Coniothyrium minitans beta-(1,3) exoglucanase gene cbeg1

FIELD OF THE INVENTION

[0002] The invention pertains to a β-(1,3) exoglucanase gene of Coniothyrium minitans.

BACKGROUND OF THE INVENTION

[0003] The plant cell wall provides stability, protects against pathogens, and influences the growth and development of the plant cell, among other functions. Structurally, the plant cell wall consists of a primary and a secondary wall, both containing cellulose microfibrils embedded in a matrix of carbohydrates (specifically polysaccharides), structural glycoproteins, enzymes, and other components. Carbohydrate polymers have been well characterized and play a primary role in maintaining the structural rigidity of the plant cell wall. In this regard, the plant cell wall sequesters significant amounts of metabolically inactive polysaccharides from among the following classes:

[0004] celluloses (insoluble fibrils of β-(1,4) glucans);

[0005] ii) hemi-celluloses (non-cellulosic polysaccharides which include β-(1,3) glucans, β-(1,3))(1,4) glucans, mannans, and xylans); and

[0006] iii) lignin (a polyphenolic compound) (Thomson, 1993).

[0007] The β-glucans are polymers of glucose molecules formed by β-links between the glucose molecules. The links may be β-(1,4), β-(1,3), or β-(1,6) or a mixture of those in such polymers. β-glucans are ubiquitous in the natural flora. Many classes of β-glucan polymers exist, and their chemical structure, physiological function, and predominance differ among plant and fungal species.

[0008] A. Cellulosic β-Glucans

[0009] Cellulosic β-(1,4) glucans are polymeric chains formed by successive glucose monomers covalently joined by β-(1,4) glucan linkages. These β-(1,4) glucan chains associate In bundles to form rigid, insoluble microfibrils which may contain up to several hundred cellulosic polymers (Beguin and Aubert, 1994). The tensile strength of such cellulose microfibrils in the plant cell wall selves to confer rigidity to plant structures. Further, cellulosic components, together with other polymeric compounds in the plant cell wall, demonstrate a protective role by acting as a barrier to various phytopathogens.

[0010] B. Non-cellulosic β-Glucans

[0011] While cellulosic polymers are ubiquitous in the cell walls of diverse plant species, non-cellulosic glucans (β-(1,3) glucans and β-(1,3)(1,4) glucans) are typically present in the cell walls of some monocotyledonous plant families, such as the Poaceae (Gramineae) (Chesson et al., 1995). In fungi, non-cellulosic β-(1,3) glucans are predominant in the cell wall, notably providing structural resilience (Borgia and Dodge, 1992). In addition to providing structural stability to the fungal cell wall, β-(1,3) glucans serve as carbohydrate reserves in nutritionally-depleted growth environments (Copa-Patino et al., 1989).

[0012] The hydrolysis of non-cellulosic β-glucans by β-glucanase enzymes is of great significance to plant-mycopathogen interactions, fungal cell wall architecture, and forage feed digestion in ruminants (Umemoto et al., 1997; Vasquez-Garciduenas et al., 1998; Chen et al., 1997). Such enzymes have been classified into different families according to their origin (plant, fungal, or microbial), substrate specificity, and function (Table 1). Different non-cellulosic β-glucanases thus have distinct substrates and modes of hydrolytic action, to the extent that plant, fungal, and microbial non-cellulosic β-glucanases each belong to specific families with conserved sequence and functional properties.

[0013] i) Non-cellulosic β-Glucanases in Plants

[0014] In plants, non-cellulosic glucanases may be classified as either β-(1,3) endoglucanases (laminarinases) or β-(1,3)(1,4) glucanases (mixed linkage glucanases or lichenases) according to substrate specificity and function (Table 1). β-(1,3) endoglucanases (EC 3.2.1.39) hydrolyze successive β-(1,3) glucan (laminarin) chains in an endoglucanase manner (i.e. random digestion within the polymeric chain), whereas β-(1,3)(1,4) glucanases (EC 3.2.1.73) specifically degrade mixed-linkage glucans (non-cellulosic glucans containing glycosidic β-(1,3) and ,-(1,4) linkages such as lichenan) by hydrolyzing a β-(1,4) linkage adjacent to a β-(1,3) linkage in the same manner (Hoj and Fincher, 1995).

[0015] In addition to targeting different substrates, β-(1,3) endoglucanases and β-(1,3)(1,4) glucanases are distinct functionally. β-(1,3) endoglucanases appear to comprise a large family of pathogenesis-related proteins produced by plants during infection by pathogens. During the plant-pathogen interaction between soybean plants (Glycine max) and the fungal pathogen Phytophthora megaspora f. sp. glycinea, soybean β-(1,3) endoglucanases are able to digest the fungal cell walls (Umemoto et al., 1997). The liberated fungal β-(1,3) oligoglucans subsequently bind a β-oligoglucan receptor in the plant cell membrane, initiating a signal transduction event, and ultimately stimulating plant defense responses such as phytoalexin accumulation. β-(1,3) endoglucanases thus appear to weaken and degrade fungal cell walls, while liberating elicitor compounds (such as β-oligoglucan) in order to upregulate plant defense responses.

[0016] In comparison, β-(1,3)(1,4) glucanases may play an important role in nutrient mobilization during seed germination in some plant species. During barley (Hordeum vulgare) seed germination, the β-(1,3)(1,4) glucanases degrade the β-(1,3)(1,4) glucan-rich cell wall in the seed endosperm, allowing the diffusion of amylases and proteases into starch and protein stores in the endosperm compartment (Hoj and Fincher, 1995).

[0017] Although β-(1,3) endoglucanases thus differ functionally from β-(1,3)(1,4) glucanases, these glucanase types in plants are structurally conserved, appearing to originate from a common ancestor (Hoj and Fincher, 1995).

[0018] ii) Non-cellulosic D-Glucanases in Fungi

[0019] In comparison to β-(1,3) endoglucanases and β-(1,3)(1,4) glucanases in plants, fungal glucanases differ in both sequence and function (Table 1). In fungi, non-cellulosic glucanases consist of the following classes: β-(1,3) exoglucanase (EC 3.2.1.58); β-(1,3) endoglucanase (EC 3.2.1.39); β-(1,3)(1,4) endoglucanase (EC 3.2.1.73); and β-(1,3)/(1,3)(1,4) glucanase (EC 3.2.1.6). Fungal β-(1,3) exoglucanases are quintessential enzymes in mycoparasitism. Mycoparasites, such as Trichoderma hazarium, rely on β-(1,3) exoglucanases to hydrolyze the cell wall of various fungal phytopathogens, thus liberating nutritionally available oligoglucans for absorption and metabolism (Vasquez-Garciduenas et al., 1998). Further, fungal β-(1,3) exoglucanases have been implicated in the autolysis of fungal cell walls in nutritionally-depleted environments (Copa-Patino et al., 1989; Stahmann et al., 1993). In addition, β-(1,3) exoglucanases may have a morphogenic role in fungal growth and differentiation (Peberdy, 1990).

[0020] The prevalence of β-(1,3)(1,4) endoglucanases in fungi has yet to be confirmed. To date, few of these have been cloned, with the pioneering example being a mixed-linkage glucanase from the ruminal anaerobic fungus Orpinomyces (licA) (Chen et al., 1997). Such mixed-linkage glucanases from ruminal organisms are presumably produced to improve the digestibility of non-cellulosic β-glucans from fibrous forage feed.

[0021] iii) Non-cellulosic -Glucanases in Bacteria

[0022] In bacteria, non-cellulosic glucanases consist of β-(1,3)(1,4) glucanases (EC 3.2.1.73), which are specific for the substrate, β-(1,3)(1,4) glucan (Table 1). Examples of such microbial glucanases include enzymes from ruminal and non-ruminal microbial species (e.g. Fibrobacter succinogenes and Bacillus subtilis respectively) (Teather and Erfle, 1990; Wolf et al., 1995).

[0023] iv) Non-cellulosic β-Glucanases in Lower Animalia

[0024] A metazoan β-(1,3) endoglucanase from the sea urchin Strongylocentrotus purpuratus has been characterized, apparently having a bacterial origin (Bachman and McClay, 1996). Its presence in sea urchin eggs implies that the enzyme may have a glucanolytic function in embryogenesis. Although the role of β-glucanases in metazoans remains obscure, the mere presence of β-glucanases in natural flora and fauna demonstrates the significance of glucanohydrolytic enzymes among a diverse spectrum of biological systems.

[0025] v) Applications for Non-cellulosic β-Glucanases

[0026] The developing interest in non-cellulosic β-glucanases ranges from the elucidation of their basic enzymatic action to their numerous industrial applications. Although they have yet to be used extensively in commercial applications, non-cellulosic β-glucanases have already been used to hydrolyze and clarify barley β-glucan in brewing processes (Bamforth, 1980).

[0027] Specific interest in non-cellulosic β-glucanases has stemmed from the production of plant β-(1,3) endoglucanases in response to fungal infection. Although such enzymes participate in pathogen responses with some degree of efficacy, the incorporation of a β-(1,3) glucanase with superior hydrolytic activity into a pathogen response regimen may improve plant resistance to fungi. In this regard, compatible β-(1,3) glucanase genes may be incorporated into a transgenic plant line under the transcriptional regulation of a pathogen-responsive promoter.

[0028] Furthermore, the development of non-cellulosic β-(1,3)(1,4) glucanases in ruminant microbial technology may increase the efficiency by which non-cellulosic fiber (such as barley β-glucan) is digested. Hence, compatible glucanolytic genes may be incorporated into ruminant microbial or fungal species to improve fiber digestion and nutritive carbohydrate availability from forage feed. Acquisition and characterization of novel non-cellulosic β-glucanases are thus essential towards the use of glucanase genes in various transgenic applications, and the study of the functional flexibility of β-glucanase enzymes.

[0029]

Coniothyrium minitans
is a higher eukaryotic fungal mycoparasite which is ubiquitous in soil and non-pathogenic to plants and animals. C. minitans exhibits marked β-glucanolytic properties, indicating potential for its development in biotechnological and transgenic applications. C. minitans culture supernatants have been previously shown to be effective in hydrolyzing fungal residue of the phytopathogenic organism Sclerotinia sclerotiorum (Lib.) de Bary by cooperative activity of β-(1,3) exo- and β-(1,3) endoglucanases (Jones et al., 1974). Additionally, the production of extracellular β-glucanohydrolases was induced by the presence of β-glucan-rich complex carbohydrate sources found in fungal cell walls (International Publication No. WO 99/02662 to Huang et al.). C. minitans β-glucanases have also been implicated in S. sclerotiorum hyphal and sclerotial invasion, penetration, and degradation (Huang and Hoes, 1976; Huang and Kokko, 1987; Huang and Kokko, 1988).

