COMPOUNDS AND METHODS FOR TREATING FIBROTIC PATHOLOGIES

Abstract
The present application provides methods for treating or preventing diseases and conditions associated with tissue fibrosis.
Description
SEQUENCE LISTING

This application contains a Sequence Listing that has been submitted electronically as an XML file named 07039-1920002_SL_ST26.xml. The XML file, created on Feb. 13, 2022, is 48,550 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.


TECHNICAL FIELD

This invention relates to compounds (e.g., isochromane compounds) that inhibit YAP/TAZ in fibroblasts and are useful in treating diseases and conditions associated with tissue fibrosis.


BACKGROUND

Tissue fibrosis across all organs affects a vast population of people. In the U.S. alone over half a million people are affected by liver (>400k) and lung (>100k) fibrosis. These diseases remain very challenging to treat clinically. In examples such as idiopathic pulmonary fibrosis (IPF) and scleroderma, therapeutic options are extremely limited. In fact, for this group of diseases, the five year survival rate can be as bleak as many late stage aggressive cancers.


SUMMARY

Tissue fibrosis is characterized by uncontrolled deposition and diminished clearance of fibrous connective tissue proteins, and ultimately leads to fatal, end-stage organ scarring. Yes-associated protein 1 (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ) play a role in the mesenchymal cell activation that drives tissue fibrosis (Refs. 1-4). YAP and TAZ are downstream transcriptional effectors of multiple pro-fibrotic stimuli in mesenchymal cells (See e.g., Ref. 5), and their expression in other cells and tissues is essential to regeneration and homeostasis (See e.g., Ref. 6), complicating efforts to target them therapeutically (See e.g., Ref. 7).


In one general aspect, the present application provides methods for inhibiting YAP and TAZ in mesenchymal cells via GPCR agonism. The data presented herein demonstrates the efficacy of this approach in murine models of lung and liver fibrosis. Gαs-coupled dopamine receptor D1 is preferentially expressed in lung and liver mesenchymal cells relative to other major resident cells of these organs. Agonism of the D1 receptor selectively inhibits YAP/TAZ function in mesenchymal cells, and shifts their phenotype in a YAP/TAZ dependent fashion from pro-fibrotic to fibrosis-resolving, effectively reversing in vitro extracellular matrix accumulation and stiffening and reversing in vivo tissue fibrosis. This finding demonstrates a cell-selective approach to inhibiting a target that drives tissue fibrosis, and establishes Gαs agonism as a strategy for generating a fibrosis-resolving mesenchymal phenotype.


In one general aspect, the present application provides a compound of Formula (I):




embedded image


or a pharmaceutically acceptable salt thereof, wherein R1 and R3 are as described herein. In another general aspect, the present disclosure provides a compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt thereof, wherein R1, R2, R3, R4 and R5 are as described herein.


In another general aspect, the present disclosure provides a compound of Formula (III):




embedded image


or a pharmaceutically acceptable salt thereof, wherein X1, R1, R3, and R4 are as described herein. In another general aspect, the present disclosure provides a compound of Formula (IV):




embedded image


or a pharmaceutically acceptable salt thereof, wherein X1, X2, R1, R2, R4 and R5 are as described herein.


In another general aspect, the present disclosure provides a pharmaceutical composition comprising a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.


In another general aspect, the present application provides a method of agonizing a GαS protein coupled receptor in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of promoting YAP/TAZ phosphorylation in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of inhibiting YAP/TAZ function in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of inhibiting expression of a profibrotic gene in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of reducing nuclear localization of YAP/TAZ in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of inhibiting expressing of α-smooth muscle actin (αSMA) in a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of inhibiting extra-cellular matrix production and deposition by a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In another general aspect, the present application provides a method of enhancing extra-cellular matrix degradation by a cell, the method comprising contacting the cell with an effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof.


In yet another general aspect, the present application provides a method of treating or preventing a fibrotic pathology, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of the Formulae described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same.


Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. Methods and materials are described herein for use in the present application; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.


Other features and advantages of the present application will be apparent from the following detailed description and figures, and from the claims.





DESCRIPTION OF DRAWINGS


FIG. 1 contains a schematic representation of molecular mechanism by which transcription factor YAP/TAZ promotes tissue fibrosis. YAP/TAZ nuclear localization and activity is mediated by multiple profibrotic signaling pathways. Activation of the D1 dopamine receptor inhibits nuclear localization and activity of YAP/TAZ in fibroblasts.



FIG. 2 contains a scheme showing that Gαs-coupled Dopamine Receptor D1 is selectively expressed in pulmonary fibroblasts. The scheme shows regulation of YAP/TAZ transcription co-factor activity by GPCR signaling. Receptors which couple to Gαs elevate CAMP and induce phosphorylation of YAP/TAZ which blocks nuclear localization. Receptors which couple to Galphα/q/12 promote nuclear localization and activity of YAP/TAZ, e.g., through Rho-kinase (ROCK).



FIG. 3 contains a line plot showing GPCR expression profiling of cultured human alveolar epithelial cells and normal human pulmonary fibroblasts. Dopamine Receptor D1 (DRD1) transcripts are highly expressed in fibroblasts and not detected in epithelial cells. Red points indicate GPCRs which selectively couple to Gαs. Orange diagonal line indicates 10-fold preferential expression, blue line 100-fold.



FIG. 4 contains a bar graph showing DRD1 expression in cultured non-IPF associated fibroblasts, IPF patient-derived fibroblasts, normal human alveolar epithelial cells (NHAEpC), and normal human microvasculature endothelial cells (NHMVEC), passage 6 or less. NHAEpC and NHMVEC, n=2. non-IPF FB and IPF FB, n=6.



FIG. 5 shows expression of DRD1 in freshly isolated mouse lung fibroblasts (FB), epithelial (EpC), endothelial cells (EC), and leukocytes (Leuk). Lung from a healthy COL1A1-GFP expressing mouse was enzymatically digested then sorted for markers of fibroblasts (GFP+, CD140a+), epithelial cells (CD326+), endothelial cells (CD31+), and leukocytes (CD45+) followed by RNA isolation to validate selective populations and expression of Drd1.



FIG. 6 shows that dopamine Receptor D1 agonism blocks YAP/TAZ nuclear localization. Selective agonists of dopamine receptor D1 with varying efficacy inhibit YAP/TAZ nuclear localization; this effect can be overcome by treatment with a DRD1 receptor antagonist (SCH 39166, 3 μM), (Dihydrexidine, 10 μM). IMR-90 cells treated 2 hours prior to fixation. N=4 (****p<0.0001 vs. 0.1% DMSO vehicle control). Scale bar represents 100 μm.



FIG. 7 shows that, consistent with DRD1 expression, D1 agonist (e.g., DHX) inhibits YAP/TAZ only in fibroblasts (IPF-FBs) but not in epithelial (NHEpCs) or endothelial (NHMVECs) cells. N=4 (****p<0.0001 vs. 0.1% DMSO vehicle control)



FIG. 8 shows that YAP/TAZ localization is induced through multiple ligands which stimulate receptors coupled to Galphαi/q/12, endothelin 1 (ET-1:100 nM), lysophosphatidic acid (LPA: 10 μM), and serotonin (5-HT: 1 μM). In each case DHX treatment (10 μM) can reverse this effect on YAP/TAZ. IMR-90 cells plated densely onto plastic cell culture plates for 24 hours in media containing 0.1% FBS, treated for 2 hours prior to fixation. N=4 (****p<0.0001 vs. 0.1% DMSO vehicle control), (++++p<0.0001 vs. the respective stimulated agonist ET-1, LPA, or 5-HT). Scale bar represents 100 μm.



FIG. 9 contains a bar graph showing cAMP measured in IPF patient-derived fibroblasts treated for 20 minutes with DHX (10 μM) +/−SCH 39166 (3 μM). N=3 (** p<0.01 vs. 0.1% DMSO vehicle control).



FIG. 10 shows phosphorylation of YAP by Rho-kinase inhibitor Y27632 (20 μM), direct cAMP stimulator Forskolin (10 μM), or DHX (10 μM). IMR-90 cells cultured for 24 hours in media containing 0.1% FBS, treated 2 hours prior to fixation. N=3 (***p<0.001 vs. 0.1% DMSO vehicle control).



FIG. 11 shows that D1 agonist (e.g., DHX) reverses fibroblast matrix deposition, contraction and stiffening. DHX blocks profibrotic gene expression in IPF patient-derived fibroblasts. Genes which encode Connective tissue growth factor (CTGF), Collagen I (COL1A1), αSMA (ACTA2), and Fibronectin (FN1) are reduced by 24 hour treatment with DHX (10 μM), +/−SCH 39166 (3 μM). N=3 (****p<0.0001, ***p<0.001, *p<0.05 vs. 0.1% DMSO vehicle control)



FIG. 12 shows that D1 agonist (e.g., DHX) reverses TGFβ-induced αSMA+ stress fiber formation. IMR-90 cells pre-stimulated with 2 ng/ml TGFβ for 48 hours and then treated with DHX (10 μM)+2 ng/ml TGFβ for an additional 24 hours prior to fixation. Cells which are positive for αSMA were quantified by a blinded investigator and noted in the bottom right corner, a minimum of 300 cells in each experiment were quantified. N=3.



FIG. 13 shows that D1 agonist (e.g., DHX) reverses TGFβ-induced extracellular matrix accumulation. IPF patient-derived fibroblasts grown at confluence were pre-stimulated with 2 ng/mL TGFβ for 48 hours and then treated with DHX (10 μM)+2 ng/ml TGFβ for an additional 24 hours prior to fixation. Cell derived matrix is measured using antibodies for Collagen I and Fibronectin. N=3 (****p<0.0001, ***p<0.001, **p<0.01 vs. 0.1% DMSO vehicle control)



FIG. 14 shows that D1 agonist (e.g., DHX) attenuates IPF patient-derived fibroblast contractility measured by traction force microscopy. Representative traction maps are shown from cells plated onto 6.4 kPa matrices treated with the indicated concentration of DHX. RMS tractions were determined in two independent experiments; box and whisker plots show min to max, quartile, and mean from one representative experiment (****p<0.0001, *p<0.05 vs. 0.1% DMSO vehicle control).



FIG. 15 shows that D1 agonist (e.g., DHX) reverses extracellular matrix stiffening. NIH-3T3 cells plated onto gelatin-coated tissue culture plates stimulated to deposit matrix with 2 ng/ml TGFβ and 20 μM ascorbic acid for 72 hours prior to AFM microindentation analysis to measure stiffness (elastic modulus). The same dishes were then treated +/−10 μM DHX in the same media for another 72 hours and AFM analysis. The matrices were decellularized and passage 3 NHLFs were plated onto the matrices; after 24 hours RNA was collected and expression of profibrotic genes was analyzed. AFM analysis N=2. 75 indentation measurements were made for each plate. The box and whisker plots show min to max, quartile, and mean from one representative experiment (****p<0.0001 vs. 0.1% DMSO vehicle control) (++p<0.01, +p<0.05 vs. the same culture plate after the first 72 hour incubation). Measurement of RNA from cell plated onto decellularized matrices N=3. (*p<0.05 vs. 0.1% DMSO vehicle control).



FIG. 16 shows that D1 agonist (e.g., DHX) modulates matrix deposition vs. matrix degradation gene program. IPF patient-derived fibroblasts cultured in media containing 0.1% FBS were stimulated for 24 hours with 2 ng/ml TGFβ and 10 μM DHX prior to RNA isolation. Genes which encode for ECM crosslinking: transglutaminase 2 (TGM2), lysyl oxidase and lysyl oxidase-like enzymes (LOX and LOXL1-4), ECM degradation: uPA (PLAU), tPa (PLAT), cathepsin K (CTSK), and matrix metalloprotease-14 (MMP14) and ECM protease inhibitors: metalloprotease inhibitor 3 (TIMP3), and plasminogen activator inhibitor 1 (SERPINE1) were measured. N=3. (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05 vs. 0.1% DMSO vehicle control non-TGFβ treated), (++++p<0.0001, ++p<0.01, +p<0.05 vs. 0.1% DMSO vehicle control TGFβ treated).



FIG. 17 shows that D1 agonist (e.g., DHX) therapeutically reverses bleomycin-induced pulmonary fibrosis. Weight change as a result of bleomycin induced lung injury and DHX therapeutic benefit. Female mice were intratracheally administered Bleomycin on Day 0; treatment was initiated on Day 10 (5 mg/kg DHX i.n., daily) and continued until day 24.



FIG. 18 shows H&E staining to visualize collagen and architectural changes. Paraffin embedded lung sections were stained and analyzed in a blinded fashion by a pulmonary pathologist and scored using the Ashcroft method.



FIG. 19 shows results of hydroxyproline assay to measure collagen deposition in the lungs. Snap frozen lung tissue was biochemically analyzed for collagen abundance using the hydroxyproline assay.



FIG. 20 contains immunofluorescence imaging of lung sections for αSMA and Yap/Taz. Lung sections were stained immune-probed for αSMA and Yap/Taz. Cells which were double positive for both αSMA and Yap/Taz were quantified using automated software.



FIG. 21 shows changes in pro-fibrotic gene expression, Yap and Taz (Wwtr1) in whole lung homogenates. Sham Control N=15, Bleo Control N=17, and Bleo DHX N=17. (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05 vs. Sham Control) (++p<0.01, +p<0.05 vs. the respective Bleo Control).



FIG. 22 shows that intratracheally administered YAP/TAZ siRNA worsens bleomycin induced lung injury and fibrosis. Mice were administered bleomycin on Day 0 and then intratracheally administered siRNA for Yap and Taz on Day 14. On Day 21 BAL fluid was collected and lungs were harvested for analysis. Yap/Taz siRNA enhanced collagen deposition. Sham treated mice N=4, Bleo treated mice N=6 (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05 vs. Sham NT-siRNA).



FIG. 23A contains images of lungs treated with bleomycin and YAP/TAZ siRNA. FIG. 23B contains a bar graph showing weight of sham-and bleo-treated lungs. FIG. 23C contains a bar graph showing total BAL fluid protein in sham-and bleo-treated lungs.



FIG. 24 shows that D1 agonist (e.g., DHX) inhibits YAP/TAZ localization in fibroblasts from multiple tissues. Mesenchymal cells derived from lung (IMR-90 and IPF-FBs) hepatic stellate cells (HSC), human adult cardiac fibroblasts, (HACF) and human dermal fibroblasts (HDF) were plated densely (Confluent) or sparsely (Control and all remaining conditions) onto plastic cell culture plates for 24 hours in media containing 0.1% FBS, treated for 2 hours with Rho kinase inhibitor Y27632, adenylate cyclase activator forskolin and DHX. N=4, Cells that were positive for nuclear YAP/TAZ were quantified by automated image analysis.



FIG. 25 shows time course for D1 agonist (e.g., DHX) inhibition of YAP/TAZ nuclear localization. IMR-90 cells, N=3 (***p<0.001 vs. 0.1% DMSO vehicle control).



FIG. 26 shows that D1 agonist (e.g., DHX) does not lose potency in IPF derived fibroblasts, unlike PGE2. N=3.



FIG. 27 shows that D1 agonist (e.g., DHX) inhibits pro-fibrotic gene expression through DRD1 agonism. siRNA treatment to knockdown DRD1.



FIG. 28 shows reduced D1 agonist (e.g., DHX)-mediated inhibition of YAP/TAZ nuclear localization and pro-fibrotic gene expression in DRD1-siRNA treated cells. IMR-90 cells transfected with siRNA targeting DRD1 or NT siRNA for 72 hours prior to 2 hour (b) or 24 hour (c) treatment with DHX. N=2 for all (****p<0.0001, **p<0.01, *p<0.05 vs. NTsiRNA).



FIG. 29 shows that D1 agonist (e.g., DHX) inhibition of pro-fibrotic gene expression and matrix deposition requires inhibition of YAP/TAZ. DHX does not inhibit pro-fibrotic gene expression when fibroblasts express a constitutively active mutant TAZ (TAZASA). TAZ4SA expression was induced with 100 ng/ml doxycycline for 72 hours prior to treatment with 10 μM or the indicated concentration of dihydrexidine. For gene expression experiments efficacy of DHX in NIH-3T3 cells was validated with by DHX (10 μM) effect on TGFβ (24 hour, 2 ng/ml) induced gene expression. N=2 for all.



FIG. 30 shows that D1 agonist (e.g., DHX) inhibition of pro-fibrotic gene expression and matrix deposition requires inhibition of YAP/TAZ. DHX does not inhibit ECM deposition when fibroblasts express a constitutively active mutant TAZ (TAZASA). TAZASA expression was induced with 100 ng/mL doxycycline for 72 hours prior to treatment with 10 μM or the indicated concentration of dihydrexidine. For gene expression experiments efficacy of DHX in NIH-3T3 cells was validated with by DHX (10 μM) effect on TGFβ (24 hour, 2 ng/ml) induced gene expression. N=2 for all.



FIG. 31 shows that D1 agonist (e.g., DHX) alone does not affect lung matrix content or profibrotic gene expression. In normal healthy mice DHX did not alter body weight. n=6 mice per group.



FIG. 32 shows that in normal healthy mice D1 agonist (e.g., DHX) did not alter lung histology n=6 mice per group.



FIG. 33 shows that in normal healthy mice D1 agonist (e.g., DHX) did not alter lung collagen deposition. n=6 mice per group.



FIG. 34 shows that in normal healthy mice D1 agonist (e.g., DHX) did not alter expression of Ctgf, Col1a1, Acta2, and Fn1. n=6 mice per group.



FIG. 35 shows that D1 agonist (e.g., DHX) reverses hepatic stellate cell activation and in vivo hepatic fibrosis. DRD1 is preferentially expressed in cultured human hepatic stellate cells (HSCs): ACTA2, PDGFRA positive, relative to cultured human hepatocytes (Heps): ALB positive. N=1.



FIG. 36 shows that D1 agonist (e.g., DHX) inhibits TGFβ-mediated hepatic stellate cell activation in vitro. HSCs were stimulated with TGFβ for 48 hours +/−DHX (10 μM) prior to total protein isolation and western blot analysis of αSMA and Fibronectin. N-3 (***p<0.001, **p<0.01, *p<0.05 vs. Control+TGFβ).



FIG. 37 shows that D1 agonist (e.g., DHX) reverses bile duct ligation (BDL)-mediated fibrosis in vivo measured by trichrome staining. Sham Control N=5, BDL Control N=7, and BDL DHX N=8 (**p<0.01 vs. BDL Control).



FIG. 38 shows that D1 agonist (e.g., DHX) reverses Bile duct ligation (BDL) mediated fibrosis in vivo measured by hydroxyproline. Sham Control N=5, BDL Control N=7, and BDL DHX N=8 (**p<0.01 vs. BDL Control).



FIG. 39 shows that YAP phosphorylation blocks nuclear localization of pYAP.



FIG. 40 shows that D1 receptor agonists targeting the same receptor and having diverse structures produce similar effect.



FIG. 41 shows that YAP inactivation by D1 agonist (e.g., DHX) are based on D1 receptor activity.



FIG. 42 shows that D1 receptor agonist reduces expression of multiple profibrotic genes in fibroblasts from patients with IPF.



FIG. 43 shows that D1 receptor agonist (e.g., DHX) selectively slows proliferation in IPF fibroblasts. IPF fibroblast and Normal lung fibroblast co-culture proliferation. Cell are prelabelled with fluorescent dyes (red and green) and then cocultured at a ratio of about 1:1 in 96 well plates. Cell counts are determined every 24 hours and plotted as a ratio of IPF/HLF cells. In the control wells the IPF cells outgrow and take over the well. N=2.



FIG. 44 shows that YAP/TAZ are necessary for matrix stiffness-dependent fibroblast activation.



FIG. 45 shows that mutant YAP/TAZ are active on soft matrices in NIH 3T3 fibroblasts.



FIG. 46 shows that YAP/TAZ confer fibrogenic potential in vivo.



FIG. 47 shows that global YAP/TAZ targeting is not viable.



FIG. 48 shows Western blot protein expression of the D1 dopamine receptor from IPF patient derived fibroblasts, normal human alveolar epithelial cells (NHAEpC), and normal human microvasculature endothelial cells. NHAEpC and NHMVEC, N=2. non-IPF FB and IPF FB, N=3 different donor lines.



FIG. 49 shows GPCR expression profiling of primary cultured human pulmonary microvascular endothelial cells and normal human pulmonary fibroblasts. Red points indicate GPCRs that selectively couple to Gαs. Blue lines indicate 100-fold preferential expression. Prostaglandin receptors PTGER2 and PTGDR (red points directly above DRD1) were also selectively expressed in fibroblasts vs. endothelial cells, however both of these receptors were highly expressed in epithelial cells.



FIG. 50A shows that dopamine receptor D1 agonism blocks YAP/TAZ nuclear localization. D1 receptor selective agonists inhibit YAP/TAZ nuclear localization. IPF patient-derived lung fibroblasts cells treated 2 hours prior to fixation with diverse dopaminergic agonists (10 μM). N=4 different patient samples. % nuclear localization of YAP/TAZ was determined using automated imaging software. Scale bar represents 100 μm.



FIG. 50B shows cAMP measured in IPF patient-derived fibroblasts treated for 20 minutes with D1 receptor agonist (e.g., DHX). N=3.



FIG. 50C shows that D1 receptor agonist (e.g., DHX) inhibits YAP/TAZ nuclear localization in fibroblasts from multiple organs: hepatic stellate cells (HSC), human adult cardiac fibroblasts (HACFs), and human dermal fibroblasts (HDFs) but not in lung alveolar epithelial (NHAEp) or endothelial (NHMVE) cells. N=3 (****p<0.0001 vs. 0.1% DMSO vehicle control).



FIG. 51 shows that D1 receptor agonist (e.g., DHX) reverses fibroblast matrix deposition, contraction and stiffening. D1 receptor selective agonists inhibit fibroblast activation (Representative image: 1 μM dihydrexidine (DHX). IPF patient-derived lung fibroblasts cells treated for 72 hours prior to fixation with a library of diverse, mixed selectivity dopaminergic agonists (1 μM)+TGFβ. N=4 different patient samples. αSMA intensity was determined using automated imaging software. Scale bar represents 100 μm.



FIG. 52 shows that D1 receptor agonist (e.g., DHX) attenuates IPF fibroblast contractility measured by traction force microscopy. (****p<0.0001, *p<0.05 vs. 0.1% DMSO vehicle control).



FIG. 53 shows that D1 receptor agonist (e.g., DHX) reverses extracellular matrix accumulation. IPF patient-derived fibroblasts pre-stimulated with 2 ng/ml TGFβ for 48 hours, then treated with DHX+2 ng/mL TGFβ for additional 24 hours. N=3 (****p<0.0001, ***p<0.001, **p<0.01 vs. 0.1% DMSO vehicle control)



FIG. 54 shows that D1 receptor agonist (e.g., DHX) and YAP/TAZ siRNA modulate matrix crosslinking and degradation gene programs. IPF fibroblasts treated 24 hours with 2 ng/ml TGFβ+/−10 μM DHX or YAP and TAZ siRNA (>90% knockdown). N=3. Heat map indicates % change relative to unstimulated controls.



FIG. 55 shows that D1 receptor agonist (e.g., DHX) reverses extracellular matrix stiffening. IPF patient derived fibroblasts and their cell-derived matrices were characterized by AFM microindentation using a spherical tip after 72 hours, then treated +/−10 μM DHX in matrix deposition media for additional 72 hours and re-characterized. N=5 different patient samples. (*p<0.05 vs. 0.1% DMSO vehicle control).



FIG. 56 shows that DHX selectively blocks expression of YAP/TAZ target genes in lung fibroblasts in vivo. Two groups of mice were injured intratracheally with bleomycin at day 0, on day 10 one group received two doses of DHX (2 and 24 hours prior to collecting lungs) and the other received vehicle control. On day 11 lungs were collected to flow sort fibroblasts, epithelial, and endothelial cells.



FIG. 57 shows that changes in RNA expression of YAP/TAZ target genes from freshly isolated cells.



FIG. 58A shows that DRD1 agonism selectively blocks localization and activity of YAP/TAZ in lung fibroblasts. IPF derived lung fibroblasts, lung alveolar epithelial (NHAEp) and endothelial (NHMVE) cells were treated for 2 hours with DRD1 selective agonist (e.g., DHX)



FIG. 58B shows results of an experiment where IPF derived lung fibroblasts, lung alveolar epithelial (NHAEp) and endothelial (NHMVE) cells were treated for 24 hours with DRD1 selective agonist prior to RNA isolation and measurement of YAP/TAZ target genes. N=2 technical replicates.


FIG. 58C shows results of an experiment where IPF derived lung fibroblasts, lung alveolar epithelial (NHAEp) and endothelial (NHMVE) cells were treated for 2 hours with butaprost (EP2 receptor agonist). DRD1 receptor is only expressed in fibroblasts while EP2 receptor, which also elevates cAMP, is expressed in all three cell types.



FIG. 58D shows results of an experiment where IPF derived lung fibroblasts, lung alveolar epithelial (NHAEp) and endothelial (NHMVE) cells were treated for 24 hours with butaprost (EP2 receptor agonist) prior to RNA isolation and measurement of YAP/TAZ target genes. N=2 technical replicates.



FIG. 59A shows that D1 receptor agonist (e.g., DHX) activity is dependent on DRD1 receptor.



FIG. 59B shows that D1 receptor agonist (e.g., DHX) activity is dependent on DRD1 receptor.



