0° C. The resulting mixture was extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-(2,2-difluoropropyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (29 mg, 46%) as a solid. LCMS (ES, m/z): 572 [M+H]+.


Synthesis of Compound 364



embedded image


A solution of tert-butyl 4-[2-(2,2-difluoropropyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (29.0 mg, 0.05 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 1) to afford 2-(2,2-difluoropropyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (8 mg, 27%) as a solid. LCMS (ES, m/z): 472 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.19 (s, 1H), 9.40 (s, 1H), 9.00 (s, 1H), 8.86-8.85 (m, 2H), 8.08-8.06 (m, 2H), 7.53 (d, J=11.9 Hz, 1H), 6.66 (d, J=8.0 Hz, 1H), 5.17 (t, J=13.1 Hz, 2H), 3.60-3.59 (m, 4H), 3.37-3.35 (m, 4H), 2.41 (s, 3H), 1.78 (t, J=19.2 Hz, 3H).


Example 115: Synthesis of Compound 365
Synthesis of Intermediate C150



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (50 mg, 0.1 mmol, 1 equiv), 2-oxaspiro[3.3]heptan-6-yl methanesulfonate (50 mg, 0.26 mmol, 2.57 equiv), and Cs2CO3 (99 mg, 0.3 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 12 h at 90° C. The reaction mixture was purified by reverse flash chromatography (Condition 2, Gradient 3) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-{2-oxaspiro[3.3]heptan-6-yl}indazol-4-yl]piperazine-1-carboxylate (50 mg, 84%) as a solid. LCMS (ES, m/z): 590 [M+H]+.


Synthesis of Compound 365



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-{2-oxaspiro[3.3]heptan-6-yl}indazol-4-yl]piperazine-1-carboxylate (30 mg, 0.05 mmol, 1 equiv) and ZnBr2 (30 mg, 0.133 mmol, 2.62 equiv) in DCM (1 mL) was stirred for 12 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-{2-oxaspiro[3.3]heptan-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (2 mg, 8%) as a solid. LCMS (ES, m/z): 490 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.84 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.92 (d, J=3.1 Hz, 1H), 7.22 (dd, J=12.3, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 5.19 (p, J=8.1 Hz, 1H), 4.77 (s, 2H), 4.70 (s, 2H), 3.32-3.26 (m, 4H), 2.96-2.91 (m, 8H), 2.39-2.33 (m, 3H).


Example 116: Synthesis of Compound 366
Synthesis of Intermediate C151



embedded image


To a stirred solution of 1,3-oxazol-5-ylmethanol (600.0 mg, 6.055 mmol, 1.0 equiv) in DCM (12 mL) was added Et3N (919.1 mg, 9.082 mmol, 1.5 equiv) and MsCl (762.9 mg, 6.660 mmol, 1.1 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 30 min at room temperature under nitrogen atmosphere, then concentrated under vacuum to give a residue.


Synthesis of Intermediate C152



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (600.0 mg, 1.216 mmol, 1.0 equiv) in DMF (12 mL) was added Cs2CO3 (1.18 g, 3.648 mmol, 3.0 equiv) and 1,3-oxazol-5-ylmethyl methanesulfonate (215.4 mg, 1.216 mmol, 1.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 50° C., then cooled to room temperature. The resulting mixture was diluted with water (20 mL) and extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (3×20 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1,3-oxazol-5-ylmethyl) indazol-4-yl]piperazine-1-carboxylate (80 mg, 11%) as a solid. LCMS (ES, m/z): 575 [M+H]+.


Synthesis of Compound 366



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1,3-oxazol-5-ylmethyl) indazol-4-yl]piperazine-1-carboxylate (75.0 mg, 0.131 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.2 mL) dropwise at 0° C. The resulting mixture was stirred for 30 min at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 8) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(1,3-oxazol-5-ylmethyl)-4-(piperazin-1-yl) indazole-7-carboxamide (20.2 mg, 33%) as a solid. LCMS (ES, m/z): 475 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.95 (s, 1H), 8.42 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.92 (d, J 3.1 Hz, 1H), 7.50 (s, 1H), 7.14 (dd, J=12.2, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 5.95 (s, 2H), 3.38 (t, 4H), 2.93 (t, 4H), 2.36 (s, 3H).


Example 117: Synthesis of Compound 367
Synthesis of Intermediate C153



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (120.0 mg, 0.24 mmol, 1.0 equiv) and 1-bromo-2-methoxypropane (55.8 mg, 0.36 mmol, 1.5 equiv) in DMF (1.5 mL) was added Cs2CO3 (237.6 mg, 0.73 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 4 h at 40° C., then diluted with water and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxypropyl) indazol-4-yl]piperazine-1-carboxylate (70 mg, 51%) as a solid. LCMS (ES, m/z): 566 [M+H]+.


Synthesis of Compound 367



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxypropyl) indazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.12 mmol, 1.0 equiv) in DCM (0.7 mL) was treated with TFA (0.7 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 15) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxypropyl)-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (28 mg, 39%) as a solid. LCMS (ES, m/z): 466 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 9.41 (d, J=1.6 Hz, 1H), 8.90-8.88 (m, 3H), 8.08 (d, J=2.7 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.62 (d, J=11.9 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.76-4.50 (m, 2H), 4.03 (td, J=6.8, 4.5 Hz, 1H), 3.60 (t, J=5.0 Hz, 4H), 3.37-3.35 (m, 4H), 3.24 (s, 3H), 2.42 (s, 3H), 1.21 (d, J=6.2 Hz, 3H).


Example 118: Synthesis of Compound 368
Synthesis of Intermediate C154



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 4-(chloromethyl)-1-methyl-1,2,3-triazole (31.9 mg, 0.24 mmol, 1.2 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water and extracted with ethyl acetate (2×15 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(1-methyl-1,2,3-triazol-4-yl)methyl]indazol-4-yl]piperazine-1-carboxylate (65 mg, 55%) as a solid. LCMS (ES, m/z): 589 [M+H]+.


Synthesis of Compound 368



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(1-methyl-1,2,3-triazol-4-yl)methyl]indazol-4-yl]piperazine-1-carboxylate (65.0 mg, 0.11 mmol, 1.0 equiv) in DCM (0.3 mL) was treated with TFA (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 7) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(1-methyl-1,2,3-triazol-4-yl)methyl]-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (25.8 mg, 39%) as a solid. LCMS (ES, m/z): 489 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ 11.22 (s, 1H), 9.40 (d, J=1.6 Hz, 1H), 9.04 (s, 1H), 8.90-8.89 (m, 2H), 8.26 (s, 1H), 8.08 (d, J=2.7 Hz, 1H), 8.03 (d, J=8.0 Hz, 1H), 7.55 (d, J=12.0 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 5.89 (s, 2H), 4.06 (s, 3H), 3.60-3.59 (m, 4H), 3.36-3.34 (m, 4H), 2.42 (s, 3H).


Example 119: Synthesis of Compound 369
Synthesis of Intermediate C155



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(2-hydroxyethyl)-N-(piperidin-4-yl)carbamate (43.74 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(2-hydroxyethyl)carbamate (70 mg, 83%) as an oil. LCMS (ES, m/z): 566[M+H]+.


Synthesis of Compound 369



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(2-hydroxyethyl)carbamate (70 mg, 0.124 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 108.79 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 8) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-{4-[(2-hydroxyethyl)amino]piperidin-1-yl}-2-methylindazole-7-carboxamide (14.1 mg, 24%) as a solid. LCMS (ES, m/z): 466[M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.2 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.56-6.45 (m, 2H), 4.57 (s, 1H), 4.30 (s, 3H), 3.91 (d, J=12.7 Hz, 2H), 3.50 (s, 2H), 3.06 (t, J=11.8 Hz, 2H), 2.70 (s, 3H), 2.35 (s, 3H), 1.99 (d, J=12.6 Hz, 2H), 1.47 (d, J=11.6 Hz, 2H).


Example 120: Synthesis of Compound 370
Synthesis of Intermediate C156



embedded image


A mixture of tert-butyl 4-oxopiperidine-1-carboxylate (2.0 g, 10.038 mmol, 1 equiv) and benzylamine (1.08 g, 10.038 mmol, 1 equiv) in toluene (30 mL) was stirred overnight at 120° C. with an attached Dean-Stark trap. The resulting mixture was cooled to room temperature, then concentrated under vacuum to afford tert-butyl 4-(benzylimino)piperidine-1-carboxylate (3.05 g, crude) as an oil. LCMS (ES, m/z): 289[M+H]+.


Synthesis of Intermediate C157



embedded image


To a stirred solution of tert-butyl 4-(benzylimino)piperidine-1-carboxylate (3.05 g, 10.576 mmol, 1 equiv), DMF (2.32 g, 31.728 mmol, 3 equiv), and KHF2 (0.66 g, 8.461 mmol, 0.8 equiv) in acetonitrile (30 mL) was added TFA (1.51 g, 13.220 mmol, 1.25 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 20 min at 0° C. under nitrogen atmosphere. To the reaction mixture was added trifluoromethyltrimethylsilane (2.26 g, 15.864 mmol, 1.5 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere, then quenched with saturated NaHCO3 (50 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (1×50 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 4-(benzylamino)-4-(trifluoromethyl)piperidine-1-carboxylate (820 mg, 22%) as an oil. LCMS (ES, m/z): 359[M+H]+.


Synthesis of Intermediate C158



embedded image


A mixture of tert-butyl 4-(benzylamino)-4-(trifluoromethyl)piperidine-1-carboxylate (200 mg, 0.558 mmol, 1 equiv) and HCl (gas) in 1,4-dioxane (2 mL) was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum to afford N-benzyl-4-(trifluoromethyl)piperidin-4-amine dihydrochloride (180 mg, 97%) as a solid. LCMS (ES, m/z): 259[M+H]+.


Synthesis of Intermediate C159



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and N-benzyl-4-(trifluoromethyl)piperidin-4-amine (46.23 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford 4-[4-(benzylamino)-4-(trifluoromethyl)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 81%) as an oil. LCMS (ES, m/z): 580[M+H]+.


Synthesis of Compound 370



embedded image


To a solution of 4-[4-(benzylamino)-4-(trifluoromethyl)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.121 mmol, 1 equiv) in methanol (5 mL) was added Pd/C (10%, 10 mg) under nitrogen atmosphere. The reaction mixture was hydrogenated at room temperature for 1 h using a hydrogen balloon. The resulting mixture was filtered, and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 4-[4-amino-4-(trifluoromethyl)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (7.9 mg, 13%) as a solid. LCMS (ES, m/z): 490[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.09 (d, J=1.6 Hz, 1H), 8.52 (s, 1H), 8.09 (d, J=8.1 Hz, 1H), 7.75-7.70 (m, 1H), 7.26 (dd, J=11.8, 1.7 Hz, 1H), 6.57 (d, J=8.2 Hz, 1H), 4.85 (s, 3H), 4.33 (s, 2H), 3.85 (d, J=12.8 Hz, 2H), 3.49-3.39 (m, 2H), 2.44 (d, J=0.9 Hz, 3H), 2.17-2.03 (m, 2H), 1.76 (d, J=13.2 Hz, 2H), 1.31 (s, 1H).


Example 121: Synthesis of Compound 371
Synthesis of Intermediate C160



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-[(3R)-pyrrolidin-3-yl]carbamate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-cyclopropyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 73%) as a solid. LCMS (ES, m/z): 548[M+H]+.


Synthesis of Compound 371



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TMSI (109.61 mg, 0.550 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then neutralized with triethylamine. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2), followed by chiral SFC (Condition 4, Gradient 1) to afford 4-[(3R)-3-(cyclopropylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (17.8 mg, 36%) as a solid. LCMS (ES, m/z): 448[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.02 (d, J=1.8 Hz, 1H), 8.54 (s, 1H), 8.04 (d, J=8.4 Hz, 1H), 7.70 (d, J=3.0 Hz, 1H), 7.18 (dd, J=11.9, 1.6 Hz, 1H), 6.07 (d, J=8.5 Hz, 1H), 4.29 (s, 3H), 3.93-3.81 (m, 2H), 3.70 (dq, J=12.0, 6.8, 6.1 Hz, 2H), 3.53 (dd, J=10.3, 5.5 Hz, 1H), 2.44 (s, 3H), 2.40-2.26 (m, 2H), 2.15-2.02 (m, 1H), 0.58 (d, J=6.9 Hz, 2H), 0.45 (q, J=3.7 Hz, 2H).


Example 122: Synthesis of Compound 372
Synthesis of Intermediate C161



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N—[(3S)-pyrrolidin-3-yl]carbamate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-cyclopropyl-N-[(3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 73%) as a solid. LCMS (ES, m/z): 548[M+H]+.


Synthesis of Compound 372



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TMSI (109.61 mg, 0.550 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then neutralized with triethylamine. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 12, Gradient 1). The product was further purified by chiral SFC (Condition 4, Gradient 1) to afford 4-[(3S)-3-(cyclopropylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (9.3 mg, 19%) as a solid. LCMS (ES, m/z): 448[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.02 (d, J=1.6 Hz, 1H), 8.54 (s, 1H), 8.04 (d, J=8.4 Hz, 1H), 7.70 (d, J=3.0 Hz, 1H), 7.18 (dd, J=11.9, 1.7 Hz, 1H), 6.07 (d, J=8.4 Hz, 1H), 4.29 (s, 3H), 3.92-3.80 (m, 2H), 3.69 (dq, J=12.1, 6.7, 6.0 Hz, 2H), 3.57-3.50 (m, 1H), 2.44 (s, 3H), 2.40-2.26 (m, 2H), 2.12-2.04 (m, 2H), 0.61-0.52 (m, 2H), 0.44 (h, J=4.5, 3.9 Hz, 2H).


Example 123: Synthesis of Compound 373
Synthesis of Compound 373



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and N-[1-(fluoromethyl)cyclopropyl]pyrrolidin-3-amine (47.20 mg, 0.299 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs2CO3 (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1), followed by Prep-HPLC (Condition 12, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(3-{[1-(fluoromethyl)cyclopropyl]amino}pyrrolidin-1-yl)-2-methylindazole-7-carboxamide (5.1 mg, 4%) as a solid. LCMS (ES, m/z): 480[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.04 (d, J=1.7 Hz, 1H), 8.53 (s, 1H), 8.04 (d, J=8.4 Hz, 1H), 7.74-7.68 (m, 1H), 7.21 (dd, J=11.9, 1.6 Hz, 1H), 6.06 (d, J=8.4 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.30 (s, 3H), 3.89 (q, J=7.8, 6.7 Hz, 3H), 3.85-3.78 (m, 1H), 3.71 (q, J=7.7 Hz, 1H), 2.44 (d, J=0.9 Hz, 3H), 2.34 (dd, J=12.1, 6.3 Hz, 1H), 2.04 (dt, J=13.9, 6.9 Hz, 1H), 1.31 (s, 2H), 0.84-0.67 (m, 4H).


Example 124: Synthesis of Compound 374
Synthesis of Intermediate C162



embedded image


A mixture of methyl 4-bromo-2H-indazole-7-carboxylate (8 g, 31.36 mmol, 1 equiv) and tetrafluoroboranuide; triethyloxidanium (17.9 g, 94.09 mmol, 3 equiv) in ethyl acetate (100 mL) was stirred overnight at room temperature. The reaction mixture was quenched with water (200 mL) at room temperature, then extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-ethylindazole-7-carboxylate (6.36 g, 72%) as a solid. LCMS (ES, m/z): 283 [M+H]+.


Synthesis of Intermediate C163



embedded image


A mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (5.4 g, 18.93 mmol, 1 equiv) and LiOH·H2O (7.9 g, 189.3 mmol, 10 equiv) in THF (50 mL), methanol (50 mL) and water (25 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in ethyl acetate (100 mL) and diluted with water (200 mL). The resulting mixture was acidified to pH 2 with 1M HCl (aq.) and extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (1×100 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-2-ethylindazole-7-carboxylic acid (5 g, 98%) as a solid. LCMS (ES, m/z): 269 [M+H]+.


Synthesis of Intermediate C164



embedded image


To a stirred mixture of 4-bromo-2-ethylindazole-7-carboxylic acid (5.8 g, 21.55 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (5.3 g, 32.33 mmol, 1.5 equiv) in DMF (20 mL) was added HATU (9.8 g, 25.86 mmol, 1.2 equiv) and DIEA (13.9 g, 107.76 mmol, 5 equiv) in portions at room temperature. The resulting mixture was stirred for 4 h at room temperature, then quenched with water (50 mL). A precipitate formed that was collected by filtration and washed with water (2×50 mL) to afford 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (8.1 g, 90%) as a solid. LCMS (ES, m/z): 416 [M+H]+.


Synthesis of Intermediate C165



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) was added Cs2CO3 (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was taken up in water (20 mL) and extracted with ethyl acetate (3×10 mL). The organic layers were combined, washed with brine (1×30 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H]+.


Synthesis of Compound 374



embedded image


A mixture of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was basified to pH 8 with 7 M NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (30 mg, 27%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.97-7.85 (m, 2H), 7.26 (dd, J=12.4, 1.6 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.76 (dq, J=13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J=7.4 Hz, 3H), 3.42 (dd, J=10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J=11.2, 4.5 Hz, 1H), 1.92 (dd, J=11.8, 6.1 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Example 125: Synthesis of Compound 375
Synthesis of Compound 375



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpyrrolidin-3-amine (25 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 2) to afford 4-[3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (17.4 mg, 18%) as a solid. LCMS (ES, m/z): 450 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.88 (s, 1H), 7.98-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 6.05 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.81 (dt, J=19.0, 9.0 Hz, 2H), 3.65 (q, J=9.5, 9.0 Hz, 1H), 3.46 (t, J=9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J=11.6, 10.7 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Example 126: Synthesis of Compound 376
Synthesis of Intermediate C166



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (190 mg, 0.46 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-(piperidin-4-yl)carbamate (110 mg, 0.46 mmol, 1 equiv) in dioxane (10 mL) was added Cs2CO3 (446 mg, 1.38 mmol, 3 equiv), RuPhos (43 mg, 0.092 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (38 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (150 mg, 57%) as a solid. LCMS (ES, m/z): 576 [M+H]+.


Synthesis of Compound 376



embedded image


A mixture of tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (60 mg, 0.104 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was basified to pH 8 with 7 M NH3(g) in methanol, then concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 3) to afford 4-[4-(cyclopropylamino)piperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (20 mg, 40%) as a solid. LCMS (ES, m/z): 476 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.88 (d, J=13.0 Hz, 2H), 3.13-2.99 (m, 2H), 2.77 (dd, J=9.2, 5.0 Hz, 1H), 2.35 (s, 3H), 2.13 (tt, J=6.8, 3.6 Hz, 1H), 2.06-1.96 (m, 2H), 1.62 (t, J=7.3 Hz, 3H), 1.48 (q, J=10.2 Hz, 2H), 0.40 (dt, J=6.2, 3.0 Hz, 2H), 0.24 (p, J=3.9 Hz, 2H).


Example 127: Synthesis of Compound 377
Synthesis of Intermediate C167



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (50 mg, 0.24 mmol, 1.0 equiv) in dioxane (5 mL) was added Cs2CO3 (211 mg, 0.648 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl (2R,6S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (65 mg, 55%) as a solid. LCMS (ES, m/z): 550 [M+H]+.


Synthesis of Compound 377



embedded image


A mixture of tert-butyl (2R,6S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (10 mg, 0.018 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure, then basified to pH 8 with 7 M NH3 (g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 4) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (12 mg, 27%) as a solid. LCMS (ES, m/z): 450 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.82 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.78 (dd, J=12.2, 2.7 Hz, 2H), 2.96 (tt, J=8.0, 5.5 Hz, 2H), 2.44 (d, J=11.0 Hz, 2H), 2.35 (s, 3H), 1.62 (t, J=7.2 Hz, 3H), 1.07 (d, J=6.2 Hz, 6H).


Example 128: Synthesis of Compound 378
Synthesis of Compound 378



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and 1-methylpiperazine (22 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature, and concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (15 mg, 16%) as a solid. LCMS (ES, m/z): 436 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.90 (dd, J=3.1, 1.0 Hz, 1H), 7.30 (dd, J=12.4, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.43 (t, J=5.0 Hz, 4H), 2.55 (d, J=4.9 Hz, 4H), 2.35 (s, 3H), 2.28 (s, 3H), 1.62 (t, J=7.3 Hz, 3H).


Example 129: Synthesis of Compound 379
Synthesis of Intermediate C168



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (46 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (10 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature, and concentrated under vacuum to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4,7-diazaspiro[2.5]octane-4-carboxylate (50 mg, 42%) as a solid. LCMS (ES, m/z): 548 [M+H]+.


Synthesis of Compound 379



embedded image


A mixture of tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4,7-diazaspiro[2.5]octane-4-carboxylate (40 mg, 0.073 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum, basified to pH 8 with 7 M NH3(g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 3) to afford 4-{4,7-diazaspiro[2.5]octan-7-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (20 mg, 61%) as a solid. LCMS (ES, m/z): 448 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.20 (s, 1H), 8.73 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.93-7.87 (m, 1H), 7.30 (d, J=12.3 Hz, 1H), 6.46 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.2 Hz, 2H), 3.40 (s, 2H), 3.25 (s, 2H), 2.99 (d, J=6.0 Hz, 2H), 2.35 (s, 3H), 1.62 (t, J=7.3 Hz, 3H), 0.61 (s, 2H), 0.54 (s, 2H).


Example 130: Synthesis of Compound 380
Synthesis of Intermediate C169



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.216 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (49 mg, 0.216 mmol, 1 equiv) in dioxane (5 mL) was added Cs2CO3 (211 mg, 0.648 mmol, 3 equiv), RuPhos (11 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (10 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere, then cooled to room temperature, and concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3×5 mL). The organic layers were combined, washed with brine (1×10 mL), dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-ethyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (45 mg, 37%) as a solid. LCMS (ES, m/z): 564 [M+H]+.


Synthesis of Compound 380



embedded image


A mixture of tert-butyl N-ethyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (35 mg, 0.062 mmol, 1 equiv) in trifluoroacetic acid (1 mL) and DCM (1 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure, basified to pH 8 with 7 M NH3(g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 3) to afford 2-ethyl-4-[4-(ethylamino)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (15 mg, 52%) as a solid. LCMS (ES, m/z): 464 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.89 (d, J=12.7 Hz, 2H), 3.06 (t, J=11.4 Hz, 2H), 2.75-2.55 (m, 3H), 2.35 (s, 3H), 1.96 (d, J=12.1 Hz, 2H), 1.62 (t, J=7.2 Hz, 3H), 1.45 (q, J=10.0, 9.6 Hz, 2H), 1.04 (t, J=7.1 Hz, 3H).


Example 131: Synthesis of Compound 381
Synthesis of Compound 381



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL, 143.58 equiv) was added TFA (1 mL, 122.88 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 4-[(3R)-3-aminopyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (10.4 mg, 23%) as a solid. LCMS (ES, m/z): 408[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.39 (d, J=1.4 Hz, 1H), 8.62 (s, 1H), 8.10 (d, J=8.3 Hz, 1H), 8.00 (s, 1H), 7.82 (d, J=11.3 Hz, 1H), 6.17 (d, J=8.4 Hz, 1H), 4.32 (s, 3H), 4.15 (s, 1H), 4.02 (dt, J=17.0, 9.3 Hz, 2H), 3.95-3.85 (m, 1H), 3.77 (d, J=10.9 Hz, 1H), 2.63-2.56 (m, 1H), 2.54 (s, 3H), 2.31 (s, 1H).


Example 132: Synthesis of Compound 382
Synthesis of Compound 382



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-[(3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL, 143.58 equiv) was added TFA (1 mL, 122.88 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 4-[(3S)-3-aminopyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (22.1 mg, 50%) as a solid. LCMS (ES, m/z): 408[M+H]+. 1H NMR (400 MHz, Methanol-d4) δ 9.39 (d, J=1.4 Hz, 1H), 8.62 (s, 1H), 8.10 (d, J=8.3 Hz, 1H), 8.00 (s, 1H), 7.82 (d, J=11.3 Hz, 1H), 6.17 (d, J=8.4 Hz, 1H), 4.32 (s, 3H), 4.15 (s, 1H), 4.02 (dt, J=17.0, 9.3 Hz, 2H), 3.95-3.85 (m, 1H), 3.77 (d, J=10.9 Hz, 1H), 2.63-2.56 (m, 1H), 2.54 (s, 3H), 2.31 (s, 1H).


Example 133: Synthesis of Compound 383
Synthesis of Intermediate C162



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-{2-azabicyclo[2.1.1]hexan-4-yl}carbamate (35.49 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) were added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-{2-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2-azabicyclo[2.1.1]hexan-4-yl}carbamate (C162, 70 mg, 90%) as a solid. LCMS (ES, m/z): 520 [M+H]+


Synthesis of Compound 383



embedded image


To a stirred solution of tert-butyl N-{2-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2-azabicyclo[2.1.1]hexan-4-yl}carbamate (70 mg, 0.135 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 99.93 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 1) to afford 4-{4-amino-2-azabicyclo[2.1.1]hexan-2-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 383, 14 mg, 24%) as a solid. LCMS (ES, m/z): 420 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.97 (s, 1H), 9.19 (s, 1H), 8.78 (s, 1H), 7.95-7.87 (m, 2H), 7.32 (d, J=12.4 Hz, 1H), 6.29 (d, J=8.4 Hz, 1H), 4.52 (s, 1H), 4.28 (s, 3H), 3.49 (s, 2H), 2.35 (s, 3H), 1.85 (s, 2H), 1.61 (s, 2H).


Example 134: Synthesis of Compound 384
Synthesis of Intermediate C163



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.203 mmol, 1 equiv), (3-hydroxyoxetan-3-yl)methyl methanesulfonate (55 mg, 0.304 mmol, 1.5 equiv) and Cs2CO3 (198 mg, 0.609 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 12 hr at 90° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(3-hydroxyoxetan-3-yl)methyl]indazol-4-yl]piperazine-1-carboxylate (C163, 35 mg, 29%) as a solid. LCMS (ES, m/z): 580 [M+H]+


Synthesis of Compound 384



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(3-hydroxyoxetan-3-yl)methyl]indazol-4-yl]piperazine-1-carboxylate (30 mg, 0.052 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(3-hydroxyoxetan-3-yl)methyl]-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 384, 10 mg, 40%) as a solid. LCMS (ES, m/z): 480 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.03 (s, 1H), 9.24 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 8.00 (d, J=8.1 Hz, 1H), 7.92 (d, J=3.2 Hz, 1H), 7.25 (dd, J=12.4, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 6.25 (s, 1H), 4.88 (s, 2H), 4.84-4.70 (m, 2H), 4.51 (d, J=6.5 Hz, 2H), 3.45-3.37 (m, 4H), 2.91-2.73 (m, 4H), 2.35 (s, 3H).


Example 135: Synthesis of Compound 385
Synthesis of Intermediate C164



embedded image


Into a 40 mL round-bottom flask were added methyl 3-hydroxy-2-nitrobenzoate (700 mg, 3.551 mmol, 1 equiv), acetic acid (10 mL) and Br2 (851.14 mg, 5.327 mmol, 1.5 equiv) at 25 degrees C. The resulting mixture was stirred for 12 hr at 25° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford methyl 4-bromo-3-hydroxy-2-nitrobenzoate (C164, 730 mg, 74%) as a solid. LCMS (ES, m/z): 274 [M−H]


Synthesis of Intermediate C165



embedded image


Into a 40 mL round-bottom flask were added methyl 4-bromo-3-hydroxy-2-nitrobenzoate (300 mg, 1.087 mmol, 1 equiv), acetic acid (6 mL) and zinc (213.16 mg, 3.260 mmol, 3.00 equiv) at 25 degrees C. The resulting mixture was stirred for 12 h at 25 degrees C. The reaction was quenched by the addition of sodium bicarbonate aqueous solution (50 mL) at 25 degrees C. The aqueous layer was extracted with ethyl acetate (3×20 mL). The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 2-amino-4-bromo-3-hydroxybenzoate (C165, 200 mg, 74%) as a solid. LCMS (ES, m/z): 246 [M+H]+


Synthesis of Intermediate C166



embedded image


Into a 40 mL round-bottom flask were added methyl 2-amino-4-bromo-3-hydroxybenzoate (200 mg, 0.813 mmol, 1 equiv) THF (10 mL) carbonyldiimidazole (197.70 mg, 1.220 mmol, 1.5 equiv) and triethylamine (246.75 mg, 2.439 mmol, 3 equiv) at 25° C. The resulting mixture was stirred for 12 h at 60° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 7-bromo-2-oxo-3H-1,3-benz oxazole-4-carboxylate (C166, 200 mg, 90%) as a solid. LCMS (ES, m/z): 272 [M−H]


Synthesis of Intermediate C167



embedded image


Into a 40 mL vial were added methyl 7-bromo-2-oxo-3H-1,3-benzoxazole-4-carboxylate (200 mg, 0.735 mmol, 1 equiv), triphenylphosphine (289.24 mg, 1.103 mmol, 1.5 equiv), DCM (4 mL) and 2-methoxyethanol (67.13 mg, 0.882 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 1 hr at 0° C. under nitrogen atmosphere. To the above mixture was added DEAD (192.05 mg, 1.103 mmol, 1.5 equiv). The resulting mixture was stirred for additional 2 h at 25 degrees C. The reaction was quenched by the addition of water (10 mL) at room temperature. The aqueous layer was extracted with ethyl acetate (2×10 mL). The resulting liquid was dried Na2SO4. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford methyl 7-bromo-2-(2-methoxyethoxy)-1,3-benzoxazole-4-carboxylate (C167, 160 mg, 65%) as a solid.


LCMS (ES, m/z): 330 [M+H]+


Synthesis of Intermediate C168



embedded image


Into a 40 mL vial were added methyl 7-bromo-2-(2-methoxyethoxy)-1,3-benzoxazole-4-carboxylate (150 mg, 0.454 mmol, 1 equiv), tert-butyl piperazine-1-carboxylate (101.55 mg, 0.545 mmol, 1.2 equiv) BINAP (56.59 mg, 0.091 mmol, 0.2 equiv), K3PO4 (289.33 mg, 1.362 mmol, 3 equiv), Pd2(dba)3 (41.61 mg, 0.045 mmol, 0.1 equiv) and dioxane (5 mL) at room temperature. The resulting mixture was stirred for 3 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with THF/EA (1:1) to afford methyl 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethoxy)-1,3-benzoxazole-4-carboxylate (C168, 120 mg, 60%) as a solid. LCMS (ES, m/z): 436 [M+H]+


Synthesis of Intermediate C169



embedded image


Into a 40 mL vial were added methyl 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethoxy)-1,3-benzoxazole-4-carboxylate (120 mg, 0.276 mmol, 1 equiv), tetrahydrofuran (2 mL), water (2 mL) and LiOH (9.90 mg, 0.414 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 40° C. The resulting mixture was diluted with water (30 mL). The mixture was acidified to pH 5 with HCl (aq.). The aqueous layer was extracted with ethyl acetate (2×50 mL). The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxy ethoxy)-1,3-benzoxazole-4-carboxylic acid (C169, 100 mg, 86%) as a solid. LCMS (ES, m/z): 422 [M+H]+


Synthesis of Intermediate C170



embedded image


Into a 40 mL vial were added 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-(2-methoxyethoxy)-1,3-benzoxazole-4-carboxylic acid (100 mg, 0.237 mmol, 1 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (47.03 mg, 0.284 mmol, 1.2 equiv), HATU (85.79 mg, 0.355 mmol, 1.5 equiv), dimethylformamide (3 mL) and DIEA (92.00 mg, 0.711 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The reaction was quenched by the addition of water (10 mL) at room temperature. The aqueous layer was extracted with ethyl acetate (2×10 mL). The resulting liquid was dried over Na2SO4. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford tert-butyl 4-[4-({8-fluoro-2-methylimidazo [1,2-a]pyri din-6-yl}carbamoyl)-2-(2-methoxyethoxy)-1,3-benzoxazol-7-yl]piperazine-1-carboxylate (C170, 63 mg, 46%) as a solid. LCMS (ES, m/z): 569 [M+H]+


Synthesis of Compound 367



embedded image


Into a 8 mL vial were added tert-butyl 4-[4-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethoxy)-1,3-benzoxazol-7-yl]piperazine-1-carboxylate (40 mg, 0.070 mmol, 1 equiv), DCM (1 mL), trimethylsilyl triflate (156.35 mg, 0.700 mmol, 10 equiv) and DIEA (90.92 mg, 0.700 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The crude product was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethoxy)-7-(piperazin-1-yl)-1,3-benzoxazole-4-carboxamide (Compound 367, 7.7 mg, 23%) as a solid. LCMS (ES, m/z): 469 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.62 (s, 1H), 9.06 (d, J=1.6 Hz, 1H), 7.94 (d, J=3.1 Hz, 1H), 7.40 (d, J=8.7 Hz, 1H), 7.22 (dd, J=12.6, 1.6 Hz, 1H), 6.79 (d, J=8.8 Hz, 1H), 4.20 (t, J=5.2 Hz, 2H), 3.45 (t, J=5.2 Hz, 2H), 3.21 (dd, J=6.4, 3.5 Hz, 4H), 3.09 (s, 3H), 2.88 (dd, J=6.2, 3.5 Hz, 4H), 2.34 (s, 2H).


Example 136: Synthesis of Compound 386
Synthesis of Intermediate C171



embedded image


To a solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (50 mg, 0.099 mmol, 1 equiv) in DMF (1 mL) was added sodium hydride (60% in oil, 7.88 mg, 2 equiv) at 0° C. The mixture was stirred for 15 min. CH3I (13.28 mg, 0.094 mmol, 0.95 equiv) was added and the mixture was allowed to warm to room temperature and stirred for 2 hr. The reaction mixture was quenched by water and extracted with DCM (3×25 mL). The organic phase was concentrated under reduced pressure to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}(methyl)carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C171, 40 mg, 77%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 386



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}(methyl)carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (40 mg, 0.077 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-N,2-dimethyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 386, 8.8 mg, 27%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 8.38 (s, 1H), 8.28 (s, 1H), 7.65 (d, J=2.9 Hz, 1H), 7.19-7.11 (m, 2H), 6.22 (d, J=7.6 Hz, 1H), 4.08 (s, 3H), 3.35 (s, 3H), 3.14 (t, J=4.9 Hz, 4H), 2.93 (t, J=4.9 Hz, 4H), 2.26 (s, 3H).


Example 137: Synthesis of Compound 387
Synthesis of Intermediate C172



embedded image


To a stirred solution of methyl 4-bromo-2-methylindazole-7-carboxylate (350 mg, 1.30 mmol, 1.0 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (286.5 mg, 1.43 mmol, 1.1 equiv) in dioxane (4 mL) were added Cs2CO3 (1.27 g, 3.90 mmol, 3.0 equiv), RuPhos (121.3 mg, 0.26 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (108.7 mg, 0.13 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-methylindazole-7-carboxylate (C172, 398 mg, 78%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C173



embedded image


To a stirred solution of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-methylindazole-7-carboxylate (398.0 mg, 1.02 mmol, 1.0 equiv) in THF (4 mL) were added H2O (4 mL) and LiOH (214.9 mg, 5.12 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50° C. The resulting mixture was concentrated under vacuum and diluted with water (10 mL). The mixture was acidified to pH 7 with HCl (2 M) and was extracted with ethyl acetate (3×10 mL). The combined organic layers were washed with brine (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-methylindazole-7-carboxylic acid (C173, 312 mg, 81%) as a solid. LCMS (ES, m/z): 375 [M+H]+


Synthesis of Intermediate C174



embedded image


To a stirred solution of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-methylindazole-7-carboxylic acid (312.0 mg, 0.83 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyrazin-6-amine (152.3 mg, 0.91 mmol, 1.1 equiv) in DMF (4 mL) were added HATU (475.2 mg, 1.24 mmol, 1.5 equiv) and DIEA (323.0 mg, 2.49 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 7 hr at room temperature. The resulting mixture was diluted with water (5 mL) and extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate (100%) to afford tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (C174, 210 mg, 48%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 387



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (210 mg, 0.40 mmol, 1.0 equiv) in DCM (3 mL) was added TFA (1 mL) dropwise at 0° C. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (Compound 387, 32.4 mg, 19%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.7 Hz, 1H), 8.83 (s, 1H), 8.11-7.79 (m, 2H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.76 (t, J=15.2, 6.5 Hz, 2H), 3.66 (s, 1H), 3.43 (d, J=10.8 Hz, 1H), 3.36 (d, J=5.4 Hz, 1H), 2.35 (d, J=1.5 Hz, 6H), 2.15 (dt, J=12.8, 6.5 Hz, 1H), 1.93 (dd, J=12.0, 6.3 Hz, 1H).


Example 138: Synthesis of Compound 388
Synthesis of Intermediate C175



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (400 mg, 1.486 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (357.3 mg, 1.783 mmol, 1.2 equiv) in dioxane (8 mL) were added Cs2CO3 (1.45 g, 4.458 mmol, 3.0 equiv) and RuPhos (138.7 mg, 0.297 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (124.3 mg, 0.149 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-1-yl)-2-methyl-2H-indazole-7-carboxylate (C175, 650 mg, 112%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C176



embedded image


To a stirred mixture of methyl (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-1-yl)-2-methyl-2H-indazole-7-carboxylate (650.0 mg, 1.673 mmol, 1 equiv) in THF (8 mL) were added H2O (8 mL) and lithium hydroxide hydrate (561.7 mg, 13.384 mmol, 8.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water (10 mL). The mixture was acidified to pH 6 with HCl (2 M). The resulting mixture was extracted with ethyl acetate (3×10 mL). The combined organic layers were washed with water (2×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-1-yl)-2-methyl-2H-indazole-7-carboxylic acid (C176, 570 mg, 90%) as a solid. LCMS (ES, m/z): 375 [M+H]+


Synthesis of Intermediate C177



embedded image


To a stirred mixture of (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-1-yl)-2-methyl-2H-indazole-7-carboxylic acid (200.0 mg, 0.534 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (132.3 mg, 0.801 mmol, 1.5 equiv) in DMF (2.5 mL) were added DIEA (276.1 mg, 2.136 mmol, 4.0 equiv) and HATU (243.7 mg, 0.641 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50° C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with ethyl acetate (3×10 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl (S)-(1-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-methyl-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (C177, 130 mg, 46%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 388



embedded image


To a stirred mixture of tert-butyl (S)-(1-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-methyl-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (110 mg, 0.211 mmol, 1 equiv) in DCM (2.5 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 1) to afford (S)—N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (Compound 388, 55 mg, 61%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.82 (s, 1H), 7.96-7.86 (m, 2H), 7.29 (dd, J=12.4, 1.7 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.27 (t, 3H), 3.75 (dq, J=21.5, 7.5, 6.8 Hz, 2H), 3.64 (d, J=7.5 Hz, 1H), 3.42 (dd, J=10.6, 4.0 Hz, 1H), 3.35 (d, J=10.5 Hz, 1H), 2.35 (s, 6H), 2.21-2.11 (m, 1H), 1.92 (dq, J=12.3, 6.2 Hz, 1H).


Example 139: Synthesis of Compound 389
Synthesis of Intermediate C178



embedded image


To a stirred solution of {6-bromo-8-fluoroimidazo[1,2-a]pyridin-2-yl}methanol (60 mg, 0.245 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (88.01 mg, 0.245 mmol, 1 equiv) and Cs2CO3 (239.33 mg, 0.735 mmol, 3.0 equiv) in Dioxane (2 mL) were added XantPhos (14.17 mg, 0.025 mmol, 0.1 equiv) and Pd2(dba)3 (11.21 mg, 0.012 mmol, 0.05 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 hr at 100° C. under nitrogen atmosphere. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)imidazo[1,2-a]pyridin-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (C178, 40 mg, 31%) as a solid. LCMS (ES, m/z): 524 [M+H]+


Synthesis of Compound 389



embedded image


A mixture of tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)imidazo[1,2-a]pyridin-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (35 mg, 0.067 mmol, 1 equiv) in DCM (2 mL) and TFA (1 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 4, Gradient 1) to afford N-[8-fluoro-2-(hydroxymethyl)imidazo[1,2-a]pyridin-6-yl]-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (Compound 389, 18 mg, 50%) as a solid. LCMS (ES, m/z): 424 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 9.35 (s, 1H), 8.89-8.82 (m, 3H), 8.10 (s, 1H), 8.03-8.01 (d, J=8 Hz, 1H), 7.54-7.53 (br, 1H), 6.62-6.60 (d, J=8 Hz, 1H), 4.66 (s, 2H), 4.32 (s, 3H), 3.60-3.52 (m, 4H), 3.40-3.25 (m, 4H).


Example 140: Synthesis of Compound 387
Synthesis of Compound 387



embedded image


Compound 298 was separated by prep-chiral-HPLC (Condition 2, Gradient 1) to yield (R)—N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (5.9 mg, 25%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.00 (s, 1H), 8.53 (s, 1H), 8.03 (d, J=8.3 Hz, 1H), 7.70 (d, J=3.0 Hz, 1H), 7.13 (d, J=12.4 Hz, 1H), 6.07 (d, J=8.4 Hz, 1H), 4.30 (s, 3H), 3.90-3.77 (m, 2H), 3.73-3.67 (m, 1H), 3.53-3.52 (m, 2H), 2.53 (s, 3H), 2.44 (s, 3H), 2.41-2.33 (m, 1H), 2.09-2.03 (m, 1H).


Example 141: Synthesis of Compound 388
Synthesis of Compound 388



embedded image


Compound 298 was separated by prep-chiral-HPLC (Condition 2, Gradient 1) to yield (S)—N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (5.2 mg, 23%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 8.99 (d, J=1.6 Hz, 1H), 8.51 (s, 1H), 8.03 (d, J=8.4 Hz, 1H), 7.69 (d, J=2.9 Hz, 1H), 7.11 (dd, J=11.9, 1.6 Hz, 1H), 6.07 (d, J=8.4 Hz, 1H), 4.29 (s, 3H), 3.94-3.76 (m, 2H), 3.72-3.66 (m, 1H), 3.54-3.53 (m, 2H), 2.54 (s, 3H), 2.44 (s, 3H), 2.40-2.34 (m, 1H), 2.10-2.02 (m, 1H).


Example 142: Synthesis of Compound 391
Synthesis of Intermediate C179



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and iodocyclobutane (55.3 mg, 0.30 mmol, 1.5 equiv) in DMF (2 mL) was added Cs2CO3 (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3×15 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl 4-[2-cyclobutyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl] piperazine-1-carboxylate (C179, 59 mg, 53%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 391



embedded image


A solution of tert-butyl 4-[2-cyclobutyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (59.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.6 mL) was treated with TFA (0.6 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-cyclobutyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 391, 9.7 mg, 20%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 9.22 (s, 1H), 8.89 (s, 1H), 7.99 (d, J=7.8 Hz, 1H), 7.92 (s, 1H), 7.24 (d, J=12.3 Hz, 1H), 6.50 (d, J=8.1 Hz, 1H), 5.35-5.28 (m, 1H), 3.37-3.34 (m, 5H), 2.95-2.93 (m, 4H), 2.82-2.71 (m, 2H), 2.60-2.59 (m, 2H), 2.36 (s, 3H), 1.96 (q, J=11.5, 11.1 Hz, 2H).


Example 143: Synthesis of Compound 392
Synthesis of Intermediate C180



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and allyl bromide (36.7 mg, 0.30 mmol, 1.5 equiv) in DMF (2 mL) was added Cs2CO3 (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (2×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(prop-2-en-1-yl) indazol-4-yl] piperazine-1-carboxylate (C180, 52 mg, 48%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 392



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(prop-2-en-1-yl) indazol-4-yl]piperazine-1-carboxylate (52 mg, 0.10 mmol, 1 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(prop-2-en-1-yl) indazole-7-carboxamide (Compound 392, 12.7 mg, 30%) as a solid. LCMS (ES, m/z): 434 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.13 (s, 1H), 9.22 (d, J=1.6 Hz, 1H), 8.82 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.24 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.1 Hz, 1H), 6.26 (ddd, J=16.4, 10.3, 6.0 Hz, 1H), 5.45-5.29 (m, 2H), 5.22 (d, J=6.1 Hz, 2H), 3.36 (t, J=5.0 Hz, 4H), 2.92 (t, J=4.9 Hz, 4H), 2.35 (s, 3H).


Example 144: Synthesis of Compound 394
Synthesis of Intermediate C181



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl 1,7-diazaspiro[3.5]nonane-1-carboxylate (49 mg, 0.22 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 1) to afford tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (75 mg, 61%) as a solid. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 394



embedded image


To a stirred solution of tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-1,7-diazaspiro[3.5]nonane-1-carboxylate (90 mg, 0.16 mmol, 1 equiv) and DIEA (31 mg, 0.24 mmol, 1.5 equiv) in DCM (5 mL) was added Trimethylsilyl trifluorornethanesulfonate (107 mg, 0.48 mmol, 3 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The reaction was quenched with water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 4-{1,7-diazaspiro[3.5]nonan-7-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 394, 30 mg, 40%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.4, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.99-3.70 (m, 1H), 3.60-3.40 (m, 3H), 3.29 (s, 2H), 2.35 (s, 3H), 2.07 (t, J=7.5 Hz, 2H), 1.96-1.77 (m, 4H), 1.62 (t, J=7.2 Hz, 3H).


Example 145: Synthesis of Compound 395



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpiperidin-4-amine (28 mg, 0.22 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 4-[4-(dimethylamino)piperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 395, 30 mg, 29%) as a solid. LCMS (ES, m/z): 464 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.81 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.96 (d, J=12.5 Hz, 2H), 2.97 (t, J=11.8 Hz, 2H), 2.35 (s, 4H), 2.22 (s, 6H), 1.90 (d, J=12.2 Hz, 2H), 1.62 (t, J=7.2 Hz, 4H).


Example 146: Synthesis of Compound 396
Synthesis of Intermediate C182



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl N-ethyl-N-(pyrrolidin-3-yl)carbamate (93 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (423 mg, 1.29 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-ethyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (C182, 100 mg, 42%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 396



embedded image


A solution of tert-butyl N-ethyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (140 mg, 0.255 mmol, 1 equiv) in trifluoroacetic acid (3 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 2-ethyl-4-[3-(ethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 396, 60 mg, 52%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.26 (dd, J=12.4, 1.7 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.77 (dd, J=13.6, 7.0 Hz, 2H), 3.70-3.57 (m, 1H), 3.53-3.37 (m, 2H), 2.63 (q, J=7.1 Hz, 2H), 2.35 (s, 3H), 2.16 (dd, J=12.3, 6.0 Hz, 1H), 1.90 (dd, J=12.1, 6.3 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H), 1.05 (t, J=7.1 Hz, 3H).


Example 147: Synthesis of Compound 397
Synthesis of Intermediate C183



embedded image


To a stirred solution of 4-[(tert-butoxycarbonyl)amino]piperidine-4-carboxylic acid (1.5 g, 6.140 mmol, 1.0 equiv) and sodium methaneperoxoate sodium (1.3 g, 12.280 mmol, 2.0 equiv) in tetrahydrofuran (15 mL), water (15 mL) was added benzyl chloroformate (1.2 g, 7.368 mmol, 1.2 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was diluted with water (30 mL). The mixture was acidified to PH 5 with HCl (aq.). The resulting mixture was extracted with ethyl acetate (2×50 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 1-[(benzyloxy)carbonyl]-4-[(tert-butoxycarbonyl)amino]piperidine-4-carboxylic acid (C183, 1.4 g, 55%) as an oil. LCMS (ES, m/z): 379 [M+H]+


Synthesis of Intermediate C184



embedded image


To a stirred solution of 1-[(benzyloxy)carbonyl]-4-[(tert-butoxycarbonyl)amino]piperidine-4-carboxylic acid (1.4 g, 3.700 mmol, 1.0 equiv) in tetrahydrofuran (15 mL) was added borane-tetrahydrofuran complex, 1M (40 mL) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 hr at 0° C. under nitrogen atmosphere. The reaction was quenched with methanol at 0° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford benzyl 4-amino-4-(hydroxymethyl)piperidine-1-carboxylate (C184, 0.78 g, 71%) as an oil. LCMS (ES, m/z): 265 [M+H]+


Synthesis of Intermediate C185



embedded image


To a stirred mixture of benzyl 4-amino-4-(hydroxymethyl)piperidine-1-carboxylate (0.7 g, 2.762 mmol, 1.0 equiv) and triethylamine (0.8 g, 8.286 mmol, 3.0 equiv) in DCM (10 mL) was added di-tert-butyl dicarbonate (0.7 g, 3.314 mmol, 1.2 equiv) in portions at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford benzyl 4-[(tert-butoxycarbonyl) amino]-4-(hydroxymethyl) piperidine-1-carboxylate (C185, 0.8 g, 71%) as an oil. LCMS (ES, m/z): 365 [M+H]+


Synthesis of Intermediate C186



embedded image


To a stirred solution of benzyl 4-[(tert-butoxycarbonyl)amino]-4-(hydroxymethyl)piperidine-1-carboxylate (700.0 mg, 1.921 mmol, 1.0 equiv) in DCM (8 mL) was added Diethylaminosulfur trifluoride (464.4 mg, 2.881 mmol, 1.5 equiv) dropwise at 0° C. under nitrogen atmosphere. The reaction was quenched with sat. NaHCO3 (aq.) at 0° C. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure.


LCMS (ES, m/z): 367 [M+H]+


Synthesis of Intermediate C187



embedded image


To a solution of benzyl 4-[(tert-butoxycarbonyl)amino]-4-(fluoromethyl)piperidine-1-carboxylate (290.0 mg, 0.791 mmol, 1.0 equiv) in 10 mL methanol was added Pd/C (10%, 250 mg) under nitrogen atmosphere in a mL round-bottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon. The mixture was filtered through a Celite pad and concentrated under reduced pressure to yield tert-butyl (4-(fluoromethyl)piperidin-4-yl)carbamate (C187, 130 mg, 65%) as a solid. LCMS (ES, m/z): 233 [M+H]+


Synthesis of Intermediate C188



embedded image


To a solution of tert-butyl N-[4-(fluoromethyl) piperidin-4-yl]carbamate (80.0 mg, 0.344 mmol, 1 equiv) and 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (138.5 mg, 0.344 mmol, 1.0 equiv) in dioxane (4 mL) were added Cs2CO3 (280.5 mg, 0.860 mmol, 2.5 equiv) and Ruphos (32.1 mg, 0.069 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (28.8 mg, 0.034 mmol, 0.1 equiv). After stirring for 3 hr at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-4-(fluoromethyl)piperidin-4-yl}carbamate (C188, 120 mg, 53.50%) as a solid. LCMS (ES, m/z): 554 [M+H]+


Synthesis of Intermediate Compound 397



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-4-(fluoromethyl)piperidin-4-yl}carbamate (80.0 mg, 0.145 mmol, 1.0 equiv) in DCM (1 mL) was added trifluoroacetaldehyde (0.5 mL) dropwise at 0° C. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-amino-4-(fluoromethyl)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (C187, 9 mg, 13%) as a light yellow solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.22 (d, J=1.6 Hz, 1H), 8.82 (d, J=5.8 Hz, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.2 Hz, 1H), 7.35 (dd, J=12.3, 1.7 Hz, 1H), 6.55 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.81 (d, J=12.7 Hz, 2H), 3.25-3.24 (m, 4H), 2.76 (d, J=19.4 Hz, 2H), 2.35 (s, 3H), 1.95-1.83 (m, 4H).


Example 148: Synthesis of Compound 398
Synthesis of Intermediate C189



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (190 mg, 0.456 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3-yl)carbamate (103 mg, 0.456 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (446 mg, 1.368 mmol, 3 equiv), RuPhos (43 mg, 0.091 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (21 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (C189, 200 mg, 78%) as a solid. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 398



embedded image


A solution of tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (90 mg, 0.160 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 10, Gradient 4) to afford 4-[3-(cyclopropylamino)pyrrolidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 398, 60 mg, 81%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.04 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.97-7.85 (m, 2H), 7.25 (dd, J=12.4, 1.7 Hz, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.77 (dd, J=12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71 (m, 1H) 2.35 (s, 3H), 2.17 (td, J=7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J=12.3, 6.2 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H), 0.42 (d, J=6.6 Hz, 2H), 0.25 (dq, J=9.7, 6.2, 4.7 Hz, 2H).


Example 149: Synthesis of Compounds 399 and 400



embedded image


Compound 396 was separated by Prep-Chiral-HPLC (Condition 3, Gradient 1) to afford (R)-2-ethyl-4-(3-(ethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 400, 18.4 mg, 30%) as a white solid and (S)-2-ethyl-4-(3-(ethylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 399, 18.4 mg, 30%) as a solid.













Compound No.
Analysis Data







399
LCMS (ES, m/z): 450 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H),




8.84 (s, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.89 (d, J = 3.1 Hz, 1H), 7.26 (dd, J =



12.4, 1.7 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.77 (dd,



J = 13.6, 7.0 Hz, 2H), 3.70-3.57 (m, 1H), 3.53-3.37 (m, 2H), 2.63 (q, J = 7.1



Hz, 2H), 2.35 (s, 3H), 2.16 (dd, J = 12.3, 6.0 Hz, 1H), 1.90 (dd, J = 12.1, 6.3



Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H), 1.05 (t, J = 7.1 Hz, 3H).


400
LCMS (ES, m/z): 450 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H),




8.84 (s, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.89 (d, J = 3.1 Hz, 1H), 7.26 (dd, J =



12.4, 1.7 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.77 (dd,



J = 13.6, 7.0 Hz, 2H), 3.70-3.57 (m, 1H), 3.53-3.37 (m, 2H), 2.63 (q, J = 7.1



Hz, 2H), 2.35 (s, 3H), 2.16 (dd, J = 12.3, 6.0 Hz, 1H), 1.90 (dd, J = 12.1, 6.3



Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H), 1.05 (t, J = 7.1 Hz, 3H).









Example 150: Synthesis of Compound 401



embedded image


To a stirred solution of 4-{1,7-diazaspiro[3.5]nonan-7-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (280 mg, 0.607 mmol, 1 equiv) and 37% HCHO (91 mg, 3.035 mmol, 5 equiv) in ACN (5 mL) was added NaBH3CN (114.3 mg, 1.821 mmol, 3 equiv) in portions at room temperature. The resulting mixture was stirred for 30 min at room temperature. To the above mixture was added HOAc (364.3 mg, 6.070 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for additional 2 hr at room temperature. The reaction was quenched with water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 4) to afford 2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(1-methyl-1,7-diazaspiro[3.5]nonan-7-yl)-2H-indazole-7-carboxamide 2,2,2-trifluoroacetate (Compound 401, 100 mg, 27%) as a solid. LCMS (ES, m/z): 476 [M+H]+ 1H NMR (300 MHz, Methanol-d4) δ 9.52 (d, J=1.6 Hz, 1H), 8.64 (s, 1H), 8.20-8.07 (m, 2H), 7.99 (dd, J=11.3, 1.6 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 4.67 (q, J=7.3 Hz, 2H), 4.33-4.21 (m, 1H), 4.16-4.01 (m, 2H), 3.96 (d, J=10.3 Hz, 1H), 3.16 (q, J=12.5 Hz, 2H), 2.87 (s, 3H), 2.68-2.56 (m, 5H), 2.44 (d, J=12.2 Hz, 1H), 2.37-2.23 (m, 3H), 1.73 (t, J=7.3 Hz, 3H).


Example 151: Synthesis of Compound 402
Synthesis of Intermediate C190



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4-yl)carbamate (35.85 mg, 0.179 mmol, 1.2 equiv) in dioxane (1 mL) was added Cs2CO3 (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (C190, 50 mg, 64%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 402



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (50 mg, 0.096 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 4-(4-aminopiperidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 402, 8.6 mg, 21%) as solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J=12.8 Hz, 2H), 3.05 (t, J=11.8 Hz, 2H), 2.85 (s, 1H), 2.35 (s, 3H), 1.88 (d, J=12.8 Hz, 2H), 1.43 (q, J=10.7, 10.3 Hz, 2H).


Example 152: Synthesis of Compound 403
Synthesis of Intermediate C191



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl 2-(hydroxymethyl)piperazine-1-carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs2CO3 (2.35 g, 7.206 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90° C. under a nitrogen atmosphere. The resulting mixture was diluted with H2O (20 mL). The resulting mixture was extracted with EA (3×20 mL). The combined organic layers were washed with NaCl (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2-(hydroxymethyl)piperazine-1-carboxylate (C191, 500 mg, 37%) as a solid. LCMS (ES, m/z): 552 [M+H]


Synthesis of Compound 403



embedded image


A solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2-(hydroxymethyl)piperazine-1-carboxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-(hydroxymethyl)piperazin-1-yl]indazole-7-carboxamide (Compound 403, 10 mg, 24%) as a solid.


LCMS (ES, m/z): 452 [M+H]+ 1H NMR (300 MHz, DMSO-d6) b 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (dd, J=3.2, 1.0 Hz, 1H), 7.31 (dd, J=12.3, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.79 (d, J=10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J=10.3, 9.3 Hz, 3H), 2.77-2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J=7.3 Hz, 3H).