[0030] Fungal non-cellulosic β-glucanases are rare enzymes for which only a few sequences are presently known and available for comparison and functional extrapolation to their homologous counterparts. Isolation and characterization of novel fungal ,-glucanases will consolidate functional studies based on gene sequence homologies. Moreover, the discovery of novel glucanolytic sequences will actively contribute to an expanding database containing potential sequences for various biotechnological applications.

1TABLE ISurvey of non-cellulosic glucanases: origin, substrate specificities. and functionEnzyme classificationOrganismEnzymeEC numberFamily*Substrate specificityFunction(s)Lower Animaliaβ-(1,3) endoglucanaseEC 3.2.1.39N/A**β-(1,3) glucanOnly example is foundin sea urchin,may have a role in embryogenesis.Plantβ-(1,3) endoglucanaseEC 3.2.1.3917β-(1,3) glucan (laminarin)Elicitor signal transduction.Part of pathogenesis-related protein(fungal cell wall degradation).β-(1,3)(1,4) glucanaseEC 3.2.1.73N/A**β-(1,3)(1,4) glucan (lichenan)Germination of barley seeds.Fungiβ-(1,3) exoglucanaseEC 3.2.1.585, someβ-(1,3) glucanMycopathogenesis, autolysisin a novelduring nutritional stress, cellclasswall restructuring processes.β3-(1,3) endoglucanaseEC 3.2.1.39N/A**β-(1,3) glucanExamples of these have yet to becloned. Role of β-(1,3)endoglucanasesare suspected to besimilar to fungalβ-(1,3) exoglucanases.β-(1,3)(1,4) endoglucanaseEC 3.2.1.73N/A**β-(1,3)(1,4) glucanOrpinomyces licA lichenase;digestion of forage fiber.β-(1,3)/(1,3)(1,4) glucanaseEC 3.2.1.6N/A**β-(1,3) glucan andFrom Rhizopus arrhizus,β-(1,3)(1,4) glucanfunction unclear.Bacteriaβ-(1,3)(1,4) glucanaseEC 3.2.1.7316β-(1,3)(1,4) glucanForage fiber digestion in ruminantbacteria. Also found innon-ruminantbacteria (Bacillus lichenformis)presumably functions in metaboliccatalysis.*Enzyme family classification according to Henrissat and Bairoch, 1993 and Henrissat et al., 1989. **Enzymes belonging to a novel enzyme family, not classified by existing classification schemes.

SUMMARY OF THE INVENTION

[0031] The invention provides a novel β-(1,3) exoglucanase gene (denoted herein as cbeg1) of the soil-borne fungus Coniothyrium minitans. The DNA sequence of the cbeg1 gene and the deduced amino sequence of the encoded β-(1,3) exoglucanase Cbeg1 are depicted in SEQ ID NOS: 1 and 2 respectively. The invention extends to polypeptides possessing β-(1,3) exoglucanase activity, and which comprise amino acid sequences having a length of at least 50 amino acid residues, more preferably at least 100 amino acid residues, more preferably at least 200 amino acid residues, more preferably at least 500 amino acid residues, more preferably at least 600 amino acid residues, more preferably at least 700 amino acid residues, and most preferably at least 750 amino acid residues to the amino acid sequence depicted in SEQ ID NO: 2. In addition, the invention extends to polypeptides possessing β-(1,3) exoglucanase activity, and which comprise amino acid sequences having at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95% homology to the amino acid sequence depicted in SEQ ID NO: 2.

[0032] The cbeg1 gene is compatible with a eukaryotic heterologous expression system, making it particularly useful for a wide range of industrial applications, such as improvement of plant resistance to fungal phytopathogens or use in non-ruminant and ruminant microbial transgenic strategies to improve feed digestion and nutritive carbohydrate availability from forage feed, whereby Cbeg1 degrades the cell wall from plants, particularly within the Poaceae.

[0033] In addition, the high activity of Cbeg1 over broad pH and temperature ranges provides benefits in high temperature industrial applications, such as bleaching of pulp, which require temperatures greater than 37° C. Further, Cbeg1 complements degradation initiated by endoglucanases which release oligoglucans, in that β-(1,3) exoglucanase sequentially hydrolyzes β-(1,3) glucan fragments and is required to hydrolyze oligoglucan fragments completely to obtain D-glucose, which can be assimilated. Further, Cbeg1 benefits the plant itself by degrading the cell walls of pathogenic fungi without affecting plant cell walls in dicots, and controlling and stimulating expansion of the cell wall to promote plant growth in monocots and dicots.

[0034] Encoded β-(1,3) exoglucanase Cbeg1 is specific for the substrate laminarin, a β-(1,3) glucan with some β-(1,6) linkages, which serves as a carbon reserve polysaccharide in Laminaria and other brown algae (Phaeophyta). Further, Cbeg1 is specific for only laminarin, in that results showed no activity with other substrates tested, such as carboxymethylcellulose, barley β-glucan, lichenan, oat spelt xylan and birchwood xylan. The pH and temperature optima for β-(1,3) exoglucanase Cbeg1 are 6.0 and 57° C., respectively. Cbeg1 contains 784 amino acids, and has a predicted isoelectric point (pI) of 6.0 and molecular weight of 83,646 Daltons.

[0035] The invention further provides vectors and cells comprising a nucleic acid molecule encoding the cbeg1 gene, and methods for producing β-(1,3) exoglucanase Cbeg1.

[0036] As used herein and in the claims, the terms and phrases set out below have the following definitions.

[0037] A “β-(1,3) exoglucanase” is an enzyme that catalyzes the successive hydrolysis of beta-D-glucose units from the non-reducing ends of 1,3-beta-D-glucans, releasing alpha-glucose. The Official Name for β-(1,3) exoglucanase, as recommended by the International Union of Biochemistry and Molecular Biology (“IUBMB”) is “glucan 1,3-beta-glucosidase”, and its Enzyme Commission (“EC”) number is (EC 3.2.1.58). Similarly, a “polypeptide having β-(1,3) exoglucanase activity” is a polypeptide that catalyzes the successive hydrolysis of beta-D-glucose units from the non-reducing ends of 1,3-beta-D-glucans, releasing alpha-glucose.

[0038] A “β-glucan” is a polymer of glucose molecules formed by β-links between the glucose molecules. The links may be β-(1,4), β-(1,3), or β-(1,6) or a mixture of those in such a polymer.

[0039] “Coding sequence” means the part of a gene which codes for the amino acid sequence of a protein, or for a functional RNA such as a tRNA or rRNA.

[0040] “Complement” or “complementary sequence” means a sequence of nucleotides which forms a hydrogen-bonded duplex with another sequence of nucleotides according to Watson-Crick base-pairing rules. For example, the complementary base sequence for 5′-AAGGCT-3″ is 3′-TTCCGA-5′.

[0041] A “domain” of a polypeptide is a portion or region of the polypeptide that forms a structural or functional niche within the remainder of the polypeptide. For example, DNA-binding proteins have DNA-binding domains with specific features such as helix-turn-helix configurations or Zn2+-fingers which enable them to recognize and bind to specific structures or sequences on their target DNA with high specificity and affinity.

[0042] “Downstream” means on the 3′ side of any site in DNA or RNA.

[0043] “Expression” refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA) with subsequent translation into a protein.

[0044] An amino acid sequence that is “functionally equivalent” to C. minitans Cbeg1 is an amino acid sequence that has been modified by single or multiple amino acid substitutions, by addition and/or deletion of amino acids, or where one or more amino acids have been chemically modified, but which nevertheless retains the β-(1,3) exoglucanase activity of C. minitans Cbeg1.

[0045] “Functionally equivalent” nucleotide sequences are those that encode polypeptides having substantially the same biological activity.

[0046] Two nucleic acid sequences are “heterologous” to one another if the sequences are derived from separate organisms, whether or not such organisms are of different species, as long as the sequences do not naturally occur together in the same arrangement in the same organism.

[0047] Two polynucleotides or polypeptides are “homologous” or “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described herein. Sequence comparisons between two or more polynucleotides or polypeptides are generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to about 200 contiguous nucleotides or contiguous amino acid residues. The “percentage of sequence identity” or “percentage of sequence homology” for polynucleotides and polypeptides may be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and, (c) multiplying the result by 100 to yield the percentage of sequence identity.

[0048] Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms, or by inspection. A list providing sources of both commercially available and free software is found in Ausubel et al. (2000). Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1997) and ClustalW programs. BLAST is available on the Internet at http://www.ncbi.nlm.nih.gov and a version of ClustalW is available at http://www2.ebi.ac.uk. Other suitable programs include GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.). For greater certainty, as used herein and in the claims, “percentage of sequence identity” or “percentage of sequence homology” of amino acid sequences is determined based on optimal sequence alignments determined in accordance with the default values of the BLASTX program, available as described above.

[0049] As discussed in greater detail hereinafter, homology between nucleotide sequences can also be determined by DNA hybridization analysis, wherein the stability of the double-stranded DNA hybrid is dependent on the extent of base pairing that occurs. Conditions of high temperature and/or low salt content reduce the stability of the hybrid, and can be varied to prevent annealing of sequences having less than a selected degree of homology.

[0050] “Hemicellulose” includes glucans (apart from starch), mannans, xylans, arabinans or polyglucuronic or polygalacturonic acid.

[0051] “Isolated” means altered “by the hand of man” from the natural state. If an “isolated” composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.

[0052] “Laminarin” means a polymer of β-(1,3) glucan with some β-(1,6) linkages, which serves as a carbon reserve polysaccharide in Laminaria and other brown algae (Phaeophyta).

[0053] A “polynucleotide” is a linear sequence of deoxyribonucleotides (in DNA) or ribonucleotides (in RNA) in which the 3′ carbon of the pentose sugar of one nucleotide is linked to the 5′ carbon of the pentose sugar of the adjacent nucleotide via a phosphate group.

[0054] A “polynucleotide construct” is a nucleic acid molecule which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined and juxtaposed in a manner which would not otherwise exist in nature.

[0055] Two DNA sequences are “operably linked” if the nature of the linkage does not interfere with the ability of the sequences to effect their normal functions relative to each other. For instance, a promoter region would be operably linked to a coding sequence if the promoter were capable of effecting transcription of that coding sequence.