FIG. 59C shows that DRD1 siRNA treatment blocks DHX's elevation of cAMP. N=3, IMR-90 lung fibroblasts.



FIG. 59D shows that DRD1 siRNA treatment blocks inhibition of YAP/TAZ nuclear localization. N=3, IMR-90 lung fibroblasts.



FIG. 59E shows that DRD1 siRNA treatment inhibition of YAP/TAZ target genes. N=3, IMR-90 lung fibroblasts.



FIG. 59F shows that dopamine receptor D1 antagonists SCH-39166 and LE-300 block DHX's elevation of cAMP. N=3, IMR-90 lung fibroblasts.



FIG. 59G shows that dopamine receptor D1 antagonists SCH-39166 and LE-300 block DHX's inhibition of YAP/TAZ nuclear localization. N=3, IMR-90 lung fibroblasts.



FIG. 59H shows that dopamine receptor D1 antagonists SCH-39166 and LE-300 block DHX's inhibition of YAP/TAZ target genes. N=3, IMR-90 lung fibroblasts.



FIG. 60A shows that DHX blocks proliferation and primes lung fibroblasts for apoptosis. Proliferation of lung fibroblasts (IMR-90 cells) measured for 4 days in the presence of GPCR agonists ET-1 (100 nM) and LPA (10 μM)+/−10 μM DHX. Cells were fixed and counted with DAPI at the end of each day. N=3 technical triplicates.



FIG. 60B shows results of an experiment where proliferation of lung fibroblasts (IPF Patient-Derived Lung fibroblasts) measured for 4 days in the presence of GPCR agonists ET-1 (100 nM) and LPA (10 μM)+/−10 μM DHX. Cells were fixed and counted with DAPI at the end of each day. N=3 technical triplicates.



FIG. 60C shows results of an experiment where proliferation of lung fibroblasts (IMR-90 cells) was measured for 4 days in the presence of growth factor TGFβ (2 ng/ml)+/−10 μM DHX. Cells were fixed and counted with DAPI at the end of each day. N=3 technical triplicates.



FIG. 60D shows results of an experiment where proliferation of lung fibroblasts (IPF Patient-Derived Lung fibroblasts) measured for 4 days in the presence of growth factor CTGF (100 ng/mL)+/−10 μM DHX. Cells were fixed and counted with DAPI at the end of each day. N=3 technical triplicates.



FIG. 60E shows results of an experiment where RNA Expression of pro-apoptotic factor BIM was assessed following 24 treatment with DHX (10 μM). N=4. IMR-90 cells.



FIG. 60F shows results of an experiment where RNA Expression of pro-apoptotic factor BIM was assessed following 24 treatment with DHX (10 μM). N=4. IPF Patient-Derived Lung fibroblasts.



FIG. 60G shows results of an experiment where RNA Expression of anti-apoptotic factor BCL2 was assessed following 24 treatment with DHX (10 μM). N=4. IMR-90 cells.



FIG. 60H shows results of an experiment where RNA Expression of anti-apoptotic factor BCL2 was assessed following 24 treatment with DHX (10 μM). N=4. IPF Patient-Derived Lung fibroblasts.



FIG. 61A DOPA decarboxylase is decreased in IPF, and correlates with worsening disease severity. Expression levels for DDC and DRD1 were queried from microarray analyses of IPF (n=134) and control (n=108) lungs. Each data point represents expression levels from an individual. Bars indicate mean and standard deviation.



FIG. 61B shows results of an experiment where western blotting was used to detect DDC protein expression in whole lung homogenates from IPF (n=10) and control (n=11) lungs. Bars indicate mean and standard deviation.



FIG. 61C shows results of an experiment where univariate analysis of the correlation of DDC expression with forced vital capacity (FVC) and diffusing capacity of the lung for carbon monoxide (DLCO) was performed using the Pearson's correlation coefficient (r). Each data point represents expression levels and lung function (expressed a percent predicted based on age, sex and ideal body weight) from an individual. P values are as indicated for each figure panel.



FIG. 62A shows that dopamine promotes anti-fibrotic effects. Dopamine inhibits YAP/TAZ nuclear localization in low density IPF-patient derived fibroblasts plated onto tissue culture plastic. N=2.



FIG. 62B shows that dopamine attenuates IPF fibroblast contractility measured by traction force microscopy. (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05 vs. the indicated group).



FIG. 62C shows that dopamine reverses αSMA+stress fiber formation. IPF-patient derived fibroblasts, pre-stimulated with 2 ng/ml TGFβ for 48 hours, then treated with dopamine (1 μM) +2 ng/ml TGFβ for additional 24 hours. N=4. Scale bar represents 500 μm.



FIG. 63 shows that DRD1 agonism blocks profibrotic gene expression in human dermal fibroblasts. Human dermal fibroblasts treated for 24 hours+/−2 ng/ml TGFβ and D1 agonists: DHX and A68930 prior to RNA isolation. N=2.



FIG. 64 shows that dihydrexidine (DHX) efficacy depends on expression of D1 like dopamine receptors (DRD1, DRD5). IMR-90 lung fibroblasts express higher levels of DRD1 and DRD5 than mesenchymal cells derived from uterine fibroids which results in marginal inhibition of YAP/TAZ nuclear localization by DHX in these cells. ND refers to the gene not being detected.


FIG. 65 contains a bar graph showing nuclear YAP/TAZ/DAPI inhibition by D1 agonists dihydrexidine (DHX), A-68930, (R)-(−)-apomorphine, and R(−)-2,10,11-trihydroxyaporphine. (10 μM) N=4 IPF-patient derived lung fibroblasts.



FIG. 66 contains a line plot showing that compound CTC-3 inhibits YAP/TAZ nuclear localization. Adult lung fibroblasts (N=2) sparsely plated into 96-well plates. Treated for 2 hours with compounds prior to fixing and immunostaining for YAP/TAZ. Imaging and quantification of nuclear YAP/TAZ performed through automation using a Cytation 5 (IC50 is 102 nM).



FIG. 67 contains a line plot showing that compound CTC-6 inhibits YAP/TAZ nuclear localization. Adult lung fibroblasts (N=2) sparsely plated into 96-well plates. Treated for 2 hours with compounds prior to fixing and immunostaining for YAP/TAZ. Imaging and quantification of nuclear YAP/TAZ performed through automation using a Cytation 5 (IC50 is 62 nM).



FIG. 68 contains a line plot showing that compound CTC-3 inhibits fibroblast proliferation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/mL TGFβ and compounds at the indicated concentration. Proliferation determined by fixing and counting DAPI nuclei using a Cytation 5. N=2.



FIG. 69 contains a line plot showing that compound CTC-6 inhibits fibroblast proliferation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/mL TGFβ and compounds at the indicated concentration. Proliferation determined by fixing and counting DAPI nuclei using a Cytation 5. N=2.



FIG. 70 contains a line plot showing that compound CTC-3 inhibits fibroblast activation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/ml TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of αSMA intensity performed through automation using a Cytation 5. (IC50 is 0.3 μM).



FIG. 71 contains a line plot showing that compound CTC-6 inhibits fibroblast activation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/ml TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of αSMA intensity performed through automation using a Cytation 5. (IC50 is 0.1 μM).



FIG. 72 contains a line plot showing that compound CTC-3 inhibits Collagen I deposition. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/ml TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of Collagen I intensity performed through automation using a LI-COR Odyssey. (IC50 is 0.7 μM).



FIG. 73 contains a line plot showing that compound CTC-6 inhibits Collagen I deposition. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/mL TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of Collagen I intensity performed through automation using a LI-COR Odyssey. (IC50 is 0.4 μM).



FIG. 74 contains a line plot showing that compound CTC-1 inhibits YAP/TAZ nuclear localization. Adult lung fibroblasts (N=2) sparsely plated into 96-well plates. Treated for 2 hours with compounds prior to fixing and immunostaining for YAP/TAZ. Imaging and quantification of nuclear YAP/TAZ performed through automation using a Cytation 5 (IC50 is 285 nM).



FIG. 75 contains a line plot showing that compound CTC-2 inhibits YAP/TAZ nuclear localization. Adult lung fibroblasts (N=2) sparsely plated into 96-well plates. Treated for 2 hours with compounds prior to fixing and immunostaining for YAP/TAZ. Imaging and quantification of nuclear YAP/TAZ performed through automation using a Cytation 5 (IC50 is 490 nM).



FIG. 76 contains bar graphs showing inhibition of profibrotic gene expression by compounds CTC-1 and CTC-2. IMR-90 lung fibroblasts, treated for 24 hours with the indicated concentration of compound. N=3.



FIG. 77A contains structure and YAP/TAZ inhibition efficacy of dihydrexidine (“DHX”). Human lung fibroblasts were treated for 2 hours with the indicated concentration of dihydrexidine prior to imaging and quantifying YAP/TAZ localization.



FIG. 77B contains an image of fried eggs model of predicted BBB penetration for DHX using TPSA and WLOGP properties. Compounds which fit into the “yolk” are predicted to enter the CNS. These predictions correlate with in vitro models of BBB penetration.



FIG. 78 contains structures and efficacy data for phenyl containing analogs of A-68930. Potency and Efficacy of 3-substituted A-68930 analogs. Measurements were obtained using gold-fish retina or rat striatum, per U.S. Pat. No. 5,621,133.



FIG. 79 contains comparative YAP/TAZ nuclear localization inhibition between A-68930 and D1 agonists of the present disclosure. Adult lung fibroblasts (N=2) sparsely plated into 96-well plates. Treated for 2 hours with compounds prior to fixing and immunostaining for YAP/TAZ. Imaging and quantification of nuclear YAP/TAZ performed through automation using a Cytation 5. A-68390 was tested as an optically pure stereoisomer. CTC-3 and CTC-6 are both 1:1 mixtures of active and inactive stereoisomers (the observed potency is 2-fold higher). The major drawback of A-68930 is it lacks full efficacy to elevate cAMP.



FIG. 80 contains line plots efficacy of CTC-6 in vitro. A. Dose-response curve for CTC-6 inhibiting YAP/TAZ localization in lung fibroblasts. B. Human lung fibroblasts were stimulated for 4 days with 2 ng/ml TGFβ and cell number was measured daily by counting DAPI nuclei from fixed cells treated with the indicated concentration of CTC-6. C. Expression of αSMA intensity measured by immunocytochemistry. D. Collagen deposition measured using a “in-cell Western blot” technique developed by our group. Important to note: these data were collected using a racemic mixture of CTC-6. The active stereoisomer is 2-fold more potent that the inactive stereoisomer.



FIG. 81A contains fried eggs model of predicted BBB penetration using TPSA and WLOGP properties. Compounds which fit into the “yolk” are predicted to enter the CNS. DHX and CTC-6 are plotted along with the other compounds of the present disclosure.



FIG. 81B contains fried eggs model of predicted BBB penetration using TPSA and WLOGP properties. Compounds which fit into the “yolk” are predicted to enter the CNS. A-68930 and CTC-6 are plotted along with the other compounds of the present disclosure.



FIG. 82 contains compound structures and data from cyclohexane and cyclooctane derivatives of DHX. Potency appears to be maintained and the efficacy is dramatically increased in the cycloctane. Measurements were obtained using gold-fish retina or rat striatum according to published patent and manuscript.



FIG. 83 contains a fried eggs model of predicted BBB penetration using TPSA and WLOGP properties for the compounds of example 9 having various heterocyclis in position R1 of Formula (I).



FIG. 84 shows compounds having dinapsoline/A-68930 hybrid scaffold (3), which is more potent than DHX and more efficacious than A-68930. Dinapsoline/A-68930 hybrid scaffolds were previously described by a group at Purdue University in 2010. This hybrid is ˜6× more potent than DHX and shows full efficacy at elevating cAMP.



FIG. 85 shows fried eggs model of predicted BBB penetration using TPSA and WLOGP properties of compound of Example 2. Chemical structure of the compound is also shown.



FIG. 86 shows that dinapsoline and dinoxyline display similar D1 binding affinity as dihydrexidine. Not shown in the figure, all three compounds produced full magnitude cAMP response (full efficacy) in published manuscripts. Dinapsoline (DNS) and dinoxyline (DNX) are dihydrexidine (DHX) framework mimics discovered in the late 1990s and early 2000s by the same group from Purdue University



FIG. 87 shows fried eggs model of predicted BBB penetration using TPSA and WLOGP properties of compound of Example 1 and dinapsoline (DNS), dinoxyline (DNX), and dihydrexidine (DHX). Chemical structure of the compound of example 1 is also shown.



FIG. 88 contains line plots showing % nuclear YAP/TAZ for compound CTC-3 in human lumng fibroblasts and human alveolar epithelial cells.



FIG. 89 contains line plots showing % nuclear YAP/TAZ for compound CTC-6 in human lumng fibroblasts and human alveolar epithelial cells.



FIG. 90 contains chemical structure of compound 1 and also contains a line plot showing that compound 1 inhibits fibroblast proliferation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/mL TGFβ and compounds at the indicated concentration. Proliferation determined by fixing and counting DAPI nuclei using a Cytation 5. N=2.



FIG. 91A contains a line plot showing that compound 1 inhibits fibroblast activation. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/ml TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of αSMA intensity performed through automation using a Cytation 5.



FIG. 91B contains a line plot showing that compound 1 inhibits Collagen I deposition. Adult lung fibroblasts plated into 96-well plates, stimulated with 2 ng/ml TGFβ for 96 hours and treated with the indicated concentration of compounds every 48 hours. Imaging and quantification of Collagen I intensity performed through automation using a LI-COR Odyssey.



FIG. 92A shows in vitro efficacy of compound 1 (MS-9). Human lung fibroblasts and alveolar epithelial cells are treated with MS-9 and influence on YAP/TAZ localization is determined.



FIG. 92B shows in vitro efficacy of compound 1 (MS-9) blocks expression of TGFβ.



FIG. 92C contains a line plot showing cell count (filed of view) for 1 μM and 10 μM of compound 1 (MS-9).





DETAILED DESCRIPTION

Tissue fibrosis can occur in multiple vital organs including heart, lung, liver, and kidney. Fibrosis is a progressive process which, through multiple mechanisms, transforms a normal healthy organ into an architecturally and functionally compromised tissue. From a clinical standpoint they represent a serious problem as the therapeutic options remain minimal and the prognosis is generally very poor. Dopamine receptors, which are almost exclusively researched as part of the central nervous system, are actually highly expressed in the periphery as well in select tissues and cells in the body. These receptors signal through downstream pathways which play a major role in tissue fibrosis. One example of such receptors is a Gαs-coupled receptor, such as a dopamine receptor D1 (DRD1). As described in the present disclosure, agonising dopamine receptors leads to treatment or prevention of tissue fibrosis in multiple organs.


YAP and TAZ are transcriptional co-activators and central effectors of the Hippo pathway (Ref. 8). Originally identified based on their roles in organ growth and size control during tissue morphogenesis, the Hippo pathway and YAP/TAZ in adult tissues regulate epithelial and endothelial homeostasis (Ref. 9-13), stem cell function (Ref. 14-16) and tissue regeneration (Ref. 9,17,18). Roles for YAP and TAZ in mesenchymal cell activation and fibrosis in multiple organs (Ref. 19-22), including the lung and liver (Ref. 2), was also shown. An array of mechanical and biochemical signals have been implicated as upstream regulators of YAP and TAZ, with multiple pro-fibrotic stimuli including matrix stiffness, TGFB/SMAD, MRTF/SRF, and WNT (Ref. 5, 23, 24) signaling all potentially involved.


G protein coupled receptors are linked to effector proteins from four main classes of G-proteins (e.g., Gα12/13, Gαq/11, Gαi/o or Gαs). In some instances, G protein coupled receptor stimulates


YAP/TAZ nuclear translocation and transcriptional activity. In other instances, G protein coupled receptors inhibit YAP/TAZ nuclear localization and activity via elevation of cAMP (see, e.g., FIG. 1, 2).


In some embodiments, activation (agonism) of a G protein coupled receptor results in YAP/TAZ hyper phosphorylation and inactivation under physiological conditions (e.g., agonism of the receptor prevents YAP/TAZ nuclear localization). This is in contrast to inactivation (antagonism) of G protein coupled receptor, which stimulates YAP/TAZ nuclear translocation and transcriptional activity, which results in expression of profibrotic genes, such as Acta2 (αSMA), Ctgf (Connective tissue growth factor), Fn1 (Fibronectin), Col1a1 (Collagen I), and Col1a2 (Collagen II).


In some embodiments, the present disclosure provides a method of agonizing a G protein coupled receptor in a cell, the method comprising contacting the cell with any one of compounds described herein, or a pharmaceutically acceptable salt thereof. In such embodiments, the compound selectively agonizes the Gαs receptor (e.g., the compound is 100-fold, 50-fold, or 10-fold selective to Gαs protein coupled receptor as compared to Gα12/13, Gαq/11 or Gαi/o protein coupled receptor, or any combination of the aforementioned).


In some embodiments, the cell is a mesenchymal cell (e.g., the G protein coupled receptor is expressed in a mesenchymal cell). In some embodiments, the mesenchymal cell is a fibroblast (e.g., pulmonary, cardiac, hepatic, renal or dermal fibroblast) or a stellate cell (e.g., pancreatic stellate cell, hepatic stellate cell, podocyte, or osteocyte). In some embodiments, the G protein coupled receptor is preferentially expressed in mesenchymal cells as compared to epithelial or endothelial cells of a tissue (e.g., lung tissue or liver tissue). In one example, the G protein coupled receptor is preferentially expressed in pulmonary fibroblasts over alveolar epithelial cells. In another example, the G protein coupled receptor is preferentially expressed in hepatic stellate cells over hepatocytes.


In some embodiments, the G protein coupled receptor is GαS receptor. In one example, GαS receptor is expressed preferentially in the mesenchymal cell. In some embodiments, the Gαs protein coupled receptor is a dopamine receptor (e.g., D1, D2, D3, D4, or D5 dopamine receptor). In some embodiments the dopamine receptor is a dopamine receptor D1 (DRD1). In one example, the methods of the present disclosure include selectively agonizing the dopamine receptor D1 (e.g., the compound of Formula (I) is 100-fold, 50-fold, or 10-fold selective to D1 dopamine receptor as compared to D2, D3, D4, or D5 receptor, or any combination of the aforementioned).


Referring to FIGS. 1 and 2, without being bound by a theory, it is believed that agonism of a G protein coupled receptor results in YAP/TAZ phosphorylation and subsequent degradation of YAP/TAZ in the cell. In some embodiments, the YAP/TAZ phosphorylation comprises phosphorylation of YAP serine 127. In some embodiments, the YAP/TAZ phosphorylation comprises phosphorylation of TAZ serine 89. In some embodiments, the YAP/TAZ phosphorylation comprises phosphorylation of YAP serine 127 and phosphorylation of TAZ serine 89. Hence, in some embodiments, the present disclosure provides a method of promoting YAP phosphorylation in a cell, the method comprising contacting the cell with any one of compounds described herein, or a pharmaceutically acceptable salt thereof. Because the compounds of the present disclosure promote degradation of the YAP/TAZ protein complex, in some embodiments, the present disclosure provides a method of reducing nuclear localization of YAP/TAZ in a cell, the method comprising contacting the cell with any one of the compounds of the present disclosure, or a pharmaceutically acceptable salt thereof. Hence, the compounds of this disclosure render YAP/TAZ unable to perform its cellular function. In some embodiments, the present disclosure provides a method of inhibiting YAP/TAZ function in a cell, the method comprising contacting the cell with any one of the compounds of the present disclosure, or a pharmaceutically acceptable salt thereof. Examples of the YAP/TAZ cellular functions include expression of profibrotic genes in the cell and production of fibrotic biomolecules (e.g., actin, collagen) by the cell. Generally, these fibrotic biomolecules constitute extra-cellular matrix surrounding the cell. Suitable examples of profibrotic genes include Acta2 (αSMA), Ctgf (Connective tissue growth factor), Fn1 (Fibronectin), Col1a1 (Collagen I), and Col1a2 (Collagen II). In some embodiments, the present disclosure provides a method of inhibiting expression of α-smooth muscle actin (αSMA) in a cell, the method comprising contacting the cell with any one of the compounds of the present disclosure, or a pharmaceutically acceptable salt thereof. Concomitantly, in some embodiments, the present disclosure provides a method of inhibiting production and deposition of extra-cellular matrix by a cell, the method comprising contacting the cell with any one of the compounds of the present disclosure, or a pharmaceutically acceptable salt thereof. In some embodiments, inhibiting YAP/TAZ function in a cell by the compound of the present disclosure results in a prevention of accumulation of extracellular matrix in a tissue.


Without being bound by a theory, it is believed that agonism of a G protein coupled receptor reverses fiber formation and extracellular matrix accumulation (e.g., a G protein coupled receptor agonism leads to removing the fiber and extracellular matrix from a tissue). Hence, in some embodiments, the present disclosure provides a method enhancing extra-cellular matrix degradation by a cell, the method comprising contacting the cell with any one of the compounds of the present disclosure, or a pharmaceutically acceptable salt thereof.


In some embodiments, the fiber formation, or fibrosis, is induced in a tissue by trauma or tissue injury. Normally, cells generate just the right amount of tissue to replace old tissue or repair tissue damage. Excessive connective tissue generation (e.g., in response to trauma or injury) results in pathological accumulation of fibrotic tissue (e.g., extracellular matrix proteins) leading to organ or tissue thickening and scarring.


In some embodiments, the present disclosure provides a method of treating or preventing a fibrotic pathology in a subject, the method comprising administering to the subject in need thereof a therapeutically effective amount of any one of the compounds described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, the subject in need of treatment of fibrotic pathology is diagnosed with fibrotic pathology by a treating physician.


In some embodiments, the fibrotic pathology is interstitial lung disease (ILD). In some embodiments, fibrotic pathology is lung tissue fibrosis, e.g., pulmonary fibrosis (PF) or idiopathic pulmonary fibrosis (IPF). Despite the name, cystic fibrosis is not considered an interstitial lung disease or predominantly a fibrotic pathology. Cystic fibrosis results from impaired ion transport, mucus dysfunction, and failure to effectively clear pathogens from the airways, which eventually results in scarring of the airways and lungs.


In some embodiments, fibrotic pathology is a liver tissue fibrosis, e.g., cirrhosis or biliary atresia. In some embodiments, fibrotic pathology is a heart tissue fibroses (cardiac fibrosis), e.g., atrial fibrosis, endomyocardial fibrosis, or post-myocardial infarction scarring. In some embodiments, fibrotic pathology is a brain tissue fibrosis, e.g., glial scar. In some embodiments, fibrotic pathology is arterial stiffness, arthrofibrosis (knee, shoulder, elbow, or other joints), kidney fibrosis (e.g., chronic kidney disease and fibrosis), liver fibrosis, nonalcoholic fatty liver, nonalcoholic steatohepatitis, Crohn's disease (intestinal scarring), Dupuytren's contracture (scar tissue in hands or fingers), skin tissue fibrosis, e.g., keloid (a scar on the skin), mediastinal fibrosis (soft tissue of the mediastinum), Peyronie's disease (scar in a penial tissue), nephrogenic systemic fibrosis, progressive massive fibrosis, retroperitoneal fibrosis (scar on the soft tissue of the retroperitoneum) or adhesive capsulitis.


In some embodiments, the subject in need of prevention of fibrotic pathology is diagnosed with tissue trauma or injury by a treating physician. Suitable examples of tissue injury include injury caused by inhaled substances (e.g., silica or asbestos), drug-induced injury (injury caused by an antibiotic or an anticancer drug), tissue injury caused by autoimmune disease (e.g., rheumatoid arthritis, sclerosis, such as systemic sclerosis, lupus), injury caused by infection (e.g., tuberculosis, pneumonia, respiratory virus), or sarcoidosis.


Exemplary Therapeutic Compounds
Compounds of Formula (I)

In some embodiments, the present disclosure provides a compound of Formula (I):




embedded image




    • or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from HO-C1-6 alkyl, NH2—C1-6 alkyl, 5-6-membered heteroaryl ring comprising 1 to 5 heteroatoms selected from N, O, and S, and 3-10-membered heterocycloalkyl ring comprising 1 to 3 heteroatoms independently selected from N, O, and S;

    • wherein said heteroaryl ring and heterocycloalkyl ring are each optionally substituted with 1, 2, or 3 substituents independently selected from R2;

    • each R2 is independently selected from halo, OH, C1-3 alkoxy, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, C1-3 alkoxy, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino; and

    • R3 is selected from H and halo.





In some embodiments, the present disclosure provides a compound of Formula (I):




embedded image




    • or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from HO—C1-6 alkyl, NH2—C1-6 alkyl, 5-6-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, and 3-7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S;

    • wherein said heteroaryl ring and heterocycloalkyl ring are each optionally substituted with 1, 2, or 3 substituents independently selected from R2; and

    • each R2 is independently selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.





In some embodiments, R1 is 5-6-membered heteroaryl ring comprising 1 to 5 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 5-6-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 5-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 6-membered heteroaryl ring comprising 1 or 2 N atoms, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridinyl, pyrimidinyl, pyrazinyl, diazinyl, triazinyl, tetrazinyl, and pentazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridyl, pyrazinyl, pyrimidinyl, and pyridazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridinyl, pyrimidinyl, and pyrazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is pyridinyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, R1 is 3-10-membered heterocycloalkyl ring comprising 1 to 3 heteroatoms independently selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 3-7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 3-membered heterocycloalkyl ring comprising 1 heteroatom selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include aziridinyl and oxiranyl.