Example 153: Synthesis of Compound 404
Synthesis of Intermediate 192



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (172 mg, 0.413 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (94 mg, 0.413 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (404 mg, 1.239 mmol, 3 equiv) and RuPhos Palladacycle Gen.3 (19 mg, 0.041 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 hr at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:5) to afford tert-butyl N-{4-ethyl-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (C192, 150 mg, 64%) as a solid. LCMS (ES, m/z): 564 [M+H]+


Synthesis of Compound 404



embedded image


A solution of tert-butyl N-{4-ethyl-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (140 mg, 0.248 mmol, 1 equiv) in 2,2,2-trifluoroacetic acid (5 mL) and DCM (5 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3 (g) in methanol. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 4) to afford 4-(4-amino-4-ethylpiperidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 402, 30 mg, 26%) as a solid. LCMS (ES, m/z): 464 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.29 (dd, J=12.4, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.62 (dt, J=13.1, 4.2 Hz, 2H), 3.51-3.36 (m, 2H), 2.35 (s, 3H), 1.62 (t, J=7.2 Hz, 6H), 1.54-1.46 (m, 2H), 1.40 (q, J=7.5 Hz, 2H), 0.88 (t, J=7.4 Hz, 3H).


Example 154: Synthesis of Compound 405
Synthesis of Intermediate C193



embedded image


A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (35 mg, 0.097 mmol, 1 equiv), 6-chloro-2,4-dimethyl-[1,3]oxazolo[4,5-c]pyridine (21.34 mg, 0.116 mmol, 1.2 equiv), Pd2(dba)3 (8.92 mg, 0.010 mmol, 0.1 equiv), BINAP (12.13 mg, 0.019 mmol, 0.2 equiv) and tert-butoxysodium (28.08 mg, 0.291 mmol, 3 equiv) in dioxane (1 mL) was stirred for 3 hr at 80° C. under nitrogen atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA=3:1 to afford tert-butyl 4-[7-({2,4-dimethyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C193, 28 mg, 56%) as a solid. LCMS (ES, m/z): 524 [M+H]+


Synthesis of Compound 405



embedded image


A solution of tert-butyl 4-[7-({2,4-dimethyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (28 mg, 0.055 mmol, 1 equiv) in DCM (1 mL) was treated with DIEA (85.90 mg, 0.660 mmol, 12 equiv) and trimethylsilyl triflate (123.09 mg, 0.550 mmol, 10 equiv) for 1 h at room temperature. The mixture was basified to pH 9 with NaHCO3. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 1) to afford N-{2,4-dimethyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 405, 7.3 mg, 32%) as a solid. LCMS (ES, m/z): 406 [M+H] 1H NMR (300 MHz, DMSO-d6) δ 11.60 (s, 1H), 8.82 (s, 1H), 8.45 (s, 1H), 8.05 (d, J=8.1 Hz, 1H), 6.51 (d, J=8.3 Hz, 1H), 4.28 (s, 3H), 3.42-3.37 (m, 4H), 2.93 (t, J=5.0 Hz, 4H), 2.66 (s, 3H), 2.64 (s, 3H).


Example 155: Synthesis of Compound 406
Synthesis of Intermediate C194



embedded image


A solution of (6-bromo-4-fluoro-1,3-benzoxazol-2-yl)methyl acetate (100 mg, 0.347 mmol, 1 equiv), tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (149.73 mg, 0.416 mmol, 1.2 equiv), Pd2(dba)3 (31.79 mg, 0.035 mmol, 0.1 equiv), Xantphos (40.17 mg, 0.069 mmol, 0.2 equiv) and caesio methaneperoxoate caesium (340.36 mg, 1.041 mmol, 3 equiv) in dioxane (2 mL) was stirred for 4 hr at 80° C. under nitrogen atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA=3:1 to afford tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-1,3-benzoxazol-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C194, 83 mg, 42%) as a solid. LCMS (ES, m/z): 567 [M+H]+


Synthesis of Intermediate C195



embedded image


A solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-1,3-benzoxazol-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (63 mg, 0.111 mmol, 1 equiv) in methanol (2 mL) was treated with potassium methaneperoxoate potassium (46.44 mg, 0.333 mmol, 3 equiv) for 2 hr at room temperature. The resulting mixture was filtered, the filter cake was washed with DCM. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA=1:1 to afford tert-butyl 4-(7-{[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (C195, 42 mg, 72%) as a solid. LCMS (ES, m/z): 525 [M+H]+


Synthesis of Compound 406



embedded image


A solution of tert-butyl 4-(7-{[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (42 mg, 0.080 mmol, 1 equiv) in DCM (1 mL) was treated with DIEA (124.18 mg, 0.960 mmol, 12 equiv), trimethylsilyl triflate (177.95 mg, 0.800 mmol, 10 equiv) for 1 hr at room temperature. The mixture was basified to pH 9 with NaHCO3. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 1) to afford N-[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 406, 8.1 mg, 23%) as a solid. LCMS (ES, m/z): 425 [M+H]+1H NMR (300 MHz, DMSO-d6) δ 11.47 (s, 1H), 8.80 (s, 1H), 8.19 (d, J=1.6 Hz, 1H), 8.00 (d, J=8.1 Hz, 1H), 7.66 (dd, J=12.1, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 5.95 (s, 1H), 4.71 (s, 2H), 4.30 (s, 3H), 2.91 (t, J=5.0 Hz, 4H), 2.51 (t, J=3.7 Hz, 4H).


Example 156: Synthesis of Compounds 407 and 408
Synthesis of Intermediate C196



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpyrrolidin-3-amine (25 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) were added Cs2CO3 (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 2) to afford 4-[3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (70 mg, 71%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.88 (s, 1H), 7.98-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 6.05 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.81 (dt, J=19.0, 9.0 Hz, 2H), 3.65 (q, J=9.5, 9.0 Hz, 1H), 3.46 (t, J=9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J=11.6, 10.7 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Synthesis of Compounds 407 and 408



embedded image


C196 was separated by Prep-Chiral-HPLC (Condition 4, Gradient 1) to afford (R)-4-(3-(dimethylamino)pyrrolidin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 407, 23.9 mg, 36%) as a white solid and (S)-4-(3-(dimethylamino)pyrrolidin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 408, 25.7 mg, 39%) as a solid.













Compound



No.
Analysis Data







407
LCMS (ES, m/z): 450 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.88 (s,




1H), 7.98-7.86 (m, 2H), 7.27 (dd, J = 12.4, 1.7 Hz, 1H), 6.05 (d, J = 8.4 Hz, 1H), 4.57



(q, J = 7.3 Hz, 2H), 3.81 (dt, J = 19.0, 9.0 Hz, 2H), 3.65 (q, J = 9.5, 9.0 Hz, 1H), 3.46



(t, J = 9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J =



11.6, 10.7 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).


408
LCMS (ES, m/z): 450 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.88 (s,




1H), 7.98-7.86 (m, 2H), 7.27 (dd, J = 12.4, 1.7 Hz, 1H), 6.05 (d, J = 8.4 Hz, 1H), 4.57



(q, J = 7.3 Hz, 2H), 3.81 (dt, J = 19.0, 9.0 Hz, 2H), 3.65 (q, J = 9.5, 9.0 Hz, 1H), 3.46



(t, J = 9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J =



11.6, 10.7 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).









Example 157: Synthesis of Compounds 398, 409, and 410
Synthesis of Intermediate C197



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (190 mg, 0.456 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3-yl)carbamate (103 mg, 0.456 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (446 mg, 1.368 mmol, 3 equiv), RuPhos (43 mg, 0.091 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (21 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (C197, 200 mg, 78%) as a solid. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 398



embedded image


A solution of tert-butyl N-cyclopropyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (90 mg, 0.160 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 10, Gradient 4) to afford 4-[3-(cyclopropylamino)pyrrolidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 398, 60 mg, 81.13%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.04 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.97-7.85 (m, 2H), 7.25 (dd, J=12.4, 1.7 Hz, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.77 (dd, J=12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71 (m, 1H) 2.35 (s, 3H), 2.17 (td, J=7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J=12.3, 6.2 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H), 0.42 (d, J=6.6 Hz, 2H), 0.25 (dq, J=9.7, 6.2, 4.7 Hz, 2H).


Synthesis of Compounds 409 and 410



embedded image


Compound 398 was chiral-separation by Prep-Chiral-HPLC (Condition 5, Gradient 1) to afford (R)-4-(3-(cyclopropylamino)pyrrolidin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 409, 20 mg, 35%) as a solid and (S)-4-(3-(cyclopropylamino)pyrrolidin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (Compound 410, 18 mg, 31%) as a solid.













Compound No.
Analysis Data







409
LCMS (ES, m/z): 462 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.04 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.83 (s,




1H), 7.97-7.85 (m, 2H), 7.25 (dd, J = 12.4, 1.7 Hz, 1H), 6.00 (d, J = 8.4 Hz, 1H),



4.57 (q, J = 7.3 Hz, 2H), 3.77 (dd, J = 12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71



(m, 1H)2.35 (s, 3H), 2.17 (td, J = 7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J = 12.3, 6.2 Hz,



1H), 1.61 (t, J = 7.2 Hz, 3H), 0.42 (d, J = 6.6 Hz, 2H), 0.25 (dq, J = 9.7, 6.2, 4.7 Hz,



2H).


410
LCMS (ES, m/z): 462 [M + H]+




1H NMR (300 MHz, DMSO-d6) δ 11.04 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.83 (s,




1H), 7.97-7.85 (m, 2H), 7.25 (dd, J = 12.4, 1.7 Hz, 1H), 6.00 (d, J = 8.4 Hz, 1H),



4.57 (q, J = 7.3 Hz, 2H), 3.77 (dd, J = 12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71



(m, 1H)2.35 (s, 3H), 2.17 (td, J = 7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J = 12.3, 6.2 Hz,



1H), 1.61 (t, J = 7.2 Hz, 3H), 0.42 (d, J = 6.6 Hz, 2H), 0.25 (dq, J = 9.7, 6.2, 4.7 Hz,



2H).









Example 158: Synthesis of Compounds 411 and 412
Synthesis of Intermediate C198



embedded image


To a stirred solution of ethanamine hydrochloride (22.32 g, 273.672 mmol, 3 equiv) in DCM (300 mL) was added triethyl amine (27.69 g, 273.672 mmol, 3.0 equiv) at room temperature. The mixture was stirred for 10 min at room temperature. To the above mixture was added benzyl 3-oxopyrrolidine-1-carboxylate (20 g, 91.224 mmol, 1.0 equiv), NaBH(OAc)3 (29.00 g, 136.836 mmol, 1.5 equiv) in portions over 10 min at 0° C. The resulting mixture was stirred for additional 16 hr at room temperature. The reaction was quenched with water at 0° C. and diluted with water (200 mL). The resulting mixture was extracted with CH2Cl2 (3×200 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford benzyl 3-(ethylamino)pyrrolidine-1-carboxylate (C198, 47 g, 99%) as an oil. LCMS (ES, m/z): 249 [M+H]


Synthesis of Intermediate C199



embedded image


To a stirred mixture of benzyl 3-(ethylamino)pyrrolidine-1-carboxylate (47.00 g, 189.267 mmol, 1 equiv) in DCM (940 mL) were added Et3N (57.46 g, 567.801 mmol, 3 equiv) and Boc2O (61.96 g, 283.900 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 4 h at room temperature. The resulting mixture was diluted with water (900 mL). The resulting mixture was extracted with CH2Cl2 (3×500 mL). The combined organic layers were washed with water (2×400 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford benzyl 3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidine-1-carboxylate (C199, 27 mg, 40%) as an oil. LCMS (ES, m/z): 349 [M+H]+


Synthesis of Intermediate C200



embedded image


To a solution of benzyl 3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidine-1-carboxylate (10 g, 28.699 mmol, 1 equiv) in methanol (100 mL) was added Pd/C (2 g 20% W) in a pressure tank. The mixture was hydrogenated at room temperature under 30 psi of hydrogen pressure for 16 hr. The resulting mixture was filtered and the precipitated solids was washed with MeOH (3×50 mL). The combined filtrate was concentrated under vacuum to afford tert-butyl N-ethyl-N-(pyrrolidin-3-yl)carbamate (C200, 5.1 g, 82%) as an oil. LCMS (ES, m/z): 214 [M+H]+ Synthesis of Intermediate C201




embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (2.5 g, 9.801 mmol, 1 equiv) and tert-butyl N-ethyl-N-(pyrrolidin-3-yl)carbamate (3.15 g, 14.701 mmol, 1.5 equiv) in toluene (50 mL) were added K2CO3 (4.06 g, 29.403 mmol, 3 equiv) and BINAP (1.22 g, 1.960 mmol, 0.2 equiv) and Pd(AcO)2 (0.22 g, 0.980 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 hr at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidin-1-yl}-2H-indazole-7-carboxylate (C201, 3.2 g, 84%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C202



embedded image


To a stirred mixture of methyl 4-{3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidin-1-yl}-2H-indazole-7-carboxylate (3.2 g, 8.237 mmol, 1 equiv) in THF (32 mL) were added H2O (32 mL) and LiOH·H2O (1.58 g, 65.896 mmol, 8 equiv) at room temperature. The resulting mixture was stirred for 3 hr at 50° C. The mixture was acidified to pH 6 with 1 N of HCl. The resulting mixture was extracted with ethyl acetate (4×40 mL). The combined organic layers were washed with water (3×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert-butoxycarbonyl) (ethyl)amino]pyrrolidin-1-yl}-2H-indazole-7-carboxylic acid (C202, 2.48 g, 80%) as a solid. LCMS (ES, m/z): 375 [M+H]+


Synthesis of Intermediate C203



embedded image


To a stirred mixture of 4-{3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidin-1-yl}-2H-indazole-7-carboxylic acid (1.8 g, 4.807 mmol, 1.00 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (0.95 g, 5.768 mmol, 1.2 equiv) in pyridine (36 mL) was added EDCI (1.38 g, 7.211 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was diluted with water (60 mL). The resulting mixture was extracted with ethyl acetate (3×60 mL). The combined organic layers were washed with water (3×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]pyrrolidin-3-yl}carbamate (C203, 420 mg, 16%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Intermediate C203



embedded image


To a stirred mixture of tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]pyrrolidin-3-yl}carbamate (400 mg, 0.767 mmol, 1 equiv) and 2-bromoethyl methyl ether (159.88 mg, 1.151 mmol, 1.5 equiv) in DMF (8 mL, 103.372 mmol, 134.80 equiv) was added Cs2CO3 (749.59 mg, 2.301 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with water (3×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (210 mg, 47.24%) as a solid. LCMS (ES, m/z): 580[M+H]+


Synthesis of Intermediates C204 and C205



embedded image


Intermediate C203 was separated by Chiral-Prep HPLC (Condition 4, Gradient 1) to yield intermediates C204 and C205.
















Intermediate No.
Analysis Data









C204
RT = 8.054 min on chiral-HPLC




LCMS (ES, m/z): 422 [M + H]+



C205
RT = 9.404 min on chiral-HPLC




LCMS (ES, m/z): 422 [M + H]+










Synthesis of Compound 412



embedded image


To a stirred mixture of tert-butyl N-ethyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl]carbamate (65 mg, 0.112 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.4 mL) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-(ethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (Compound 412, 23.8 mg, 44%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.82 (s, 1H), 7.94 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.28 (dd, J=12.4, 1.7 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.71 (t, J=5.2 Hz, 2H), 3.94 (t, J=5.2 Hz, 2H), 3.83-3.73 (m, 2H), 3.64 (d, J=8.0 Hz, 1H), 3.52-3.42 (m, 2H), 3.32 (s, 3H), 2.65 (q, J=7.0 Hz, 2H), 2.35 (s, 3H), 2.18 (dd, J=12.6, 6.3 Hz, 1H), 1.93 (dt, J=12.3, 6.3 Hz, 1H), 1.06 (t, J=7.1 Hz, 3H).


Synthesis of Compound 411



embedded image


To a stirred mixture of tert-butyl N-ethyl-N-[(3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl]carbamate (70 mg, 0.121 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.4 mL) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3S)-3-(ethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl) indazole-7-carboxamide (Compound 411, 28.4 mg, 49%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.82 (s, 1H), 7.94 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.0 Hz, 1H), 7.28 (dd, J=12.4, 1.7 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.71 (t, J=5.2 Hz, 2H), 3.94 (t, J=5.2 Hz, 2H), 3.83-3.73 (m, 2H), 3.64 (d, J=8.2 Hz, 1H), 3.50-3.40 (m, 2H), 3.32 (s, 3H), 2.68-2.58 (m, 2H), 2.35 (s, 3H), 2.17 (dt, J=12.7, 6.1 Hz, 1H), 1.92 (dd, J=12.1, 6.4 Hz, 1H), 1.05 (t, J=7.1 Hz, 3H).


Example 159: Synthesis of Compound 413
Synthesis of Intermediate C206



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2-bromoacetonitrile (36.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs2CO3 (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-(cyanomethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C206, 56 mg, 51%) as a solid. LCMS (ES, m/z): 533 [M+H]+ Synthesis of Compound 413




embedded image


A solution of tert-butyl 4-[2-(cyanomethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (56.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 6) to afford 2-(cyanomethyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 413, 6.1 mg, 13%) as a solid. LCMS (ES, m/z): 433 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.94 (s, 1H), 9.26 (s, 1H), 9.01 (s, 1H), 8.03 (s, 1H), 7.92 (s, 1H), 7.27 (s, 1H), 6.54 (s, 1H), 5.94 (s, 2H), 3.33-3.32 (m, 4H), 2.92-2.94 (m, 4H), 2.35 (s, 3H).


Example 160: Synthesis of Compound 414
Synthesis of Intermediate C207



embedded image


To a stirred mixture of methyl 3-hydroxybicyclo[1.1.1]pentane-1-carboxylate (500.0 mg, 3.51 mmol, 1.0 equiv) and imidazole (478.9 mg, 7.03 mmol, 2.0 equiv) in DMF (5 mL) was added TBSCl (636.1 mg, 4.22 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for overnight at room temperature. The reaction was monitored by TLC. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification to afford methyl 3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentane-1-carboxylate (C207, 900 mg, 99%) as a solid. 1H NMR (400 MHz, Chloroform-d) δ 3.69 (s, 3H), 2.22 (s, 6H), 0.90 (s, 9H), 0.12 (s, 6H).


Synthesis of Intermediate C208



embedded image


To a stirred solution of LiAlH4 (266.4 mg, 7.02 mmol, 2.0 equiv) in THF (9 mL) was added methyl 3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentane-1-carboxylate (900 mg, 3.51 mmol, 1.0 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0° C. under nitrogen atmosphere. The reaction was quenched with water (0.3 mL) and NaOH (15%) (0.3 mL) at 0° C. The resulting mixture was dried over anhydrous MgSO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification to afford {3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methanol (C208, 700 mg, 87%) as a oil. 1H NMR (400 MHz, Chloroform-d) δ 3.76 (s, 2H), 1.88 (s, 6H), 0.91 (s, 8H), 0.12 (s, 6H).


Synthesis of Intermediate C209



embedded image


To a stirred mixture of {3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methanol (300 mg, 1.31 mmol, 1.0 equiv) and Et3N (199.3 mg, 1.97 mmol, 1.5 equiv) in DCM (3 mL) was added MsCl (165.4 mg, 1.44 mmol, 1.1 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at room temperature under nitrogen atmosphere. The reaction was quenched with water. The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford {3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methyl methanesulfonate (C209, 235 mg, 58%) as a colorless oil without further purification.


Synthesis of Intermediate C210



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (235.0 mg, 0.476 mmol, 1.0 equiv) and {3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methyl methanesulfonate (175.1 mg, 0.57 mmol, 1.2 equiv) in DMF (1.5 mL) was added Cs2CO3 (465.4 mg, 1.42 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 hr at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-({3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate hydrofluoride (C210, 130 mg, 37%) as a solid. LCMS (ES, m/z): 704 [M+H]+


Synthesis of Compound 414



embedded image


A solution of tert-butyl 4-[2-({3-[(tert-butyldimethylsilyl)oxy]bicyclo[1.1.1]pentan-1-yl}methyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (130 mg, 0.18 mmol, 1.0 equiv) in DCM (1 mL) was treated with TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-({3-hydroxybicyclo[1.1.1]pentan-1-yl}methyl)-4-(piperazin-1-yl) indazole-7-carboxamide 2,2,2-trifluoroacetate (Compound 414, 52 mg, 46%) as a solid. LCMS (ES, m/z): 490 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.35 (s, 1H), 9.48 (d, J=1.5 Hz, 1H), 8.97 (s, 2H), 8.89 (s, 1H), 8.18 (dd, J=2.6, 1.2 Hz, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.66 (d, J=11.6 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.79 (s, 2H), 3.61 (t, J=5.1 Hz, 4H), 3.37-3.35 (m 4H), 2.45 (d, J=1.0 Hz, 3H), 1.80 (s, 6H).


Example 161: Synthesis of Compound 415



embedded image


To a stirred solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2-(hydroxymethyl)piperazine-1-carboxylate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added DAST (60 mg, 0.372 mmol, 2.05 equiv) dropwise at −78° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The mixture was basified to pH 8 with NaHCO3 aq. The resulting mixture was extracted with EA (3×5 mL). The combined organic layers were washed with NaCl (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-{3-oxo-tetrahydro-1H-[1,3]oxazolo[3,4-a]pyrazin-7-yl}indazole-7-carboxamide (Compound 415, 20 mg, 23%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.22 (d, J=1.6 Hz, 1H), 8.88 (s, 1H), 8.00 (d, J=8.0 Hz, 1H), 7.91 (dd, J=3.2, 1.0 Hz, 1H), 7.32 (dd, J=12.4, 1.7 Hz, 1H), 6.59 (d, J=8.1 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 4.47 (t, J=7.9 Hz, 1H), 4.20-4.01 (m, 3H), 3.89 (d, J=12.5 Hz, 1H), 3.79-3.68 (m, 1H), 3.02-2.82 (m, 2H), 2.36 (d, J=0.8 Hz, 3H), 1.64 (t, J=7.3 Hz, 3H).


Example 162: Synthesis of Compound 416
Synthesis of Intermediate 211



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (200.0 mg, 0.40 mmol, 1.0 equiv) and 2-bromo-1-propene (73.5 mg, 0.60 mmol, 1.5 equiv) in DMF (4 mL) were added CS2CO3 (396.1 mg, 1.21 mmol, 3.0 equiv), (1R,2R)-cyclohexane-1,2-diamine (9.2 mg, 0.08 mmol, 0.2 equiv) and CuI (7.7 mg, 0.04 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 hr at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water and extracted with ethyl acetate (3×20 mL). The combined organic layers were washed with water (1×10 mL), brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-1-(prop-1-en-2-yl) indazol-4-yl]piperazine-1-carboxylate (C211, 108 mg, 49%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 416



embedded image


To a stirred mixture of tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-1-(prop-1-en-2-yl)-1H-indazol-4-yl)piperazine-1-carboxylate (65.0 mg, 0.122 mmol, 1.0 equiv) in DCM (2 mL) were added ZnBr2 (270.7 mg, 1.220 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 7) to afford N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(piperazin-1-yl)-1-(prop-1-en-2-yl)-1H-indazole-7-carboxamide (Compound 416, 27.4 mg, 51%) as a solid. LCMS (ES, m/z): 434 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.42 (s, 1H), 9.08 (d, J=1.6 Hz, 1H), 8.35 (s, 1H), 7.95 (d, J=3.0 Hz, 1H), 7.49 (d, J=7.9 Hz, 1H), 7.14 (dd, J=12.6, 1.6 Hz, 1H), 6.61 (d, J=7.9 Hz, 1H), 5.01 (d, J=1.6 Hz, 1H), 4.77 (s, 1H), 3.27 (t, J=4.9 Hz, 1H), 2.94 (t, J=4.8 Hz, 4H), 2.34 (s, 3H), 2.23 (s, 3H).


Example 163: Synthesis of Compound 417
Synthesis of Intermediate C212



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (1.5 g, 5.574 mmol, 1 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (1.34 g, 6.689 mmol, 1.2 equiv) in dioxane (30 mL) were added Cs2CO3 (5.45 g, 16.722 mmol, 3 equiv) and RuPhos (0.52 g, 1.115 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (0.47 g, 0.557 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (C212, 2.45 g, 113%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C213



embedded image


To a stirred mixture of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-methylindazole-7-carboxylate (2.4 g, 6.178 mmol, 1 equiv) in NH3(g) (7 M in MeOH) (200 mL) at room temperature. The resulting mixture was stirred for 72 hr at sealed 100° C. under NH3 atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (C214, 1.87 g, 62%) as a solid.


LCMS (ES, m/z): 374 [M+H]+


Synthesis of Intermediate C215



embedded image


To a stirred mixture of tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (280.0 mg, 0.577 mmol, 1 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (209.6 mg, 0.865 mmol, 1.5 equiv) in Dioxane (5.39 mL) were added Cs2CO3 (564.3 mg, 1.731 mmol, 3.0 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (lx 5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-{1-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (C215, 170 mg, 55%) as a solid. LCMS (ES, m/z): 535 [M+H]+


Synthesis of Compound 417



embedded image


To a stirred mixture of tert-butyl N-[1-(7-{[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]carbamoyl}-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (160 mg, 0.292 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0° C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 8) to afford N-[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]-2-methyl-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (85 mg, 65%) as a solid. LCMS (ES, m/z): 435 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.20 (s, 1H), 8.99 (s, 1H), 8.83 (s, 1H), 7.95 (d, J=8.3 Hz, 1H), 7.90 (d, J=1.0 Hz, 1H), 6.02 (d, J=8.5 Hz, 1H), 4.24 (s, 3H), 4.10 (s, 3H), 3.80-3.73 (m, 2H), 3.69 (d, J=27.8 Hz, 1H), 3.43 (dd, J=10.2, 4.0 Hz, 1H), 3.32 (s, 1H), 2.34 (d, J=2.8 Hz, 6H), 2.15 (dp, J=13.1, 7.2, 6.5 Hz, 1H), 1.92 (dd, J=12.0, 6.5 Hz, 1H).


Example 164: Synthesis of Compounds 418, 431, and 432
Synthesis of Intermediate C216



embedded image


To a stirred solution/mixture of methyl 4-bromo-2H-indazole-7-carboxylate (3.0 g, 11.761 mmol, 1.0 equiv) and Cs2CO3 (7.6 g, 23.522 mmol, 2.0 equiv) in dimethylformamide (50 mL) were added 2-bromoethyl methyl ether (2.45 g, 17.642 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was diluted with water (50 mL). The resulting mixture was extracted with ethyl acetate (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylate (1.2 g, 29%) as a solid. LCMS (ES, m/z): 313 [M+H]+


Synthesis of Intermediate C217



embedded image


To a solution of methyl 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylate (1.1 g, 3.513 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (1.4 g, 7.026 mmol, 2.0 equiv) in toluene (20 mL) were added potassium methaneperoxoate potassium (0.9 g, 7.026 mmol, 2.0 equiv) and BINAP (0.4 g, 0.703 mmol, 0.2 equiv), Pd(OAc)2 (0.08 g, 0.351 mmol, 0.1 equiv). After stirring for 16 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford methyl 4-{3-[(tert-butoxycarbonyl) (methyl)amino]pyrrolidin-1-yl}-2-(2-methoxyethyl) indazole-7-carboxylate (C217, 1.5 g, 88%) as an oil. LCMS (ES, m/z): 433 [M+H]+


Synthesis of Intermediate C218



embedded image


To a solution of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl}-2-(2-methoxyethyl) indazole-7-carboxylate (500.0 mg, 1.156 mmol, 1.0 equiv) was added NH3(g) in methanol (50 mL) in a pressure tank. The resulting mixture was stirred for 2 days at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl N-{1-[7-carbamoyl-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (C218, 450 mg, 74%) as a solid. LCMS (ES, m/z): 418 [M+H]+


Synthesis of Intermediate C219



embedded image


To a solution of tert-butyl N-{1-[7-carbamoyl-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (200.0 mg, 0.479 mmol, 1.0 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (150.7 mg, 0.623 mmol, 1.3 equiv) in dioxane (5 mL) were added caesio methaneperoxoate caesium (391.4 mg, 1.198 mmol, 2.5 equiv) and Pd2(dba)3 (43.8 mg, 0.048 mmol, 0.1 equiv), Xantphos (55.4 mg, 0.096 mmol, 0.2 equiv). After stirring for 3 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (40:1) to afford tert-butyl N-{1-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (C219, 200 mg, 57%) as a solid. LCMS (ES, m/z): 579 [M+H]+


Synthesis of Compound 418



embedded image


To a stirred solution/mixture of tert-butyl N-{1-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (180.0 mg, 0.311 mmol, 1.0 equiv) in DCM (2 mL) were added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 3, Gradient 1) to afford N-{8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-(2-methoxyethyl)-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (Compound 418, 50 mg, 32%) as a solid. LCMS (ES, m/z): 479 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 8.98 (s, 1H), 8.86 (s, 1H), 7.96 (d, J=8.3 Hz, 1H), 7.91 (d, J=1.0 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.66 (t, J=5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J=5.3 Hz, 2H), 3.81-3.74 (m, 2H), 3.67-3.64 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J=19.5 Hz, 6H), 2.24-2.14 (m, 1H), 1.97-1.95 (m, 1H).


Synthesis of Compound 431



embedded image


Compound 418 was separated by prep-chiral-HPLC (Condition 2, Gradient 2) to yield (R)—N-(8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl)-2-(2-methoxyethyl)-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (Compound 431, 5.7 mg, 13%) as a solid. LCMS (ES, m/z): 479 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 8.98 (s, 1H), 8.86 (s, 1H), 7.96 (d, J=8.3 Hz, 1H), 7.91 (d, J=1.0 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.66 (t, J=5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J=5.3 Hz, 2H), 3.80-3.75 (m, 2H), 3.67-3.65 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J=19.5 Hz, 6H), 2.24-2.14 (m, 1H), 1.97-1.88 (m, 1H).


Synthesis of Compound 432



embedded image


Compound 418 was separated by prep-chiral-HPLC (Condition 2, Gradient 2) to yield (S)—N-(8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl)-2-(2-methoxyethyl)-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (Compound 432, 6.7 mg, 15%) as a solid. LCMS (ES, m/z): 479 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 8.98 (s, 1H), 8.86 (s, 1H), 7.96 (d, J=8.3 Hz, 1H), 7.91 (d, J=1.0 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.66 (t, J=5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J=5.3 Hz, 2H), 3.84-3.78 (m, 2H), 3.67-3.65 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J=19.5 Hz, 6H), 2.24-2.14 (m, 1H), 1.97-1.95 (m, 1H).


Example 165: Synthesis of Compound 419
Synthesis of Intermediate C220



embedded image


To a stirred mixture of 3,5-dibromopyrazin-2-amine (10.00 g, 39.542 mmol, 1 equiv) and Dimethylamine hydrochloride (3.55 g, 43.496 mmol, 1.1 equiv) in DMSO (100 mL) was added DIEA (15.33 g, 118.626 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at 110° C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (3×200 mL). The combined organic layers were washed with water (2×200 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford 6-bromo-N2, N2-dimethylpyrazine-2,3-diamine (C220, 6.5 g, 75%) as a solid. LCMS (ES, m/z): 217 [M+H]+


Synthesis of Intermediate C221



embedded image


To a stirred mixture of 6-bromo-N2,N2-dimethylpyrazine-2,3-diamine (6.50 g, 29.944 mmol, 1 equiv) and 1-bromo-1,1-dimethoxyethane (6.07 g, 35.933 mmol, 1.2 equiv) in i-PrOH (130 mL) was added PPTS (0.75 g, 2.994 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 16 hr at 80° C. The mixture was allowed to cool down to room temperature. The resulting mixture was filtered and the filter cake was washed with i-PrOH (3×100 mL). The filter cake was dried to afford 6-bromo-N,N,2-trimethylimidazo[1,2-a]pyrazin-8-amine (C221, 5.1 g, 66%) as a solid. LCMS (ES, m/z): 255 [M+H]+


Synthesis of Intermediate C222



embedded image


To a stirred mixture of tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (280.0 mg, 0.577 mmol, 1.0 equiv) and 6-bromo-N,N,2-trimethylimidazo[1,2-a]pyrazin-8-amine (220.9 mg, 0.865 mmol, 1.5 equiv) in dioxane (6 mL) were added Cs2CO3 (564.3 mg, 1.731 mmol, 3 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[1-(7-{[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]carbamoyl}-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (C222, 170 mg, 53%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 419



embedded image


To a stirred mixture of tert-butyl N-[1-(7-{[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]carbamoyl}-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (160 mg, 0.292 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0° C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]-2-methyl-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (Compound 419, 85 mg, 65%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.06 (s, 1H), 8.81 (s, 1H), 8.62 (s, 1H), 7.92 (d, J=8.3 Hz, 1H), 7.73 (d, J=1.0 Hz, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.22 (s, 3H), 3.75 (dq, J=22.4, 7.9, 6.9 Hz, 2H), 3.64 (q, J=8.4, 7.8 Hz, 1H), 3.53 (s, 6H), 3.42 (dd, J=9.9, 4.1 Hz, 1H), 3.35 (d, J=5.5 Hz, 1H), 2.33 (d, J=10.7 Hz, 6H), 2.14 (dt, J=13.0, 6.5 Hz, 1H), 1.92 (dt, J=11.6, 5.8 Hz, 1H).


Example 166: Synthesis of Compound 421
Synthesis of Intermediate C223



embedded image


A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv), 5-chloro-2,7-dimethylpyrazolo[1,5-a]pyrimidine (36.38 mg, 0.200 mmol, 1.2 equiv), Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv), XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Cs2CO3 (163.17 mg, 0.501 mmol, 3 equiv) in dioxane (2 mL) was stirred for 4 h at 80° C. under N2 atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA=5:1 to afford tert-butyl 4-[7-({2,7-dimethylpyrazolo[1,5-a]pyrimidin-5-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C223, 47 mg, 55%) as a solid. LCMS (ES, m/z): 505 [M+H]+


Synthesis of Compound 421



embedded image


A solution of tert-butyl 4-[7-({2,7-dimethylpyrazolo[1,5-a]pyrimidin-5-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (47 mg, 0.093 mmol, 1 equiv) in HCl (gas) in 1,4-dioxane (1 mL) for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 2) to afford N-{2,7-dimethylpyrazolo[1,5-a]pyrimidin-5-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (C224, 18 mg, 47%) as a solid. LCMS (ES, m/z): 405 [M+H]+1H NMR (300 MHz, Methanol-d4) δ 8.54 (s, 1H), 8.13 (d, J=8.2 Hz, 1H), 7.78 (s, 1H), 6.54 (d, J=8.2 Hz, 1H), 6.29 (s, 1H), 4.38 (s, 3H), 3.58-3.49 (m, 4H), 3.09 (t, J=5.0 Hz, 4H), 2.57 (d, J=6.3 Hz, 6H).


Example 167: Synthesis of Compound 422
Synthesis of Intermediate C224



embedded image


To a mixture of tert-butyl 1,7-diazaspiro[3.5]nonane-7-carboxylate (210 mg, 0.928 mmol, 1 equiv) and HCHO (55.72 mg, 1.856 mmol, 2 equiv) in EtOH/MeCN (2:1) (5 ml) was added Pd/C (100 mg, 0.094 mmol, 0.10 equiv, 10%) under nitrogen atmosphere in a 50 mL round-bottom flask. The mixture was hydrogenated at room temperature overnight under hydrogen atmosphere using a hydrogen balloon, filtered through filter paper and concentrated under reduced pressure to afford tert-butyl 1-methyl-1,7-diazaspiro[3.5]nonane-7-carboxylate (C224, 65 mg, 29%) as an oil. LCMS (ES, m/z): 241 [M+H]+


Synthesis of Intermediate C225



embedded image


To a stirred solution of tert-butyl 1-methyl-1,7-diazaspiro[3.5]nonane-7-carboxylate (35 mg, 0.146 mmol, 1 equiv) in DCM (0.5 mL) was added TFA (0.5 mL, 6.732 mmol, 46.23 equiv) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 141 [M+H]+


Synthesis of Compound 422



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (65 mg, 0.162 mmol, 1 equiv) and Intermediate C225 (27.19 mg, 0.194 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs2CO3 (157.96 mg, 0.486 mmol, 3 equiv), RuPhos (15.08 mg, 0.032 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (13.52 mg, 0.016 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 15, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-{1-methyl-1,7-diazaspiro[3.5]nonan-7-yl}indazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 422, 1.9 mg, 10%) as a solid. LCMS (ES, m/z): 462 [M+H]+1H NMR (400 MHz, Methanol-d4) δ 9.47 (d, J=1.5 Hz, 1H), 8.59 (s, 1H), 8.14 (d, J=8.1 Hz, 1H), 8.07-8.02 (m, 1H), 7.92 (dd, J=11.5, 1.5 Hz, 1H), 6.63 (d, J=8.1 Hz, 1H), 4.37 (s, 3H), 4.28 (d, J=8.7 Hz, 1H), 4.09 (d, J=12.7 Hz, 1H), 3.98 (t, J=14.2 Hz, 2H), 3.23-3.12 (m, 2H), 2.86 (s, 3H), 2.61 (t, J=8.2 Hz, 2H), 2.57 (d, J=1.0 Hz, 3H), 2.44 (d, J=12.3 Hz, 1H), 2.31 (d, J=13.1 Hz, 3H).


Example 168: Synthesis of Compound 427
Synthesis of Intermediate C226



embedded image


To a stirred solution of 3-bromobenzene-1,2-diamine (4.0 g, 21.386 mmol, 1.0 equiv) in acetic acid (20 mL) and water (20 mL) were added sodium nitrite (1.6 g, 23.525 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The precipitated solids were collected by filtration and washed with water (2×20 mL). The solid was dried and this resulted in 4-bromo-2H-1,2,3-benzotriazole (C226, 3.2 g, 71%) as a solid. LCMS (ES, m/z): 198 [M+H]+


Synthesis of Intermediate C227



embedded image


To a stirred mixture of 4-bromo-2H-1,2,3-benzotriazole (2.7 g, 13.635 mmol, 1.0 equiv) and K2CO3 (3.76 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0° C. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (2×100 mL). The combined organic layers were washed with water (2×200 mL), brine (1×200 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/PE (5:1) to afford 4-bromo-2-methyl-1,2,3-benzotriazole (C227, 0.9 g, 28%) as a solid. LCMS (ES, m/z): 212 [M+H]+


Synthesis of Intermediate C228



embedded image


To a solution of 4-bromo-2-methyl-1,2,3-benzotriazole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (0.9 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs2CO3 (3.0 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.4 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 hr at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (C228, 1.2 g, 90%) as a solid. LCMS (ES, m/z): 318 [M+H]+


Synthesis of Intermediate C229



embedded image


To a stirred solution of tert-butyl 4-(2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with ethyl acetate (2×40 mL). The combined organic layers were washed with water (2×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(7-bromo-2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (C229, 820.0 mg, 73%) as a solid. LCMS (ES, m/z): 396 [M+H]+


Synthesis of Intermediate C230



embedded image


To a solution of tert-butyl 4-(7-bromo-2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (250.0 mg, 0.631 mmol, 1.0 equiv) in MeOH (20 mL) was added Pd(dppf)Cl2 (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80° C. for 16 h. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford methyl 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-methyl-1,2,3-benzotriazole-4-carboxylate as a solid. LCMS (ES, m/z): 376 [M+H]+


Synthesis of Intermediate C231



embedded image


To a stirred mixture of methyl 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-methyl-1,2,3-benzotriazole-4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOH·H2O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50° C. The resulting mixture was diluted with deionized water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2×30 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-methyl-1,2,3-benzotriazole-4-carboxylic acid (C231, 130 mg, 73%) as a solid. LCMS (ES, m/z): 362 [M+H]+


Synthesis of Intermediate C232



embedded image


To a stirred solution of 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methyl-1,2,3-benzotriazole-4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at room temperature. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with brine (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (C232, 100.0 mg, 58%) as a solid. LCMS (ES, m/z): 509 [M+H]+


Synthesis of Compound 427



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-7-(piperazin-1-yl)-1,2,3-benzotriazole-4-carboxamide (Compound 427, 19.7 mg, 23%) as a solid. LCMS (ES, m/z): 409 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.18 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.00 (d, J=8.3 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.39 (dd, J=12.5, 1.7 Hz, 1H), 6.72 (d, J=8.4 Hz, 1H), 4.61 (s, 3H), 3.72 (t, J=5.0 Hz, 4H), 2.91 (t, J=5.1 Hz, 4H), 2.35 (s, 3H).


Example 169: Synthesis of Compound 428
Synthesis of Intermediate C233



embedded image


To a solution of methyl 3-hydroxy-2-nitrobenzoate (2 g, 10.145 mmol, 1 equiv) in HOAc (40 mL) was added with Br2 (2.4 g, 15.018 mmol, 1.48 equiv) dropwise at 0° C. The resulting was stirred for 12 h at room temperature. The reaction was quenched with aq. Na2S2O3 (50 mL) at room temperature. The resulting mixture was extracted with EA (3×50 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4:1) to afford methyl 4-bromo-3-hydroxy-2-nitrobenzoate (C233, 1 g, 35%) as a solid. LCMS (ES, m/z): 276 [M+H]+


Synthesis of Intermediate C234



embedded image


To a stirred solution of methyl 4-bromo-3-hydroxy-2-nitrobenzoate (1 g, 3.623 mmol, 1 equiv) in THF (15 mL) was added a solution of Na2S2O4 (3.15 g, 18.115 mmol, 5.0 equiv) in H2O (15 mL) dropwise at room temperature. The resulting mixture was stirred at room temperature for 12 h. The resulting mixture was extracted with EA (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4:1) to afford methyl 2-amino-4-bromo-3-hydroxybenzoate (C234, 500 mg, 56%) as a solid. LCMS (ES, m/z): 246 [M+H]+


Synthesis of Intermediate C235



embedded image


A solution of methyl 2-amino-4-bromo-3-hydroxybenzoate (400 mg, 1.626 mmol, 1 equiv) in toluene (25 mL) was treated with AcCl (153 mg, 1.951 mmol, 1.2 equiv), TEA (197.40 mg, 1.951 mmol, 1.2 equiv) and PPTS (122 mg, 0.488 mmol, 0.3 equiv) for 2 hr at 110° C. under nitrogen atmosphere. The resulting mixture was diluted with H2O (10 mL). The resulting mixture was extracted with EA (2×10 mL). The combined organic layers were washed with NaCl (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4:1) to afford methyl 7-bromo-2-methyl-1,3-benzoxazole-4-carboxylate (C235, 280 mg, 63%) as a solid. LCMS (ES, m/z): 270 [M+H]+


Synthesis of Intermediate C236



embedded image


To a solution of methyl 7-bromo-2-methyl-1,3-benzoxazole-4-carboxylate (280 mg, 1.037 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (289 mg, 1.555 mmol, 1.5 equiv) in dioxane (5 mL) were added Cs2CO3 (1.01 g, 3.111 mmol, 3.0 equiv), RuPhos (96 mg, 0.207 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (48 mg, 0.104 mmol, 0.1 equiv). After stirring for 1 hr at 85° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methyl-1,3-benzoxazole-4-carboxylate (C236, 200 mg, 51%) as a solid.


LCMS (ES, m/z): 376 [M+H]+


Synthesis of Intermediate C237



embedded image


A solution of methyl 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methyl-1,3-benzoxazole-4-carboxylate (250 mg, 0.666 mmol, 1 equiv) in MeOH (1 mL) and THF (1 mL) was treated with a solution of LiOH·H2O (167 mg, 3.996 mmol, 6 equiv) in H2O (1 mL) for 1 hr at room temperature. The mixture was acidified to pH 3 with 1 M HCl. The resulting mixture was extracted with EA (2×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methyl-1,3-benzoxazole-4-carboxylic acid (C237, 200 mg, 83%) as a solid. LCMS (ES, m/z): 362 [M+H]+


Synthesis of Intermediate C238



embedded image


To a stirred solution of 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methyl-1,3-benzoxazole-4-carboxylic acid (240 mg, 0.664 mmol, 1 equiv) and HATU (757 mg, 1.992 mmol, 3.0 equiv) in DMF (7 mL) were added DIEA (257 mg, 1.992 mmol, 3.0 equiv) and NH4Cl (355.22 mg, 6.640 mmol, 10 equiv) in portions at room temperature. The resulting mixture was stirred for 12 hr at room temperature. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4-(4-carbamoyl-2-methyl-1,3-benzoxazol-7-yl) piperazine-1-carboxylate (C238, 150 mg, 62%) as a solid. LCMS (ES, m/z): 361 [M+H]+


Synthesis of Intermediate C239



embedded image


To a solution of tert-butyl 4-(4-carbamoyl-2-methyl-1,3-benzoxazol-7-yl)piperazine-1-carboxylate (50 mg, 0.139 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (43 mg, 0.167 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs2CO3 (135 mg, 0.417 mmol, 3.0 equiv), XantPhos (16 mg, 0.028 mmol, 0.2 equiv) and Pd2(dba)3CHCl3 (14 mg, 0.014 mmol, 0.1 equiv). After stirring for 1 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1:1) to afford tert-butyl 4-[4-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-1,3-benzoxazol-7-yl]piperazine-1-carboxylate (C239, 70 mg, 93%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 428



embedded image


A solution of tert-butyl 4-[4-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine-6-yl}carbamoyl)-2-methyl-1,3-benzoxazol-7-yl]piperazine-1-carboxylate (60 mg, 0.111 mmol, 1 equiv) and TFA (0.3 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford N-{8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-7-(piperazin-1-yl)-1,3-benzoxazole-4-carboxamide (Compound 428, 14 mg, 28%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.32 (s, 1H), 9.43 (s, 1H), 7.92 (d, J=8.6 Hz, 1H), 7.80 (d, J=3.1 Hz, 1H), 6.95 (d, J=8.8 Hz, 1H), 4.20 (d, J=2.0 Hz, 3H), 3.48-3.39 (m, 4H), 2.90 (t, J=5.0 Hz, 4H), 2.80 (s, 3H), 2.32 (s, 3H).


Example 170: Synthesis of Compound 429
Synthesis of Intermediate C240



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl (R)-2-(hydroxymethyl)piperazine-1-carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs2CO3 (2.35 g, 7.206 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90° C. under a nitrogen atmosphere. The resulting mixture was diluted with H2O (20 mL). The resulting mixture was extracted with EA (3×20 mL). The combined organic layers were washed with NaCl (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-1-carboxylate (C240, 500 mg, 37%) as a solid. LCMS (ES, m/z): 552 [M+H]


Synthesis of Intermediate C241



embedded image


A solution of tert-butyl (R)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-1-carboxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 6) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(3-(hydroxymethyl)piperazin-1-yl)-2H-indazole-7-carboxamide (Compound 429, 10 mg, 24%) as a solid. LCMS (ES, m/z): 452 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (dd, J=3.2, 1.0 Hz, 1H), 7.31 (dd, J=12.3, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.79 (d, J=10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J=10.3, 9.3 Hz, 3H), 2.77-2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J=7.3 Hz, 3H).


Example 171: Synthesis of Compound 430
Synthesis of Intermediate C241



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl (S)-2-(hydroxymethyl)piperazine-1-carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs2CO3 (2.35 g, 7.206 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90° C. under a nitrogen atmosphere. The resulting mixture was diluted with H2O (20 mL). The resulting mixture was extracted with EA (3×20 mL). The combined organic layers were washed with NaCl (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (S)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-1-carboxylate (500 mg, 37.73%) as a solid. LCMS (ES, m/z): 552 [M+H]


Synthesis of Compound 430



embedded image


A solution of tert-butyl (S)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-1-carboxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford (S)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(3-(hydroxymethyl)piperazin-1-yl)-2H-indazole-7-carboxamide (Compound 430, 11 mg, 25%) as a solid. LCMS (ES, m/z): 452 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (dd, J=3.2, 1.0 Hz, 1H), 7.31 (dd, J=12.3, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.79 (d, J=10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J=10.3, 9.3 Hz, 3H), 2.77-2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J=7.3 Hz, 3H).


Example 172: Synthesis of Compound 469
Synthesis of Intermediate C242



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (R)-methyl(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H2O (20 mL) and extracted with ethyl acetate (3×10 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (C242, 160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 469



embedded image


A solution of tert-butyl tert-butyl (R)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (Compound 469, 12 mg, 10%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.97-7.85 (m, 2H), 7.26 (dd, J=12.4, 1.6 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.76 (dq, J=13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J=7.4 Hz, 3H), 3.42 (dd, J=10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J=11.2, 4.5 Hz, 1H), 1.92 (dd, J=11.8, 6.1 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Example 173: Synthesis of Compound 437
Synthesis of Intermediate C243



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (S)-methyl(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H2O (20 mL) and extracted with ethyl acetate (3×10 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (S)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (C243, 160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 437



embedded image


A solution of tert-butyl tert-butyl (S)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (S)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (Compound 437, 13 mg, 11%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.97-7.85 (m, 2H), 7.26 (dd, J=12.4, 1.6 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.76 (dq, J=13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J=7.4 Hz, 3H), 3.42 (dd, J=10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J=11.2, 4.5 Hz, 1H), 1.92 (dd, J=11.8, 6.1 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Example 174: Synthesis of Compounds 438 and 439
Synthesis of Compound 439



embedded image


Compound 367 was separated by prep-chiral-HPLC (Condition 6, Gradient 1) to afford (S)—N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxypropyl)-4-(piperazin-1-yl)-2H-indazole-7-carboxamide (Compound 438, 1.7 mg) as a solid. LCMS (ES, m/z): 466 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.10 (d, J=1.7 Hz, 1H), 8.52 (s, 1H), 8.11 (d, J=8.0 Hz, 1H), 7.73 (d, J=3.0 Hz, 1H), 7.26 (dd, J=11.8, 1.7 Hz, 1H), 6.55 (d, J=8.2 Hz, 1H), 4.72-4.33 (m, 2H), 4.02 (qd, J=6.5, 3.7 Hz, 1H), 3.46 (dd, J=6.3, 3.7 Hz, 4H), 3.33 (p, J=1.6 Hz, 3H), 3.08 (dd, J=6.1, 3.6 Hz, 4H), 2.44 (s, 3H), 1.29 (d, J=6.3 Hz, 3H).


Synthesis of Compound 438



embedded image


Compound 367 (17 mg) was separated by prep-chiral-HPLC (Condition 6, Gradient 1) to afford (R)—N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxypropyl)-4-(piperazin-1-yl)-2H-indazole-7-carboxamide (Compound 438, 1.2 mg) as a solid. LCMS (ES, m/z): 466 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.10 (d, J=1.7 Hz, 1H), 8.52 (s, 1H), 8.11 (d, J=8.0 Hz, 1H), 7.73 (d, J=3.0 Hz, 1H), 7.26 (dd, J=11.8, 1.7 Hz, 1H), 6.55 (d, J=8.2 Hz, 1H), 4.72-4.33 (m, 2H), 4.02 (qd, J=6.5, 3.7 Hz, 1H), 3.46 (dd, J=6.3, 3.7 Hz, 4H), 3.33 (p, J=1.6 Hz, 3H), 3.08 (dd, J=6.1, 3.6 Hz, 4H), 2.44 (s, 3H), 1.29 (d, J=6.3 Hz, 3H).


Example 175: Synthesis of Compound 443
Synthesis of Intermediate C244



embedded image


To a solution of methyl 4-bromo-2-methylindazole-7-carboxylate (300.0 mg, 1.115 mmol, 1.0 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl) carbamate (305.4 mg, 1.338 mmol, 1.2 equiv) in dioxane (10 mL) were added Cs2CO3 (910.9 mg, 2.788 mmol, 2.5 equiv) and Ruphos (104.0 mg, 0.223 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (93.2 mg, 0.112 mmol, 0.1 equiv). After stirring for 3 h at 80° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford methyl 4-{4-[(tert-butoxycarbonyl) (ethyl)amino] piperidin-1-yl}-2-methylindazole-7-carboxylate (C244, 320 mg, 63%) as a solid. LCMS (ES, m/z): 417 [M+H]+


Synthesis of Intermediate C245



embedded image


To a solution of methyl 4-{4-[(tert-butoxycarbonyl) (ethyl)amino] piperidin-1-yl}-2-methylindazole-7-carboxylate (300.0 mg, 0.720 mmol, 1.0 equiv) was added NH3(g) in MeOH (50 mL) in a pressure tank. The resulting mixture was stirred for 2 days at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl) piperidin-4-yl]-N-ethylcarbamate (C245, 280 mg, 87%) as a solid. LCMS (ES, m/z): 402 [M+H]+


Synthesis of Intermediate C246



embedded image


To a solution of tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl) piperidin-4-yl]-N-ethylcarbamate (130.0 mg, 0.324 mmol, 1.0 equiv) and 6-bromo-4-fluoro-2-methyl-1,3-benzothiazole (95.6 mg, 0.389 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs2CO3 (264.5 mg, 0.810 mmol, 2.5 equiv) and Xantphos (37.4 mg, 0.065 mmol, 0.2 equiv), Pd2(dba)3 (29.6 mg, 0.032 mmol, 0.1 equiv). After stirring for 2 hr at 100° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford tert-butyl N-ethyl-N-(1-{7-[(4-fluoro-2-methyl-1,3-benzothiazol-6-yl) carbamoyl]-2-methylindazol-4-yl} piperidin-4-yl)carbamate (C246, 100.0 mg, 54%) as a solid. LCMS (ES, m/z): 567 [M+H]+


Synthesis of Compound 443



embedded image


To a stirred solution of tert-butyl N-ethyl-N-(1-{7-[(4-fluoro-2-methyl-1,3-benzothiazol-6-yl)carbamoyl]-2-methylindazol-4-yl}piperidin-4-yl)carbamate (110.0 mg, 0.194 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature under nitrogen atmosphere. The reaction was monitored by LCMS. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-(ethylamino) piperidin-1-yl]-N-(4-fluoro-2-methyl-1,3-benzothiazol-6-yl)-2-methylindazole-7-carboxamide (Compound 443, 27 mg, 29%) as a solid. LCMS (ES, m/z): 467 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.43 (s, 1H), 8.78 (s, 1H), 8.30 (d, J=1.9 Hz, 1H), 7.99 (d, J=8.2 Hz, 1H), 7.89 (dd, J=12.9, 1.9 Hz, 1H), 6.50 (d, J=8.3 Hz, 1H), 4.31 (s, 3H), 3.91 (d, J=12.9 Hz, 2H), 3.07 (t, J=11.4 Hz, 2H), 2.81 (s, 3H), 2.73-2.72 (m, 1H), 2.63 (t, J=7.1 Hz, 2H), 1.97 (d, J=12.4 Hz, 2H), 1.46 (q, J=11.0 Hz, 2H), 1.05 (t, J=7.1 Hz, 3H).


Example 176: Synthesis of Compound 444
Synthesis of Intermediate C247



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine-1-carboxylate (300 mg, 0.835 mmol, 1 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyridine-7-carbonitrile (197.04 mg, 0.835 mmol, 1 equiv) in dioxane (5 mL) were added Cs2CO3 (815.84 mg, 2.505 mmol, 3 equiv), Pd2(dba)3 (76.43 mg, 0.084 mmol, 0.1 equiv) and XantPhos (48.30 mg, 0.084 mmol, 0.1 equiv). After stirring for 2 hr at 100° C. under a nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1:1-1:10) to afford tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C247, 400 mg, 93%) as a solid. 1H NMR (400 MHz, DMSO-d6) δ 11.47 (s, 1H), 9.66 (s, 1H), 8.85 (s, 1H), 8.29 (s, 1H), 8.06-7.96 (m, 2H), 6.52 (d, J=8.2 Hz, 1H), 4.26 (s, 3H), 3.57 (d, J=5.7 Hz, 5H), 3.48 (d, J=5.7 Hz, 3H), 2.40 (s, 3H), 1.45 (s, 9H).


Synthesis of Compound 444



embedded image


A solution of tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (80 mg, 0.155 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 4) to afford N-{7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 444, 4 mg, 6%) as a solid. LCMS (ES, m/z): 515 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 11.48 (s, 1H), 9.67 (s, 1H), 8.82 (s, 1H), 8.29 (s, 1H), 8.08-7.97 (m, 2H), 6.51 (d, J=8.2 Hz, 1H), 4.25 (s, 3H), 3.39 (t, J=5.0 Hz, 4H), 2.91 (t, J=5.0 Hz, 4H), 2.40 (s, 3H).