[0056] A “polypeptide” is a linear polymer of amino acids that are linked by peptide bonds.

[0057] “Promoter” means a cis-acting DNA sequence, generally 80-120 base pairs long and located upstream of the initiation site of a gene, to which RNA polymerase may bind and initiate correct transcription.

[0058] A “recombinant” nucleic acid molecule, for instance a recombinant DNA molecule, is a novel nucleic acid sequence formed in vitro through the ligation of two or more nonhomologous DNA molecules (for example a recombinant plasmid containing one or more inserts of foreign DNA cloned into its cloning site or its polylinker).

[0059] “Transformation” means the directed modification of the genome of a cell by the external application of purified recombinant DNA from another cell of different genotype, leading to its uptake and integration into the subject cell's genome. In bacteria, the recombinant DNA is not integrated into the bacterial chromosome, but instead replicates autonomously as a plasmid.

[0060] A “transgenic” organism, such as a transgenic plant, is an organism into which foreign DNA has been introduced. A “transgenic plant” encompasses all descendants, hybrids, and crosses thereof, whether reproduced sexually or asexually, and which continue to harbour the foreign DNA.

[0061] “Upstream” means on the 5′ side of any site in DNA or RNA.

[0062] A “vector” is a nucleic acid molecule that is able to replicate autonomously in a host cell and can accept foreign DNA. A vector carries its own origin of replication, one or more unique recognition sites for restriction endonucleases which can be used for the insertion of foreign DNA, and usually selectable markers such as genes coding for antibiotic resistance, and often recognition sequences (e.g. promoter) for the expression of the inserted DNA. Common vectors include plasmid vectors and phage vectors.

BRIEF DESCRIPTION OF THE DRAWINGS

[0063]
FIGS. 1A and 1B are a sequence alignment of three fungal β-(1,3) exoglucanase genes used in the construction of semi-degenerate β-(1,3) exoglucanase-specific PCR primers (SEQ ID NOS: 3, 7, 8, 12, and 13) used in the examples. The sources of β-(1,3) exoglucanase sequences are:

[0064] (1) Ampelomyces quisqualis (Rotem et al., 1997; GenBank accession no. AF029354) SEQ ID NOS: 4 and 9;

[0065] (2) Cochliobolus carbonum (Schaeffer et al., 1994; GenBank accession no. L48994) SEQ ID NOS: 5 and 10;

[0066] (3) Trichoderma harzianum (Cohen-Kupiec et al., 1999; GenBank accession no. AJ002397) SEQ ID NOS: 6 and 11.

[0067]
FIGS. 2A, 2B, 2C and 2D are an amino acid sequence comparison of the deduced amino acid sequence (SEQ ID NO: 2) of the Cbeg1 β-(1,3) exoglucanase encoded by the C. minitans cbeg1 β-(1,3) exoglucanase gene, with representative fungal β-(1,3) exoglucanases and a β-(1,3)(1,4) endoglucanase. Sequences were aligned using the CLUSTALW alignment algorithm. The glucanases depicted are as follows:

[0068] (1) Cbeg1 , Coniothyrium minitans (fungal mycoparasite) SEQ ID NO: 2;

[0069] (2) Exg1, Cochliobolus carbonum (fungus, Schaeffer et al., 1994; GenBank accession no. L48994) SEQ ID NO: 14;

[0070] (3) ExgA, Ampelomyces quisqualis (fungus, Rotem et al., 1997; GenBank accession no. AF029354) SEQ ID NO: 15;

[0071] (4) Trexo, Trichoderma harzianum β-(1,3) exoglucanase (fungal mycoparasite, Cohen-Kupiec et al., 1999; GenBank accession no. AJ002397) SEQ ID NO: 16; and

[0072] (5) Bgn13.1, Trichoderma harzianum β-(1,3)(1,4) endoglucanase (fungal mycoparasite, de la Cruz et al., 1995; GenBank accession no. X84085) SEQ ID NO: 17.

[0073] Conserved amino acid residues are highlighted in bold. GAK (amino acids 63 to 82) and GAX (amino acids 425 to 435) boxes are underlined.

[0074]
FIG. 3 is a GAX box alignment among a portion of the deduced amino acid sequence of the Cbeg1 β-(1,3) exoglucanase encoded by the C. minitans cbeg1 β-(1,3) exoglucanase gene (amino acids 416 to 464 of SEQ ID NO: 2) and partial sequences of non-glucanolytic enzymes aligned using the CLUSTALW alignment algorithm. Conserved amino-acid residues are highlighted in bold. The non-glucanolytic enzymes depicted are as follows:

[0075] (1) Phi-29, a neck appendage protein from a Bacillus bacteriophage phi-29 (Vlcek and Paces, 1986; GenBank accession no. M14782) SEQ ID NO: 18;

[0076] (2) AlgE7, a mannuronan C5 epimerase from the bacterial species Azotobacter vinelandii (Svanem et al., 1999; GenBank accession no. AF099800) SEQ ID NO: 19;

[0077] (3) Endo-N, endo-N-acylneuraminidase from a bacteriophage K1F (Petter and Vimr, 1993; GenBank accession no. M63657) SEQ ID NO: 20; and

[0078] (4) Exopg, an exopolygalacturonase from Arabidopsis thaliana (Torki et al., 1999; GenBank accession no. X72292) SEQ ID NO: 21.

[0079]
FIG. 4 is a comparison of the GAK (N-terminal) and GAX (C-terminal) boxes of the deduced amino acid sequence of the Cbeg1 β-(1,3) exoglucanase encoded by the C. minitans cbeg1 β-(1,3) exoglucanase gene. Sequences were aligned with the CLUSTALW alignment algorithm. Conserved amino-acid residues are highlighted in bold. The N-terminal region of the sequence includes amino acids 1 to 337 of SEQ ID NO: 2 and the C-terminal region includes amino acids 338 to 785 of SEQ ID NO: 2.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0080] The invention provides a novel β-(1,3) exoglucanase gene obtained from Coniothyrium minitans, and denoted cbeg1. The nucleotide sequence of the cbeg1 gene is set forth in SEQ ID NO:

[0081] 1. The open reading frame is indicated by the corresponding amino acids underneath (extending from nucleotide 25 to nucleotide 2379). The putative signal peptide extends from amino acid 1 to 21. The cbeg1 gene encodes a polypeptide having β-(1,3) exoglucanase activity, and denoted C. minitans glucanase Cbeg1. The deduced amino acid sequence of the encoded Cbeg1 β-(1,3) exoglucanase is depicted in SEQ ID NO: 2.

[0082] It will be appreciated by those of skill in the art that, due to the degeneracy of the genetic code, numerous functionally equivalent nucleotide sequences encode the same amino acid sequence. All nucleotide sequences that encode the Cbeg1 β-(1,3) exoglucanase sequence depicted in SEQ ID NO: 2 are included in the invention.

[0083] Further, strains of C. minitans may contain naturally occurring allelic variants of the cbeg1 gene which encode variants of Cbeg1 having β-(1,3) exoglucanase activity that is substantially the same as that of the Cbeg1 sequence depicted in SEQ ID NO: 2. All such allelic variants of the cbeg1 gene and the encoded Cbeg1 β-(1,3) exoglucanase are included within the scope of the invention.

[0084] Using the techniques described in detail in the Examples herein, the cbeg1 gene sequence depicted in SEQ ID NO: 1 or the encoded Cbeg1 protein sequence depicted in SEQ ID NO: 2 can be used to design primers (such as the Gf1/Gr1 primer pair described in the Examples herein) for amplification of homologous sequences in C. minitans or other organisms by polymerase chain reaction (PCR), or for the construction of labeled probes (e.g. biotin-labeled, radio-labeled) for use in nucleic acid hybridization assays to identify homologous nucleic acid sequences. Such sequences can then be tested by the methods described in the Examples herein for the expression of polypeptides having β-(1,3) exoglucanase activity. By these methods, those skilled in the art can identify different alleles of the cbeg1 β-(1,3) exoglucanase gene, or variant nucleotide sequences that encode polypeptides having β-(1,3) exoglucanase activity.

[0085] Additionally, those skilled in the art can obtain altered cbeg1 gene sequences and test them for the expression of polypeptides having β-(1,3) exoglucanase activity through standard mutagenesis techniques in conjunction with the β-(1,3) exoglucanase activity assays described in the Examples herein. Useful mutagenesis techniques known in the art include, without limitation, oligonucleotide-directed mutagenesis, region-specific mutagenesis, linker-scanning mutagenesis, and site-directed mutagenesis by PCR (Sambrook el al., 1989: Ausubel et al., 2000). A method of generating variants of the nucleotide sequences can also be obtained by changing nucleotides through addition or deletion of nucleotides within the sequence and testing the encoded polypeptide for activity (International Publication No. WO 00/18909 to Swanson et al.).

[0086] In obtaining variant cbeg1 coding sequences, those skilled in the art will recognize that proteins may be modified by certain amino acid substitutions. additions, deletions, and post-translational modifications, without loss or reduction of biological activity. In particular, it is well-known that conservative amino acid substitutions, that is, substitution of one amino acid for another amino acid of similar size, charge, polarity and conformation, are unlikely to significantly alter protein function. The 20 standard amino acids that are the constituents of proteins can be broadly categorized into four groups of conservative amino acids as follows: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine and tyrosine; the positively charged (basic) group contains arginine, histidine and lysine; and the negatively charged (acidic) group contains aspartic acid and glutamic acid. Substitution in a protein of one amino acid for another within the same group is unlikely to have an adverse effect on the biological activity of the protein.

[0087] As shown in FIGS. 2A-2D, Cbeg1 β-(1,3) exoglucanase exhibits homology to other fungal β-(1,3) exoglucanases and a β-(1,3)(1,4) endoglucanase. Among the glucanases compared, Cbeg1 exhibits the greatest homology to Exg1, Cochliobolus carbonum (Schaeffer et al., 1994) with an overall homology of 59% over the whole sequence. The homologies of Cbeg1 are 51 % with Trexo, Trichoderma harzianum β-(1,3) exoglucanase (Cohen-Kupiec et al., 1999); 43% with ExgA, Ampelomyces quisqualis (Rotem et al., 1997); and 26% with Bgn13. 1, Trichoderma harzianum β-(1,3)(1,4) endoglucanase (de la Cruz et al., 1995). Homologies of Cbeg1 with recently discovered GLUC78, Trichoderma atroviride glucan 1,3-β-glucosidase (Donzelli et al., 2000) and Cmg1, Coniothyrium minitans β-(1,3) glucanase (Giezey et al., 2000) were 44% and 42% respectively

[0088] It is well-known in the art that individual amino acids or sequences of amino acids that are essential to the biological activity of a protein are closely conserved among related proteins, in accordance with principles of natural selection. Thus, those of skill in the art will recognize that substitutions, additions, deletions, and modifications of amino acids within the Cbeg1 sequence at non-conserved regions will be less likely to negatively affect the glucanolytic function of the enzyme than would equivalent changes within highly conserved regions. As such, it is expected that substitutions, additions, deletions, and modifications would be least likely to negatively affect the glucanolytic activity of Cbeg1 if they were to occur in a subregion where there is little or no conservation of the amino acid sequence.