In some embodiments, R1 is 4-membered heterocycloalkyl ring comprising 1 heteroatom selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include oxetanyl and azetidinyl.


In some embodiments, R1 is 5-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include tetrahydrofuranyl, pyrrolidinyl, isoxazolidinyl, imidazolidinyl, and thiazolidinyl.


In some embodiments, R1 is 6-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include morpholinyl, thiomorpholinyl, tetrahydropyranyl, piperazinyl, and piperidinyl.


In some embodiments, R1 is 7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 8-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 9-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 10-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, pyrrolidinyl, pyranyl, morpholinyl, oxazinyl, dioxanyl, dioxinyl, diazinanyl, triazinanyl, trioxanyl, azepanyl, azepinyl, oxepanyl, oxepinyl, diazepanyl, diazepinyl, azocanyl, azocinyl, oxocanyl, oxocinyl, azonanyl, azoninyl, oxonanyl, and oxoninyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, and pyrrolidinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl and piperidinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is tetrahydropyranyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is piperidinyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, R1 is selected from HO—C1-6 alkyl and NH2—C1-6 alkyl.


In some embodiments, R1 is HO—C1-6 alkyl.


In some embodiments, R1 is NH2—C1-6 alkyl.


In some embodiments, R2 is independently selected from halo, OH, C1-3 alkoxy, C1-3 alkyl, and C1-3 haloalkyl.


In some embodiments, R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from OH and NH2. In some embodiments, R2 is OH.


In some embodiments, R2 is NH2. In some embodiments, R2 is C1-3 alkyl. In some embodiments, R2 is HO—C1-3 alkyl. In some embodiments, R2 is NH2—C1-3 alkyl.


In some embodiments, R3 is H.


In some embodiments, R3 is halo.


In some embodiments, R3 is selected from Cl, F, and Br. In some embodiments, R3 is Cl. In some embodiments, R3 is F. In some embodiments, R3 is Br.


In some embodiments, the compound of Formula (I) is selected from any one of the following compounds:




embedded image


embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is selected from any one of the following compounds:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is selected from any one of the following compounds:




embedded image


or a pharmaceutically acceptable salt thereof.


Compounds of Formula (II)

In some embodiments, the present disclosure provides a compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from H and C1-3 alkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, or di(C1-3 alkyl)amino;
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino; and
    • R5 is selected from H and halo.


In some embodiments of the compound of Formula (II), when R5 is H:

    • (i) at least one of R2, R3, and R4 is not H;
    • (ii) if R2 is H and R3 is OH, then R4 is not H or OH; and
    • (iii) if R2 is OH, then at least one of R3 and R4 is not H. In some embodiments, the present disclosure provides a compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from H and C1-3 alkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, or di(C1-3 alkyl)amino; and
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments of the compound of Formula (II), at least one of R2, R3, and R4 is not H. In some embodiments of the compound of Formula (II), if R2 is H and R3 is OH, then R4 is not H or OH. In some embodiments of the compound of Formula (II), if R2 is OH, then at least one of R3 and R4 is not H.


In some embodiments of the compound of Formula (II):

    • (i) at least one of R2, R3, and R4 is not H;
    • (ii) if R2 is H and R3 is OH, then R4 is not H or OH; and
    • (iii) if R2 is OH, then at least one of R3 and R4 is not H.


In some embodiments, R1 is H.


In some embodiments, R1 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl).


In some embodiments, R1 is selected from HO—C1-3 alkyl and NH2—C1-3 alkyl. In some embodiments, R1 is HO—C1-3 alkyl. In some embodiments, R1 is NH2—C1-3 alkyl.


In some embodiments, at least one of R2, R3, and R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, at least one of R2, R3, and R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


In some embodiments, at least one of R2, R3, and R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments, at least one of R2, R3, and R4 is C1-3 alkyl.


In some embodiments, R2 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R2 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R2 is HO—C1-3alkyl. In some embodiments, R2 is NH2—C1-3 alkyl. In some embodiments, R2 is OH. In some embodiments, R2 is NH2. In some embodiments, R2 is H.


In some embodiments, R3 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R3 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R3 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R3 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R3 is HO—C1-3 alkyl. In some embodiments, R3 is NH2—C1-3 alkyl. In some embodiments, R3 is OH. In some embodiments, R3 is NH2. In some embodiments, R3 is H.


In some embodiments, R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R4 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R4 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R4 is HO—C1-3 alkyl. In some embodiments, R4 is NH2—C1-3 alkyl. In some embodiments, R4 is OH. In some embodiments, R4 is NH2. In some embodiments, R4 is H.


In some embodiments:

    • R3 is OH; and
    • R2 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3alkylamino and di(C1-3 alkyl)amino.


In some embodiments:

    • R3 is OH; and
    • R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments:

    • R3 is OH; and
    • R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


In some embodiments:

    • R3 is OH; and
    • R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments:

    • R4 is OH; and
    • R3 is selected from H, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


In some embodiments:

    • R4 is OH; and
    • R3 is selected from H, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments:

    • R2 is OH; and
    • at least one of R3 and R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


In some embodiments:

    • R2 is OH; and
    • at least one of R3 and R4 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments, R3 is OH and R2 is C1-3 alkyl. In some embodiments, R3 is C1-3 alkyl and R2 is OH. In some embodiments, R3 is OH and R4 is C1-3 alkyl. In some embodiments, R3 is C1-3 alkyl and R4 is OH.


In some embodiments:

    • R5 is halo; and
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2, R3, and R4 are each independently selected from H, OH, and C1-3 alkyl. In some embodiments, R2, R3, and R4 are each H.


In some embodiments, R5 is H. In some embodiments, R5 is halo. In some embodiments, R5 is selected from Cl, Br, and F. In some embodiments, R5 is Cl. In some embodiments, R5 is Br. In some embodiments, R5 is F.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (I) is:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (II) is selected from any one of the following compounds:




embedded image


or a pharmaceutically acceptable salt thereof.


Compounds of Formula (III)

In some embodiments, the present disclosure provides a compound of Formula (III):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • X1 is selected from CH2 and O;
    • R1 is selected from HO—C1-6 alkyl, NH2—C1-6 alkyl, 5-6-membered heteroaryl ring comprising 1 to 5 heteroatoms selected from N, O, and S, and 3-10-membered heterocycloalkyl ring comprising 1 to 3 heteroatoms independently selected from N, O, and S; wherein said heteroaryl ring and heterocycloalkyl ring are each optionally substituted with 1, 2, or 3 substituents independently selected from R2;
    • each R2 is independently selected from halo, OH, C1-3 alkoxy, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, C1-3 alkoxy, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino;
    • R3 is selected from H and halo; and
    • R4 is selected from H and C1-3 alkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, or di(C1-3 alkyl)amino.


In some embodiments, X1 is CH2. In some embodiments, X1 is O.


In some embodiments, R3 is H. In some embodiments, R3 is halo. In some embodiments, R3 is selected from Cl, Br, and F. In some embodiments, R3 is Cl. In some embodiments, R3 is Br. In some embodiments, R3 is F.


In some embodiments, R4 is selected from H and C1-3 alkyl.


In some embodiments, R4 is H. In some embodiments, R4 is C1-3 alkyl.


In some embodiments, R1 is 5-6-membered heteroaryl ring comprising 1 to 5 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 5-6-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 5-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 6-membered heteroaryl ring comprising 1 or 2 N atoms, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridinyl, pyrimidinyl, pyrazinyl, diazinyl, triazinyl, tetrazinyl, and pentazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridyl, pyrazinyl, pyrimidinyl, and pyridazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from pyridinyl, pyrimidinyl, and pyrazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is pyridinyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, the compound of Formula (III) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (III) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, R1 is 3-10-membered heterocycloalkyl ring comprising 1 to 3 heteroatoms independently selected from N, O, and S, which is optionally substituted with 1, 2,or 3 substituents independently selected from R2.


In some embodiments, R1 is 3-7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 3-membered heterocycloalkyl ring comprising 1 heteroatom selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include aziridinyl and oxiranyl.


In some embodiments, R1 is 4-membered heterocycloalkyl ring comprising 1 heteroatom selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include oxetanyl and azetidinyl.


In some embodiments, R1 is 5-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include tetrahydrofuranyl, pyrrolidinyl, isoxazolidinyl, imidazolidinyl, and thiazolidinyl.


In some embodiments, R1 is 6-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. Examples of such rings include morpholinyl, thiomorpholinyl, tetrahydropyranyl, piperazinyl, and piperidinyl.


In some embodiments, R1 is 7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 8-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 9-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is 10-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, pyrrolidinyl, pyranyl, morpholinyl, oxazinyl, dioxanyl, dioxinyl, diazinanyl, triazinanyl, trioxanyl, azepanyl, azepinyl, oxepanyl, oxepinyl, diazepanyl, diazepinyl, azocanyl, azocinyl, oxocanyl, oxocinyl, azonanyl, azoninyl, oxonanyl, and oxoninyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, and pyrrolidinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


In some embodiments, R1 is selected from tetrahydropyranyl and piperidinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2. In some embodiments, R1 is tetrahydropyranyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2. In some embodiments, R1 is any one of R1 described herein for Formula (I).


In some embodiments, the compound of Formula (III) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the compound of Formula (III) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, R1 is selected from HO—C1-6 alkyl and NH2—C1-6 alkyl.


In some embodiments, R1 is HO—C1-6 alkyl.


In some embodiments, R1 is NH2—C1-6 alkyl.


In some embodiments, each R2 is independently selected from halo, OH, C1-3 alkoxy, C1-3 alkyl, and C1-3 haloalkyl. In some embodiments, R2 is any of the R2 groups described herein for the compound of Formula (I). In some embodiments, R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from OH and NH2. In some embodiments, R2 is OH. In some embodiments, R2 is NH2. In some embodiments, R2 is C1-3 alkyl. In some embodiments, R2 is HO—C1-3 alkyl. In some embodiments, R2 is NH2—C1-3 alkyl.


In some embodiments, the compound of Formula (III) is selected from any one of the following compounds:




embedded image


embedded image


embedded image


or a pharmaceutically acceptable salt thereof.


Compounds of Formula (IV)

In some embodiments, the present disclosure provides a compound of Formula (IV):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • X1 is selected from CH2 and O;
    • X2 is selected from CR3 and N;
    • R1 is selected from H and C1-3 alkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, or di(C1-3 alkyl)amino;
    • R5 is selected from H and halo; and
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments of the compound of Formula (IV), if R5 is H and X2 is CR3, then at least one of R2, R3, and R4 is not H.


In some embodiments, X1 is CH2. In some embodiments, X1 is O.


In some embodiments, R1 is selected from H and C1-3 alkyl.


In some embodiments, R1 is H. In some embodiments, R1 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R1 is selected from HO—C1-3 alkyl and NH2—C1-3 alkyl.


In some embodiments, R1 is HO—C1-3 alkyl. In some embodiments, R1 is NH2—C1-3 alkyl.


In some embodiments, R5 is H. In some embodiments, R5 is halo. In some embodiments, R5 is selected from Cl, Br, and F. In some embodiments, R5 is Cl. In some embodiments, R5 is Br. In some embodiments, R5 is F.


In some embodiments, X2 is N. In some embodiments, X2 is CR3.


In some embodiments, at least one of R2, R3, and R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, at least one of R2, R3, and R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


In some embodiments, at least one of R2, R3, and R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


In some embodiments, at least one of R2, R3, and R4 is C1-3 alkyl.


In some embodiments, R2 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R2 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R2 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R2 is HO—C1-3 alkyl. In some embodiments, R2 is NH2—C1-3 alkyl. In some embodiments, R2 is OH. In some embodiments, R2 is NH2. In some embodiments, R2 is H.


In some embodiments, R3 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R3 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R3 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R3 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R3 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R3 is HO—C1-3 alkyl. In some embodiments, R3 is NH2—C1-3 alkyl. In some embodiments, R3 is OH. In some embodiments, R3 is NH2. In some embodiments, R3 is H.


In some embodiments, R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R4 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl. In some embodiments, R4 is selected from C1-3 alkyl and HO—C1-3 alkyl. In some embodiments, R4 is C1-3 alkyl (e.g., methyl, ethyl, propyl, isopropyl). In some embodiments, R4 is HO—C1-3 alkyl. In some embodiments, R4 is NH2—C1-3 alkyl. In some embodiments, R4 is OH. In some embodiments, R4 is NH2. In some embodiments, R4 is H.


In some embodiments, the compound of Formula (IV) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments:

    • R5 is halo; and
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


In some embodiments, R2, R3, and R4 are each independently selected from H, OH, and C1-3 alkyl. In some embodiments, R2, R3, and R4 are each H.


In some embodiments:

    • R3 is H;
    • R5 is H; and
    • R2 and R4 are each independently selected from OH and C1-3 alkyl.


In some embodiments, the compound of Formula (IV) has formula:




embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, R2 and R4 are each independently selected from H, halo, OH, C1-3 alkoxy, C1-3 alkyl, and C1-3 haloalkyl.


In some embodiments, the compound of Formula (IV) is selected from any one of the following compounds:




embedded image


embedded image


embedded image


embedded image


embedded image


or a pharmaceutically acceptable salt thereof.


In some embodiments, the the compound of any one of the foregoing Formulae is hydrophilic. In such embodiments, the structure of the compound contains hydrogen bond donor (HBD) atoms that are capable of forming hydrogen bonds with molecules of water and with the amino acids within the active site of a G protein coupled receptor. In some embodiments, the compound of any one of the foregoing Formulae contains at least 2, 3, 4, 5, or 6 HBD atoms (e.g., heteroatoms such as O, N or S). In some embodiments, the compound of any one of the foregoing Formulae contains at least one hydroxyl group (e.g., 1, 2, 3, 4, 5, or 6 hydroxyl groups). In some embodiments, the compound of any one of the foregoing Formulae contains amino groups (e.g., 1, 2, 3, 4, 5, or 6 amino groups).


In some embodiments, the compound of any one of the foregoing Formulae does not penetrate the blood brain barrier or only an insignificant amount of the compound of any one of the foregoing Formulae penetrates the blood brain barrier after the compound is administered to a subject (e.g., not more than about 0.1 wt. %, about 1 wt. %, about 5 wt. %, about 10 wt. %, or about 20 wt. % of the amount of the compound administered to the subject penetrates the blood brain barrier). In one example, the compound of any one of the foregoing Formulae is ineffective or only weakly effective in treating central nervous system (CNS) disorders due to its hydrophilicity and subsequent inability to penetrate the blood bran barrier.


Pharmaceutical Compositions and Formulations

The present application also provides pharmaceutical compositions comprising an effective amount of a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. The pharmaceutical composition may also comprise at least one of any one of the additional therapeutic agents described. In certain embodiments, the application also provides pharmaceutical compositions and dosage forms comprising any one the additional therapeutic agents described herein (e.g., in a kit). The carrier(s) are “acceptable” in the sense of being compatible with the other ingredients of the formulation and, in the case of a pharmaceutically acceptable carrier, not deleterious to the recipient thereof in an amount used in the medicament.


Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions of the present application include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.


The compositions or dosage forms may contain any one of the compounds and therapeutic agents described herein in the range of 0.005% to 100% with the balance made up from the suitable pharmaceutically acceptable excipients. The contemplated compositions may contain 0.001%-100% of any one of the compounds and therapeutic agents provided herein, in one embodiment 0.1-95%, in another embodiment 75-85%, in a further embodiment 20-80%, wherein the balance may be made up of any pharmaceutically acceptable excipient described herein, or any combination of these excipients.


Routes of Administration and Dosage Forms

The pharmaceutical compositions of the present application include those suitable for any acceptable route of administration. Acceptable routes of administration include, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal.


Compositions and formulations described herein may conveniently be presented in a unit dosage form, e.g., tablets, capsules (e.g., hard or soft gelatin capsules), sustained release capsules, and in liposomes, and may be prepared by any methods well known in the art of pharmacy. See, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore, MD (20th ed. 2000). Such preparative methods include the step of bringing into association with the molecule to be administered ingredients such as the carrier that constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, liposomes or finely divided solid carriers, or both, and then, if necessary, shaping the product.


In some embodiments, any one of the compounds and therapeutic agents disclosed herein are administered orally. Compositions of the present application suitable for oral administration may be presented as discrete units such as capsules, sachets, granules or tablets each containing a predetermined amount (e.g., effective amount) of the active ingredient; a powder or granules; a solution or a suspension in an aqueous liquid or a non-aqueous liquid; an oil-in-water liquid emulsion; a water-in-oil liquid emulsion; packed in liposomes; or as a bolus, etc. Soft gelatin capsules can be useful for containing such suspensions, which may beneficially increase the rate of compound absorption. In the case of tablets for oral use, carriers that are commonly used include lactose, sucrose, glucose, mannitol, and silicic acid and starches. Other acceptable excipients may include: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. Compositions suitable for oral administration include lozenges comprising the ingredients in a flavored basis, usually sucrose and acacia or tragacanth; and pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia.


Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions or infusion solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, saline (e.g., 0.9% saline solution) or 5% dextrose solution, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.


The injection solutions may be in the form, for example, of a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant.


The pharmaceutical compositions of the present application may be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of the present application with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include cocoa butter, beeswax, and polyethylene glycols.


The pharmaceutical compositions of the present application may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art. See, for example, U.S. Pat. No. 6,803,031. Additional formulations and methods for intranasal administration are found in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci 11:1-18, 2000.


The topical compositions of the present disclosure can be prepared and used in the form of an aerosol spray, cream, emulsion, solid, liquid, dispersion, foam, oil, gel, hydrogel, lotion, mousse, ointment, powder, patch, pomade, solution, pump spray, stick, towelette, soap, or other forms commonly employed in the art of topical administration and/or cosmetic and skin care formulation. The topical compositions can be in an emulsion form. Topical administration of the pharmaceutical compositions of the present application is especially useful when the desired treatment involves areas or organs readily accessible by topical application. In some embodiments, the topical composition comprises a combination of any one of the compounds and therapeutic agents disclosed herein, and one or more additional ingredients, carriers, excipients, or diluents including absorbents, anti-irritants, anti-acne agents, preservatives, antioxidants, coloring agents/pigments, emollients (moisturizers), emulsifiers, film-forming/holding agents, fragrances, leave-on exfoliants, prescription drugs, preservatives, scrub agents, silicones, skin-identical/repairing agents, slip agents, sunscreen actives, surfactants/detergent cleansing agents, penetration enhancers, and thickeners.


The compounds and therapeutic agents of the present application may be incorporated into compositions for coating an implantable medical device, such as prostheses, artificial valves, vascular grafts, stents, or catheters. Suitable coatings and the general preparation of coated implantable devices are known in the art and are exemplified in U.S. Pat. Nos. 6,099,562; 5,886,026; and 5,304,121. The coatings are typically biocompatible polymeric materials such as a hydrogel polymer, polymethyldisiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate, and mixtures thereof. The coatings may optionally be further covered by a suitable topcoat of fluorosilicone, polysaccharides, polyethylene glycol, phospholipids or combinations thereof to impart controlled release characteristics in the composition. Coatings for invasive devices are to be included within the definition of pharmaceutically acceptable carrier, adjuvant or vehicle, as those terms are used herein. According to another embodiment, the present application provides an implantable drug release device impregnated with or containing a compound or a therapeutic agent, or a composition comprising a compound of the present application or a therapeutic agent, such that said compound or therapeutic agent is released from said device and is therapeutically active.


Dosages and Regimens

In the pharmaceutical compositions of the present application, a therapeutic compound is present in an effective amount (e.g., a therapeutically effective amount).


Effective doses may vary, depending on the diseases treated, the severity of the disease, the route of administration, the sex, age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents and the judgment of the treating physician.


In some embodiments, an effective amount of a therapeutic compound can range, for example, from about 0.001 mg/kg to about 500 mg/kg (e.g., from about 0.001 mg/kg to about 200 mg/kg; from about 0.01 mg/kg to about 200 mg/kg; from about 0.01 mg/kg to about 150 mg/kg; from about 0.01 mg/kg to about 100 mg/kg; from about 0.01 mg/kg to about 50 mg/kg; from about 0.01 mg/kg to about 10 mg/kg; from about 0.01 mg/kg to about 5 mg/kg; from about 0.01 mg/kg to about 1 mg/kg; from about 0.01 mg/kg to about 0.5 mg/kg; from about 0.01 mg/kg to about 0.1 mg/kg; from about 0. 1 mg/kg to about 200 mg/kg; from about 0. 1 mg/kg to about 150mg/kg; from about 0. 1 mg/kg to about 100 mg/kg; from about 0.1 mg/kg to about 50 mg/kg; from about 0. 1 mg/kg to about 10 mg/kg; from about 0.1 mg/kg to about 5 mg/kg; from about 0.1 mg/kg to about 2 mg/kg; from about 0.1 mg/kg to about 1 mg/kg; or from about 0.1 mg/kg to about 0.5 mg/kg).


In some embodiments, an effective amount of a therapeutic compound is about 0.1 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, or about 5 mg/kg.


The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses, e.g., once daily, twice daily, thrice daily) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weekly, once every two weeks, once a month). The compounds and compositions described herein can be administered to the subject in any order. A first therapeutic agent, such as a compound of the present disclosure, can be administered prior to or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before or after), or concomitantly with the administration of a second therapeutic agent, such as an anti-fibrotic agent described herein, to a subject in need of treatment. Thus, the compound of the present disclosure, or a composition containing the compound, can be administered separately, sequentially or simultaneously with the second therapeutic agent, such as an anti-fibrotic agent described herein. When the compound of the present disclosure, or a pharmaceutically acceptable salt thereof, and a second or third therapeutic agent are administered to the subject simultaneously, the therapeutic agents may be administered in a single dosage form (e.g., tablet, capsule, or a solution for injection or infusion).


In some embodiments, the second (additional) therapeutic agent is a drug that is useful in treating or preventing a fibrotic pathology. Suitable examples of such drugs include nintedanib, pirfenidone, or prednisone, or mmunosuppressants, such as cyclophosphamide, azathioprine, methotrexate, penicillamine, and cyclosporine.


In some embodiments, the additional therapeutic agent is dopamine, or a pharmaceutically acceptable salt thereof.


In some embodiments, the additional therapeutic agent is a dopamine receptor agonist. In some embodiments, the dopamine receptor agonist is selected from: ABT-413, A-86929, dihydrexidine (DHX), dinapsoline, dinoxyline, doxanthrine, SKF-81297, SKF-82958, SKF-38393, fenoldopam, 6-Br-APB, stepholidine, A-68930, A-77636, CY-208-243, SKF-89145, SKF-89626, 7,8-dihydroxy-5-phenyl-octahydrobenzo[h]isoquinoline, cabergoline, pergolide, R(−)-2,10,11-trihydroxyaporphine, (R)-(−)-apomorphine, R(−)-propylnorapomorphine, R(+)-6-bromo-APB, R(−)-2,10,11-trihydroxy-N-propyl-noraporphine, 6,7-ADTN, mesulergine, N-methyldopamine, 4-hydroxyphenethylamine, cabergoline, 3-hydroxyphenethylamine, pramipexole, PD-168077, fenoldopam, (+)-PD 128-907, (+)-2-(N-phenylethyl-N-propyl) amino-5-hydroxytetralin, bromocriptine, ropinirole, LY-163-502, dipropyldopamine, B-HT 920, piribedil, (+)-UH 232, pergolide, (−)-quinpirole, R(−)-2,11-dihydroxy-10-methoxyapomorphine, or a pharmaceutically acceptable salt thereof.


In some embodiments, the second (additional) therapeutic agent is an anti-inflammatory drug. Suitable examples of such drugs include NSAIDs such as celecoxib, rofecoxib, ibuprofen, naproxen, aspirin, diclofenac, sulindac, oxaprozin, piroxicam, indomethacin, meloxicam, fenoprofen, diflunisal, methotrexate, BAY 11-7082, or a pharmaceutically acceptable salt thereof. Suitable examples of steroid anti-inflammatory agents include cortisol, corticosterone, hydrocortisone, aldosterone, deoxycorticosterone, triamcinolone, bardoxolone, bardoxolone methyl, triamcinolone, cortisone, prednisone, and methylprednisolone, or a pharmaceutically acceptable salt thereof.


Kits

The present invention also includes pharmaceutical kits useful, for example, in the treatment of disorders, diseases and conditions referred to herein, which include one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. Such kits can further include, if desired, one or more of various conventional pharmaceutical kit components, such as, for example, containers with one or more pharmaceutically acceptable carriers, additional containers, etc. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, can also be included in the kit.


Definitions

As used herein, the term “about” means “approximately” (e.g., plus or minus approximately 10% of the indicated value).


As used herein, the term “compound” as used herein is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures named or depicted. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise specified.


The terms “pharmaceutical” and “pharmaceutically acceptable” are employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.


As used herein, the term “cell” is meant to refer to a cell that is in vitro, ex vivo or in vivo. In some embodiments, an ex vivo cell can be part of a tissue sample excised from an organism such as a mammal. In some embodiments, an in vitro cell can be a cell in a cell culture. In some embodiments, an in vivo cell is a cell living in an organism such as a mammal. In some embodiments, the cell is a mesenchymal cell. In some embodiments, the cell is a fibroblast (e.g., cardiac, dermal or lung fibroblast). In some embodiments, the cell is a hepatic stellate cell.