Example 177: Synthesis of Compound 445
Synthesis of Intermediate C248



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (300.0 mg, 0.608 mmol, 1.0 equiv) and Cs2CO3 (396.1 mg, 1.216 mmol, 2.0 equiv) in DMF (6 mL) was added propylene oxide (52.9 mg, 0.912 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80° C. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with water (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-hydroxypropyl) indazol-4-yl]piperazine-1-carboxylate (C248, 200 mg, 59%) as a solid. LCMS (ES, m/z): 552 [M+H]+


Synthesis of Intermediate C249



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-hydroxypropyl) indazol-4-yl]piperazine-1-carboxylate (210.0 mg, 0.381 mmol, 1.0 equiv) and Et3N (77.0 mg, 0.762 mmol, 2.0 equiv) in DCM (4 mL) was added MsCl (52.3 mg, 0.457 mmol, 1.2 equiv) dropwise at 0° C. The resulting mixture was stirred for 1 hr at 0° C. The resulting mixture was washed with 1×4 mL of water. The organic layer was dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under vacuum to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[2-(methanesulfonyloxy)propyl]indazol-4-yl]piperazine-1-carboxylate (C249, 200 mg, 83%) as a solid. LCMS (ES, m/z): 630 [M+H]+


Synthesis of Intermediate C250



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[2-(methanesulfonyloxy)propyl]indazol-4-yl]piperazine-1-carboxylate (210.0 mg, 0.333 mmol, 1.0 equiv) in THF (2 mL) was added t-BuOK (74.8 mg, 0.666 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was diluted with water (4 mL). The resulting mixture was extracted with ethyl acetate (2×4 mL). The combined organic layers were washed with water (1×4 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(1E)-prop-1-en-1-yl]indazol-4-yl]piperazine-1-carboxylate (C250, 130 mg, 73%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 445



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[(1E)-prop-1-en-1-yl]indazol-4-yl]piperazine-1-carboxylate (80.0 mg, 0.150 mmol, 1.0 equiv) in DCM (2 mL) was added ZnBr2 (337.6 mg, 1.500 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 9) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-[(1E)-prop-1-en-1-yl]indazole-7-carboxamide (Compound 445, 18 mg, 27%) as a solid.


LCMS (ES, m/z): 434 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.91 (s, 1H), 9.25-9.15 (m, 1H), 8.98 (s, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.47 (dd, J=14.1, 1.9 Hz, 1H), 7.38-7.29 (m, 1H), 6.78 (dq, J=14.0, 6.9 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 3.37 (t, J=5.1 Hz, 4H), 2.92 (t, J=5.0 Hz, 4H), 2.36 (s, 3H), 1.96 (dd, J=7.0, 1.8 Hz, 3H).


Example 178: Synthesis of Compound 446 and 447
Synthesis of Intermediate C251



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and tert-butyl (3S)-3-methylpiperazine-1-carboxylate (59.75 mg, 0.299 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl (3S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-1-carboxylate (C251, 70 mg, 53%) as solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 446



embedded image


To a stirred solution of tert-butyl (3S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-1-carboxylate (70 mg, 0.134 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(2S)-2-methylpiperazin-1-yl]indazole-7-carboxamide (Compound 44614.9 mg, 26%) as solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.11 (d, J=1.6 Hz, 1H), 8.55 (s, 1H), 8.11 (d, J=8.1 Hz, 1H), 7.74 (d, J=3.0 Hz, 1H), 7.33-7.25 (m, 1H), 6.57 (d, J=8.2 Hz, 1H), 4.34 (s, 3H), 4.28 (dd, J=6.8, 3.4 Hz, 1H), 3.49-3.37 (m, 2H), 3.25 (dd, J=12.8, 3.9 Hz, 1H), 3.16 (d, J=12.9 Hz, 1H), 3.03-2.90 (m, 2H), 2.45 (d, J=0.9 Hz, 3H), 1.20 (d, J=6.7 Hz, 3H).


Synthesis of Intermediate C252



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and tert-butyl (3R)-3-methylpiperazine-1-carboxylate (59.75 mg, 0.299 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl (3R)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-1-carboxylate (C252, 80 mg, 61%) as solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 447



embedded image


To a stirred solution of tert-butyl (3R)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-1-carboxylate (80 mg, 0.153 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(2R)-2-methylpiperazin-1-yl]indazole-7-carboxamide (Compound 447, 21.6 mg, 33%) as solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.12-9.05 (m, 1H), 8.52 (d, J=4.8 Hz, 1H), 8.09 (dd, J=8.2, 3.1 Hz, 1H), 7.72 (s, 1H), 7.30-7.21 (m, 1H), 6.55 (dd, J=8.1, 3.8 Hz, 1H), 4.33 (d, J=2.1 Hz, 3H), 4.26 (s, 1H), 3.43 (q, J=14.7, 13.4 Hz, 2H), 3.28-3.19 (m, 1H), 3.15 (d, J=12.6 Hz, 1H), 3.03-2.89 (m, 2H), 2.46-2.41 (m, 3H), 1.19 (d, J=6.7 Hz, 3H).


Example 179: Synthesis of Compound 455
Synthesis of Intermediate C253



embedded image


To a stirred solution of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-formylindazole-7-carboxamide (70 mg, 0.192 mmol, 1 equiv) and tert-butyl N-(1,3-dihydroxypropan-2-yl)carbamate (73 mg, 0.384 mmol, 2.0 equiv) in DCM (3.5 mL) and THF (0.3 mL) were added p-TsOH (50 mg, 0.288 mmol, 1.5 equiv) and Na2SO4 (41 mg, 0.288 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 12 hr at room temperature. The resulting mixture was diluted with H2O (5 mL). The resulting mixture was extracted with EA (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-1,3-dioxan-5-yl}carbamate (C253, 30 mg, 29%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 455



embedded image


A solution of tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-1,3-dioxan-5-yl}carbamate (30 mg, 0.056 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-(5-amino-1,3-dioxan-2-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 445, 10 mg, 40%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.22 (d, J=3.6 Hz, 1H), 9.25 (d, J=1.7 Hz, 1H), 8.81 (s, 1H), 8.08 (dd, J=7.3, 4.0 Hz, 1H), 7.95 (d, J=3.2 Hz, 1H), 7.41-7.28 (m, 2H), 5.87 (s, 1H), 4.76-4.62 (m, 2H), 4.18 (t, J=9.7 Hz, 2H), 3.93 (d, J=11.1 Hz, 2H), 3.51 (t, J=10.6 Hz, 1H), 2.77 (s, 1H), 2.36 (s, 3H), 1.69-1.58 (m, 3H).


Example 180: Synthesis of Compound 460
Synthesis of Intermediate C254



embedded image


To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100 mg, 0.238 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (54.34 mg, 0.238 mmol, 1 equiv), Cs2CO3 (227.19 mg, 0.696 mmol, 3 equiv) in 1,4-dioxane (2 mL) was added Ruphos (11.10 mg, 0.024 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (19.90 mg, 0.024 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-ethyl-N-{1-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (C254, 80 mg, 59%) as a solid. LCMS (ES, m/z): 568 [M+H]+


Synthesis of Compound 460



embedded image


To a stirred solution of tert-butyl N-ethyl-N-{1-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (70 mg, 0.123 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 2) to afford 4-[4-(ethylamino)piperidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 460, 22.9 mg, 26%) as solid. LCMS (ES, m/z): 468 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.41 (s, 1H), 8.59 (s, 1H), 8.02 (s, 1H), 7.82 (t, J=9.5 Hz, 1H), 6.37 (d, J=15.4 Hz, 1H), 4.30 (s, 3H), 4.17 (d, J=13.2 Hz, 2H), 3.50-3.39 (m, 1H), 3.24-3.11 (m, 4H), 2.56 (s, 3H), 2.28 (d, J=12.2 Hz, 2H), 1.84 (tt, J=12.6, 6.4 Hz, 2H), 1.42-1.28 (m, 3H).


Example 181: Synthesis of Compound 440
Synthesis of Intermediate C255



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (800.0 mg, 1.621 mmol, 1.0 equiv) and methyl 2-bromopropanoate (406.0 mg, 2.431 mmol, 1.5 equiv) in DMF (20 mL) was added Cs2CO3 (1056.2 mg, 3.242 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (60 mL). The resulting mixture was extracted with ethyl acetate (3×50 mL). The combined organic layers were washed with water (3×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1-methoxy-1-oxopropan-2-yl) indazol-4-yl]piperazine-1-carboxylate (C255, 520 mg, 55%) as a solid. LCMS (ES, m/z): 580 [M+H]+


Synthesis of Intermediate C256



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1-methoxy-1-oxopropan-2-yl) indazol-4-yl]piperazine-1-carboxylate (520.0 mg, 0.897 mmol, 1.0 equiv) in THF (10 mL) was added LiBH4 (58.6 mg, 2.691 mmol, 3.0 equiv) at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0° C. under nitrogen atmosphere. The reaction was quenched with water/ice at 0° C. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with water (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1-hydroxypropan-2-yl) indazol-4-yl]piperazine-1-carboxylate (C256, 420 mg, 84%) as a solid. LCMS (ES, m/z): 552 [M+H]+


Synthesis of Intermediate C257



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(1-hydroxypropan-2-yl) indazol-4-yl]piperazine-1-carboxylate (420.0 mg, 0.761 mmol, 1.0 equiv) and Et3N (231.1 mg, 2.283 mmol, 3.0 equiv) in DCM (8 mL) was added MsCl (104.6 mg, 0.913 mmol, 1.2 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0° C. under nitrogen atmosphere. The reaction was quenched with water/ice at 0° C. The resulting mixture was extracted with CH2Cl2 (2×10 mL). The combined organic layers were washed with water (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[1-(methanesulfonyloxy)propan-2-yl]indazol-4-yl]piperazine-1-carboxylate (C257, 450 mg, 93%) as a solid. LCMS (ES, m/z): 630 [M+H]+


Synthesis of Intermediate C258



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-[1-(methanesulfonyloxy)propan-2-yl]indazol-4-yl]piperazine-1-carboxylate (450.0 mg, 0.715 mmol, 1.0 equiv) in THF (9 mL) was added tert-butoxypotassium (160.4 mg, 1.430 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with water (1×40 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(prop-1-en-2-yl) indazol-4-yl]piperazine-1-carboxylate (C258, 210 mg, 55%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 440



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(prop-1-en-2-yl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.187 mmol, 1.0 equiv) in DCM (2 mL) was added ZnBr2 (422.1 mg, 1.870 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 9) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2-(prop-1-en-2-yl) indazole-7-carboxamide (Compound 440, 6 mg, 7%) as a solid. LCMS (ES, m/z): 434 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.93 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.99 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 7.97-7.83 (m, 1H), 7.20 (dd, J=12.2, 1.7 Hz, 1H), 6.52 (d, J=8.2 Hz, 1H), 6.01 (s, 1H), 5.23 (s, 1H), 3.39 (t, J=5.0 Hz, 4H), 2.93 (t, J=4.9 Hz, 4H), 2.54 (s, 3H), 2.35 (s, 3H).


Example 182: Synthesis of Compound 450
Synthesis of Intermediate C259



embedded image


To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv) and 1-methylpiperazine (0.42 g, 4.238 mmol, 1.2 equiv) in dioxane (20 mL) were added Cs2CO3 (3.45 g, 10.596 mmol, 3.0 equiv), RuPhos (0.16 g, 0.353 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (0.3 g, 0.353 mmol, 0.1 equiv). After stirring for 1 hr at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 2-ethyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (C259, 1 g, 93%) as a solid. LCMS (ES, m/z): 303 [M+H]+


Synthesis of Intermediate C260



embedded image


A solution of methyl 2-ethyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (200 mg, 0.661 mmol, 1 equiv) in 7 N NH3(g) in MeOH (40 mL) was stirred for 3 days at 100° C. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 288 [M+H]+


Synthesis of Intermediate C261



embedded image


To a solution of 2-ethyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (200 mg, 0.696 mmol, 1 equiv) and (6-bromo-4-fluoro-1,3-benzoxazol-2-yl)methyl acetate (240 mg, 0.833 mmol, 1.20 equiv) in dioxane (6 mL) were added Cs2CO3 (680 mg, 2.088 mmol, 3.0 equiv), XantPhos (81 mg, 0.139 mmol, 0.2 equiv) and Pd2(dba)3 (64 mg, 0.070 mmol, 0.1 equiv). After stirring for 2 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford{6-[2-ethyl-4-(4-methylpiperazin-1-yl) indazole-7-amido]-4-fluoro-1,3-benzoxazol-2-yl}methyl acetate (C261, 100 mg, 29%) as a solid. LCMS (ES, m/z): 495 [M+H]+


Synthesis of Compound 450



embedded image


A solution of {6-[2-ethyl-4-(4-methylpiperazin-1-yl) indazole-7-amido]-4-fluoro-1,3-benzoxazol-2-yl}methyl acetate (100 mg, 0.202 mmol, 1 equiv) and K2CO3 (167 mg, 1.212 mmol, 6.0 equiv) in methanol (3 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2-ethyl-N-[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (Compound 450, 24.8 mg, 27%) as a solid. LCMS (ES, m/z): 453 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.53 (s, 1H), 8.85 (s, 1H), 8.18 (d, J=1.6 Hz, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.65 (dd, J=12.1, 1.7 Hz, 1H), 6.52 (d, J=8.2 Hz, 1H), 5.93 (s, 1H), 4.72 (s, 2H), 4.61 (q, J=7.2 Hz, 2H), 3.45 (t, J=4.9 Hz, 4H), 2.55 (d, J=4.9 Hz, 4H), 2.28 (s, 3H), 1.63 (t, J=7.3 Hz, 3H).


Example 183: Synthesis of Compound 451
Synthesis of Intermediate C262



embedded image


A solution of 5-bromo-4-methoxypyrimidin-2-amine (20 g, 98.026 mmol, 1 equiv) in isopropanol (480 mL) was treated with 1-bromo-2,2-dimethoxypropane (26.91 g, 147.039 mmol, 1.5 equiv) and PPTS (2.46 g, 9.803 mmol, 0.1 equiv) for 48 hours at 80° C. The precipitated solids were collected by filtration and washed with isopropanol (50 mL). To afford 6-bromo-2-methyl-8H-imidazo[1,2-a]pyrimidin-7-one (17.5 g, 69.32%) as a solid. LCMS (ES, m/z): 228 [M+H]+


Synthesis of Intermediate C263



embedded image


A solution of 6-bromo-2-methyl-8H-imidazo[1,2-a]pyrimidin-7-one (2 g, 8.770 mmol, 1 equiv) in MeCN (40 mL) was treated with K2CO3 (3.64 g, 26.310 mmol, 3 equiv), CH3I (1.87 g, 13.155 mmol, 1.5 equiv) for 8 hours at 50° C. The resulting mixture was diluted with MeOH (100 mL). The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (20/1) to afford 6-bromo-2,8-dimethylimidazo[1,2-a]pyrimidin-7-one (C263, 800 mg, 37%) as a solid. LCMS (ES, m/z): 242 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 8.67 (d, J=9.3 Hz, 1H), 7.10 (dd, J=10.7, 1.4 Hz, 1H), 4.95 (s, 1H), 3.37 (d, J=14.2 Hz, 13H), 2.29-2.21 (m, 3H), 2.10 (d, J=1.3 Hz, 1H)


Synthesis of Intermediate C264



embedded image


A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (445 mg, 1.239 mmol, 1 equiv) in toluene (10 mL) as treated with 6-bromo-2,8-dimethylimidazo[1,2-a]pyrimidin-7-one (300 mg, 1.239 mmol, 1.00 equiv), methyl[2-(methylamino)ethyl]amine (218 mg, 2.478 mmol, 2 equiv), Cu (78 mg, 1.239 mmol, 1 equiv), K2CO3 (342 mg, 2.478 mmol, 2 equiv) for 8 hours at 100° C. under nitrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (100 mL). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with MeOH/DCM (1/10) to afford tert-butyl 4-[7-({2,8-dimethyl-7-oxoimidazo[1,2-a]pyrimidin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (100 mg, 15%) as a solid. LCMS (ES, m/z): 521 [M+H]+


Synthesis of Compound 451



embedded image


A solution of tert-butyl 4-[7-({2,8-dimethyl-7-oxoimidazo[1,2-a]pyrimidin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (100 mg, 0.192 mmol, 1 equiv) in DCM (20 mL) was treated with TFA (2 mL) for 1 hour at 20° C. The residue was purified by reverse flash chromatography (Condition 2, Gradient 1) to afford N-{2,8-dimethyl-7-oxoimidazo[1,2-a]pyrimidin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 451, 10 mg, 12%) as a solid. LCMS (ES, m/z): 421 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.47 (s, 1H), 9.25 (s, 1H), 8.75 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.31 (d, J=1.5 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.24 (s, 3H), 3.46 (s, 3H), 3.35 (s, 15H), 2.92 (d, J=6.0 Hz, 3H), 2.26 (d, J=1.3 Hz, 3H)


Example 184: Synthesis of Compound 453



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and 2-(fluoromethyl)piperazine (125 mg, 1.056 mmol, 2.2 equiv) in dioxane (5 mL) were added Cs2CO3 (469.64 mg, 1.440 mmol, 3.0 equiv), RuPhos (45 mg, 0.096 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (41 mg, 0.048 mmol, 0.1 equiv). After stirring for 3 hr at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-(fluoromethyl)piperazin-1-yl]indazole-7-carboxamide (Compound 453, 54 mg, 24%) as a solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (300 MHz) 9.15 (d, J=13.9 Hz, 2H), 8.55 (d, J=8.4 Hz, 1H), 8.06 (d, J=10.0 Hz, 1H), 7.97 (s, 1H), 7.13 (d, J=8.5 Hz, 1H), 5.01-4.99 (m, 4H), 4.31 (d, J=12.7 Hz, 3H), 4.03-3.87 (m, 4H), 2.75 (d, J=1.1 Hz, 3H), 1.92 (t, J=7.2 Hz, 3H).


Example 185: Synthesis of Compound 454
Synthesis of Intermediate C265



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1 equiv) and potassium ethenyltrifluoroboranuide (193 mg, 1.441 mmol, 1.2 equiv) in dioxane (8 mL) and H2O (2 mL) were added K2CO3 (498 mg, 3.603 mmol, 3.0 equiv) and Pd(dtbpf)Cl2 (78 mg, 0.120 mmol, 0.1 equiv). After stirring for 1 hr at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-ethenyl-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (C265, 400 mg, 91%) as a solid. LCMS (ES, m/z): 364 [M+H]+


Synthesis of Intermediate C266



embedded image


To a solution of 4-ethenyl-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.550 mmol, 1 equiv) and NaIO4 (235.4 mg, 1.100 mmol, 2.0 equiv) in dioxane (6 mL) and H2O (2 mL) were added K2OsO4·2H2O (20.3 mg, 0.055 mmol, 0.1 equiv). After stirring for 1 hr at room temperature under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4:1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-formylindazole-7-carboxamide (C266, 40 mg, 19%) as a solid. LCMS (ES, m/z): 366 [M+H]+


Synthesis of Intermediate C267



embedded image


To a stirred solution of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-formylindazole-7-carboxamide (40 mg, 0.109 mmol, 1 equiv) and tert-butyl N-(1,3-dihydroxy-2-methylpropan-2-yl)carbamate (80 mg, 0.390 mmol, 3.56 equiv) in DCM (2 mL) and THF (0.2 mL) were addedp-TsOH (56 mg, 0.325 mmol, 2.97 equiv) and Na2SO4 (80 mg, 0.563 mmol, 5.14 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at room temperature. The resulting mixture was diluted with H2O (5 mL). The resulting mixture was extracted with EA (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 553 [M+H]+


Synthesis of Compound 454



embedded image


A solution of tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-5-methyl-1,3-dioxan-5-yl}carbamate (20 mg, 0.036 mmol, 1 equiv) and TFA (0.2 mL) in DCM (3 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 1) to afford 4-(5-amino-5-methyl-1,3-dioxan-2-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 454, 5 mg, 30%) as a solid. LCMS (ES, m/z): 453 [M+H]+ 1H NMR (300 MHz, Methanol-d4) δ 9.14 (d, J=1.7 Hz, 1H), 8.58 (s, 1H), 8.17 (d, J=7.4 Hz, 1H), 7.73 (dd, J=3.1, 1.0 Hz, 1H), 7.39 (dd, J=7.4, 0.8 Hz, 1H), 7.23 (dd, J=11.7, 1.7 Hz, 1H), 5.81 (s, 1H), 4.68 (q, J=7.3 Hz, 2H), 4.00 (d, J=11.0 Hz, 2H), 3.90 (d, J=10.9 Hz, 2H), 2.44 (d, J=0.9 Hz, 3H), 1.73 (t, J=7.3 Hz, 3H), 1.05 (s, 3H).


Example 186: Synthesis of Compounds 456 and 484
Synthesis of Intermediate C268



embedded image


A solution of 2-fluoro-4-methoxy-1-methylbenzene (10 g, 71.349 mmol, 1 equiv) and NBS (13.3 g, 74.916 mmol, 1.05 equiv) in MeCN (200 mL) was stirred for 4 h at room temperature. The reaction was quenched with water (200 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3×200 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford 1-bromo-4-fluoro-2-methoxy-5-methylbenzene (C268, 12 g, 76%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 7.50 (dd, J=8.3, 0.8 Hz, 1H), 7.01 (d, J=11.6 Hz, 1H), 3.83 (s, 3H), 2.15 (dd, J=2.0, 0.7 Hz, 3H).


Synthesis of Intermediate C269



embedded image


To a stirred mixture of 1-bromo-4-fluoro-2-methoxy-5-methylbenzene (12 g, 54.781 mmol, 1 equiv) in THF (240 mL) was added LDA (in 2M THF) (36 mL, 71.1 mmol, 1.3 equiv) dropwise at −78° C. under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at −78° C. under nitrogen atmosphere. Then the mixture was added DMF (20.02 g, 273.905 mmol, 5 equiv) dropwise at −78° C. under nitrogen atmosphere and stirred at room temperature for 16 hr. The reaction was quenched with sat. NH4Cl (aq.) (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3×100 mL). The combined organic layers dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford 3-bromo-6-fluoro-2-methoxy-5-methylbenzaldehyde (C269, 9 g, 66%) as an oil. 1H NMR (300 MHz, DMSO-d6) δ 10.21 (d, J=1.1 Hz, 1H), 7.95 (m, 1H), 3.87 (s, 3H), 2.23 (dd, J=2.4, 0.8 Hz, 4H).


Synthesis of Intermediate C270



embedded image


A mixture of 3-bromo-6-fluoro-2-methoxy-5-methylbenzaldehyde (8 g, 32.380 mmol, 1 equiv), O-methylhydroxylamine (1.68 g, 35.618 mmol, 1.1 equiv) and K2CO3 (6.71 g, 48.570 mmol, 1.5 equiv) in DME (80 mL) was stirred for 4 hr at 60° C. The reaction was quenched with water (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3×100 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford (E)-[(3-bromo-6-fluoro-2-methoxy-5-methylphenyl)methylidene](methoxy)amine (C270, 7 g, 78%) as a solid. LCMS (ES, m/z): 276 [M+H]+


Synthesis of Intermediate C271



embedded image


A mixture of 3-bromo-6-fluoro-2-methoxy-5-methylbenzaldehyde O-methyl (6 g, 21.82 mmol, 1 equiv) in DMSO (70 mL) and N2H4·H2O (70 mL) was stirred for 4 h at 140° C. The reaction was quenched with water (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3×100 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 5-bromo-4-methoxy-7-methyl-2H-indazole (C271, 1.0 g, 19%) as a solid. LCMS (ES, m/z): 241 [M+H]+


Synthesis of Intermediate C272



embedded image


A mixture of 5-bromo-4-methoxy-7-methyl-2H-indazole (300 mg, 1.244 mmol, 1 equiv) and tetrafluoroboranuide; trimethyloxidanium (920.3 mg, 6.220 mmol, 5 equiv) in EA (3 mL) was stirred for 2 hr at 25° C. under N2 atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA to afford 5-bromo-4-methoxy-2,7-dimethylindazole (C272, 270 mg, 85%) as a solid. LCMS (ES, m/z): 255 [M+H]+


Synthesis of Intermediate C273



embedded image


A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (200 mg, 0.556 mmol, 1 equiv) and 5-bromo-4-methoxy-2,7-dimethylindazole (170.4 mg, 0.667 mmol, 1.2 equiv), methyl[2-(methylamino)ethyl]amine (24.5 mg, 0.278 mmol, 0.5 equiv), Cu (17.7 mg, 0.278 mmol, 0.5 equiv), K2CO3 (230.7 mg, 1.668 mmol, 3 equiv) in xylene (2 mL) was stirred for 16 h at 120° C. under N2 atmosphere. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-{7-[(4-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (C273, 70 mg, 23%) as a solid. LCMS (ES, m/z): 533 [M+H]+


Synthesis of Compound 456



embedded image


A mixture of tert-butyl 4-{7-[(4-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (70 mg, 0.131 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol, 20.53 equiv) in DCM (1 mL) was stirred for 1 hr at 25° C. under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-(4-hydroxy-2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 456, 5 mg) as a solid. LCMS (ES, m/z): 434[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.30 (s, 1H), 8.75 (s, 1H), 8.53 (s, 1H), 8.28 (d, J=1.3 Hz, 1H), 7.99 (d, J=8.0 Hz, 1H), 6.48 (d, J=8.1 Hz, 1H), 4.27 (s, 3H), 4.15 (d, J=15.7 Hz, 6H), 3.30 (s, 1H), 2.92 (t, J=4.9 Hz, 4H), 2.47 (d, J=1.1 Hz, 3H).


Synthesis of Compound 484



embedded image


A mixture of tert-butyl 4-{7-[(4-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl}piperazine-1-carboxylate (45 mg, 0.084 mmol, 1 equiv) and BBr3 (0.5 mL, 5.289 mmol, 62.72 equiv) in DCM (0.5 mL) was stirred for 16 h at 25° C. under N2 atmosphere. The product was precipitated by the addition of MeOH. The precipitated solids were collected by filtration and washed with MeOH. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-(4-hydroxy-2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 484, 11 mg, 31%) as a solid. LCMS (ES, m/z): 420[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 10.34 (s, 1H), 8.91 (d, J=9.3 Hz, 3H), 8.32 (s, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.45 (d, J=1.2 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.29 (s, 3H), 4.16 (s, 3H), 3.36 (s, 4H), 2.43 (d, J=1.0 Hz, 3H).


Example 187: Synthesis of Compound 457
Synthesis of Intermediate C274



embedded image


A solution of 2-methyl-6-nitroimidazo[1,2-a]pyridine (150 mg, 0.847 mmol, 1 equiv) in MeOH (20 mL) was treated with PtO2 (75 mg, 0.330 mmol, 0.39 equiv) for 8 hr at 80° C. under 20 atm hydrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with methanol. The filtrate was concentrated under reduced pressure. The crude product 2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-amine (C274, 146 mg, 66%) was used in the next step directly without further purification. LCMS (ES, m/z): 152[M+H]+


1. Synthesis of Intermediate c275




embedded image


A solution of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (100 mg, 0.277 mmol, 1.00 equiv) in DMF (3 mL) was treated with 2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-amine (100 mg, 0.661 mmol, 2.38 equiv), HATU (126 mg, 0.332 mmol, 1.2 equiv), DIEA (107 mg, 0.831 mmol, 3 equiv) for 8 hr at 20° C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford tert-butyl 4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C275, 60 mg, 43%) as a solid. LCMS (ES, m/z): 494 [M+H]+


Synthesis of Compound 457



embedded image


A solution of tert-butyl 4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (50 mg, 0.101 mmol, 1 equiv) in DCM (10 mL) was treated with TFA (1 mL) for 1 hr at 0° C. The resulting mixture was diluted with water and concentrated under reduced pressure to afford 2-methyl-N-{2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 457, 30 mg, 75%) as a solid. LCMS (ES, m/z): 394 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 14.17 (s, 1H), 9.19 (d, J=7.0 Hz, 2H), 8.93 (s, 2H), 8.82 (s, 2H), 7.92 (d, J=7.9 Hz, 2H), 7.31 (d, J=1.3 Hz, 2H), 6.55 (d, J=8.0 Hz, 2H), 4.62 (s, 2H), 4.41 (dd, J=12.9, 4.4 Hz, 2H), 4.15 (s, 8H), 3.30-3.06 (m, 6H), 2.30-2.13 (m, 10H)


Example 188: Synthesis of Compound 458
Synthesis of Intermediate C276



embedded image


To a stirred solution of 5-bromo-3-fluoropyridin-2-amine (2 g, 10.471 mmol, 1 equiv) and 3-bromo-2-butanone (1.58 g, 10.471 mmol, 1 equiv) in n-BuOH (1 mL) was added pyridinium p-toluenesulfonate (263.14 mg, 1.047 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 72 hr at 120° C. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash (Condition 7, Gradient 1) to afford 6-bromo-8-fluoro-2,3-dimethylimidazo[1,2-a]pyridine (C276, 300 mg, 11%) as a solid. LCMS (ES, m/z): 243 [M+H]+


Synthesis of Intermediate C277



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (200 mg, 0.556 mmol, 1 equiv) and 6-bromo-8-fluoro-2,3-dimethylimidazo[1,2-a]pyridine (162.31 mg, 0.667 mmol, 1.2 equiv) in dioxane (10 mL) were added Pd2(dba)3 (50.95 mg, 0.056 mmol, 0.1 equiv), XantPhos (32.20 mg, 0.056 mmol, 0.1 equiv) and Cs2CO3 (543.89 mg, 1.668 mmol, 3 equiv). After stirring for 3 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford tert-butyl 4-[7-({8-fluoro-2,3-dimethylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C277, 200 mg, 68%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 458



embedded image


A solution of tert-butyl 4-[7-({8-fluoro-2,3-dimethylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (110 mg, 0.211 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 7, Gradient 2) to afford N-{8-fluoro-2,3-dimethylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 458, 13 mg, 14%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 11.12 (s, 1H), 8.91 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.32 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.36 (d, J=5.9 Hz, 4H), 2.92 (t, J=5.0 Hz, 4H), 2.42 (s, 3H), 2.34 (s, 3H).


Example 189: Synthesis of Compound 459
Synthesis of Intermediate C278



embedded image


To a solution of tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl) piperidin-4-yl]-N-ethylcarbamate (150.0 mg, 0.374 mmol, 1.0 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a] pyridine (116.1 mg, 0.449 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs2CO3 (305.2 mg, 0.935 mmol, 2.5 equiv) and Xantphos (43.2 mg, 0.075 mmol, 0.2 equiv), Pd2(dba)3 (34.2 mg, 0.037 mmol, 0.1 equiv). After stirring for 2 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a] pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl] piperidin-4-yl} carbamate (C278, 130 mg, 48%) as a solid. LCMS (ES, m/z): 580 [M+H]+


Synthesis of Intermediate Compound 459



embedded image


Into a 40 mL vial were added tert-butyl N-ethyl-N-{1-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (90.0 mg, 0.155 mmol, 1.0 equiv), DCM (2 mL) and TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-(ethylamino)piperidin-1-yl]-N-{8-fluoro-7-methoxy-2-methylimidazo [1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 459, 8.0 mg, 11%) as a solid. LCMS (ES, m/z): 480 [M+H]+ 1H NMR (400 MHz, Chloroform-d) δ 11.48 (s, 1H), 9.47 (d, J=1.3 Hz, 1H), 8.21 (d, J=8.0 Hz, 1H), 8.05 (s, 1H), 7.30 (d, J=3.0 Hz, 1H), 6.52 (d, J=8.1 Hz, 1H), 4.32 (s, 3H), 4.27 (d, J=2.3 Hz, 3H), 3.90 (d, J=12.7 Hz, 2H), 3.03 (t, J=11.8 Hz, 2H), 2.84 (q, J=7.0 Hz, 3H), 2.61-2.35 (m, 3H), 2.15 (d, J=12.5 Hz, 2H), 1.76-1.68 (m, 2H), 1.24 (t, J=7.1 Hz, 3H).


Example 190: Synthesis of Compound 460
Synthesis of Intermediate C279



embedded image


To a stirred mixture of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (110 mg, 0.383 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (87.49 mg, 0.383 mmol, 1 equiv), Cs2CO3 (374.52 mg, 1.149 mmol, 3 equiv) in 1,4-dioxane (2 mL) was added RuPhos (35.76 mg, 0.077 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (32.05 mg, 0.038 mmol, 0.10 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-6-fluoro-2-methylindazole-7-carboxylate (C279, 145 mg, 87%) as a solid. LCMS (ES, m/z): 435 [M+H]*Synthesis of Intermediate 280




embedded image


To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-6-fluoro-2-methylindazole-7-carboxylate (145 mg, 0.334 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (42.01 mg, 1.002 mmol, 3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water. The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-6-fluoro-2-methylindazole-7-carboxylic acid (C280, 130 mg, 92%) as a solid. LCMS (ES, m/z): 421 [M−H]


Synthesis of Intermediate C281



embedded image


To a stirred mixture of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-6-fluoro-2-methylindazole-7-carboxylic acid (130 mg, 0.309 mmol, 1 equiv) and NH4Cl (66.15 mg, 1.236 mmol, 4 equiv) in DCM (2 mL) was added HATU (141.07 mg, 0.371 mmol, 1.2 equiv) and DIEA (199.79 mg, 1.545 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:4) to afford tert-butyl N-[1-(7-carbamoyl-6-fluoro-2-methylindazol-4-yl)piperidin-4-yl]-N-ethylcarbamate (C281, 110 mg, 84%) as solid. LCMS (ES, m/z): 420 [M−H]


Synthesis of Intermediate C282



embedded image


To a stirred mixture of tert-butyl N-[1-(7-carbamoyl-6-fluoro-2-methylindazol-4-yl)piperidin-4-yl]-N-ethylcarbamate (90 mg, 0.215 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (66.70 mg, 0.258 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs2CO3 (209.70 mg, 0.645 mmol, 3 equiv), X-Phos (20.46 mg, 0.043 mmol, 0.2 equiv) and Pd2(dba)3 (19.65 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-ethyl-N-{1-[6-fluoro-7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (C282, 65 mg, 50%) as a solid. LCMS (ES, m/z): 596 [M−H]


Synthesis of Compound 460



embedded image


To a stirred solution of tert-butyl N-ethyl-N-{1-[6-fluoro-7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}carbamate (65 mg, 0.109 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 10) to afford 4-[4-(ethylamino)piperidin-1-yl]-6-fluoro-N-{8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 460, 15.3 mg, 28%) as a solid. LCMS (ES, m/z): 498 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.56 (s, 1H), 9.46 (s, 1H), 8.83 (s, 1H), 7.76 (d, J=3.0 Hz, 1H), 6.23 (d, J=16.2 Hz, 1H), 4.27-4.17 (m, 6H), 3.93 (d, J=13.0 Hz, 2H), 3.14 (t, J=11.7 Hz, 2H), 2.71 (dd, J=8.8, 4.7 Hz, 1H), 2.60 (q, J=7.1 Hz, 2H), 2.31 (s, 3H), 1.99-1.90 (m, 2H), 1.40 (q, J=9.6 Hz, 2H), 1.04 (t, J=7.1 Hz, 3H).


Example 191: Synthesis of Compound 462
Synthesis of Intermediate C283



embedded image


A solution of 5-bromo-3-fluoro-2-iminopyridin-1-amine (1.5 g, 7.281 mmol, 1 equiv), Et3N (3.68 g, 36.405 mmol, 5 equiv) and Ac2O (3.72 g, 36.405 mmol, 5 equiv) in toluene (30 mL) was stirred for 16 h at 100° C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 6-bromo-8-fluoro-2-methyl-[1,2,4]triazolo[1,5-a]pyridine (C283, 1 g, 59%) as a solid. LCMS (ES, m/z): 230 [M+H]+


Synthesis of Intermediate C284



embedded image


A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (150 mg, 0.417 mmol, 1 equiv) and 6-bromo-8-fluoro-2-methyl-[1,2,4]triazolo[1,5-a]pyridine (115.20 mg, 0.500 mmol, 1.2 equiv), XantPhos (24.15 mg, 0.042 mmol, 0.1 equiv), Pd2(dba)3, (38.22 mg, 0.042 mmol, 0.1 equiv), Cs2CO3 (407.92 mg, 1.251 mmol, 3 equiv) in dioxane (2 mL) was stirred for 16 h at 100° C. under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-[7-({8-fluoro-2-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C284, 150 mg) as a solid. LCMS (ES, m/z): 509 [M+H]+


Synthesis of Compound 462



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-2-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (150 mg, 0.295 mmol, 1 equiv) and TFA (0.4 mL, 5.385 mmol, 18.26 equiv) in DCM (2 mL) was stirred for 1 hr at 25° C. under N2 atmosphere. The resulting mixture was concentrated under vacuum. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 12) to afford N-{8-fluoro-2-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 462, 63 mg, 52%) as a solid. LCMS (ES, m/z): 409 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.29 (s, 1H), 9.50 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.87 (dd, J=11.7, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.37 (t, J=4.9 Hz, 4H), 2.91 (t, J=4.8 Hz, 4H).


Example 192: Synthesis of Compound 463



embedded image


To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (80 mg, 0.190 mmol, 1 equiv) and (3R)—N,N-dimethylpyrrolidin-3-amine (21.74 mg, 0.190 mmol, 1 equiv), Cs2CO3 (186.09 mg, 0.570 mmol, 3 equiv) in 1,4-dioxane (1 mL) was added Ruphos (8.88 mg, 0.019 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (15.92 mg, 0.019 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (55 mg, crude). The crude product was purified was purified by Prep-HPLC (Condition 10, Gradient 11) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 463, 25.4 mg, 29%) as a solid. LCMS (ES, m/z): 454 [M−H]1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.87 (d, J=3.1 Hz, 1H), 7.25 (dd, J=12.5, 1.7 Hz, 1H), 5.81 (d, J=16.0 Hz, 1H), 4.22 (s, 3H), 3.77 (dt, J=26.1, 9.0 Hz, 2H), 3.61 (d, J=8.0 Hz, 1H), 3.42 (d, J=9.0 Hz, 1H), 2.86 (p, J=7.6 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 7H), 1.96-1.82 (m, 1H).


Example 193: Synthesis of Compound 464



embedded image


To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (80 mg, 0.190 mmol, 1 equiv) and (3S)—N,N-dimethylpyrrolidin-3-amine (21.74 mg, 0.190 mmol, 1 equiv), Cs2CO3 (186.09 mg, 0.570 mmol, 3 equiv) in 1,4-dioxane (1 mL) was added Ruphos (8.88 mg, 0.019 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (15.92 mg, 0.019 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (50 mg, crude). The crude product was purified was purified by Prep-HPLC (Condition 10, Gradient 11) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 464, 25.2 mg, 29%) as a solid.


LCMS (ES, m/z): 454 [M−H]1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.87 (d, J=3.1 Hz, 1H), 7.25 (dd, J=12.5, 1.7 Hz, 1H), 5.81 (d, J=16.0 Hz, 1H), 4.22 (s, 3H), 3.77 (dt, J=26.1, 9.0 Hz, 2H), 3.61 (d, J=8.0 Hz, 1H), 3.42 (d, J=9.0 Hz, 1H), 2.86 (p, J=7.6 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 7H), 1.96-1.82 (m, 1H).


Example 194: Synthesis of Compound 470
Synthesis of Intermediate C285



embedded image


A solution of 6-bromo-3-methyl-[1,2,4]triazolo[4,3-a]pyridine (2 g, 9.432 mmol, 1 equiv) in dioxane (20 mL) was treated with acetamide (0.84 g, 14.148 mmol, 1.5 equiv), Pd2(dba)3 (0.86 g, 0.943 mmol, 0.1 equiv) xantphos (1.09 g, 1.886 mmol, 0.2 equiv), Cs2CO3 (6.15 g, 18.864 mmol, 2 equiv) for 8 hours at 80° C. under nitrogen atmosphere. The resulting mixture was filtered. the filter cake was washed with MeOH (3×50 mL). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (10%-50%) to afford N-{3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetamide (C285, 1.7 g, 94%) as a solid. LCMS (ES, m/z): 191 [M+H]+


Synthesis of Intermediate C286



embedded image


A solution N-{3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetamide (1.5 g, 7.886 mmol, 1 equiv) and Pd(OH)2/C (1.66 g, 11.829 mmol, 1.5 equiv) in EtOH (15 mL) was stirred for 120° C. at 16 hr under H2 (30 atm) atmosphere. The resulting mixture was filtered and the filter cake was washed with ethanol (20 mL×3). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA to afford N-{3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetamide (C286, 900 mg, 58%) as a solid. LCMS (ES, m/z): 195 [M+H]+


Synthesis of Intermediate C287



embedded image


A mixture of N-{3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetamide (300 mg, 1.544 mmol, 1 equiv) in NaOH (4 M, 3 mL) was stirred for 2 h at 100° C. under N2 atmosphere. The resulting mixture was concentrated under reduced pressure to afford 3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-amine (C287, 300 mg crude) as a solid. LCMS (ES, m/z): 153 [M+H]+


Synthesis of Intermediate C288



embedded image


A solution 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (150 mg, 0.416 mmol, 1 equiv) and 3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-amine (C287, 190.03 mg, 1.248 mmol, 3 equiv), HATU (189.90 mg, 0.499 mmol, 1.2 equiv), DIEA (161.37 mg, 1.248 mmol, 3 equiv) in DMF (2 mL) was stirred for 2 hr at 25° C. under N2 atmosphere. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-[2-methyl-7-({3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C288, 140 mg, 68%) as a solid. LCMS (ES, m/z): 495 [M+H]+


Synthesis of Compound 470



embedded image


A mixture of tert-butyl 4-[2-methyl-7-({3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (120 mg, 0.243 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol, 11.10 equiv) in DCM (1 mL) was stirred for 2 h at 25° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 8, Gradient 1) to afford 2-methyl-N-{3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 470, 23 mg, 24%) as a solid. LCMS (ES, m/z): 395 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 9.27 (d, J=7.2 Hz, 1H), 8.69 (s, 1H), 7.89 (d, J=8.0 Hz, 1H), 6.42 (d, J=8.1 Hz, 1H), 4.57 (d, J=6.2 Hz, 1H), 4.17 (dd, J=12.3, 4.6 Hz, 1H), 4.11 (s, 3H), 3.91 (dd, J=12.3, 5.8 Hz, 1H), 3.27 (s, 3H), 3.02 (t, J=6.9 Hz, 2H), 2.90 (s, 3H), 2.28 (s, 3H), 2.11 (d, J=7.2 Hz, 2H).


Example 195: Synthesis of Compound 472



embedded image


To a stirred mixture of 4-bromo-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (250 mg, 0.576 mmol, 1 equiv), (3S)—N,N-dimethylpyrrolidin-3-amine (62.45 mg, 0.547 mmol, 0.95 equiv) and Cs2CO3 (562.73 mg, 1.728 mmol, 3 equiv) in 1,4-dioxane (5 mL) was added Ruphos (26.87 mg, 0.058 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (48.15 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (35 mg, crude). The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 472, 7 mg, 2%) as solid. LCMS (ES, m/z): 468 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.05 (d, J=1.6 Hz, 1H), 8.61 (s, 1H), 7.71 (d, J=2.9 Hz, 1H), 7.14 (dd, J=11.8, 1.6 Hz, 1H), 5.84 (d, J=16.2 Hz, 1H), 4.56 (q, J=7.3 Hz, 2H), 3.87 (dt, J=16.6, 9.0 Hz, 2H), 3.71 (q, J=10.2, 9.6 Hz, 1H), 3.49 (t, J=8.6 Hz, 1H), 3.03 (p, J=7.6 Hz, 1H), 2.43 (d, J=12.5 Hz, 9H), 2.38 (d, J=6.8 Hz, 1H), 2.02 (p, J=10.0 Hz, 1H), 1.69 (t, J=7.3 Hz, 3H),


Example 196: Synthesis of Compound 473
Synthesis of Intermediate C289



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (160 mg, 0.531 mmol, 1 equiv) and (3R)—N,N-dimethylpyrrolidin-3-amine (72.81 mg, 0.637 mmol, 1.2 equiv) in dioxane (3 mL) was added Cs2CO3 (519.38 mg, 1.593 mmol, 3 equiv), Ruphos (49.59 mg, 0.106 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (44.44 mg, 0.053 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford methyl 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (C289, 135 mg, 75%) as solid. LCMS (ES, m/z): 335 [M+H]+


Synthesis of Intermediate C290



embedded image


To a stirred solution of methyl 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (135 mg, 0.404 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (33.88 mg, 0.808 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The residue was dissolved in methanol (5 mL). The solution was added HCl(g) in MeOH (1 mL) dropwise at 0° C. The resulting mixture was stirred for 10 min at room temperature. The resulting mixture was concentrated under vacuum to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (C290, 150 mg) as a solid. LCMS (ES, m/z): 319 [M−H]


Synthesis of Compound 473



embedded image


To a stirred mixture of 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (150 mg, 0.468 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (103.85 mg, 0.515 mmol, 1.1 equiv) in DCM (1.5 mL) was added HATU (231.44 mg, 0.608 mmol, 1.3 equiv) and DIEA (302.57 mg, 2.340 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (30 mg, crude). The crude product was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 473, 16.9 mg, 5%) as a solid. LCMS (ES, m/z): 468 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.41 (d, J=1.5 Hz, 1H), 8.72 (s, 1H), 8.05 (dd, J=2.4, 1.2 Hz, 1H), 7.84 (dd, J=11.4, 1.5 Hz, 1H), 5.98 (d, J=15.8 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 4.18 (p, J=7.1 Hz, 2H), 4.03 (td, J=9.5, 3.2 Hz, 1H), 3.96-3.79 (m, 2H), 3.08 (s, 6H), 2.75-2.67 (m, 1H), 2.57 (d, J=0.9 Hz, H), 2.42 (dq, J=12.5, 8.5 Hz, 1H), 1.70 (t, J=7.3 Hz, 3H).


Example 197: Synthesis of Compound 474
Synthesis of Intermediate C290



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (81.65 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (90 mg, 60.61%) as a solid. LCMS (ES, m/z): 407 [M+H]+


Synthesis of Intermediate C291



embedded image


To a stirred solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (90 mg, 0.221 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (18.58 mg, 0.442 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (5 mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (C291, 65 mg, 74%) as a solid. LCMS (ES, m/z): 391 [M−H]


Synthesis of Intermediate C292



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (65 mg, 0.166 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (36.74 mg, 0.183 mmol, 1.1 equiv) in DCM (1 mL) was added DIEA (107.04 mg, 0.830 mmol, 5 equiv) and HATU (81.87 mg, 0.216 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl 4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C292, 70 mg, 78%) as a solid. LCMS (ES, m/z): 540 [M−H]


Synthesis of Compound 474



embedded image


To a stirred solution of tert-butyl 4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (70 mg, 0.130 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 473, 13.7 mg, 24%) as solid. LCMS (ES, m/z): 440 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.94 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.79 (s, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.21 (dd, J=12.4, 1.7 Hz, 1H), 6.23 (d, J=15.2 Hz, 1H), 4.50 (q, J=7.3 Hz, 2H), 3.36 (d, J=10.0 Hz, 4H), 2.90 (t, J=4.9 Hz, 4H), 2.35 (s, 3H), 1.56 (t, J=7.3 Hz, 3H).


Example 198: Synthesis of Compound 476
Synthesis of Intermediate C293



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 4-aminopiperidine-1-carboxylate (288.6 mg, 1.440 mmol, 3.0 equiv) in dioxane (10 mL) were added Cs2CO3 (469.6 mg, 1.440 mmol, 3.0 equiv), RuPhos (22.4 mg, 0.048 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (80.3 mg, 0.096 mmol, 0.2 equiv). After stirring for 3 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 5) to afford tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]amino}piperidine-1-carboxylate (C293, 120 mg, 46%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 476



embedded image


A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]amino}piperidine-1-carboxylate (70 mg, 0.131 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 7) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperidin-4-ylamino) indazole-7-carboxamide (Compound 476, 27.4 mg, 48%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.90 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.74 (s, 1H), 7.96-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 6.89 (d, J=7.6 Hz, 1H), 6.19 (d, J=8.3 Hz, 1H), 4.56 (q, J=7.2 Hz, 2H), 3.55 (s, 1H), 3.00 (d, J=12.4 Hz, 2H), 2.60 (t, J=11.6 Hz, 2H), 2.35 (s, 3H), 1.95 (d, J=12.0 Hz, 2H), 1.61 (t, J=7.3 Hz, 3H), 1.39 (td, J=13.7, 12.2, 6.3 Hz, 2H).


Example 199: Synthesis of Compound 477
Synthesis of Intermediate C294



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 2,6-diazaspiro[3.3]heptane-2-carboxylate (214.3 mg, 1.080 mmol, 3.0 equiv) in dioxane (4 mL) were added Cs2CO3 (82.3 mg, 1.080 mmol, 3.0 equiv), RuPhos (16.8 mg, 0.036 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (60.2 mg, 0.072 mmol, 0.2 equiv). After stirring for 12 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-diazaspiro[3.3]heptane-2-carboxylate (C294, 160 mg, 83%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 477



embedded image


A solution of tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-diazaspiro[3.3]heptane-2-carboxylate (60 mg, 0.112 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 silica gel; mobile phase, CH3CN in water (0.05% NH3·H2O), 20% to 60% gradient in 10 min; detector, UV 254 nm. This resulted in 4-{2,6-diazaspiro[3.3]heptan-2-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (27.4 mg, 56.21%) as a light yellow solid.


LCMS (ES, m/z): 434 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.96 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.67 (s, 1H), 7.97-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 5.90 (d, J=8.2 Hz, 1H), 4.58 (q, J=7.2 Hz, 2H), 4.35 (s, 4H), 4.07 (s, 1H), 3.77 (s, 3H), 2.38-2.32 (m, 3H), 1.61 (t, J=7.3 Hz, 3H).


Example 200: Synthesis of Compound 478
Synthesis of Intermediate C295



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3S)-pyrrolidin-3-yl]carbamate (87.80 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (C295, 85 mg, 55%) as a solid. LCMS (ES, m/z): 421 [M+H]+


Synthesis of Intermediate C296



embedded image


To a stirred solution of methyl 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (85 mg, 0.202 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithium hydroxide hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (5 mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (C296, 60 mg, 73%) as solid. LCMS (ES, m/z): 405 [M−H]


Synthesis of Intermediate C297



embedded image


To a stirred mixture of 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (60 mg, 0.148 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (32.74 mg, 0.163 mmol, 1.1 equiv) in DCM (2 mL) was added DIEA (95.40 mg, 0.740 mmol, 5 equiv) and HATU (72.97 mg, 0.192 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl N-[(3S)-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (C297, 70 mg, 85%) as a solid. LCMS (ES, m/z): 554 [M+H]+


Synthesis of Compound 478



embedded image


To a stirred solution of tert-butyl N-[(3S)-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (70 mg, 0.126 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 478, 14.6 mg, 16%) as solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.47 (d, J=1.6 Hz, 1H), 8.71 (s, 1H), 8.09 (dd, J=2.4, 1.2 Hz, 1H), 7.93 (dd, J=11.3, 1.5 Hz, 1H), 5.99 (d, J=15.8 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 4.15-4.01 (m, 2H), 4.03-3.95 (m, 1H), 3.90 (h, J=6.7, 6.2 Hz, 2H), 2.88 (s, 3H), 2.65 (dt, J=13.5, 6.9 Hz, 1H), 2.59 (d, J=1.0 Hz, 3H), 2.41 (dt, J=11.9, 6.4 Hz, 1H), 1.70 (t, J=7.3 Hz, 3H).


Example 201: Synthesis of Compound 479
Synthesis of Intermediate C298



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (87.80 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (80 mg, 52%) as a solid. LCMS (ES, m/z): 421 [M+H]+


Synthesis of Intermediate C299



embedded image


To a stirred solution of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (80 mg, 0.190 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (15.97 mg, 0.380 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (5 mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (C299, 55 mg, 71%) as a solid. LCMS (ES, m/z): 405 [M−H]


Synthesis of Intermediate C300



embedded image


To a stirred mixture of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (55 mg, 0.135 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (30.01 mg, 0.149 mmol, 1.1 equiv) in DCM (1 mL) was added DIEA (87.45 mg, 0.675 mmol, 5 equiv) and HATU (66.89 mg, 0.176 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl N-[(3R)-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (C300, 65 mg, 86%) as solid. LCMS (ES, m/z): 554 [M+H]+


Synthesis of Compound 479



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (65 mg, 0.117 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide; trifluoroacetic acid (Compound 479, 23.6 mg, 35%) as a solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.20 (s, 1H), 9.38 (s, 1H), 8.88 (s, 1H), 8.84 (s, 3H), 8.07 (s, 1H), 7.60 (s, 1H), 5.91 (d, J=15.6 Hz, 1H), 4.55 (q, J=7.3 Hz, 2H), 3.96 (dd, J=19.8, 8.5 Hz, 2H), 3.87 (d, J=8.8 Hz, 1H), 3.77 (d, J=10.0 Hz, 2H), 2.75-2.68 (m, 3H), 2.42 (s, 4H), 2.35-2.21 (m, 1H), 1.59 (t, J=7.2 Hz, 3H).


Example 202: Synthesis of Compound 480
Synthesis of Intermediate C301



embedded image


A solution of amino 2,4,6-trimethylbenzenesulfonate (5.41 g, 25.130 mmol, 1.2 equiv) in DCM (60 mL) was treated with 5-bromo-3-fluoropyridin-2-amine (4 g, 20.942 mmol, 1 equiv) for 10 mins at 0° C. The mixture was stirred for 8 hr at 20° C. The precipitated solids were collected by filtration and washed with DCM (20 mL). The residue was purified by trituration with ether (20 mL) to afford 5-bromo-3-fluoro-2-iminopyridin-1-amine (C301, 3.8 g, 88%) as a solid. LCMS (ES, m/z): 206 [M+H]+


Synthesis of Intermediate C302



embedded image


A solution of 5-bromo-3-fluoro-2-iminopyridin-1-amine (2 g, 9.708 mmol, 1 equiv) in EtOH (60 mL) was treated with ethyl chloroacetate (2.38 g, 19.416 mmol, 2 equiv), K2CO3 (2.68 g, 19.416 mmol, 2 equiv) for 4 hr at 80° C. The residue was purified by silica gel column chromatography, eluted with PE:EA (70%) to afford 6-bromo-2-(chloromethyl)-8-fluoro-[1,2,4]triazolo[1,5-a]pyridine (C302, 1 g, 38%) as a solid. LCMS (ES, m/z): 264 [M+H]+


Synthesis of Intermediate C303



embedded image


A solution of 6-bromo-2-(chloromethyl)-8-fluoro-[1,2,4]triazolo[1,5-a]pyridine (831 mg, 3.142 mmol, 1 equiv) in DMF (20 mL) was treated with AcONa (386 mg, 4.713 mmol, 1.5 equiv) for 8 hr at 20° C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford {6-bromo-8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-2-yl}methyl acetate (C303, 500 mg, 55%) as a solid. LCMS (ES, m/z): 288 [M+H]+


Synthesis of Intermediate C304



embedded image


A solution of {6-bromo-8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-2-yl}methyl acetate (270 mg, 0.937 mmol, 1.5 equiv) in dioxane (5 mL) was treated with tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (224 mg, 0.625 mmol, 1.00 equiv), XantPhos (72 mg, 0.125 mmol, 0.2 equiv), Pd2(dba)3 (57 mg, 0.062 mmol, 0.1 equiv), Cs2CO3 (407 mg, 1.249 mmol, 2 equiv) for 8 hours at 110° C. under nitrogen atmosphere. The resulting mixture was washed with water 100 mL. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH 10:1. tert-butyl 4-[7-({2-[(acetyloxy)methyl]-8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C304, 300 mg, 84%) as a solid.


LCMS (ES, m/z): 567 [M+H]+


Synthesis of Intermediate C305



embedded image


A solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-8-fluoro-[1,2,4]triazolo[1,5-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (330 mg, 0.582 mmol, 1 equiv) in CH3OH (10 mL) was treated with K2CO3 (241.48 mg, 1.746 mmol, 3 equiv) for 1 hour at 80° C. The resulting mixture was filtered. the filter cake was washed with CH3OH (3×10 mL). The filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 15, Gradient 4) to afford tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)-[1,2,4]triazolo[1,5-a]pyridin-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (C305, 280 mg, 91%) as a solid.


LCMS (ES, m/z): 525[M+H]+


Synthesis of Compound 480



embedded image


A solution of tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)-[1,2,4]triazolo[1,5-a]pyridin-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (240 mg, 0.458 mmol, 1 equiv) in 1,4-dioxane (4 mL) was treated with HCl (4 mL) for 2 hr at 20° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford N-[8-fluoro-2-(hydroxymethyl)-[1,2,4]triazolo[1,5-a]pyridin-6-yl]-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 480, 2.2 mg, 1%) as a solid.


LCMS (ES, m/z): 425 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.33 (s, 1H), 9.57 (s, 1H), 8.82 (s, 1H), 7.97 (dd, J=17.9, 9.8 Hz, 2H), 6.50 (d, J=8.2 Hz, 1H), 5.55 (d, J=6.3 Hz, 1H), 4.67 (d, J=6.1 Hz, 2H), 4.31 (s, 3H), 2.91 (s, 4H).