[0089] Homology between nucleotide sequences can be determined by DNA hybridization analysis, wherein the stability of the double-stranded DNA hybrid is dependent on the extent of base pairing that occurs. Conditions of high temperature and/or low salt content reduce the stability of the hybrid, and can be varied to prevent annealing of sequences having less than a selected degree of homology. Under the following conditions, the temperature and salt concentration of hybridization and washing conditions can be adjusted to target any specific homology levels. Obtaining a homology of 70% using the coding sequence of cbeg1 (52% GC content) involves hybridizing with 6×SSC (sodium chloride/sodium citrate buffer) and 0.1% SDS (sodium dodecyl sulfate) at 52° C. and washing with 1×SSC and 0.1% SDS at 39° C. By increasing the hybridization and washing temperature in 5° C. increments, the level of homology would increase by 5%. For hybridization and washing temperatures of 57 and 44° C., 62 and 49° C., 67 and 54° C., 68 and 59° C., 68 and 64° C., and 68 and 69° C., the theoretical homology of sequences hybridized with the coding region of cbeg1 would be 75, 80, 85, 90, 95, and 100% respectively.

[0090] A wide range of computer programs for comparing nucleotide and amino acid sequences (and measuring the degree of homology) are also available, and a list providing sources of both commercially available and free software is found in Ausubel et al. (2000). Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1997) and ClustalW programs. BLAST is available on the Internet at http://www.ncbi.nlm.nih.gov and a version of ClustalW is available at http://www2.ebi.ac.uk.

[0091] An additional method for comparing nucleotide sequences involves storing a sequence of interest on computer media and using a computer program to compare the stored sequence with reference sequences (International Publication No. WO 00/18909 to Swanson et a./).

[0092] In view of the foregoing, nucleotide sequences having at least 70% homology, more preferably at least 75% homology, more preferably at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably at least 95% homology with the cbeg1 gene sequence depicted in SEQ ID NO: 1, and which encode polypeptides having glucanolytic activity are within the scope of this invention, as are amino acid sequences having at least 70% homology, more preferably at least 75% homology, more preferably at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably at least 95% homology with the Cbeg1 glucanase sequence depicted in SEQ ID NO: 2 and which possess glucanolytic activity. These homology values are based on comparison between the whole length of both sequences encoding a polypeptide at the amino acid or DNA level. Further, these homology values are based on the comparisons of Cbeg1 with other glucanases, with the greatest or closest homology to Exg1, Cochliobolus carbonum (Schaeffer et al, 1994) being 59% over the whole sequence.

[0093] Thus, in a first embodiment, the invention provides an isolated nucleic acid molecule encoding a polypeptide having glucanolytic activity, the encoded polypeptide comprising the amino acid sequence depicted in SEQ ID NO, 2 from amino acid 1 to amino acid 785, or a functionally equivalent sequence having at least 70% homology, more preferably at least 75% homology, more preferably at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably al least 95% homology thereto.

[0094] As detailed in Example 4 herein, analysis of the Cbeg1 glucanase sequence depicted in SEQ ID NO: 2 indicates that Cbeg1 has a similar structure as other fungal β(1,3) exoglucanases from C. carbonum, A. quisqualis, and T. harzianum, since Cbeg1 includes a GAK box extending from amino acids 63 to 82 of SEQ ID NO: 2 and a signal peptide at the N-terminal end (amino acids 1 to 2 1). It is speculated that this predicted signal peptide could likely be deleted without affecting enzymatic activity. Therefore, in another embodiment, the invention provides an isolated nucleic acid molecule encoding a polypeptide having glucanolytic activity, with the encoded polypeptide comprising the amino acid sequence depicted in SEQ ID NO: 2 from amino acid 22 to 785, or a functionally equivalent sequence having at least 70% homology, more preferably at least 75% homology, more preferably at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably at least 95% homology thereto.

[0095] Furthermore, Cbeg1 also includes a GAX box spanning amino acids 425 to 434 of SEQ ID NO: 2, which exhibits identity to GAX box regions in genes, such as Phi-29, AlgE7, Endo-N, and Exopg, which have diverse origins and encode non-glucanolytic enzymes with dissimilar functions. In addition, a sequence comparison of the GAK (N-terminal) and GAX (C-terminal) boxes of Cbeg1 indicates conservation of key residues outside a homologous “GDGXTDD” domain. Conservation of this “GDGXTDD” sequence within Cbeg1 and other homologous sequences of disparate origin and function denotes the significance of this domain in glucanolytic function in addition to non-glucanolytic functions evolved in genes derived from this fungal glycosyl hydrolase family.

[0096] Cbeg1 is specific for the substrate laminarin, in that results showed no activity with other substrates tested, such as carboxymethylcellulose, barley β-glucan, lichenan, oat spelt xylan and birchwood xylan. The specificity of Cbeg1 for only one substrate is beneficial in that degradation of the exact desired substrate, laminarin, is guaranteed to proceed efficiently. In the event where an enzyme has activity upon more than one substrate, there is no guarantee that degradation of any desired substrate will occur since the enzyme then has unlimited substrates available.

[0097] Exo- and endo-glucanases are known to work cooperatively to degrade glucans efficiently (Jones et al., 1974). Cbeg1 may complement degradation initiated by endoglucanases which release oligoglucans, in that β-(1,3) exoglucanase sequentially hydrolyzes β-(1,3) glucan fragments and is required to hydrolyze oligoglucan fragments completely to obtain D-glucose, which can be assimilated.

[0098] The pH and temperature optima for Cbeg1 are 6.0 and 57° C., respectively. Cbeg1 displays high activity not only over a broad and high temperature range, with over 80% of activity recorded between 42 and 63 ° C., but also over a broad pH range, with more than 80% of activity observed between a pH of 4.8 and 6.8. High activity of Cbeg1 over broad pH and temperature ranges is advantageous by ensuring efficient degradation of β-(1,3) glucan. Moreover, since the enzyme is stable at high temperatures and works successfully across such broad ranges, Cbeg1 may be beneficial for use in high temperature industrial applications, such as bleaching of pulp, which require temperatures greater than 37° C.

[0099]

C. minitans
is a higher eukaryotic fungus, belonging to either the Ascomycota or Basidiomycota subphyla, depending on its reproductive regimen. Since the GC content and codon usage are close to those of higher plants, genes isolated from C. minitans are likely to be compatible with other higher eukaryotic systems and may thus be expressed efficiently in both prokaryotic and eukaryotic systems.

[0100] In prokaryotes, functional compatibility of Cbeg1 with microbial systems may be of great importance to ruminal biotechnology. The transfer of the Cbeg1 cDNA into ruminal microbial or fungal species, and the overexpression of Cbeg1 in the rumen can increase digestive efficiency of non-N4 cellulosic fiber such as barley β-glucan. Therefore, in further embodiments, the invention extends to cells other than C. minitans transformed with a nucleic acid molecule encoding C. minitans glucanase Cbeg1 or a variant thereof having glucanolytic activity and to methods for producing a polypeptide having glucanolytic activity, comprising culturing such cells under conditions conducive to the expression of the encoded polypeptide and recovering the encoded polypeptide from the culture. The invention also extends to vectors containing nucleic acid molecules of the invention encoding polypeptides having glucanolytic activity. Such vectors will usually also contain at least a promoter and a transcription termination signal.

[0101] In eukaryotes, expression of the isolated C. minitans β-(1,3) exoglucanase gene cbeg1 of the invention is demonstrated in Example 5 herein which describes the expression of cbeg1 in the yeast Pichia pastoris. Large quantities of the Cbeg1 enzyme can be produced by Pichia pastoris using a large-scale fermentor. After growth of the yeast, the medium which contains Cbeg1 is withdrawn from the fermentor and enzymatic activity determined. The medium is then prepared in either solid or liquid form. To provide a solid form, the medium may be lyophilized to facilitate handling and preservation. Alternatively to produce a liquid form, an enzyme stabilizer such as glycerol may be added to the medium and the enzyme dispensed as a liquid. Whether the enzyme-containing medium is prepared in either liquid or solid form, sufficient medium should be added to provide 25000 U of enzyme activity per ton of feed for beef cattle. However, the units of enzyme activity to be added to feed may be multiplied by factors of 2, 5, 10 or 50, depending on the nature of the feed (silage or barley grain) and the animal species.

[0102] Further, cbeg1 is useful for effecting the recombinant expression of Cbeg1 in plants, as shown in Examples 6 and 7 which describe cbeg1 expression in monocotyledonous (barley cultivar Golden Promise) and dicotyledonous (Brassica napus cultivar Westar) plants respectively. Plant species of interest include, without limitation: canola, mustard, or rapeseed (Brassica spp.); flax (Linum spp.); corn (Zea mays); soybean (Glycine and Soja spp.); cotton (Gossypium spp.); mouse ear crest (Arabidopsis thaliana); wheat (Triticum spp.); rye (Secale spp.); barley (Hordeum spp.); oats (Avena spp.); rice (Oryza spp.); sorghum (Sorghum spp.); potato (Solanum spp.); tomato (Lycopersicon spp.); tobacco (Nicotiana spp.); and Cucurbita spp. (gourd, squash, pumpkin, watermelon, etc.).

[0103] Expression of cbeg1 in barley (Hordeum spp.) provides an economical and direct way to supplement this enzyme to the feed of beef cattle. Cbeg1 may facilitate efficient digestion of oligoglucan degraded by ruminal bacteria, thereby increasing percentages of digestibility and energy uptake. Considering the size of the beef cattle industry in North America and worldwide, a few percent increase has tremendous impact.