As used herein, the term “contacting” refers to the bringing together of indicated moieties or items in an in vitro system, an ex vivo system, or an in vivo system. For example, “contacting” a cell with a compound provided herein includes the act of administering that compound to a mammal (e.g., a human) containing that cell as well as, for example, introducing that compound into a cell culture containing that cell.


As used herein, the term “mammal” includes, without limitation, mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, elephants, deer, non-human primates (e.g., monkeys and apes), house pets, and humans.


As used herein, the phrase “effective amount” or “therapeutically effective amount” refers to the amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, mammal, or human that is being sought by a researcher, veterinarian, medical doctor, or other clinician.


As used herein the term “treating” or “treatment” refers to 1) inhibiting the disease; for example, inhibiting a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., arresting further development of the pathology and/or symptomatology), or 2) ameliorating the disease; for example, ameliorating a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and/or symptomatology).


As used herein, the term “preventing” or “prevention” of a disease, condition or disorder refers to decreasing the risk of occurrence of the disease, condition or disorder in a subject or group of subjects (e.g., a subject or group of subjects predisposed to or susceptible to the disease, condition or disorder). In some embodiments, preventing a disease, condition or disorder refers to decreasing the possibility of acquiring the disease, condition or disorder and/or its associated symptoms. In some embodiments, preventing a disease, condition or disorder refers to completely or almost completely stopping the disease, condition or disorder from occurring.


As used herein, the term “pharmaceutically acceptable salt” refers to a salt that is formed between an acid and a basic group of the compound, such as an amino functional group, or a base and an acidic group of the compound, such as a carboxyl functional group. In some embodiments, the compound is a pharmaceutically acceptable acid addition salt. In some embodiments, acids commonly employed to form pharmaceutically acceptable salts of the therapeutic compounds described herein include inorganic acids such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid and phosphoric acid, as well as organic acids such as para-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, besylic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, para-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid and acetic acid, as well as related inorganic and organic acids. Such pharmaceutically acceptable salts thus include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylene sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate and other salts. In one embodiment, pharmaceutically acceptable acid addition salts include those formed with mineral acids such as hydrochloric acid and hydrobromic acid, and especially those formed with organic acids such as maleic acid.


In some embodiments, bases commonly employed to form pharmaceutically acceptable salts of the therapeutic compounds described herein include hydroxides of alkali metals, including sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxyl-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-(C1-C6)-alkylamine), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like.


As used herein, the phrase “optionally substituted” means unsubstituted or substituted. The substituents are independently selected, and substitution can be at any chemically accessible position. As used herein, the term “substituted” means that a hydrogen atom is removed and replaced by a substituent. A single divalent substituent, e.g., oxo, can replace two hydrogen atoms. It is to be understood that substitution at a given atom is limited by valency.


Throughout the definitions, the term “Cn-m” indicates a range which includes the endpoints, wherein n and m are integers and indicate the number of carbons. Examples include C1-4, C1-6, and the like.


As used herein, the term “Cn-m alkyl”, employed alone or in combination with other terms, refers to a saturated hydrocarbon group that may be straight-chain or branched, having n to m carbons.


Examples of alkyl moieties include, without limitation, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; higher homologs such as 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, and the like. In some embodiments, the alkyl group contains from 1 to 6 carbon atoms, from 1 to 4 carbon atoms, from 1 to 3 carbon atoms, or 1 to 2 carbon atoms.


As used herein, the term “Cn-m haloalkyl”, employed alone or in combination with other terms, refers to an alkyl group having from one halogen atom to 2s+1 halogen atoms that may be the same or different, where “s” is the number of carbon atoms in the alkyl group, wherein the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is fluorinated only.


In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.


As used herein, the term “amino” refers to a group of formula —NH2.


As used herein, the term “Cn-m alkylamino” refers to a group of formula —NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Suitable examples of alkylamino groups include N-methylamino, N-ethylamino, N-propylamino (e.g., N-(n-propyl)amino and N-isopropylamino), N-butylamino (e.g., N-(n-butyl)amino and N-(tert-butyl)amino), and the like.


As used herein, the term “di Cn-m alkylamino” refers to a group of formula —N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Suitable examples of dialkylamino groups include N,N-methylehtylamino, N,N-diethylamino, N,N-propylethylamino, N,N-butylisopropylamino, and the like.


As used herein, the term “Cn-m alkoxy”, employed alone or in combination with other terms, refers to a group of formula —O-alkyl, wherein the alkyl group has n to m carbons. Example alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), butoxy (e.g., n-butoxy and tert-butoxy), and the like. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.


As used herein, the term “HO—C1-3 alkyl” refers to a group of formula-(C1-3 alkylene)—OH. As used herein, the term “NH2—C1-3 alkyl” refers to a group of formula-(C1-3 alkylene)—NH2.


As used herein, “halo” refers to F, Cl, Br, or I. In some embodiments, a halo is F, Cl, or Br.


As used herein, “heteroaryl” refers to a monocyclic or polycyclic aromatic heterocycle having at least one heteroatom ring member selected from sulfur, oxygen, and nitrogen. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, any ring-forming N in a heteroaryl moiety can be an N-oxide. In some embodiments, the heteroaryl is a 5-10 membered monocyclic or bicyclic heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5-6 monocyclic heteroaryl having 1 or 2 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a five-membered or six-membered heteroaryl ring. A five-membered heteroaryl ring is a heteroaryl with a ring having five ring atoms wherein one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary five-membered ring heteroaryls include, without limitation, thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl. A six-membered heteroaryl ring is a heteroaryl with a ring having six ring atoms wherein one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary six-membered ring heteroaryls include, without limitation, pyridyl, pyrazinyl, pyrimidinyl, triazinyl, and pyridazinyl.


As used herein, “heterocycloalkyl” refers to non-aromatic monocyclic or polycyclic heterocycles having one or more ring-forming heteroatoms selected from O, N, or S. Included in heterocycloalkyl are monocyclic 4-, 5-, 6-, 7-, 8-, 9-, or 10-membered heterocycloalkyl groups. Heterocycloalkyl groups can also include spirocycles. Example heterocycloalkyl groups include, without limitation, pyrrolidin-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydropyran, oxetanyl, azetidinyl, morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazapene, and the like. Ring-forming carbon atoms and heteroatoms of a heterocycloalkyl group can be optionally substituted by 1 or 2 independently selected oxo or sulfido groups (e.g., C(O), S(O), C(S), or S(O)2, etc.). The heterocycloalkyl group can be attached through a ring-forming carbon atom or a ring-forming heteroatom. In some embodiments, the heterocycloalkyl group contains 0 to 3 double bonds. In some embodiments, the heterocycloalkyl group contains 0 to 2 double bonds. Also included in the definition of heterocycloalkyl are moieties that have one or more aromatic rings fused (i.e., having a bond in common with) to the cycloalkyl ring, for example, benzo or thienyl derivatives of piperidine, morpholine, azepine, etc. A heterocycloalkyl group containing a fused aromatic ring can be attached through any ring-forming atom including a ring-forming atom of the fused aromatic ring. In some embodiments, the heterocycloalkyl is a monocyclic 4-6 membered heterocycloalkyl having 1 or 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members. In some embodiments, the heterocycloalkyl is a monocyclic or bicyclic 4-10 membered heterocycloalkyl having 1, 2, 3, or 4heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members.


EXAMPLES
Materials and methods

Cell culture: Cells were all maintained in EMEM (ATCC) containing 10% FBS, unless otherwise noted. IMR-90 embryonic lung fibroblasts and NIH-3T3 mouse fibroblasts were purchased from ATCC. Doxycycline-inducible Tet-On NIH3T3 expressing TAZ4SA or control empty vector were described previously. Normal Human Alveolar Epithelial Cells (NHAEpCs), Normal Human Microvascular Endothelial Cells (NHMVECs), Normal Human Lung Fibroblasts (NHLFs), and Human Dermal Fibroblasts (HDFs) were purchased from Lonza and were cultured in the proprietary media per Lonza's recommendation. Human Adult Cardiac Fibroblasts (HACFs) and Hepatic Stellate Cells (HSCs) were purchased from ScienCell and were cultured in the proprietary media per ScienCell's recommendation. Hepatocytes were purchased from Samsara and were cultured in the proprietary media per Samsara's recommendation. All additional experiments with pulmonary fibroblasts used primary human lung fibroblasts isolated by explant culture from the lungs of subjects diagnosed with IPF who underwent lung transplantation, or donors whose organs were rejected for transplantation (non-IPF), generously provided by Peter Bitterman and Craig Henke at the University of Minnesota under a protocol approved by the University of Minnesota Institutional Review Board. All primary cell culture experiments were performed with cells at passage six or less.


Chemicals and Reagents: Dimethyl sulfoxide (DMSO), Y-27632, endothelin 1 (ET-1), and ascorbic acid were purchased from Sigma-Aldrich. Dihydrexidine (DHX), SKF-81297, fenoldopam, forskolin, and prostaglandin E2 were purchased from Tocris Bioscience. lysophosphatidic acid (LPA), and serotonin (5-HT) were purchased from Cayman Chemical. SCH 39166 was purchased from Santa Cruz Biotechnology. TGFβ1 was purchased from eBioscience.


GPCRome Profiling and qPCR: GPCRome profiling was performed according to the manufacturer's suggestions (Qiagen). Cells were grown in their recommended growth media for 24 hours prior to RNA isolation using RNeasy Plus Mini Kit (Qiagen) according to manufacturer's instructions. Isolated RNA (1000 ng) was then used to synthesize cDNA using the RT2 First Strand Kit (Qiagen) and the G Protein Coupled Receptors 384HT PCR Array was analyzed using a LightCycler 480 (Roche). Data are shown as 1/Ct (FIG. 3), GAPDH for fibroblast and epithelial cell datasets were nearly identical (17.39 and 17.41 respectively). Raw Ct values for all receptors are available (Table 1).









TABLE 1







Receptors marked (*) were identified to exclusively couple to Gαs (See e.g., Ref. 21)











Uni
Gen


Fibr text missing or illegible when filed


Gene
Bank
Symbol
Description
 text missing or illegible when filed





Hs.377783
NM_001118
ADCYAP1R1
Adenylate cyclase activating polypeptide 1 (pituitary) receptor type I
34.9 text missing or illegible when filed


Hs.77867
NM_000674
ADORA1
Adenosine Al receptor
29.7 text missing or illegible when filed


Hs.197029
NM_000675
ADORA2A
Adenosine A2a receptor
32.4 text missing or illegible when filed


Hs.167046
NM_000676
ADORA2B
Adenosine A2b receptor
26.8 text missing or illegible when filed


Hs.281342
NM_000677
ADORA3
Adenosine A3 receptor
37.7 text missing or illegible when filed


Hs.709175
NM_033303
ADRA1A
Adrenergic, alpha-1A-, receptor
34.6 text missing or illegible when filed


Hs.368632
NM_000679
ADRA1B
Adrenergic, alpha-1B-, receptor
32.9 text missing or illegible when filed


Hs.557
NM_000678
ADRAID
Adrenergic, alpha-1D-, receptor
29.1 text missing or illegible when filed


Hs.249159
NM_000681
ADRA2A
Adrenergic, alpha-2A-, receptor
33.6 text missing or illegible when filed


Hs.247686
NM_000682
ADRA2B
Adrenergic, alpha-2B-, receptor
36.0 text missing or illegible when filed


Hs.123022
NM_000683
ADRA2C
Adrenergic, alpha-2C-, receptor
33.7 text missing or illegible when filed


Hs.99913
NM_000684
ADRB1
Adrenergic, beta-1-, receptor
36.0 text missing or illegible when filed


Hs.591251
NM_000024
ADRB2
Adrenergic, beta-2-, receptor, surface
24.6 text missing or illegible when filed


Hs.2549
NM_000025
ADRB3
Adrenergic, beta-3-, receptor
33.1 text missing or illegible when filed


Hs.728754
NM_031850
AGTRI
Angiotensin II receptor, type 1
26.7 text missing or illegible when filed


Hs.405348
NM_000686
AGTR2
Angiotensin II receptor, type 2
35.1 text missing or illegible when filed


Hs.438311
NM_005161
APLNR
Apelin receptor
36.2 text missing or illegible when filed


Hs.2131
NM_000706
AVPR1A
Arginine vasopressin receptor 1A
33.8 text missing or illegible when filed


Hs.1372
NM_000707
AVPR1B
Arginine vasopressin receptor 1B
30.8 text missing or illegible when filed


Hs.567240
NM_000054
AVPR2
Arginine vasopressin receptor 2 (*)
35.1 text missing or illegible when filed


Hs.194654
NM_001702
BAI1
Brain-specific angiogenesis inhibitor 1
35.5 text missing or illegible when filed


Hs.524138
NM_001703
BAI2
Brain-specific angiogenesis inhibitor 2
28.0 text missing or illegible when filed


Hs.13261
NM_001704
BAI3
Brain-specific angiogenesis inhibitor 3
34.6 text missing or illegible when filed


Hs.525572
NM_000710
BDKRB1
Bradykinin receptor B1
25.5 text missing or illegible when filed


Hs.654542
NM_000623
BDKRB2
Bradykinin receptor B2
29.2 text missing or illegible when filed


Hs.121484
NM_001727
BRS3
Bombesin-like receptor 3
34.5 text missing or illegible when filed


Hs.591148
NM_004054
C3AR1
Complement component 3a receptor 1
31.7 text missing or illegible when filed


Hs.2161
NM_001736
C5AR1
Complement component 5a receptor 1
30.5 text missing or illegible when filed


Hs.489127
NM_001742
CALCR
CALCITONIN RECEPTOR
38.1 text missing or illegible when filed


Hs.470882
NM_005795
CALCRL
Calcitonin receptor-like
31.1 text missing or illegible when filed


Hs.435615
NM_000388
CASR
Calcium-sensing receptor
31.3 text missing or illegible when filed


Hs.146346
NM_001296
CCBP2
Chemokine binding protein 2
27.7 text missing or illegible when filed


Hs.129
NM_000730
CCKAR
Cholecystokinin A receptor
32.4 text missing or illegible when filed


Hs.203
NM_176875
CCKBR
Cholecystokinin B receptor
34.9 text missing or illegible when filed


Hs.301921
NM_001295
CCR1
Chemokine (C-C motif) receptor 1
30.5 text missing or illegible when filed


Hs.278446
NM_016602
CCR10
Chemokine (C-C motif) receptor 10
29.8 text missing or illegible when filed


Hs.511794
NM_001123396
CCR2
Chemokine (C-C motif) receptor 2
34.7 text missing or illegible when filed


Hs.506190
NM_001837
CCR3
Chemokine (C-C motif) receptor 3
33.3 text missing or illegible when filed


Hs.184926
NM_005508
CCR4
Chemokine (C-C motif) receptor 4
32.9 text missing or illegible when filed


Hs.450802
NM_000579
CCR5
Chemokine (C-C motif) receptor 5
32.8 text missing or illegible when filed


Hs.46468
NM_004367
CCR6
Chemokine (C-C motif) receptor 6
33.7 text missing or illegible when filed


Hs.370036
NM_001838
CCR7
Chemokine (C-C motif) receptor 7
30.4 text missing or illegible when filed


Hs.113222
NM_005201
CCR8
Chemokine (C-C motif) receptor 8
36.9 text missing or illegible when filed


Hs.225946
NM_006641
CCR9
Chemokine (C-C motif) receptor 9
33.7 text missing or illegible when filed


Hs.729361
NM_016557
CCRL1
Chemokine (C-C motif) receptor-like 1
24.6 text missing or illegible when filed


Hs.535713
NM_003965
CCRL2
Chemokine (C-C motif) receptor-like 2
32.8 text missing or illegible when filed


Hs.466039
NM_001784
CD97
CD97 molecule
23.1 text missing or illegible when filed


Hs.252387
NM_014246
CELSR1
Cadherin, EGF LAG seven-pass G-type receptor 1
29.5 text missing or illegible when filed


Hs.57652
NM_001408
CELSR2
Cadherin, EGF LAG seven-pass G-type receptor 2
32.5 text missing or illegible when filed


Hs.631926
NM_001407
CELSR3
Cadherin, EGF LAG seven-pass G-type receptor 3
32.9 text missing or illegible when filed


Hs.632119
NM_000738
CHRM1
Cholinergic receptor, muscarinic 1
40


Hs.535891
NM_000739
CHRM2
Cholinergic receptor, muscarinic 2
26.1 text missing or illegible when filed


Hs.7138
NM_000740
CHRM3
Cholinergic receptor, muscarinic 3
36.7 text missing or illegible when filed


Hs.248100
NM_000741
CHRM4
Cholinergic receptor, muscarinic 4
30.1 text missing or illegible when filed


Hs.584747
NM_012125
CHRM5
Cholinergic receptor, muscarinic 5
31.4 text missing or illegible when filed


Hs.197143
NM_004072
CMKLR1
CHEMOKINE-LIKE RECEPTOR 1
34.5 text missing or illegible when filed


Hs.75110
NM_016083
CNR1
Cannabinoid receptor 1 (brain)
36.1 text missing or illegible when filed


Hs.73037
NM_001841
CNR2
Cannabinoid receptor 2 (macrophage)
27.8 text missing or illegible when filed


Hs.300684
NM_014478
CRCP
CGRP receptor component
24.2 text missing or illegible when filed


Hs.417628
NM_004382
CRHR1
Corticotropin releasing hormone receptor 1
33


Hs.729970
NM_001883
CRHR2
Corticotropin releasing hormone receptor 2
35.5 text missing or illegible when filed


Hs.78913
NM_001337
CX3CR1
Chemokine (C—X3—C motif) receptor 1
35.8 text missing or illegible when filed


Hs.194778
NM_000634
CXCR1
Chemokine (C—X—C motif) receptor 1
38.6 text missing or illegible when filed


Hs.846
NM_001557
CXCR2
Chemokine (C—X—C motif) receptor 2
26.1 text missing or illegible when filed


Hs.198252
NM_001504
CXCR3
Chemokine (C—X—C motif) receptor 3
31.5 text missing or illegible when filed


Hs.593413
NM_003467
CXCR4
Chemokine (C—X—C motif) receptor 4
33.7 text missing or illegible when filed


Hs.113916
NM_001716
CXCR5
Chemokine (C—X—C motif) receptor 5
34.7 text missing or illegible when filed


Hs.34526
NM_006564
CXCR6
Chemokine (C—X—C motif) receptor 6
29.4 text missing or illegible when filed


Hs.471751
NM_020311
CXCR7
Chemokine (C—X—C motif) receptor 7
29.5 text missing or illegible when filed


Hs.201300
NM_006639
CYSLTR1
Cysteinyl leukotriene receptor 1
34.6 text missing or illegible when filed


Hs.253706
NM_020377
CYSLTR2
Cysteinyl leukotriene receptor 2
36.8 text missing or illegible when filed


Hs.153381
NM_002036
DARC
Duffy blood group, chemokine receptor
40


Hs.2624
NM_000794
DRD1
Dopamine receptor D1 (*)
26.4 text missing or illegible when filed


Hs.73893
NM_000795
DRD2
Dopamine receptor D2
32.9 text missing or illegible when filed


Hs.121478
NM_000796
DRD3
Dopamine receptor D3
32.2 text missing or illegible when filed


Hs.99922
NM_000797
DRD4
Dopamine receptor D4
33.5 text missing or illegible when filed


Hs.380681
NM_000798
DRD5
Dopamine receptor D5 (*)
35.7 text missing or illegible when filed


Hs.183713
NM_001957
EDNRA
Endothelin receptor type A
24.0 text missing or illegible when filed


Hs.82002
NM_000115
EDNRB
Endothelin receptor type B
27.7 text missing or illegible when filed


Hs.132314
NM_022159
ELTD1
EGF, latrophilin and seven transmembrane domain containing 1
25.5 text missing or illegible when filed


Hs.2375
NM_001974
EMR1
Egf-like module containing, mucin-like, hormone receptor-like 1
31.0 text missing or illegible when filed


Hs.482562
NM_001992
F2R
Coagulation factor II (thrombin) receptor
20.4 text missing or illegible when filed


Hs.154299
NM_005242
F2RL1
Coagulation factor II (thrombin) receptor-like 1
23.3 text missing or illegible when filed


Hs.42502
NM_004101
F2RL2
Coagulation factor II (thrombin) receptor-like 2
23.3 text missing or illegible when filed


Hs.137574
NM_003950
F2RL3
Coagulation factor II (thrombin) receptor-like 3
32.5 text missing or illegible when filed


Hs.248127
NM_005303
FFAR1
Free fatty acid receptor 1
34.8 text missing or illegible when filed


Hs.248056
NM_005306
FFAR2
Free fatty acid receptor 2
40


Hs.248055
NM_005304
FFAR3
Free fatty acid receptor 3
35.5 text missing or illegible when filed


Hs.753
NM_002029
FPR1
Formyl peptide receptor 1
35.8 text missing or illegible when filed


Hs.99855
NM_001462
FPR2
Formyl peptide receptor 2
33.2 text missing or illegible when filed


Hs.445466
NM_002030
FPR.3
Formyl peptide receptor 3
33.4 text missing or illegible when filed


Hs.1428
NM_181446
FSHR
Follicle stimulating hormone receptor
35.8 text missing or illegible when filed


Hs.94234
NM_003505
FZD1
Frizzled family receptor 1
23.2 text missing or illegible when filed


Hs.31664
NM_007197
FZD10
Frizzled family receptor 10
37.6 text missing or illegible when filed


Hs.142912
NM_001466
FZD2
Frizzled family receptor 2
26.9 text missing or illegible when filed


Hs.40735
NM_017412
FZD3
Frizzled family receptor 3 (*)
29.1 text missing or illegible when filed


Hs.19545
NM_012193
FZD4
Frizzled family receptor 4
25.5 text missing or illegible when filed


Hs.17631
NM_003468
FZD5
Frizzled family receptor 5
29.4 text missing or illegible when filed


Hs.591863
NM_003506
FZD6
Frizzled family receptor 6
23.5 text missing or illegible when filed


Hs.173859
NM_003507
FZD7
Frizzled family receptor 7
25.4 text missing or illegible when filed


Hs.302634
NM_031866
FZD8
Frizzled family receptor 8
28.6 text missing or illegible when filed


Hs.647029
NM_003508
FZD9
Frizzled family receptor 9
33.0 text missing or illegible when filed


Hs.167017
NM_001470
GABBR1
Gamma-aminobutyric acid (GABA) B receptor, 1
29.8 text missing or illegible when filed


Hs.198612
NM_005458
GABBR2
Gamma-aminobutyric acid (GABA) B receptor, 2
23.5 text missing or illegible when filed


Hs.272191
NM_001480
GALR1
Galanin receptor 1
37.8 text missing or illegible when filed


Hs.666366
NM_003857
GALR2
GALANIN RECEPTOR 2
34.9 text missing or illegible when filed


Hs.158353
NM_003614
GALR3
Galanin receptor 3
35.0 text missing or illegible when filed


Hs.208
NM_000160
GCGR
Glucagon receptor (*)
40


Hs.767
NM_000823
GHRHR
Growth hormone releasing hormone receptor (*)
32.2 text missing or illegible when filed


Hs.248115
NM_004122
GHSR
Growth hormone secretagogue receptor
35.5 text missing or illegible when filed


Hs.658534
NM_000164
GIPR
Gastric inhibitory polypeptide receptor (*)
31.2 text missing or illegible when filed


Hs.389103
NM_002062
GLP1R
Glucagon-like peptide 1 receptor
40


Hs.248202
NM_004246
GLP2R
Glucagon-like peptide 2 receptor
35.4 text missing or illegible when filed


Hs.407587
NM_000406
GNRHR
Gonadotropin-releasing hormone receptor
33.1 text missing or illegible when filed


Hs.160954
NM_170699
GPBAR1
G protein-coupled bile acid receptor 1 (*)
32.4 text missing or illegible when filed


Hs.20961
NM_001505
GPER
G protein-coupled estrogen receptor 1
28.5 text missing or illegible when filed


Hs.184907
NM_005279
GPR1
G protein-coupled receptor 1
26.6 text missing or illegible when filed


Hs.350569
NM_054021
GPR101
G protein-coupled receptor 101 (*)
34.3 text missing or illegible when filed


Hs.256897
NM_153840
GPR110
G protein-coupled receptor 110
33.0 text missing or illegible when filed


Hs.715357
NM_153839
GPR111
G protein-coupled receptor 111
33.7 text missing or illegible when filed


Hs.381354
NM_153834
GPR112
G protein-coupled receptor 112
40


Hs.631878
NM_153835
GPR113
G protein-coupled receptor 113
34.2 text missing or illegible when filed


Hs.187884
NM_153837
GPR114
G protein-coupled receptor 114
31.8 text missing or illegible when filed


Hs.710050
NM_153838
GPR115
G protein-coupled receptor 115
40


Hs.362806
NM_015234
GPR116
G protein-coupled receptor 116
27.9 text missing or illegible when filed


Hs.496762
NM_178471
GPR119
G protein-coupled receptor 119 (*)
35.6 text missing or illegible when filed


Hs.123034
NM_005288
GPR12
G protein-coupled receptor 12
33.5 text missing or illegible when filed


Hs.435183
NM_001083909
GPR123
G protein-coupled receptor 123
34.4 text missing or illegible when filed


Hs.708086
NM_032777
GPR124
G protein-coupled receptor 124
27.9 text missing or illegible when filed


Hs.99195
NM_145290
GPR125
G protein-coupled receptor 125
24.4 text missing or illegible when filed