Example 203: Synthesis of Compound 481
Synthesis of Intermediate C306



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and piperazine, 1-methyl- (43.91 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 2-ethyl-6-fluoro-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (C306, 90 mg, 76%) as a solid. LCMS (ES, m/z): 421 [M+H]+


Synthesis of Intermediate C307



embedded image


To a stirred solution of methyl 2-ethyl-6-fluoro-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (90 mg, 0.281 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithium hydroxide hydrate (23.58 mg, 0.562 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The residue was dissolved in methanol (5 mL). The solution was added HCl(gas) in MeOH (1 mL) dropwise at 0° C. The resulting mixture was stirred for 10 min at room temperature. The resulting mixture was concentrated under vacuum to afford 2-ethyl-6-fluoro-4-(4-methylpiperazin-1-yl) indazole-7-carboxylic acid (C307, 145 mg, 84%) as a solid. LCMS (ES, m/z): 307 [M+H]+


Synthesis of Compound 481



embedded image


To a stirred mixture of 2-ethyl-6-fluoro-4-(4-methylpiperazin-1-yl) indazole-7-carboxylic acid (145 mg, 0.237 mmol, 1 equiv, 50%) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (52.49 mg, 0.261 mmol, 1.1 equiv) in DCM (3 mL) was added HATU (116.98 mg, 0.308 mmol, 1.3 equiv) and DIEA (152.94 mg, 1.185 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 12) to afford 2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (Compound 481, 5.7 mg, 5%) as a solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.10 (d, J=1.6 Hz, 1H), 8.59 (s, 1H), 7.74 (d, J=2.9 Hz, 1H), 7.21 (dd, J=11.9, 1.7 Hz, 1H), 6.31 (d, J=15.5 Hz, 1H), 4.58 (q, J=7.3 Hz, 2H), 3.55 (t, J=5.0 Hz, 4H), 2.74-2.67 (m, 4H), 2.43 (d, J=12.4 Hz, 6H), 1.69 (t, J=7.3 Hz, 3H).


Example 204: Synthesis of Compound 482
Synthesis of Intermediate C308



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 2,5-diazaspiro[3.4]octane-5-carboxylate (153 mg, 0.720 mmol, 3.0 equiv) in dioxane (4 mL) were added Cs2CO3 (82.3 mg, 1.080 mmol, 3.0 equiv), RuPhos (16.8 mg, 0.036 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (60.2 mg, 0.072 mmol, 0.2 equiv). After stirring for 12 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,5-diazaspiro[3.4]octane-5-carboxylate (C308, 120 mg, 91%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 482



embedded image


A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,5-diazaspiro[3.4]octane-5-carboxylate (100 mg, 0.183 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, C18 silica gel; mobile phase, CH3CN in water (0.05% NH3·H2O), 20% to 60% gradient in 10 min; detector, UV 254 nm. This resulted in 4-{2,5-diazaspiro[3.4]octan-2-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 481, 25 mg, 30%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.97 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.67 (s, 1H), 7.98-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 5.90 (d, J=8.1 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 4.25 (d, J=8.2 Hz, 2H), 4.13 (d, J=8.2 Hz, 2H), 2.91 (t, J=6.9 Hz, 2H), 2.35 (s, 3H), 2.02 (dd, J=8.3, 6.4 Hz, 2H), 1.77 (p, J=7.1 Hz, 2H), 1.61 (t, J=7.3 Hz, 3H).


Example 205: Synthesis of Compound 390



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (50 mg, 0.124 mmol, 1 equiv) and 1H,4H,5H,6H,7H-pyrrolo[3,2-c]pyridine (18.22 mg, 0.149 mmol, 1.2 equiv) in dioxane (1 mL) was added Cs2CO3 (121.51 mg, 0.372 mmol, 3 equiv), RuPhos (11.60 mg, 0.025 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (10.40 mg, 0.012 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-{1H,4H,6H,7H-pyrrolo[3,2-c]pyridin-5-yl}indazole-7-carboxamide (Compound 390, 16 mg, 29%) as solid. LCMS (ES, m/z): 444 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.06 (s, 1H), 10.56 (s, 1H), 9.21 (s, 1H), 8.85 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.34 (d, J=12.7 Hz, 1H), 6.62 (t, J=2.6 Hz, 1H), 6.53 (d, J=8.4 Hz, 1H), 5.90 (t, J=2.5 Hz, 1H), 4.46 (s, 2H), 4.32 (s, 3H), 3.86 (t, J=5.5 Hz, 2H), 2.87 (t, J=5.4 Hz, 2H), 2.35 (s, 3H).


Example 206: Synthesis of Compound 143
Synthesis of Intermediate C309



embedded image


To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (500 mg, 1.387 mmol, 1 equiv) and HATU (633.00 mg, 1.664 mmol, 1.2 equiv) in DMF (10 mL) was added DIEA (537.91 mg, 4.161 mmol, 3 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (335.66 mg, 1.664 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was filtered. The filter cake was washed with methyl tert butyl ether (3×10 mL) and dried under infrared light to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C309, 460 mg, 65%) as solid. LCMS (ES, m/z): 508[M+H]+


Synthesis of Compound 143



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (460 mg, 0.906 mmol, 1 equiv) in dioxane (5 mL) was added HCl (gas) in 1,4-dioxane (5 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The resulting mixture was diluted with water (30 mL). The mixture was neutralized to pH 7 with saturated NaHCO3 (aq.). The aqueous layer was extracted with dichloromethane (3×100 mL). The combined organic layers were concentrated under reduced pressure to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 143, 297.7 mg, 80%) as solid. LCMS (ES, m/z): 408 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J=8.0 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.36 (t, J=5.0 Hz, 4H), 2.96-2.89 (m, 4H), 2.35 (s, 3H).


Example 207: Synthesis of Compound 468
Synthesis of Intermediate C310



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.432 mmol, 1 equiv) and tert-butyl N-methyl-N-(4-methylpiperidin-4-yl)carbamate (99 mg, 0.432 mmol, 1 equiv) in dioxane (5 mL) were added Cs2CO3 (423 mg, 1.296 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylcarbamate (C310, 210 mg, 86%) as a solid. LCMS (ES, m/z): 564 [M+H]+


Synthesis of Compound 460



embedded image


A solution of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylcarbamate (200 mg, 0.355 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[4-methyl-4-(methylamino)piperidin-1-yl]indazole-7-carboxamide (Compound 460, 50 mg, 30%) as a solid.


LCMS (ES, m/z): 464 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.90 (dd, J=3.2, 1.0 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.55-3.43 (m, 4H), 2.38-2.33 (m, 3H), 2.23 (s, 3H), 1.70 (dt, J=13.3, 4.6 Hz, 2H), 1.61 (q, J=7.4 Hz, 5H), 1.09 (s, 3H).


Example 208: Synthesis of Compound 496
Synthesis of Intermediate C311



embedded image


To a stirred mixture of Cis-tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-((1s,3s)-3-hydroxycyclobutyl)-2H-indazol-4-yl)piperazine-1-carboxylate (270.0 mg, 0.479 mmol, 1.0 equiv) and K2CO3 (133.3 mg, 0.958 mmol, 2.0 equiv), DMF (5 mL) were added methyl iodide (101.9 mg, 0.718 mmol, 1.5 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 6 hr at 50° C. under nitrogen atmosphere. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford Cis-tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-((1s,3s)-3-methoxycyclobutyl)-2H-indazol-4-yl)piperazine-1-carboxylate (C311, 150 mg, 49%) as a solid. LCMS (ES, m/z): 578 [M+H]+


Synthesis of Compound 496



embedded image


To a stirred mixture of Cis-tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-((1s,3s)-3-methoxycyclobutyl)-2H-indazol-4-yl)piperazine-1-carboxylate (150.0 mg, 0.260 mmol, 1.0 equiv) in DCM (2 mL) were added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford Cis-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-((1s,3s)-3-methoxycyclobutyl)-4-(piperazin-1-yl)-2H-indazole-7-carboxamide 2,2,2-trifluoroacetate (Compound 496, 70 mg, 44%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.52 (s, 1H), 9.68 (d, J=1.6 Hz, 1H), 9.11-9.07 (m, 2H), 9.03 (s, 1H), 8.41 (d, J=1.4 Hz, 1H), 8.12-8.02 (m, 2H), 6.64 (d, J=8.1 Hz, 1H), 5.62 (s, 1H), 4.96-4.84 (m, 1H), 4.17 (p, J=7.1 Hz, 1H), 4.01 (d, J=1.2 Hz, 3H), 3.63 (t, J=5.1 Hz, 4H), 3.37 (d, J=5.8 Hz, 4H), 2.98 (dhept, J=9.2, 2.5, 2.0 Hz, 2H), 2.66 (tdd, J=9.0, 7.5, 2.8 Hz, 2H), 2.55-2.50 (m, 3H).


Example 209: Synthesis of Compound 420
Synthesis of Intermediate C312



embedded image


To a stirred solution of NaH (1.42 g, 59.313 mmol, 1.5 equiv) in THF (100 mL) was added ethanol (2.19 g, 47.450 mmol, 1.2 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at room temperature under nitrogen atmosphere. To the above mixture was added 3,5-dibromopyrazin-2-amine (10.0 g, 39.542 mmol, 1.0 equiv) at room temperature. The resulting mixture was stirred for additional 16 hr at 50° C. The reaction was quenched with water at 0° C. The resulting mixture was extracted with ethyl acetate (2×100 mL). The combined organic layers were washed with water (1×200 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford 5-bromo-3-ethoxypyrazin-2-amine (C312, 6 g, 69%) as a solid. LCMS (ES, m/z): 218 [M+H]+


Synthesis of Intermediate C313



embedded image


To a stirred mixture of 5-bromo-3-ethoxypyrazin-2-amine (3.40 g, 15.592 mmol, 1 equiv) and 1-bromo-2,2-dimethoxypropane (3.42 g, 18.710 mmol, 1.2 equiv) in i-PrOH (60 mL) was added PPTS (0.39 g, 1.559 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 80° C. under nitrogen atmosphere. The mixture was neutralized to pH 7 with saturated NaHCO3 (aq.). The organic solvent was concentrated under vacuum. The residue was extracted with ethyl acetate (3×100 mL). The combined organic layers were washed with water (1×200 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford 6-bromo-8-ethoxy-2-methylimidazo[1,2-a]pyrazine (C313, 1.9 g, 47%) as a solid. LCMS (ES, m/z): 256 [M+H]+


Synthesis of Intermediate C314



embedded image


To a stirred mixture of tert-butyl N-[1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (280.0 mg, 0.577 mmol, 1 equiv, 77%) and 6-bromo-8-ethoxy-2-methylimidazo[1,2-a]pyrazine (221.8 mg, 0.865 mmol, 1.5 equiv) in dioxane (6 mL) were added Cs2CO3 (564.3 mg, 1.731 mmol, 3 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-{1-[7-({8-ethoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (C314, 180 mg, 56%) as a solid. LCMS (ES, m/z): 549 [M+H]+


Synthesis of Compound 420



embedded image


To a stirred mixture of tert-butyl N-{1-[7-({8-ethoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (170 mg, 0.310 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0° C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-ethoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-[3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (80 mg, 57%) as a solid. LCMS (ES, m/z): 449 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.18 (s, 1H), 8.97 (s, 1H), 8.83 (s, 1H), 7.94 (d, J=8.3 Hz, 1H), 7.89 (d, J=1.0 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.1 Hz, 2H), 4.24 (s, 3H), 3.83-3.73 (m, 2H), 3.65 (d, J=7.5 Hz, 1H), 3.44-3.31 (m, 2H), 2.50 (s, 3H), 2.49 (s, 3H), 2.16 (dt, J=13.0, 6.3 Hz, 1H), 1.94 (dt, J=11.8, 6.0 Hz, 1H), 1.47 (t, J=7.1 Hz, 3H).


Example 210: Synthesis of Compound 483
Synthesis of Intermediate C315



embedded image


A solution of methyl 3-fluoro-1H-pyrrole-2-carboxylate (10 g, 69.873 mmol, 1 equiv) in THF (100 mL) was treated with NaH (2.52 g, 104.810 mmol, 1.5 equiv) for 0.5 h at 0° C. under nitrogen atmosphere followed by the addition of SESCl (16.83 g, 83.848 mmol, 1.2 equiv) dropwise at 25° C. was stirred for 2 hr. The resulting mixture was extracted with EA (50 mL×2). The combined organic layers were washed with brine (20 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜ 50%) to afford methyl 3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylate (C315, 18 g, 94%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 11.68 (s, 1H), 6.87 (ddd, J=4.7, 3.8, 2.9 Hz, 1H), 6.03 (t, J=2.8 Hz, 1H), 4.24 (q, J=7.1 Hz, 2H), 1.27 (t, J=7.1 Hz, 3H).


Synthesis of Intermediate C316



embedded image


A solution of methyl 3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylate (19 g, 69.501 mmol, 1 equiv) and N-bromosuccinimide (13.61 g, 76.451 mmol, 1.1 equiv) in HOAc (150 mL, 2617.731 mmol, 37.66 equiv) was stirred for 2 hr at 25° C. under N2 atmosphere. The mixture was basified to pH 8 with Na2CO3. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜40%) to afford methyl 4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylate (C316, 3 g, 12%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 7.54 (d, J=4.8 Hz, 1H), 5.54 (d, J=1.0 Hz, 2H), 4.26 (q, J=7.1 Hz, 2H), 3.45 (t, J=7.8 Hz, 2H), 1.27 (t, J=7.1 Hz, 3H), 0.80 (t, J=7.8 Hz, 2H), 0.06 (s, 8H).


Synthesis of Intermediate C317



embedded image


A solution of methyl 4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylate (3 g, 8.516 mmol, 1 equiv) and LiOH (1.02 g, 42.580 mmol, 5 equiv) in MeOH (10 mL), THF (10 mL), H2O (10 mL) was stirred for 2 hr at 25° C. under N2 atmosphere. The resulting mixture was extracted with EA (20 mL×2). The combined organic layers were washed with brine (10 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylic acid (C317, 2.7 g, 93%) as a solid. LCMS (ES, m/z): 338 [M+H]+


Synthesis of Intermediate C318



embedded image


A solution 4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylic acid (2.7 g, 7.982 mmol, 1 equiv) and N,O-dimethylhydroxylamine (0.73 g, 11.973 mmol, 1.5 equiv), HATU (9.11 g, 23.946 mmol, 3 equiv), DIEA (3.10 g, 23.946 mmol, 3 equiv) in DCM (30 mL) was stirred for 2 hr at 25° C. under nitrogen atmosphere. The resulting mixture was extracted with EA (20 mL×2). The combined organic layers were washed with brine (10 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜50%) to afford 4-bromo-3-fluoro-N-methoxy-N-methyl-1-{[2-(trimethylsilyl) ethoxy] methyl}pyrrole-2-carboxamide (C318, 2.6 g, 85%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 7.40 (d, J=4.5 Hz, 1H), 5.36 (d, J=1.1 Hz, 2H), 3.61 (s, 3H), 3.37 (d, J=8.0 Hz, 2H), 2.08 (s, OH), 0.79 (dd, J=8.9, 7.5 Hz, 2H).


Synthesis of Intermediate C319



embedded image


A mixture of 4-bromo-3-fluoro-N-methoxy-N-methyl-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxamide (2.6 g, 6.818 mmol, 1 equiv) and MeMgBr (2.44 g, 20.454 mmol, 3 equiv) in THF (30 mL) was stirred for 12 h at 50° C. under N2 atmosphere. The resulting mixture was extracted with EA (20 mL×2). The combined organic layers were washed with brine (10 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜50%) to afford 1-(4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrol-2-yl)ethanone (C319, 1.4 g, 61%) as a solid. LCMS (ES, m/z): 334 [M−H]


Synthesis of Intermediate C320



embedded image


A solution of 1-(4-bromo-3-fluoro-1-{[2-(trimethylsilyl)ethoxy]methyl}pyrrol-2-yl)ethanone (1.4 g, 4.163 mmol, 1 equiv) and TFA (2.37 g, 20.815 mmol, 5 equiv) in DCM (14 mL) was stirred for 2 hr at 25° C. under N2 atmosphere. The resulting mixture was concentrated under reduced pressure to afford 1-(4-bromo-3-fluoro-1H-pyrrol-2-yl)ethanone (C320, 700 mg, 81%) as a solid. 1H NMR (300 MHz, DMSO-d6) δ 12.12 (s, 2H), 7.20 (d, J=4.2 Hz, 2H), 2.36 (d, J=2.5 Hz, 7H), 1.24 (s, 1H).


Synthesis of Intermediate C321



embedded image


A solution of 1-(4-bromo-3-fluoro-1H-pyrrol-2-yl)ethanone (700 mg, 3.398 mmol, 1 equiv) and bromoacetone (698.13 mg, 5.097 mmol, 1.5 equiv) in ACN (7 mL) was stirred for 12 hr at 50° C. under N2 atmosphere. The resulting mixture was extracted with EA (10 mL×2). The combined organic layers were washed with brine (5 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜50%) to afford 1-(2-acetyl-4-bromo-3-fluoropyrrol-1-yl)propan-2-one (C321, 430 mg, 48%) as a solid. LCMS (ES, m/z): 262 [M+H]+


Synthesis of Intermediate C322



embedded image


A solution 1-(2-acetyl-4-bromo-3-fluoropyrrol-1-yl)propan-2-one (430 mg, 1.641 mmol, 1 equiv) and NH4OAc (2529.45 mg, 32.820 mmol, 20 equiv) in AcOH (4 mL, 69.806 mmol, 42.55 equiv) was stirred for 12 hr at 120° C. under N2 atmosphere. The resulting mixture was extracted with EA (10 mL×2). The combined organic layers were washed with brine (5 mL×2), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜50%) to afford 7-bromo-8-fluoro-1,3-dimethylpyrrolo[1,2-a]pyrazine (C322, 270 mg, 67%) as a solid. LCMS (ES, m/z): 243 [M+H]+


Synthesis of Intermediate C323



embedded image


A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (150 mg, 0.417 mmol, 1 equiv) and 7-bromo-8-fluoro-1,3-dimethylpyrrolo[1,2-a]pyrazine (121.73 mg, 0.500 mmol, 1.2 equiv), XantPhos (24.15 mg, 0.042 mmol, 0.1 equiv), Pd2(dba)3 (38.22 mg, 0.042 mmol, 0.1 equiv), Cs2CO3 (407.92 mg, 1.251 mmol, 3 equiv) in dioxane (3 mL) was stirred for 12 h at 100° C. under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%˜80%) to afford tert-butyl 4-[7-({8-fluoro-1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (C323, 40 mg, 18%) as a solid LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 483



embedded image


A mixture of tert-butyl 4-[7-({8-fluoro-1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (40 mg, 0.077 mmol, 1 equiv) and TFA (43.72 mg, 0.385 mmol, 5 equiv) in DCM (2 mL) was stirred for 1 hr at 25° C. under N2 atmosphere. The residue was purified by reverse flash chromatography (Condition 9, Gradient 1) to afford N-{8-fluoro-1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 483, 3 mg, 9%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.40 (s, 1H), 9.08 (s, 2H), 8.94 (s, 1H), 8.60 (s, 1H), 8.21 (s, 1H), 8.06 (d, J=7.8 Hz, 1H), 6.63 (d, J=8.0 Hz, 1H), 4.28 (s, 3H), 3.62 (s, 4H), 3.35 (s, 4H), 2.80 (s, 3H), 2.34 (s, 3H).


Example 211: Synthesis of Compound 485
Synthesis of Intermediate C234



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 3-hydroxypyrrolidine-1-carboxylate (269.8 mg, 1.440 mmol, 3.0 equiv) in dioxane (5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}pyrrolidine-1-carboxylate (C234, 80 mg, 31%) as a solid. LCMS (ES, m/z): 523 [M+H]+


Synthesis of Compound 485



embedded image


A solution of tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}pyrrolidine-1-carboxylate (80 mg, 0.153 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol) in DCM (2 mL) was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(pyrrolidin-3-yloxy) indazole-7-carboxamide (Compound 485, 30 mg, 46%) as a solid. LCMS (ES, m/z): 423[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.41 (d, J=1.5 Hz, 1H), 9.29 (s, 1H), 9.13 (s, 1H), 8.68 (s, 1H), 8.10 (d, J=8.1 Hz, 2H), 7.71 (d, J=12.0 Hz, 1H), 6.75 (d, J=8.2 Hz, 1H), 5.43 (s, 1H), 4.64 (q, J=7.3 Hz, 2H), 3.65-3.35 (m, 4H), 3.51 (s, 1H), 2.43 (d, J=0.9 Hz, 3H), 2.41-2.20 (m, 2H), 1.62 (t, J=7.3 Hz, 3H).


Example 212: Synthesis of Compound 486



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100.0 mg, 0.24 mmol, 1.0 equiv) and morpholine (43.3 mg, 0.49 mmol, 2.0 equiv) in dioxane (1 mL) were added Cs2CO3 (243.0 mg, 0.74 mmol, 3.0 equiv), RuPhos (23.2 mg, 0.05 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100° C. under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(morpholin-4-yl) indazole-7-carboxamide (Compound 486, 21 mg, 20%) as a solid. LCMS (ES, m/z): 409 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.08 (s, 1H), 9.22 (d, J=1.6 Hz, 1H), 8.87 (s, 1H), 8.00 (d, J=8.0 Hz, 1H), 7.91 (d, J=2.7 Hz, 1H), 7.35 (dd, J=12.5, 1.7 Hz, 1H), 6.53 (d, J=8.1 Hz, 1H), 4.30 (s, 3H), 3.88-3.75 (m, 4H), 3.41 (t, J=4.8 Hz, 4H), 2.38-2.31 (m, 3H).


Example 213: Synthesis of Compound 487



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100.0 mg, 0.25 mmol, 1.0 equiv) and pyrrolidine (35.3 mg, 0.50 mmol, 2.0 equiv) in dioxane (1 mL) were added Cs2CO3 (243.0 mg, 0.74 mmol, 3.0 equiv), RuPhos (23.2 mg, 0.05 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100° C. under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(pyrrolidin-1-yl) indazole-7-carboxamide (Compound 487, 47.5 mg, 48%) as a solid.


LCMS (ES, m/z): 393 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.7 Hz, 1H), 8.82 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.88 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.5, 1.7 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.64 (t, J=4.9 Hz, 4H), 2.35 (s, 3H), 2.23-1.91 (m, 4H).


Example 214: Synthesis of Compound 488
Synthesis of Intermediate C235



embedded image


To a solution of 6-bromo-3-methyl-[1,2,4]triazolo[4,3-a]pyridine (100 mg, 0.472 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (203.40 mg, 0.566 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs2CO3 (460.9 mg, 1.416 mmol, 3.0 equiv), XantPhos (27.2 mg, 0.047 mmol, 0.1 equiv) and Pd2(dba)3 (43.1 mg, 0.047 mmol, 0.1 equiv). After stirring for 3 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford in tert-butyl 4-[2-methyl-7-({3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C235, 200 mg, 86%) as a solid. LCMS (ES, m/z): 491 [M+H]+


Synthesis of Compound 488



embedded image


A solution of tert-butyl 4-[2-methyl-7-({3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (80 mg, 0.163 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2-methyl-N-{3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 488, 30 mg, 47%) as a solid. LCMS (ES, m/z): 391[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.24 (s, 1H), 9.19-9.12 (m, 1H), 8.82 (s, 1H), 8.00 (d, J=8.1 Hz, 1H), 7.80 (dd, J=9.7, 1.0 Hz, 1H), 7.44 (dd, J=9.7, 1.8 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.54 (s, 1H), 3.41-3.33 (m, 4H), 2.92 (d, J=5.6 Hz, 3H), 2.69 (s, 3H).


Example 215: Synthesis of Compound 489
Synthesis of Intermediate C236



embedded image


To a solution of 7-bromo-2-methyl-[1,2,4]triazolo[1,5-a]pyridine (100 mg, 0.472 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (203.4 mg, 0.566 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs2CO3 (460.9 mg, 1.416 mmol, 3.0 equiv), XantPhos (54.5 mg, 0.094 mmol, 0.2 equiv) and Pd2(dba)3 (27.1 mg, 0.047 mmol, 0.1 equiv). After stirring for 1 hr at 80° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4-[2-methyl-7-({2-methyl-[1,2,4]triazolo[1,5-a]pyridin-7-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (C236, 200 mg, 86%) as a solid. LCMS (ES, m/z): 491 [M+H]+


Synthesis of Compound 489



embedded image


A solution of tert-butyl 4-[2-methyl-7-({2-methyl-[1,2,4]triazolo[1,5-a]pyridin-7-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (60 mg, 0.122 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2-methyl-N-{2-methyl-[1,2,4]triazolo[1,5-a]pyridin-7-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 489, 20 mg, 41%) as a solid. LCMS (ES, m/z): 391[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.52 (s, 1H), 8.85-8.73 (m, 2H), 8.34-8.27 (m, 1H), 8.01 (d, J=8.2 Hz, 1H), 7.31 (dd, J=7.4, 2.3 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.38 (t, J=4.9 Hz, 4H), 2.92 (t, J=4.9 Hz, 4H), 2.44 (s, 3H).


Example 216: Synthesis of Compound 490



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (60.0 mg, 0.122 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl)-2H-indazole-7-carboxamide (Compound 490, 22.1 mg, 44%) as a solid. LCMS (ES, m/z): 394 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 13.14 (m, 1H), 10.43 (m, 1H), 9.23-9.17 (m, 1H), 8.88 (s, 2H), 8.38 (s, 1H), 8.12-8.01 (m, 2H), 7.67 (s, 1H), 6.68 (d, J=8.2 Hz, 1H), 3.65 (t, J=5.1 Hz, 4H), 3.37 (m, 4H), 2.42 (s, 3H).


Example 217: Synthesis of Compound 491
Synthesis of Intermediate C237



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (140 mg, 0.336 mmol, 1 equiv), Cs2CO3 (329 mg, 1.008 mmol, 3 equiv) and tert-butyl 2,6-diazaspiro[3.4]octane-6-carboxylate (214 mg, 1.008 mmol, 3 equiv) in dioxane (2 mL) were added RuPhos (117 mg, 0.034 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (112 mg, 0.134 mmol, 0.4 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 hr at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA/MeOH (10:1) to afford tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-diazaspiro[3.4]octane-6-carboxylate (C237, 120 mg, 65%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 491



embedded image


A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-diazaspiro[3.4]octane-6-carboxylate (120 mg, 0.219 mmol, 1 equiv) in trifluoroacetic acid (5 mL) and DCM (5 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 4-{2,6-diazaspiro[3.4]octan-2-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (491, 18 mg, 18%) as an solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (300 MHz, Chloroform-d) δ 11.00 (s, 1H), 9.26 (d, J=1.6 Hz, 1H), 8.20 (d, J=8.0 Hz, 1H), 8.00 (s, 1H), 7.47-7.39 (m, 1H), 6.83 (dd, J=11.3, 1.6 Hz, 1H), 5.96 (d, J=8.1 Hz, 1H), 4.53 (q, J=7.3 Hz, 2H), 4.23 (d, J=1.5 Hz, 4H), 3.27 (s, 2H), 3.13 (t, J=7.1 Hz, 2H), 2.49 (d, J=0.8 Hz, 3H), 2.18 (t, J=7.1 Hz, 2H), 1.73 (d, J=14.6 Hz, 3H).


Example 218: Synthesis of Compound 492
Synthesis of Intermediate C238



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1 equiv) and tert-butyl 2,7-diazaspiro[3.5]nonane-7-carboxylate (407.78 mg, 1.802 mmol, 1.5 equiv) in dioxane (12 mL) were added Cs2CO3 (1.17 g, 3.603 mmol, 3.0 equiv), RuPhos (56.1 mg, 0.120 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (200.9 mg, 0.240 mmol, 0.2 equiv). After stirring for 12 hr at 100° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The resulting mixture was diluted with H2O (20 mL). The resulting mixture was extracted with DCM (3×20 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,7-diazaspiro [3.5] nonane-7-carboxylate (C238, 500 mg, 74.11%) as a solid. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 492



embedded image


A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,7-diazaspiro[3.5]nonane-7-carboxylate (100 mg, 0.178 mmol, 1 equiv) and TFA (0.4 mL) in DCM (4 mL) was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 7, Gradient 3) to afford 4-{2,7-diazaspiro[3.5]nonan-2-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 492, 40 mg, 48%) as a solid. LCMS (ES, m/z): 462[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.96 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.71 (s, 1H), 7.97-7.86 (m, 2H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 5.88 (d, J=8.2 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.97 (s, 4H), 2.69 (s, 4H), 2.35 (s, 3H), 1.72 (d, J=5.6 Hz, 4H), 1.61 (t, J=7.3 Hz, 3H).


Example 219: Synthesis of Compound 493
Synthesis of Intermediate C339



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (93.95 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (C339, 95 mg, 59%) as a solid. LCMS (ES, m/z): 435 [M+H]+


Synthesis of Intermediate C340



embedded image


To a stirred solution of methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 0.219 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (5 mL). The mixture was acidified to pH 4 with citric acid and extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (C340, 85 mg, 92%) as a solid. LCMS (ES, m/z): 419 [M−H]


Synthesis of Intermediate C341



embedded image


To a stirred mixture of 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (85 mg, 0.202 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (44.83 mg, 0.222 mmol, 1.10 equiv) in DCM (2 mL) was added DIEA (130.63 mg, 1.010 mmol, 5 equiv) and HATU (99.92 mg, 0.263 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (C341, 80 mg, 69%) as a solid.


LCMS (ES, m/z): 568 [M−H]


Synthesis of Compound 493



embedded image


To a stirred solution of tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (80 mg, 0.141 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide; trifluoroacetic acid (Compound 493, 31.4 mg, 38%) as a solid. LCMS (ES, m/z): 468 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.40 (s, 1H), 9.19 (s, 1H), 8.91 (s, 1H), 8.56 (d, J=11.5 Hz, 1H), 8.11 (s, 1H), 7.58 (d, J=12.2 Hz, 1H), 6.48 (d, J=14.4 Hz, 1H), 4.52 (q, J=7.3 Hz, 2H), 4.04 (d, J=13.2 Hz, 2H), 2.95 (t, J=12.4 Hz, 2H), 2.44 (d, J=4.9 Hz, 3H), 1.58 (t, J=7.3 Hz, 3H), 1.32 (d, J=6.4 Hz, 6H).


Example 220: Synthesis of Compound 494
Synthesis of Intermediate C342



embedded image


To a solution of methyl 4-bromo-2-methylindazole-7-carboxylate (3 g, 11.148 mmol, 1 equiv) and piperazine, 1-methyl- (1.68 g, 16.722 mmol, 1.5 equiv) in dioxane (5 mL) were added Cs2CO3 (9.08 g, 27.870 mmol, 2.5 equiv), RuPhos Palladacycle Gen.3 (932 mg, 1.115 mmol, 0.1 equiv) and RuPhos (520 mg, 1.115 mmol, 0.1 equiv). After stirring for 16 hr at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford methyl 2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (C342, 2.5 g, 77%) as an oil. LCMS (ES, m/z): 289 [M+H]+


Synthesis of Intermediate C343



embedded image


A solution of methyl 2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxylate (500 mg, 1.734 mmol, 1 equiv) in NH3(g) in MeOH (40 mL) was stirred for 48 h at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford 2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (400 mg, 84.39%) as a solid. LCMS (ES, m/z): 274 [M+H]+


Synthesis of Intermediate C344



embedded image


To a solution of 2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (300 mg, 1.098 mmol, 1 equiv) and 6-bromo-4-fluoro-2-(methoxymethyl)-1,3-benzoxazole (428 mg, 1.647 mmol, 1.5 equiv) in dioxane (10 mL), were added Cs2CO3 (893.99 mg, 2.745 mmol, 2.5 equiv), Pd2(dba)3 (100 mg, 0.110 mmol, 0.1 equiv) and XantPhos (63 mg, 0.110 mmol, 0.1 equiv). After stirring for 4 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford N-[4-fluoro-2-(methoxymethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (C343, 200 mg, 40%) as a solid. 1H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 8.80 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.41 (dd, J=12.2, 2.2 Hz, 1H), 7.24 (t, J=1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.72 (s, 2H), 4.28 (s, 3H), 3.91 (s, 3H), 3.42 (t, J=4.9 Hz, 4H), 2.54 (d, J=5.1 Hz, 4H), 2.27 (s, 3H).


Synthesis of Compound 494



embedded image


To a stirred solution of N-[4-fluoro-2-(methoxymethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (150 mg, 0.331 mmol, 1 equiv) in DCM (5 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by trituration with DMSO (5 mL) to afford N-[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(4-methylpiperazin-1-yl) indazole-7-carboxamide (Compound 494, 120 mg, 82%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.96 (s, 1H), 8.76 (s, 1H), 7.93 (d, J=8.0 Hz, 1H), 7.20 (dd, J=12.6, 2.3 Hz, 1H), 6.93 (t, J=1.9 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.27 (s, 3H), 4.20 (s, 2H), 3.39 (t, J=5.0 Hz, 4H), 2.53 (d, J=5.6 Hz, 4H), 2.27 (s, 3H).


Example 221: Synthesis of Compound 495
Synthesis of Intermediate C345



embedded image


A solution of 7-bromo-2-methyl-[1,2,4]triazolo[1,5-a]pyridine (1.6 g, 7.545 mmol, 1 equiv) in dioxane (30 mL) was treated with acetamide (0.89 g, 15.090 mmol, 2 equiv), Pd(OAc)2 (0.17 g, 0.755 mmol, 0.1 equiv) X-Phos (0.72 g, 1.509 mmol, 0.2 equiv), Cs2CO3 (4.92 g, 15.090 mmol, 2 equiv) for 8 hr at 100° C. under nitrogen atmosphere. The resulting mixture was washed with NaHCO3 (3×100 mL). The residue was purified by silica gel column chromatography, eluted with PE:EA (50%) to afford N-{2-methyl-[1,2,4]triazolo[1,5-a]pyridin-7-yl}acetamide (2 g, 77%) as a solid. LCMS (ES, m/z): 191 [M+H]+


Synthesis of Intermediate C346



embedded image


A solution of N-{2-methyl-[1,2,4]triazolo[1,5-a]pyridin-7-yl}acetamide (1.6 g, 8.412 mmol, 1 equiv) in EtOH (200 mL) was treated with PtO2 (0.80 g, 3.533 mmol, 0.42 equiv), TFA (0.80 g, 6.982 mmol, 0.83 equiv) for 16 hr at 100° C. under H2 (30 atm). The resulting mixture was filtered. the filter cake was washed with 100 mL of methanol. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA/PE 1:3 to afford N-{2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-yl}acetamide (C346, 1 g, 61%, crude) as an oil. LCMS (ES, m/z): 195 [M+H]+


Synthesis of Intermediate C347



embedded image


A solution of N-{2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-yl}acetamide (300 mg, 1.544 mmol, 1 equiv) in methanol (5 mL) was treated with HCl (5 mL, 15.000 mmol, 9.71 equiv) for 1 hr at 20° C. The residue was acidified to pH 7 with ammonia. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford 2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-amine (C347, 200 mg, 85%) as a solid. LCMS (ES, m/z): 153 [M+H]+


Synthesis of Intermediate C348



embedded image


A solution of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylic acid (100 mg, 0.277 mmol, 1.00 equiv) in DMF (5 mL) was treated with 2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-amine (42 mg, 0.277 mmol, 1.00 equiv), HATU (126 mg, 0.332 mmol, 1.20 equiv), DIEA (107 mg, 0.828 mmol, 2.99 equiv) for 2 hours at 20° C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford tert-butyl 4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate-(C348, 60 mg, 43%) as a solid. LCMS (ES, m/z): 495 [M+H]+


Synthesis of Compound 495



embedded image


A solution of tert-butyl-4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.202 mmol, 1 equiv) in DCM (5 mL) was treated with HCl (gas) in 1,4-dioxane (10 mL, 329.128 mmol, 1627.87 equiv) for 30 mins at 20° C. Desired product could be detected by LCMS. The mixture was neutralized to pH 7 with NaHCO3. The resulting solution was dried N2 gas. The residue was purified by prep-(Condition 16, Gradient 1) to afford 2-methyl-N-{2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[1,5-a]pyridin-7-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (Compound 495, 6 mg, 7%) as a solid.


LCMS (ES, m/z): 395 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 9.21 (d, J=7.1 Hz, 1H), 8.67 (s, 1H), 7.87 (d, J=7.9 Hz, 1H), 6.41 (d, J=8.1 Hz, 1H), 4.52 (t, J=7.2 Hz, 1H), 4.20 (hept, J=7.6, 6.7 Hz, 2H), 4.11 (s, 3H), 3.26 (t, J=5.0 Hz, 5H), 3.17 (d, J=5.4 Hz, 2H), 2.91 (dt, J=9.5, 5.4 Hz, 4H), 2.55-2.47 (m, 1H), 2.39-2.23 (m, 1H), 2.28 (s, 1H), 2.21 (s, 3H).


Example 222: Synthesis of Compound 435
Synthesis of Intermediate C349



embedded image


To a stirred solution of 4-bromo-2H-1,2,3-benzotriazole (2.7 g, 13.635 mmol, 1.0 equiv) and K2CO3 (3.8 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0° C. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (2×200 mL). The combined organic layers were washed with water (2×200 mL), brine (2×200 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/PE (5:1) to afford 4-bromo-1-methyl-1,2,3-benzotriazole (C349, 0.8 g, 25%) as a solid. LCMS (ES, m/z): 212 [M+H]+


Synthesis of Intermediate C350



embedded image


To a solution of 4-bromo-1-methyl-1,2,3-benzotriazole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (0.9 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs2CO3 (3.0 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.3 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 hr at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(1-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (C350, 0.83 g, 63%) as a solid. LCMS (ES, m/z): 318 [M+H]+


Synthesis of Intermediate C351



embedded image


To a stirred solution of tert-butyl 4-(1-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with deionized water (30 mL). The resulting mixture was extracted with ethyl acetate (2×40 mL). The combined organic layers were washed with water (2×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(7-bromo-1-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (C351 800 mg, 69%) as a solid. LCMS (ES, m/z): 396 [M+H]+


Synthesis of Intermediate C352



embedded image


To a solution of tert-butyl 4-(7-bromo-1-methyl-1,2,3-benzotriazol-4-yl)piperazine-1-carboxylate (250.0 mg, 0.631 mmol, 1.0 equiv) in MeOH (20 mL) was added Pd(dppf)Cl2 (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80° C. for 16 hr. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford methyl 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-3-methyl-1,2,3-benzotriazole-4-carboxylate (240.0 mg, 94.24%) as a solid. LCMS (ES, m/z): 376 [M+H]+


Synthesis of Intermediate C353



embedded image


To a stirred mixture of methyl 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-3-methyl-1,2,3-benzotriazole-4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOH·H2O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50° C. The resulting mixture was diluted with water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2×30 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-3-methyl-1,2,3-benzotriazole-4-carboxylic acid (C353, 150 mg, 85%) as a solid. LCMS (ES, m/z): 362 [M+H]+


Synthesis of Intermediate C354



embedded image


To a stirred solution of 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-3-methyl-1,2,3-benzotriazole-4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a] pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with brine (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-1-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (C354, 110 mg, 66%) as a solid. LCMS (ES, m/z): 509 [M+H]+


Synthesis of Compound 435



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-1-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-3-methyl-7-(piperazin-1-yl)-1,2,3-benzotriazole-4-carboxamide (Compound 435, 26.8 mg, 32%) as a solid. LCMS (ES, m/z): 409 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.87 (s, 1H), 9.18 (d, J=1.7 Hz, 1H), 8.00 (d, J=7.9 Hz, 1H), 7.93 (dd, J=3.2, 1.0 Hz, 1H), 7.39 (dd, J=12.4, 1.7 Hz, 1H), 7.24 (d, J=7.9 Hz, 1H), 4.58 (s, 3H), 3.04-2.97 (m, 8H), 2.36 (s, 3H).


Example 223: Synthesis of Compound 436
Synthesis of Intermediate C355



embedded image


To a stirred solution of 4-bromo-2H-1,2,3-benzotriazole (2.7 g, 13.635 mmol, 1.0 equiv) and K2CO3 (3.8 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0° C. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with deionized water (100 mL). The resulting mixture was extracted with ethyl acetate (2×100 mL). The combined organic layers were washed with brine (2×100 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/PE (5:1) to afford 7-bromo-1-methyl-1,2,3-benzotriazole (C355, 1 g, 31%) as a solid. LCMS (ES, m/z): 212 [M+H]+


Synthesis of Intermediate C356



embedded image


To a solution of 7-bromo-1-methyl-1,2,3-benzotriazole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine-1-carboxylate (0.91 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs2CO3 (3.1 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.3 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(3-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (C356, 780 mg, 61%) as a solid. LCMS (ES, m/z): 318 [M+H]+


Synthesis of Intermediate C357



embedded image


To a stirred solution of tert-butyl 4-(3-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with ethyl acetate (2×40 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(7-bromo-3-methyl-1,2,3-benzotriazol-4-yl)piperazine-1-carboxylate (C357, 830 mg, 72%) as a solid. LCMS (ES, m/z): 396 [M+H]+


Synthesis of Intermediate C358



embedded image


To a solution of tert-butyl 4-(7-bromo-3-methyl-1,2,3-benzotriazol-4-yl) piperazine-1-carboxylate (250 mg, 0.631 mmol, 1 equiv) in 20 mL MeOH was added Pd(dppf)Cl2CH2Cl2 (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80° C. for 16 hr. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (30:1) to afford methyl 7-[4-(tert-butoxycarbonyl)piperazin-1-yl]-1-methyl-1,2,3-benzotriazole-4-carboxylate (C358, 230 mg, 87%) as a solid. LCMS (ES, m/z): 376 [M+H]+


Synthesis of Intermediate C359



embedded image


To a stirred mixture of methyl 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-1-methyl-1,2,3-benzotriazole-4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOH·H2O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50° C. The resulting mixture was diluted with deionized water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2×30 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-1-methyl-1,2,3-benzotriazole-4-carboxylic acid (C359, 145 mg, 83%) as a solid. LCMS (ES, m/z): 362 [M+H]+


Synthesis of Intermediate C360



embedded image


To a stirred solution of 7-[4-(tert-butoxycarbonyl) piperazin-1-yl]-1-methyl-1,2,3-benzotriazole-4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a] pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was extracted with ethyl acetate (2×20 mL). The combined organic layers were washed with brine (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-3-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (C360, 120 mg, 72%) as a solid. LCMS (ES, m/z): 509 [M+H]+


Synthesis of Compound 436



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}carbamoyl)-3-methyl-1,2,3-benzotriazol-4-yl]piperazine-1-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-1-methyl-7-(piperazin-1-yl)-1,2,3-benzotriazole-4-carboxamide (Compound 436, 41.4 mg, 51%) as a solid. LCMS (ES, m/z): 409 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.53 (s, 1H), 9.14 (d, J=1.6 Hz, 1H), 7.98-7.91 (m, 1H), 7.75 (d, J=8.2 Hz, 1H), 7.27 (dd, J=12.7, 1.6 Hz, 1H), 6.67 (d, J=8.3 Hz, 1H), 4.31 (s, 3H), 3.80 (dd, J=6.1, 3.9 Hz, 4H), 2.94 (dd, J=6.2, 3.8 Hz, 4H), 2.35 (d, J=0.8 Hz, 3H).


Example 224: Synthesis of Compound 448
Synthesis of Intermediate C361



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (110 mg, 0.273 mmol, 1 equiv) and tert-butyl N-methyl-N-(piperidin-4-yl)carbamate (70.33 mg, 0.328 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (267.31 mg, 0.819 mmol, 3 equiv), RuPhos (25.52 mg, 0.055 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (22.87 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-methylcarbamate (C461, 80 mg, 54%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 448



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-methylcarbamate (80 mg, 0.149 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 13) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[4-(methylamino)piperidin-1-yl]indazole-7-carboxamide (Compound 448, 29 mg, 44%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.34 (dd, J=12.4, 1.7 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.30 (s, 3H), 3.88 (d, J=12.9 Hz, 2H), 3.13-3.02 (m, 2H), 2.61-2.52 (m, 1H), 2.35 (s, 3H), 2.33 (s, 3H), 2.01-1.93 (m, 2H), 1.41 (dd, J=16.9, 7.3 Hz, 2H).


Example 225: Synthesis of Compound 449



embedded image


Compound 373 (50 mg) was purified by Prep-Chiral HPLC (Condition 17, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3-{[1-(fluoromethyl)cyclopropyl]amino}pyrrolidin-1-yl]-2-methylindazole-7-carboxamide (Compound 449, 15.1 mg, 29%, assumed) as a solid. LCMS (ES, m/z): 480 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.05 (s, 1H), 8.55 (s, 1H), 8.04 (d, J=8.7 Hz, 1H), 7.72 (s, 1H), 7.24 (d, J=11.8 Hz, 1H), 6.07 (d, J=8.3 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.30 (s, 3H), 3.90 (d, J=6.0 Hz, 3H), 3.84 (s, 1H), 3.72 (d, J=9.7 Hz, 1H), 2.44 (s, 3H), 2.36-2.31 (m, 1H), 2.05 (s, 1H), 0.82-0.70 (m, 4H).


Example 226: Synthesis of Compound 461



embedded image


Compound 373 (50 mg) was purified by Prep-Chiral HPLC (Condition 17, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3R)-3-{[1-(fluoromethyl)cyclopropyl]amino}pyrrolidin-1-yl]-2-methylindazole-7-carboxamide (Compound 461, 17.9 mg, 33%) as a solid. LCMS (ES, m/z): 480 [M+H]+1H NMR (400 MHz, Methanol-d4) δ 9.02 (d, J=1.7 Hz, 1H), 8.51 (s, 1H), 8.03 (d, J=8.5 Hz, 1H), 7.70 (d, J=2.9 Hz, 1H), 7.18 (d, J=11.9 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.29 (s, 3H), 3.94-3.76 (m, 3H), 3.69 (q, J=8.1 Hz, 1H), 3.47 (s, 1H), 2.44 (d, J=0.9 Hz, 3H), 2.33 (dd, J=12.1, 6.4 Hz, 1H), 2.04 (dd, J=12.4, 6.7 Hz, 1H), 0.85-0.66 (m, 4H).


Example 227: Synthesis of Compounds



embedded image


4-[3-(dimethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (20 mg) was purified by PREP-CHIRAL-HPLC with the following conditions (Column: CHIRAL ART Cellulose-SB, 2×25 cm, 5 um; Mobile Phase A: MtBE (0.1% DEA)-HPLC-Imported, Mobile Phase B: EtOH-HPLC; Flow rate: 20 mL/min; Gradient: 10% B to 10% B in 7.5 min; Wave Length: 220/254 nm; RT1 (min): 5.9; RT2 (min): 6.4; Sample Solvent: MeOH:DCM=2:1; Injection Volume: 0.2 mL; Number Of Runs: 18) to afford Compound 351 (5 mg) as a solid and Compound 350 (Second peak, 5 mg) as a solid. Compound 351: LCMS: (ES, m/z): 436 [M+H]+ 1H NMR: (400 MHz, DMSO-d6) δ 11.02 (d, J 2.4 Hz, 1H), 9.20 (t, J 2.1 Hz, 1H), 8.87 (d, J 2.4 Hz, 1H), 7.97-7.86 (m, 2H), 7.36-7.28 (m, 1H), 6.05 (dd, J 8.3, 2.4 Hz, 1H), 4.28 (d, J 2.4 Hz, 3H), 3.85 (s, 1H), 3.77 (s, 1H), 3.65 (d, J 9.3 Hz, 1H), 3.46 (s, 2H), 2.89 (s, 1H), 2.35 (d, J 2.4 Hz, 6H), 2.29 (s, 3H), 1.92 (s, 1H). Compound 350 LCMS: (ES, m/z): 436 [M+H]+ 1H NMR: (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J 1.7 Hz, 1H), 8.87 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J 12.4, 1.7 Hz, 1H), 6.05 (d, J 8.4 Hz, 1H), 4.28 (s, 3H), 3.85 (t, J 8.6 Hz, 1H), 3.77 (t, J 9.4 Hz, 1H), 3.64 (q, J 8.9 Hz, 1H), 3.48 (d, J 9.0 Hz, 2H), 2.91 (s, 1H), 2.37-2.33 (m, 3H), 2.29 (s, 6H), 1.92 (t, J 10.3 Hz, 1H).


Example 228: Synthesis of Compound 304
Synthesis of Intermediate C363



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.20 mmol, 1.0 equiv) and 4-iodooxane (64.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) were added Cs2CO3 (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The reaction was quenched by the addition of water at room temperature. The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxan-4-yl) indazol-4-yl]piperazine-1-carboxylate (41 mg, 35%) as a solid. LCMS (ES, m/z): 578 [M+H]+


Synthesis of Compound 304



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxan-4-yl) indazol-4-yl]piperazine-1-carboxylate (40 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxan-4-yl)-4-(piperazin-1-yl) indazole-7-carboxamide trifluoroacetic acid salt (22.8 mg, 50%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.17 (s, 1H), 9.44 (d, J=1.6 Hz, 1H), 9.15 (s, 2H), 9.00 (s, 1H), 8.13 (d, J=2.6 Hz, 1H), 8.04 (d, J=8.0 Hz, 1H), 7.71 (dd, J=11.8, 1.6 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.95 (tt, J=10.4, 5.5 Hz, 1H), 4.10 (dt, J=11.2, 3.2 Hz, 2H), 3.69-3.51 (m, 6H), 3.37-3.35 (m, 4H), 2.44 (s, 3H), 2.25 (td, J=10.3, 9.5, 4.1 Hz, 4H).


Example 229: Synthesis of Compound 342
Synthesis of Intermediate C365



embedded image


To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (5.0 g, 19.602 mmol, 1 equiv) and in EA (150 mL) was added tetrafluoroboranuide; trimethyloxidanium (14.50 g, 98.010 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with EA (150 mL) and washed with water (3×200 mL). The organic phase was dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-methylindazole-7-carboxylate (4.8 g, 91%) as a solid. LCMS (ES, m/z): 269[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 8.62 (s, 1H), 7.84 (d, J=7.6 Hz, 1H), 7.42 (d, J=7.7 Hz, 1H), 4.25 (s, 3H), 3.89 (s, 3H).


Synthesis of Intermediate C366



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (4.5 g, 16.723 mmol, 1 equiv) and tert-butyl piperazine-1-carboxylate (6.23 g, 33.446 mmol, 2 equiv) in dioxane (90 mL) was added Cs2CO3 (16.35 g, 50.169 mmol, 3 equiv), RuPhos (1.56 g, 3.345 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (1.40 g, 1.672 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (5.2 g, 83%) as a solid. LCMS (ES, m/z): 375[M+H]+


Synthesis of Intermediate C367



embedded image


A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-methylindazole-7-carboxylate (2.5 g, 6.677 mmol, 1 equiv) in NH3(g) in MeOH (70 mL) was stirred for 2 days at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (1.35 g, 56%) as an solid. LCMS (ES, m/z): 360[M+H]+


Synthesis of Intermediate C368



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) and Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv) were added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). After stirring for overnight at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (35 mg, 40%) as a solid. LCMS (ES, m/z): 521 [M+H]+


Synthesis of Compound 342



embedded image


A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-dioxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv) for 2 h at 80° C. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 17, Gradient 1) to afford N-{8-hydroxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (6.5 mg, 31%) as a solid. LCMS (ES, m/z): 407 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.94 (s, 1H), 8.90 (s, 3H), 8.33 (s, 1H), 8.01 (d, J=8.0 Hz, 1H), 7.78 (s, 1H), 6.61 (d, J=8.1 Hz, 1H), 4.30 (s, 3H), 3.62 (t, 4H), 3.35 (t, 4H), 2.34 (s, 3H). 19F NMR (400 MHz, DMSO-d6) δ −73.89


Example 230: Synthesis of Compound 393
Synthesis of Intermediate C370



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (R)-methyl(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs2CO3 (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H2O (20 mL) and extracted with EtOAc (3×10 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 393



embedded image


A solution of tert-butyl tert-butyl (R)-(1-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(3-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide (12 mg, 11%) as a solid. LCMS (ES, m/z): 436 [M+H]+1H NMR (300 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.97-7.85 (m, 2H), 7.26 (dd, J=12.4, 1.6 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.76 (dq, J=13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J=7.4 Hz, 3H), 3.42 (dd, J=10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J=11.2, 4.5 Hz, 1H), 1.92 (dd, J=11.8, 6.1 Hz, 1H), 1.61 (t, J=7.2 Hz, 3H).


Example 231: Synthesis of Compound 423
Synthesis of Intermediate C371



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (180 mg, 0.432 mmol, 1 equiv) and tert-butyl N-methyl-N-(4-methylpiperidin-4-yl)carbamate (99 mg, 0.432 mmol, 1 equiv) in dioxane (5 mL) were added Cs2CO3 (423 mg, 1.296 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylcarbamate (210 mg, 86%) as a solid. LCMS (ES, m/z): 564 [M+H]+


Synthesis of Compound 423



embedded image


A solution of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylcarbamate (200 mg, 0.355 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[4-methyl-4-(methylamino)piperidin-1-yl]indazole-7-carboxamide (50 mg, 30%) as a solid. LCMS (ES, m/z): 464 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.90 (dd, J=3.2, 1.0 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.55-3.43 (m, 4H), 2.38-2.33 (m, 3H), 2.23 (s, 3H), 1.70 (dt, J=13.3, 4.6 Hz, 2H), 1.61 (q, J=7.4 Hz, 5H), 1.09 (s, 3H).


Example 232: Synthesis of Compound 452
Synthesis of Intermediate C373



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine-1-carboxylate (300 mg, 0.835 mmol, 1 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyridine-7-carbonitrile (197.04 mg, 0.835 mmol, 1 equiv) in dioxane (5 mL) were added Cs2CO3 (815.84 mg, 2.505 mmol, 3 equiv), Pd2(dba)3 (76.43 mg, 0.084 mmol, 0.1 equiv) and XantPhos (48.30 mg, 0.084 mmol, 0.1 equiv). After stirring for 2 h at 100° C. under a nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1:1-1:10) to afford tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (400 mg, 93.13%) as a solid. 1H NMR (400 MHz, DMSO-d6) δ 11.47 (s, 1H), 9.66 (s, 1H), 8.85 (s, 1H), 8.29 (s, 1H), 8.06-7.96 (m, 2H), 6.52 (d, J=8.2 Hz, 1H), 4.26 (s, 3H), 3.57 (d, J=5.7 Hz, 5H), 3.48 (d, J=5.7 Hz, 3H), 2.40 (s, 3H), 1.45 (s, 9H).


Synthesis of Compound 452



embedded image


A solution of tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (80 mg, 0.155 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 4) to afford N-{7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (4 mg, 6%) as a solid. LCMS (ES, m/z): 515 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 11.48 (s, 1H), 9.67 (s, 1H), 8.82 (s, 1H), 8.29 (s, 1H), 8.08-7.97 (m, 2H), 6.51 (d, J=8.2 Hz, 1H), 4.25 (s, 3H), 3.39 (t, J=5.0 Hz, 4H), 2.91 (t, J=5.0 Hz, 4H), 2.40 (s, 3H).


Example 233: Synthesis of Compound 475
Synthesis of Intermediate C375



embedded image


To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (93.95 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 60%) as a solid. LCMS (ES, m/z): 435 [M+H]+


Synthesis of Intermediate C376



embedded image


To a stirred solution of methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 0.219 mmol, 1 equiv) in THF (1.2 mL) and H2O (0.4 mL) was added lithiumol hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (5 mL). The mixture was acidified to pH 4 with citric acid and extracted with DCM (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (85 mg, 92%) as a solid. LCMS (ES, m/z): 419 [M−H]


Synthesis of Intermediate C377



embedded image


To a stirred mixture of 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoroindazole-7-carboxylic acid (85 mg, 0.202 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (44.83 mg, 0.222 mmol, 1.10 equiv) in DCM (2 mL) was added DIEA (130.63 mg, 1.010 mmol, 5 equiv) and HATU (99.92 mg, 0.263 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (80 mg, 70%) as a solid. LCMS (ES, m/z): 568 [M−H]


Synthesis of Compound 475



embedded image


To a stirred solution of tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2,6-dimethylpiperazine-1-carboxylate (80 mg, 0.141 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide; trifluoroacetic acid (31.4 mg, 38%) as a solid. LCMS (ES, m/z): 468 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.40 (s, 1H), 9.19 (s, 1H), 8.91 (s, 1H), 8.56 (d, J=11.5 Hz, 1H), 8.11 (s, 1H), 7.58 (d, J=12.2 Hz, 1H), 6.48 (d, J=14.4 Hz, 1H), 4.52 (q, J=7.3 Hz, 2H), 4.04 (d, J=13.2 Hz, 2H), 2.95 (t, J=12.4 Hz, 2H), 2.44 (d, J=4.9 Hz, 3H), 1.58 (t, J=7.3 Hz, 3H), 1.32 (d, J=6.4 Hz, 6H).