[0104] For making transgenic plants, an appropriate vector must be prepared initially, with suitable recombinant vectors including an expression cassette designed for initiating transcription of the C. minitans β-(1,3) exoglucanase gene cbeg1 in plants. Additional sequences can be included to allow the vector to be cloned in a bacterial or phage host. The vector will preferably contain a prokaryote origin of replication having a broad host range. A selectable marker may also be included to allow selection of bacterial cells bearing the desired construct; for example, suitable prokaryotic selectable markers include those that confer resistance to antibiotics such as ampicillin. Other DNA sequences encoding additional functions may also be present in the vector; for instance, in the case of Agrobacterium mediated transformation, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.

[0105] For expression in plants, the recombinant expression cassette preferably contains, in addition to the desired sequence, a promoter region effective in plants, a transcription initiation site (if the sequence to be transcribed lacks one), and a transcription termination sequence. Unique restriction enzyme sites at the 5′ and 3′ ends of the cassette are typically included to allow for easy insertion into a pre-existing vector. Sequences controlling eukaryotic gene expression are well known in the art.

[0106] Transcription of DNA into mRNA is regulated by a region of DNA referred to as the promoter. The promoter region contains a sequence of bases that signals RNA polymerase to associate with the DNA, and to initiate the transcription of mRNA using one of the DNA strands as a template to make a corresponding complementary strand of RNA. Promoter sequence elements include the TATA box consensus sequence (TATAAT), which is usually 20 to 30 bp upstream of the transcription start site. In most instances the TATA box is required for accurate transcription initiation. The TATA box is the only upstream promoter element that has a relatively fixed location with respect to the start point. Another consensus sequence, the CAAT box, is centered at −75, but can function at distances that vary considerably from the start point and in either orientation. Another common promoter element is the GC box at −90 which contains the consensus sequence GGGCGG. It may occur in multiple copies and in either orientation. Other sequences conferring tissue specificity, response to environmental signals, or maximum efficiency of transcription may also be found in the promoter region. Such sequences are often found within 400 bp of transcription initiation size, but may extend as far as 2000 bp or more. In heterologous promoter/structural gene combinations, the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. However, some variation in this distance can be accommodated without loss of promoter function.

[0107] The particular promoter used in the expression cassette is not critical to the invention. Any of a number of promoters which direct transcription in plant cells is suitable. The promoter can be either constitutive, inducible, tissue specific, or temporal specific. A number of promoters which are active in plant cells have been described in the literature. These include the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumour-inducing plasmids of Agrobacterium tumefaciens), the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S and 35S and the figwort mosaic virus 35S-promoters, the light-inducible promoter from the small subunit of ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide), and the chlorophyll a/b binding protein gene promoter, a cryptic promoter (tCUP) from tobacco, etc. All of these promoters have been used to create various types of DNA constructs which have been expressed in plants. The CaMV 35S promoter, which is used in Example 7 herein, has been shown to be highly active and constitutively expressed in most tissues (Bevan et al., 1986). Other promoters may be used; for example, those for the genes napin and cruciferin (Breen and Crouch, 1992; Scofield and Crouch, 1987).

[0108] In addition to a promoter sequence, the expression cassette should contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from either the same gene as the promoter sequence or different genes. In the exemplified cases, the nopaline synthase NOS 3′terminator sequence (Bevan et al. 1983) was used.

[0109] Polyadenylation is believed to have an effect on stabilizing mRNAs. Therefore, polyadenylation sequences are also commonly added to the vector construct if the mRNA encoded by the structural gene is to be efficiently translated (Alber and Kawasaki, 1982). Polyadenylation sequences include, but are not limited to the Agrobacterium octopine synthase signal (Gielen et al., 1984) or the nopaline synthase signal (Depicker et al., 1982).

[0110] The vector will also typically contain a selectable marker gene by which transformed plant cells can be identified in culture. Typically, the marker gene encodes antibiotic resistance or herbicide resistance. These markers include those that confer resistance to the antibiotics G418, hygromycin, bleomycin, kanamycin, gentamycin, and the bar gene which confers herbicide resistance. In exemplified cases, the marker genes confer resistance to kanamycin, and glufosinate ammonium herbicide (Wan and Lemaux, 1994). Those cells containing the vector will be identified by their ability to grow in a medium containing the particular selective agent.

[0111] With the objective of plant transformation with Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1, the polynucleotide would be inserted in the sense orientation into the expression cassette.

[0112] Once an appropriate vector has been assembled, a variety of techniques are available for introducing foreign DNA into plant cells. In accordance with the invention, bombardment (Weeks et al., 1993; Wan and Lemaux, 1994; Cho et al., 1998) is a preferred method for introducing cbeg1 into cell explants from monocotyledonous plants (e.g. barley, oat, wheat). Alternatively, Agrobacterium mediated transformation has been reported for barley (Tingay et al., 1997). For introduction of C. minitans β-(1,3) exoglucanase gene cbeg1 into cell explants from dicotyledonous plants (e.g. canola), Agrobacterium mediated transformation (Tingay et al., 1997; Trick and Finer, 1997) is preferred. Preferred sources of tissue explants include scutella from immature embryos or other tissue undergoing rapid multiplication and differentiation (e.g. meristems, immature inflorescences, callus, microspores, microspore-derived embryos, cell suspensions, and protoplasts).

[0113] Other transformation techniques which are known in the art can also be used to transfer the recombinant DNA. For instance, the vector can be micro-injected directly into plant cells. Alternatively, nucleic acids may be introduced to the plant cell by high velocity ballistic penetration with small particles having the nucleic acid of interest embedded within the matrix or alternatively on the surface of the particles. Fusion of protoplasts with lipid-surfaced bodies such as minicells, cells or lysosomes carrying the DNA of interest can be used. The DNA may also be introduced into plant cells by electroporation, wherein plant protoplasts are electroporated in the presence of plasmids carrying the expression cassette. A review of these techniques is found in Gelvin et al. (1994).

[0114] The above-mentioned Agrobacterium mediated transformation technique, which is particularly useful for transformation of dicots such as canola, is a form of vectored transformation that uses Agrobacterium tumefaciens. A. tumefaciens is a Gram-negative soil bacteria which causes a neoplastic disease known as crown gall in dicotyledonous plants. Induction of tumours is caused by tumour-inducing plasmids known as Ti plasmids, which direct the synthesis of opines or octopines in the infected plant. The opines or octopines are used as a source of carbon and/or nitrogen by the Agrobacterium.

[0115] The bacterium does not enter the plant cell, but transfers only part of the Ti plasmid, a portion called T-DNA. The T-DNA becomes stably integrated into the plant genome, where it expresses the functions needed to synthesize opines and to transform the plant cell. Virulence (Vir) genes on the Ti plasmid, outside of the T-DNA region, are necessary for the transfer of the T-DNA. The vir region, however, is not transferred. In fact, the vir region, although required for T-DNA transfer, need not be physically linked to the T-DNA and may be provided on a separate plasmid.

[0116] The tumour-inducing portions of the T-DNA can be interrupted or deleted without loss of the transfer and integration functions, such that normal and healthy transformed plant cells may be produced which have lost all properties of tumour cells, but still harbour and express certain parts of T-DNA, particularly the T-DNA border regions. Therefore, modified Ti plasmids, in which the disease causing genes have been deleted, may be used as vectors for the transfer of gene constructs of the present invention.

[0117] Transformation of plants cells with Agrobacterium and regeneration of whole plants typically involves either co-cultivation of Agrobacterium with cultured isolated protoplasts or transformation of intact cells or tissues with Agrobacterium. In an exemplified case, petiole explants from Brassica napus plantlets are transformed with Agrobacterium.

[0118] When it is desired to transform monocots such as wheat or barley with C. minitans β-(1,3) exoglucanase gene cbeg1, biolistic transformation techniques are preferred. The transformation vector preferably includes a rice actin promoter and the first intron of the actin gene (which controls the expression of the bar gene), followed by the bar gene (which confers resistance to glufosinate ammonium herbicide) and the NOS terminator. A second similar vector is also prepared, in which the C. minitans β-(1,3) exoglucanase gene cbeg1 of interest is substituted for the bar gene. Plant tissues are co-transformed by bombardment with gold particles coated with both vectors. Co-transformation enables integration of vectors in different location of the genome which will lead to segregation of the marker gene from the gene of interest in subsequent generations when plants are regenerated.

[0119] Embryogenic tissue, such as immature scutella dissected from embryos, is preferred for bombardment (Cho et al., 1998; Wan and Lemaux, 1994). The embryonic tissue preferably is obtained from an easily regenerated plant line or cultivar (e.g. var. Golden Promise in barley). Using a micro-projectile bombardment device, embryogenic tissues are bombarded with gold particles that are coated with the DNA constructs of interest, and plants are then regenerated (Wan and Lemaux, 1994).

[0120] After transformation, transformed plant cells or plants carrying the introduced DNA are identified, typically by selection for the marker gene. In exemplified cases, transformed plant cells are selected by growing the cells on growth medium containing kanamycin and glufosinate ammonium. Other selectable markers will be apparent to those of skill in the art. For instance, the presence of opines can be used to identify transformants if the plants are transformed with Agrobacterium.

[0121] It will be apparent to those of ordinary skill in the art that alternative methods, reagents, procedures and techniques other than those specifically detailed herein can be employed or readily adapted to practice this invention. The invention is further illustrated in the following non-limiting Examples. All abbreviations used herein are standard abbreviations used in the art. Specific procedures not described in detail in the Examples are well-known in the art.

EXAMPLE 1

[0122] Cloning and characterizing a genomic glucanase-like DNA fragment from Coniothyrium minitans

[0123] i) Genomic DNA isolation from Coniothyrium minitans strains M11-3B 2A2 A10-4 and 2134

[0124] A Coniothyrium minitans strain with superior cellulolytic activity (C. minitans strain LRS M11-3B 2A2—Lethbridge Research Centre Collection (“LRCC”), Agriculture and Agri-Food Canada, Lethbridge Research Centre, Lethbridge, Alberta, Canada), was generated from a wild-type C. minitans strain (LRCC C. minitans strain LRS 2134 - deposited under accession No. 74415 with the American Type Culture Collection (“ATCC”), located at 10801 University Boulevard, Manassas, Va., 20110-2209, USA), by UV mutagenesis and subsequent screening for improved glycosyl hydrolase activity (International Publication No. WO 99/02662 to Huang et al.). C. minitans strain A10-4 (LRCC C. minitans strain LRS A1 0-4 (ATCC 74435)), was generated from wild-type C. minitans strain ATCC 74415 by UV mutagenesis and was screened for cellulase activity in the presence of glucose (whereas glucanolytic activity from the parental C. minitans strain ATCC 74415 was repressed in the presence of glucose). Morphological characteristics of the C minitans strains are described in International Publication No. WO 99/02662 to Huang et al.