Hs.715560
NM_020455
GPR126
G protein-coupled receptor 126
22.4 text missing or illegible when filed


Hs.334511
NM_032787
GPR128
G protein-coupled receptor 128
36.1 text missing or illegible when filed


Hs.532504
NM_013345
GPR132
G protein-coupled receptor 132
28.8 text missing or illegible when filed


Hs.656751
NM_198827
GPR133
G protein-coupled receptor 133
27.9 text missing or illegible when filed


Hs.647573
NM_022571
GPR135
G protein-coupled receptor 135
28.6 text missing or illegible when filed


Hs.446875
NM_001002911
GPR139
G protein-coupled receptor 139
30.4 text missing or illegible when filed


Hs.688230
NM_181791
GPR141
G protein-coupled receptor 141
37.0 text missing or illegible when filed


Hs.574368
NM_181790
GPR142
G protein-coupled receptor 142
35.8 text missing or illegible when filed


Hs.74124
NM_000273
GPR143
G protein-coupled receptor 143
34.1 text missing or illegible when filed


Hs.454099
NM_001161808
GPR144
G protein-coupled receptor 144
33.5 text missing or illegible when filed


Hs.729332
NM_138445
GPR146
G protein-coupled receptor 146
31.7 text missing or illegible when filed


Hs.452574
NM_207364
GPR148
G protein-coupled receptor 148
35.2 text missing or illegible when filed


Hs.688231
NM_001038705
GPR149
G protein-coupled receptor 149
31.0 text missing or illegible when filed


Hs.563128
NM_005290
GPR15
G protein-coupled receptor 15
36.4 text missing or illegible when filed


Hs.143315
NM_199243
GPR150
G protein-coupled receptor 150
32.5 text missing or illegible when filed


Hs.483732
NM_194251
GPR151
G protein-coupled receptor 151
33.1 text missing or illegible when filed


Hs.567997
NM_206997
GPR152
G protein-coupled receptor 152
30.5 text missing or illegible when filed


Hs.531581
NM_207370
GPR153
G protein-coupled receptor 153
27.1 text missing or illegible when filed


Hs.333358
NM_153002
GPR156
G protein-coupled receptor 156
32.0 text missing or illegible when filed


Hs.632367
NM_024980
GPR157
G protein-coupled receptor 157
27.5 text missing or illegible when filed


Hs.499108
NM_020752
GPR158
G protein-coupled receptor 158
33.6 text missing or illegible when filed


Hs.231320
NM_014373
GPR160
G protein-coupled receptor 160
29.2 text missing or illegible when filed


Hs.271809
NM_153832
GPR161
G protein-coupled receptor 161
25.8 text missing or illegible when filed


Hs.631654
NM_014449
GPR162
G protein-coupled receptor 162
26.7 text missing or illegible when filed


Hs.46453
NM_005291
GPR17
G protein-coupled receptor 17
31.2 text missing or illegible when filed


Hs.549152
NM_013308
GPR171
G protein-coupled receptor 171
33.1 text missing or illegible when filed


Hs.661815
NM_018969
GPR173
G protein-coupled receptor 173
28.1 text missing or illegible when filed


Hs.326713
NM_032553
GPR174
G protein-coupled receptor 174
38.4 text missing or illegible when filed


Hs.37196
NM_007223
GPR176
G protein-coupled receptor 176
21.9 text missing or illegible when filed


Hs.462915
NM_001004334
GPR179
G protein-coupled receptor 179
33.8 text missing or illegible when filed


Hs.631765
NM_005292
GPR18
G protein-coupled receptor 18
29.7 text missing or illegible when filed


Hs.483909
NM_007264
GPR182
G protein-coupled receptor 182
32.2 text missing or illegible when filed


Hs.784
NM_004951
GPR183
G protein-coupled receptor 183
27.5 text missing or illegible when filed


Hs.657862
NM_006143
GPR19
G protein-coupled receptor 19
31.6 text missing or illegible when filed


Hs.188859
NM_005293
GPR20
G protein-coupled receptor 20
34.5 text missing or illegible when filed


Hs.728941
NM_005294
GPR21
G protein-coupled receptor 21
31.0 text missing or illegible when filed


Hs.657277
NM_005295
GPR22
G protein-coupled receptor 22
31.4 text missing or illegible when filed


Hs.534316
NM_005298
GPR25
G protein-coupled receptor 25
37.4 text missing or illegible when filed


Hs.12751
NM_153442
GPR26
G protein-coupled receptor 26 (*)
34.8 text missing or illegible when filed


Hs.591653
NM_018971
GPR27
G protein-coupled receptor 27
28.0 text missing or illegible when filed


Hs.66542
NM_005281
GPR3
G protein-coupled receptor 3 (*)
26.1 text missing or illegible when filed


Hs.248124
NM_005299
GPR31
G protein-coupled receptor 31
31


Hs.515555
NM_001506
GPR32
G protein-coupled receptor 32
36.0 text missing or illegible when filed


Hs.495989
NM_005300
GPR34
G protein-coupled receptor 34
31.4 text missing or illegible when filed


Hs.239891
NM_005301
GPR35
G protein-coupled receptor 35
34.2 text missing or illegible when filed


Hs.406094
NM_005302
GPR37
G protein-coupled receptor 37
24.8 text missing or illegible when filed


Hs.132049
NM_004767
GPR37L1
G protein-coupled receptor 37 like 1
32.8 text missing or illegible when filed


Hs.432395
NM_001508
GPR39
G protein-coupled receptor 39
28.5 text missing or illegible when filed


Hs.17170
NM_005282
GPR4
G protein-coupled receptor 4
29.1 text missing or illegible when filed


Hs.299567
NM_004778
PTGDR2
Prostaglandin D2 receptor 2
37.6 text missing or illegible when filed


Hs.590903
NM_007227
GPR45
G protein-coupled receptor 45
33.1 text missing or illegible when filed


Hs.567390
NM_004224
GPR50
G protein-coupled receptor 50
34.9 text missing or illegible when filed


Hs.673850
NM_005684
GPR52
G protein-coupled receptor 52
31.7 text missing or illegible when filed


Hs.114545
NM_005683
GPR55
G protein-coupled receptor 55
33.5 text missing or illegible when filed


Hs.513633
NM_005682
GPR56
G protein-coupled receptor 56
26.5 text missing or illegible when filed


Hs.46332
NM_005284
GPR6
G protein-coupled receptor 6
36.1 text missing or illegible when filed


Hs.709782
NM_031936
GPR61
G protein-coupled receptor 61 (*)
37.7 text missing or illegible when filed


Hs.232213
NM_080865
GPR62
G protein-coupled receptor 62
35.1 text missing or illegible when filed


Hs.632612
NM_030784
GPR63
G protein-coupled receptor 63
28.6 text missing or illegible when filed


Hs.146978
NM_005756
GPR64
G protein-coupled receptor 64
30.1 text missing or illegible when filed


Hs.513440
NM_003608
GPR65
G protein-coupled receptor 65 (*)
32.0 text missing or illegible when filed


Hs.8882
NM_003485
GPR68
G protein-coupled receptor 68
25.8 text missing or illegible when filed


Hs.696596
NM_006794
GPR75
G protein-coupled receptor 75
25.5 text missing or illegible when filed


Hs.534412
NM_018485
GPR77
G protein-coupled receptor 77
36.1 text missing or illegible when filed


Hs.350588
NM_080819
GPR78
G protein-coupled receptor 78 (*)
32.7 text missing or illegible when filed


Hs.664795
NM_080817
GPR82
G protein-coupled receptor 82
31.7 text missing or illegible when filed


Hs.272385
NM_016540
GPR83
G protein-coupled receptor 83
30.9 text missing or illegible when filed


Hs.306199
NM_020370
GPR84
G protein-coupled receptor 84
35.0 text missing or illegible when filed


Hs.152009
NM_018970
GPR85
G protein-coupled receptor 85
27.7 text missing or illegible when filed


Hs.591292
NM_023915
GPR87
G protein-coupled receptor 87
32.9 text missing or illegible when filed


Hs.170053
NM_022049
GPR88
G protein-coupled receptor 88
30.9 text missing or illegible when filed


Hs.383403
NM_170776
GPR97
G protein-coupled receptor 97
32.7 text missing or illegible when filed


Hs.591777
NM_032119
GPR98
G protein-coupled receptor 98
35.7 text missing or illegible when filed


Hs.631733
NM_003979
GPRC5A
G protein-coupled receptor, family C, group 5, member A
23.5 text missing or illegible when filed


Hs.148685
NM_016235
GPRC5B
G protein-coupled receptor, family C, group 5, member B
29.2 text missing or illegible when filed


Hs.446438
NM_018653
GPRC5C
G protein-coupled receptor, family C, group 5, member C
33.9 text missing or illegible when filed


Hs.644599
NM_018654
GPRC5D
G protein-coupled receptor, family C, group 5, member D
29.4 text missing or illegible when filed


Hs.266745
NM_148963
GPRC6A
G protein-coupled receptor, family C, group 6, member A
34.2 text missing or illegible when filed


Hs.128848
NM_000831
GRIK3
Glutamate receptor, ionotropic, kainate 3
40


Hs.32945
NM_000838
GRM1
Glutamate receptor, metabotropic 1
36.8 text missing or illegible when filed


Hs.121510
NM_000839
GRM2
Glutamate receptor, metabotropic 2
32.2 text missing or illegible when filed


Hs.590575
NM_000840
GRM3
Glutamate receptor, metabotropic 3
36.8 text missing or illegible when filed


Hs.654847
NM_000841
GRM4
Glutamate receptor, metabotropic 4
33.1 text missing or illegible when filed


Hs.147361
NM_000842
GRM5
Glutamate receptor, metabotropic 5
31.8 text missing or illegible when filed


Hs.248131
NM_000843
GRM6
Glutamate receptor, metabotropic 6
35.3 text missing or illegible when filed


Hs.606393
NM_000844
GRM7
Glutamate receptor, metabotropic 7
33.6 text missing or illegible when filed


Hs.449625
NM_000845
GRM8
Glutamate receptor, metabotropic 8
34.0 text missing or illegible when filed


Hs.567282
NM_005314
GRPR
Gastrin-releasing peptide receptor
28.1 text missing or illegible when filed


Hs.610873
NM_032554
HCAR1
Hydroxycarboxylic acid receptor 1
31.7 text missing or illegible when filed


Hs.524812
NM_177551
HCAR2
Hydroxycarboxylic acid receptor 2
33.9 text missing or illegible when filed


Hs.388226
NM_001525
HCRTR1
Hypocretin (orexin) receptor 1
33.8 text missing or illegible when filed


Hs.151624
NM_001526
HCRTR2
Hypocretin (orexin) receptor 2
37.9 text missing or illegible when filed


Hs.1570
NM_000861
HRH1
Histamine receptor H1
25.7 text missing or illegible when filed


Hs.247885
NM_022304
HRH2
Histamine receptor H2
32.1 text missing or illegible when filed


Hs.251399
NM_007232
HRH3
Histamine receptor H3
31.4 text missing or illegible when filed


Hs.287388
NM_021624
HRH4
Histamine receptor H4
33.1 text missing or illegible when filed


Hs.247940
NM_000524
HTR1A
5-hydroxytryptamine (serotonin) receptor 1A
35.6 text missing or illegible when filed


Hs.123016
NM_000863
HTR1B
5-hydroxytryptamine (serotonin) receptor 1B
29.4 text missing or illegible when filed


Hs.121482
NM_000864
HTR1D
5-hydroxytryptamine (serotonin) receptor 1D
33.8 text missing or illegible when filed


Hs.1611
NM_000865
HTR1E
5-hydroxytryptamine (serotonin) receptor 1E
40


Hs.248136
NM_000866
HTR1F
5-hydroxytryptamine (serotonin) receptor 1F
33.2 text missing or illegible when filed


Hs.654586
NM_000621
HTR2A
5-hydroxytryptamine (serotonin) receptor 2A
32.7 text missing or illegible when filed


Hs.421649
NM_000867
HTR2B
5-hydroxytryptamine (serotonin) receptor 2B
29.0 text missing or illegible when filed


Hs.149037
NM_000868
HTR2C
5-hydroxytryptamine (serotonin) receptor 2C
36.2 text missing or illegible when filed


Hs.413899
NM_000869
HTR3A
5-hydroxytryptamine (serotonin) receptor 3A
33.4 text missing or illegible when filed


Hs.241377
NM_006028
HTR3B
5-hydroxytryptamine (serotonin) receptor 3B
33.9 text missing or illegible when filed


Hs.483773
NM_000870
HTR4
5-hydroxytryptamine (serotonin) receptor 4
34.8 text missing or illegible when filed


Hs.65791
NM_024012
HTR5A
5-hydroxytryptamine (serotonin) receptor 5A
35.8 text missing or illegible when filed


Hs.22180
NM_000871
HTR6
5-hydroxytryptamine (serotonin) receptor 6
35.5 text missing or illegible when filed


Hs.73739
NM_000872
HTR7
5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (*)
27.8 text missing or illegible when filed


Hs.208229
NM_032551
KISSIR
KISS1 receptor
34.0 text missing or illegible when filed


Hs.705413
NM_002303
LEPR
Leptin receptor
26.5 text missing or illegible when filed


Hs.502176
NM_018490
LGR4
Leucine-rich repeat containing G protein-coupled receptor 4
24.4 text missing or illegible when filed


Hs.658889
NM_003667
LGR5
Leucine-rich repeat containing G protein-coupled receptor 5
33.8 text missing or illegible when filed


Hs.468490
NM_000233
LHCGR
Luteinizing hormone/choriogonadotropin receptor
35.4 text missing or illegible when filed


Hs.126667
NM_057159
LPAR1
Lysophosphatidic acid receptor 1
22.0 text missing or illegible when filed


Hs.122575
NM_004720
LPAR2
Lysophosphatidic acid receptor 2
29.1 text missing or illegible when filed


Hs.674915
NM_012152
LPAR3
Lysophosphatidic acid receptor 3
27.3 text missing or illegible when filed


Hs.522701
NM_005296
LPAR4
Lysophosphatidic acid receptor 4
31.2 text missing or illegible when filed


Hs.155538
NM_020400
LPAR5
Lysophosphatidic acid receptor 5
33.2 text missing or illegible when filed


Hs.123464
NM_005767
LPAR6
Lysophosphatidic acid receptor 6
28.7 text missing or illegible when filed


Hs.654658
NM_014921
LPHN1
Latrophilin 1
33.5 text missing or illegible when filed


Hs.24212
NM_012302
LPHN2
Latrophilin 2
23.4 text missing or illegible when filed


Hs.28391
NM_015236
LPHN3
Latrophilin 3
34.5 text missing or illegible when filed


Hs.655431
NM_181657
LTB4R
Leukotriene B4 receptor
32.2 text missing or illegible when filed


Hs.130685
NM_019839
LTB4R2
Leukotriene B4 receptor 2
31.2 text missing or illegible when filed


Hs.99900
NM_002377
MAS1
MAS1 oncogene
36


Hs.513829
NM_002386
MC1R
Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) (*)
30.3 text missing or illegible when filed


Hs.248144
NM_000529
MC2R
Melanocortin 2 receptor (adrenocorticotropic hormone) (*)
40


Hs.248018
NM_019888
MC3R
Melanocortin 3 receptor (*)
30.9 text missing or illegible when filed


Hs.532833
NM_005912
MC4R
Melanocortin 4 receptor (*)
35.4 text missing or illegible when filed


Hs.248145
NM_005913
MC5R
Melanocortin 5 receptor (*)
31.5 text missing or illegible when filed


Hs.248122
NM_005297
MCHR1
Melanin-concentrating hormone receptor 1
34


Hs.591342
NM_032503
MCHR2
Melanin-concentrating hormone receptor 2
37.3 text missing or illegible when filed


Hs.527802
NM_198923
MRGPRD
MAS-related GPR, member D
31.3 text missing or illegible when filed


Hs.706565
NM_001039165
MRGPRE
MAS-related GPR, member E
31.6 text missing or illegible when filed


Hs.118513
NM_145015
MRGPRF
MAS-related GPR, member F
25.4 text missing or illegible when filed


Hs.730306
NM_001164377
MRGPRG
MAS-related GPR, member G
27.3 text missing or illegible when filed


Hs.711459
NM_147199
MRGPRX1
MAS-related GPR, member X1
37.0 text missing or illegible when filed


Hs.350566
NM_054030
MRGPRX2
MAS-related GPR, member X2
25.9 text missing or illegible when filed


Hs.380177
NM_054031
MRGPRX3
MAS-related GPR, member X3
34.0 text missing or illegible when filed


Hs.632138
NM_054032
MRGPRX4
MAS-related GPR, member X4
35.6 text missing or illegible when filed


Hs.243467
NM_005958
MTNR1A
Melatonin receptor 1A
34.8 text missing or illegible when filed


Hs.569039
NM_005959
MTNR1B
Melatonin receptor 1B
30.7 text missing or illegible when filed


Hs.654478
NM_002511
NMBR
Neuromedin B receptor
32.9 text missing or illegible when filed


Hs.471619
NM_006056
NMUR1
Neuromedin U receptor 1
33.9 text missing or illegible when filed


Hs.283093
NM_020167
NMUR2
Neuromedin U receptor 2
34.6 text missing or illegible when filed


Hs.248117
NM_005285
NPBWR1
Neuropeptides B/W receptor 1
36.1 text missing or illegible when filed


Hs.248118
NM_005286
NPBWR2
Neuropeptides B/W receptor 2
37.4 text missing or illegible when filed


Hs.302026
NM_022146
NPFFR1
Neuropeptide FF receptor 1
34.2 text missing or illegible when filed


Hs.99231
NM_053036
NPFFR2
Neuropeptide FF receptor 2
40


Hs.490330
NM_000906
NPR1
Natriuretic peptide receptor A
28.7 text missing or illegible when filed


Hs.78518
NM_003995
NPR2
Natriuretic peptide receptor B
25.4 text missing or illegible when filed


Hs.237028
NM_000908
NPR3
Natriuretic peptide receptor B
26.2 text missing or illegible when filed


Hs.652373
NM_207172
NPSR1
Neuropeptide S receptor 1
34.0 text missing or illegible when filed


Hs.519057
NM_000909
NPY1R
Neuropeptide Y receptor Y1
32.3 text missing or illegible when filed


Hs.37125
NM_000910
NPY2R
Neuropeptide Y receptor Y2
30.6 text missing or illegible when filed


Hs.598503
NM_006174
NPY5R
Neuropeptide Y receptor Y5
38.2 text missing or illegible when filed


Hs.590869
NM_002531
NTSR1
Neurotensin receptor 1 (high affinity)
27.6 text missing or illegible when filed


Hs.131138
NM_012344
NTSR2
Neurotensin receptor 2
34.1 text missing or illegible when filed


Hs.677835
NM_181745
O3FAR1
Omega-3 fatty acid receptor 1
35.3 text missing or illegible when filed


Hs.67896
NM_007346
OGFR
Opioid growth factor receptor
26.1 text missing or illegible when filed


Hs.656404
NM_001708
OPNISW
Opsin 1 (cone pigments), short-wave-sensitive
24.4 text missing or illegible when filed


Hs.534399
NM_014322
OPN3
Opsin 3
26.3 text missing or illegible when filed


Hs.283922
NM_033282
OPN4
Opsin 4
33.6 text missing or illegible when filed


Hs.213717
NM_181744
OPN5
Opsin 5
40


Hs.372
NM_000911
OPRD1
Opioid receptor, delta 1
30.8 text missing or illegible when filed


Hs.106795
NM_000912
OPRK1
Opioid receptor, kappa 1
34.6 text missing or illegible when filed


Hs.2859
NM_000913
OPRL1
Opiate receptor-like 1
33.9 text missing or illegible when filed


Hs.2353
NM_000914
OPRM1
Opioid receptor, mu 1
35.4 text missing or illegible when filed


Hs.352218
NM_080818
OXGR1
Oxoglutarate (alpha-ketoglutarate) receptor 1
40


Hs.2820
NM_000916
OXTR
Oxytocin receptor
25.2 text missing or illegible when filed


Hs.654526
NM_002563
P2RY1
Purinergic receptor P2Y, G-protein coupled, 1
29.2 text missing or illegible when filed


Hs.296433
NM_198333
P2RY10
Purinergic receptor P2Y, G-protein coupled, 10
40


Hs.166168
NM_002566
P2RY11
Purinergic receptor P2Y, G-protein coupled, 11
31.6 text missing or illegible when filed


Hs.591281
NM_022788
P2RY12
Purinergic receptor P2Y, G-protein coupled, 12
32.4 text missing or illegible when filed


Hs.546396
NM_176894
P2RY13
Purinergic receptor P2Y, G-protein coupled, 13
33.6 text missing or illegible when filed


Hs.2465
NM_014879
P2RY14
Purinergic receptor P2Y, G-protein coupled, 14
34.6 text missing or illegible when filed


Hs.339
NM_002564
P2RY2
Purinergic receptor P2Y, G-protein coupled, 2
35.4 text missing or illegible when filed


Hs.673854
NM_002565
P2RY4
Pyrimidinergic receptor P2Y, G-protein coupled, 4
34.1 text missing or illegible when filed


Hs.16362
NM_004154
P2RY6
Pyrimidinergic receptor P2Y, G-protein coupled, 6
34.5 text missing or illegible when filed


Hs.111377
NM_178129
P2RY8
Purinergic receptor P2Y, G-protein coupled, 8
36.9 text missing or illegible when filed


Hs.509067
NM_002609
PDGFRB
Platelet-derived growth factor receptor, beta polypeptide
27.5 text missing or illegible when filed


Hs.458573
NM_006207
PDGFRL
Platelet-derived growth factor receptor-like
26.5 text missing or illegible when filed


Hs.524719
NM_005972
PPYR1
Pancreatic polypeptide receptor 1
29


Hs.248119
NM_004248
PRLHR
Prolactin releasing hormone receptor
32.8 text missing or illegible when filed


Hs.683430
NM_138964
PROKR1
Prokineticin receptor 1
40


Hs.375029
NM_144773
PROKR2
Prokineticin receptor 2
35.4 text missing or illegible when filed


Hs.709174
NM_000952
PTAFR
Platelet-activating factor receptor
31.9 text missing or illegible when filed


Hs.306831
NM_000953
PTGDR
Prostaglandin D2 receptor (DP) (*)
25.3 text missing or illegible when filed


Hs.159360
NM_000955
PTGER1
Prostaglandin E receptor 1 (subtype EP1), 42kDa
32.1 text missing or illegible when filed


Hs.2090
NM_000956
PTGER2
Prostaglandin E receptor 2 (subtype EP2), 53kDa (*)
25.8 text missing or illegible when filed


Hs.445000
NM_198715
PTGER3
Prostaglandin E receptor 3 (subtype EP3)
26.9 text missing or illegible when filed


Hs.199248
NM_000958
PTGER4
Prostaglandin E receptor 4 (subtype EP4)
26.6 text missing or illegible when filed


Hs.654365
NM_000959
PTGFR
Prostaglandin F receptor (FP)
27.1 text missing or illegible when filed


Hs.458324
NM_000960
PTGIR
Prostaglandin 12 (prostacyclin) receptor (IP)
28.3 text missing or illegible when filed


Hs.1019
NM_000316
PTH1R
Parathyroid hormone 1 receptor
33.5 text missing or illegible when filed


Hs.570296
NM_005048
PTH2R
Parathyroid hormone 2 receptor
36.1 text missing or illegible when filed


Hs.368977
NM_198179
QRFPR
Pyroglutamylated RFamide peptide receptor
34.8 text missing or illegible when filed


Hs.1544
NM_002921
RGR
Retinal G protein coupled receptor
33.4 text missing or illegible when filed


Hs.247565
NM_000539
RHO
Rhodopsin
31.9 text missing or illegible when filed


Hs.658310
NM_006583
RRH
Retinal pigment epithelium-derived rhodopsin homolog
33.0 text missing or illegible when filed


Hs.591686
NM_021634
RXFP1
Relaxin/insulin-like family peptide receptor 1
33.2 text missing or illegible when filed


Hs.680763
NM_130806
RXFP2
Relaxin/insulin-like family peptide receptor 2
33.2 text missing or illegible when filed


Hs.170146
NM_016568
RXFP3
Relaxin/insulin-like family peptide receptor 3
33.2 text missing or illegible when filed


Hs.449914
NM_181885
RXFP4
Relaxin/insulin-like family peptide receptor 4
34


Hs.154210
NM_001400
S1PR1
Sphingosine-1-phosphate receptor 1
26.4 text missing or illegible when filed


Hs.655405
NM_004230
S1PR2
Sphingosine-1-phosphate receptor 2
23.9 text missing or illegible when filed


Hs.585118
NM_005226
S1PR3
Sphingosine-1-phosphate receptor 3
25.5 text missing or illegible when filed


Hs.662006
NM_003775
S1PR4
Sphingosine-1-phosphate receptor 4
33.5 text missing or illegible when filed


Hs.501561
NM_030760
S1PR5
Sphingosine-1-phosphate receptor 5
37.4 text missing or illegible when filed


Hs.42091
NM_002980
SCTR
Secretin receptor
40


Hs.522087
NM_005866
SIGMAR1
Sigma non-opioid intracellular receptor 1
21.5 text missing or illegible when filed


Hs.437846
NM_005631
SMO
Smoothened, frizzled family receptor
27.8 text missing or illegible when filed


Hs.591915
NM_052918
SORCS1
Sortilin-related VPS10 domain containing receptor 1
32.1 text missing or illegible when filed


Hs.479099
NM_020777
SORCS2
Sortilin-related VPS10 domain containing receptor 2
32.7 text missing or illegible when filed


Hs.671950
NM_014978
SORCS3
Sortilin-related VPS10 domain containing receptor 3
40


Hs.248160
NM_001049
SSTR1
Somatostatin receptor 1
23.9 text missing or illegible when filed


Hs.514451
NM_001050
SSTR2
Somatostatin receptor 2
32.9 text missing or illegible when filed


Hs.225995
NM_001051
SSTR3
Somatostatin receptor 3
33.5 text missing or illegible when filed


Hs.673846
NM_001052
SSTR4
Somatostatin receptor 4
31.4 text missing or illegible when filed


Hs.449840
NM_001053
SSTR5
Somatostatin receptor 5
40


Hs.279575
NM_033050
SUCNR
Succinate receptor 1
34.4 text missing or illegible when filed


Hs.375030
NM_138327
TAAR1
Trace amine associated receptor 1
35.0 text missing or illegible when filed


Hs.272382
NM_014626
TAAR2
Trace amine associated receptor 2
36.9 text missing or illegible when filed


Hs.248198
NM_003967
TAAR5
Trace amine associated receptor 5
27.0 text missing or illegible when filed


Hs.434196
NM_175067
TAAR6
Trace amine associated receptor 6
33.8 text missing or illegible when filed


Hs.434116
NM_175057
TAAR9
Trace amine associated receptor 9 (gene/pseudogene)
35.8 text missing or illegible when filed


Hs.633301
NM_001058
TACR1
Tachykinin receptor 1
28.1 text missing or illegible when filed


Hs.88372
NM_001057
TACR2
Tachykinin receptor 2
28.2 text missing or illegible when filed


Hs.942
NM_001059
TACR3
Tachykinin receptor 3
31.3 text missing or illegible when filed


Hs.442530
NM_001060
TBXA2R
Thromboxane A2 receptor
29.6 text missing or illegible when filed


Hs.656790
NM_032027
TM2D1
TM2 domain containing 1
24.1 text missing or illegible when filed


Hs.3022
NM_003301
TRHR
Thyrotropin-releasing hormone receptor
32.5 text missing or illegible when filed


Hs.160411
NM_000369
TSHR
Thyroid stimulating hormone receptor
34.5 text missing or illegible when filed


Hs.192720
NM_018949
UTS2R
Urotensin 2 receptor
32.5 text missing or illegible when filed


Hs.348500
NM_004624
VIPR1
Vasoactive intestinal peptide receptor 1
34.5 text missing or illegible when filed


Hs.585052
NM_003382
VIPR2
Vasoactive intestinal peptide receptor 2 (*)
35.0 text missing or illegible when filed


Hs.248116
NM_005283
XCR1
Chemokine (C motif) receptor 1
35.0 text missing or illegible when filed


Hs.227656
NM_004736
XPR1
Xenotropic and polytropic retrovirus receptor 1
23.4 text missing or illegible when filed


Hs.592355
NM_002046
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
17.3 text missing or illegible when filed






text missing or illegible when filed indicates data missing or illegible when filed







For all other in vitro experiments, cells were treated as indicated prior to RNA isolation using RNeasy Plus Mini Kit (Qiagen) according to manufacturer's instructions. Isolated RNA (250 ng) was then used to synthesize cDNA using SuperScript VILO (Invitrogen). Quantitative PCR was performed using FastStart Essential DNA Green Master (Roche) and analyzed using a LightCycler 96 (Roche). Data are expressed as a fold change by ΔΔCt relative to GAPDH. For in vivo experiments, tissue was immediately frozen, and stored at −80° C. RNA isolation, cDNA synthesis, and qPCR analysis were performed as above. Primers used for qPCR are shown in Table 2.