Example 234: Synthesis of Compound 497
Synthesis of Intermediate C378



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperazine-1-carboxylate (110 mg, 0.223 mmol, 1.0 equiv) and 3-(iodomethyl)oxetane (66.20 mg, 0.335 mmol, 1.5 equiv) in DMF (2.2 mL) was added Cs2CO3 (217.8 mg, 0.669 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with water (10 mL) and extracted with EtOAc (3×10 mL). The combined organic layer was washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-ylmethyl) indazol-4-yl]piperazine-1-carboxylate (65 mg, 52%) as a solid. LCMS (ES, m/z): 423.2 [M+H]+


Synthesis of Compound 497



embedded image


To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(oxetan-3-ylmethyl) indazol-4-yl]piperazine-1-carboxylate (20 mg, 0.035 mmol, 1.0 equiv) in DCM (0.5 mL) was added ZnBr2 (79.91 mg, 0.350 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (2 mL) and extracted with CH2Cl2 (2×2 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(oxetan-3-ylmethyl)-4-(piperazin-1-yl) indazole-7-carboxamide (5.6 mg, 34%) as a solid. LCMS (ES, m/z): 403.2 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.02 (s, 1H), 8.55 (s, 1H), 8.06 (d, J=8.0 Hz, 1H), 7.69-7.63 (m, 1H), 7.14 (d, J=11.8 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.95-4.82 (m, 4H), 4.71 (t, J=6.1 Hz, 2H), 3.82-3.72 (m, 1H), 3.42 (t, J=4.9 Hz, 4H), 3.07 (m, 4H), 2.42 (s, 3H)).


Example 235: Synthesis of Compound 498
Synthesis of Intermediate C379



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 3-hydroxypyrrolidine-1-carboxylate (269.8 mg, 1.440 mmol, 3.0 equiv) in dioxane (5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}pyrrolidine-1-carboxylate (80 mg, 32%) as a solid. LCMS (ES, m/z): 523 [M+H]+


Synthesis of Compound 498



embedded image


A solution of tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}pyrrolidine-1-carboxylate (80 mg, 0.153 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(pyrrolidin-3-yloxy) indazole-7-carboxamide (30 mg, 46%) as a solid. LCMS (ES, m/z): 423[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.41 (d, J=1.5 Hz, 1H), 9.29 (s, 1H), 9.13 (s, 1H), 8.68 (s, 1H), 8.10 (d, J=8.1 Hz, 2H), 7.71 (d, J=12.0 Hz, 1H), 6.75 (d, J=8.2 Hz, 1H), 5.43 (s, 1H), 4.64 (q, J=7.3 Hz, 2H), 3.65-3.35 (m, 4H), 3.51 (s, 1H), 2.43 (d, J=0.9 Hz, 3H), 2.41-2.20 (m, 2H), 1.62 (t, J=7.3 Hz, 3H).


Example 236: Synthesis of Compound 499
Synthesis of Intermediate C380



embedded image


To a solution of 6-bromo-3-methylbenzo[d]oxazol-2(3H)-one (150 mg, 0.658 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (263 mg, 0.658 mmol, 1 equiv) in dioxane (8 mL) were added Cs2CO3 (643 mg, 1.974 mmol, 3.0 equiv), XantPhos (76 mg, 0.131 mmol, 0.2 equiv) and Pd2(dba)3 (60 mg, 0.0658 mmol, 0.1 equiv). After stirring for 3 h at 90° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0:100) to tert-butyl 4-(2-methyl-7-((3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6-yl)carbamoyl)-2H-indazol-4-yl)piperazine-1-carboxylate (150 mg, 43%) as a solid. LCMS (ES, m/z): 507 [M+H]+


Synthesis of Compound 499



embedded image


A solution of tert-butyl 4-(2-methyl-7-((3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6-yl)carbamoyl)-2H-indazol-4-yl)piperazine-1-carboxylate (150 mg, 0.296 mmol, 1 equiv) and TFA (0.5 mL) in DCM (4 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-methyl-N-(3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6-yl)-4-(piperazin-1-yl)-2H-indazole-7-carboxamide (80 mg, 67%) as a solid. LCMS (ES, m/z): 407 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.23 (s, 1H), 8.78 (s, 1H), 8.03 (d, J=1.9 Hz, 1H), 7.98 (d, J=8.0 Hz, 1H), 7.47 (dd, J=8.4, 2.0 Hz, 1H), 7.25 (d, J=8.4 Hz, 1H), 6.47 (d, J=8.1 Hz, 1H), 4.28 (s, 3H), 3.35 (s, 4H), 3.32 (s, 3H), 2.91 (t, J=4.8 Hz, 4H).


Example 237: Synthesis of Compound 500
Synthesis of Intermediate C381



embedded image


A solution of methyl 4-bromo-2-methylindazole-7-carboxylate (550 mg, 2.044 mmol, 1.0 equiv) in THF (6 mL) was treated with DIBAL-H (6.13 mL, 6.132 mmol, 3.0 equiv) at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 0° C. under nitrogen atmosphere. The reaction was quenched with water at 0° C. The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford (4-bromo-2-methylindazol-7-yl)methanol (505 mg, 100%) as a solid. LCMS (ES, m/z): 241 [M+H]+


Synthesis of Intermediate C382



embedded image


A solution of (4-bromo-2-methylindazol-7-yl)methanol (505 mg, 2.095 mmol, 1 equiv) in DCM (5 mL) was treated with manganese dioxide (1821.0 mg, 20.950 mmol, 10 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 4 h at room temperature under nitrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with DCM (2×5 mL). The filtrate was concentrated under reduced pressure to afford 4-bromo-2-methylindazole-7-carbaldehyde (440 mg, 88%) as a solid. LCMS (ES, m/z): 239 [M+H]+


Synthesis of Intermediate C383



embedded image


To a stirred mixture of 4-bromo-2-methylindazole-7-carbaldehyde (440 mg, 1.840 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (364.8 mg, 2.208 mmol, 1.2 equiv) in DCM (5 mL) was added NaBH(OAc)3 (780.1 mg, 3.680 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere. The reaction was quenched with Water at room temperature. The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford N-[(4-bromo-2-methylindazol-7-yl)methyl]-8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (610 mg, 85%) as a solid. LCMS (ES, m/z): 388 [M+H]+


Synthesis of Intermediate C385



embedded image


To a stirred mixture of N-[(4-bromo-2-methylindazol-7-yl)methyl]-8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (300 mg, 0.773 mmol, 1.0 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (264.7 mg, 1.159 mmol, 1.5 equiv) in dioxane (3 mL) were added Cs2CO3 (755.3 mg, 2.319 mmol, 3.0 equiv), RuPhos (72.1 mg, 0.155 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (64.6 mg, 0.077 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 4 h at 100° C. under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-ethyl-N-(1-{7-[({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}amino)methyl]-2-methylindazol-4-yl}piperidin-4-yl)carbamate (180 mg, 43%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 500



embedded image


A solution of tert-butyl N-ethyl-N-(1-{7-[({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}amino)methyl]-2-methylindazol-4-yl}piperidin-4-yl)carbamate (160 mg, 0.299 mmol, 1.0 equiv) in DCM (2 mL) was treated with ZnBr2 (336.3 mg, 1.495 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-ethyl-1-[7-({[(6E)-8-fluoro-2-methyl-5H-imidazo[1,2-a]pyridin-6-ylidene]amino}methyl)-2-methylindazol-4-yl]piperidin-4-amine (8 mg, 6.15%) as a brown solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 8.40 (s, 1H), 7.41 (d, J=3.2 Hz, 1H), 6.84 (d, J=12.9 Hz, 1H), 6.71 (d, J=7.4 Hz, 1H), 6.17 (d, J=7.5 Hz, 1H), 5.18 (s, 2H), 4.33 (s, 2H), 4.20 (s, 3H), 3.54 (d, J=12.0 Hz, 2H), 2.68 (t, J=11.7 Hz, 2H), 2.58 (d, J=7.1 Hz, 3H), 2.21 (s, 3H), 1.91 (d, J=12.3 Hz, 2H), 1.42 (q, J=11.0 Hz, 2H), 1.02 (t, J=7.1 Hz, 3H).


Example 238: Synthesis of Compound 501
Synthesis of Intermediate C387



embedded image


To a stirred solution of methyl 4-bromo-2-hydroxybenzoate (10 g, 43.282 mmol, 1 equiv) and K2CO3 (17.95 g, 129.846 mmol, 3.0 equiv) in DMF (150 mL) was added propargyl bromide (7.72 g, 64.923 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 50° C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (500 mL). The resulting mixture was extracted with EA (3×100 mL). The combined organic layers were washed with brine (2×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-(prop-2-yn-1-yloxy)benzoate (10.1 g, 87%) as a solid. 1H NMR (400 MHz, DMSO-d6) δ 7.62 (d, J=8.2 Hz, 1H), 7.45 (d, J=1.8 Hz, 1H), 7.29 (dd, J=8.3, 1.8 Hz, 1H), 4.96 (d, J=2.4 Hz, 2H), 3.80 (s, 3H), 3.65 (t, J=2.4 Hz, 1H).


Synthesis of Intermediate C388



embedded image


A mixture of methyl 4-bromo-2-(prop-2-yn-1-yloxy)benzoate (5.0 g, 18.581 mmol, 1 equiv) and CsF (2.82 g, 18.581 mmol, 1.0 equiv) in DMA (50 mL) was irradiated with microwave for 4 h at 190° C. The reaction was quenched with water (200 mL). The resulting mixture was extracted with EA (3×100 mL). The combined organic layers were washed with brine (2×100 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford methyl 4-bromo-2-methyl-1-benzofuran-7-carboxylate (2.0 g, 40%) as a solid. LCMS (ES, m/z): 269 [M+H]+


Synthesis of Intermediate C389



embedded image


To a solution of methyl 4-bromo-2-methyl-1-benzofuran-7-carboxylate (670 mg, 2.490 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (852.78 mg, 3.735 mmol, 1.5 equiv) in dioxane (20 mL) were added Cs2CO3 (1622.47 mg, 4.980 mmol, 2.0 equiv), RuPhos (116.03 mg, 0249 mmol, 0.1 equiv) and 3rd Generation RuPhos precatalyst (208.24 mg, 0.249 mmol, 0.1 equiv). After stirring for 4 h at 90° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2-methyl-1-benzofuran-7-carboxylate (750 mg, 72%) as a solid. LCMS (ES, m/z): 417 [M+H]+


Synthesis of Intermediate C390



embedded image


To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2-methyl-1-benzofuran-7-carboxylate (720 mg, 1.729 mmol, 1 equiv) in H2O (5 mL), MeOH (10 mL) and THF (10 mL) were added LiOH (248.40 mg, 10.374 mmol, 6.0 equiv) in portions at room temperature. The resulting mixture was stirred for 2 h at 50° C. The resulting mixture was concentrated under reduced pressure. The residue was acidified to pH 6 with 1 N HCl. The precipitated solids were collected by filtration and washed with water (2×20 mL). The resulting solids were dried to afford 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2-methyl-1-benzofuran-7-carboxylic acid (650 mg, 93%) as a solid. LCMS (ES, m/z): 403 [M+H]+


Synthesis of Intermediate C391



embedded image


To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2-methyl-1-benzofuran-7-carboxylic acid (650 mg, 1.615 mmol, 1 equiv) and DIEA (417.45 mg, 3.230 mmol, 2.0 equiv) in DMF (6 mL) were added HATU (736.87 mg, 1.938 mmol, 1.2 equiv) and NH4Cl (856 mg, 16.15 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The reaction was quenched with water (50 mL) at room temperature. The precipitated solids were collected by filtration and washed with water (2×10 mL) to afford tert-butyl N-[1-(7-carbamoyl-2-methyl-1-benzofuran-4-yl)piperidin-4-yl]-N-ethylcarbamate (450 mg, 69%) as a solid. LCMS (ES, m/z): 402[M+H]+


Synthesis of Intermediate C392



embedded image


To a solution of 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (154.86 mg, 0.598 mmol, 1.2 equiv) and tert-butyl N-[1-(7-carbamoyl-2-methyl-1-benzofuran-4-yl)piperidin-4-yl]-N-ethylcarbamate (200 mg, 0.498 mmol, 1 equiv) in 1,4-dioxane (5 mL) were added Cs2CO3 (323.78 mg, 0.996 mmol, 2.0 equiv), RuPhos (23.24 mg, 0.050 mmol, 0.1 equiv) and 3rd Generation RuPhos precatalyst (41.66 mg, 0.050 mmol, 0.1 equiv). After stirring for 5 h at 90° C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-1-benzofuran-4-yl]piperidin-4-yl}carbamate (200 mg, 69%) as a solid. LCMS (ES, m/z): 580 [M+H]+


Synthesis of Compound 501



embedded image


A solution of tert-butyl N-ethyl-N-{1-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methyl-1-benzofuran-4-yl]piperidin-4-yl}carbamate (100 mg, 0.173 mmol, 1 equiv) in TFA (3 mL, 40.389 mmol, 234.13 equiv) and DCM (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 6, Gradient 2) to afford 4-(4-(ethylamino)piperidin-1-yl)-N-(8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methylbenzofuran-7-carboxamide 2,2,2-trifluoroacetate (30 mg, 36%) as a solid. LCMS (ES, m/z): 480 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 9.94 (s, 1H), 9.65 (d, J=1.1 Hz, 1H), 8.75 (s, 2H), 8.08 (dd, J=2.6, 1.3 Hz, 1H), 7.82 (d, J=8.5 Hz, 1H), 6.90-6.80 (m, 2H), 4.39 (d, J=4.0 Hz, 3H), 3.87 (d, J=12.6 Hz, 2H), 3.31 (s, 1H), 3.05 (q, J=6.8 Hz, 2H), 2.95 (t, J=12.3 Hz, 2H), 2.60 (s, 3H), 2.47-2.40 (m, 3H), 2.21-2.10 (m, 2H), 1.73 (td, J=12.8, 9.1 Hz, 2H), 1.24 (t, J=7.2 Hz, 3H).


Example 239: Synthesis of Compound 502
Synthesis of Intermediate C393



embedded image


To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1 equiv), K2CO3 (1.63 g, 11.760 mmol, 3 equiv) and tert-butyl N-methyl-N-(piperidin-4-yl)carbamate (1.68 g, 7.840 mmol, 2 equiv) in Toluene (10 mL) were added Pd(OAc)2 (0.09 g, 0.392 mmol, 0.1 equiv) and BINAP (0.49 g, 0.784 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylate (500 mg, 33%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C394



embedded image


A solution of methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylate (1 g, 2.574 mmol, 1 equiv) and lithiumol (0.31 g, 12.870 mmol, 5 equiv) in THF (5 mL), H2O (5 mL) and MeOH (1 mL) was stirred for 3 h at 40° C. The resulting mixture was concentrated under reduced pressure. The mixture was acidified to pH 4 with HCl (1 mol/L, aq.). The precipitated solids were collected by filtration and washed with water (3×5 mL) to afford 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylic acid (600 mg, 62%) as a solid. LCMS (ES, m/z): 375 [M+H]+


Synthesis of Intermediate C395



embedded image


To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylic acid (500 mg, 1.335 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (264.67 mg, 1.602 mmol, 1.2 equiv) in MeCN (10 mL) were added TCFH (487.06 mg, 1.736 mmol, 1.3 equiv) and NMI (383.73 mg, 4.672 mmol, 3.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0:1) to afford tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}-N-methylcarbamate (300 mg, 43%) as an oil. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Intermediate C396



embedded image


To a stirred solution of tert-butyl N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}-N-methylcarbamate (100 mg, 0.192 mmol, 1 equiv) and 1-chloro-2-iodoethane (55 mg, 0.288 mmol, 1.5 equiv) in DMF (5 mL) was added NaOH (39 mg, 0.960 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The reaction mixture was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford tert-butyl N-{1-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}-N-methylcarbamate (60 mg, 57%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 502



embedded image


A solution of tert-butyl N-{1-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}-N-methylcarbamate (60 mg, 0.109 mmol, 1 equiv) and trifluoroacetic acid (2 mL) in DCM (5 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-ethenyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[4-(methylamino)piperidin-1-yl]indazole-7-carboxamide (11 mg, 22%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.91 (s, 1H), 9.22 (s, 1H), 9.08 (s, 1H), 8.03 (d, J=8.2 Hz, 1H), 7.91 (d, J=3.3 Hz, 1H), 7.68 (dd, J=15.5, 8.7 Hz, 1H), 7.35 (d, J=12.8 Hz, 1H), 6.52 (d, J=8.1 Hz, 1H), 6.26 (d, J=15.7 Hz, 1H), 5.36 (d, J=8.5 Hz, 1H), 3.93 (d, J=12.7 Hz, 2H), 3.11 (t, J=11.9 Hz, 2H), 2.65 (s, 1H), 2.36 (d, J=1.7 Hz, 6H), 1.99 (d, J=13.2 Hz, 2H), 1.48 (d, J=11.0 Hz, 2H).


Example 240: Synthesis of Compound 503
Synthesis of Intermediate C397



embedded image


To a solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (1.79 g, 7.840 mmol, 2.0 equiv) in Toluene (20 mL) were added K2CO3 (1.63 g, 11.760 mmol, 3.0 equiv), BINAP (0.49 g, 0.784 mmol, 0.2 equiv) and Pd(OAc)2 (0.09 g, 0.392 mmol, 0.1 equiv). After stirring for 12 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylate (1 g, 63%) as a solid. LCMS (ES, m/z): 403 [M+H]+


Synthesis of Intermediate C398



embedded image


To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylate (1 g, 2.485 mmol, 1 equiv) in THF (9 mg) and MeOH (9 mL) was added a solution of LiOH·H2O (0.6 g, 24.850 mmol, 10 equiv) in H2O (9 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was acidified to pH 2 with 2 M HCl. The precipitated solids were collected by filtration and washed with H2O (1×10 mL). This resulted in 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylic acid (0.8 g, 83%) as a solid. LCMS (ES, m/z): 389[M+H]+


Synthesis of Intermediate C399



embedded image


To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-1-yl}-2H-indazole-7-carboxylic acid (300 mg, 0.772 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (191.3 mg, 1.158 mmol, 1.5 equiv) in CH3CN (6 mL) were added TCFH (281.6 mg, 1.004 mmol, 1.3 equiv) and NMI (221.9 mg, 2.702 mmol, 3.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}carbamate (183 mg, 44%) as a solid. LCMS (ES, m/z): 536[M+H]+


Synthesis of Intermediate C400



embedded image


To a stirred solution of tert-butyl N-ethyl-N-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}carbamate (180 mg, 0.336 mmol, 1 equiv) and 1-chloro-2-iodoethane (95.9 mg, 0.504 mmol, 1.5 equiv) in DMF (3 mL) was added KOH (113.1 mg, 2.016 mmol, 6.0 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at 80° C. The mixture was allowed to cool down to room temperature. The resulting mixture was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-{1-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}-N-ethylcarbamate (80 mg, 42%) as a solid. LCMS (ES, m/z): 562[M+H]+


Synthesis of Compound 503



embedded image


A solution of tert-butyl N-{1-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}-N-ethylcarbamate (80 mg, 0.142 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-ethenyl-4-[4-(ethylamino)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (18 mg, 27%) as a solid. LCMS (ES, m/z): 462[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 9.15 (t, J=1.7 Hz, 1H), 9.01 (d, J=1.5 Hz, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.87 (d, J=3.1 Hz, 1H), 7.64 (dd, J=15.5, 8.7 Hz, 1H), 7.32 (dd, J=12.3, 1.5 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 6.22 (d, J=15.5 Hz, 1H), 5.34 (d, J=8.5 Hz, 1H), 3.94 (d, J=12.9 Hz, 2H), 3.06 (t, J=12.1 Hz, 2H), 2.80-2.71 (m, 1H), 2.64 (q, J=7.1 Hz, 2H), 2.34 (s, 3H), 1.99 (d, J=12.6 Hz, 2H), 1.48 (q, J=11.4 Hz, 2H), 1.06 (t, J=7.1 Hz, 3H).


Example 241: Synthesis of Compound 504
Synthesis of Intermediate C402



embedded image


A solution of 2-fluoro-6-methoxyaniline (15 g, 106.274 mmol, 1 equiv) in CH3CN (200 mL) was treated with NBS (28.37 g, 159.411 mmol, 1.5 equiv) for 8 hours at 20° C. The mixture was neutralized to pH 7 with NaHCO3. The aqueous layer was extracted with DCM 500 mL×3 times. The combined organic layers were washed with water (1×500 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3:1) to afford 4-bromo-2-fluoro-6-methoxyaniline (5 g, 21%) is given with solid. LCMS (ES, m/z): 220 [M+H]+


Synthesis of Intermediate C403



embedded image


To a solution of 4-bromo-2-fluoro-6-methoxyaniline (5 g, 22.723 mmol, 1 equiv) in DCM (50 mL) was added BBr3 (8.54 g, 34.084 mmol, 1.5 equiv) dropwise at 0° C. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (100 mL). The mixture was neutralized to pH 7 with NaHCO3. The resulting mixture was extracted with EtOAc (3×200 mL). The combined organic layers were washed with water (1×500 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with MeOH/DCM (1/20) to afford 2-amino-5-bromo-3-fluorophenol (3.7 g, 79%) as an oil. LCMS (ES, m/z): 206 [M+H]+


Synthesis of Intermediate C404



embedded image


A solution of 2-amino-5-bromo-3-fluorophenol (4 g, 19.416 mmol, 1 equiv) in MeOH (100 mL) was treated with 2-chloro-1,1,1-trimethoxyethane (6.00 g, 38.832 mmol, 2.00 equiv) for 8 hours at 80° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3/1) to afford 6-bromo-2-(chloromethyl)-4-fluoro-1,3-benzoxazole (4.5 g, 88%) as a solid. LCMS (ES, m/z): 264 [M+H]+


Synthesis of Intermediate C405



embedded image


A solution of 6-bromo-2-(chloromethyl)-4-fluoro-1,3-benzoxazole (2.26 g, 8.545 mmol, 1 equiv) in MeOH (20 mL) was treated with sodium methoxide (4.62 g, 85.450 mmol, 10 equiv) for 8 hours at 26° C. The resulting mixture was diluted with water (100 mL). The aqueous layer was extracted with DCM (3×100 mL). The resulting mixture was washed with 2×200 mL of brine. The resulting organic layer was dried by Na2SO4 and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3/1) to afford 6-bromo-4-fluoro-2-(methoxymethyl)-1,3-benzoxazole (2 g, 90%) as a solid. LCMS (ES, m/z): 260 [M+H]+


Synthesis of Intermediate C406



embedded image


A solution of 6-bromo-4-fluoro-2-(methoxymethyl)-1,3-benzoxazole (200 mg, 0.769 mmol, 1 equiv) in dioxane (5 mL) was treated with tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (360 mg, 1.002 mmol, 1.30 equiv), Pd2(dba)3 (70 mg, 0.076 mmol, 0.10 equiv), Cs2CO3 (501 mg, 1.538 mmol, 2.00 equiv), XantPhos (89 mg, 0.154 mmol, 0.20 equiv) for 8 hours at 110° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with MeOH/DCM (1/10) to afford tert-butyl 4-(7-{[4-fluoro-2-(methoxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (380 mg, 91%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 504



embedded image


To a stirred mixture of tert-butyl 4-(7-{[4-fluoro-2-(methoxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (80 mg, 0.149 mmol, 1 equiv) in DCM (2 mL) was added ZnBr2 (194.2 mg, 2.980 mmol, 20 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 7) to afford N-[4-fluoro-2-(methoxymethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (8 mg, 12%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 8.78 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.41 (dd, J=12.2, 2.3 Hz, 1H), 7.24 (t, J=1.8 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.73 (s, 2H), 4.28 (s, 3H), 3.91 (s, 3H), 3.38-3.32 (m, 4H), 2.94-2.87 (m, 4H).


Example 242: Synthesis of Compound 505
Synthesis of Intermediate C407



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 4-hydroxypiperidine-1-carboxylate (290.1 mg, 1.440 mmol, 3.0 equiv) in dioxane (0.5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}piperidine-1-carboxylate (100 mg, 39%) as a solid. LCMS (ES, m/z): 537 [M+H]+


Synthesis of Compound 505



embedded image


A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]oxy}piperidine-1-carboxylate (100 mg, 0.186 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperidin-4-yloxy) indazole-7-carboxamide (45 mg, 55%) as a solid. LCMS (ES, m/z): 437 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 10.95 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.72 (s, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.92 (d, J=3.1 Hz, 1H), 7.33 (dd, J=12.3, 1.7 Hz, 1H), 6.74 (d, J=8.2 Hz, 1H), 4.73 (d, J=8.7 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 3.01 (d, J=12.8 Hz, 2H), 2.65 (t, J=9.9 Hz, 2H), 2.39-2.33 (m, 3H), 2.03 (d, J=12.0 Hz, 2H), 1.61 (t, J=7.3 Hz, 5H).


Example 243: Synthesis of Compound 506
Synthesis of Intermediate C408



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (100 mg, 0.240 mmol, 1 equiv) and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-carboxylate (89.1 mg, 0.288 mmol, 1.2 equiv) in dioxane (2 mL) were added K3PO4 (152.9 mg, 0.720 mmol, 3.0 equiv) and Pd(dppf)Cl2CH2Cl2 (19.5 mg, 0.024 mmol, 0.1 equiv). After stirring for 1 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (100 mg, 80%) as a solid. LCMS (ES, m/z): 519 [M+H]+


Synthesis of Compound 506



embedded image


A solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3,6-dihydro-2H-pyridine-1-carboxylate (80 mg, 0.154 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(1,2,3,6-tetrahydropyridin-4-yl) indazole-7-carboxamide (25 mg, 38%) as a solid. LCMS (ES, m/z): 419[M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.34 (s, 1H), 9.43 (s, 1H), 8.98 (d, J=14.9 Hz, 3H), 8.12 (s, 1H), 8.12 (d, J=7.5 Hz, 1H), 7.72 (s, 1H), 7.32 (d, J=7.5 Hz, 1H), 6.47 (s, 1H), 4.69 (q, J=7.3 Hz, 2H), 3.90 (s, 2H), 2.83 (s, 2H), 2.83 (s, 2H), 2.43 (t, J=1.1 Hz, 3H), 1.65 (t, J=7.3 Hz, 3H).


Example 244: Synthesis of Compound 507
Synthesis of Intermediate C410



embedded image


A solution of 3-bromo-5-chloropyrazin-2-amine (1 g, 4.798 mmol, 1.0 equiv) in isopropanol (30 mL) was treated with PPTS (120 mg, 0.480 mmol, 0.1 equiv) and bromoacetone (1.97 g, 14.394 mmol, 3.0 equiv) for 48 hours at 80° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (50%) to afford 8-bromo-6-chloro-2-methylimidazo[1,2-a]pyrazine (600 mg, 51%) as a solid. LCMS (ES, m/z): 246 [M+H]+


Synthesis of Intermediate C411



embedded image


To a solution of 8-bromo-6-chloro-2-methylimidazo[1,2-a]pyrazine (450 mg, 1.826 mmol, 1 equiv) in DMF (5 mL) were added Zn(CN)2 (1071 mg, 9.130 mmol, 5.0 equiv) and Pd(PPh3)4 (210 mg, 0.183 mmol, 0.1 equiv). After stirring for 16 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH (10:1) to afford 6-chloro-2-methylimidazo[1,2-a]pyrazine-8-carbonitrile (200 mg, 57%) as a solid. LCMS (ES, m/z): 193 [M+H]+ 1H NMR (300 MHz, Chloroform-d) δ 8.31 (s, 1H), 7.69 (s, 1H), 2.64 (d, J=0.7 Hz, 3H).


Synthesis of Intermediate C412



embedded image


To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (150 mg, 0.417 mmol, 1.0 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyrazine-8-carbonitrile (98.9 mg, 0.417 mmol, 1.0 equiv) in dioxane (3 mL) were added Cs2CO3 (407.9 mg, 1.251 mmol, 3.0 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:9) to afford tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (40 mg, 19%) as a solid. LCMS (ES, m/z): 516 [M+H]+


Synthesis of Compound 507



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (30 mg, 0.058 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (0.25 mL, 4M) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford N-{8-cyano-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (8.6 mg, 36%) as a solid. LCMS (ES, m/z): 416 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.51 (s, 1H), 9.79 (s, 1H), 8.93 (s, 1H), 8.84 (s, 2H), 8.32 (s, 1H), 8.10 (d, J=8.0 Hz, 1H), 6.64 (d, J=8.1 Hz, 1H), 4.32 (s, 3H), 3.62 (t, J=5.1 Hz, 4H), 3.36 (d, J=5.1 Hz, 4H), 2.50 (s, 3H).


Example 245: Synthesis of Compound 508



embedded image


To a stirred solution of 4-(4-amino-4-ethylpiperidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (130 mg, 0.28 mmol, 1 equiv) and aq. HCHO (105 mg, 1.4 mmol, 5 equiv, 40% HCHO in water) in MeCN (5 mL) was added NaBH(OAc)3 (178 mg, 0.84 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 0.5 h at room temperature. To the above mixture was added HOAc (170 mg, 2.8 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for additional 3 h at room temperature. The reaction was quenched by the addition of water (5 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-[4-(dimethylamino)-4-ethylpiperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (42.2 mg, 31%) as a solid. LCMS (ES, m/z): 492 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.82 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.27 (dd, J=12.3, 1.7 Hz, 1H), 6.43 (d, J=8.3 Hz, 1H), 4.58 (q, J=7.3 Hz, 2H), 3.53 (dt, J=11.8, 4.5 Hz, 2H), 3.41 (ddd, J=12.4, 9.9, 2.9 Hz, 2H), 2.35 (s, 3H), 2.23 (s, 6H), 1.91-1.77 (m, 2H), 1.70-1.54 (m, 5H), 1.50 (q, J=7.5 Hz, 2H), 0.85 (t, J=7.5 Hz, 3H).


Example 246: Synthesis of Compound 510
Synthesis of Intermediate C413



embedded image


A solution of 4-[4-(tert-butoxycarbonyl) piperazin-1-yl]-2-(2-methoxyethyl) indazole-7-carboxylic acid (480 mg, 1.187 mmol, 1 equiv) in DMF (1 mL) was added NH4Cl (317.4 mg, 5.935 mmol, 5.0 equiv), HATU (676.8 mg, 1.780 mmol, 1.5 equiv) and DIEA (460.1 mg, 3.561 mmol, 3.0 equiv). The mixture was stirred at room temperature for 1 h and washed with 2×10 mL of water, extracted with EtOAc (3×20 mL), and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (65%) to afford tert-butyl 4-[7-carbamoyl-2-(2-methoxyethyl) indazol-4-yl] piperazine-1-carboxylate (520 mg, 99%) as an oil. LCMS (ES, m/z): 404 [M+H]+


Synthesis of Intermediate C414



embedded image


A solution of tert-butyl 4-[7-carbamoyl-2-(2-methoxyethyl) indazol-4-yl] piperazine-1-carboxylate (200 mg, 0.496 mmol, 1 equiv) in dioxane (3 mL) was added 6-bromo-8-methoxy-2-methylimidazo[1,2-a] pyrazine (179.9 mg, 0.744 mmol, 1.5 equiv), Cs2CO3 (323.0 mg, 0.992 mmol, 2 equiv), XantPhos (57.3 mg, 0.099 mmol, 0.2 equiv) and Pd2(dba)3 (45.3 mg, 0.050 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 100° C. for 1 h to give a black solution. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (95%) to afford N-{8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-(2-methoxyethyl)-4-(piperazin-1-yl) indazole-7-carboxamide (100 mg, 43%) as a oil. LCMS (ES, m/z): 565 [M+H]+


Synthesis of Compound 510



embedded image


A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a] pyrazin-6-yl}carbamoyl)-2-(2-methoxyethyl) indazol-4-yl] piperazine-1-carboxylate (100 mg, 0.177 mmol, 1 equiv) in DCM (3 mL) was added HCl (gas) in 1,4-dioxane (1.5 mL, 4M). The mixture was stirred for 1 h at 25° C. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions (SunFire Prep C18 OBD Column 19*150 mm, 5 μm 10 nm, mobile phase, MeCN in water (0.05% TFA), 20% to 40% gradient in 7 min; detector, UV 254 nm) to afford N-{8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-(2-methoxyethyl)-4-(piperazin-1-yl) indazole-7-carboxamide (36.5 mg, 44%) as a solid. LCMS (ES, m/z): 465 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.48 (d, J=6.6 Hz, 1H), 9.10 (d, J=7.6 Hz, 1H), 8.94 (s, 1H), 8.83-8.80 (m, 1H), 8.06-8.00 (m, 2H), 6.64 (d, J=8.1 Hz, 1H), 4.70 (t, J=5.1 Hz, 2H), 4.15 (d, J=2.2 Hz, 4H), 4.05 (t, J=5.2 Hz, 2H), 3.61 (d, J=6.3 Hz, 4H), 3.36-3.35 (m, 4H), 3.29 (s, 3H), 2.39 (s, 3H).


Example 247: Synthesis of Compound 511
Synthesis of Intermediate C415



embedded image


Into a 100 mL 3-necked round-bottom flask were added 2,6-dichloro-4-methylpyridin-3-amine (5.0 g, 28.244 mmol, 1.0 equiv) and acetic anhydride (30 mL) at room temperature. The resulting mixture was stirred for 1 h at 90° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford N-(2,6-dichloro-4-methylpyridin-3-yl) acetamide (2.5 g, 37%) as a solid. LCMS (ES, m/z): 219 [M+H]+


Synthesis of Intermediate C416



embedded image


Into a 40 mL vial were added N-(2,6-dichloro-4-methylpyridin-3-yl) acetamide (1.0 g, 4.565 mmol, 1.0 equiv), copper(I) iodide (90.0 mg, 0.457 mmol, 0.1 equiv), (1R,2R)—N1,N2-dimethylcyclohexane-1,2-diamine (130.0 mg, 0.913 mmol, 0.2 equiv), K2CO3 (1.3 g, 9.130 mmol, 2.0 equiv) and dioxane (20 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford 5-chloro-2,7-dimethyl-[1,3] oxazolo[5,4-b]pyridine (0.8 g, 86%) as a solid. LCMS (ES, m/z): 183 [M+H]+


Synthesis of Intermediate C417



embedded image


To a solution of 5-chloro-2,7-dimethyl-[1,3] oxazolo[5,4-b]pyridine (110.0 mg, 0.602 mmol, 1.0 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (238.1 mg, 0.662 mmol, 1.1 equiv) in dioxane (3 mL) were added Cs2CO3 (393.7 mg, 1.204 mmol, 2.0 equiv) and Pd2(dba)3 (55.1 mg, 0.060 mmol, 0.1 equiv). After stirring for 2 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl 4-[7-({2,7-dimethyl-[1,3] oxazolo[5,4-b]pyridin-5-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (120 mg, 37%) as a solid. LCMS (ES, m/z): 506 [M+H]+


Synthesis of Compound 511



embedded image


To a stirred solution of tert-butyl 4-[7-({2,7-dimethyl-[1,3]oxazolo[5,4-b]pyridin-5-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (70.0 mg, 0.138 mmol, 1.0 equiv) in DCM (2 mL) was added trimethylsilyl triflate (123.0 mg, 0.552 mmol, 4.0 equiv) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{2,7-dimethyl-[1,3]oxazolo[5,4-b]pyridin-5-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (35 mg, 61%) as a solid. LCMS (ES, m/z): 406 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.58 (s, 1H), 8.82 (s, 1H), 8.35 (s, 1H), 8.05 (d, J=8.1 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.28 (s, 3H), 3.38-3.37 (m, 4H), 2.97-2.90 (m, 4H), 2.62 (s, 3H), 2.57 (s, 3H).


Example 248: Synthesis of Compound 512
Synthesis of Intermediate C418



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 6-(trifluoro-lambda4-boranyl)-3-azabicyclo[4.1.0]heptane-3-carboxylate potassium (120.2 mg, 0.396 mmol, 1.1 equiv) in Toluene (7.5 mL) and H2O (0.75 mL) were added Cs2CO3 (176.1 mg, 0.540 mmol, 1.5 equiv) and Cata Pd G3 (26.2 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 10 h at 90° C. under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3-azabicyclo[4.1.0]heptane-3-carboxylate (90 mg, 47%) as a solid. LCMS (ES, m/z): 533 [M+H]+


Synthesis of Compound 512



embedded image


To a stirred mixture of tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3-azabicyclo[4.1.0]heptane-3-carboxylate (90 mg, 0.169 mmol, 1 equiv) in DCM (2 mL) was added TMSOTf (150.2 mg, 0.676 mmol, 4 equiv) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford 4-{3-azabicyclo[4.1.0]heptan-6-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide 2,2,2-trifluoroacetate (35.4 mg, 48%) as a solid. LCMS (ES, m/z): 433 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.28 (s, 1H), 9.42 (d, J=1.6 Hz, 1H), 8.98 (s, 1H), 8.79 (d, J=12.3 Hz, 1H), 8.67-8.66 (m, 1H), 8.14-8.09 (m, 1H), 8.05 (d, J=7.3 Hz, 1H), 7.71 (d, J=11.9 Hz, 1H), 7.23 (d, J=7.3 Hz, 1H), 4.67 (q, J=7.3 Hz, 2H), 3.78 (dd, J=12.6, 7.1 Hz, 1H), 3.18 (dd, J=12.2, 5.7 Hz, 1H), 2.96 (d, J=9.1 Hz, 1H), 2.43 (s, 3H), 2.36 (dt, J=14.4, 4.9 Hz, 1H), 2.20 (ddd, J=14.6, 9.4, 5.5 Hz, 1H), 1.67 (t, J=7.2 Hz, 3H), 1.60 (q, J=6.7 Hz, 1H), 1.28 (t, J=5.5 Hz, 1H), 1.20 (dd, J=9.3, 5.2 Hz, 1H).


Example 249: Synthesis of Compound 514
Synthesis of Intermediate C419



embedded image


A solution of ethyl 2-fluoroethanimidate hydrochloride (140 mg, 0.989 mmol, 1 equiv) and 2-amino-5-bromo-3-fluorophenol (142.6 mg, 0.692 mmol, 0.7 equiv) in EtOH (4 mL) was stirred for 1 h at 60° C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 248 [M+H]+


Synthesis of Intermediate C420



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-4-fluoro-2-(fluoromethyl)-1,3-benzoxazole (100 mg, 0.403 mmol, 1.45 equiv) in dioxane (4 mL) were added Cs2CO3 (271.9 mg, 0.834 mmol, 3.0 equiv), XantPhos (32.2 mg, 0.056 mmol, 0.2 equiv) and Pd2(dba)3 (25.4 mg, 0.028 mmol, 0.1 equiv). After stirring for 3 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-(7-{[4-fluoro-2-(fluoromethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (100 mg, 68%) as a solid. LCMS (ES, m/z): 527[M+H]+


Synthesis of Compound 514



embedded image


A solution of tert-butyl 4-(7-{[4-fluoro-2-(fluoromethyl)-1,3-benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-1-carboxylate (80 mg, 0.152 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford N-[4-fluoro-2-(fluoromethyl)-1,3-benzoxazol-6-yl]-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (24 mg, 37.04%) as a solid. LCMS (ES, m/z): 427 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.53 (s, 1H), 8.81 (s, 1H), 8.28 (d, J=1.6 Hz, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.73 (dd, J=12.1, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 5.81 (s, 1H), 5.66 (s, 1H), 4.31 (s, 3H), 3.37 (d, J=5.0 Hz, 4H), 2.92 (t, J=5.1 Hz, 4H).


Example 250: Synthesis of Compound 515
Synthesis of Intermediate C421



embedded image


To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (500 mg, 1.766 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (604.8 mg, 2.649 mmol, 1.5 equiv) in dioxane (20 mL) were added Cs2CO3 (1.73 g, 5.298 mmol, 3.0 equiv), RuPhos (164.8 mg, 0.353 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (147.7 mg, 0.177 mmol, 0.1 equiv). After stirring for 1 h at 80° C. under a nitrogen atmosphere, the mixture was allowed to cool down to room temperature. The resulting mixture was diluted with H2O (20 mL). The resulting mixture was extracted with EA (3×20 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylate (300 mg, 39%) as a solid. LCMS (ES, m/z): 431 [M+H]+


Synthesis of Intermediate C422



embedded image


A solution of methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylate (300 mg, 0.697 mmol, 1 equiv) in DMF (4 mL) was treated with NaH (55.7 mg, 1.394 mmol, 2.0 equiv, 60%) for 30 min at 0° C. followed by the addition of CH3I (148.3 mg, 1.045 mmol, 1.5 equiv) dropwise at 0° C. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with H2O (5 mL). The resulting mixture was extracted with EA (3×10 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylate (170 mg, 55%) as a solid. LCMS (ES, m/z): 445 [M+H]+


Synthesis of Intermediate C423



embedded image


To a solution of methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylate (170 mg, 0.382 mmol, 1 equiv) in MeOH (2 mL) and THF (2 mL) was added a solution of LiOH·H2O (96.2 mg, 2.292 mmol, 6.0 equiv) in H2O (2 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was acidified to pH 2 with 2 M HCl. The resulting mixture was extracted with EA (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 6) to afford 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylic acid (141 mg, 85%) as a solid. LCMS (ES, m/z): 431 [M+H]+


Synthesis of Intermediate C424



embedded image


To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-1-yl}-2-ethylindazole-7-carboxylic acid (140 mg, 0.325 mmol, 1 equiv) and TCFH (118.6 mg, 0.423 mmol, 1.3 equiv) in CH3CN (3 mL) were added NMI (93.4 mg, 1.137 mmol, 3.5 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (64.4 mg, 0.390 mmol, 1.2 equiv) in portions at room temperature. The resulting mixture was stirred for 2 h at room temperature. The precipitated solids were collected by filtration and washed with H2O (1×5 mL). The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 578 [M+H]+


Synthesis of Compound 515



embedded image


A solution of tert-butyl N-{4-ethyl-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}-N-methylcarbamate (70 mg, 0.121 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-4-[4-ethyl-4-(methylamino)piperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (28 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.90 (dd, J=3.2, 1.0 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.46 (d, J=8.3 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.58 (d, J=12.5 Hz, 2H), 3.49-3.30 (m, 2H), 2.38-2.32 (m, 3H), 2.16 (s, 3H), 1.72-1.48 (m, 7H), 1.42 (q, J=7.4 Hz, 2H), 0.80 (t, J=7.4 Hz, 3H).


Example 251: Synthesis of Compounds 516 and 517
Synthesis of Intermediate C425



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (300 mg, 0.721 mmol, 1 equiv), tert-butyl N-(4-methylpiperidin-4-yl)carbamate (154 mg, 0.721 mmol, 1 equiv) and Cs2CO3 (470 mg, 1.442 mmol, 2.0 equiv) in dioxane (5 mL) were added RuPhos (67.26 mg, 0.144 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (60.28 mg, 0.072 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA/MeOH (20:1) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}carbamate (260 mg, 66%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Intermediate C426



embedded image


A solution of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-methylpiperidin-4-yl}carbamate (250 mg, 0.455 mmol, 1 equiv) and trifluoroacetic acid (3 mL) in DCM (6 mL) was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 4-(4-amino-4-methylpiperidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (130 mg, 64%) as a solid. LCMS (ES, m/z): 450 [M+H]+


Synthesis of Compounds 516 and 517



embedded image


To a stirred solution of 4-(4-amino-4-methylpiperidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.334 mmol, 1 equiv) and acetaldehyde (73.50 mg, 1.670 mmol, 5 equiv) in DCE (5 mL) were added HOAc (60.11 mg, 1.002 mmol, 3 equiv) and NaBH3CN (104.84 mg, 1.670 mmol, 5 equiv) portions at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched by the addition of water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-ethyl-4-[4-(ethylamino)-4-methylpiperidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (3 mg, 2%) as a solid and 4-[4-(diethylamino)-4-methylpiperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide trifluoroacetic acid (25 mg, 12%) as a solid which was further purified by reverse flash chromatography (Condition 3, Gradient 3). Compound 516: LCMS (ES, m/z): 408 [M+H]+ 1H NMR (300 MHz, Methanol-d4) δ 9.11 (s, 1H), 8.55 (s, 1H), 8.10 (d, J=8.2 Hz, 1H), 7.74 (s, 1H), 7.25 (d, J=12.1 Hz, 1H), 6.56 (d, J=8.1 Hz, 1H), 4.63 (q, J=7.1 Hz, 2H), 3.81 (d, J=12.9 Hz, 2H), 3.20 (d, J=12.7 Hz, 2H), 2.80 (d, J=5.9 Hz, 2H), 2.44 (s, 3H), 1.97-1.83 (m, 4H), 1.72 (t, J=7.3 Hz, 3H), 1.33 (s, 3H), 1.22 (t, J=7.1 Hz, 3H). Compound 517: LCMS (ES, m/z): 506 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.27 (s, 1H), 9.44 (s, 1H), 8.92 (s, 1H), 8.30 (s, 1H), 8.13 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 7.76 (d, J=12.0 Hz, 1H), 6.58 (d, J=8.2 Hz, 1H), 4.63 (q, J=7.2 Hz, 2H), 4.03 (d, J=13.2 Hz, 2H), 3.49 (dd, J=13.3, 7.0 Hz, 2H), 3.20 (d, J=12.7 Hz, 2H), 3.06 (dt, J=13.5, 6.7 Hz, 2H), 2.44 (s, 3H), 2.09 (s, 4H), 1.64 (t, J=7.3 Hz, 3H), 1.45 (s, 3H), 1.31 (t, J=7.2 Hz, 6H).


Example 252: Synthesis of Compound 518
Synthesis of Intermediate C427



embedded image


To a solution of 6-bromo-2-methylimidazo[1,2-a]pyridine (100 mg, 0.474 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (170.30 mg, 0.474 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) were added Cs2CO3 (308.74 mg, 0.948 mmol, 2.0 equiv), XantPhos (54.83 mg, 0.095 mmol, 0.2 equiv) and Pd2(dba)3 (43.39 mg, 0.047 mmol, 0.1 equiv). After stirring for 5 h at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford tert-butyl 4-[2-methyl-7-({2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 43%) as a solid. LCMS (ES, m/z): 490 [M+H]+


Synthesis of Compound 518



embedded image


A solution of tert-butyl 4-[2-methyl-7-({2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (100 mg, 0.204 mmol, 1 equiv) and TFA (3 mL) in DCM (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-methyl-N-{2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (30 mg, 37.71%) as a solid. LCMS (ES, m/z): 390 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.35 (dd, J=2.1, 0.9 Hz, 1H), 8.80 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.76 (s, 1H), 7.48 (d, J=9.5 Hz, 1H), 7.25 (dd, J=9.5, 2.0 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.29 (s, 3H), 3.35 (d, J=5.3 Hz, 4H), 2.93 (dd, J=6.0, 3.6 Hz, 4H), 2.33 (d, J=0.9 Hz, 3H).


Example 253: Synthesis of Compound 520
Synthesis of Intermediate C428



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (120.0 mg, 0.298 mmol, 1.0 equiv) and tert-butyl N-ethyl-N-[(3R)-pyrrolidin-3-yl]carbamate (83.1 mg, 0.387 mmol, 1.3 equiv) in dioxane (1 mL) were added Cs2CO3 (194.4 mg, 0.596 mmol, 2.0 equiv) 184 and Ruphos (27.8 mg, 0.060 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (24.9 mg, 0.030 mmol, 0.1 equiv). After stirring for 2 h at 85° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford tert-butyl N-ethyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (130 mg, 80%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 520



embedded image


Into a 40 mL vial were added tert-butyl N-ethyl-N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (120.0 mg, 0.224 mmol, 1.0 equiv), DCM (2 mL) and HCl(gas) in 1,4-dioxane (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[(3R)-3-(ethylamino)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (25 mg, 25.34%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.96-7.86 (m, 2H), 7.30 (dd, J=12.4, 1.7 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.70 (m, 2H), 3.63 (d, J=8.4 Hz, 1H), 3.45 (dd, J=10.3, 5.1 Hz, 2H), 2.63 (q, J=7.1 Hz, 2H), 2.35 (s, 3H), 2.17 (dq, J=12.8, 6.6 Hz, 1H), 1.91 (dt, J=12.2, 6.3 Hz, 2H), 1.05 (t, J=7.1 Hz, 3H).


Example 254: Synthesis of Compound 522



embedded image


Into a 8 mL vial were added (3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (100.0 mg, 0.168 mmol, 1.0 equiv), DMSO (0.5 mL) and 1-cyclopropylmethanamine (47.9 mg, 0.672 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 60° C. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with CH2Cl2 (2×5 mL). The combined organic layers were washed with brine (1×3 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (THF) to afford 4-[(3R)-3-[(cyclopropylmethyl)amino]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (50 mg, 25%) as a solid. The crude product (50 mg) was purified by Chiral Prep-HPLC w (Condition 8, Gradient 1) to afford 4-[(3R)-3-[(cyclopropylmethyl)amino]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (20 mg, 25%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.31 (dd, J=12.5, 1.7 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.71 (m, 2H), 3.64 (s, 1H), 3.50 (d, J=30.5 Hz, 2H), 2.35 (s, 3H), 2.18 (s, 1H), 1.95 (s, 1H), 1.24 (s, 1H), 0.89 (d, J=22.6 Hz, 1H), 0.43 (d, J=7.7 Hz, 2H), 0.16 (d, J=4.6 Hz, 2H).


Example 255: Synthesis of Compound 524
Synthesis of Intermediate C429



embedded image


A solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) in dioxane (1 mL) was added tert-butyl N-isopropyl-N-[(3R)-pyrrolidin-3-yl] carbamate (85.1 mg, 0.373 mmol, 1.5 equiv), Cs2CO3 (202.5 mg, 0.623 mmol, 2.5 equiv) and Ruphos (23.3 mg, 0.050 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was stirred for 1 h at 80° C. to give a black solution. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (60%) to afford tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl] pyrrolidin-3-yl]-N-isopropylcarbamate (135 mg, 99%) as an oil. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 524



embedded image


A solution of tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl] pyrrolidin-3-yl]-N-isopropylcarbamate (150 mg, 0.273 mmol, 1 equiv) in DCM (2 mL) was added HCl(gas) in 1,4-dioxane (1 mL, 4M). The mixture was stirred for 1 h at 20° C. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-4-[(3R)-3-(isopropylamino) pyrrolidin-1-yl]-2-methylindazole-7-carboxamide (60 mg, 49%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.88 (s, 1H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.83 (t, J=8.4 Hz, 1H), 3.74 (m, 1H), 3.69-3.51 (m, 2H), 3.37 (d, J=13.2 Hz, 2H), 2.89 (p, J=6.2 Hz, 1H), 2.35 (s, 3H), 2.18 (dt, J=12.6, 6.2 Hz, 1H), 1.87 (dt, J=12.5, 6.9 Hz, 1H), 1.03 (t, J=5.8 Hz, 6H).


Example 256: Synthesis of Compound 525
Synthesis of Intermediate C430



embedded image


To a stirred solution of tert-butyl 4-amino-4-methylpiperidine-1-carboxylate (1 g, 4.666 mmol, 1 equiv) and (1-ethoxycyclopropoxy) trimethylsilane (1.63 g, 9.332 mmol, 2 equiv) in tetrahydrofuran (20 mL) were added HOAc (0.84 g, 13.998 mmol, 3 equiv) and NaBH3CN (0.88 g, 13.998 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for overnight at 60° C. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×30 mL). The combined organic layers were washed with brine (2×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford tert-butyl 4-(cyclopropylamino)-4-methylpiperidine-1-carboxylate (260 mg, 22%) as an oil. LCMS (ES, m/z): 255 [M+H]+


Synthesis of Intermediate C431



embedded image


Into a 40 mL vial were added tert-butyl 4-(cyclopropylamino)-4-methylpiperidine-1-carboxylate (260 mg, 1.022 mmol, 1 equiv) and HCl(gas) in 1,4-dioxane (5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 155 [M+H]+


Synthesis of Compound 525



embedded image


To a stirred solution of N-cyclopropyl-4-methylpiperidin-4-amine hydrochloride (100 mg, 0.524 mmol, 1 equiv) and 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (327 mg, 0.786 mmol, 1.5 equiv) in 1,4-dioxane (10 mL) were added Cs2CO3 (512 mg, 1.572 mmol, 3 equiv) and Pd-PEPPSI-IPentCl 2-methylpyridine (o-picoline (22 mg, 0.026 mmol, 0.05 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 48 h at 100° C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (2×30 mL). The combined organic layers were washed with brine (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[4-(cyclopropylamino)-4-methylpiperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (19 mg, 7%) as a solid. LCMS (ES, m/z): 490 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (s, 1H), 8.80 (s, 1H), 8.01-7.88 (m, 2H), 7.30 (d, J=12.4 Hz, 1H), 6.48 (d, J=8.7 Hz, 1H), 4.59 (d, J=7.4 Hz, 2H), 3.36-3.29 (m, 4H), 2.49 (s, 1H), 2.36 (d, J=2.6 Hz, 3H), 2.11 (s, 1H), 1.81 (d, J=13.2 Hz, 2H), 1.63 (dt, J=9.0, 4.5 Hz, 5H), 1.21 (d, J=2.6 Hz, 3H), 0.42 (d, J=3.6 Hz, 2H), 0.24 (s, 2H).


Example 256: Synthesis of Compound 526
Synthesis of Intermediate C432



embedded image


A solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (500 mg, 1.766 mmol, 1.00 equiv) in dioxane/H2O (4:1) (1 mL) were added tert-butyl 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4,5-dihydropyrrole-1-carboxylate (781.96 mg, 2.649 mmol, 1.5 equiv), K3PO4 (749.7 mg, 3.532 mmol, 2.0 equiv) and Pd(dppf)Cl2 (129.2 mg, 0.177 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 80° C. for 1 h. The resulting mixture was concentrated under vacuum to give the crude product. The residue was purified by silica gel column chromatography, eluted with PE/EA (65%) to afford methyl 4-[1-(tert-butoxycarbonyl)-4,5-dihydropyrrol-3-yl]-2-ethylindazole-7-carboxylate (500 mg, 76%) as an oil. LCMS (ES, m/z): 372 [M+H]+


Synthesis of Intermediate C433



embedded image


A solution of methyl 4-[1-(tert-butoxycarbonyl)-4,5-dihydropyrrol-3-yl]-2-ethylindazole-7-carboxylate (500 mg, 1.346 mmol, 1 equiv) in MeOH (15 mL) was added Pd/C (200 mg, 10% w/w). The mixture was stirred for 3 h at room temperature under hydrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1/1) to afford methyl 4-[1-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2-ethylindazole-7-carboxylate (270 mg, 54%) as an oil. LCMS (ES, m/z): 374 [M+H]+


Synthesis of Intermediate C434



embedded image


A solution of methyl 4-[1-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2-ethylindazole-7-carboxylate (270 mg, 0.723 mmol, 1 equiv) in THF/MeOH/H2O (1:1:1) (6 mL) was added LiOH·H2O (303.36 mg, 7.230 mmol, 10.0 equiv). The mixture was stirred for 1 h at 50° C. to give a yellow mixture. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum and acidified to pH 5-6 with 1M HCl. The resulting mixture was extracted with EtOAc (3×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[1-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2-ethylindazole-7-carboxylic acid (170 mg, 65%) as a oil. LCMS (ES, m/z): 360 [M+H]+


Synthesis of Intermediate C435



embedded image


A solution of 4-[1-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2-ethylindazole-7-carboxylic acid (170 mg, 0.473 mmol, 1 equiv) in DMF (1.5 mL) was added NH4Cl (126.5 mg, 2.365 mmol, 5 equiv), HATU (539.5 mg, 1.419 mmol, 3 equiv) and DIEA (91.7 mg, 0.710 mmol, 1.5 equiv). The mixture was stirred at room temperature for 1 h. The resulting mixture was washed with 2×10 mL of water. Then extracted with EtOAc (3×20 mL), and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE in EA (55%) to afford tert-butyl 3-(7-carbamoyl-2-ethylindazol-4-yl) pyrrolidine-1-carboxylate (125 mg, 74%) as an oil. LCMS (ES, m/z): 359 [M+H]+


Synthesis of Intermediate C436



embedded image


A solution of tert-butyl 3-(7-carbamoyl-2-ethylindazol-4-yl) pyrrolidine-1-carboxylate (125 mg, 0.349 mmol, 1 equiv) in dioxane (1.5 mL) was added 6-bromo-8-fluoroimidazo[1,2-a]pyridine (112.4 mg, 0.523 mmol, 1.5 equiv), Cs2CO3 (227.2 mg, 0.698 mmol, 2 equiv), XantPhos (40.3 mg, 0.070 mmol, 0.2 equiv) and Pd2(dba)3 (31.9 mg, 0.035 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 100° C. for 1 h to give a black solution. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (40%) to afford tert-butyl 3-[2-ethyl-7-({8-fluoroimidazo[1,2-a] pyridin-6-yl} carbamoyl) indazol-4-yl]pyrrolidine-1-carboxylate (50 mg, 29%) as an oil. LCMS (ES, m/z): 493 [M+H]+


Synthesis of Compound 526



embedded image


A solution of tert-butyl 3-[2-ethyl-7-({8-fluoroimidazo[1,2-a] pyridin-6-yl} carbamoyl) indazol-4-yl] pyrrolidine-1-carboxylate (50 mg, 0.102 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (1 mL, 4M). The mixture was stirred for 1 h at 20° C. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2-ethyl-N-{8-fluoroimidazo[1,2-a] pyridin-6-yl}-4-(pyrrolidin-3-yl) indazole-7-carboxamide (6.8 mg, 17%) as a solid. LCMS (ES, m/z): 393 [M+H]+ 1H NMR (400 MHz, Methanol-d4) δ 9.29 (d, J=1.8 Hz, 1H), 8.66 (d, J=1.3 Hz, 1H), 8.18 (d, J=7.4 Hz, 1H), 8.03 (dd, J=3.0, 1.4 Hz, 1H), 7.64 (d, J=1.3 Hz, 1H), 7.46 (t, J=7.8 Hz, OH), 7.34 (dd, J=11.7, 2.1 Hz, 1H), 7.20 (d, J=7.4 Hz, 1H), 4.69 (t, J=7.3 Hz, 2H), 3.84-3.74 (m, 1H), 3.60-3.45 (m, 1H), 3.29 (d, J=4.8 Hz, 1H), 3.25-3.07 (m, 2H), 2.50-2.37 (m, 1H), 2.24-2.06 (m, 1H), 1.75 (td, J=7.3, 3.1 Hz, 3H).