[0125]

C. minitans
strains M11-3B 2A2, A10-4 and 2134 were inoculated into liquid potato dextrose broth (“PDB”) using mycelial plugs from C. minitans grown on potato dextrose agar (“PDA”). Cultures were grown with constant agitation (250 rpm) at 20° C. for 14 days. Cultures were harvested after two weeks by filtration using MIRACLOTH quick-filtration material (Calbiochem, PO Box 12087, LaJolla, Calif. 92039-2087, USA, product #475855) and flash frozen in liquid nitrogen. Approximately three grams of frozen C. minitans mycelia was homogenized and thoroughly mixed with 20 ml of extraction buffer [100 mM Tris-HCl (pH 8.5), 100 mM NaCl, 50 mM ethylenediaminetetraacetic acid (“EDTA”) (pH 8.0), 2% sodium dodecyl sulfate (“SDS”) (w/v), and 0.05 mg/ml proteinase K]. The mixture was incubated at 37° C. for one hour with frequent inversion. The mixture was extracted once with 10 ml each of phenol and chloroform and precipitated with 0.6 volume of isopropanol. The genomic DNA was suspended in 0.5 ml of ultrapure water (OPTIMA, Fisher Scientific Ltd, 112 Colonnade Road, Nepean, Ontario K2E 7L6, product #W7-4) and stored at −20° C. for use as polymerase chain reaction (“PCR”) template.

[0126] ii) Primer design for PCR amplification of a genomic C. minitans glucanase fragment

[0127] β-(1,3) exoglucanase amino acid sequences from fungal species Ampelomyces quisqualis (Rotem et al., 1997), Cochliobolus carbonum (Schaeffer et al., 1994), and Trichoderma harzianum (Cohen-Kupiec et al., 1999) were aligned to identify regions of homology. These three fungal species represent very divergent phylogenetic species. Two regions exhibiting stretches of homology of at least seven amino acids in length were identified. To reduce degeneracy and non-specific amplification in the PCR amplification, DNA nucleotide sequences corresponding to the two regions of homology were identified and aligned as an alternative to the construction of degenerate primers based on homologous amino acid sequences alone. Direct nucleotide sequence comparison yielded a consensus sequence that was used to generate semi-degenerate primers Gf1 (5′ gg(tc)ga(tc)gg(tc)gt(tc)ac(tc)ga(tc)ga 3′) SEQ ID NO: 7 and Gr1 (5′ aagttgcg(ga)at(ct)tg(cg)cg 3′) SEQ ID NO: 13 targeting a homologous genomic C. minitans glucanase fragment by PCR amplification (FIGS. 1A and 1B). The DNA sequence represented by the Gf1 and Gr1 primer pair appeared to exhibit a high level of conservation at the nucleotide level with nucleotide ambiguities (at the third nucleotide) of either AG or TC pairs (which are common ambiguities generated by transition mutations during evolution). Classical PCR amplification strategies which make use of degenerate PCR primers traditionally involve deducing nucleotide primer sequences from an amino-acid sequence based on codon usage or universal translation tables. By constructing primers using a conserved consensus nucleotide sequence from regions of high homology, the specificity with which a target sequence will be amplified is significantly increased. In this manner, the Gf1/Gr1 primer pair was designed with high specificity to the target C. minitans β-(1,3) exoglucanase sequence without heavy ambiguity or amplification of extraneous sequences.

[0128] iii) PCR amplification, cloning and sequencing of the aenomic C. minitans glucanase-like fragment Glu1

[0129] The PCR reactions consisted of 25 μl reactions containing 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM Mg2+, 0.8 mM each of primer Gf1 and Gr1, 1 U TAQ DNA POLYMERASE (Life Technologies, 8400 Helgerman Court, PO Box 6009, Gaithersburg, Md. 20898-9980, USA, product #10342-020), 0.2 mM deoxynucleotide triphosphate (“dNTP”) (each of deoxyadenosine triphosphate “dATP”, deoxythymidine triphosphate (“dTTP”), deoxyguanosine triphosphate (“dGTP”), and deoxycytosine triphosphate (“dCTP”), Life Technologies, product #10297-018) mix, and 150 ng of template DNA from C. minitans strains M 1l-3B 2A2, A10-4 and 2134. The PCR cycle profile consisted of progressive touchdown annealing steps in which the annealing temperature decreased progressively with each cycle. After an initial denaturing step of 1.5 minutes at 94° C., the cycle consisted of: (1) a denaturing step of 1.5 minutes at 94° C; (2) an annealing step of one minute at 60° C.; and, (3) an extension step at 72° C. for two minutes. This cycle was repeated twenty times, the annealing temperature decreasing by 0.5° C. in each cycle, to a final annealing temperature of 50° C. This was followed by the same 3-step profile, annealing at 50° C., for an additional twenty cycles.

[0130] PCR reactions were resolved on a 1.5% Tris-acetate-EDTA (“TAE”) agarose gel, stained with ethidium bromide, and visualized under ultraviolet (“UV”) light. PCR reactions were semi-purified by passage through a 1 ml SEPHADEX G-50 DNA grade fine (Pharmacia Biotech Inc., 500 Morgan Blvd, Baie D'Urfé, Quebec, Canada H9X 3V1, product #170573-01) column and ligated overnight into the pGEM-T PCR vector system (Promega Corporation, 2800 Wood Hollow Road, Madison, Wis., 53711-5399, USA, product #A3600). The ligation mix was transformed into MAX EFFICIENCY DH5α COMPETENT CELLS (Life Technologies, product #18258-012) and recombinant vectors were screened by blue-white/ampicillin selection (white LacZ- cells were indicative of recombinant clones, transformants were selected through ampicillin resistance). Plasmid DNA (pDNA) from recombinant clones was purified using the WIZARD PLUS miniprep purification system (Promega Corporation, product #A7500) and sequenced using the universal 24 base M13 forward (5′ cgc cag ggt ttt ccc agt cac gac 3′) and the 24 base reverse (5′ agc gga taa caa ttt cac aca 3′) sequencing primers using a fluorescent dye-terminator sequencing kit (ABI-PRISM BIGDYE TERMINATOR CYCLE SEQUENCING READY REACTION KIT, PE Applied Biosystems, 850 Lincoln Centre Drive, Foster City Calif., 94404, USA, product #4303149).

[0131] iv) Characterizing the C. minitans glucanase-like zenomic fragment sequence

[0132] Fragments of identical size and around 325 bp were observed on the agarose gel from the amplified genomic DNA originating from C. minitans strains M11-3B 2A2, A10-4 and 2134 and were cloned and sequenced. The sequence of the 319 bp genomic fragment from the three C. minitans strains M11-3B 2A2, A10-4 and 2134 was obtained from the sequenced pGEM-T clones and found to be identical. The genomic DNA sequences were entered into an alignment search algorithm (BLAST) to identify homologous sequences (Altschul et al., 1997). The C. minitans genomic fragments obtained by PCR demonstrated homology to the original C. carbonum, A. quisqualis, and T. harzianum {3-(1,3) exoglucanase sequences (Schaeffer et al., 1994; Rotem et al., 1997; and Cohen-Kupiec et al., 1999) used in designing semi-degenerate primers Gf1 and Gr1. No apparent introns were observed within the glu1 genomic sequences. The absence of introns was subsequently confirmed by comparison to the full-length CBEG1 cDNA sequence.

EXAMPLE 2

[0133] Assessing presence, size, and abundance of a C. minitans glucanase-like hybridizing transcript

[0134] i) RNA isolation from C. minitans strains M11-3B 2A2, 2134 and A10-4

[0135] LRCC C. minitans strains M11-3B 2A2, 2134 and Al 0-4 were inoculated into minimal Czapek-Dox media (0.2% NH4H2PO4, 0.1% K2HPO4, 0.05% MgSO4, 7H2O, 0.05% KCl, 0.001% FeSO4, 0.00001% ZnSO4, and 0.000005% CuSO4; (all w/v)) supplemented with 1% ground sclerotia of Sclerotinia sclerotiorum as the sole carbon source as well as PDB. Cultures were incubated with constant agitation (250 rpm) at 20° C. for 14 days and harvested by filtration with MIRACLOTH filtration cloth (Calbiochem). C. minitans tissue was flash frozen in liquid nitrogen and ground into a fine powder. Total RNA was extracted from ground C. minitans tissue using TRIZOL solution (Life Technologies, product #15596-018).

[0136] ii) Northern hybridization analysis of total C. minitans RNA Ten micrograms of total RNA was loaded and resolved on a 1.5% agarose gel containing 1.9% formaldehyde, and 0.02 M 3-[N-Morpholino] propanesulfonic acid (“MOPS”) buffer. The RNA was transferred to a nylon membrane (MAXIMUM STRENGTH NYTRAN, Schleicher & Schuell, PO Box 2012, Keene, NH, 0343 1, USA, product #77404) by Northern transfer (Sambrook et al., 1989) and immobilized by UV crosslinking.

[0137] Nested primers were designed to amplify a subfragment from the C. minitans glucanase-like fragment for constructing a radiolabeled probe for hybridization to total C. minitans RNA. Primers Gf1b (5′ gccatcaatgccgccatagctg 3′) (nucleotides 277 to 298 of SEQ ID NO: 1) and Gr1b (5′ cattggtagaagtccagcctg 3′) (inverse complement sequence of nucleotides 520 to 541 of SEQ ID NO: 1) were used to PCR amplify a 265 bp C. minitans glucanase-like subfragment which was subsequently [32P]-α-dCTP labeled by secondary PCR amplification. The radiolabeled GLU1 subfragment was hybridized to total C. minitans RNA under semi-stringent conditions [55° C. overnight in 20 ml of hybridization buffer (1% (w/v) sarkosyl, 5.8% NaCl (w/v), and 50 mM Tris-HCl (pH 7.5)), 0.4 ml of 50×Denhardt's solution (50×1% (w/v) FICOLL (Type 400, Pharmacia, product #17-0400-01), 1% (w/v) polyvinylpyrrolidone, 1% (w/v) bovine serum albumin), 10% dextran sulfate, and 20 mg of denatured herring sperm DNA] and washed under stringent conditions [two washes of 0.1×sodium chloride-sodium phosphate-EDTA (“SSPE”) (20×SSPE=3.0 M NaCl, 0.2 M NaH2PO4.H2O, 20 mM EDTA, pH 7.4), 0.1% SDS at 55° C. for 20 minutes]. The membrane was exposed to FUJI Medical X-Ray Film RX (8″×10″) autoradiographic film (Innomed Christie Group Ltd., 18208 102nd Avenue, Edmonton, Alberta, Canada T5S1S7, product #03E050) for 12 hours at −80° C. before development.