TABLE 2







Human Primer
Sequence






DRD1
F: CCCAGCCCTATCAGTCATATTG,
SEQ ID NOs: 1 and 2



R: AGGATTCATCTGCGAGTTCAG






CTGF
F: GTCCAGCACGAGGCTCA,
SEQ ID NOs: 3 and 4



R: TCGCCTTCGTGGTCCTC






COL1A1
F: AAGGGACACAGAGGTTTCAGTGG,
SEQ ID NOs: 5 and 6



R: CAGCACCAGTAGCACCATCATTTC






ACTA2
F: GTGAAGAAGAGGACAGCACTG,
SEQ ID NOs: 7 and 8



R: CCCATTCCCACCATC ACC






FN1
F: TGTCAGTCAAAGCAAGCCCG,
SEQ ID NOs: 9 and 10



R: TTAGGACGCTCATAAGTGTCACCC






TGM2
F: TCAGCTACAATGGGATCTTGG,
SEQ ID NOs: 11 and 12



R: AAGGCAGTCACGGTATTTCTC






LOX
F: ACATTCGCTACACAGGACATC,
SEQ ID NOs: 13 and 14



R: TTCCCACTTCAGAACACCAG






LOXL1
F: TGCCAGTGGATCGACATAAC,
SEQ ID NOs: 15 and 16



R: GAAACGTAGCGACCTGTGTAG






LOXL2
F: GTGCAGCGACAAAAGGATTC,
SEQ ID NOs: 17 and 18



R: GCGGTAGGTTGAGAGGATG






LOXL3
F: AGCGAAAAGAGGGTCAACG,
SEQ ID NOs: 19 and 20



R: TGTCATTGGCACGATAGAACTC






LOXL4
F: GTGGCAGAGTCAGATTTCTCC,
SEQ ID NOs: 21 and 22



R: TTGTTCCTGAGACGCTGTTC






PLAU
F: GGGAGATGAAGTTTGAGGTGG,
SEQ ID NOs: 23 and 24



R: AGATGGTCTGTATAGTCCGGG






PLAT
F: AAACCCAGATCGAGACTCAAAG,
SEQ ID NOs: 25 and 26



R: ACCCATTCCCAAAGTAGCAG






CTSK
F: CTCCTTCCAGTTTTACAGCAAAG,
SEQ ID NOs: 27 and 28



R: TTTCCCCAGTTTTCTCCCC






MMP14
F: TGCCTACCGACAAGATTGATG,
SEQ ID NOs: 29 and 30



R: ATCCCTTCCCAGACTTTGATG





Mouse Primer
Sequence





Drd1
F: CCCGTAGCCATTATGATCGTC,
SEQ ID NOs: 31 and 32



R: AGAGCATTCGACAGGGTTTC






Pdgfra
F: TCCTTCTACCACCTCAGCGAG,
SEQ ID NOs: 33 and 34



R: CCGGATGGTCACTCT TTAGGAAG






Epcam
F: TTGCTCCAAACTGGCGTCTA,
SEQ ID NOs: 35 and 36



R: ACGTGATCTCCGTGTCCTTGT






Pecam1
F: CTGCCAGTCCGAAAATGGAAC,
SEQ ID NOs: 37 and 38



R: CTTCATCCACTGGGGCTATC






Ptprc
F: GACAGAGTTAGTGAATGGAGACC,
SEQ ID NOs: 39 and 40



R: AAAAGTTCGGAGAGTGTAGGC






Acta2
F: GAGAAGCCCAGCCAGTCG,
SEQ ID NOs: 41 and 42



R: CTCTTGCTCTGGGCTTCA






Ctgf
F: CCTGCGACCCACACAAG,
SEQ ID NOs: 43 and 44



R: GACCCACCGAAGACACAG






Fn1
F: CCAGCAGCATGATCAAAACAC,
SEQ ID NOs: 45 and 46



R: GGTGGCTACATGTTAGAGTGTC






Col1a1
F: ATCATAGCCATAGGACATCTGG,
SEQ ID NOs: 47 and 48



R: CTGGACAGCCTGGACTTC






Yap1
F: CTCTGAGTGATCCTCTGGTTC,
SEQ ID NOs: 49 and 50



R: CCATAAGAACAAGACCACATCCT






WWtr1
F: CTTGCTGGTGTTGGTGATTC,
SEQ ID NOs: 51 and 52



R: ATCAGCCTCTGAATCATGTGAA






Alb
F: TGCTTTTTCCAGGGGTGTGTT,
SEQ ID NOs: 53 and 54



R: TTACTTCCTGCACTAATTTGGCA









Cell Sorting: FACS: PBS perfused mouse lungs were finely minced with a razor blade in a 100 mm petri dish in 1 mL of cold DMEM medium containing 0.2 mg/ml Liberase DL (Roche) and 100 U/ml DNase I (Roche). The mixture was transferred to 15 ml tubes and incubated at 37° C. for 30 min in a water bath. Enzymatic digestion was inactivated by adding DMEM medium containing 10% fetal bovine serum. The cell suspension was passed once through a 40 um cell strainer (Fisher) to remove multicellular debris. Cells were then centrifuged at 1,300 r.p.m. at 4° C. for 10 min, washed once in PBS and resuspended in 0.2 ml of FACS buffer (1% BSA, 0.5 μM EDTA pH 7.4 in PBS). The single cell suspension was then incubated with anti-CD45-PerCp-Cy5.5, anti-CD31-PE, anti-PDGFRα-APC and anti-EpCAM-BV421 antibodies (1:200) (Biolegend) for 20 min on ice. After incubation, cells were washed with ice-cold FACS buffer and resuspended in 1 ml of FACS buffer. FACS sorting was conducted using a BD FACS Aria II (BD Biosciences). FACS-sorted epithelial cells, endothelial cells and fibroblasts were collected in 1.5 mL Eppendorf tubes containing RLT lysis buffer (Qiagen), which were subjected to mRNA extraction, complementary DNA synthesis and RT-PCR analysis. MACS: PBS perfused mouse lungs were finely minced with a razor blade in a 100 mm petri dish in 1 ml of MACs dissociation solution described in the MACS mouse lung dissociation kit. The mixture was transferred to 15 ml tubes and incubated at 37° C. for 30 min in a water bath. Enzymatic digestion was inactivated by adding DMEM containing 10% fetal bovine serum. The cell suspension was passed once through a 40 μm cell strainer (Fisher) to remove multicellular debris. Cells were then centrifuged at 1,350 r.p.m. at 4° C. for 10 min and supernatant aspirated. The samples were resuspended in 0.1 mL 15% BSA-autoMACS rinsing solution. The single cell suspension was than incubated with mouse anti-CD45 MicroBeads (1:10) for 15 minutes at 4-8° C. Cells were then magnetically filtered using LS column (Miltenyi Biotec). Positively selected cells were pelleted at 1350 RPM at 4° C. and resuspended in RLT lysis buffer (Qiagen). Samples were then subjected to mRNA extraction, complementary DNA synthesis and RT-PCR analysis.


Immunofluorescence Microscopy: Cells were plated into 96 well plates (Corning 3603) in their specific growth media and allowed to attach (8 hours). Media was then exchanged for the indicated conditions for each experiment. Cells were fixed in 3.7% formalin (Sigma-Aldrich), permeabilized in 0.25% Triton X-100 (Sigma-Aldrich) and then blocked with 1% BSA for 1 h. Cells or tissue sections were incubated overnight with mouse monoclonal antibody against αSMA (Sigma-Aldrich F3777), and/or a rabbit monoclonal antibody against YAP/TAZ (Cell Signaling D24E4) diluted 1:200 in PBS with 1% BSA. Cells were then washed and exposed to flourescence-conjugated secondary antibodies (Invitrogen) diluted 1:1000 and DAPI (Thermo Fisher Scientific). Images were taken with a Cytation5 (BioTek) microscope. For scoring αSMA positive cells (FIG. 12), an observer blinded to the treatment conditions counted αSMA-positive cells using a visual threshold for bright fibrous staining; a minimum of 200 cells was counted for each condition. YAP/TAZ localization was quantified (FIGS. 6-10, 24-26, and 29-30) using Gen5 (Biotek) software. Images were taken at 4× magnification of both DAPI and YAP/TAZ staining. Objects were identified using the DAPI channel and a subpopulation of YAP/TAZ nuclear positive cells was counted based on nuclei where the average pixel intensity of the YAP/TAZ channel was greater than 85% of the average pixel intensity of all the nuclei in the control treated cells. Quantification of double positive (YAP/TAZ and αSMA) cells from lung tissue sections (FIG. 17-21) was performed similarly; however separate thresholds were established for both YAP/TAZ and αSMA. A minimum of 4000 cells was quantified for each mouse.


Traction Force Microscopy: Traction analysis was conducted as previously described. Briefly, polyacrylamide substrates with shear moduli of 6.4 kPa were prepared, and fluorescent sulfate-modified latex microspheres (0.2 μm, 505/515 ex/em) (FluoSpheres, Life Technologies) were conjugated to the gel surfaces after treatment with 1 mg/ml of dopamine hydrochloride (Sigma-Aldrich) in 50 mM HEPES solution (pH 8.5). IPF patient derived fibroblasts were plated on the gels overnight and treated as indicated before traction force measurements. Images of gel surface-conjugated fluorescent beads were acquired for each cell before and after trypsinization using a Nikon ECLIPSE Ti microscope at×10 magnification. Traction forces were estimated by measuring bead displacement fields and computing corresponding traction fields using TractionsForAll (freely distributed program that calculates 2-D tractions exerted by an adherent cell on its substrate).


CAMP Assay: IPF patient derived fibroblasts were plated in EMEM containing 10% FBS overnight. Media was exchanged with EMEM containing 0.1% FBS for 24 hours. cAMP was measured using the cAMP-Glo™ Assay (Promega) according to manufacturer's suggestions. 20 minutes prior to cell lysis media was removed and cells were treated with “induction buffer” containing nonselective phosphodiesterase inhibitors and the indicated concentration of compound(s). Luminescence was measured on a Flexstation 3 (Molecular Devices) plate reader.


Western Blotting: Cells were plated in EMEM containing 10% FBS overnight. Media was exchanged with EMEM containing 0.1% FBS for 24 hours. Prior to protein isolation cells were treated with the indicated concentration of compounds for the indicated time. Total protein was isolated using RIPA buffer (pH 8.0) containing Pierce Phosphatase Inhibitor (Thermo) and Halt Protease Inhibitor Cocktail (Thermo). Lysate total protein concentration was determined using Pierce BCA Protein Assay Kit (Thermo) and samples were run on a 10% polyacrylamide gel. Blots were incubated overnight with primary antibodies: pYAP (Ser 127, Cell Signaling D9W21), YAP/TAZ (Cell Signaling D24E4), GAPDH (Cell Signaling 14C10), HSC70 (Santa Cruz sc-7298), aSMA (Abcam ab5694), and fibronectin (Santa Cruz sc-9068) diluted 1:1000 in Li-Cor Odyssey Blocking Buffer. Blots were washed with TBS-Tween before 60 minute incubation with IR-dye-conjugated secondary antibodies (Li-Cor) diluted 1:10,000. Plates were imaged via a Li-Cor OdysseyXL system with quantification performed via densitometry.


Immuno-ECM: Adapting from previously published methods, IPF patient-derived fibroblasts were plated to confluence in clear-bottom 96-well plates. After cells attached, the medium was swapped for EMEM containing 0.1% FBS±2 ng/ml TGF-β. After 48 hours the indicated concentration of DHX or DMSO control was added to each well and incubated for 24 hours. WST-1 viability reagent was added to each well (Sigma-Aldrich) and measured on a Flexstation 3 (Molecular Devices) plate reader. Cells were then fixed in 3.7% formalin (Sigma-Aldrich), and permeabilized in 0.25% Triton X-100 (Sigma-Aldrich). Wells were washed with tris-buffered saline (TBS) and blocked with Li-Cor Odyssey Blocking Buffer for 60 minutes before overnight incubation in a polyclonal rabbit antibody for fibronectin (Sigma sc-9068) or collagen I (Novus NB600-408) diluted 1:200 in blocking buffer. Wells were washed with TBS-Tween before 45 minute incubation with IR-dye-conjugated secondary antibody (Li-Cor #926-32211) diluted 1:400. Plates were imaged via a Li-Cor OdysseyXL system with quantification performed via densitometry. Data are expressed as IR intensity relative to WST-1 signal absorbance in order to account for any potential compound toxicity.


Matrix Remodeling Measured by Atomic Force Microscopy: NIH-3T3 cells were plated to confluence onto gelatin coated (Cell Biologics) AFM compatible tissue culture dishes (Willco) in DMEM containing 10% FBS. After cells attached overnight media was replaced with DMEM containing 2% FBS, 2 ng/mL TGFβ, and 20 μg/mL ascorbic acid to promote matrix deposition. After 72 hours, measurements were made using a BioScope Catalyst AFM (Bruker, MA, USA). Microindentations were performed using a 2.5 μm radius sphere-tipped probe (Novascan, IA, USA) with a spring constant determined at about 100 pN/nm by thermal fluctuation method. For each dish, 3 different areas were analyzed. Force curves were acquired with MIRO 2.0 (NanoScope 9.1; Bruker) at an indentation rate of 20 μm/s and a ramp size of 10 μm on different points. 75 force curves were performed per cell dish (25 per area). The Young's modulus E was determined by the fitting of force curve by Hertz model using NanoScope Analysis software (Bruker) and considering Poisson's ratio of 0.5. Media was exchanged for fresh DMEM containing 2% FBS, 2 ng/ml TGFβ, and 20 μg/mL ascorbic acid with the indicated concentration of DHX or 0.1% DMSO (vehicle control). After another 72 hours AFM measurements were made as before. The resulting cell-derived matrix was then decellularized with Phosphate-buffered saline (Gibco) containing: 0.5% (v/v) Triton X-100 (Sigma-Aldrich) and 20 mM NH4OH (LabChem Inc.). Matrices were washed 3× with PBS and then plated with low passage (P3), NHLFs for 24 hours prior to RNA isolation.


RNA Interference: Cells were transfected using Lipofectamine RNAiMAX (Life Technologies) with 25 nM siGENOME siRNA SMARTpool (Dharmacon) targeting DRD1 (L-005477-00-0005) or a nontargeting SMARTpool (D-001810-10-5). Cells were cultured for 72 hours before collecting RNA. For the YAP/TAZ localization experiments, the cells were transfected in their 6-well plates for 48 hours prior to re-plating into 96-well plates for the immunofluorescence assays. See below for in vivo siRNA methodology.


Bleomycin Mouse Study: In the initial in vivo siRNA study (FIGS. 22 and 23A-23C), adult male age-matched C57BL/6N mice at 6-8 weeks of age were purchased from the National Cancer Institute (NCI)-Frederick Mouse Repository (Frederick, MD, USA). All experiments were performed in accordance with National Institute of Health guidelines and protocols approved by the Massachusetts General Hospital Subcommittee on Research Animal Care, and maintained all mice in a specific pathogen-free (SPF) environment certified by the American Association for Accreditation of Laboratory Animal Care (AAALAC). 6-8 weeks old mice were anesthetized with ketamine and xylazine before exposure of the trachea. Lung fibrosis was induced by intratracheal injection of bleomycin (50 μl at 1.2 U/kg) or phosphate buffered saline (PBS; as control) on day 0. After 14 days Small interfering RNA (siRNA) duplexes targeting mouse Yap (L-046247-01-0005) or Taz (L-058248-01-0005) mRNA (Dharmacon) or nontargeting control siRNA were administered in vivo by intratracheal instillation at a single dose of 25 μg (each siRNA) per mouse. On day 21 Mice were sacrificed and lungs harvested for collagen determination and biochemical analyses. To obtain BAL samples for total protein concentration determination, lungs were lavaged with six 0.5-mL aliquots of PBS. BAL samples were centrifuged at 3,000 g for 20 min at 4° C. and transferred the supernatants to siliconized low-binding Eppendorf tubes (PGC Scientifics) for subsequent analysis. Total protein concentration of the BAL fluid was determined by BCA Protein Assay Kit (Pierce). In the dihydrexidine treatment studies (FIG. 17-21), 8 week old female C57/BL6 mice were purchased from Charles River Laboratories. Mouse lung fibrosis was induced with bleomycin (BLEO; Fresenius Kabi) delivered intratracheally (3 U/kg) to the lungs using MicroSprayer® Aerosolizer (Penn-Century). The Sham mice received sterile 0.9% saline instead using identical methods. Mice were weighed every 24 hrs, and both groups were then randomized at day 10 into DHX and Control treatment groups, matching for the degree of weight change. DHX (5 mg/kg) was administered everyday intranasally (i.n.) dissolved in surfactant (infasurf) which has previously shown to aid in spreading to pulmonary aveoli for 14 days. The control groups of mice received the equivalent vehicle dose of surfactant. Following the final DHX treatment, mice were sacrificed and the right lungs were inflated with 4% paraformaldehyde (PFA) and further incubated in 4% PFA for 24 hours prior processing for paraffin embedding. The left lobe of the lung was snap frozen in liquid nitrogen for RNA isolation and hydroxyproline assay. Experimental procedures were approved by the Mayo Clinic Institutional Animal Care and Use Committee and the animals were handled in accordance with their guidelines.


Bile Duct Ligation: BDL was performed as previously described. Briefly, 8-10 weak old female C57BL/6N underwent either BDL or sham surgery. Mice were anesthetized on Day 0 following IACUC protocol, and the bile duct was ligated using sterile 3/0 silk ligatures. Sham surgery was performed by passing a silk ligature under the bile duct. Starting on Day 7, DHX (5 mg/kg) or vehicle control was administered everyday intraperitoneally (i.p.) for 14 days. Following the final DHX treatment, mice were sacrificed and the livers harvested for analysis of fibrosis.


Histological Scoring: Five um thick sections were cut from Paraffin embedded lung tissues, and the sections were stained either with hematoxylin and eosin (H&E) or with Masson's Trichrome stain kit (Abcam). All H&E-stained slides and trichrome-stained slides were reviewed in a blinded fashion by a thoracic pathologist. The severity of interstitial and peribronchiolar lung immature and mature fibrosis was estimated on a numerical scale according to Ashcroft et al. For scoring purposes, all H&E stained slides were systematically scanned at 100×magnification and successive 100×fields were scored. Scoring was based on the following scale: 0 (no fibrosis), 1 (minimal interstitial and/or peribronchiolar thickening due to fibrosis), 3 (moderate thickening without obvious architectural distortion), 5 (increased fibrosis with formation of fibrous bands and/or small masses), 7 (severe architectural distortion with large areas of fibrosis and areas of honeycomb changes), and 8 (total fibrous obliteration of the field). The predominant score for each field was recorded. The mean of all scores was calculated for each case. Liver trichrome stained sections were computationally measured using Image J software. After converting each image in an RGB stack, the threshold was adjusted and kept at the same level for all the images.


Hydroxyproline: Hydroxyproline content was measured using a hydroxyproline assay kit (Biovision) according to the manufacture's instruction with slight modification. The lung tissues were weighed, homogenized in sterile water (10 mg of tissue per 100 μL H2O) and hydrolyzed in 12N HCl in a pressure-tight, teflon capped vial at 120° C. for 3 hours followed by filtration through a 45 μm Spin-X® Centrifuge Tube filter (Corning). 10 μL of the hydrolyzed samples was dried in a Speed-Vac for 2 hours, followed by incubation with 100 μL of Chloramine T reagent for 5 minutes at room temperature and 100 μL of 4-(dimethylamino) benzaldehyde (DMAB) for 90 minutes at 60° C. The absorbance of oxidized hydroxyproline was determined at 560 nm. Hyrdroxyproline concentrations were calculated from a standard curve generated using known concentrations of trans-4-hydroxyl-L-proline. The total amount of protein isolated from the weighed tissues was determined by using a protein assay kit (Bio-Rad, absorbance at 595 nm). The amount of collagen was expressed in μg/mg total protein.


Statistics: Groups were compared by one-way ANOVA with Tukey's multiple comparison's test. All statistical tests were carried out using GraphPad Prism 6 with statistical significance defined as p<0.05. Results are expressed throughout as the mean±standard error of the mean (SEM).


Example 1—Selective YAP and TAZ Targeting by Agonizing Gαs Receptors

To test whether nonselective YAP and TAZ targeting may be effective in a model of pulmonary fibrosis, YAP and TAZ siRNA were administered intratracheally to mice following bleomycin injury, a standard model of pulmonary fibrosis (FIG. 17-21). Non-selective targeting of YAP/TAZ in this context amplified fibrosis (measured by hydroxyproline assay), while also increasing lung injury and vascular leakage. Contrastingly, fibroblast selective genetic deletion of YAP and TAZ has shown promise in a kidney fibrosis model (See e.g., Ref. 25).


G protein-coupled receptors (GPCRs) make up the largest family of membrane receptors in the human genome, and have been prolific therapeutic targets, with their ligands account for >30% of all clinically approved drugs (See e.g., Ref. 26). GPCRs are linked to effector proteins from four main classes of G-proteins. Activation of receptors which couple to Gα12/13, Gαq/11 and Gαi/o stimulates YAP/TAZ nuclear translocation and transcriptional activity. In contrast, receptors which couple to Gαs inhibit YAP/TAZ nuclear localization and activity via elevation of cAMP (See e.g., Ref. 27-30) (FIG. 1,2).