Example 257: Synthesis of Compound 527
Synthesis of Intermediate C437



embedded image


To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (310 mg, 1.152 mmol, 1 equiv) and tert-butyl 4-aminopiperidine-1-carboxylate (276.8 mg, 1.382 mmol, 1.2 equiv) in 1,4-dioxane (3 mL) were added Cs2CO3 (1.12 mg, 3.456 mmol, 3 equiv), RuPhos (107.5 mg, 0.230 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (96.4 mg, 0.115 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl]amino}-2-methylindazole-7-carboxylate (300 mg, 67%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C438



embedded image


To a solution of methyl 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl]amino}-2-methylindazole-7-carboxylate (110 mg, 0.283 mmol, 1 equiv) in THF (2 mL) was added NaH (17.0 mg, 0.424 mmol, 1.5 equiv, 60%) at 0° C. The mixture was stirred for 30 min and ethyl iodide (44.2 mg, 0.283 mmol, 1.0 equiv) was added and the mixture was allowed to warm to rt and stirred for 2 h. The reaction was quenched with MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2-methylindazole-7-carboxylate (120 mg, 92%) as a solid. LCMS (ES, m/z): 417 [M+H]+


Synthesis of Intermediate C439



embedded image


To a stirred mixture of methyl 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2-methylindazole-7-carboxylate (120 mg, 0.288 mmol, 1 equiv) in THF (1.5 mL) and H2O (1.5 mL) was added lithiumol hydrate (96.71 mg, 2.304 mmol, 8 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50° C. The mixture was acidified to pH 5 with HCl (2M). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2-methylindazole-7-carboxylic acid (120 mg, 99%) as a solid. LCMS (ES, m/z): 403 [M+H]+


Synthesis of Intermediate C440



embedded image


To a stirred mixture of 4-{[1-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2-methylindazole-7-carboxylic acid (100 mg, 0.248 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (49.24 mg, 0.298 mmol, 1.2 equiv) in DMF (1 mL) were added NMI (81.60 mg, 0.992 mmol, 4 equiv) and TCFH (104.57 mg, 0.372 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature. The resulting mixture was diluted with water (6 mL). The resulting mixture was extracted with EtOAc (3×6 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-{ethyl[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]amino}piperidine-1-carboxylate (50 mg, 37%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 527



embedded image


To a stirred mixture of tert-butyl 4-{ethyl[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]amino}piperidine-1-carboxylate (50 mg, 0.091 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (0.2 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[ethyl(piperidin-4-yl)amino]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (9 mg, 22%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.09 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.56 (s, 1H), 7.94 (d, J=8.4 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.32 (dd, J=12.4, 1.7 Hz, 1H), 6.37 (d, J=8.5 Hz, 1H), 4.31 (s, 3H), 4.06 (d, J=8.9 Hz, 1H), 3.57 (t, J=7.0 Hz, 2H), 3.04 (d, J=12.1 Hz, 2H), 2.76-2.60 (m, 2H), 2.35 (s, 3H), 1.72 (d, J=18.6 Hz, 4H), 1.21 (t, J=6.9 Hz, 3H).


Example 258: Synthesis of Compound 528
Synthesis of Intermediate C441



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (85.0 mg, 0.167 mmol, 1.0 equiv) in DCE (2 mL) was added PCl5 (45.3 mg, 0.217 mmol, 1.3 equiv) in portions at room temperature. The resulting mixture was stirred for 5 h at 60° C. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product mixture was used in the next step directly without further purification. LCMS (ES, m/z): 541 [M+H]+


Synthesis of Compound 528



embedded image


Into a 40 mL vial were added tert-butyl 4-[5-chloro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (80.0 mg, 0.148 mmol, 1.0 equiv), DCM (2 mL) and HCl(gas) in 1,4-dioxane (0.5 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 5-chloro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (15 mg, 23%) as a solid. LCMS (ES, m/z): 441 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.00 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 8.95 (s, 1H), 7.96-7.90 (m, 2H), 7.36 (dd, J=12.3, 1.7 Hz, 1H), 4.32 (s, 3H), 3.39 (t, J=4.7 Hz, 4H), 2.90 (t, J=4.8 Hz, 4H), 2.36 (s, 3H).


Example 259: Synthesis of Compound 529
Synthesis of Intermediate C442



embedded image


To a stirred mixture of 6-bromo-2-methoxypyridin-3-amine (9 g, 44.326 mmol, 1 equiv) in DCM (90 mL) was added NCS (7.1 g, 53.191 mmol, 1.2 equiv) in portions at 0° C. The resulting mixture was stirred for overnight at room temperature. The resulting mixture was diluted with water (100 mL). The resulting mixture was extracted with CH2Cl2 (2×100 mL). The combined organic layers were washed with brine (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (10:1) to afford 6-bromo-4-chloro-2-methoxypyridin-3-amine (6 g, 57%) as a solid. LCMS (ES, m/z): 237 [M+H]+


Synthesis of Intermediate C443



embedded image


A solution of 6-bromo-4-chloro-2-methoxypyridin-3-amine (2 g, 8.422 mmol, 1 equiv) in Ac2O (20 mL) was stirred for 2 h at 80° C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford N-acetyl-N-(6-bromo-4-chloro-2-methoxypyridin-3-yl) acetamide (1.5 g, 55%) as a solid. LCMS (ES, m/z): 280 [M+H]+


Synthesis of Intermediate C444



embedded image


To a solution of N-(6-bromo-4-chloro-2-methoxypyridin-3-yl)acetamide (1 g, 3.578 mmol, 1 equiv) in DMF (3 mL) was added Cs2CO3 (2.33 g, 7.156 mmol, 2.0 equiv), (1S,2S)—N1,N2-dimethylcyclohexane-1,2-diamine (0.1 g, 0.716 mmol, 0.2 equiv) and CuI (0.07 g, 0.358 mmol, 0.1 equiv). After stirring for 3 h at 80° C. under a nitrogen atmosphere, the mixture was allowed to cool down to rt. The resulting mixture was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford 6-bromo-4-methoxy-2-methyl-[1,3]oxazolo[4,5-c]pyridine (100 mg, 12%) as a solid. LCMS (ES, m/z): 243 [M+H]+


Synthesis of Intermediate C445



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-1-carboxylate (150 mg, 0.417 mmol, 1 equiv) and 6-bromo-4-methoxy-2-methyl-[1,3]oxazolo[4,5-c]pyridine (101.4 mg, 0.417 mmol, 1.0 equiv) in dioxane (4 mL) were added Cs2CO3 (407.9 mg, 1.251 mmol, 3.0 equiv), Xantphos (48.3 mg, 0.083 mmol, 0.2 equiv) and Pd2(dba)3·CHCl3 (43.2 mg, 0.042 mmol, 0.1 equiv). After stirring for 2 h at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[7-({4-methoxy-2-methyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (163 mg, 75%) as a solid. LCMS (ES, m/z): 522 [M+H]+


Synthesis of Compound 529



embedded image


A solution of tert-butyl 4-[7-({4-methoxy-2-methyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (150 mg, 0.288 mmol, 1 equiv) and TFA (0.3 mL) in DCM (3 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford N-{4-methoxy-2-methyl-[1,3]oxazolo[4,5-c]pyridin-6-yl}-2-methyl-4-(piperazin-1-yl) indazole-7-carboxamide (26 mg, 21%) as a solid. LCMS (ES, m/z): 422 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.69 (s, 1H), 8.81 (s, 1H), 8.20 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.26 (s, 3H), 4.09 (s, 3H), 3.37-3.32 (m, 4H), 2.92 (t, J=5.0 Hz, 4H), 2.60 (s, 3H).


Example 260: Synthesis of Compound 531



embedded image


To a stirred mixture of (3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (150 mg, 0.253 mmol, 1 equiv) in DMSO (0.75 mL) was added oxetan-3-amine (92.36 mg, 1.265 mmol, 5 equiv) dropwise at room temperature. The resulting mixture was stirred for 24 h at 60° C. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (2×10 mL). The combined organic layers were washed with water (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(oxetan-3-ylamino)pyrrolidin-1-yl]indazole-7-carboxamide (50 mg) and then prep-chiral-HPLC (Condition 9, Gradient 1) to afford the target compound (12.2 mg, 10%) as a solid. LCMS (ES, m/z): 464 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.82 (s, 1H), 7.97-7.85 (m, 2H), 7.31 (dd, J=12.4, 1.6 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.68 (td, J=6.6, 3.7 Hz, 2H), 4.36 (dt, J=10.6, 6.1 Hz, 2H), 4.27 (s, 3H), 4.03 (p, J=6.7 Hz, 1H), 3.79-3.71 (m, 2H), 3.67-3.61 (m, 1H), 3.41 (d, J=8.8 Hz, 3H), 2.35 (s, 3H), 2.14-2.09 (m, 1H), 1.85 (dd, J=12.3, 6.3 Hz, 1H).


Example 261: Synthesis of Compound 533



embedded image


To a stirred mixture of (3S)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (150 mg, 0.253 mmol, 1 equiv) in DMSO (0.75 mL) was added cyclobutanamine (89.83 mg, 1.265 mmol, 5 equiv) dropwise at room temperature. The resulting mixture was stirred for 24 h at 60° C. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (2×10 mL). The combined organic layers were washed with water (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford (R)-4-(3-(cyclobutylamino)pyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-2H-indazole-7-carboxamide (60 mg) and then prep-chiral-HPLC (Condition 9, Gradient 1) to afford the target compound (19.3 mg, 17%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.81 (s, 1H), 7.93 (d, J=8.2 Hz, 1H), 7.88 (d, J=3.0 Hz, 1H), 7.30 (dd, J=12.4, 1.7 Hz, 1H), 6.01 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.78-3.72 (m, 2H), 3.66-3.59 (m, 1H), 3.49-3.47 (m, 1H), 3.41-3.39 (m, 2H), 2.35 (s, 3H), 2.21-2.11 (m, 3H), 1.95-1.88 (m, 1H), 1.79-1.74 (m, 2H), 1.66-1.55 (m, 2H).


Example 262: Synthesis of Compound 535
Synthesis of Intermediate C446



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.36 mmol, 1 equiv) and tert-butyl (2S)-2-isopropylpiperazine-1-carboxylate (124 mg, 0.54 mmol, 1.5 equiv) in dioxane (8 mL) were added Cs2CO3 (235 mg, 0.72 mmol, 2 equiv), RuPhos (34 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (31 mg, 0.036 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:5) to afford tert-butyl (2S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2-isopropylpiperazine-1-carboxylate (100 mg, 49%) as a solid. LCMS (ES, m/z): 564 [M+H]+


Synthesis of Compound 535



embedded image


A solution of tert-butyl (2S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-2-isopropylpiperazine-1-carboxylate (100 mg, 0.177 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3 S)-3-isopropylpiperazin-1-yl]indazole-7-carboxamide (35 mg, 43%) as a solid. LCMS (ES, m/z): 464 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.76 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.30 (d, J=12.2 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.84 (d, J=8.4 Hz, 1H), 3.75 (d, J=11.7 Hz, 1H), 3.05 (d, J=8.0 Hz, 1H), 2.90 (d, J=8.6 Hz, 2H), 2.67 (t, J=11.0 Hz, 2H), 2.35 (s, 3H), 1.61 (t, J=7.2 Hz, 4H), 0.97 (d, J=6.7 Hz, 6H).


Example 263: Synthesis of Compounds 537 and 538
Synthesis of Compound 537



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv), Cs2CO3 (352 mg, 1.080 mmol, 3 equiv) and (9aR)-octahydropyrazino[2,1-c][1,4]oxazine (76 mg, 0.540 mmol, 1.5 equiv) in 1,4-dioxane (5 mL) were added RuPhos (33 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at 100° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[(9aR)-hexahydro-1H-pyrazino[2,1-c][1,4]oxazin-8-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (11 mg, 6%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 9.22 (d, J=1.6 Hz, 1H), 8.89 (s, 1H), 7.99 (d, J=8.0 Hz, 1H), 7.92 (d, J=3.1 Hz, 1H), 7.33 (d, J=12.0 Hz, 1H), 6.52 (s, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.86 (s, 4H), 3.58 (s, 4H), 2.97 (s, 1H), 2.87 (s, 1H), 2.73 (s, 1H), 2.54 (s, 1H), 2.36 (s, 3H), 1.63 (t, J=7.3 Hz, 3H).


Synthesis of Compound 538



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (100 mg, 0.24 mmol, 1 equiv) and (9aS)-octahydropyrazino[2,1-c][1,4]oxazine (69 mg, 0.48 mmol, 2 equiv) in dioxane (3 mL) were added Cs2CO3 (470 mg, 1.440 mmol, 6 equiv), RuPhos (23 mg, 0.048 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20 mg, 0.024 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 5 h at 100° C. The mixture was allowed to cool down to room temperature. The reaction was quenched with water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 4-[(9aS)-hexahydro-1H-pyrazino[2,1-c][1,4]oxazin-8-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} indazole-7-carboxamide (55 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.88 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.31 (dd, J=12.4, 1.5 Hz, 1H), 6.51 (d, J=8.1 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.81 (dq, J=22.0, 12.0 Hz, 4H), 3.57 (t, J=11.2 Hz, 1H), 3.19 (t, J=10.4 Hz, 1H), 3.08 (t, J=11.5 Hz, 1H), 2.88 (d, J=11.5 Hz, 1H), 2.73 (d, J=10.7 Hz, 1H), 2.61 (t, J=11.2 Hz, 1H), 2.35 (s, 6H), 1.63 (t, J=7.2 Hz, 3H).


Example 264: Synthesis of Compound 539
Synthesis of Intermediate C447



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (100.0 mg, 0.240 mmol, 1.0 equiv) and tert-butyl N-(3-methylpyrrolidin-3-yl)carbamate (72.1 mg, 0.360 mmol, 1.5 equiv) in dioxane (4 mL) were added Cs2CO3 (156.5 mg, 0.480 mmol, 2.0 equiv) and Ruphos (22.4 mg, 0.048 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.0 mg, 0.024 mmol, 0.1 equiv). After stirring for 2 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:5) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3-methylpyrrolidin-3-yl}carbamate (80 mg, 57.20%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 539



embedded image


To a stirred mixture of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl) indazol-4-yl]-3-methylpyrrolidin-3-yl}carbamate (80.0 mg, 0.149 mmol, 1.0 equiv) in DCM (2 mL) was added HCl(gas) in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-(3-amino-3-methylpyrrolidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (15 mg, 23%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.0 Hz, 1H), 7.27 (dd, J=12.4, 1.7 Hz, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.85 (d, J=8.9 Hz, 1H), 3.72-3.71 (m, 1H), 3.51 (q, J=10.1 Hz, 2H), 2.37-2.33 (m, 3H), 1.96 (t, J=6.9 Hz, 2H), 1.61 (t, J=7.3 Hz, 3H), 1.34 (s, 3H).


Example 265: Synthesis of Compounds 541 and 542
Synthesis of Intermediate C448



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1.0 equiv) and tert-butyl 2-cyclopropylpiperazine-1-carboxylate (97.8 mg, 0.432 mmol, 1.2 equiv) in dioxane (1.5 mL) were added Cs2CO3 (352.2 mg, 1.080 mmol, 3.0 equiv), Ruphos (33.6 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.1 mg, 0.036 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was concentrated off. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 2-cyclopropyl-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (116 mg, 57%) as a solid. LCMS (ES, m/z): 562 [M+H]+


Synthesis of Compound 541



embedded image


A solution of tert-butyl 2-cyclopropyl-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (110 mg, 0.196 mmol, 1 equiv) in DCM (0.9 mL) was treated with HCl(gas) in 1,4-dioxane (0.3 mL). The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was neutralized to PH=7 with NaHCO3 aqueous and extracted with DCM/MeOH (20/1). The organic layer was concentrated in vacuo. The residue was purified by chiral-HPLC (Condition 2, Gradient 2) to afford 4-[(3S)-3-cyclopropylpiperazin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (23 mg, 29%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.77 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 3.79 (dd, J=19.6, 11.7 Hz, 2H), 3.08-2.72 (m, 4H), 2.35 (s, 3H), 2.16-2.03 (m, 1H), 1.62 (t, J=7.3 Hz, 3H), 0.81 (qt, J=8.4, 5.0 Hz, 1H), 0.44 (dd, J=7.9, 3.9 Hz, 2H), 0.42-0.26 (m, 2H).


Synthesis of Compound 542



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (100 mg, 0.240 mmol, 1.0 equiv) and (2R)-2-cyclopropylpiperazine (36.4 mg, 0.288 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs2CO3 (244.2 mg, 0.750 mmol, 3.0 equiv), Ruphos (23.3 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.9 mg, 0.025 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature and concentrated off. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-cyclopropylpiperazin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (32.3 mg, 29%) as a solid. LCMS (ES, m/z): 462 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.77 (s, 1H), 7.99 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.0 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 3.79 (dd, J=19.5, 11.6 Hz, 2H), 3.03 (d, J=11.2 Hz, 1H), 2.99-2.90 (m, 1H), 2.87 (dd, J=11.2, 2.5 Hz, 1H), 2.84-2.75 (m, 1H), 2.35 (s, 3H), 2.11 (t, J=9.1 Hz, 1H), 1.62 (t, J=7.3 Hz, 3H), 0.81 (td, J=8.7, 8.1, 4.1 Hz, 1H), 0.43 (dd, J=7.8, 3.7 Hz, 2H), 0.40-0.26 (m, 2H).


Example 266: Synthesis of Compound 543
Synthesis of Intermediate C449



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (130 mg, 0.312 mmol, 1 equiv) and tert-butyl N-cyclobutyl-N-(piperidin-4-yl)carbamate (159 mg, 0.624 mmol, 2 equiv) in dioxane (10 mL) were added Cs2CO3 (204 mg, 0.624 mmol, 2 equiv), RuPhos (29 mg, 0.062 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (26 mg, 0.031 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford tert-butyl N-cyclobutyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (100 mg, 54%) as a solid. LCMS (ES, m/z): 590 [M+H]+


Synthesis of Compound 543



embedded image


A solution of tert-butyl N-cyclobutyl-N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (90 mg, 0.153 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[4-(cyclobutylamino)piperidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (40 mg, 54%) as a solid. LCMS (ES, m/z): 490 [M+H]+1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.20 (s, 1H), 8.78 (s, 1H), 7.96 (d, J=8.0 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.29 (d, J=12.2 Hz, 1H), 6.47 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.86 (d, J=12.5 Hz, 2H), 3.27 (d, J=7.4 Hz, 1H), 3.03 (t, J=11.9 Hz, 2H), 2.65 (dq, J=9.7, 4.6, 4.1 Hz, 1H), 2.35 (s, 3H), 2.12 (t, J=8.2 Hz, 2H), 1.96-1.76 (m, 3H), 1.76-1.50 (m, 7H), 1.43 (q, J=11.5, 9.7 Hz, 2H).


Example 267: Synthesis of Compounds 544, 547, and 548
Synthesis of Intermediate C450



embedded image


To a stirred solution of tert-butyl N-(3-methylpyrrolidin-3-yl)carbamate (2.0 g, 9.986 mmol, 1.0 equiv) and DIEA (2.5 g, 19.972 mmol, 2.0 equiv) in DCM (30 mL) was added benzyl chloroformate (2.0 g, 11.983 mmol, 1.2 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 5 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with CH2Cl2 (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford benzyl 3-[(tert-butoxycarbonyl)amino]-3-methylpyrrolidine-1-carboxylate (3.4 g, 92%) as a solid. LCMS (ES, m/z): 335 [M+H]+


Synthesis of Intermediate C451



embedded image


To a stirred solution of benzyl 3-[(tert-butoxycarbonyl)amino]-3-methylpyrrolidine-1-carboxylate (750.0 mg, 2.243 mmol, 1.0 equiv) and NaH (107.6 mg, 4.486 mmol, 2.0 equiv) in dimethylformamide (15 mL) was added methyl iodide (636.6 mg, 4.486 mmol, 2.0 equiv) dropwise at 0° C. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with Water at 0° C. The resulting mixture was extracted with EtOAc (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. LCMS (ES, m/z): 349 [M+H]+


Synthesis of Intermediate C452



embedded image


To a solution of benzyl 3-[(tert-butoxycarbonyl)(methyl)amino]-3-methylpyrrolidine-1-carboxylate (650.0 mg, 1.865 mmol, 1.0 equiv) in 15 mL MeOH was added Pd/C (10%, 59.5 mg) under nitrogen atmosphere in a 100 mL round-bottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon, filtered through a Celite pad and concentrated under reduced pressure. This resulted in tert-butyl N-methyl-N-(3-methylpyrrolidin-3-yl) carbamate (350 mg, 79%) as an oil. LCMS (ES, m/z): 215 [M+H]+


Synthesis of Intermediate C453



embedded image


To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (100.0 mg, 0.240 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(3-methylpyrrolidin-3-yl) carbamate (77.2 mg, 0.360 mmol, 1.5 equiv) in dioxane (3 mL) were added Cs2CO3 (157.0 mg, 0.480 mmol, 2.0 equiv) and Ruphos (22.4 mg, 0.048 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.0 mg, 0.024 mmol, 0.1 equiv). After stirring for 2 h at 85° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:5) to afford tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-3-methylpyrrolidin-3-yl}-N-methylcarbamate (130 mg, 89%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 544



embedded image


To a stirred solution of tert-butyl N-{1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl) indazol-4-yl]-3-methylpyrrolidin-3-yl}-N-methylcarbamate (100.0 mg, 0.182 mmol, 1.0 equiv) in DCM (2 mL) was added HCl (gas) in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-methyl-3-(methylamino) pyrrolidin-1-yl]indazole-7-carboxamide (23 mg, 28%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.78 (d, J=8.4 Hz, 1H), 3.68 (m, 1H), 3.57 (d, J=10.3 Hz, 1H), 3.45 (d, J=10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J=12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82 (m, 1H), 1.61 (t, J=7.2 Hz, 3H), 1.27 (s, 3H).


Synthesis of Compound 547



embedded image


17 mg of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-methyl-3-(methylamino) pyrrolidin-1-yl]indazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 10, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3R)-3-methyl-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (6 mg, 33%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.78 (d, J=8.4 Hz, 1H), 3.68-3.67 (m, 1H), 3.57 (d, J=10.3 Hz, 1H), 3.45 (d, J=10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J=12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82-1.81 (m, 1H), 1.61 (t, J=7.2 Hz, 3H), 1.27 (s, 3H).


Synthesis of Compound 548



embedded image


17 mg of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-methyl-3-(methylamino) pyrrolidin-1-yl]indazole-7-carboxamide was purified by prep-chiral HPLC (Condition 10, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo [1,2-a]pyridin-6-yl}-4-[(3S)-3-methyl-3-(methylamino) pyrrolidin-1-yl]indazole-7-carboxamide (6 mg, 33%) as a solid.


LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.78 (d, J=8.4 Hz, 1H), 3.68-3.67 (m, 1H), 3.57 (d, J=10.3 Hz, 1H), 3.45 (d, J=10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J=12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82-1.81 (m, 1H), 1.61 (t, J=7.2 Hz, 3H), 1.27 (s, 3H).


Example 268: Synthesis of Compound 545
Synthesis of Intermediate C454



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.36 mmol, 1 equiv), Cs2CO3 (235 mg, 0.72 mmol, 2 equiv) and tert-butyl 4-(methylamino)piperidine-1-carboxylate (116 mg, 0.54 mmol, 1.5 equiv) in dioxane (5 mL) were added RuPhos (34 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:5) to afford tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl](methyl)amino}piperidine-1-carboxylate (60 mg, 30%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 545



embedded image


A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl](methyl)amino}piperidine-1-carboxylate (60 mg, 0.109 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(methyl(piperidin-4-yl)amino)-2H-indazole-7-carboxamide (16 mg, 33%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.70 (s, 1H), 7.99-7.86 (m, 2H), 7.33-7.23 (m, 1H), 6.34 (d, J=8.5 Hz, 1H), 4.60 (q, J=7.2 Hz, 2H), 3.99 (s, 1H), 3.06 (d, J=15.7 Hz, 5H), 2.67 (s, 2H), 2.35 (s, 3H), 1.72 (s, 4H), 1.62 (t, J=7.2 Hz, 3H).


Example 269: Synthesis of Compound 550
Synthesis of Intermediate C455



embedded image


To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv) and tert-butyl (1R,5S)-3-amino-8-azabicyclo[3.2.1]octane-8-carboxylate (0.96 g, 4.238 mmol, 1.2 equiv) in dioxane (18 mL) were added RuPhos (0.33 g, 0.706 mmol, 0.2 equiv), Cs2CO3 (3.45 g, 10.596 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (0.3 g, 0.353 mmol, 0.1 equiv). After stirring for 3 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography w (Condition 5, Gradient 2) to afford methyl 4-{[(1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl]amino}-2-ethylindazole-7-carboxylate (1.4 g, 93%) as a solid. LCMS (ES, m/z): 429 [M+H]+


Synthesis of Intermediate C456



embedded image


To a stirred solution of methyl 4-{[(1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl]amino}-2-ethylindazole-7-carboxylate (500 mg, 1.167 mmol, 1 equiv) in DMF (6 mL) was added NaH (93.33 mg, 2.334 mmol, 2.0 equiv, 60%) in portions at 0° C. The resulting mixture was stirred for 0.5 h at 0° C. To the above mixture was added CH3I (165.6 mg, 1.167 mmol, 1.0 equiv) dropwise at 0° C. The resulting mixture was stirred for additional 2 h at room temperature. The reaction mixture was quenched by the addition of MeOH (5 mL) at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{[(1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl](methyl)amino}-2-ethylindazole-7-carboxylate (500 mg, 97%) as a solid. LCMS (ES, m/z): 443 [M+H]+


Synthesis of Intermediate C457



embedded image


A solution of methyl 4-{[(1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl](methyl)amino}-2-ethylindazole-7-carboxylate (500 mg, 1.130 mmol, 1 equiv) and LiOH·H2O (162.3 mg, 6.780 mmol, 6.0 equiv) in MeOH (2 mL), H2O (2 mL) and THF (2 mL) was stirred for 12 h at room temperature. The mixture was acidified to pH 2 with 2 mol/L aq. HCl. The precipitated solids were collected by filtration and washed with H2O (3×5 mL) to afford 4-(((1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)-2-ethyl-2H-indazole-7-carboxylic acid (400 mg, 83%) as a solid. LCMS (ES, m/z): 429 [M+H]+


Synthesis of Intermediate C458



embedded image


To a solution of 4-{[(1R,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan-3-yl](methyl)amino}-2-ethylindazole-7-carboxylic acid (100 mg, 0.233 mmol, 1 equiv) and TCFH (85.1 mg, 0.303 mmol, 1.3 equiv) in CH3CN (2 mL) were added NMI (67 mg, 0.816 mmol, 3.5 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (46.2 mg, 0.28 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 1) to afford tert-butyl (1R,5S)-3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl](methyl)amino}-8-azabicyclo[3.2.1]octane-8-carboxylate (55 mg, 41%) as a solid.


LCMS (ES, m/z): 576 [M+H]+


Synthesis of Compound 550



embedded image


A solution of tert-butyl (1R,5S)-3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl](methyl)amino}-8-azabicyclo[3.2.1]octane-8-carboxylate (50 mg, 0.087 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-[(1R,5S)-8-azabicyclo[3.2.1]octan-3-yl(methyl)amino]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (20 mg, 48%) as a solid. LCMS (ES, m/z): 476 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.09 (s, 1H), 9.22 (d, J=1.7 Hz, 1H), 8.69 (s, 1H), 7.99-7.86 (m, 2H), 7.28 (dd, J=12.4, 1.7 Hz, 1H), 6.37 (d, J=8.5 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 4.38-4.18 (m, 1H), 3.52 (s, 2H), 3.07 (s, 3H), 2.35 (s, 3H), 1.87 (t, J=11.5 Hz, 2H), 1.74 (s, 3H), 1.63 (q, J=9.2, 7.3 Hz, 6H).


Example 270: Synthesis of Compound 552
Synthesis of Intermediate C459



embedded image


A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-1-carboxylate (500 mg, 1.332 mmol, 1.0 equiv) in DMSO (5 mL) was treated with morpholine (580.1 mg, 6.66 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 70° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was extracted with EtOAc (3×30 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford benzyl (3R)-3-(morpholin-4-yl)pyrrolidine-1-carboxylate (395 mg, 98%) as a solid. LCMS (ES, m/z): 291 [M+H]+


Synthesis of Intermediate C460



embedded image


To a solution of benzyl (3R)-3-(morpholin-4-yl)pyrrolidine-1-carboxylate (395 mg, 1.360 mmol, 1.0 equiv) in 10 mL MeOH was added Pd/C (10%, 40 mg) in a pressure tank. The mixture was hydrogenated at room temperature under 5 psi of hydrogen pressure for overnight, filtered through a Celite pad and concentrated under reduced pressure to afford 4-[(3R)-pyrrolidin-3-yl]morpholine (170 mg, 80%) as a oil. 1H NMR (400 MHz, Chloroform-d) δ 3.73 (t, J=4.8 Hz, 4H), 3.19-3.01 (m, 2H), 2.95 (dt, J=11.0, 7.5 Hz, 1H), 2.83-2.62 (m, 2H), 2.49 (ddt, J=27.6, 10.7, 4.0 Hz, 4H), 1.95 (dtd, J=12.3, 7.4, 4.7 Hz, 1H), 1.64 (dq, J=12.4, 7.7 Hz, 1H).


Synthesis of Compound 552



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1.0 equiv) and 4-[(3R)-pyrrolidin-3-yl]morpholine (32.6 mg, 0.209 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs2CO3 (170.1 mg, 0.522 mmol, 3.0 equiv), Ruphos (8.1 mg, 0.017 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (14.5 mg, 0.017 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(morpholin-4-yl)pyrrolidin-1-yl]indazole-7-carboxamide (40 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.86 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.90-7.86 (m, 1H), 7.30 (dd, J=12.5, 1.7 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.96-3.84 (m, 1H), 3.75 (t, J=9.3 Hz, 1H), 3.64-3.61 (m, 5H), 3.49 (t, J=9.0 Hz, 1H), 3.00 (t, J=8.2 Hz, 1H), 2.53-2.52 (m, 4H), 2.34 (s, 3H), 2.33-2.18 (m, 1H), 1.90-1.88 (m, 1H).


Example 271: Synthesis of Compound 554
Synthesis of Intermediate C461



embedded image


To a stirred solution of allylamine (2.0 g, 35.029 mmol, 1.0 equiv) and DIEA (9.0 g, 70.058 mmol, 2.0 equiv) in DCM (30 mL) was added 4-nitrobenzenesulfonyl chloride (7.7 g, 35.029 mmol, 1.0 equiv) dropwise at room temperature. The resulting mixture was stirred for 5 h at room temperature. The resulting mixture was extracted with CH2Cl2 (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford 4-nitro-N-(prop-2-en-1-yl)benzenesulfonamide (5 g, 53%) as a solid. LCMS (ES, m/z): 243 [M+H]+


Synthesis of Intermediate C462



embedded image


To a stirred solution of 4-nitro-N-(prop-2-en-1-yl)benzenesulfonamide (1.5 g, 6.192 mmol, 1.0 equiv), triphenylphosphine (2.7 g, 10.526 mmol, 1.7 equiv) and tert-butyl (3S)-3-hydroxypyrrolidine-1-carboxylate (1.7 g, 9.288 mmol, 1.5 equiv) in tetrahydrofuran (20 mL) was added DEAD (2.1 g, 12.384 mmol, 2.0 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 3 h at room temperature under nitrogen atmosphere. The reaction was monitored by LCMS. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with EtOAc (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford tert-butyl (3R)-3-[N-(prop-2-en-1-yl)4-nitrobenzenesulfonamido]pyrrolidine-1-carboxylate (1.6 g, 56%) as an oil. LCMS (ES, m/z): 412 [M+H]+


Synthesis of Intermediate C463



embedded image


To a stirred solution of tert-butyl (3R)-3-[N-(prop-2-en-1-yl)4-nitrobenzenesulfonamido]pyrrolidine-1-carboxylate (800.0 mg, 1.944 mmol, 1.0 equiv) in DCM (3 mL) was added HCl (gas) in 1,4-dioxane (1 mL, 4 M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was neutralized to PH=7 with NaHCO3 aqueous and extracted with DCM (3×5 mL). The combined organic layers were dried by anhydrous Na2SO4 and filtered. The filtrate was concentrated in vacuo. This resulted in 4-nitro-N-(prop-2-en-1-yl)-N-[(3R)-pyrrolidin-3-yl] benzenesulfonamide (450 mg, 68%) as a solid. LCMS (ES, m/z): 312 [M+H]+


Synthesis of Intermediate C464



embedded image


Into a 20 mL vial were added 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (200.0 mg, 0.497 mmol, 1.0 equiv), Cs2CO3 (325.0 mg, 0.994 mmol, 2.0 equiv), 4-nitro-N-(prop-2-en-1-yl)-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (309.6 mg, 0.994 mmol, 2.0 equiv), Pd-PEPPSI-IPentCl (20.9 mg, 0.025 mmol, 0.05 equiv) and dimethylformamide (5 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 70° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-[N-(prop-2-en-1-yl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]indazole-7-carboxamide (220 mg, 35%) as a solid. LCMS (ES, m/z): 633 [M+H]+


Synthesis of Compound 554



embedded image


Into a 8 mL vial were added N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-[N-(prop-2-en-1-yl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]indazole-7-carboxamide (100.0 mg, 0.158 mmol, 1.0 equiv), K2CO3 (43.6 mg, 0.316 mmol, 2.0 equiv) and C6H5SK (35.0 mg, 0.237 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(prop-2-en-1-ylamino)pyrrolidin-1-yl]indazole-7-carboxamide (70 mg) as a solid. The crude product (70 mg) was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8-fluoro-2-methylimidazo [1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(prop-2-en-1-ylamino)pyrrolidin-1-yl]indazole-7-carboxamide (15 mg, 21%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.83 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J=12.4, 1.6 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 5.89 (ddt, J=16.3, 11.3, 5.8 Hz, 1H), 5.21 (dq, J=17.3, 1.7 Hz, 1H), 5.07 (dt, J=10.3, 1.7 Hz, 1H), 4.27 (s, 3H), 3.78 (dd, J=19.9, 6.9 Hz, 2H), 3.64 (d, J=8.1 Hz, 1H), 3.51-3.40 (m, 2H), 3.26 (dt, J=5.8, 1.6 Hz, 2H), 2.37-2.33 (m, 3H), 2.17 (dd, J=11.9, 5.7 Hz, 1H), 1.93 (dd, J=12.2, 6.2 Hz, 1H).


Example 272: Synthesis of Compound 556
Synthesis of Intermediate C465



embedded image


To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (1.5 g, 5.298 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (1.27 g, 6.358 mmol, 1.2 equiv) in Dioxane (30 mL) were added Cs2CO3 (5.18 g, 15.894 mmol, 3 equiv) and RuPhos (0.49 g, 1.060 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (443.1 mg, 0.530 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 80° C. under nitrogen atmosphere. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with EtOAc (3×30 mL). The combined organic layers were washed with water (3×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethylindazole-7-carboxylate (1.9 g, 89%) as a solid. LCMS (ES, m/z): 403 [M+H]+


Synthesis of Intermediate C466



embedded image


To a stirred mixture of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethylindazole-7-carboxylate (1.9 g, 4.721 mmol, 1 equiv) in THF (20 mL) and H2O (20 mL) was added LiOH·H2O (0.99 g, 23.605 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50° C. The mixture was acidified to pH 4 with HCl (2M). The resulting mixture was extracted with EtOAc (3×40 mL). The combined organic layers were washed with water (3×40 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethylindazole-7-carboxylic acid (1.4 g, 76%) as a solid. LCMS (ES, m/z): 389 [M+H]+


Synthesis of Intermediate C467



embedded image


To a stirred mixture of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-1-yl]-2-ethylindazole-7-carboxylic acid (1.2 g, 3.089 mmol, 1 equiv) and NH4Cl (0.83 g, 15.445 mmol, 5 equiv) in DMF (24 mL) were added NMI (1.01 g, 12.356 mmol, 4 equiv) and TCFH (1.73 g, 6.178 mmol, 2 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was filtered and the filter cake was washed with EtOAc (3×10 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl N-[(3R)-1-(7-carbamoyl-2-ethylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (900 mg, 75%) as a solid. LCMS (ES, m/z): 388 [M+H]+


Synthesis of Intermediate C468



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-ethylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (400 mg, 1.032 mmol, 1 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2-a]pyridine (380.1 mg, 1.548 mmol, 1.5 equiv) in Dioxane (8 mL) were added Cs2CO3 (672.7 mg, 2.064 mmol, 2 equiv) and BrettPhos (110.8 mg, 0.206 mmol, 0.2 equiv) and Pd2(dba)3 (94.5 mg, 0.103 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100° C. under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-[(3R)-1-[7-({8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-ethylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (80 mg, 14%) as a solid. LCMS (ES, m/z): 552 [M+H]+


Synthesis of Compound 556



embedded image


To a stirred mixture of tert-butyl N-[(3R)-1-[7-({8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-ethylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (80 mg, 0.145 mmol, 1 equiv) in DCM (1.5 mL) was added HCl(gas) in 1,4-dioxane (0.5 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-ethyl-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (12.8 mg, 20%) as a solid. LCMS (ES, m/z): 452 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.03 (s, 1H), 9.30 (d, J=1.8 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J=8.2 Hz, 1H), 7.88 (s, 1H), 7.50 (d, J=1.7 Hz, 1H), 6.02 (d, J=8.3 Hz, 1H), 4.58 (q, J=7.2 Hz, 2H), 3.77 (dd, J=13.5, 7.1 Hz, 2H), 3.66 (s, 1H), 3.43 (dd, J=11.1, 3.9 Hz, 1H), 2.35 (d, J=3.5 Hz, 6H), 2.15 (dd, J=12.7, 6.1 Hz, 1H), 1.92 (dd, J=12.5, 6.7 Hz, 2H), 1.61 (t, J=7.2 Hz, 3H).


Example 273: Synthesis of Compound 557
Synthesis of Intermediate C469



embedded image


To a stirred solution of methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (2 g, 7.324 mmol, 1 equiv) in EA (20 mL) was added tetrafluoroboranuide; triethyloxidanium (2.8 g, 14.648 mmol, 2 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The reaction was quenched by the addition of saturated aqueous NaHCO3 (100 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (2.1 g, 95%) as a solid. LCMS (ES, m/z): 301 [M+H]+


Synthesis of Intermediate C470



embedded image


To a stirred solution of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (300 mg, 0.996 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (455 mg, 1.992 mmol, 2 equiv) in dioxane (10 mL) were added Cs2CO3 (649 mg, 1.992 mmol, 2 equiv), RuPhos (93 mg, 0.199 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (83 mg, 0.1 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylate (150 mg, 34%) as a solid. LCMS (ES, m/z): 449 [M+H]+


Synthesis of Intermediate C471



embedded image


A mixture of methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylate (376 mg, 0.838 mmol, 1 equiv) and LiOH (201 mg, 8.38 mmol, 10 equiv) in H2O (4 mL), THF (4 mL) and MeOH (4 mL) was stirred for overnight at room temperature. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water (20 mL). The mixture was acidified to pH 2 with 1 M HCl (aq.). The resulting mixture was extracted with CH2Cl2 (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylic acid (136 mg, 37%) as a solid. LCMS (ES, m/z): 435 [M+H]+


Synthesis of Intermediate C472



embedded image


To a stirred solution of 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylic acid (136 mg, 0.313 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (57 mg, 0.344 mmol, 1.1 equiv) in DMF (5 mL) were added HATU (143 mg, 0.376 mmol, 1.2 equiv) and DIEA (202 mg, 1.565 mmol, 5 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 24 h at room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting solids were collected by filtration and washed with water (3×5 mL) to afford tert-butyl N-{4-ethyl-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (130 mg, 71%) as a solid. LCMS (ES, m/z): 582 [M+H]+


Synthesis of Compound 557



embedded image


A mixture of tert-butyl N-{4-ethyl-1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}carbamate (150 mg, 0.258 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-(4-amino-4-ethylpiperidin-1-yl)-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (40 mg, 32%) as a solid. LCMS (ES, m/z): 482 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.97 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.78 (s, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.21 (dd, J=12.4, 1.7 Hz, 1H), 6.22 (d, J=15.5 Hz, 1H), 4.50 (q, J=7.3 Hz, 2H), 3.63 (dt, J=13.1, 4.3 Hz, 2H), 3.51-3.40 (m, 2H), 2.35 (s, 3H), 1.66-1.58 (m, 1H), 1.57 (q, J=7.3, 6.2 Hz, 4H), 1.52-1.45 (m, 2H), 1.40 (q, J=7.4 Hz, 2H), 0.88 (t, J=7.4 Hz, 3H).


Example 274: Synthesis of Compounds 559 and 560
Synthesis of Intermediate C473



embedded image


To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1.0 equiv) and 1,4-dioxa-8-azaspiro[4.5]decane (206.4 mg, 1.441 mmol, 1.2 equiv) in dioxane (5 mL) were added Cs2CO3 (1.27 g, 3.90 mmol, 3.0 equiv), Ruphos (112.1 mg, 0.240 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (100.4 mg, 0.120 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (510 mg, 89%) as a solid. LCMS (ES, m/z): 479 [M+H]+


Synthesis of Intermediate C474



embedded image


A solution of 4-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (370 mg, 0.773 mmol, 1 equiv) in Acetone (4 mL) and H2O (2 mL) was treated with PPTS (3.89 g, 15.460 mmol, 20 equiv) at room temperature. The resulting mixture was stirred for 48 h at 70° C. The mixture was allowed to cool down to room temperature. The mixture was neutralized to pH 7 with saturated NaHCO3 (aq.). The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (230 mg, 68.47%) as a yellow solid. LCMS (ES, m/z): 435 [M+H]+


Synthesis of Compound 559




embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and 3-aminocyclobutan-1-ol (24.06 mg, 0.276 mmol, 1.2 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.56 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with Water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 14) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{[(1s,3s)-3-hydroxycyclobutyl]amino}piperidin-1-yl) indazole-7-carboxamide (4.1 mg, 4%) as a solid. LCMS (ES, m/z): 506 [M+H]+ 1H NMR (300 MHz, Methanol-d6) δ 9.04 (d, J=1.6 Hz, 1H), 8.47 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 7.68 (d, J=3.0 Hz, 1H), 7.16 (dd, J=11.7, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 4.40 (s, 1H), 3.97 (d, J=12.8 Hz, 2H), 3.68 (p, J=7.2 Hz, 1H), 3.00 (t, J=12.3 Hz, 2H), 2.73 (t, J=11.2 Hz, 1H), 2.41 (s, 3H), 2.18 (q, J=6.8 Hz, 4H), 2.01 (d, J=12.5 Hz, 2H), 1.69 (t, J=7.3 Hz, 3H), 1.57 (q, J=10.1 Hz, 2H).


Synthesis of Compound 560



embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and 3-aminocyclobutan-1-ol (24.06 mg, 0.276 mmol, 1.2 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.56 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 14) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{[(1r,3r)-3-hydroxycyclobutyl]amino}piperidin-1-yl) indazole-7-carboxamide (3.6 mg, 3%) as a solid. LCMS (ES, m/z): 506 [M+H]+ 1H NMR (300 MHz, Methanol-d6) δ 9.07 (d, J=1.7 Hz, 1H), 8.50 (s, 1H), 8.06 (d, J=8.1 Hz, 1H), 7.71 (dd, J=3.0, 1.0 Hz, 1H), 7.19 (dd, J=11.8, 1.6 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 4.06-3.90 (m, 3H), 3.12-2.88 (m, 3H), 2.86-2.57 (m, 3H), 2.43 (d, J=0.8 Hz, 3H), 2.04 (d, J=12.6 Hz, 2H), 1.87-1.67 (m, 5H), 1.59 (q, J=12.1, 11.1 Hz, 2H).


Example 275: Synthesis of Compound 562
Synthesis of Intermediate C475



embedded image


A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-1-carboxylate (500 mg, 1.332 mmol, 1.0 equiv) in DMSO (5 mL) was treated with tert-butyl piperazine-1-carboxylate (1.24 g, 6.660 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 70° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was extracted with EtOAc (3×30 mL). The combined organic layers were washed with brine (1×30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl 4-[(3R)-1-[(benzyloxy)carbonyl]pyrrolidin-3-yl]piperazine-1-carboxylate (510 mg, 98%) as an oil. LCMS (ES, m/z): 390 [M+H]+


Synthesis of Intermediate C476



embedded image


To a solution of tert-butyl 4-[(3R)-1-[(benzyloxy)carbonyl]pyrrolidin-3-yl]piperazine-1-carboxylate (510 mg, 1.309 mmol, 1.0 equiv) in 10 mL MeOH was added Pd/C (10%, 50 mg) in a pressure tank. The mixture was hydrogenated at room temperature under 5 psi of hydrogen pressure for overnight, filtered through a Celite pad and concentrated under reduced pressure to afford tert-butyl 4-[(3R)-pyrrolidin-3-yl]piperazine-1-carboxylate (350 mg, 105%) as an oil.


Synthesis of Intermediate C477



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1.0 equiv) and tert-butyl 4-[(3R)-pyrrolidin-3-yl]piperazine-1-carboxylate (53.3 mg, 0.209 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs2CO3 (170.1 mg, 0.522 mmol, 3.0 equiv), Ruphos (8.1 mg, 0.017 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (14.6 mg, 0.017 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]piperazine-1-carboxylate (94 mg, 94%) as a solid. LCMS (ES, m/z): 577 [M+H]+


Synthesis of Compound 562



embedded image


A solution of tert-butyl 4-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]piperazine-1-carboxylate (93 mg, 0.161 mmol, 1.0 equiv) in DCM (0.9 mL) was treated with HCl (gas) in 1,4-dioxane (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 18, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(piperazin-1-yl)pyrrolidin-1-yl]indazole-7-carboxamide hydrochloride (39 mg, 47%) as a solid. LCMS (ES, m/z): 477 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 10.01 (s, 2H), 9.60 (s, 1H), 9.04 (s, 1H), 8.30 (s, 1H), 8.13 (d, J=11.7 Hz, 1H), 7.98 (d, J=8.2 Hz, 1H), 6.12 (d, J=8.4 Hz, 1H), 4.32 (s, 3H), 4.17 (d, J=5.7 Hz, 1H), 4.05-4.04 (m, 4H), 3.92-3.91 (m, 2H), 3.64-3.63 (m, 2H), 3.61-3.49 (m, 4H), 2.64-2.63 (m, 1H), 2.51 (s, 3H), 2.44-2.43 (m, 1H).


Example 276: Synthesis of Compound 563
Synthesis of Intermediate C448



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and tert-butyl 3,6-diazabicyclo[3.1.0]hexane-6-carboxylate (68.7 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs2CO3 (162.0 mg, 0.498 mmol, 2.0 equiv) and Ruphos (11.6 mg, 0.025 mmol, 0.1 equiv), RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv). After stirring for overnight at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl 3-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]hexane-6-carboxylate (100 mg, 72%) as a solid. LCMS (ES, m/z): 506 [M+H]+


Synthesis of Compound 563



embedded image


A solution of tert-butyl 3-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]hexane-6-carboxylate (100.0 mg, 0.198 mmol, 1.0 equiv) in DCM (2 mL) was treated with DIEA (76.7 mg, 0.594 mmol, 3.0 equiv), TMSOTf (131.8 mg, 0.594 mmol, 3.0 equiv) for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-{3,6-diazabicyclo[3.1.0]hexan-3-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (10 mg, 11%) as a solid. LCMS (ES, m/z): 406 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.97 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.77 (s, 1H), 7.97 (d, J=7.7 Hz, 1H), 7.92 (d, J=3.1 Hz, 1H), 7.35 (dd, J=12.2, 1.7 Hz, 1H), 6.68 (d, J=7.8 Hz, 1H), 4.33 (s, 3H), 3.28-3.19 (m, 4H), 2.65 (d, J=12.8 Hz, 2H), 2.36 (s, 3H).


Example 277: Synthesis of Compound 564
Synthesis of Intermediate C449



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and tert-butyl 3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (68.7 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs2CO3 (162.0 mg, 0.498 mmol, 2.0 equiv) and Ruphos (11.60 mg, 0.025 mmol, 0.1 equiv), RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv). After stirring for overnight at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl6-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (80 mg, 57%) as a solid. LCMS (ES, m/z): 506 [M+H]


Synthesis of Compound 564



embedded image


Into a 40 mL vial were added tert-butyl 6-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (80.0 mg, 0.158 mmol, 1.0 equiv), DCM (2 mL), DIEA (61.3 mg, 0.474 mmol, 3.0 equiv) and TMSOTf (105.5 mg, 0.474 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-{3,6-diazabicyclo[3.1.0]hexan-6-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (10 mg, 15%) as a solid. LCMS (ES, m/z): 406 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.97 (s, 1H), 9.20 (s, 1H), 8.77 (s, 1H), 8.01-7.85 (m, 2H), 7.34 (d, J=12.3 Hz, 1H), 6.68 (d, J=7.8 Hz, 1H), 4.33 (s, 3H), 3.28-3.19 (m, 4H), 2.65 (d, J=12.7 Hz, 2H), 2.35 (s, 3H).


Example 278: Synthesis of Compound 565
Synthesis of Intermediate C450



embedded image


To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv), tert-butyl piperazine-1-carboxylate (0.79 g, 4.238 mmol, 1.2 equiv) and Cs2CO3 (3.45 g, 10.596 mmol, 3 equiv) in 1,4-dioxane (20 mL) were added RuPhos (0.33 g, 0.706 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (0.30 g, 0.353 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylate (1.1 g, 80%) as a solid. LCMS (ES, m/z): 389[M+H]+


Synthesis of Intermediate C451



embedded image


To a stirred solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylate (1.1 g, 2.832 mmol, 1 equiv) in THF/H2O (9 mL/3 mL) was added lithiumol hydrate (0.36 g, 8.496 mmol, 3 equiv) at room temperature. The resulting mixture was stirred overnight at 40° C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H2O (10 mL). The mixture was acidified to pH 4 with citric acid. The precipitated solids were collected by filtration and dried under infrared light to afford 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylic acid (850 mg, 80%) as a solid. LCMS (ES, m/z): 375 [M+H]


Synthesis of Intermediate C452



embedded image


To a stirred solution of 4-[4-(tert-butoxycarbonyl)piperazin-1-yl]-2-ethylindazole-7-carboxylic acid (850 mg, 2.270 mmol, 1 equiv) and HATU (1035.78 mg, 2.724 mmol, 1.2 equiv) in DCM (20 mL) was added DIEA (1466.99 mg, 11.350 mmol, 5 equiv) and NH4Cl (485.70 mg, 9.080 mmol, 4 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was diluted with DCM (100 mL), washed with 2×50 mL of H2O and 1×50 mL of brine. The organic layer was dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (700 mg, 83%) as a solid. LCMS (ES, m/z): 374 [M+H]+


Synthesis of Intermediate C453



embedded image


To a stirred solution of 6-bromo-8-fluoro-2-methylimidazo[1,2-a]pyridine (1.0 g, 4.366 mmol, 1 equiv) in THF (20 mL) was added NaH (0.16 g, 6.549 mmol, 1.5 equiv) at 0° C. The resulting mixture was stirred for 0.5 h at 0° C. under nitrogen atmosphere. To the above mixture was added F-TEDA-BF4 (2.32 g, 6.549 mmol, 1.5 equiv) in portions at 0° C. The resulting mixture was stirred for additional 16 h at 60° C. The reaction was quenched with MeOH at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 6-bromo-3,8-difluoro-2-methylimidazo[1,2-a]pyridine (400 mg, 37.09%) as a solid. LCMS (ES, m/z): 247 [M+H]+


Synthesis of Intermediate C454



embedded image


To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (160 mg, 0.428 mmol, 1 equiv), Cs2CO3 (418.77 mg, 1.284 mmol, 3 equiv) and 6-bromo-3,8-difluoro-2-methylimidazo[1,2-a]pyridine (127.01 mg, 0.514 mmol, 1.2 equiv) in 1,4-dioxane (3 mL) were added XantPhos (49.58 mg, 0.086 mmol, 0.2 equiv) and Pd2(dba)3 (39.23 mg, 0.043 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-[7-({3,8-difluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (100 mg, 43%) as a solid. LCMS (ES, m/z): 540 [M+H]+


Synthesis of Compound 565



embedded image


To a stirred solution of tert-butyl 4-[7-({3,8-difluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (100 mg, 0.185 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 15, Gradient 1) to afford N-{3,8-difluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-ethyl-4-(piperazin-1-yl) indazole-7-carboxamide; trifluoroacetic acid (19 mg, 19%) as solid. LCMS (ES, m/z): 440 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.21 (s, 1H), 8.99-8.90 (m, 2H), 8.82 (s, 2H), 8.03 (d, J=8.0 Hz, 1H), 7.37 (d, J=12.6 Hz, 1H), 6.62 (d, J=8.1 Hz, 1H), 4.63 (q, J=7.2 Hz, 2H), 3.60 (t, J=5.1 Hz, 4H), 3.36 (s, 4H), 2.35 (d, J=1.3 Hz, 3H), 1.64 (t, J=7.3 Hz, 3H).


Example 279: Synthesis of Compound 566
Synthesis of Intermediate C455



embedded image


To a solution of phenol (4.30 g, 45.671 mmol, 1.1 equiv) in THF (55 mL) was added sodium hydride (60% in oil, 1.83 g, 1.1 equiv) at 0° C. The mixture was stirred for 30 min. The solution of 3,5-dibromopyrazin-2-amine (10.5 g, 41.519 mmol, 1 equiv) in THF (50 mL) was added and the mixture was allowed to warm to 70° C. and stirred overnight. The mixture was allowed to cool down to room temperature. The reaction was quenched with water/ice. The resulting mixture was extracted with EtOAc (3×100 mL). The combined organic layers were washed with brine (1×100 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 5-bromo-3-phenoxypyrazin-2-amine (2.3 g, 21%) as a solid. LCMS (ES, m/z): 266 [M+H]+


Synthesis of Intermediate C456



embedded image


To a stirred solution of 5-bromo-3-phenoxypyrazin-2-amine (2.3 g, 8.643 mmol, 1 equiv) in isopropanol (23 mL) were added 1-bromo-2,2-dimethoxypropane (1.90 g, 10.372 mmol, 1.2 equiv) and PPTS (0.22 g, 0.864 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred overnight at 80° C. The mixture was allowed to cool down to room temperature. The precipitated solids were collected by filtration and the solids was dried under vacuum to afford 6-bromo-2-methyl-8-phenoxyimidazo[1,2-a]pyrazine (800 mg, 30%) as a solid. LCMS (ES, m/z): 304 [M+H]+


Synthesis of Intermediate C457



embedded image


To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (160 mg, 0.428 mmol, 1 equiv), 6-bromo-2-methyl-8-phenoxyimidazo[1,2-a]pyrazine (156.37 mg, 0.514 mmol, 1.2 equiv) and Cs2CO3 (418.77 mg, 1.284 mmol, 3 equiv) in 1,4-dioxane (3.2 mL) was added XantPhos (49.58 mg, 0.086 mmol, 0.2 equiv) and Pd2(dba)3 (39.23 mg, 0.043 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100° C. under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 4-[2-ethyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (110 mg, 43%) as a solid. LCMS (ES, m/z): 597 [M+H]+


Synthesis of Compound 566



embedded image


To a stirred solution of tert-butyl 4-[2-ethyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}carbamoyl) indazol-4-yl]piperazine-1-carboxylate (110 mg, 0.184 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 15) to afford 2-ethyl-N-{2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}-4-(piperazin-1-yl) indazole-7-carboxamide (17.1 mg, 19%) as a solid. LCMS (ES, m/z): 497 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.23 (s, 1H), 9.09 (s, 1H), 8.75 (s, 1H), 8.04 (s, 1H), 7.96 (d, J=8.1 Hz, 1H), 7.53 (t, J=7.8 Hz, 2H), 7.37 (dd, J=13.8, 7.4 Hz, 3H), 6.46 (d, J=8.1 Hz, 1H), 4.30 (q, J=7.3 Hz, 2H), 3.34 (d, J=4.9 Hz, 4H) 2.90 (dd, J=6.1, 3.6 Hz, 4H), 2.41 (s, 4H), 1.34 (t, J=7.3 Hz, 3H), 1.24 (s, 1H).