[0138] The resulting autoradiogram indicated significant expression of a 2.3 kb transcript which hybridized to the C. minitans glucanase-like subfragment, indicating abundant expression of a glucanase-like transcript by C. minitans strains M11-3B 2A2 and 2134 when grown in presence of ground sclerotia of S. sclerotiorum as the sole carbohydrate source. This glucanase-like transcript was also present (but less abundant) in total RNA extracted from C. minitans strain A10-4 grown in presence of ground sclerotia of S. sclerotiorum. No glucanase-like-hybridizing transcript was observed in C. minitans strains 2134 (wild-type), A10-4 or M11-3B2A2 cultured in glucose-rich PDB media.

EXAMPLE 3

[0139] Constructing and screening a C. minitans cDNA library in the isolation and sequencing of the full-length glucanase transcript (cbeg1)

[0140] LRCC C. minitans strains 2134 and M11-3B2A2 were grown for 15 days on Czapek-Dox media containing 1% ground sclerotia of S. sclerotiorum as the sole carbohydrate source. Mycelium was collected as in Example 2, and ground in liquid nitrogen. Total RNA was extracted using TRIZOL solution (Life Technologies). Transcript RNA was purified from the total RNA mixture using a cellulose-bound oligo-dT purification system (MESSAGEMAKER mRNA Isolation System, Life Technologies, product #10551-018). First strand cDNA was synthesized from the purified mRNA using SUPERSCRIPT II RNase H−Reverse-Transcriptase (Life Technologies, product #18053-017) and was cloned unidirectionally into a λZAβ-cDNA GIGAPACK III GOLD cloning Kit (Stratagene, 11011 North Torrey Pines Road, La Jolla, Calif. 92037, USA, product #200450). Bacteriophage clones were packaged using X phage GIGAPACK III GOLD packaging extract (Stratagene, product #200450) and titered onto NZY agar media (1% (w/v) NZ amine, 0.5% (w/v) NaCl, 0.5% (w/v) yeast extract (Bacto), 0.2% (w/v) MgSO4.7H2O, pH 7.0). A library was obtained from each C. minitans strain. Phages were plated at a density of 50,000 per plate on 15 cm Petri plates.

[0141] Nested primers Gf1b and Gr1b were used to amplify and [32P]-αdCTP radiolabel a glucanase-like fragment by PCR from C. minitans genomic DNA. The radiolabeled glucanase-like fragment was used to hybridize to plaque lifts from the cDNA library at 55° C. overnight in 20 ml hybridization buffer (see Example 2) (Sambrook et al., 1989). Positive glucanase-like-hybridizing clones underwent secondary and tertiary screens. Positive tertiary clones were excised into the pBLUESCRIPT plasmid using the EXASSIST excision protocol from the λZAβ-GIGAPACK III cloning system (Stratagene, product #200450). A total of 500,000 recombinant clones were screened and five glucanase-like-hybridizing clones were identified. Following the tertiary screening of the glucanase-like-hybridizing clones, one full-length cbeg1 cDNA clone of 2677 bp originating from C. minitans strain 2134 with an open reading frame of 2358 bp was isolated (SEQ ID NO: 1). Both strands of the excised pBluescript clone were sequenced by primer walking using the ABI-PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, product #4303149). Sequences from both cDNA strands were found to be identical.

EXAMPLE 4

[0142] Characterization and structural analysis of cbeg1 cDNA by amino acid sequence alignment

[0143] The Cbeg1 amino acid sequence exhibits homology with fungal β-(1,3) exoglucanases originating from C. carbonum, A. quisqualis and T. harzianum (FIGS. 2A-2D). Cbeg1 exhibits the greatest homology with Exg1 (C. carbonum) with an overall homology of 59% over the whole sequence, while the homologies of Cbeg1 are 51% with Trexo (Trichoderma harzianum) and 43% with ExgA (Ampelomyces quisqualis). Highly conserved contiguous regions of homology include a “YKVFRNVKDYGAKGDGVTDD” motif (GAK box) extending over a stretch of 20 amino acid residues (amino acids 63 to 82 of SEQ ID NO: 2). This particular motif overlaps the “GDGVTDD” sequence targeted by the Gf1 semi-degenerate primer (amino acids 76 to 82 of SEQ ID NO: 2). A signal peptide of 21 amino acids was detected at the N-terminal end of the deduced polypeptide based on the SignalP V1.1 Server (Nielsen et al., 1997) (amino acids 1 to 21 of SEQ ID NO: 2).

[0144] Moreover, Cbeg1 exhibits 26% homology to the fungal β-(1,3)(1,4) endoglucanase bgn13.1 from the fungal mycoparasite T. harzianum although Cbeg1 homology to bgn13.1 fails to yield lengthy runs of conserved domains. The conserved residues between these glucanohydrolases implies that the mixed-linkage β-(1,3)(1,4) endoglucanase bgn]3.1 may share a common ancestral precursor to cbeg1 and its related fungal β-(1,3) exoglucanases.

[0145] The evolution of genes within this particular gene family appear to encompass functional enzymes and proteins from a diverse variety of organisms. A conserved amino acid “GAKGDGSTDD” motif (GAX box) (amino acids 425 to 434 of SEQ ID NO: 2) appearing downstream of the above GAK box sequence exhibits homology among GAX box regions in genes of disparate enzymatic function (FIG. 3). Representative examples of genes which include derivatives of this GAK box domain include a neck appendage protein from a Bacillus bacteriophage phi-29 (Vlcek and Paces, 1986), a mannuronan C5 epimerase from the bacterial species Azotobacter vinelandii (Svanem et al., 1999), an endo-N-acetylneuraminidase from the bacteriophage K1F (Petter and Vimr, 1993), and an exopolygalacturonase (pectinase) from the model plant Arabidopsis thaliana (Torki et al., 1999). The evolutionary diversity and functional disparity of genes containing this particular conserved domain implies their derivation from an early ancestral form.

[0146] The two conserved GAK and GAX box motifs within the Cbeg 1 peptide itself appear to be duplicated domains originating from a smaller ancestral precursor (FIG. 4). Sequence comparison of truncated N-terminal and C-terminal Cbeg1 sequences demonstrate conservation of key residues outside a homologous “GDGXTDD” domain. This instance of intrinsic homology may imply evolution of the functional Cbeg1 sequence through genetic duplication and variation of sequences outside this conserved region. Conservation of this “GDGXTDD” sequence within Cbeg1 and other homologous sequences of disparate origin and function denotes the significance of this domain in glucanolytic function in addition to non-glucanolytic functions evolved in genes derived from this fungal glycosyl hydrolase family.

[0147] The predicted Cbeg1 polypeptide has an isoelectric point (pI) of 6.0 and a molecular weight of 83,647 Daltons.

EXAMPLE 5

[0148] Assaying Cbeg1 exoglucanase activity in Pichia pastoris

[0149] i) Subcloning and expression of cbeg1 in the eukaryotic system of Pichia pastoris

[0150] EcoRI and XbaI digestion of cbeg1 within the pBluescript (pBSK) plasmid yielded an intact cbeg1 fragment containing EcoRI and XbaI overhangs (with a short pBSK lacZ sequence upstream of the cbeg1 “atg”). The EcoRI/XbaI cbeg1 fragment was unidirectionally ligated into EcoRI/XbaI sites in the P. pastoris integration vector, pPICZα B (Invitrogen Corporation, 1600 Faraday Ave, Carlsbad Calif. 92008, product #K1710-01). The ligated junctions were sequenced to ensure that the resulting α-factor excretory signal peptide/cbeg1 fusion construct was in-frame.

[0151] The pPICZα B/cbeg1 integration vector was linearized by PmeI digestion and subsequently used to transform P. pastoris strain GS 115 spheroplasts. pPICZα B/cbeg1 integrants were selected on his— regeneration dextrose base (“RDB”) media (1 M sorbitol, 2% dextrose (w/v), 1.34% yeast nitrogen base (Invitrogen, product #Q300-07)(w/v), 0.00004% biotin (w/v), 0.005% amino acid mix (Invitrogen, product #Q300-18) in the presence of ZEOCIN (at 100 μg/ml) (Invitrogen, product #R250-01). Single colony integrants were selected for growth in liquid buffered minimal glycerol (“BMGH”) medium (100 mM potassium phosphate, pH 6.0, 1.34 % yeast nitrogen base with amonium sulfate and without amino acid (w/v) (Difco, product #DF0919-15), 0.00004% biotin (w/v), 1% glycerol (v/v)) and subsequent induction of cbeg1 expression by transfer to BMMH media (BMGH media with 0.5% methanol (v/v) substituted for glycerol). Liquid BMMH cultures were incubated 24 hours with constant agitation (250 rpm) at 30° C. Culture filtrate was collected by centrifugation and used for Cbeg1 enzyme characterization.

[0152] ii) Characterization of secreted Cbeg1 enzyme

[0153] The secreted Cbeg1 enzyme in transgenic P. pastoris culture filtrates was assayed for specific activity on varying substrates. Furthermore, pH and temperature optima were determined for the secreted enzyme. ,-glucanase activity was determined by a modified reducing sugar colorimetric assay protocol (Miller, 1959). 100 μl culture filtrate was added to an equal volume of substrate solution and incubated at 37° C. The reaction was terminated by the addition of a 0.3% 3,6-dinitrophtallic acid: 1.8M K2CO3+0.1M Na2S2O3 (1:1) solution (200 el). Chromogenic development of the reaction mix was carried out at 95° C. for 10 minutes and optical density of the reaction mixes were read at an absorbance wavelength of 490 nm using an enzyme-linked immunosorbent (“ELISA”) plate reader. The specificity of the Cbeg1 enzyme in transgenic P. pastoris filtrates was determined by incubating culture filtrates with carboxymethylcellulose (“CMC”) (Sigma, product #C-5093), barley β-glucan (Megazyme International Ireland Ltd., Bray Business Park, Bray, Co. Wicklow, Republic of Ireland, product #β-BGBM), lichenan (Sigma, product #L-6133), oat spelt xylan (Sigma, product #X-0627), birchwood xylan (Sigma, product #X-0502), and laminarin (Sigma, product #L-9634) (1% (w/v) buffered in 100 mM sodium acetate, pH 5.0) at 37° C. Protein concentration of the culture filtrates were determined using a Bradford dye reagent microassay protocol (Bio-Rad, 2000 Alfred Nobel Dr., Hercules, Calif. 94547, product 4500-0006). Culture filtrates from a non-recombinant P. pastoris control strain (GS 115) were assayed as a negative control. No hydrolytic activity was measured in culture filtrates derived from the P. pastoris control strain. Transgenic Cbeg1 culture filtrates were shown to have activity on laminarin only, producing 46 U of activity (where one unit of activity is defined as one μg of reducing sugar (glucose) liberated per hour per ml at 37° C., pH 6.5) (Table II). Induction of activity in P. pastoris was rapid.