GPCR expression varies across organs and even within adjacent cell types in the same tissue (See, e.g., Ref. 31). Therefore, RNA expression of the GPCRome was profiled in both primary adult human pulmonary fibroblasts and alveolar epithelial cells (FIG. 3), searching for receptors which exclusively couple to Gαs (See, e.g., Ref. 32) (larger dots, FIG. 3) and are expressed selectively in fibroblasts. Of the 28 Gαs coupled receptors, expression of the Dopamine Receptor D1 (DRD1) exhibited relatively high expression and pronounced enrichment in fibroblasts compared to alveolar epithelial cells (FIG. 3). Abundant transcripts for DRD1 in cultured normal human lung fibroblasts and fibroblasts derived from patients with idiopathic pulmonary fibrosis was determined by qPCR, and undetectable transcript levels of DRD1 in both primary human alveolar epithelial and microvasculature endothelial cells (FIG. 4). To further validate our findings in freshly isolated lung cell populations, we sorted mouse lung tissue into mesenchymal, epithelial, endothelial, and leukocyte enriched fractions (FIG. 5). As in cultured human cells we observed robust expression of DRD1 in the freshly isolated mesenchymal cells, but undetectable levels in other lung cell populations.


Example 2—DRD1 Agonists Selectively Inhibit YAP and TAZ Localization in Mesenchymal Cells

Three selective DRD1 agonists (dihydrexidine, SKF-81297, fenoldopam) were tested for their ability to inhibit YAP/TAZ nuclear localization (FIG. 6, 24). Fibroblasts plated on stiff matrix (plastic) and lacking cell contact inhibition have abundant nuclear localization of YAP/TAZ (See e.g., Ref. 2). All three compounds reduced nuclear localization of YAP/TAZ, and their efficacy was consistent with previously described intrinsic activity of these ligands (See e.g., Ref. 33). The inhibition of YAP/TAZ nuclear localization by dihydrexidine (DHX) could be attenuated using a DRD1 selective antagonist (FIG. 24-26) or by treating the cells with DRD1-siRNA (FIG. 27-28), confirming the receptor-specific effects of DHX. Consistent with the previously defined mechanism whereby YAP/TAZ nuclear localization is controlled by cAMP-dependent phosphorylation of serine residues, promoting cytoplasmic retention or degradation, DHX elevated cAMP and promoted YAP serine 127 phosphorylation (See e.g., Ref. 27-30) (FIG. 9, 10). DHX was effective at inhibiting YAP/TAZ nuclear localization across a panel of mesenchymal cell types, including cardiac and dermal fibroblasts and hepatic stellate cells (FIG. 24-26), suggesting potentially broad relevance of this ligand for mesenchymal cell targeting of YAP and TAZ. DHX-mediated inhibition of YAP/TAZ nuclear localization was relatively sustained, and equally potent in normal lung fibroblasts and those derived from a patient with IPF, unlike the reduced potency of another GPCR ligand (PGE2) with known anti-fibrotic effects in the lung (FIG. 24-26) (See e.g., Ref. 34). In contrast to these observations, DHX had no effect on YAP/TAZ localization in pulmonary epithelial and endothelial cells (FIG. 7), consistent with the absence of detectable transcripts for DRD1 in these cell types. Multiple GPCR ligands which are known to promote fibrosis couple to Gαi, Gαq, and Gα12 which would in turn be expected to enhance YAP/TAZ nuclear localization in fibroblasts (See e.g., Ref. 28, 33). It was confirmed in confluent fibroblasts, which otherwise exhibit reduced nuclear localization of YAP/TAZ, showing that endothelin-1, lysophosphatidic acid and serotonin, all GPCR ligands implicated in promotion of fibrosis (See e.g., Ref. 35), enhance YAP/TAZ nuclear localization. DHX blocked nuclear localization of YAP/TAZ in responses to all three of these ligands, demonstrating the broad effects of GPCR ligands on YAP/TAZ in fibroblasts, and identifying DHX and stimulation of Gαs/cAMP as an effective strategy for inhibiting both mechanical (stiff matrix) and biochemical regulation of YAP/TAZ nuclear localization (FIG. 8). The ability of selected dopamine receptor agonists to inhibit YAP/TAZ nuclear localization is shown in Table 3.










TABLE 3








Nuclear localization (% of total cells)











Compound
IPF-1
IPF-2
IPF-3
IPF-4














DMSO
89.96719
77.08034
76.3871
73.26695


R(−)-2,10,11-Trihydroxyaporphine · HBr
13.70637
22.14634
24.15385
17.75309


Dihydrexidine
13.22484
21.79444
27.63449
21.08058


A 68930 · HCl
33.12535
30.59259
26.82353
10.25995


(R)-(−)-Apomorphine · HCl
29.20735
31.96825
27.47368
17.86425


(+)-SKF-82958 · HBr
29.15385
38
38
12.28571


CY 208-243
20.51748
39.79487
41.17073
19.81818


R(−)-Propylnorapomorphine · HCl
28.34884
26.70968
42.73684
29.03004


R(+)-6-BROMO-APB · HBr
28.36697
38
36
25.64706


R(−)-2,10,11-Trihydroxy-N-propyl-
32.86874
35.25275
37.69697
25.35849


noraporphine · HBr






A-77636 · HCl · H2O
26.46154
30.88136
41.33333
37.78903


Dopamine · HCl
39.84783
59.28571
49.66667
49.50943


6,7-ADTN · HBr
43.88865
44
65.5
52.64912


Mesulergine · HCl
37.81413
45.14286
78.625
45.14286


SKF 38393 · HBr
69.5873
47.375
61.33333
35.79116


N-Methyldopamine · HCl
43.15829
46.73016
60.10526
70.44275


4-Hydroxyphenethylamine · HCl
56.51852
45.69231
76.57143
43.3719


Cabergoline
57.01515
57.41176
45.95181
68.69498


3-Hydroxyphenethylamine · HCl
48.95506
56.91892
69.25
58.37466


Pramipexole Dihydrochloride
64.92308
47.64912
65.5
58.96774


Monohydrate






PD 168077 maleate
67.07869
42.44444
63.67568
68.4


Fenoldopam · HCl
68.09828
50.31884
66.63636
63


(±)-PD 128,907 · HCl
60.13115
49.53846
78.47619
60.66187


(±)-2-(N-phenylethyl-N-propyl)amino-5-
68.85
60.85714
68
56.552


hydroxytetralin · HCl






Bromocriptine mesylate
73.02879
52.81481
64.08696
64.59574


Ropinirole HCl
69.6036
58.68421
64.66099
65.69517


LY-163,502 · 2HCl
73.37074
60.97297
59.42857
66.48606


Dipropyldopamine · HBr
69.17914
74.36364
65.5
51.82253


B-HT 920 · 2HCl
75.67606
46.90411
64.78571
76.23529


Piribedil · 2HCl
61.58491
85.76119
59.05263
59.63793


(+)-UH 232 maleate
61.9521
68
71.84615
67.26608


Pergolide mesylate
82.48669
69.37255
70.66667
65.57576


(−)-Quinpirole · HCl
80.11538
73.14851
80.53731
68.54475


R(−)-2,11-dihydroxy-10-
85.18283
74.66667
80.72727
80.45283


methoxyapomorphine · HCl









The ability of selected dopamine receptor agonists to inhibit expression of αSMA is shown in Table 4.










TABLE 4








αSMA intensity (% of DMSO control)











Compound
IPF-1
IPF-2
IPF-3
IPF-4














DMSO
100
100
100
100


Dihydrexidine · HCl
4.984838
0.04693
0.513048
12.03436


A-77636 · HCl · H2O
5.808214
0.71885
0.067655
12.42941


R(−)-2,10,11-Trihydroxy-
2.887936
1.698043
7.646467
15.9942


aporphine · HBr






(±)-SKF-82958 · HBr
11.77987
4.966244
2.427766
9.32639


A 68930 · HCl
12.40274
8.110719
3.24542
7.350053


R(−)-Propylnorapomorphine · HCl
5.081187
1.878811
5.560538
19.95755


CY 208-243
21.01121
2.279688
2.610795
9.642782


R(+)-6-bromo-APB · HBr
11.25082
2.507086
0.850571
22.81622


R(−)-2,10,11-Trihydroxy-N-propyl-
4.894616
8.436081
2.988195
25.60956


noraporphine · HBr






(R)-(−)-Apomorphine · HCl
7.067375
1.172584
0.961841
33.67351


6,7-ADTN · HBr
37.14071
4.182238
9.908606
4.887935


Dopamine · HCl
35.24978
8.085496
26.56503
5.368141


N-Methyldopamine · HCl
43.19963
17.66949
28.99207
14.65662


SKF 38393 · HBr
37.06277
26.81876
31.24847
20.7973


Mesulergine · HCl
35.50719
23.27498
40.01858
19.75155


Dipropyldopamine · HBr
48.72246
28.11431
40.33584
25.85713


Bromocriptine mesylate
54.0785
53.62163
61.14226
34.0979


Pergolide mesylate
65.01308
51.5948
63.61159
48.1321


(±)-2-(N-phenylethyl-N-
65.43466
52.77428
60.4844
51.10147


propyl)amino-5-






hydroxytetralin · HCl






Piribedil · 2HCl
70.43668
61.52793
71.47113
41.19743


Cabergoline
76.91545
48.07228
77.14592
45.8402


Fenoldopam · HCl
77.33538
45.27138
69.40569
63.35173


B-HT 920 · 2HCl
74.97842
58.97091
70.11813
54.23016


Ropinirole HCl
72.18286
53.45179
78.99604
61.9799


PD 168077 maleate
75.26704
56.14917
75.76791
66.49739


(+)-UH 232 maleate
82.91486
63.85248
85.81355
65.71164


LY-163,502 · 2HCl
88.98983
72.85814
75.30018
86.7894


(−)-Quinpirole · HCl
84.60746
67.1295
85.40936
95.1307


Pramipexole Dihydrochloride
87.61601
73.21711
82.7588
89.93775


Monohydrate






(±)-PD 128,907 · HCl
83.67743
85.45062
94.2538
75.15364


R(−)-2,11-dihydroxy-10-
91.84016
92.79975
81.85245
85.60691


methoxyapomorphine · HCl






3-Hydroxyphenethylamine · HCl
88.58294
96.744
82.62473
99.8315


4-Hydroxyphenethylamine · HCl
99.7156
93.43022
95.69317
88.2748









Example 3—Dopamine Receptor Agonist (e.g., DHX) Reduces Fibroblast Activation and Matrix Deposition

To test whether DHX-mediated inhibition of YAP/TAZ nuclear localization translates into altered mesenchymal cell activation, we first demonstrated that expression of hallmark profibrotic genes CTGF, COL1A1, ACTA2, and FN1 was reduced in IPF patient-derived lung fibroblasts by DHX treatment, recapitulating effects of YAP/TAZ knockdown (See e.g., Ref. 1-4) (FIG. 11). These effects could be blocked with a DRD1 antagonist (FIG. 11) as well as DRD1-siRNA (FIG. 27-28). Stimulating fibroblasts cultured on stiff tissue culture plastic for 72 hours with TGFβ further enhances their myofibroblastic transition, as detected by αSMA+stress fibers; treating fibroblasts with DHX from 48-72 hours in the presence of TGFβ reversed this transition (FIG. 12). Similarly, DHX dose-dependently reversed fibroblast-mediated, TGFβ-stimulated accumulation of collagen I and fibronectin (FIG. 13). To validate that this effect is dependent on inhibition of YAP/TAZ, NIH-3T3 cells were employed which stably express a doxycycline-inducible, constitutively active, mutant TAZ (TAZASA) (See, e.g., Ref. 2, 36). In these cells, DHX had no effect on profibrotic gene expression or extracellular matrix accumulation (FIG. 29, 30). Finally, traction force microscopy (TFM) demonstrated that DHX significantly and dose-dependently reduced the contractile forces generated by fibroblasts (FIG. 14).


Example 4—Extracellular Matrix Remodeling by Dopamine Receptor Agonist (e.g., DHX)

The results above were consistent with DHX not only attenuating key aspects of fibroblast pro-fibrotic activation, but potentially shifting their phenotype toward one that promotes fibrosis clearance and resolution. To test this concept directly, an in vitro matrix remodeling assay was developed. Fibroblasts (NIH-3T3 cells) were first plated at confluence (A and B in FIG. 15), following an approach developed for studying cell-derived matrices. Cells on both plates were cultured with TGFβ and ascorbic acid to promote matrix synthesis and deposition. After 72 hours the stiffness of the cells and their cell-derived matrix were measured using atomic force microscopy (AFM). To test the ability of DHX to induce cell-mediated matrix remodeling, TGFβ and ascorbic acid were maintained but also DHX was added to B (vehicle control was added to A) for an additional 72 hours before probing the matrix again with AFM. While the cells and matrix in control plate A continued to stiffen over time, DHX treatment effectively reversed this trend and significantly reduced the observed stiffness. To confirm that DHX introduced a matrix remodeling effect, the matrices were decellularized and plated low passage primary human adult lung fibroblasts for 24 hours onto the decellularized matrices, then RNA was isolated to measure changes in profibrotic gene expression. CTGF, COL1A1, ACTA2 and FN1 expression were all decreased in the cells plated onto the matrix which had previously been treated with DHX, identifying a pharmaco-footprint left behind in the extracellular matrix by cellular remodeling. Based on these matrix remodeling effects of DHX, it was determined whether efficacy of this pathway extends to inducing matrix degradation/remodeling action in fibroblasts which could reverse the disease rather than simply slow its progression (an important utility of fibroblasts). First, the effect or dopamine receptor agonist (e.g., DHX) was investigated on expression of genes associated with matrix remodeling (FIG. 3f). IPF patient derived fibroblasts treated with TGFβ showed enhanced expression of matrix crosslinking genes and inhibitors of matrix protease enzymes but also showed reduced expression of several genes associated with matrix clearance (FIG. 16). In each case, DHX treatment reversed the effects of TGFβ, reducing expression of crosslinking and protease inhibitors but enhancing expression of matrix degradation associated enzymes. There doesn't appear to be a single driver gene by which DHX effects matrix remodeling, suggesting that the observed effect is a broader fibroblast program shift.


Example 5—Dopamine Receptor Agonist (e.g., DHX) Efficacy In Vivo

Bleomycin model of pulmonary fibrosis was used to test the efficacy of DHX in vivo in experimental fibrosis. Mice were administered bleomycin intratracheally at Day 0. On Day 10 injury and inflammation typically subside and fibrosis is ongoing. At Day 10 mice were randomized into two groups, one receiving DHX (5 mg/kg once daily i.n.) and the other, vehicle control. The Bleo DHX group lost significantly less weight than the Bleo control group (FIG. 17). At day 24 the mice were sacrificed and compared using histology, hydroxyproline and qPCR. Histologically, the Bleo DHX group was nearly completely protected from lung remodeling compared to the Bleo control group and sham uninjured mice, as assessed by a blinded pathologist (FIG. 18). Total collagen in the lungs of Bleo DHX mice was nearly identical to sham treated mice, and significantly reduced compared to Bleo control mice (FIG. 19). Bleomycin increased staining for YAP and TAZ in the lungs and this was attenuated by DHX treatment (FIG. 20). The Bleo Control group also showed enhanced transcript levels for profibrotic genes Acta2, Ctgf, Fn1, Col1a1, and Col1a2, as well as Yap and Taz themselves, all of which were significantly attenuated in the Bleo DHX group (FIG. 21). To assess whether DHX adversely effects lung remodeling in the absence of fibrosis, we also exposed control mice to DHX following an identical time course and route of exposure. The lungs of Sham DHX mice did not differ from those of control mice using any of these measurements (FIG. 31-34).


Example 6—Effect of Dopamine Receptor Agonist (e.g., DHX) on Hepatic Stellate Cells

Based on the efficacy of DHX in attenuating YAP/TAZ nuclear localization across an array of mesenchymal cells, we sought to extend our findings to hepatic stellate cells and liver fibrosis. Preferential expression of DRDI in hepatic stellate cells (HSCs) compared to hepatocytes (FIG. 35-38) was confirmed, with results similar to those obtained for lung tissue in the previous examples. Ability of DHX to reduce TGFβ-mediated HSC expression of SMA and FN protein was then tested by western blotting, and observed significant reversal of both. Efficacy of DHX in the bile duct ligation model of cholestatic injury and liver fibrosis was then tested. Bile duct ligation was performed at Day 0 and treatment with DHX or vehicle began at Day 7 and continued for 14 days. DHX significantly improved histological fibrosis caused by the BDL and exhibited a trend toward reduced collagen deposition (FIG. 35-38).


Previous work demonstrated that TAZ mediates fibrotic effects in hepatocytes in a model of non-alcoholic steatohepatitis (Ref. 37), that verteporfin (an inhibitor of YAP/TAZ-TEAD interactions) has limited beneficial effects in models of liver fibrosis models (Ref. 19), and that YAP/TAZ are essential in liver regeneration (nonspecific YAP knockdown in liver promotes hepatocyte necrosis (Ref. 38)). The experimental results presented here demonstrate the efficacy of a GPCR-based approach to selective inhibition of YAP/TAZ in experimental liver fibrosis.


Example 7—DOPA Decarboxylase is Decreased in IPF, and Correlates with Qorsening Disease Severity

It was discovered that IPF patient lungs express less dopa decarboxylase (DDC) (enzyme that takes part in dopamine synthesis) than non-IPF lungs and the lower level of DDC expression correlates with decreased lung function consistent with an endogenous, protective role for dopamine signaling that is lost in pulmonary fibrosis (FIG. 61A-C). In support of this, it was also shown that dopamine is antifibrotic in in vitro assessments of fibroblast activity (FIG. 62A-C).


Taken together, the experimental results and data presented in Examples 1-7 demonstrate that GPCR agonism (e.g., dopamine receptor agonism) can be used to pharmacologically target YAP and TAZ in selective cell populations to exert beneficial effects on tissue fibrosis. Gas agonism (e.g., dopamine receptor agonism) and YAP/TAZ inhibition reverses the matrix deposition and stiffening phenotype of activated fibroblasts toward a matrix remodeling phenotype that promotes fibrosis resolution, showing that Gas agonism (e.g., dopamine receptor agonism) and YAP/TAZ inhibition is an valuable approach to treat patients with fibrotic diseases.


Example 8-Compounds CTC-1, CTC-2, CTC-3, CTC-6, and CTC-7 Potently Inhibit Models of Tissue Fibrosis

As shown in FIGS. 66-76, compounds CTC-1, CTC-2, CTC-3, and CTC-6 inhibit YAP/TAZ nuclear localization, inhibit fibroblast proliferation, inhibit fibroblast activation, inhibit Collagen I deposition, and inhibition of profibrotic gene expression.


Example 9—Bioactivity of Exemplified Compounds

The compounds described in this disclosure are useful as D1 dopamine receptor agonists for the treatment of idiopathic pulmonary fibrosis. This receptor is preferentially expressed on lung fibroblasts relative to other major resident cell types, providing a mechanism to selectively inhibit the YAP/TAZ transcription program in lung fibroblasts to promote antifibrotic/pro-resolving phenotypes. As shown in the previous example, compounds CTC-3 and CTC-6potently inhibit the localization of YAP/TAZ in cultured lung fibroblasts (IC50 50-100 nM) and their physical and chemical properties suggest marginal ability to cross the blood-brain-barrier. The compounds of this example maintain or improve the potency of CTC-3/6 while enhancing the intrinsic activity (efficacy) at the D1 receptor.


Most exemplified D1 receptor agonists of the present disclosure contain a catechol moiety. At physiological pH, catechols are sometimes rapidly oxidized into quinones, and for several D1 agonists, a bulk of the drug clearance is a result of this oxidation, not liver metabolism. Fenoldopam is a clinically approved dopamine receptor agonist for the treatment of acute hypertension which contains the chloride substituted catechol ring. The chlorine substitution sometimes has a protecting effect which results in fenoldopam being stable at physiological pH and no reported metabolism through oxidation. Of note, chloride substitution at this site also enhances dopamine receptor potency. In sum, halogen substitutions to the catechol moiety in the exemplified compounds enhances their efficacy and plasma stability, e.g., by preventing oxidation. Chemical structures of exemplified compounds are shown in the tables below.









TABLE 9a









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 9b









embedded image









embedded image


















TABLE 9c









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 9d









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 9e









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 9f









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 9g









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image












embedded image









embedded image









embedded image


















TABLE 9h









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image









embedded image











Example 10—Compound 1 (MS-9) Potently Inhibits Models of Tissue Fibrosis

As shown in FIG. 90, compound 1 (MS-9) potently inhibits fibroblast proliferation. Fibroblasts were stimulated with 2 ng/mL TGFβ and treated with compound 1 (MS-9) at the indicated concentration (0.1 μM, 1 μM, and 10 μM). Proliferation determined by fixing and counting DAPI nuclei using a Cytation.


Alpha-smooth muscle actin (αSMA) staining is a well-defined marker of fibroblast activation observed in wound healing and tissue fibrosis. As shown in FIG. 91A, compound 1 (MS-9) potently inhibits fibroblast activation. Fibroblasts were stimulated with 2 ng/ml TGFβ and treated with the indicated concentration of compound 1 (MS-9) every 48 hours (IC50 is 1.1 μM). Imaging and quantification of aSMA intensity performed through automation using a Cytation 5.


As shown in FIG. 91B, compound 1 (MS-9)) potently inhibits collagen 1 deposition.


Fibroblasts were stimulated with 2 ng/mL TGFβ and treated with the indicated concentration of compound 1 every 48 hours (IC50 is 0.7 μM). Imaging and quantification of collagen I intensity performed through automation using a LI-COR Odyssey.


In cell culture studies, MS-9 potently blocks YAP/TAZ nuclear localization in fibroblasts but promotes YAP/TAZ nuclear localization in epithelial cells and effectively inhibits fibroblast activation in models of lung fibrosis. See FIGS. 92A-92C.


At physiological pH apomorphine is oxidized into the inactive quinone, representing a majority of its metabolism:




embedded image


MS-21-9 has a chloride substitution, which stabilizes the catechol while enhancing dopamine receptor potency. As such,. MS-21-9 has a longer half-life compared to compounds lacking halogen on the catechol moiety.


Additional exemplified compounds are shown in the table below:
















embedded image









embedded image









embedded image









embedded image









embedded image









embedded image











REFERENCES





    • 1 Tschumperlin, D. J., Liu, F. & Tager, A. M. Biomechanical regulation of mesenchymal cell function. Curr Opin Rheumatol 25, 92-100, doi: 10.1097/BOR.0b013e32835b13cd (2013).

    • 2 Liu, F. et al. Mechanosignaling through YAP and TAZ drives fibroblast activation and fibrosis. Am J Physiol-Lung C 308, L344-L357, doi: 10.1152/ajplung.00300.2014 (2015).

    • 3 Martin, K. et al. PAK proteins and YAP-1 signalling downstream of integrin beta-1 in myofibroblasts promote liver fibrosis. Nat Commun 7, 12502, doi: 10.1038/ncomms12502 (2016).

    • 4 Szeto, S. G. et al. YAP/TAZ Are Mechanoregulators of TGF-beta-Smad Signaling and Renal Fibrogenesis. J Am Soc Nephrol, doi: 10.1681/ASN.2015050499 (2016).

    • 5 Piersma, B., Bank, R. A. & Boersema, M. Signaling in Fibrosis: TGF-beta, WNT, and YAP/TAZ Converge. Front Med (Lausanne) 2, 59, doi: 10.3389/fmed.2015.00059 (2015).

    • 6 Hansen, C. G., Moroishi, T. & Guan, K. L. YAP and TAZ: a nexus for Hippo signaling and beyond. Trends Cell Biol 25, 499-513, doi: 10.1016/j.tcb.2015.05.002 (2015).

    • 7 Zanconato, F., Battilana, G., Cordenonsi, M. & Piccolo, S. YAP/TAZ as therapeutic targets in cancer. Curr Opin Pharmacol 29, 26-33, doi: 10.1016/j.coph.2016.05:002 (2016).

    • 8 Zhao, B., Li, L., Lei, Q. & Guan, K. L. The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version. Genes Dev 24, 862-874, doi: 24/9/862 [pii] 10.1101/gad.1909210 (2010).

    • 9 Elbediwy, A., Vincent-Mistiaen, Z. I. & Thompson, B. J. YAP and TAZ in epithelial stem cells: A sensor for cell polarity, mechanical forces and tissue damage. Bioessays 38, 644-653, doi: 10.1002/bies.201600037 (2016).

    • 10 Lin, C. W. et al. YAP is essential for mechanical force production and epithelial cell proliferation during lung branching morphogenesis. Elife 6, doi: ARTN e21130 10.7554/eLife.21130 (2017).

    • 11 Imajo, M., Ebisuya, M. & Nishida, E. Dual role of YAP and TAZ in renewal of the intestinal epithelium. Nature Cell Biology 17, 7-+, doi: 10.1038/ncb3084 (2015).

    • 12 Kim, J. et al. YAP/TAZ regulates sprouting angiogenesis and vascular barrier maturation. J Clin Invest 127, 3441-3461, doi: 10.1172/JCI93825 (2017).

    • 13 Wang, L. et al. Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nature, doi: 10.1038/nature20602 (2016).

    • 14 Tang, Y. & Weiss, S. J. Snail/Slug-YAP/TAZ complexes cooperatively regulate mesenchymal stem cell function and bone formation. Cell Cycle 16, 399-405, doi: 10.1080/15384101.2017.1280643 (2017).

    • 15 Levasseur, A., St-Jean, G., Paquet, M., Boerboom, D. & Boyer, A. Targeted disruption of YAP and TAZ impairs the maintenance of the adrenal cortex. Endocrinology, doi: 10.1210/en.2017-00098 (2017).