Example 280: Synthesis of Compound 568
Synthesis of Intermediate C458



embedded image


To a stirred mixture of bicyclo[1.1.1]pentan-1-amine hydrochloride (550 mg, 4.599 mmol, 1 equiv) in DCM (10 mL) were added Et3N (1.40 g, 13.797 mmol, 3 equiv) and 4-nitrobenzene-1-sulfonyl chloride (1.12 g, 5.059 mmol, 1.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at room temperature under nitrogen atmosphere. The resulting mixture was washed with 3×10 mL of water. dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford N-{bicyclo[1.1.1]pentan-1-yl}-4-nitrobenzenesulfonamide (780 mg, 63%) as a solid. LCMS (ES, m/z): 267 [M−H]


Synthesis of Intermediate C459



embedded image


To a stirred mixture of N-{bicyclo[1.1.1]pentan-1-yl}-4-nitrobenzenesulfonamide (750 mg, 2.795 mmol, 1.0 equiv) and tert-butyl (3S)-3-hydroxypyrrolidine-1-carboxylate (785.1 mg, 4.192 mmol, 1.5 equiv) in THF (15 mL) were added PPh3 (1.4 g, 5.590 mmol, 2.0 equiv) and DEAD (973.7 mg, 5.590 mmol, 2.0 equiv) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 50° C. under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl (3R)-3-(N-{bicyclo[1.1.1]pentan-1-yl}4-nitrobenzenesulfonamido)pyrrolidine-1-carboxylate (760 mg, 62%) as a solid. LCMS (ES, m/z): 438 [M+H]+


Synthesis of Intermediate C460



embedded image


To a stirred mixture of tert-butyl (3R)-3-(N-{bicyclo[1.1.1]pentan-1-yl}4-nitrobenzenesulfonamido)pyrrolidine-1-carboxylate (320 mg, 0.731 mmol, 1 equiv) in DCM (2 mL) was added HCl(gas) in 1,4-dioxane (0.5 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The mixture basified to pH 8 with saturated NaHCO3 (aq.). The resulting mixture was extracted with EtOAc (3×2 mL). The combined organic layers were washed with water (3×2 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford N-{bicyclo[1.1.1]pentan-1-yl}-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (230 mg, 93%) as a solid. LCMS (ES, m/z): 338 [M+H]+


Synthesis of Intermediate C461



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (110 mg, 0.273 mmol, 1.0 equiv) and N-{bicyclo[1.1.1]pentan-1-yl}-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (119.95 mg, 0.355 mmol, 1.3 equiv) in DMF (2 mL) were added Cs2CO3 (222.7 mg, 0.683 mmol, 2.5 equiv) and RuPhos (25.5 mg, 0.055 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (22.9 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford 4-[(3R)-3-(N-{bicyclo[1.1.1]pentan-1-yl}4-nitrobenzenesulfonamido)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 33%) as a solid. LCMS (ES, m/z): 658 [M+H]+


Synthesis of Compound 568



embedded image


To a stirred mixture of 4-[(3R)-3-(N-{bicyclo[1.1.1]pentan-1-yl}4-nitrobenzenesulfonamido)pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (40 mg, 0.061 mmol, 1 equiv) in DMF (1 mL) were added K2CO3 (16.8 mg, 0.122 mmol, 2 equiv) and PhSK (13.4 mg, 0.092 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-{bicyclo[1.1.1]pentan-1-ylamino}pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (11 mg, 38%) as a solid. LCMS (ES, m/z): 558 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.19 (s, 1H), 8.79 (s, 1H), 7.91 (dd, J=12.8, 5.7 Hz, 2H), 7.30 (d, J=12.2 Hz, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.93-3.44 (m, 4H), 2.36 (d, J=7.6 Hz, 5H), 2.28-2.27 (m, 1H), 1.79-1.78 (m, 7H).


Example 281: Synthesis of Compound 569
Synthesis of Intermediate C462



embedded image


To a stirred solution of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (500 mg, 1.66 mmol, 1 equiv), Cs2CO3 (1082 mg, 3.32 mmol, 2 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3-yl)carbamate (752 mg, 3.32 mmol, 2 equiv) in dioxane (10 mL) were added RuPhos (775 mg, 1.66 mmol, 1 equiv) and RuPhos Palladacycle Gen.3 (278 mg, 0.332 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (30 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylate (150 mg, 20%) as a solid. LCMS (ES, m/z): 447 [M+H]+


Synthesis of Intermediate C463



embedded image


A mixture of methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylate (150 mg, 0.336 mmol, 1 equiv) and LiOH·H2O (282 mg, 6.720 mmol, 20 equiv) in H2O (2 mL) and THF (4 mL) was stirred for 24 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was diluted with water (5.0 mL), then adjusted to pH 5 with 1 mol/L aq. HCl. The resulting mixture was extracted with CH2Cl2 (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylic acid (130 mg, 89%) as an oil. LCMS (ES, m/z): 433 [M+H]+


Synthesis of Intermediate C464



embedded image


To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl}-2-ethyl-6-fluoroindazole-7-carboxylic acid (130 mg, 0.301 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (55 mg, 0.331 mmol, 1.1 equiv) in DMF (5 mL) were added HATU (137 mg, 0.361 mmol, 1.2 equiv) and DIEA (117 mg, 0.903 mmol, 3 equiv) at room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford tert-butyl N-cyclopropyl-N-{1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (130 mg, 75%) as a solid. LCMS (ES, m/z): 580 [M+H]+


Synthesis of Compound 569



embedded image


A solution of tert-butyl N-cyclopropyl-N-{1-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl}carbamate (130 mg, 0.224 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[3-(cyclopropylamino)pyrrolidin-1-yl]-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (27 mg, 25%) as a solid. LCMS (ES, m/z): 480 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.17 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.87 (d, J=3.1 Hz, 1H), 7.18 (dd, J=12.4, 1.7 Hz, 1H), 5.74 (d, J=16.1 Hz, 1H), 4.52 (q, J=7.3 Hz, 2H), 3.85-3.48 (m, 4H), 3.44 (d, J=10.1 Hz, 1H), 2.35 (s, 3H), 2.15 (tt, J=7.0, 3.5 Hz, 2H), 1.98 (p, J=6.1 Hz, 1H), 1.58 (t, J=7.2 Hz, 3H), 0.42 (d, J=6.6 Hz, 2H), 0.26 (dq, J=7.2, 4.8, 3.3 Hz, 2H).


Example 282: Synthesis of Compound 571
Synthesis of Intermediate C465



embedded image


To a solution of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (200 mg, 0.697 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-[(3R)-pyrrolidin-3-yl]carbamate (173 mg, 0.767 mmol, 1.1 equiv) in dioxane (6 mL) were added Cs2CO3 (680 mg, 2.091 mmol, 3.0 equiv), RuPhos (32.5 mg, 0.07 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (58.2 mg, 0.070 mmol, 0.1 equiv). After stirring for 2 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl]-6-fluoro-2-methylindazole-7-carboxylate (210 mg, 70%) as a solid. LCMS (ES, m/z): 433 [M+H]+


Synthesis of Intermediate C466



embedded image


A mixture of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl]-6-fluoro-2-methylindazole-7-carboxylate (200 mg, 0.462 mmol, 1 equiv) and LiOH·H2O (66 mg, 2.772 mmol, 6.0 equiv) in H2O (2 mL), THF (2 mL) and MeOH (2 mL) was stirred for 12 h at 60° C. The mixture was acidified to pH 3 with aq. HCl (2 M). The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl]-6-fluoro-2-methylindazole-7-carboxylic acid (100 mg, 52%) as a solid. LCMS (ES, m/z): 419 [M+H]+


Synthesis of Intermediate C467



embedded image


To a stirred solution of 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-1-yl]-6-fluoro-2-methylindazole-7-carboxylic acid (100 mg, 0.239 mmol, 1 equiv) and TCFH (109 mg, 0.287 mmol, 1.2 equiv) in CH3CN (2 mL) were added NMI (123.5 mg, 0.956 mmol, 4.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (47.3 mg, 0.287 mmol, 1.2 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) tert-butyl N-cyclopropyl-N-[(3R)-1-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (20 mg, 15%) as a solid. LCMS (ES, m/z): 566 [M+H]+


Synthesis of Compound 571



embedded image


To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-1-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (15 mg, 0.027 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.05 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 4-[(3R)-3-(cyclopropylamino)pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (4 mg, 32%) as a solid. LCMS (ES, m/z): 466 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.03 (s, 1H), 9.18 (d, J=1.6 Hz, 1H), 8.80 (s, 1H), 7.91-7.83 (m, 1H), 7.25 (dd, J=12.5, 1.7 Hz, 1H), 5.76 (d, J=16.1 Hz, 1H), 4.22 (s, 3H), 3.72 (d, J=14.9 Hz, 3H), 3.65-3.51 (m, 2H), 2.38-2.31 (m, 3H), 2.16 (dd, J=8.3, 4.5 Hz, 2H), 1.98 (dd, J=12.2, 6.1 Hz, 1H), 0.42 (dd, J=6.6, 1.5 Hz, 2H), 0.25 (s, 2H).


Example 283: Synthesis of Compound 573
Synthesis of Intermediate C468



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (220 mg, 0.547 mmol, 1 equiv) and tert-butyl N-[(3R)-pyrrolidin-3-yl]carbamate (122.3 mg, 0.656 mmol, 1.2 equiv) in DMF (5.5 mL) were added Cs2CO3 (534.6 mg, 1.641 mmol, 3 equiv) and Ruphos (51.1 mg, 0.109 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (45.8 mg, 0.055 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (15 mL). The resulting mixture was extracted with EtOAc (3×15 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (200 mg, 72%) as a solid. LCMS (ES, m/z): 508 [M+H]+


Synthesis of Intermediate C469



embedded image


To a stirred mixture of tert-butyl N-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (170 mg, 0.335 mmol, 1 equiv) in DCM (2.5 mL) was added HCl(gas) in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to afford 4-[(3R)-3-aminopyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide hydrochloride (140 mg, 103%) as a solid. LCMS (ES, m/z): 408 [M+H]+


Synthesis of Compound 573



embedded image


To a stirred mixture of 4-[(3R)-3-aminopyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (76.2 mg, 0.172 mmol, 1.0 equiv) and DIEA (24.4 mg, 0.189 mmol, 1.1 equiv) in DCE (1.75 mL) were added 2-chloropyrimidine-5-carbaldehyde (24.49 mg, 0.172 mmol, 1.0 equiv) and NaBH(OAc)3 (54.6 mg, 0.258 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1.5 h at room temperature. The reaction was quenched with water at 0° C. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-{[(2-chloropyrimidin-5-yl)methyl]amino}pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (13.5 mg, 15%) as a solid. LCMS (ES, m/z): 534 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (s, 1H), 8.80 (d, J=16.3 Hz, 3H), 7.97-7.80 (m, 2H), 7.31 (d, J=12.3 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.28 (s, 3H), 3.92-3.59 (m, 5H), 3.47 (s, 2H), 2.75-2.72 (m, 1H), 2.35 (s, 3H), 2.23 (d, J=31.4 Hz, 1H), 1.98-1.97 (m, 1H).


Example 284: Synthesis of Compound 575
Synthesis of Intermediate C470



embedded image


To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-fluoroquinoline (78.7 mg, 0.348 mmol, 1.3 equiv) in dioxane (2 mL) were added Cs2CO3 (261.7 mg, 0.804 mmol, 3 equiv) and XantPhos (31 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24.5 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl 4-{2-ethyl-7-[(8-fluoroquinolin-6-yl)carbamoyl]indazol-4-yl}piperazine-1-carboxylate (100 mg, 72%) as a solid. LCMS (ES, m/z): 519 [M+H]+


Synthesis of Compound 575



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (60 mg, 0.111 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (0.25 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(piperazin-1-yl) indazole-7-carboxamide (15.8 mg, 32%) as a solid. LCMS (ES, m/z): 419 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.56 (s, 1H), 8.85 (s, 2H), 8.43 (d, J=8.4 Hz, 1H), 8.28 (d, J=2.2 Hz, 1H), 8.10-8.01 (m, 2H), 7.61 (dd, J=8.4, 4.2 Hz, 1H), 6.51 (d, J=8.1 Hz, 1H), 4.63 (q, J=7.3 Hz, 2H), 3.37 (t, J=4.9 Hz, 4H), 2.92 (t, J=4.9 Hz, 4H), 1.66 (t, J=7.3 Hz, 3H).


Example 285: Synthesis of Compound 576



embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and 1-(aminomethyl)cyclopropan-1-ol (30.0 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{[(1-hydroxycyclopropyl)methyl]amino}piperidin-1-yl) indazole-7-carboxamide (41 mg, 35%) as a solid. LCMS (ES, m/z): 506 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.1 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.49 (d, J=8.1 Hz, 1H), 5.12 (s, 1H), 4.60 (q, J=7.3 Hz, 2H), 3.94-3.83 (m, 2H), 3.13-2.97 (m, 2H), 2.75 (dq, J=9.1, 4.7, 3.8 Hz, 1H), 2.67 (s, 2H), 2.35 (s, 3H), 1.97 (dd, J=13.3, 4.0 Hz, 2H), 1.62 (t, J=7.2 Hz, 4H), 1.54-1.37 (m, 2H), 0.54 (q, J=4.5, 4.0 Hz, 2H), 0.44 (q, J=4.9, 4.5 Hz, 2H).


Example 286: Synthesis of Compound 577



embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and 1-amino-2-methylpropan-2-ol (30.7 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.5 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-{4-[(2-hydroxy-2-methylpropyl)amino]piperidin-1-yl}indazole-7-carboxamide (50.1 mg, 47%) as a solid. LCMS (ES, m/z): 506 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.6 Hz, 1H), 6.49 (d, J=8.2 Hz, 1H), 4.60 (q, J=7.3 Hz, 2H), 4.17 (s, 1H), 3.88 (dd, J=10.7, 6.6 Hz, 2H), 3.07 (t, J=11.8 Hz, 2H), 2.66 (d, J=11.6 Hz, 1H), 2.47 (s, 2H), 2.35 (s, 3H), 1.97 (d, J=12.3 Hz, 2H), 1.63 (d, J=7.3 Hz, 3H), 1.57-1.40 (m, 3H), 1.11 (s, 6H).


Example 287: Synthesis of Compound 579
Synthesis of Intermediate C471



embedded image


A solution of benzyl (3S)-3-[(4-methyl benzenesulfonyl)oxy] pyrrolidine-1-carboxylate (1 g, 2.664 mmol, 1 equiv) in DMSO (5 mL) was added DIEA (1.72 g, 13.320 mmol, 5 equiv) and aniline (1.24 g, 13.320 mmol, 5 equiv). The mixture was stirred for 24 h at 70° C. The resulting mixture was washed with 3×10 mL of water and extracted with EtOAc (2×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (15%) to afford benzyl (3R)-3-(phenylamino) pyrrolidine-1-carboxylate (530 mg, 67%) as an oil. LCMS (ES, m/z): 297 [M+H]+


Synthesis of Intermediate C472



embedded image


A solution of benzyl (3R)-3-(phenylamino) pyrrolidine-1-carboxylate (120 mg, 0.405 mmol, 1 equiv) in MeOH (10 mL) was added Pd/C (20 mg, 10%). The mixture was stirred for overnight at 50° C. under hydrogen atmosphere. The resulting mixture was filtered and the filtrate was concentrated under reduced pressure to afford (3R)—N-phenylpyrrolidin-3-amine (60 mg, 91.34%) as an oil. LCMS (ES, m/z): 163 [M+H]+


Synthesis of Compound 579



embedded image


A solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-2-methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1.0 equiv) in 1,4-dioxane (0.5 mL) was added (3R)—N-phenylpyrrolidin-3-amine (36.30 mg, 0.223 mmol, 1.5 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was stirred for 2 h at 90° C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (60%) to afford the crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(phenylamino) pyrrolidin-1-yl] indazole-7-carboxamide (5 mg, 7%) as a solid. LCMS (ES, m/z): 460 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.85 (s, 1H), 7.94 (d, J=8.2 Hz, 1H), 7.91-7.86 (m, 1H), 7.32 (dd, J=12.3, 1.6 Hz, 1H), 7.11 (t, J=7.7 Hz, 2H), 6.67 (d, J=7.9 Hz, 2H), 6.57 (t, J=7.3 Hz, 1H), 6.07 (d, J=8.4 Hz, 1H), 5.96 (d, J=6.6 Hz, 1H), 4.27 (s, 3H), 4.22 (s, 1H), 4.01 (d, J=7.1 Hz, 1H), 3.84 (d, J=9.0 Hz, 1H), 3.75 (s, 1H), 3.53 (d, J=11.6 Hz, 1H), 2.35 (s, 3H), 2.14-1.92 (m, 2H), 1.30-1.24 (m, 5H), 0.85 (d, J=7.1 Hz, 1H).


Example 288: Synthesis of Compound 580
Synthesis of Intermediate C473



embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and tert-butyl 6-amino-3-azabicyclo[3.1.0]hexane-3-carboxylate (68.4 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was extracted with CH2Cl2 (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 6-({1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}amino)-3-azabicyclo[3.1.0]hexane-3-carboxylate (113.8 mg, 80%) as a solid. LCMS (ES, m/z): 617 [M+H]+


Synthesis of Compound 580



embedded image


A solution of tert-butyl 6-({1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]piperidin-4-yl}amino)-3-azabicyclo[3.1.0]hexane-3-carboxylate (113 mg, 0.183 mmol, 1.0 equiv) in DCM (0.9 mL) was treated with HCl(gas) in 1,4-dioxane (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-(4-{3-azabicyclo[3.1.0]hexan-6-ylamino}piperidin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide; bis(trifluoroacetic acid) (60 mg, 44%) as a solid. LCMS (ES, m/z): 517 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.23 (s, 1H), 9.45-9.30 (m, 4H), 8.88 (s, 1H), 8.72 (s, 1H), 8.08 (s, 1H), 8.02 (d, J=8.0 Hz, 1H), 7.65 (d, J=11.9 Hz, 1H), 6.58 (d, J=8.2 Hz, 1H), 4.62 (q, J=7.3 Hz, 2H), 4.08 (d, J=12.8 Hz, 2H), 3.46 (d, J=5.9 Hz, 5H), 3.06 (t, J=12.4 Hz, 2H), 2.81 (s, 1H), 2.42 (s, 3H), 2.33 (s, 2H), 2.22-2.09 (m, 2H), 1.76 (td, J=13.7, 9.9 Hz, 2H), 1.64 (t, J=7.2 Hz, 3H).


Example 289: Synthesis of Compound 581



embedded image


To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-oxopiperidin-1-yl) indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and 1-(aminomethyl)cyclopropan-1-ol (30.0 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{3-oxabicyclo[3.1.0]hexan-6-ylamino}piperidin-1-yl) indazole-7-carboxamide (16.6 mg, 14%) as a solid. LCMS (ES, m/z): 518 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J=8.1 Hz, 1H), 7.90 (d, J=3.0 Hz, 1H), 7.29 (dd, J=12.3, 1.7 Hz, 1H), 6.48 (d, J=8.2 Hz, 1H), 4.59 (q, J=7.3 Hz, 2H), 3.96-3.82 (m, 2H), 3.75 (d, J=8.2 Hz, 2H), 3.59 (d, J=8.2 Hz, 2H), 3.12-2.98 (m, 2H), 2.75 (tt, J=9.5, 4.0 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 1H), 2.04-1.93 (m, 2H), 1.91 (d, J=2.3 Hz, 1H), 1.66-1.54 (m, 5H), 1.55-1.36 (m, 2H).


Example 290: Synthesis of Compound 582
Synthesis of Intermediate C474



embedded image


To a solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.268 mmol, 1 equiv) and (6-bromo-4-fluoro-1,3-benzoxazol-2-yl)methyl acetate (92.5 mg, 0.322 mmol, 1.2 equiv) in dioxane (2 mL) were added Cs2CO3 (261.7 mg, 0.804 mmol, 3.0 equiv), XantPhos (30.9 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3·CHCl3 (27.7 mg, 0.027 mmol, 0.1 equiv). After stirring for 1 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (2:1) to afford tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-1,3-benzoxazol-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (120 mg, 77%) as a solid. LCMS (ES, m/z): 581 [M+H]+


Synthesis of Intermediate C475



embedded image


To a stirred solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-1,3-benzoxazol-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (120 mg, 0.207 mmol, 1 equiv) in MeOH (2 mL) was added K2CO3 (171 mg, 1.242 mmol, 6.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at 60° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford tert-butyl 4-(2-ethyl-7-{[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}indazol-4-yl)piperazine-1-carboxylate (100 mg, 90%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 582



embedded image


A solution of tert-butyl 4-(2-ethyl-7-{[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]carbamoyl}indazol-4-yl)piperazine-1-carboxylate (50 mg, 0.093 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3 (g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2-ethyl-N-[4-fluoro-2-(hydroxymethyl)-1,3-benzoxazol-6-yl]-4-(piperazin-1-yl) indazole-7-carboxamide (20 mg, 49%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.53 (s, 1H), 8.84 (s, 1H), 8.18 (d, J=1.7 Hz, 1H), 8.01 (d, J=8.1 Hz, 1H), 7.65 (dd, J=12.0, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 5.94 (s, 1H), 4.71 (d, J=4.4 Hz, 2H), 4.61 (q, J=7.3 Hz, 2H), 3.37-3.32 (m, 4H), 2.92 (t, J=5.0 Hz, 4H), 1.63 (t, J=7.3 Hz,


Example 291: Synthesis of Compound 584
Synthesis of Intermediate C476



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv), trans-tert-butyl N-[(3R,4R)-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (126 mg, 0.576 mmol, 1.2 equiv) and Cs2CO3 (313 mg, 0.960 mmol, 2 equiv) in 1,4-dioxane (2 mL) were added RuPhos Palladacycle Gen.3 (40 mg, 0.048 mmol, 0.1 equiv) and Ruphos (22 mg, 0.048 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1:1) to afford trans-tert-butyl N-[(3R,4R)-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (108 mg, 41%) as a solid. LCMS (ES, m/z): 554 [M+H]+


Synthesis of Compound 584



embedded image


To a stirred solution of trans-tert-butyl N-[(3R,4R)-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added 4M HCl(gas) in 1,4-dioxane (0.2 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3R,4R)-3-fluoro-4-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (6.7 mg, 8%) as a solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.06 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.89 (s, 1H), 7.95 (d, J=8.2 Hz, 1H), 7.91-7.87 (m, 1H), 7.29 (dd, J=12.4, 1.7 Hz, 1H), 6.08 (d, J=8.4 Hz, 1H), 5.27 (d, J=50.8 Hz, 1H), 4.58 (q, J=7.3 Hz, 2H), 4.20-3.78 (m, 3H), 3.62 (d, J=10.9 Hz, 1H), 2.40-2.32 (m, 6H), 1.62 (t, J=7.3 Hz, 3H).


Example 292: Synthesis of Compound 585
Synthesis of Intermediate C477



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv), cis-tert-butyl N-[(3R,4S)-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (125.85 mg, 0.576 mmol, 1.2 equiv) and Cs2CO3 (313.10 mg, 0.960 mmol, 2 equiv) in 1,4-dioxane (5 mL) were added RuPhos Palladacycle Gen.3 (40.19 mg, 0.048 mmol, 0.1 equiv) and Ruphos (22.42 mg, 0.048 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1:1) to afford cis-tert-butyl N-[(3R,4S)-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (110 mg, 41%) as a solid. LCMS (ES, m/z): 554 [M+H]+


Synthesis of Compound 585



embedded image


To a stirred solution of cis-tert-butyl N-[(3R,4S)-1-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) indazol-4-yl]-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added 4M HCl(gas) in 1,4-dioxane (0.2 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 3) to afford cis-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-((3S,4R)-3-fluoro-4-(methylamino)pyrrolidin-1-yl)-2H-indazole-7-carboxamide bis(2,2,2-trifluoroacetate) (55 mg, 39%) as a solid. LCMS (ES, m/z): 454 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.27 (d, J=2.8 Hz, 1H), 10.02 (s, 1H), 9.44 (d, J=6.8 Hz, 1H), 8.86-8.73 (m, 1H), 8.06-7.95 (m, 2H), 7.57 (dd, J=23.2, 13.1 Hz, 1H), 6.04 (q, J=8.7, 6.9 Hz, 1H), 5.66 (d, J=53.9 Hz, 1H), 4.58 (q, J=7.8 Hz, 2H), 4.28-3.97 (m, 4H), 3.93-3.80 (m, 1H), 2.82 (s, 3H), 1.66 (td, J=7.3, 2.3 Hz, 3H).


Example 293: Synthesis of Compound 587
Synthesis of Intermediate C478



embedded image


To a solution of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (150 mg, 0.357 mmol, 1 equiv) and N-(1-cyanocyclopropyl)-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (144.0 mg, 0.428 mmol, 1.2 equiv) in dioxane (3 mL) were added RuPhos (33.3 mg, 0.071 mmol, 0.2 equiv), Cs2CO3 (348.9 mg, 1.071 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (29.8 mg, 0.036 mmol, 0.1 equiv). After stirring for 3 h at 80° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-[(3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (120 mg, 50%) as a solid. LCMS (ES, m/z): 676 [M+H]+


Synthesis of Compound 587



embedded image


To a stirred solution of 4-[(3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.104 mmol, 1 equiv) and (phenylsulfanyl)potassium (23.0 mg, 0.156 mmol, 1.5 equiv) in DMF (2 mL) was added K2CO3 (28.6 mg, 0.208 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with H2O (5 mL). The resulting mixture was extracted with EA (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 4-[(3R)-3-[(1-cyanocyclopropyl)amino]pyrrolidin-1-yl]-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (20 mg, 39%) as a solid. LCMS (ES, m/z): 491 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.19 (d, J=1.6 Hz, 1H), 8.78 (s, 1H), 7.88 (d, J=3.2 Hz, 1H), 7.25 (dd, J=12.6, 1.7 Hz, 1H), 5.76 (d, J=15.9 Hz, 1H), 4.22 (s, 3H), 3.77 (s, 2H), 3.70 (s, 3H), 3.44 (d, J=9.8 Hz, 1H), 2.37-2.31 (m, 3H), 2.28-2.18 (m, 1H), 2.04 (s, 1H), 1.26 (s, 2H), 1.08-0.95 (m, 2H).


Example 294: Synthesis of Compound 589
Synthesis of Intermediate C488



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (80.0 mg, 0.199 mmol, 1.0 equiv) and tert-butyl (2S)-2-isopropylpiperazine-1-carboxylate (68.1 mg, 0.298 mmol, 1.5 equiv) in DMF (2 mL) were added Cs2CO3 (129.6 mg, 0.398 mmol, 2.0 equiv) and Ruphos (18.5 mg, 0.040 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (16.6 mg, 0.020 mmol, 0.1 equiv). After stirring for 2 days at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl (2S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]-2-isopropylpiperazine-1-carboxylate (100 mg, 82%) as a solid. LCMS (ES, m/z): 550 [M+H]+


Synthesis of Compound 589



embedded image


Into a 8 mL vial were added tert-butyl (2S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl)-2-methylindazol-4-yl]-2-isopropylpiperazine-1-carboxylate (80.0 mg, 0.146 mmol, 1 equiv), DCM (1 mL) and HCl (gas) in 1,4-dioxane (0.5 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3-isopropylpiperazin-1-yl]-2-methylindazole-7-carboxamide (8 mg, 12%) as a solid. LCMS (ES, m/z): 450 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.22 (s, 1H), 8.74 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.35 (d, J=12.2 Hz, 1H), 6.51 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 3.80 (dd, J=27.2, 10.4 Hz, 2H), 3.05 (d, J=8.8 Hz, 1H), 2.94-2.87 (m, 2H), 2.67 (d, J=10.3 Hz, 1H), 2.36 (s, 3H), 1.67 (dt, J=13.1, 6.7 Hz, 1H), 0.98 (dd, J=6.8, 2.0 Hz, 6H).


Example 295: Synthesis of Compound 594



embedded image


To a stirred mixture of (R)-4-(3-aminopyrrolidin-1-yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-2H-indazole-7-carboxamide hydrochloride (40 mg, 0.090 mmol, 1 equiv) and DIEA (12 mg, 0.099 mmol, 1.1 equiv) in DCE (2 mL) were added pyrimidine-2-carbaldehyde (10 mg, 0.090 mmol, 1 equiv) and NaBH(OAc)3 (66 mg, 0.315 mmol, 3.5 equiv) at room temperature. The resulting mixture was stirred for 1.5 h at room temperature. The reaction was quenched with water (2 mL) at 0° C. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-[(pyrimidin-2-ylmethyl)amino]pyrrolidin-1-yl]indazole-7-carboxamide (6 mg, 13.33%) as a solid. LCMS (ES, m/z): 500 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.87-8.76 (m, 3H), 7.97-7.85 (m, 2H), 7.41 (t, J=4.9 Hz, 1H), 7.36-7.25 (m, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 4.03 (s, 2H), 3.76 (d, J=8.8 Hz, 1H), 3.65 (s, 2H), 3.56 (s, 2H), 2.55 (s, 2H), 2.35 (s, 3H), 2.22-2.12 (m, 1H), 2.03 (s, 1H).


Example 296: Synthesis of Compound 596
Synthesis of Intermediate C489



embedded image


To a stirred solution of 1-aminocyclopropane-1-carbonitrile hydrochloride (2.0 g, 16.869 mmol, 1.0 equiv) and DIEA (4.3 g, 33.738 mmol, 2.0 equiv) in DCM (30 mL) was added 4-nitrobenzene-1-sulfonyl chloride (3.4 g, 15.182 mmol, 0.9 equiv) at room temperature. The resulting mixture was stirred for 5 h at room temperature. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with CH2Cl2 (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford N-(1-cyanocyclopropyl)-4-nitrobenzenesulfonamide (2.5 g, 50%) as a solid. LCMS (ES, m/z): 268 [M+H]+


Synthesis of Intermediate C490



embedded image


To a stirred solution of N-(1-cyanocyclopropyl)-4-nitrobenzenesulfonamide (1.5 g, 5.613 mmol, 1.0 equiv) and tert-butyl (3S)-3-hydroxypyrrolidine-1-carboxylate (1.4 g, 7.297 mmol, 1.3 equiv) in THF (30 mL) were added DEAD (1.7 g, 10.103 mmol, 1.8 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was diluted with water (50 mL). The resulting mixture was extracted with EtOAc (2×50 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl (3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido]pyrrolidine-1-carboxylate (1 g, 38%) as a solid. LCMS (ES, m/z): 437 [M+H]+


Synthesis of Intermediate C491



embedded image


To a stirred solution of tert-butyl (3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido] pyrrolidine-1-carboxylate (1.0 g, 2.291 mmol, 1.0 equiv) in DCM (10 mL) was added TFA (5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The mixture was basified to pH 8 with saturated NaHCO3 (aq.). The resulting mixture was extracted with EtOAc (2×30 mL). The combined organic layers were washed with brine (1×50 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in N-(1-cyanocyclopropyl)-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (0.7 g, 84%) as a solid. LCMS (ES, m/z): 337 [M+H]+


Synthesis of Intermediate C492



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and N-(1-cyanocyclopropyl)-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (125.4 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs2CO3 (162.01 mg, 0.498 mmol, 2.0 equiv) and Ruphos (23.2 mg, 0.050 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv). After stirring for 16 h at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:3) to afford 4-[(3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (75 mg, 41%) as a solid. LCMS (ES, m/z): 658 [M+H]+


Synthesis of Compound 596



embedded image


To a stirred solution of 4-[(3R)-3-[N-(1-cyanocyclopropyl)4-nitrobenzenesulfonamido]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (60.0 mg, 0.091 mmol, 1.0 equiv) and K2CO3 (25.2 mg, 0.182 mmol, 2.0 equiv) in DMF (2 mL) was added PhSK (20.3 mg, 0.137 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was extracted with EtOAc (2×5 mL). The combined organic layers were washed with brine (1×3 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[(3R)-3-[(1-cyanocyclopropyl)amino]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (35 mg, 81%) as a solid. LCMS (ES, m/z): 473 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.6 Hz, 1H), 8.81 (s, 1H), 7.93 (d, J=8.2 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.31 (d, J=12.4 Hz, 1H), 6.02 (d, J=8.3 Hz, 1H), 4.28 (s, 3H), 3.84-3.82 (m, 1H), 3.76-3.70 (m, 4H), 3.48 (d, J=10.0 Hz, 1H), 2.35 (s, 3H), 2.24-2.23 (m, 1H), 2.11-2.03 (m, 1H), 1.33-1.16 (m, 2H), 1.04 (d, J=12.4 Hz, 1H), 0.98 (d, J=4.3 Hz, 1H).


Example 297: Synthesis of Compound 600



embedded image


A solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} indazole-7-carboxamide (120 mg, 0.288 mmol, 1 equiv) in 1,4-dioxane (1.5 mL) was added (2S,6R)-2-isopropyl-6-methylpiperazine (61.51 mg, 0.432 mmol, 1.5 equiv), Cs2CO3 (234.82 mg, 0.720 mmol, 2.5 equiv), RuPhos (26.91 mg, 0.058 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (24.11 mg, 0.029 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was stirred for 2 h at 90° C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (90%) to afford the crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 16) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-4-[(3S,5R)-3-isopropyl-5-methylpiperazin-1-yl] indazole-7-carboxamide (40 mg, 29%) as a solid. LCMS (ES, m/z): 478 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.6 Hz, 1H), 8.76 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.0 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.2 Hz, 2H), 3.80 (dd, J=20.3, 10.2 Hz, 2H), 2.95-2.94 (m, 1H), 2.67-2.55 (m, 2H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.05 (s, 1H), 1.62 (t, J=7.3 Hz, 4H), 1.10 (d, J=6.2 Hz, 3H), 0.99 (dd, J=6.8, 1.5 Hz, 6H).


Example 298: Synthesis of Compound 604
Synthesis of Intermediate C493



embedded image


To a stirred solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (120 mg, 0.321 mmol, 1 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2-a]pyrazine (95 mg, 0.385 mmol, 1.2 equiv) in dioxane (2.4 mL) were added Cs2CO3 (314.1 mg, 0.963 mmol, 3 equiv) and XantPhos (37.2 mg, 0.064 mmol, 0.2 equiv) and Pd2(dba)3 (29.4 mg, 0.032 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (150 mg, 87%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 604



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (100 mg, 0.186 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (0.3 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(piperazin-1-yl) indazole-7-carboxamide (24 mg, 29%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.45 (s, 1H), 9.45 (s, 1H), 8.84 (s, 1H), 8.17 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.38 (t, J=4.9 Hz, 4H), 2.92 (dd, J=6.0, 3.5 Hz, 4H), 2.42 (s, 3H), 1.64 (t, J=7.3 Hz, 3H).


Example 299: Synthesis of Compounds 605, 606, and 607
Synthesis of Intermediate C494



embedded image


To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (110.0 mg, 0.273 mmol, 1.0 equiv) and tert-butyl 2-cyclopropylpiperazine-1-carboxylate (92.8 mg, 0.410 mmol, 1.5 equiv) in DMF (3 mL) were added Cs2CO3 (178.2 mg, 0.546 mmol, 2.0 equiv) and Ruphos (25.5 mg, 0.055 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (22.8 mg, 0.027 mmol, 0.1 equiv). After stirring for 2 days at 100° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl 2-cyclopropyl-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (150 mg, 85%) as a solid. LCMS (ES, m/z): 548 [M+H]+


Synthesis of Compound 605



embedded image


Into a 8 mL round-bottom flask were added tert-butyl 2-cyclopropyl-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-1-carboxylate (140.0 mg, 0.256 mmol, 1.0 equiv), DCM (2 mL) and HCl (gas) in 1,4-dioxane (1 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-(3-cyclopropylpiperazin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (18 mg, 16%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J=8.0 Hz, 1H), 7.91 (d, J=3.0 Hz, 1H), 7.35 (d, J=12.3 Hz, 1H), 6.50 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J=10.1 Hz, 2H), 3.17 (d, J=4.9 Hz, 1H), 3.02 (d, J=11.2 Hz, 1H), 2.94 (t, J=11.6 Hz, 1H), 2.81 (dt, J=22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J=9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J=8.2 Hz, 2H), 0.36 (s, 1H), 0.33-0.26 (m, 1H).


Synthesis of Compound 606



embedded image


18 mg of 4-(3-cyclopropylpiperazin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 11, Gradient 1) to afford 4-[(3S)-3-cyclopropylpiperazin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (4.6 mg, 26%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J=8.0 Hz, 1H), 7.91 (d, J=3.0 Hz, 1H), 7.35 (d, J=12.3 Hz, 1H), 6.50 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J=10.1 Hz, 2H), 3.17 (d, J=4.9 Hz, 1H), 3.02 (d, J=11.2 Hz, 1H), 2.94 (t, J=11.6 Hz, 1H), 2.81 (dt, J=22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J=9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J=8.2 Hz, 2H), 0.36-0.35 (m, 1H), 0.33-0.26 (m, 1H).


Synthesis of Compound 607



embedded image


18 mg of 4-(3-cyclopropylpiperazin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 11, Gradient 1) to afford 4-[(3R)-3-cyclopropylpiperazin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (6 mg, 33%) as a solid. LCMS (ES, m/z): 448 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J=8.0 Hz, 1H), 7.91 (d, J=3.0 Hz, 1H), 7.35 (d, J=12.3 Hz, 1H), 6.50 (d, J=8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J=10.1 Hz, 2H), 3.17 (d, J=4.9 Hz, 1H), 3.02 (d, J=11.2 Hz, 1H), 2.94 (t, J=11.6 Hz, 1H), 2.81 (dt, J=22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J=9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J=8.2 Hz, 2H), 0.36-0.35 (m, 1H), 0.33-0.26 (m, 1H).


Example 300: Synthesis of Compound 610
Synthesis of Intermediate C495



embedded image


A solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.268 mmol, 1 equiv), 6-bromo-2-methyl-8-phenoxyimidazo[1,2-a]pyrazine (122 mg, 0.402 mmol, 1.5 equiv), Cs2CO3 (261 mg, 0.804 mmol, 3 equiv) and Pd PEPPSI IPentCl (23 mg, 0.027 mmol, 0.1 equiv) in 1,4-dioxane was stirred for 3 h at 110° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0:1) to afford tert-butyl N-methyl-N-[(3R)-1-[2-methyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]carbamate (96 mg, 60%) as a solid. LCMS (ES, m/z): 597 [M+H]+


Synthesis of Compound 610



embedded image


A solution of ert-butylN-methyl-N-[(3R)-1-[2-methyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}carbamoyl) indazol-4-yl]pyrrolidin-3-yl]carbamate (96 mg, 0.161 mmol, 1 equiv) in HCl(gas) in 1,4-dioxane (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 2-methyl-N-{2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (10 mg, 13%) as a solid. LCMS (ES, m/z): 497 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 9.05 (s, 1H), 8.78 (s, 1H), 8.03 (s, 1H), 7.90 (d, J=8.3 Hz, 1H), 7.56 (t, J=7.8 Hz, 2H), 7.41 (d, J=7.9 Hz, 2H), 7.36 (t, J=7.3 Hz, 1H), 5.99 (d, J=8.4 Hz, 1H), 4.01 (s, 3H), 3.75 (s, 2H), 3.70 (s, 1H), 3.62 (s, 1H), 3.26 (s, 1H), 2.40 (s, 3H), 2.33 (s, 3H), 2.14 (dd, J=12.4, 6.2 Hz, 1H), 1.95-1.87 (m, 1H).


Example 301: Synthesis of Compound 612
Synthesis of Intermediate C496



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.268 mmol, 1 equiv), 4-{6-bromo-2-methylimidazo[1,2-a]pyrazin-8-yl}morpholine (90 mg, 0.322 mmol, 1.2 equiv) and Cs2CO3 (175 mg, 0.536 mmol, 2.0 equiv) in 1,4-dioxane (5 mL) were added XantPhos (31 mg, 0.0536 mmol, 0.2 equiv) and Pd2(dba)3 (25 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90° C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford tert-butyl N-methyl-N-[(3R)-1-(2-methyl-7-{[2-methyl-8-(morpholin-4-yl)imidazo[1,2-a]pyrazin-6-yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbamate (96 mg, 61%) as a solid. LCMS (ES, m/z): 590 [M+H]+


Synthesis of Compound 612



embedded image


A solution of tert-butyl N-methyl-N-[(3R)-1-(2-methyl-7-{[2-methyl-8-(morpholin-4-yl)imidazo[1,2-a]pyrazin-6-yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbamate (100 mg, 0.170 mmol, 1 equiv) and TFA (0.25 mL) in DCM (0.75 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 2-methyl-N-[2-methyl-8-(morpholin-4-yl)imidazo[1,2-a]pyrazin-6-yl]-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (30 mg, 36%) as a solid. LCMS (ES, m/z): 490 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.08 (s, 1H), 8.81 (s, 1H), 8.72 (s, 1H), 7.92 (d, J=8.3 Hz, 1H), 7.78 (s, 1H), 6.00 (d, J=8.4 Hz, 1H), 4.23 (d, J=6.0 Hz, 7H), 3.78 (t, J=4.8 Hz, 6H), 3.74 (s, 1H), 3.64 (s, 1H), 3.42 (dd, J=10.3, 4.1 Hz, 1H), 2.33 (d, J=9.0 Hz, 6H), 2.15 (dq, J=13.2, 7.2 Hz, 1H), 2.08 (s, 1H), 1.92 (dt, J=11.5, 6.0 Hz, 1H)


Example 302: Synthesis of Compound 614
Synthesis of Intermediate C497



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (65 mg, 0.174 mmol, 1 equiv), Cs2CO3 (170 mg, 0.522 mmol, 3 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2-a]pyrazine (64 mg, 0.261 mmol, 1.5 equiv) in 1,4-dioxane (3.0 mL) were added XantPhos (20 mg, 0.035 mmol, 0.2 equiv) and Pd2(dba)3 (15 mg, 0.017 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0:1) to afford tert-butyl N-[(3R)-1-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (66 mg, 70%) as a solid. LCMS (ES, m/z): 539 [M+H]


Synthesis of Compound 614



embedded image


A solution of tert-butyl N-[(3R)-1-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (66 mg, 0.122 mmol, 1 equiv) and TFA (0.25 mL) in DCM (0.75 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (10 mg, 19%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 9.44 (s, 1H), 8.85 (s, 1H), 8.16 (s, 1H), 7.97 (d, J=8.4 Hz, 1H), 6.04 (d, J=8.4 Hz, 1H), 4.26 (s, 3H), 3.66 (s, 1H), 3.36-0.32 (m, 4H), 2.42 (s, 3H), 2.35 (s, 3H), 2.17 (dt, J=12.9, 6.5 Hz, −1H), 1.97-1.89 (m, 1H).


Example 303: Synthesis of Compound 615, 616, and 617
Synthesis of Compound 615



embedded image


To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and 2-cyclopropyl-6-methylpiperazine (65.7 mg, 0.468 mmol, 1.3 equiv) in dioxane (3 mL) were added Cs2CO3 (352.2 mg, 1.080 mmol, 3 equiv) and Ruphos (33.6 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.1 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90° C. under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3×10 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford 4-(3-cyclopropyl-5-methylpiperazin-1-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (80 mg, 47%) as a solid. LCMS (ES, m/z): 476 [M+H]+


Synthesis of Compound 616



embedded image


80 mg of 4-(3-cyclopropyl-5-methylpiperazin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 12, Gradient 1) to afford 4-((3S,5R)-3-cyclopropyl-5-methylpiperazin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (8.9 mg, 11.12%) as a yellow solid. LCMS (ES, m/z): 476 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.78 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 3.84-3.76 (m, 2H), 2.92 (d, J=8.7 Hz, 1H), 2.72 (d, J=10.9 Hz, 1H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.18-2.09 (m, 1H), 1.62 (t, J=7.2 Hz, 3H), 1.09 (d, J=6.2 Hz, 3H), 0.77 (qt, J=8.1, 4.8 Hz, 1H), 0.48-0.27 (m, 4H).


Synthesis of Compound 617



embedded image


80 mg of 4-(3-cyclopropyl-5-methylpiperazin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 12, Gradient 1) to afford 4-((3R,5S)-3-cyclopropyl-5-methylpiperazin-1-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide (16.5 mg, 21%) as a solid. LCMS (ES, m/z): 476 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 9.21 (d, J=1.7 Hz, 1H), 8.78 (s, 1H), 7.98 (d, J=8.1 Hz, 1H), 7.91 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.3, 1.7 Hz, 1H), 6.50 (d, J=8.2 Hz, 1H), 4.61 (q, J=7.3 Hz, 2H), 3.84-3.76 (m, 2H), 2.92 (d, J=8.7 Hz, 1H), 2.72 (d, J=10.9 Hz, 1H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.18-2.09 (m, 1H), 1.62 (t, J=7.2 Hz, 3H), 1.09 (d, J=6.2 Hz, 3H), 0.77 (qt, J=8.1, 4.8 Hz, 1H), 0.48-0.27 (m, 4H).


Example 304: Synthesis of Compound 619
Synthesis of Intermediate C498



embedded image


To a solution of 4-bromo-6-chloro-2H-indazole (2.0 g, 8.651 mmol, 1 equiv) in EA (30 mL) was added triethyloxonium tetrafluoroborate (1.98 g, 10.389 mmol, 1.2 equiv) in portions at 0 degrees C. The resulting mixture was stirred for 5 h at room temperature. The reaction mixture was quenched with saturated aqueous NaHCO3 (50 mL). The resulting mixture was extracted with EA (3×20 mL). The combined organics were washed with brine (2×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-6-chloro-2-ethyl-2H-indazole (1.8 g, 80%) as a solid. LCMS (ES, m/z): 259 [M+H]+


Synthesis of Intermediate C499



embedded image


To a solution of 4-bromo-6-chloro-2-ethylindazole (600 mg, 2.312 mmol, 1.0 equiv) and (3R)—N,N-dimethylpyrrolidin-3-amine (316 mg, 2.774 mmol, 1.2 equiv) in dioxane (6.0 mL) were added Cs2CO3 (1.5 g, 4.624 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (193 mg, 0.231 mmol, 0.1 equiv) and RuPhos (107 mg, 0.231 mmol, 0.1 equiv) at room temperature. After stirring for 1 h at 90° C. under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (20:1) to afford (3R)-1-(6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpyrrolidin-3-amine (600 mg, 89%) as a solid. LCMS (ES, m/z): 293 [M+H]+


Synthesis of Intermediate C500



embedded image


To a stirred solution of (3R)-1-(6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpyrrolidin-3-amine (600 mg, 2.049 mmol, 1.0 equiv) in DMF (12 mL) was added pyridinium tribromide (590 mg, 1.844 mmol, 0.9 equiv) in portions at −10° C. The resulting mixture was stirred for 1 h at −10° C. The reaction was quenched with water (2 mL) at 0° C. The mixture was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford (3R)-1-(7-bromo-6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpyrrolidin-3-amine (350 mg, 46%) as a solid. LCMS (ES, m/z): 371 [M+H]+


Synthesis of Intermediate C501



embedded image


To a solution of (3R)-1-(7-bromo-6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpyrrolidin-3-amine (350 mg, 0.942 mmol, 1.0 equiv) in MeOH (4 mL) were added Pd(dppf)Cl2 (68 mg, 0.094 mmol, 0.1 equiv) and TEA (476 mg, 4.710 mmol, 5.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 5 min and then was pressurized to 20 atm with carbon monoxide at 100° C. for overnight. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethylindazole-7-carboxylate (310 mg, 94%) as a solid. LCMS (ES, m/z): 351 [M+H]+


Synthesis of Intermediate C502



embedded image


A mixture of methyl 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethylindazole-7-carboxylate (310 mg, 0.884 mmol, 1.0 equiv) and LiOH (211 mg, 8.840 mmol, 10.0 equiv) in THF (1 mL), MeOH (1 mL) and H2O (1 mL) was stirred for 2 h at 50° C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethylindazole-7-carboxylic acid (150 mg, 50%) as a solid. LCMS (ES, m/z): 337 [M+H]+


Synthesis of Compound 619



embedded image


To a solution of 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethylindazole-7-carboxylic acid (150 mg, 0.445 mmol, 1.0 equiv) and DIEA (201 mg, 1.558 mmol, 3.5 equiv) in DMF (4 mL) were added HATU (338 mg, 0.890 mmol, 2.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (110 mg, 0.667 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was quenched with water (10 mL). The resulting solids were collected by filtration and purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (62 mg, 29%) as a solid. LCMS (ES, m/z): 484 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 10.75 (s, 1H), 9.23 (s, 1H), 8.78 (s, 1H), 7.92 (d, J=2.9 Hz, 1H), 7.16 (d, J=12.5 Hz, 1H), 5.89 (s, 1H), 4.45 (q, J=7.3 Hz, 2H), 3.82-3.68 (m, 2H), 3.61 (d, J=9.5 Hz, 1H), 3.41 (d, J=9.1 Hz, 2H), 2.87 (d, J=9.3 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 6H), 1.93-1.84 (m, 1H), 1.52 (t, J=7.3 Hz, 3H).


Example 305: Synthesis of Compound 621
Synthesis of Intermediate C503



embedded image


A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-1-carboxylate (2 g, 5.328 mmol, 1.0 equiv) in DMSO (5 mL) was treated with tert-butyl (2R,6S)-2,6-dimethylpiperazine-1-carboxylate (3.42 g, 15.67 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 70° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with EtOAc (3×50 mL). The combined organic layers were washed with brine (1×100 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:2) to afford tert-butyl (2R,6S)-4-[(3R)-1-[(benzyloxy)carbonyl]pyrrolidin-3-yl]-2,6-dimethylpiperazine-1-carboxylate (710 mg, 52%) as an oil. LCMS (ES, m/z): 418 [M+H]+


Synthesis of Intermediate C504



embedded image


A solution of tert-butyl (2R,6S)-4-[(3R)-1-[(benzyloxy)carbonyl]pyrrolidin-3-yl]-2,6-dimethylpiperazine-1-carboxylate (710 mg, 0.431 mmol, 1 equiv) in MeOH (10 mL) was treated with Pd/C (71 mg) at room temperature. The resulting mixture was stirred for 16 h at room temperature under H2 atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (20 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl (2R,6S)-2,6-dimethyl-4-[(3R)-pyrrolidin-3-yl]piperazine-1-carboxylate (322 mg, 83%) as an oil. LCMS (ES, m/z): 284 [M+H]+


Synthesis of Intermediate C505



embedded image


To a stirred solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (300 mg, 0.746 mmol, 1.0 equiv) and tert-butyl (2R,6S)-2,6-dimethyl-4-[(3R)-pyrrolidin-3-yl]piperazine-1-carboxylate (253.6 mg, 0.895 mmol, 1.2 equiv) in dioxane (5 mL) were added Cs2CO3 (729.0 mg, 2.238 mmol, 3.0 equiv), Ruphos (69.6 mg, 0.149 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (62.3 mg, 0.075 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85° C. under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl (2R,6S)-4-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-2,6-dimethylpiperazine-1-carboxylate (238 mg, 53%) as a solid. LCMS (ES, m/z): 605 [M+H]+


Synthesis of Compound 621



embedded image


A solution of tert-butyl (2R,6S)-4-[(3R)-1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-2,6-dimethylpiperazine-1-carboxylate (110 mg, 0.182 mmol, 1 equiv) in DCM (1 mL) was treated with HCl (gas) in 1,4-dioxane (0.2 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 11) to afford 4-[(3R)-3-[(3R,5S)-3,5-dimethylpiperazin-1-yl]pyrrolidin-1-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (34 mg, 37%) as a solid. LCMS (ES, m/z): 505 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 1H), 9.19 (d, J=1.7 Hz, 1H), 8.86 (s, 1H), 7.92 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.30 (dd, J=12.5, 1.7 Hz, 1H), 6.05 (d, J=8.4 Hz, 1H), 4.27 (s, 3H), 3.86 (t, J=8.5 Hz, 1H), 3.74 (t, J=9.4 Hz, 1H), 3.61 (d, J=8.4 Hz, 1H), 3.46 (t, J=9.0 Hz, 1H), 2.94 (p, J=7.6 Hz, 1H), 2.89-2.70 (m, 4H), 2.35 (s, 3H), 2.27 (dd, J=12.2, 6.2 Hz, 1H), 1.88 (d, J=12.1 Hz, 2H), 1.60 (q, J=10.2 Hz, 2H), 0.96 (t, J=6.4 Hz, 6H).


Example 306: Synthesis of Compound 622
Synthesis of Intermediate C506



embedded image


To a stirred mixture of benzyl 3-oxopyrrolidine-1-carboxylate (550 mg, 2.509 mmol, 1.0 equiv) and tert-butyl (3R,4R)-3-amino-4-hydroxypyrrolidine-1-carboxylate (608.8 mg, 3.011 mmol, 1.2 equiv) in DCE (5.5 mL) was added NaBH(AcO)3 (797.5 mg, 3.763 mmol, 1.5 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (80%) to afford tert-butyl 3-({1-[(benzyloxy)carbonyl]pyrrolidin-3-yl}amino)-4-hydroxypyrrolidine-1-carboxylate (802 mg, 79%) as a solid. LCMS (ES, m/z): 406 [M+H]+


Synthesis of Intermediate C507



embedded image


To a stirred mixture of tert-butyl 3-({1-[(benzyloxy)carbonyl]pyrrolidin-3-yl}amino)-4-hydroxypyrrolidine-1-carboxylate (800 mg, 1.973 mmol, 1.0 equiv) and TEA (399.2 mg, 3.946 mmol, 2.0 equiv) in DCM (8 mL) was added MsCl (271.1 mg, 2.368 mmol, 1.2 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at room temperature under nitrogen atmosphere. The reaction was quenched with Water at room temperature. The resulting mixture was extracted with CH2Cl2 (3×10 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 6-{1-[(benzyloxy)carbonyl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (623 mg, 82%) as a solid. LCMS (ES, m/z): 388 [M+H]+


Synthesis of Intermediate C508



embedded image


A solution of tert-butyl 6-{1-[(benzyloxy)carbonyl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (623 mg, 1.608 mmol, 1 equiv) in MeOH (20 mL) was treated with Pd/C (62 mg) at room temperature. The resulting mixture was stirred for 16 h at room temperature under H2 atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (10 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl 6-(pyrrolidin-3-yl)-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (280 mg, 69%) as an oil. LCMS (ES, m/z): 254 [M+H]+


Synthesis of Intermediate C509



embedded image


To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (220.0 mg, 0.547 mmol, 1.0 equiv) and tert-butyl 6-(pyrrolidin-3-yl)-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (207.8 mg, 0.821 mmol, 1.5 equiv) in 1,4-dioxane (4 mL) were added Ruphos (51.0 mg, 0.109 mmol, 0.2 equiv), Cs2CO3 (534.6 mg, 1.641 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (56.2 mg, 0.11 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with EtOAc (3×20 mL). The combined organic layers were washed with brine (1×20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2/MeOH (10:1) to afford tert-butyl 6-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (260 mg, 83%) as a solid. LCMS (ES, m/z): 575 [M+H]+


Synthesis of Compound 622



embedded image


To a stirred mixture of tert-butyl 6-{1-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (60 mg, 0.104 mmol, 1 equiv) and DIEA (67.4 mg, 0.520 mmol, 5 equiv) in DCM (1 mL) was added TMSOTf (116.0 mg, 0.520 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 4-(3-{3,6-diazabicyclo[3.1.0]hexan-6-yl}pyrrolidin-1-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (15 mg, 30%) as a solid. LCMS (ES, m/z): 475 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 9.20 (d, J=1.7 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.89 (d, J=3.1 Hz, 1H), 7.31 (dd, J=12.4, 1.7 Hz, 1H), 6.02 (d, J=8.3 Hz, 1H), 4.27 (s, 3H), 3.81 (d, J=9.5 Hz, 2H), 3.68 (s, 1H), 3.52 (d, J=10.4 Hz, 1H), 2.82 (t, J=11.8 Hz, 2H), 2.56-2.54 (m, 2H), 2.41 (dd, J=14.8, 12.3 Hz, 1H), 2.34-2.32 (m, 5H), 2.14 (tt, J=13.8, 7.0 Hz, 1H), 2.08-1.96 (m, 1H).