    • 16 Totaro, A. et al. YAP/TAZ link cell mechanics to Notch signalling to control epidermal stem cell fate. Nat Commun 8, 15206, doi: 10.1038/ncomms15206 (2017).

    • 17 Grove, M. et al. YAP/TAZ initiate and maintain Schwann cell myelination. Elife 6, doi: 10.7554/eLife.20982 (2017).

    • 18 Elbediwy, A. et al. Integrin signalling regulates YAP and TAZ to control skin homeostasis. Development 143, 1674-1687, doi: 10.1242/dev.133728 (2016).

    • 19 Martin, K. et al. PAK proteins and YAP-1 signalling downstream of integrin beta-1 in myofibroblasts promote liver fibrosis. Nat Commun 7, 12502, doi: 10.1038/ncomms12502 (2016).

    • 20 Zhang, K. et al. omega-3 PUFAs ameliorate liver fibrosis and inhibit hepatic stellate cells proliferation and activation by promoting YAP/TAZ degradation. Sci Rep 6, 30029, doi: 10.1038/srep30029 (2016).

    • 21 Perumal, N., Perumal, M., Halagowder, D. & Sivasithamparam, N. Morin attenuates diethylnitrosamine-induced rat liver fibrosis and hepatic stellate cell activation by co-ordinated regulation of Hippo/Yap and TGF-beta 1/Smad signaling. Biochimie 140, 10-19, doi: 10.1016/j.biochi.2017.05.017 (2017).

    • 22 Liang, M. et al. Yap/Taz Deletion in Gli+ Cell-Derived Myofibroblasts Attenuates Fibrosis. J Am Soc Nephrol, doi: 10.1681/ASN.2015121354 (2017).

    • 23 Miranda, M. Z. et al. TGF-betal regulates the expression and transcriptional activity of TAZ protein via a Smad3-independent, myocardin-related transcription factor-mediated mechanism. J Biol Chem 292, 14902-14920, doi: 10.1074/jbc.M117.780502 (2017).

    • 24 Szeto, S. G. et al. YAP/TAZ Are Mechanoregulators of TGF-beta-Smad Signaling and Renal Fibrogenesis. J Am Soc Nephrol 27, 3117-3128, doi: 10.1681/ASN.2015050499 (2016).

    • 25 Liang, M. et al. Yap/Taz Deletion in Gli(+) Cell-Derived Myofibroblasts Attenuates Fibrosis. J Am Soc Nephrol 28, 3278-3290, doi: 10.1681/ASN.2015121354 (2017).

    • 26 Hauser, A. S., Attwood, M. M., Rask-Andersen, M., Schioth, H. B. & Gloriam, D. E. Trends in GPCR drug discovery: new agents, targets and indications. Nat Rev Drug Discov, doi: 10.1038/nrd.2017.178 (2017).

    • 27 Zhou, X., Wang, Z., Huang, W. & Lei, Q. Y. G protein-coupled receptors: bridging the gap from the extracellular signals to the Hippo pathway. Acta Biochim Biophys Sin (Shanghai) 47, 10-15, doi: 10.1093/abbs/gmu108 (2015).

    • 28 Yu, F. X. et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150, 780-791, doi: 10.1016/j.cell.2012.06.037 (2012).

    • 29 Yu, F. X. et al. Protein kinase A activates the Hippo pathway to modulate cell proliferation and differentiation. Genes Dev 27, 1223-1232, doi: 10.1101/gad.219402.113 (2013).

    • 30 Kim, M. et al. cAMP/PKA signalling reinforces the LATS-YAP pathway to fully suppress YAP in response to actin cytoskeletal changes. Embo J 32, 1543-1555, doi: 10.1038/emboj.2013.102 (2013).

    • 31 Insel, P. A. et al. GPCR expression in tissues and cells: Are the optimal receptors being used as drug targets? Brit J Pharmacol 165, 1613-1616, doi: 10.1111/j.1476-5381.2011.01434.x (2012).

    • 32 Flock, T. et al. Selectivity determinants of GPCR-G-protein binding. Nature 545, 317-322, doi: 10.1038/nature22070 (2017).

    • 33 Southan, C. et al. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucleic Acids Res 44, D1054-D1068, doi: 10.1093/nar/gkv1037 (2016).

    • 34 Wilborn, J. et al. Cultured Lung Fibroblasts Isolated from Patients with Idiopathic Pulmonary Fibrosis Have a Diminished Capacity to Synthesize Prostaglandin E (2), and to Express Cyclooxygenase-2. Journal of Clinical Investigation 95, 1861-1868, doi: Doi 10.1172/Jci117866 (1995).

    • 35 Snead, A. N., He, S. & Insel, P. A. G protein-coupled receptor (GPCR) regulation of cardiac fibrosis. Faseb J 26 (2012).

    • 36 Jorgenson, A. J. et al. TAZ activation drives fibroblast spheroid growth, expression of profibrotic paracrine signals, and context-dependent ECM gene expression. Am J Physiol Cell Physiol 312, C277-C285, doi: 10.1152/ajpcell.00205.2016 (2017).

    • 37 Wang, X. B. et al. Hepatocyte TAZ/WWTR1 Promotes Inflammation and Fibrosis in Nonalcoholic Steatohepatitis. Cell Metab 24, 848-862, doi: 10.1016/j.cmet.2016.09.016 (2016).

    • 38 Bai, H. et al. Yes-associated protein regulates the hepatic response after bile duct ligation. Hepatology 56, 1097-1107, doi: 10.1002/hep.25769 (2012).

    • 39. LeWitt, P.A., Subcutaneously administered apomorphine: pharmacokinetics and metabolism. Neurology, 2004. 62(6 Suppl 4): p. S8-11.

    • 40. Trissel, L.A., Y. Zhang, and M.B. Baker, Stability of fenoldopam mesylate in two infusion solutions. Am J Health Syst Pharm, 2002. 59(9): p. 846-8.

    • 41. Brogden, R.N. and A. Markham, Fenoldopam: a review of its pharmacodynamic and pharmacokinetic properties and intravenous clinical potential in the management of hypertensive urgencies and emergencies. Drugs, 1997. 54(4): p. 634-50.

    • 42. Klecker, R.W. and J.M. Collins, Stereoselective metabolism of fenoldopam and its metabolites in human liver microsomes, cytosol, and slices. J Cardiovasc Pharmacol, 1997. 30(1): p. 69-74.

    • 43. Andersen, P.H. and J.A. Jansen, Dopamine receptor agonists: selectivity and dopamine D1 receptor efficacy. Eur J Pharmacol, 1990. 188(6): p. 335-47.

    • 44. Hahn, R.A., et al., Characterization of the peripheral and central effects of SK&F 82526, a novel dopamine receptor agonist. J Pharmacol Exp Ther, 1982. 223(2): p. 305-13.





Numbered Paragraphs

In some embodiments, the invention of the present disclosure can be described by reference to the following numbered paragraphs:


Paragraph 1. A compound of Formula (I):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from HO—C1-6 alkyl, NH2—C1-6 alkyl, 5-6-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, and 3-7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S;
    • wherein said heteroaryl ring and heterocycloalkyl ring are each optionally substituted with 1, 2, or 3 substituents independently selected from R2; and
    • each R2 is independently selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino.


Paragraph 2. The compound of paragraph 1, wherein R1 is 5-6-membered heteroaryl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 3. The compound of paragraph 2, wherein R1 is selected from pyridinyl, pyrimidinyl, and pyrazinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 4. The compound of paragraph 2, wherein R1 is pyridinyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 5. The compound of paragraph 4, wherein the compound of Formula (I) is




embedded image


or a pharmaceutically acceptable salt thereof.


Paragraph 6. The compound of paragraph 1, wherein R1 is 3-7-membered heterocycloalkyl ring comprising 1 or 2 heteroatoms selected from N, O, and S, which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 7. The compound of paragraph 6, wherein R1 is selected from tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, and pyrrolidinyl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 8. The compound of paragraph 6, wherein R1 is tetrahydropyranyl, optionally substituted with 1, 2, or 3 substituents independently selected from R2.


Paragraph 9. The compound of paragraph 8, wherein the compound of Formula (I) is selected from:




embedded image


or a pharmaceutically acceptable salt thereof.


Paragraph 10. The compound of paragraph 1, wherein R1 is selected from HO—C1-6 alkyl and NH2—C1-6 alkyl.


Paragraph 11. The compound of paragraph 1, wherein R1 is HO—C1-6 alkyl.


Paragraph 12. The compound of any one of paragraphs 1-9, wherein each R2 is independently selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


Paragraph 13. The compound of paragraph 1, wherein the compound of Formula (I) is selected from any one of the following compounds:




embedded image


or a pharmaceutically acceptable salt thereof.


Paragraph 14. A pharmaceutical composition comprising a compound of any one of paragraphs 1-13, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.


Paragraph 15. A method of:

    • agonizing a Gαs protein coupled receptor in a cell; and/or
    • promoting YAP/TAZ phosphorylation in a cell; and/or
    • inhibiting YAP/TAZ function in a cell; and/or
    • inhibiting expression of a profibrotic gene in a cell; and/or
    • reducing nuclear localization of YAP/TAZ in a cell; and/or
    • inhibiting expressing of α-smooth muscle actin (αSMA) in a cell; and/or
    • inhibiting extra-cellular matrix production and deposition by a cell; and/or
    • enhancing extra-cellular matrix degradation by a cell;
    • the method comprising contacting the cell with an effective amount of a compound of any one of paragraphs 1-13, or a pharmaceutically acceptable salt thereof.


Paragraph 16. The method of paragraph 15, wherein the profibrotic gene is selected from the group consisting of: CTGF, COL1A1, ACTA2, and FN.


Paragraph 17. The method of paragraph 15 or 16, wherein the Gαs protein coupled receptor is a dopamine receptor.


Paragraph 18. The method of paragraph 17, wherein the dopamine receptor is dopamine receptor D1 (DRD1).


Paragraph 19. The method of paragraph 18, wherein the method comprises selectively agonizing D1 dopamine receptor, as compared to D2, D3, D4, or D5 dopamine receptor, or any combination thereof.


Paragraph 20. The method of any one of paragraphs 15-19, wherein the cell is a mesenchymal cell.


Paragraph 21. The method of paragraph 20, wherein the mesenchymal cell is selected from a fibroblast and a stellate cell.


Paragraph 22. A method of treating or preventing a fibrotic pathology, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of paragraphs 1-13, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of paragraph 14.


Paragraph 23. The method of paragraph 22, wherein the fibrotic pathology is interstitial lung disease (ILD).


Paragraph 24. The method of paragraph 22, wherein the fibrotic pathology is selected from pulmonary fibrosis (PF) and idiopathic pulmonary fibrosis (IPF).


Paragraph 25. The method of paragraph 22, wherein the fibrotic pathology is selected from liver tissue fibrosis, cardiac fibrosis, kidney fibrosis, and skin tissue fibrosis.


Paragraph 26. The method of any one of paragraphs 22-25, further comprising administering to the subject a therapeutically effective amount of an additional therapeutic agent useful in treating a fibrotic pathology.


Paragraph 27. The method of paragraph 26, wherein the additional therapeutic agent is dopamine, or a pharmaceutically acceptable salt thereof.


Paragraph 28. The method of paragraph 26, wherein the additional therapeutic agent is a dopamine receptor agonist.


Paragraph 29. The method of claim 28, wherein the dopamine receptor agonist is selected from: ABT-413, A-86929, dihydrexidine (DHX), dinapsoline, dinoxyline, doxanthrine, SKF-81297, SKF-82958, SKF-38393, fenoldopam, 6-Br-APB, stepholidine, A-68930, A-77636,CY-208-243, SKF-89145, SKF-89626, 7,8-dihydroxy-5-phenyl-octahydrobenzo[h]isoquinoline, cabergoline, pergolide, R(−)-2,10,11-trihydroxyaporphine, (R)-(−)-apomorphine, R(−)-propylnorapomorphine, R(+)-6-bromo-APB, R (-)-2,10,11-trihydroxy-N-propyl-noraporphine, 6,7-ADTN, mesulergine, N-methyldopamine, 4-hydroxyphenethylamine, cabergoline, 3-hydroxyphenethylamine, pramipexole, PD-168077, fenoldopam, (+)-PD 128-907, (+)-2-(N-phenylethyl-N-propyl)amino-5-hydroxytetralin, bromocriptine, ropinirole, LY-163-502, dipropyldopamine, B-HT 920, piribedil, (+)-UH 232, pergolide, (−)-quinpirole, R(−)-2,11-dihydroxy-10-methoxyapomorphine, or a pharmaceutically acceptable salt thereof.


Paragraph 30. A compound of Formula (II):




embedded image


or a pharmaceutically acceptable salt thereof, wherein:

    • R1 is selected from H and C1-3 alkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, or di(C1-3 alkyl)amino;
    • R2, R3, and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino;
    • provided that:
      • (i) at least one of R2, R3, and R4 is not H;
      • (ii) if R2 is H and R3 is OH, then R4 is not H or OH; and
      • (iii) if R2 is OH, then at least one of R3 and R4 is not H.


Paragraph 31. The compound of paragraph 30, wherein R1 is H.


Paragraph 32. The compound of paragraph 30, wherein R1 is C1-3 alkyl.


Paragraph 33. The compound of paragraph 30, wherein R1 is selected from HO—C1-3 alkyl and NH2—C1-3 alkyl.

    • Paragraph 34. The compound of any one of paragraphs 30-33, wherein at least one of R2, R3, and R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


Paragraph 35. The compound of any one of paragraphs 30-33, wherein at least one of R2, R3, and R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.

    • Paragraph 36. The compound of any one of paragraphs 30-33, wherein at least one of R2, R3, and R4 is C1-3 alkyl.


Paragraph 37. The compound of any one of paragraphs 30-33, wherein:

    • R3 is OH; and
    • R2 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


Paragraph 38. The compound of any one of paragraphs 30-33, wherein:

    • R3 is OH; and
    • R2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


Paragraph 39. The compound of any one of paragraphs 30-33, wherein:

    • R3 is OH; and
    • R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


Paragraph 40. The compound of any one of paragraphs 30-33, wherein:

    • R3 is OH; and
    • R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


Paragraph 41. The compound of any one of paragraphs 30-33, wherein:

    • R4 is OH; and
    • R3 is selected from H, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


Paragraph 42. The compound of any one of paragraphs 30-33, wherein:

    • R4 is OH; and
    • R3 is selected from H, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


Paragraph 43. The compound of any one of paragraphs 30-33, wherein:

    • R2 is OH; and
    • at least one of R3 and R4 is selected from OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino.


Paragraph 44. The compound of any one of paragraphs 30-33, wherein:

    • R2 is OH; and
    • at least one of R3 and R4 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.


Paragraph 45. The compound of paragraph 30, wherein the compound of Formula (II) is:




embedded image


or a pharmaceutically acceptable salt thereof.

    • Paragraph 46. The compound of paragraph 30, wherein the compound of Formula (II) is:




embedded image


or a pharmaceutically acceptable salt thereof.


Paragraph 47. A pharmaceutical composition comprising a compound of any one of paragraphs 30-46, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.


Paragraph 48. A method of:

    • agonizing a Gαs protein coupled receptor in a cell; and/or
    • promoting YAP/TAZ phosphorylation in a cell; and/or
    • inhibiting YAP/TAZ function in a cell; and/or
    • inhibiting expression of a profibrotic gene in a cell; and/or
    • reducing nuclear localization of YAP/TAZ in a cell; and/or
    • inhibiting expressing of α-smooth muscle actin (αSMA) in a cell; and/or
    • inhibiting extra-cellular matrix production and deposition by a cell; and/or
    • enhancing extra-cellular matrix degradation by a cell;
    • the method comprising contacting the cell with an effective amount of a compound of any one of paragraphs 30-46, or a pharmaceutically acceptable salt thereof.


Paragraph 49. The method of paragraph 48, wherein the profibrotic gene is selected from the group consisting of: CTGF, COL1A1, ACTA2, and FN.


Paragraph 50. The method of paragraph 48 or 49, wherein the Gαs protein coupled receptor is a dopamine receptor.


Paragraph 51. The method of paragraph 50, wherein the dopamine receptor is dopamine receptor D1 (DRD1).


Paragraph 52. The method of paragraph 51, wherein the method comprises selectively agonizing D1 dopamine receptor, as compared to D2, D3, D4, or D5 dopamine receptor, or any combination thereof.


Paragraph 53. The method of any one of paragraphs 48-52, wherein the cell is a mesenchymal cell.


Paragraph 54. The method of paragraph 53, wherein the mesenchymal cell is selected from a fibroblast and a stellate cell.


Paragraph 55. A method of treating or preventing a fibrotic pathology, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of paragraphs 30-46, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of paragraph 47.


Paragraph 56. The method of paragraph 55, wherein the fibrotic pathology is interstitial lung disease (ILD).


Paragraph 57. The method of paragraph 56, wherein the fibrotic pathology is selected from pulmonary fibrosis (PF) and idiopathic pulmonary fibrosis (IPF).


Paragraph 58. The method of paragraph 55, wherein the fibrotic pathology is selected from liver tissue fibrosis, cardiac fibrosis, kidney fibrosis, and skin tissue fibrosis.


Paragraph 59. The method of any one of paragraphs 55-58, further comprising administering to the subject a therapeutically effective amount of an additional therapeutic agent useful in treating a fibrotic pathology.


Paragraph 60. The method of paragraph 59, wherein the additional therapeutic agent is dopamine, or a pharmaceutically acceptable salt thereof.


Paragraph 61. The method of paragraph 59, wherein the additional therapeutic agent is a dopamine receptor agonist.


Paragraph 62. The method of paragraph 61, wherein the dopamine receptor agonist is selected from: ABT-413, A-86929, dihydrexidine (DHX), dinapsoline, dinoxyline, doxanthrine, SKF-81297, SKF-82958, SKF-38393, fenoldopam, 6-Br-APB, stepholidine, A-68930, A-77636, CY-208-243, SKF-89145, SKF-89626, 7,8-dihydroxy-5-phenyl-octahydrobenzo[h]isoquinoline, cabergoline, pergolide, R(−)-2,10,11-trihydroxyaporphine, (R)-(−)-apomorphine, R(−)-propylnorapomorphine, R(+)-6-bromo-APB, R(−)-2,10,11-trihydroxy-N-propyl-noraporphine, 6,7-ADTN, mesulergine, N-methyldopamine, 4-hydroxyphenethylamine, cabergoline, 3-hydroxyphenethylamine, pramipexole, PD-168077, fenoldopam, (±)-PD 128-907, (±)-2-(N-phenylethyl-N-propyl)amino-5-hydroxytetralin, bromocriptine, ropinirole, LY-163-502, dipropyldopamine, B-HT 920, piribedil, (+)-UH 232, pergolide, (−)-quinpirole, R(−)-2,11-dihydroxy-10-methoxyapomorphine, or a pharmaceutically acceptable salt thereof.


OTHER EMBODIMENTS

It is to be understood that while the present application has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present application, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims
  • 1. A compound of Formula (II):
  • 2. The compound of claim 1, having the formula:
  • 3. The compound of claim 1, wherein R1 is H, or wherein R1 is C1-3 alkyl, or wherein R1 is selected from HO—C1-3 alkyl and NH2—C1-3 alkyl.
  • 4. The compound of claim 1, wherein at least one of R2 and R4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino, or wherein at least one of R2 and R4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl, or wherein at least one of R2, R3, and R4 is C1-3 alkyl, or wherein: R3 is OH; andR2 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino, or wherein:R3 is OH; andR2 is selected from OH, NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl, or wherein:R3 is OH; andR4 is selected from SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino, or wherein:R3 is OH; andR4 is selected from NH2, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl, or wherein:R4 is OH; andR3 is selected from H, SH, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino, or wherein:R4 is OH; andR3 is selected from H, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl, or wherein:R2 is OH; andat least one of R3 and R4 is selected from OH, SH, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino and di(C1-3 alkyl)amino, or wherein:R2 is OH; andat least one of R3 and R4 is selected from OH, C1-3 alkyl, HO—C1-3 alkyl, and NH2—C1-3 alkyl.
  • 5. The compound of claim 1, wherein: R5 is halo;R2 and R4 are each independently selected from H, OH, SH, NH2, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino; andR3 is selected from H, OH, SH, C1-3 alkylamino, di(C1-3 alkyl)amino, C1-3 alkyl, and C1-3 haloalkyl, wherein said C1-3 alkyl is optionally substituted with OH, SH, NH2, C1-3 alkylamino, and di(C1-3 alkyl)amino, optionally wherein:R2, R3, and R4 are each independently selected from H, OH, and C1-3 alkyl, optionally wherein:R2, R3, and R4 are each H.
  • 6. The compound of claim 1, wherein R5 is H, or wherein R5 is selected from Cl, Br, and F.
  • 7. The compound of claim 1, wherein the compound of Formula (II) is:
  • 8. A pharmaceutical composition comprising a compound of claim 1, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
  • 9. An in vitro or ex vivo method of: agonizing a Gαs protein coupled receptor in a cell; and/orpromoting YAP/TAZ phosphorylation in a cell; and/orinhibiting YAP/TAZ function in a cell; and/orinhibiting expression of a profibrotic gene in a cell; and/orreducing nuclear localization of YAP/TAZ in a cell; and/orinhibiting expressing of α-smooth muscle actin (αSMA) in a cell; and/orinhibiting extra-cellular matrix production and deposition by a cell; and/orenhancing extra-cellular matrix degradation by a cell;the method comprising contacting the cell with an effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof.
  • 10. The method of claim 9, wherein the YAP/TAZ phosphorylation comprises phosphorylation of YAP serine 127, optionally wherein the YAP/TAZ phosphorylation comprises phosphorylation of TAZ serine 89, optionally wherein the profibrotic gene is selected from the group consisting of: CTGF, COL1A1, ACTA2, and FN.
  • 11. The method of claim 9, wherein the Gαs protein coupled receptor is a dopamine receptor, optionally wherein the dopamine receptor is dopamine receptor D1 (DRD1), optionally wherein the method comprises selectively agonizing D1 dopamine receptor, as compared to D2, D3, D4, or D5 dopamine receptor, or any combination thereof.
  • 12. The method of claim 9, wherein the cell is a mesenchymal cell, optionally wherein the mesenchymal cell is selected from a fibroblast and a stellate cell.
  • 13. A compound of claim 1, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of claim 8 for use in a method of treating or preventing a fibrotic pathology, the method comprising administering to a subject in need thereof a therapeutically effective amount of said compound, or pharmaceutically acceptable salt thereof, or said pharmaceutical composition.
  • 14. The compound, or pharmaceutically acceptable salt thereof, or the pharmaceutical composition for use of claim 13, wherein the fibrotic pathology is interstitial lung disease (ILD), or wherein the fibrotic pathology is selected from pulmonary fibrosis (PF) and idiopathic pulmonary fibrosis (IPF), or wherein the fibrotic pathology is selected from liver tissue fibrosis, cardiac fibrosis, kidney fibrosis, and skin tissue fibrosis.
  • 15. The compound, or pharmaceutically acceptable salt thereof, or the pharmaceutical composition for use of claim 13, further comprising administering to the subject a therapeutically effective amount of an additional therapeutic agent useful in treating a fibrotic pathology, optionally wherein the additional therapeutic agent is dopamine, or a pharmaceutically acceptable salt thereof, or optionally wherein the additional therapeutic agent is a dopamine receptor agonist, optionally wherein the dopamine receptor agonist is selected from: ABT-413, A-86929, dihydrexidine (DHX), dinapsoline, dinoxyline, doxanthrine, SKF-81297, SKF-82958, SKF-38393, fenoldopam, 6-Br-APB, stepholidine, A-68930, A-77636, CY-208-243, SKF-89145, SKF-89626, 7,8-dihydroxy-5-phenyl-octahydrobenzo[h]isoquinoline, cabergoline, pergolide, R(−)-2,10,11-trihydroxyaporphine, (R)-(−)-apomorphine, R(−)-propylnorapomorphine, R(+)-6-bromo-APB, R(−)-2,10,11-trihydroxy-N-propyl-noraporphine, 6,7-ADTN, mesulergine, N-methyldopamine, 4-hydroxyphenethylamine, cabergoline, 3-hydroxyphenethylamine, pramipexole, PD-168077, fenoldopam, (±)-PD 128-907, (±)-2-(N-phenylethyl-N-propyl)amino-5-hydroxytetralin, bromocriptine, ropinirole, LY-163-502, dipropyldopamine, B-HT 920, piribedil, (+)-UH 232, pergolide, (−)-quinpirole, R(−)-2,11-dihydroxy-10-methoxyapomorphine, or a pharmaceutically acceptable salt thereof.
CLAIM OF PRIORITY

This application is a continuation of U.S. application Ser. No. 17/625,244, filed on Jan. 6, 2022, which is a National Stage application under 35 U.S.C. § 371 of International Application No. PCT/US2020/044054, having an International Filing Date of Jul. 29, 2020, which claims priority under U.S. Provisional Patent Application Ser. No. 62/880,494, filed on Jul. 30, 2019, and U.S. Provisional Patent Application Ser. No. 62/880,594, filed on Jul. 30, 2019. The contents of the aforementioned applications are hereby incorporated be reference in their entirety.

Provisional Applications (2)
Number Date Country
62880494 Jul 2019 US
62880594 Jul 2019 US
Continuations (1)
Number Date Country
Parent 17625244 Jan 2022 US
Child 19055696 US