Example 307: Synthesis of Compound 624
Synthesis of Intermediate C510



embedded image


A solution of methyl 1-methyl-4-nitropyrazole-3-carboxylate (2 g, 10.803 mmol, 1 equiv) in 7M NH3(g) in MeOH (32 mL) was stirred for overnight at 50° C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure to afford 1-methyl-4-nitropyrazole-3-carboxamide (1.8 g, 98%) as a solid. LCMS (ES, m/z): 171 [M+H]+


Synthesis of Intermediate C511



embedded image


To a solution of 1-methyl-4-nitropyrazole-3-carboxamide (1.9 g, 11.168 mmol, 1 equiv) in MeOH (20 mL) was added Pd/C (10%, 1.19 g) under nitrogen atmosphere in a 50 mL round-bottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon, filtered through a Celite pad and concentrated under reduced pressure to afford 4-amino-1-methylpyrazole-3-carboxamide (1.5 g, 96%) as a solid. LCMS (ES, m/z): 141 [M+H]+


Synthesis of Intermediate C512



embedded image


To a stirred solution of 4-amino-1-methylpyrazole-3-carboxamide (1.5 g, 10.703 mmol, 1 equiv) in dimethylformamide (20 mL) was added NaH (1.54 g, 64.218 mmol, 6 equiv) in portions at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at 0° C. under nitrogen atmosphere. To the above mixture was added CDI (5.21 g, 32.109 mmol, 3 equiv) at 0° C. The resulting mixture was stirred for additional 3 h at 75° C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (50 mL) at room temperature. The residue was purified by reverse flash chromatography (Condition 5, Gradient 7) to afford 2-methyl-4H,6H-pyrazolo[4,3-d]pyrimidine-5,7-dione (300 mg, 17%) as a solid. LCMS (ES, m/z): 167 [M+H]+


Synthesis of Intermediate C513



embedded image


A solution of 2-methyl-4H,6H-pyrazolo[4,3-d]pyrimidine-5,7-dione (300 mg, 1.806 mmol, 1 equiv) in POCl3 (2.8 g, 18.060 mmol, 10 equiv) was stirred for 2 h at 50° C. To the above mixture was added DBU (1.65 g, 10.836 mmol, 6 equiv) at 50° C. The resulting mixture was stirred for additional 8 h at 80° C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The mixture was basified to pH 8 with saturated aq NaHCO3. The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:10) to afford 5,7-dichloro-2-methylpyrazolo[4,3-d]pyrimidine (250 mg, 68%) as a solid. LCMS (ES, m/z): 203 [M+H]+


Synthesis of Intermediate C514



embedded image


To a stirred solution of 5,7-dichloro-2-methylpyrazolo[4,3-d]pyrimidine (250 mg, 1.231 mmol, 1 equiv) in tetrahydrofuran (5 mL) was added sodium methoxide (63 mg, 1.169 mmol, 0.95 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with brine (1×10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1:1) to afford 5-chloro-7-methoxy-2-methylpyrazolo[4,3-d]pyrimidine (180 mg, 74%) as a solid. LCMS (ES, m/z): 199 [M+H]+


Synthesis of Intermediate C515



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.268 mmol, 1 equiv) and 5-chloro-7-methoxy-2-methylpyrazolo[4,3-d]pyrimidine (53 mg, 0.268 mmol, 1 equiv) in dioxane (3 mL) were added Cs2CO3 (175 mg, 0.536 mmol, 2 equiv), RuPhos (25 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (25 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with brine (1×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 10, Gradient 3) to afford tert-butyl N-[(3R)-1-[7-({7-methoxy-2-methylpyrazolo[4,3-d]pyrimidin-5-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (90 mg, 63%) as a solid. LCMS (ES, m/z): 536 [M+H]+


Synthesis of Compound 624



embedded image


A solution of tert-butyl N-[(3R)-1-[7-({7-methoxy-2-methylpyrazolo[4,3-d]pyrimidin-5-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (90 mg, 0.168 mmol, 1 equiv) in 4 M HCl(gas) in 1,4-dioxane (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{7-methoxy-2-methylpyrazolo[4,3-d]pyrimidin-5-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (16 mg, 19%) as a solid. LCMS (ES, m/z): 436 [M+H]+ 1H NMR (300 MHz, DMSO-d6) δ 11.50 (s, 1H), 8.83 (s, 1H), 8.40 (s, 1H), 7.95 (d, J=8.3 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.24 (s, 3H), 4.17 (d, J=3.6 Hz, 6H), 3.77 (q, J=9.6 Hz, 2H), 3.66 (s, 2H), 2.35 (s, 3H), 2.21-2.09 (m, 1H), 1.95 (s, 2H).


Example 308: Synthesis of Compound 626
Synthesis of Intermediate C516



embedded image


To a stirred solution of tert-butyl N-[(3R)-1-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarbamate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazine (107. mg, 0.402 mmol, 1.5 equiv) in 1,4-dioxane (4.0 mL) were added Cs2CO3 (261 mg, 0.804 mmol, 3 equiv), RuPhos (24 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90° C. The mixture was allowed to cool down to room temperature. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[(3R)-1-[7-({8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (90 mg, 60%) as a solid. LCMS (ES, m/z): 561 [M+H]+


Synthesis of Compound 626



embedded image


A solution of tert-butyl N-[(3R)-1-[7-({8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (90 mg, 0.161 mmol, 1 equiv) in 4 M HCl (gas) in 1,4-dioxane (4 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (22 mg, 30%) as a solid. LCMS (ES, m/z): 461 [M+H]+1H NMR (400 MHz, DMSO-d6) δ 11.28 (s, 1H), 9.00 (s, 1H), 8.83 (s, 1H), 7.98-7.89 (m, 2H), 6.02 (d, J=8.4 Hz, 1H), 4.53 (tt, J=6.5, 3.3 Hz, 1H), 4.23 (s, 3H), 3.82-3.70 (m, 1H), 3.65 (d, J=7.2 Hz, 1H), 3.42 (d, J=9.5 Hz, 1H), 2.33 (d, J=7.5 Hz, 6H), 2.14 (dt, J=13.1, 6.5 Hz, 1H), 2.00 (s, 1H), 1.92 (dd, J=12.0, 6.5 Hz, 1H), 0.98-0.82 (m, 4H).


Example 309: Synthesis of Compound 631
Synthesis of Intermediate C517



embedded image


A solution of tert-butyl N-[(3R)-1-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methylcarbamate (200 mg, 0.371 mmol, 1 equiv) in 2 M methylamine in THF (2 mL) was stirred for overnight at 80° C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-methyl-N-[(3R)-1-(2-methyl-7-{[2-methyl-8-(methylamino)imidazo[1,2-a]pyrazin-6-yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbamate (150 mg, 76%) as a solid. LCMS (ES, m/z): 534 [M+H]+


Synthesis of Compound 631



embedded image


A solution of tert-butyl N-methyl-N-[(3R)-1-(2-methyl-7-{[2-methyl-8-(methylamino)imidazo[1,2-a]pyrazin-6-yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbamate (90 mg, 0.169 mmol, 1 equiv) in 4 M HCl(gas) in 1,4-dioxane (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-methyl-N-[2-methyl-8-(methylamino)imidazo[1,2-a]pyrazin-6-yl]-4-[(3R)-3-(methylamino)pyrrolidin-1-yl]indazole-7-carboxamide (35 mg, 48%) as a solid. LCMS (ES, m/z): 434 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.03 (s, 1H), 8.82 (s, 1H), 8.60 (s, 1H), 7.93 (d, J=8.3 Hz, 1H), 7.67 (d, J=1.0 Hz, 1H), 7.50 (d, J=4.9 Hz, 1H), 6.02 (d, J=8.4 Hz, 1H), 4.23 (s, 3H), 3.84-3.69 (m, 2H), 3.65 (d, J=7.4 Hz, 1H), 3.45 (d, J=9.9 Hz, 1H), 3.39 (s, 1H), 3.00 (d, J=4.7 Hz, 3H), 2.38 (s, 3H), 2.32 (s, 3H), 2.18 (dd, J=12.4, 5.9 Hz, 1H), 1.95 (dd, J=12.0, 6.4 Hz, 1H).


Example 310: Synthesis of Compound 656
Synthesis of Intermediate C518



embedded image


To a stirred solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (120 mg, 0.321 mmol, 1 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2-a]pyrazine (95 mg, 0.385 mmol, 1.2 equiv) in dioxane (2.4 mL) were added Cs2CO3 (314.1 mg, 0.963 mmol, 3 equiv) and XantPhos (37.2 mg, 0.064 mmol, 0.2 equiv) and Pd2(dba)3 (29.4 mg, 0.032 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (150 mg, 87%) as a solid. LCMS (ES, m/z): 539 [M+H]+


Synthesis of Compound 656



embedded image


To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-ethylindazol-4-yl]piperazine-1-carboxylate (100 mg, 0.186 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas) in 1,4-dioxane (0.3 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(piperazin-1-yl) indazole-7-carboxamide (24 mg, 29%) as a solid. LCMS (ES, m/z): 439 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.45 (s, 1H), 9.45 (s, 1H), 8.84 (s, 1H), 8.17 (s, 1H), 8.03 (d, J=8.1 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.57 (q, J=7.3 Hz, 2H), 3.38 (t, J=4.9 Hz, 4H), 2.92 (dd, J=6.0, 3.5 Hz, 4H), 2.42 (s, 3H), 1.64 (t, J=7.3 Hz, 3H).


Example 311: Synthesis of Compound 658
Synthesis of Intermediate C519



embedded image


To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-1-carboxylate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-fluoroisoquinoline (78.7 mg, 0.348 mmol, 1.3 equiv) in dioxane (2.5 mL) were added Cs2CO3 (174.49 mg, 0.536 mmol, 2 equiv) and XantPhos (31 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24.5 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90° C. under nitrogen atmosphere. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3×5 mL). The combined organic layers were washed with water (3×5 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-{2-ethyl-7-[(8-fluoroisoquinolin-6-yl)carbamoyl]indazol-4-yl}piperazine-1-carboxylate (150 mg, 97%) as a solid. LCMS (ES, m/z): 519 [M+H]+


Synthesis of Compound 658



embedded image


To a stirred mixture of tert-butyl 4-{2-ethyl-7-[(8-fluoroisoquinolin-6-yl)carbamoyl]indazol-4-yl}piperazine-1-carboxylate (100 mg, 0.193 mmol, 1 equiv) in DCM (1 mL) was added HCl (gas) in 1,4-dioxane (0.3 mL) dropwise room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2-ethyl-N-(8-fluoroisoquinolin-6-yl)-4-(piperazin-1-yl) indazole-7-carboxamide (30 mg, 37%) as a solid. LCMS (ES, m/z): 419 [M+H]+ 1H NMR (400 MHz, DMSO-d6) δ 11.66 (s, 1H), 9.35 (s, 1H), 8.86 (s, 1H), 8.54 (d, J=5.8 Hz, 1H), 8.28 (d, J=1.8 Hz, 1H), 8.04 (d, J=8.1 Hz, 1H), 7.93 (dd, J=12.5, 1.8 Hz, 1H), 7.87 (dd, J=5.8, 1.8 Hz, 1H), 6.51 (d, J=8.2 Hz, 1H), 4.63 (q, J=7.3 Hz, 2H), 3.42-3.35 (m, 4H), 2.95-2.88 (m, 4H), 1.65 (t, J=7.3 Hz, 3H).


Example 312: Exemplary Splicing Assay for Monitoring Expression Levels of Splice Variants

Compounds described herein were used to modulate RNA transcript abundance in cells. The expression of a target mRNA was measured by detecting the formation of an exon-exon junction in the canonical transcript (CJ). A compound mediated exon-inclusion event was detected by observing an increase in formation of a new junction with an alternative exon (AJ). Real-time qPCR assays were used to detect these splicing switches and interrogate the potency of various compounds towards different target genes. A high-throughput real time quantitative PCR (RT-qPCR) assay was developed to measure these two isoforms of the mRNA (CJ and AJ) for exemplary genes, such as HTT, SMN2, and MYB, together with a control housekeeping gene, GAPDH or GUSB or PPIA, used for normalization. Briefly, the A673 or K562 cell line was treated with various compounds described herein (e.g., compounds of Formula (I)). After treatment, the levels of the HTT, MYB, or SMN2 mRNA targets were determined from each sample of cell lysate by cDNA synthesis followed by qPCR.


Materials:





    • Cells-to-CT 1-step kit: ThermoFisher A25602, Cells-to-CT lysis reagent: ThermoFisher 4391851C, TaqMan™ Fast Virus 1-Step Master Mix: ThermoFisher 4444436

    • GAPDH: VIC-PL, ThermoFisher 4326317E (Assay: Hs99999905_m1)—used for K562/suspension cell lines

    • GUSB: VIC-PL, ThermoFisher 4326320E (Assay: Hs99999908_m1)—used for K562/suspension cell lines

    • PPIA: VIC-PL, ThermoFisher 4326316E (Assay: Hs99999904_m1)—used for A673/adherent cell lines












Probe/primer sequences


Canonical junction (CJ)


HTT Primer 1:


TCCTCCTGAGAAAGAGAAGGAC


HTT Primer 2:


GCCTGGAGATCCAGACTCA


HTT CY5-Probe:


/5Cy5/TGGCAACCCTTGAGGCCCTGTCCT/3IAbRQSp/


MYB Primer 1:


CCTCATTGGTCACAAATTGACTG


MYB Primer 2:


TGGAGAGCTTTCTAAGATTGACC


MYB CY5-Probe:


/5Cy5/AGGAAAATACTGTTTTTAGAACCCCAG/3IAbRQSp/





Alternative junction (AJ)


HTT Primer 1:


TCCTGAGAAAGAGAAGGACATTG


HTT Primer 2:


CTGTGGGCTCCTGTAGAAATC


HTT FAM-Probe:


/56-FAM/TGGCAACCC/ZEN/TTGAGAGGCAAGCCCT/3IABKFQ/


MYB Primer 1:


CAACACCATTTCATAGAGACCAGAC


MYB Primer 2:


GTTCTAAAATCATCCCTTGGCTTCTAAT


MYB FAM-Probe:


/56-FAM/AAATACTGT/ZEN/ATAGGACCTCTTCTGACATCC/


3IABKFQ/






Description

The A673 cell line was cultured in DMEM with 10% FBS. Cells were diluted with full growth media and plated in a 96-well plate (15,000 cells in 100 ul media per well). The plate was incubated at 37° C. with 5% CO2 for 24 hours to allow cells to adhere. An 11-point 3-fold serial dilution of the compounds was made in DMSO then diluted in media in an intermediate plate. Compounds were transferred from the intermediate plate to the cell plate with the top dose at a final concentration of 10 uM in the well. Final DMSO concentration was kept at or below 0.25%. The cell plate was returned to the incubator at 37° C. with 5% CO2 for an additional 24 hours.


The K562 cell line was cultured in IMDM with 10% FBS. For K562, cells were diluted with full growth media and plated in either a 96-well plate (50,000 cells in 50 uL media per well) or a 384-well plate (8,000-40,000 cells in 45 uL media per well). An 11-point 3-fold serial dilution of the compounds were made in DMSO then diluted in media in an intermediate plate. Compound was transferred from the intermediate plate to the cell plate with the top dose at a final concentration of 10 uM in the well. Final DMSO concentration was kept at or below 0.25%. Final volume was 100 uL for 96-well plate and 50 uL for 384-well plate. The cell plate was then placed in an incubator at 37° C. with 5% CO2 for 24 hours.


The cells were then gently washed with 50 uL-100 uL cold PBS before proceeding to addition of lysis buffer. 30 uL-50 uL of room temperature lysis buffer with DNAse I (and optionally RNAsin) was added to each well. Cells were shaken/mixed thoroughly at room temperature for 5-10 minutes for lysis to take place and then 3 uL-5 uL of room temperature stop solution was added and wells were shaken/mixed again. After 2-5 minutes, the cell lysate plate was transferred to ice for RT-qPCR reaction setup. The lysates could also be frozen at −80° C. for later use.


In some cases, a direct lysis buffer was used. An appropriate volume of 3× lysis buffer (10 mM Tris, 150 mM NaCl, 1.5%-2.5% Igepal and 0.1-1 U/uL RNAsin, pH 7.4) was directly added to either K562 or A673 cells in media and mixed by pipetting 3 times. The plates were then incubated at room temperature with shaking/rocking for 20-50 minutes to allow for lysis to take place. After this time, the cell lysate plate was transferred to ice to set up for the RT-qPCR reactions. The lysates could also be frozen at −80° C. for later use.


To set up 10 uL RT-qPCR reactions, cell lysates were transferred to 384-well qPCR plates containing the master mix according to the table below. The plates were sealed, gently vortexed, and spun down before the run. The volumes were adjusted accordingly in some instances where the reaction was carried in 20 μL. The table below summarizes the components of the RT-qPCR reactions:
















Component
1X



















Taqman 1-step RT-qPCR mix (4X)
2.5



20X AJ Primers + Probe (FAM)
0.5



20X CJ Primers + Probe (CY5)
0.5



20X PPIA Control (VIC)
0.5



Cell lysate (1X)
1-2



H2O
4-5



Total volume
10










The RT-qPCR reaction was performed using a QuantStudio (ThermoFisher) under the following fast cycling conditions. All samples and standards were analyzed at least in duplicate. In some instances, bulk room temperature (RT) step of 5-10 minutes was completed for all plates before proceeding with qPCR. The table below summarizes the PCR cycle:


















Step
# cycles
Temp.
Time






















RT step
1
50° C.
5
min



RT inactivation/initial
1
95° C.
20
sec



denaturation



Amplification
40
95° C.
3
sec





60° C.
30
sec










The data analysis was performed by first determining the ΔCt vs the housekeeper gene. This ΔCt was then normalized against the DMSO control (ΔΔCt) and converted to RQ (relative quantification) using the 2{circumflex over ( )}(−ΔΔCt) equation. The RQ were then converted to a percentage response by arbitrarily setting an assay window of 3.5 and 4.0 ΔCt for HTT-CJ and MYB-CJ respectively and an assay window of 9 and 3 ΔCt for HTT-AJ and MYB-AJ in 96 well format (50,000 K562 cells/well and 15,000 A673 cells per well) and an assay window of 3 and 4 ΔCt for HTT-CJ and MYB-CJ respectively and an assay window of 5 and 3 ΔCt for HTT-AJ and MYB-AJ respectively in 384 well format (8,000 K562 cells/well example). These assay windows correspond to the maximal modulation observed at high concentration of the most active compounds. The percentage response was then fitted to the 4 parametric logistic equation to evaluate the concentration dependence of compound treatment. The increase in AJ mRNA is reported as AC50 (compound concentration having 500 response in AJ increase) while the decrease in CJ mRNA levels is reported as IC50 (compound concentration having 50% response in CJ decrease).


A summary of these results is illustrated in Tables 3A and 3B, wherein “A” represents an AC50/IC50 of less than 100 Nm; “B” represents an AC50/IC50 of between 100 Nm and 1 μM; and “C” represents an AC50/IC50 of between 1 μM and 10 μM; and “D” represents an AC50/IC50 of greater than 10 μM.









TABLE 3A







Modulation of RNA Splicing by Exemplary Compounds











Cmpnd
HTT
HTT
MYB
MYB


No.
CJ
AJ
CJ
AJ





119
C
D
C
C


141
A
A
A
A


142
C
C
B
B


145
C
C
B
B


148
C
C
C
C


149
C
C
B
B


188
D
D
C
C


189
C
C
B
B


190
B
B
A
A


191
B
C
B
B


192
C
C
B
B


193
C
C
B
B


195
D
D
B
C


197
D
D
C
C


199
B
B
B
B


200
C
C
C
C


201
D
D
D
D


202
D
C
B
A


204
C
C
B
B


205
B
C
B
B


206
C
C
B
B


209
B
B
A
A


210
B
B
A
A


212
C
D
B
C


217
D
D
D
D


219
D
D
B
C


229
B
B
A
A


230
D
D
D
D


231
D
D
D
D


235
C
C
B
B


237
C
C
B
A


238
C
C
B
B


239
B
B
A
B


240
B
B
A
A


242
B
C
A
B


243
B
B
A
A


244
D
D
D
D


245
B
B
B
B


246
C
C
A
A


247
D
D
D
D


249
D
D
B
B


253
D
D
D
D


255
C
C
B
A


256
C
C
B
B


257
C
C
B
B


258
C
B
A
A


259
C
C
B
C


260
B
B
A
A


261
D
D
D
D


262
C
C
B
B


263
C
C
B
B


264
D
D
D
D


265
D
D
D
D


266
C
C
B
A


267
D
C
C
B


268
D
D
D
D


269
B
B
A
A


270
D
D
D
D


271
D
D
C
C


272
B
B
B
A


273
D
D
B
B


274
C
D
B
B


275
C
C
B
A


278
C
C
B
A


280
C
C
D
C


281
C
C
C
C


282
C
C
D
D


283
C
D
C
D


286
D
D
B
C


289
C
D
B
B


290
D
D
B
B


291
C
C
B
B


292
C
C
A
A


293
C
B
A
A


294
B
C
A
A


295
D
C
B
B


296
D
D
A
A


297
C
C
C
C


298
C
C
A
B


299
D
D
B
B


300
D
D
C
B


301
B
B
A
A


302
C
C
A
A


303
C
C
B
B


304
C
D
B
B


305
C
C
B
B


306
C
C
B
A


307
C
C
B
B


308
D
D
D
D


309
D
D
C
D


310
C
C
A
A


311
D
D
B
C


312
C
C
B
A


313
D
D
C
C


314
C
C
A
A


315
B
B
A
A


316
D
D
C
B


318
D
D
B
B


319
C
C
A
A


320
C
C
B
B


321
D
D
D
D


322
D
D
C
D


323
A
B
A
A


324
D
C
B
B


325
D
D
C
C


326
B
B
A
A


327
D
D
B
B


328
D
D
C
D


329
D
D
D
D


330
D
D
B
B


332
D
D
D
D


333
C
C
B
B


334
D
D
B
B


335
D
D
C
C


336
B
B
A
A


337
C
C
B
B


338
C
C
B
B


339
D
D
C
C


340
D
D
C
C


341
D
D
C
C


342
D
D
C
D


343
A
A
A
A


344
D
D
C
C


347
C
C
A
A


348
C
C
A
A


349
B
B
A
A


350
C
C
A
A


351
C
C
A
A


352
B
B
A
A


353
B
B
A
A


354
D
D
C
C


355
D
C
A
A


356
D
D
B
B


358
C
D
B
B


362
D
D
C
C


364
C
D
C
B


366
C
C
A
A


367
C
C
B
B


368
D
D
B
B


369
B
B
A
A


370
D
D
B
C


371
B
B
A
A


372
C
C
A
A


373
C
C
A
A


374
D
D
A
A


375
B
B
B
B


376
B
C
B
B


377
C
C
B
B


378
C
C
B
B


379
C
D
B
C


380
C
C
A
A


381
D
D
A
A


382
C
C
A
A


383
D
D
A
B


384
D
D
D
C


385
D
D
D
D


387
C
C
A
A


388
C
C


389
D
D
B
C


390
D
D
D
D


391
D
C
A
B


392
C
C
A
A


393
D
D
B
B


394
C
C
B
B


395
C
C
A
A


396
D
D
B
A


397
C
C
B
B


398
D
D
B
B


399
D
D
B
B


400
D
D
A
A


401
B
B
A
A


402
B
B
A
A


403
C
C
B
B


404


405
C
C
A
B


406
B
B
A
A


407
D
D
B
B


408
D
D
B
B


409
D
D
B
A


410
D
D
B
C


411
C
C
A
A


412
C
D
A
A


413
C
C
A
A


414
D
D
C
C


415
B
B
B
B


416
D
D
D
D


417
C
D
A
A


418
D
D
B
C


419
D
D
D
D


420
D
D
B
B


421
D
D
D
D


423
B
B
A
A


424
D
D
D
D


425
D
D
D
D


426
D
D
D
D


427
B
B
B
B


428
A
A
A
A


429
C
C
B
B


430
C
C
A
A


431
D
D
B
B


432
D
D
A
A


434
C
C
B
C


435
D
D
D
D


436
D
D
B
B


437
C
C
A
A


441
C
C
A
A


442
C
D
B
B


443
C
C
A
A


444
C
D
B
B


446
C
C
B
B


447
B
B
A
A


448
B
C
A
A


450
D
D
D
D


451
D
D
C
C


452
D
D
C
C


453
D
D
C
C


454
C
C
B
C


455
D
D
D
D


456
D
D
D
C


457
D
D
D
D


458
A
B
A
A


459
B
B
A
A


460
A
B
A
A


461
C
D
A
B


462
B
B
A
A


463
B
B
A
A


464
B
B
A
A


469
D
D
D
D


470
D
D
D
D


472
D
C
A
A


473
C
C
A
A


474
A
B
A
A


475
B
B
A
A


476
B
C
C
C


477
C
D
B
B


478
C
D
A
B


479
C
C
A
A


481
B
C
A
B


482
D
D
C
C


484
D
D
D
D


486
B
B
B
B


487
C
C
C
C


488
D
D
D
D


489
D
D
D
D


490
D
D
C
C


491
C
D
B
C


492
C
D
B
C


494
D
D
D
D


496
D
D
D
D


497
B
B
A
A


498
B
C
B
B


499
D
D
D
D


500
D
D
D
D


501
A
A
A
A


502
A
B
A
A


503
B
A
A
A


504
C
C
C
C


505
C
C
B
B


506
B
C
B
B


507
C
C
B
B


508
A
B
A
A


509
D
D
C
C


510
C
C
B
B


511
B
B
B
B


513
C
D
B
B


514
B
B
A
A


515
B
B
A
A


517
C
D
B
B


518
C
C
B
A


520
C
C
A
A


522
C
C
A
B


524
D
D
A
A


525
B
B
A
A


526
D
D
C
C


527
D
D
B
B


528
D
D
B
B


529
A
B
A
A


531
C
C
B
C


533
C
C
A
A


535
D
D
B
B


537
D
D
C
C


538
C
C
C
C


539
D
D
C
C


541
D
D
B
B


542
C
C
B
B


543
C
C
A
A


544
D
D
C
C


545
C
D
B
B


547
D
D
D
D


548
D
D
D
D


550
D
D
C
C


552
B
B
B
B


554
D
D
B
A


556
D
D
C
D


557
B
B
A
A


559
C
C
A
A


560
C
C
B
B


562
D
D
C
C


563
B
B
A
A


564
B
B
A
A


565
D
D
D
D


566
C
C
B
B


568
C
C
C
C


569
D
C
A
A


571
B
B
A
A


573
D
D
B
B


574
D
D
B
B


575
D
D
D
D


576
C
D
B
B


577
B
B
B
B


579
D
D
D
D


580
D
D
B
C


581
C
C
B
B


582
B
B
B
B


584
C
C
B
B


585
D
D
B
B


587
B
B
B
B


589
D
D
B
C


590
C
C
B
B


592
C
D
B
B


594
D
D
B
C


596
D
D
C
C


598
C
C
A
B


600
D
D
C
C


602
C
C
A
B


603
D
D
C
D


604
D
D
C
C


606
B
C
B
B


607
C
C
B
B


610
D
C
B
B


612
D
D
D
D


614
D
D
B
B


616
B
C
B
B


617
C
D
B
C


619
D
D
B
B


621
D
D
C
B


622
D
D
C
D


624
C
C
C
C


626
C
C
B
B


627
C
C
B
B


629
C
C
C
C


631
D
D
C
C


633
C
D
B
B


635
D
D
B
C


637
C
C
B
C


639
D
D
B
B


641
C
C
A
A


643
D
D
B
B


645
C
D
B
B


649
D
D
B
B


651
D
D
D
D


653
D
D
D
D




















TABLE 3B





Cmpnd
HTT
HTT
MYB
MYB


No.
CJ
AJ
CJ
AJ







908
B
B
A
A


916
B
B
A
A


932
D
D
C
C


940
A
B
A
A


941
B
B
A
A


942
B
C
B
B


943
B
C
A
A


944
C
C
B
B


945
C
C
A
A


946
A
B
A
A


949
A
A
A
A


950
B
B
A
B


952
B
B
B
B


953
C
C
B
B


954
C
C
B
B


955
B
C
A
A


956
A
B
A
A


958
B
C
A
A


959
B
B
A
A


960
B
B
B
B


961
B
B
A
A


963
C
C
B
B


965
A
A
A
A


966
A
A
A
A


968
B
C
A
B


969
C
D
A
A


971
B
B
A
A


973
C
C
A
A


974
B
B
A
A


976
B
C
A
A


978
B
B
A
A


979
B
B
A
A









Additional studies were carried out for a larger panel of genes using the protocol provided above. The junction between flanking upstream and downstream exons was used to design canonical junction qPCR assays. At least one of the forward primer, reverse primer or the CY5-labeled 5′ nuclease probe (with 3′ quencher such as ZEN/Iowa Black FQ) was designed to overlap with the exon junction to capture the CJ mRNA transcript. BLAST was used to confirm the specificity of the probeset and parameters such as melting temperature, GC content, amplicon size, and primer dimer formation are considered during their design. Data for the decrease in CJ mRNA levels for three exemplary genes (HTT, SMN2, and Target C) analyzed in this panel are reported as IC50 (compound concentration having 5000 response in CJ decrease).


A summary of the results from the panel is illustrated in Tables 4A and 4B3, wherein “A” represents an IC50 of less than 100 nM; “B” represents an IC50 of between 100 nM and 1 μM; and “C” represents an IC50 of between 1 μM and 10 μM; and “D” represents an IC50 of greater than 10 μM.









TABLE 4A







Modulation of RNA Splicing by Exemplary Compounds











Compound


Target



No.
HTT
SMN2
C
MYB





118
C
B
D
B


119
C
B
D
C


140
C
B
C
C


141
A
A
B
A


142
C
A
B
B


143
A
A
B
A


145
C
A
B
B


148
C
B
C
C


149
C
A
D
B


187
B
A
C
B


188
D
B
C
C


189
C
A
C
B


190
B
B
C
A


191
B
A
C
B


192
C
A
C
B


193
C
A
D
B


194
C
A
D
B


195
D
A
D
B


196
C
A
C
B


197
D
B
D
C


198
C
A
C
A


199
B
A
C
B


200
C
A
C
C


201
D
C
D
D


202
D
A
D
B


203
D
A
D
B


204
C
A
C
B


205
B
A
C
B


206
C
A
D
B


207
B
A
C
A


208
B
A
B
A


209
B
C
B
A


210
B
A
C
A


211
C
A
C
B


212
C
B
D
B


217
D
C
D
D


218
C
A
C
B


219
D
B
D
B


228
B
A
B
A


229
B
A
C
A


230
D
D
D
D


231
D
D
D
D


234
C
A
C
A


235
C
A
D
B


237
C
A
D
B


238
C
A
D
B


239
B
A
C
A


240
B
A
C
A


241
B
A
C
B


242
B
A
C
A


243
B
A
C
A


244
D
B
D
D


245
B
A
B
B


246
C
A
D
A


247
D
D
D
D


249
D
A
D
B


250
A
A
B
A


251
B
A
C
A


252
B
A
B
A


253
D
C
D
D


255
C
A
D
B


256
C
A
D
B


257
C
A
D
B


258
C
A
C
A


259
C
A
C
B


260
B
C
C
A


261
D
C
D
D


262
C
A
D
B


263
C
A
C
B


264
D
D
D
D


265
D
C
D
D


266
C
A
D
B


267
D
A
D
C


268
D
D
D
D


269
B
A
C
A


270
D
D
D
D


271
D
B
D
C


272
B
A
B
B


273
D
A
D
B


274
C
A
D
B


275
C
A
D
B


277
B
A
C
A


278
C
A
C
B


279
C
A
C
A


280
C
C
D
D


281
C
B
C
C


282
C
B
D
D


283
C
B
D
C


284
C
A
C
A


285
B
A
B
A


286
D
B
D
B


288
C
A
C
A


289
C
A
D
B


290
D
A
D
B


291
C
A
C
B


292
C
A
C
A


293
C
A
D
A


294
B
A
D
A


295
D
A
D
B


296
D
A
D
A


297
C
B
C
C


298
C
A
C
A


299
D
A
D
B


300
D
B
D
C


301
B
A
C
A


302
C
A
D
A


303
C
A
D
B


304
C
A
D
B


305
C
A
D
B


306
C
A
D
B


307
C
A
D
B


308
D
D
D
D


309
D
C
D
C


310
C
A
D
A


311
D
A
D
B


312
C
A
C
B


313
D
B
C
C


314
C
A
D
A


315
B
A
B
A


316
D
B
D
C


318
D
A
D
B


319
C
A
C
A


320
C
A
D
B


321
D
D
D
D


322
D
C
D
C


323
A
A
C
A


324
D
A
D
B


325
D
A
D
C


326
B
A
C
A


327
D
B
D
B


328
D
B
D
C


329
D
C
D
D


330
D
A
D
B


332
D
D
D
D


333
C
A
D
B


334
D
A
D
B


335
D
B
D
C


336
B
A
B
A


337
C
A
D
B


338
C
A
D
B


339
D
B
D
C


340
D
B
D
C


341
D
B
D
C


342
D
D
D
C


343
A
A
B
A


344
D
B
D
C


347
C
A
C
A


348
C
A
C
A


349
B
A
B
A


350
C
A
D
A


351
C
A
D
A


352
B
A
C
A


353
B
A
C
A


354
D
B
D
C


355
D
A
D
A


356
D
A
D
B


358
C
A
D
B


361
A
A
A
A


362
D
B
D
C


363
A
A
A
A


364
C
A
D
C


366
C
A
D
A


367
C
A
D
B


368
D
A
D
B


369
B
A
C
A


370
D
B
D
B


371
D
A
D
A


372
D
A
D
A


373
C
A
D
A


374
D
A
D
A


375
B
A
B
B


376
C
A
D
A


377
C
A
C
A


378
C
A
D
A


379
C
A
C
B


380
C
A
C
A


381
D
A
D
A


382
C
A
D
A


383
D
A
D
A


384
D
B
D
D


385
D
D
D
D


386
D
D
D
D


387
C
A
D
A


388
D
A
D
A


389
D
A
D
B


407
D
A
D
B


408
D
A
D
B


409
D
A
D
B


410
D
A
D
B


411
D
A
D
A


412
C
A
D
A


413
C
A
D
A


414
D
C
D
C


415
B
B
B
B


416
D
C
D
D


417
D
A
D
A


418
D
A
D
B


419
D
D
D
D


420
D
A
D
B


421
D
D
D
D


422
A
A
B
A


423
B
A
C
A


424
D
C
D
D


425
D
D
D
D


426
D
D
D
D


427
B
A
C
B


428
A
A
B
A


429
C
A
D
B


430
C
A
D
A


431
C
A
C
A


432
D
A
D
B


433
C
A
C
B


434
D
A
D
A


435
C
A
C
B


436
D
D
D
D


437
D
A
D
B


440
A
A
C
A


441
C
A
D
A


442
C
A
D
A


443
C
A
D
B


444
C
A
C
A


445
A
A
B
A


446
C
A
C
B


447
C
A
C
B


448
B
A
C
A


449
C
A
D
A


450
B
A
C
A


451
D
D
D
D


452
D
B
D
C


453
D
B
D
C


454
D
A
D
C


455
C
B
C
B


456
D
D
D
D


457
D
D
D
D


458
D
D
D
D


459
A
A
C
A


460
B
A
B
A


461
C
A
D
A


462
B
A
D
A


463
B
A
D
A


464
B
A
C
A


469
D
D
D
D


470
D
D
D
D


471
A
A
A
A


472
D
A
D
A


473
C
A
D
A


474
B
A
C
A


475
B
A
C
A


476
B
B
C
C


477
C
B
D
B




















TABLE 4B





Compound


Target



No.
HTT
SMN2
C
MYB







908
B
A
C
A


916
B
A
B
A


932
D
B
D
C


940
A
A
B
A


941
B
A
C
A


942
B
A
C
B


943
B
A
C
A


944
C
A
C
B


945
C
A
C
A


946
A
A
B
A


949
A
A
A
A


950
B
A
D
A


952
B
A
B
B


953
C
A
C
B


954
C
A
C
B


955
B
A
D
A


956
A
A
B
A


958
B
A
D
A


959
B
A
B
A


960
B
A
B
B


961
B
A
B
A


963
C
A
D
B


965
A
A
B
A


966
A
A
A
A


968
B
A
C
A


969
C
A
C
A


971
B
A
B
A


973
C
A
C
A


974
B
A
B
A


976
B
A
C
A


978
B
A
C
A


979
B
A
C
A









Example 313: Evaluating Effect of Exemplary Compounds on Protein Abundance

Compounds described herein were used to screen for effects on quantitative protein abundance using a HiBit assay system (Promega). Quantitative protein abundance was determined by measuring the protein levels of HiBit-tagged protein targets expressed in cell culture via luminescence using the Nano-Glo HiBiT Lytic Detection System, which uses a split complementation assay format to reconstitute NanoBiT enzyme to generate a luminescent signal. A protein abundance assay was developed such that endogenous protein targets could be modified with the HiBiT peptide tag and their abundance could be assessed after compound treatment. Briefly, K562 cell lines containing a HiBiT-modification were treated with various compounds described herein (e.g., compounds of Formulas (I) or (II)). After treatment for 24 hours, the protein abundance of a specific target was determined by measuring luminescence.


Materials:





    • Promega Nano-Glo HiBiT Lytic Detection System (cat #N3030)

    • Corning 384-well TC-treated microplates (cat #3570)

    • Synthego Engineered Cells Knock-In Clones












TABLE 5







Design of genetically modified HiBiT cell lines















Guide
Guide



Cell


RNA
RNA cut



Line
Gene
Modification
Sequence
location
Donor Sequence





K562
MYB
HiBiT
GCGCCA
chr6:
CGGTGCGGTCCCCGCGGCTC





TGGCCC
135,181,526
TCGGCGGAGCCCCGCGCCCG





GAAGAC

CCGCGCCATGgtgagcggctggcgg





CC

ctgttcaagaagattagcGGCAGCTCC







GGAGGATCTAGCGGCGCCCG







AAGACCCCGGCACAGgtaacgg







ggagccggggggcggccgaggg





K562
HTT
HiBiT
CAGCTTT
chr4:
CGAGTCGGCCCGAGGCCTCC





TCCAGG
3,074,830
GGGGACTGCCGTGCCGGGCG





GTCGCC

GGAGACCGCCATGgtgagcggctg





A

gcggctgttcaagaagattagcGGCAGC







TCCGGAGGATCTAGCGGCGC







GACCCTGGAAAAGCTGATGA







AGGCCTTCGAGTCCCTCAAG







TCCTTCCA









Description:

Cells were maintained in EIDM with 10% FBS. Before the assay, cells were diluted with phenolphthalein-free growth media (EIDM+1% FBS media) and were seeded in a 384-well plate at a density of 10000 cells/well (for each cell line listed in Table 5). Each compound was prepared as a 10-point 3-fold serial dilution in DMSO with the top dose at a final concentration of 10 μM in the well. Unmodified K562 cells were added at the previously specified density with DMSO to serve as an assay baseline and positive control (PC) and DMSO only with the respective modified cell lines was added to the negative control (NC) columns. Final DMSO concentration was kept at or below 0.25%. Treated cell plates were placed in an incubator at 37° C. with 5% CO2 for 24 hours. After 24 hours, 25 μL of Complete HiBit Lytic reagent was added to each well at room temperature (e.g. one plate requiring 10 mL Lytic Buffer, 100 μL LgBiT Protein, 200 μL Lytic Substrate), shaken for 5 minutes at 600 RPM, then left to sit for 10 minutes for signal to stabilize before reading on a Spark Cyto plate reader (Tecan) with a 500 ms measurement time.


To determine compound effects on protein abundance of each target in Table 6, the percent response for each respective cell line was calculated at each compound concentration as follows:







%


response

=

100
*


(

S
-
PC

)

/

(

NC
-
PC

)







For the normalized response at each concentration, a four-parameter logistical regression was fit to the data and the response was interpolated at the 50% value to determine a concentration for protein abundance at 5000 (IC50) the untreated control.


A summary of the results for protein abundance is illustrated in Table 6, wherein A represents <100 nM; B represents 100-1000 nM; C represents 1000-9999 nM; and D represents greater than 10 μM.














TABLE 6







Compound No.
HTT
MYB
Target C









118
B
A
C



119
C
C
D



140
C
C
C



141
B
B
C



142
B
A
C



143
A
A
A



145
C
A
C



148
C
C
C



149
C
A
C



187
A
B
B



189
D
B
C



190
B
A
C



191
B
A
C



192
C
B
C



193
C
B
D



194
C
B
D



195
D
C
C



196
B
A
C



197
D
C
D



198
C
A
D



199
C
A
D



200
C
C
C



187
C
A
C



190
B
A
C



191
C
B
C



192
C
B
C



193
C
B
D



194
C
B
D



197
D
C
D



198
C
A
D



199
C
A
D



200
A
A
B



208
B
A
B



217
D
D
D



556
C
C
C



557
B
A
B



559
B
A
B



560
C
A
C



562
D
D
D



563
B
A
B



564
B
B
B



565
C
C
D



566
C
B
C



568
C
C
C



569
C
A
C



571
B
A
C



573
D
C
D



574
D
B
D



575
C
C
D










Example 314: Investigating Effect of Exemplary Compounds on Cell Viability

Compounds described herein were screened for toxicity in K562 (human chronic myelogenous leukemia) and SH-SY5Y (human neuroblastoma) cells using a Cell Titer Glo 2.0 assay.


Materials:





    • Promega CellTiter-Glo® 2.0 Cell Viability Assay (cat #G9241)

    • Corning 384-well TC-treated microplates (cat #3570)





Description:

Cells were plated at 500 cells/well (K562 cells) in 45 μL of IMDM supplemented with 10% FBS in a 384-well opaque plate. Wells containing only medium were used as a blank control. Test compounds (e.g., compounds of Formula (I) or (II)) were first serially diluted in DMSO then diluted 1:100 with EIDM+10% FBS. The final concentration of DMSO was 0.1% in each well. The cells were incubated for 72 hours at 37° C. and 5% CO2 before assaying with Cell Titer Glo 2.0 reagent.


The compounds tested exhibited the following range as shown in Table 7, wherein A represents <100 nM; B represents 100-1000 nM; C represents 1000-9999 nM; and D represents greater than 10 μM in K562 cells.












TABLE 7







Compound No.
GI50 nM









118
B



119
C



140
C



141
B



142
B



143
B



148
C



149
B



187
B



189
B



190
B



191
B



192
B



193
B



194
B



195
B



196
A



197
B



198
A



199
B



200
C



208
B



217
B



556
B



557
A



559
A



560
A



562
C



563
B



564
B



565
C



566
B



568
B



569
B



571
B



573
C



574
B



575
B










EQUIVALENTS AND SCOPE

This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.


Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, Figures, or Examples but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.

Claims
  • 1. A compound of Formula (I):
  • 2. The compound of claim 1, wherein each of A and B is independently heteroaryl or heterocyclyl, each of which is optionally substituted with one or more R1.
  • 3. The compound of any one of the preceding claims, wherein one of A and B is independently a monocyclic heteroaryl or bicyclic heteroaryl, each of which is optionally substituted with one or more R1.
  • 4. The compound of any one of the preceding claims, wherein one of A and B is independently a bicyclic heteroaryl optionally substituted with one or more R1.
  • 5. The compound of any one of the preceding claims, wherein one of A and B is independently a nitrogen-containing heteroaryl optionally substituted with one or more R1.
  • 6. The compound of any one of the preceding claims, wherein one of A and B is a 5-10 membered heteroaryl optionally substituted with one or more R1.
  • 7. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 8. The compound of any one of the preceeding claims, wherein one of A and B is independently selected from
  • 9. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 10. The compound of any one of the preceding claims, wherein one of A and B is independently
  • 11. The compound of any one of the preceding claims, wherein A is selected from
  • 12. The compound of any one of the preceding claims, wherein B is selected from
  • 13. The compound of any one of the preceding claims, wherein A is selected from
  • 14. The compound of any one of the preceding claims, wherein A is
  • 15. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 16. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 17. The compound of any one of the preceding claims, wherein one of A and B is independently
  • 18. The compound of any one of the preceding claims, wherein A is selected from
  • 19. The compound of any one of the preceding claims, wherein B is selected from
  • 20. The compound of any one of the preceding claims, wherein A selected from
  • 21. The compound of any one of the preceding claims, wherein A is
  • 22. The compound of any one of the preceding claims, wherein one of A and B is independently a monocyclic heterocyclyl or bicyclic heterocyclyl, each of which is optionally substituted with one or more R1.
  • 23. The compound of any one of the preceding claims, wherein one of A and B is independently a nitrogen-containing heterocyclyl optionally substituted with one or more R1.
  • 24. The compound of any one of the preceding claims, wherein one of A and B is independently a 4-8 membered heterocyclyl optionally substituted with one or more R1.
  • 25. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 26. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 27. The compound of any one of the preceding claims, wherein one of A and B is
  • 28. The compound of any one of the preceding claims, wherein A is selected from
  • 29. The compound of any one of the preceding claims, wherein B is selected from
  • 30. The compound of any one of the preceding claims, wherein B is selected from
  • 31. The compound of any one of the preceding claims, wherein B is
  • 32. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 33. The compound of any one of the preceding claims, wherein one of A and B is independently selected from,
  • 34. The compound of any one of the preceding claims, wherein one of A and B is
  • 35. The compound of any one of the preceding claims, wherein A is selected from
  • 36. The compound of any one of the preceding claims wherein B is selected from
  • 37. The compound of any one of the preceding claims, wherein B is selected from,
  • 38. The compound of any one of the preceding claims, wherein B is
  • 39. The compound of any one of the preceding claims, wherein one of L1 and L2 is independently absent, —N(R4)C(O)—, or —C(O)N(R4)—.
  • 40. The compound of any one of the preceding claims, wherein each of L1 and L2 is independently absent.
  • 41. The compound of any one of the preceding claims, wherein L1 is —C(O)N(R4)—.
  • 42. The compound of any one of the preceding claims, wherein L2 is absent.
  • 43. The compound of any one of the preceding claims, wherein L1 is —C(O)NH— and L2 is absent.
  • 44. The compound of any one of the preceding claims, wherein at least one of X, Y, and Z is N or N(R3c).
  • 45. The compound of any one of the preceding claims, wherein one of X, Y, and Z is C(R3a) (e.g., CH), and the others of X, Y, and Z are each independently 4N or N(R3c).
  • 46. The compound of any one of the preceding claims, wherein Z and Y are each independently N or N(R3c), and X is C(R3a) (e.g., CH).
  • 47. The compound of any one of the preceding claims, wherein X is C(R3a) (e.g., CH), and Y and Z are each independently N or N(R3c).
  • 48. The compound of any one of the preceding claims, wherein
  • 49. The compound of any one of the preceding claims, wherein
  • 50. The compound of any one of the preceding claims, wherein R3, is C1-C6-alkyl, C2-C6-alkenyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, heteroaryl, wherein each alkyl, alkylene, alkenyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R′.
  • 51. The compound of any one of the preceding claims, wherein the compound of Formula (I) is Formula (I-a):
  • 52. The compound of any one of the preceding claims, wherein the compound of Formula (I) is Formula (I-b):
  • 53. The compound of any one of the preceding claims, wherein the compound of Formula (I) is a compound of Formula (I-c):
  • 54. The compound of claim 52, wherein: A is heteroaryl (e.g., bicyclic heteroaryl) optionally substituted with R1;B is heterocyclyl (e.g., monocyclic heterocyclyl), optionally substituted with one or more R1; andR3c is C1-C6-alkyl, C2-C6-alkenyl, C1-C6-heteroalkyl, C1-C6-haloalkyl, cycloalkyl, heterocyclyl, C1-C6 alkylene-heterocyclyl, aryl, C1-C6 alkylene-aryl, heteroaryl, C1-C6 alkylene-heteroaryl, heteroaryl, wherein each alkyl, alkylene, alkenyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R8;wherein each of R1 and R8 are defined as in claim 1.
  • 55. The compound of any one of the preceding claims, wherein the compound of Formula (I) is a compound of Formula (I-d):
  • 56. The compound of any one of the preceding claims, wherein the compound of Formula (I) is a compound of Formula (I-e):
  • 57. The compound of any one of the preceding claims, wherein the compound is selected from a compound listed in Table 1, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.
  • 58. A compound of Formula (II):
  • 59. The compound of claim 58, wherein each of A and B is independently heteroaryl or heterocyclyl, each of which is optionally substituted with one or more R1.
  • 60. The compound of any one of the preceding claims, wherein one of A and B is independently a monocyclic heteroaryl or bicyclic heteroaryl, each of which is optionally substituted with one or more R1.
  • 61. The compound of any one of the preceding claims, wherein one of A and B is independently a bicyclic heteroaryl optionally substituted with one or more R1.
  • 62. The compound of any one of the preceding claims, wherein one of A and B is independently a nitrogen-containing heteroaryl optionally substituted with one or more R1.
  • 63. The compound of any one of the preceding claims, wherein one of A and B is a 5-10 membered heteroaryl optionally substituted with one or more R1.
  • 64. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 65. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 66. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 67. The compound of any one of the preceding claims, wherein one of A and B is independently
  • 68. The compound of any one of the preceding claims, wherein A is selected from
  • 69. The compound of any one of the preceding claims, wherein B is selected from
  • 70. The compound of any one of the preceding claims, wherein A is selected from
  • 71. The compound of any one of the preceding claims, wherein A is
  • 72. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 73. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 74. The compound of any one of the preceding claims, wherein one of A and B is independently
  • 75. The compound of any one of the preceding claims, wherein A is selected from
  • 76. The compound of any one of the preceding claims, wherein B is selected from
  • 77. The compound of any one of the preceding claims, wherein A selected from
  • 78. The compound of any one of the preceding claims, wherein A is
  • 79. The compound of any one of the preceding claims, wherein one of A and B is independently a monocyclic heterocyclyl or bicyclic heterocyclyl, each of which is optionally substituted with one or more R1.
  • 80. The compound of any one of the preceding claims, wherein one of A and B is independently a nitrogen-containing heterocyclyl optionally substituted with one or more R1.
  • 81. The compound of any one of the preceding claims, wherein one of A and B is independently a 4-8 membered heterocyclyl optionally substituted with one or more R1.
  • 82. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 83. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 84. The compound of any one of the preceding claims, wherein one of A and B is selected from
  • 85. The compound of any one of the preceding claims, wherein A is selected from
  • 86. The compound of any one of the preceding claims, wherein B is selected from
  • 87. The compound of any one of the preceding claims, wherein B is selected from
  • 88. The compound of any one of the preceding claims, wherein B is
  • 89. The compound of any one of the preceding claims, wherein one of A and B is independently selected from
  • 90. The compound of any one of the preceding claims, wherein one of A and B is independently selected from,
  • 91. The compound of any one of the preceding claims, wherein one of A and B is selected from
  • 92. The compound of any one of the preceding claims, wherein A is selected from
  • 93. The compound of any one of the preceding claims, wherein B is selected from
  • 94. The compound of any one of the preceding claims, wherein B is selected from,
  • 95. The compound of any one of the preceding claims, wherein B is selected from
  • 96. The compound of any one of the preceding claims, wherein each of L1 and L2 is independently absent, —N(R3)— (e.g., —N(CH3)—), C6-C12-arylene, —N(R4)C(O)—, or —C(O)N(R4)—, wherein arylene is optionally substituted with one or more R1.
  • 97. The compound of any one of the preceding claims, wherein one of L1 and L2 is independently absent, —N(R4)C(O)—, or —C(O)N(R4)—.
  • 98. The compound of any one of the preceding claims, wherein each of L1 and L2 is independently absent.
  • 99. The compound of any one of the preceding claims, wherein L1 is —C(O)N(R4)—.
  • 100. The compound of any one of the preceding claims, wherein L2 is absent.
  • 101. The compound of any one of the preceding claims, wherein L1 is —C(O)NH— and L2 is absent.
  • 102. The compound of any one of the preceding claims, wherein each of M and P is independently C(R2) (e.g., CH).
  • 103. The compound of any one of the preceding claims, wherein M is C(R2) (e.g., CH) and P is N.
  • 104. The compound of any one of the preceding claims, wherein M is N and P is C(R2) (e.g., CH).
  • 105. The compound of any one of the preceding claims, wherein each of U and W is independently C.
  • 106. The compound of any one of the preceding claims, wherein U is C and W is N.
  • 107. The compound of any one of the preceding claims, wherein U is N and W is C.
  • 108. The compound of any one of the preceding claims, wherein one of X, Y, and Z is C(R3a) (e.g., CH), and the others of X, Y, and Z are each independently N, N(R3c), or S.
  • 109. The compound of any one of the preceding claims, wherein two of X, Y, and Z are independently N or N(R3c).
  • 110. The compound of any one of the preceding claims, wherein X and Y are each independently N or N(R3c), and Z is C(R3a) (e.g., CH).
  • 111. The compound of any one of the preceding claims, wherein X is C(R3a) (e.g., CH), and Y and Z are each independently N or N(R3c).
  • 112. The compound of any one of the preceding claims, wherein two of X, Y, and Z independently is C(R3a) (e.g., CH).
  • 113. The compound of any one of the preceding claims, wherein X is N and Z is S.
  • 114. The compound of any one of the preceding claims, wherein X is N and Y is S.
  • 115. The compound of any one of the preceding claims, wherein
  • 116. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-a):
  • 117. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-c):
  • 118. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-d):
  • 119. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-e):
  • 120. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-f):
  • 121. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-g):
  • 122. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-h):
  • 123. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-i):
  • 124. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-j):
  • 125. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-k):
  • 126. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-l):
  • 127. The compound of any one of the preceding claims, wherein the compound of Formula (II) is Formula (II-m):
  • 128. The compound of any one of the preceding claims, wherein the compound is selected from any one of the compounds shown in Table 1 or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.
  • 129. A pharmaceutical composition comprising a compound of any one of the preceding claims and a pharmaceutically acceptable excipient.
  • 130. The compound of any one of claims 1-128, or the pharmaceutical composition of claim 129, wherein the compound alters a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA).
  • 131. The compound of any one of claims 1-128, or the pharmaceutical composition of claim 129, wherein the compound binds to a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA).
  • 132. The compound of any one of claims 1-128, or the pharmaceutical composition of claim 129, wherein the compound stabilizes a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA).
  • 133. The compound of any one of claims 1-128, or the pharmaceutical composition of claim 129, wherein the compound increases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by qPCR.
  • 134. The compound of any one of claims 1-128, or the pharmaceutical composition of claim 129, wherein the compound decreases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by qPCR %.
  • 135. A method of forming a complex comprising a component of a spliceosome (e.g., a major spliceosome component or a minor spliceosome component), a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA), and a compound of Formula (I) or (II) or a composition thereof according to any one of claims 1-129: comprising contacting the nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) with a compound of Formula (I) or (II).
  • 136. The method of claim 135, wherein the component of a spliceosome is recruited to the nucleic acid in the presence of the compound of Formula (I) or (II).
  • 137. A method of altering the conformation of a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) comprising contacting the nucleic acid with a compound of Formula (I) or (II) according to any one of claims 1-128, or the pharmaceutical composition of claim 129.
  • 138. The method of claim 137, wherein the altering comprises forming a bulge in the nucleic acid.
  • 139. The method of claim 137, wherein the altering comprises stabilizing a bulge in the nucleic acid.
  • 140. The method of claim 137, wherein the altering comprises reducing a bulge in the nucleic acid.
  • 141. The method of any one of any one of claims 137-140, wherein the nucleic acid comprises a splice site.
  • 142. A method for treating a disease or disorder in a subject comprising administering to the subject a compound of Formula (I) or (II) according to any one of claims 1-128 or the pharmaceutical composition of claim 129.
  • 143. The method of claim 142, wherein the disease or disorder comprises a proliferative disease (e.g., cancer, a benign neoplasm, or angiogenesis).
  • 144. The method of any one of claims 142-143, wherein the proliferative disease is cancer.
  • 145. The method of any one of claims 142-143, wherein the proliferative disease comprises adenoid cystic carcinoma, colorectal cancer, leukemia, lung cancer, prostate cancer, breast cancer, or ovarian cancer
  • 146. The method of claim 142, wherein the disease or disorder comprises a neurological disease or disorder, autoimmune disease or disorder, immunodeficiency disease or disorder, lysosomal storage disease or disorder, cardiovascular disease or disorder, metabolic disease or disorder, respiratory disease or disorder, renal disease or disorder, or infectious disease.
  • 147. The method of claim 146, wherein the disease or disorder comprises a neurological disease or disorder.
  • 148. The method of claim 146, wherein the disease or disorder comprises Huntington's disease.
CLAIM OF PRIORITY

This application claims priority to U.S. Application No. 63/238,691, filed on Aug. 30, 2021; U.S. Application No. 63/238,694, filed on Aug. 30, 2021; U.S. Application No. 63/282,906, filed on Nov. 24, 2021; U.S. Application No. 63/283,132, filed on Nov. 24, 2021; U.S. Application No. 63/393,205, filed on Jul. 28, 2022; and U.S. Application No. 63/393,206, filed on Jul. 28, 2022. The disclosure of each of the foregoing applications is incorporated herein by reference in its entirety.

PCT Information
Filing Document Filing Date Country Kind
PCT/US2022/075684 8/30/2022 WO
Provisional Applications (6)
Number Date Country
63393205 Jul 2022 US
63393206 Jul 2022 US
63283132 Nov 2021 US
63282906 Nov 2021 US
63238691 Aug 2021 US
63238694 Aug 2021 US