[0154] pH optima was determined for P. pastoris filtrates by assaying laminarin hydrolysis of buffered substrates (1% (w/v) laminarin) ranging from pH 3.5 to 8 (50 mM Na acetate for pH 3.5 to 6, 50 mM NaPO4 for pH 6 to 8). The pH optima for the secreted Cbeg1 enzyme was determined to be 6.0 (as a result of four assayed Cbeg1-expressing independent clones). Temperature optimum was determined by laminarin hydrolysis (1% (w/v), buffered at pH 6.5 in presence of 50 mM NaPO4 buffer. Optimal glucanolytic activity occurred at a temperature of 57° C. (Table II). No activity was detected in the control P. pastoris media filtrates.

2TABLE IICharacterization of transgenic Cxy1 expression in recombinantPichia pastoris culture filtratepH optimum6.0Temperature optimum57° C.Enzymatic activity (*U):CMC0barley β-glucan0lichenan0laminarin46oat spelt xylan0birchwood xylan0*one unit of catalytic activity is defined by one μg of reducing sugar (glucose) liberated at pH 6.5 and 37° C. per hour per ml of culture filtrate. This activity was measured 24 h after induction.

EXAMPLE 6

[0155] Expression of Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1 in Monocots

[0156] The constructs used for transformation of monocots using the bombardment technique are similar to the constructs used for the transformation of dicots, and include a promoter, the Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1, and a terminator gene segment.

[0157] The promoter is preferably a rice actin promoter and includes the 5′ terminal end of the same actin gene including the first intron (McElroy et al, 1991). A C. minitans β-(1,3) exoglucanase gene cbeg1 is inserted in frame and followed by a 3′ non-translated fragment of the NOS gene as terminator. This construct is identified as the pCORcbeg1 construct. The bar gene conferring resistance to glufosinate ammonium is used for selection (White et al., 1990). A pMB vector, such as pMB2 or pMB4 (Erickson et al., 1999), may be used. In this vector the bar gene is inserted in frame between the 35S promoter and the NOS terminator. Equal amount of the two constructs are used to coat gold particles before their acceleration into plant tissues.

[0158] Immature scutella are dissected from embryos of the barley cultivar Golden Promise and placed on the callus induction medium. Tissues are co-transformed with the pMB4 plasmid carrying the bar marker gene and the pCORcbeg1 construct carrying the cbeg1 polynucleotide. DNA delivery to the tissues is carried out with the HELIOS Gene Gun System, a microprojectile bombardment device (Bio-Rad, product #165-2431). An equal mass of these two plasmids (25 μg each) is mixed and coated on 25 mg of 1 μm gold particles and distributed on the inside wall of a 60 cm GOLDCOAT tubing according to the manufacturer's instructions. Discharge pressure is set at 125 psi and a diffusion screen (Bio-Rad, product #165-2475) is used to ensure an even distribution of the gold particles carrying the plasmids. A similar particle delivery device, such as the Biolistic PDS-1000 He System (Bio-Rad product #165-2257), or other functionally equivalent equipment can alternatively be used. The preparation of particles and pressure used are in accordance with the manufacturer's instructions for the instrument of choice.

[0159] The scutella are transferred to callus induction medium containing 5 mg/L of glufosinate ammonium salt (Crescent Chemical, Hauppauge, NY, USA, product #C140300) 16h after bombardment. After 20-25 days, masses of cells are transferred to plant regeneration medium containing the same amount of selective agent as the previous medium. A mass of cells develops on the plant regeneration medium to produce shoots and regenerated plantlets. A mass of cells with green shoots is excised and placed on a rooting medium (without selective agent) to favour rooting. Plantlets are then transferred to soil.

[0160] Herbicide-tolerant regenerated plants are tested with the leaf brush technique (LBT) using 500 mg/L of glufosinate ammonium salt, with an abundant brushing (Wan and Lamaux, 1994).

[0161] PCR product is probed to confirm presence of the bar gene or NPTII DNA in the plant cells, and PCR and Southern blot analyses and colorimetric assays are used to confirm the presence and activity of the cbeg1 polynucleotide.

EXAMPLE 7

[0162] Expression of Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1 in Dicots

[0163] A construct containing an isolated Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1 of the invention is engineered into the pBI121 vector that contains the CaMV 35S promoter (Kay et al., 1987) and the NOS 3′ terminator sequence (Bevan et al., 1983). The pBI121 plasmid is composed of the following well-characterized segments of DNA. A 0.93 kb fragment isolated from transposon Tn7 which encodes bacterial spectinomycin/streptomycin (Spc/Str) resistance and is a determinant for selection in E. coli and Agrobacterium tumefaciens (Fling et al., 1985). This is joined to a chimeric kanamycin resistance gene engineered for plant expression to allow selection of the transformed tissue. The chimeric gene consists of the 0.35 kb cauliflower mosaic virus 35S promoter (β-35S) (Odell et al., 1985), the 0.83 kb neomycin phosphotransferase type II gene (NPTII), and the 0.26 kb 3′ non-translated region of the nopaline synthase gene (NOS 3,) (Fraley et al., 1983). The next segment is a 0.75 kb origin of replication from the RK2 plasmid (ori-V) (Stalker et al, 1981). It is joined to a 3.1 kb SalI to PvuI segment of pBR322 which provides the origin of replication for maintenance in E. coli (ori-322) and the bom site for the conjugational transfer in the Agrobacterium tumefaciens cells. Next is a 0.36 kb PvuI fragment from the pTiT37 plasmid which contains the nopaline-type T-DNA right border region (Fraley et al., 1985).

[0164] The vector containing the C. minitans β-(1,3) exoglucanase gene cbeg1 is transformed into the B. napus cultivar Westar according to the method of Moloney et al. (1989).

[0165] To prepare cotyledons for transformation, seeds are sterilized in 20% commercial bleach for 30 minutes while shaking. The seeds are then washed five times in a sterile funnel and filter paper using ddH2O. The washed seeds are placed on Brassica napus I (BNI) seed germination medium (˜20 per plate) (Moloney et al., 1989), wrapped in PARAFILM, and incubated at 25° C. for five days.

[0166] Agrobacterium harboring the plasmid of interest (e.g. pPZP (Hajdukiewicz et al., 1994) or another appropriate binary vector) is inoculated with 5 mL of Agrobacterium medium (AB) with a selection antibiotic and incubated at 28° C. for two days. Immediately prior to the transformation step, 1 mL of the Agrobacterium culture is spun down in a microfuge (13,000×g) for 1-2 minutes. The culture is resuspended in 1 mL of AB broth (no antibiotics) and diluted until OD600=0.05.

[0167] Four to five day old cotyledons are used for transformation. The cotyledon is held with sterile forceps and cut with a sterile scalpel, without removing the apical meristem. Only a few cotyledons are cut at a time, and they are left on the germination plate to reduce dessication. The petiole of the cotyledon is dipped in the Agrobacterium suspension for 1 second and placed on BNII (co-cultivation) medium (Moloney et al, 1989). The petiole is pushed into the soft agar. To avoid growback, the cotyledon is not dipped a second time into the Agrobacterium suspension. Ten cotyledons are placed on each plate, and the plates are wrapped in PARAFILM and incubated in a growth room (25° C. with light) for two days.

[0168] The cotyledons are then transferred to BNIV (selection/regeneration) medium (Moloney et al., 1989), wrapped in PARAFILM, and incubated in a growth room. Agrobacterium growth is monitored during the first few weeks, and the tissue is transferred to new BNIV at the first sign of grow back of bacteria (approximately every second week). As soon as shoots arise from callus tissue, they are cut and placed on BNV (shoot elongation) medium (Moloney et al., 1989) in Magenta jars. Every second week, the shoots are transferred to fresh BNV medium. After the shoots have elongated, they are transferred to BNVI (rooting) medium (Moloney et al., 1989). Once the roots have formed, the plantlets are transferred to soil and placed in a misting chamber until NPTII enzymatic assays are done. NPTII positive plants are then and grown to maturity in a greenhouse growth chamber.

[0169] After enough leaf tissue has formed, Southern Blot or PCR analyses can be performed to verify presence of the Coniothyrium minitans β-(1,3) exoglucanase gene cbeg1. When seeds have formed, or at other stages of development, Northern, RT-PCR and Western Blots can be performed, and enzymatic activity measured.

REFERENCES

[0170] Alber, T. and Kawasaki, G. (1982) Nucleotide sequence of the triose phosphate isomerase gene of Saccharomyces cerevisiae. J. Mol. Appl. Genet. 1:419-434.

[0171] Atschul, S. F., Madden, T. L., Scaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.

[0172] Ausubel, F. M., Bent, R., Kingston, R. E., Moore, D. J., Smith, J. A., Silverman, J. G. and Struhl K. (2000) Current Protocols in Molecular Biology. John Wiley & Sons, New York.

[0173] Bachman, E. S. and McClay, D. R. (1996) Molecular cloning of the first metazoan β-1,3 glucanase from eggs of the sea urchin Strongylocentrotus purpuratus. Proc. Natl. Acad. Sci. 93: 6808-6813.

[0174] Bamforth, C. W. (1980) The adaptability, purification and properties of exo-β1,3-glucanase from the fungus Trichoderma reesei. Biochem. J. 191:863-866.

[0175] Beguin, P. and Aubert, J.-P. (1994) The biological degradation of cellulose. FEMS Microbiol Revs 13:25-58.

[0176] Bevan, M. W., Flavell, R. B. and Chilton, M.-D. (1983) A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature (London) 304:184-187.

[0177] Bevan M., Barker R., Goldsbrough, A., Jarvis, M., Kavanagh, T. and Iturriaga, G. (1986) The structure and transcription start site of a major potato tuber protein gene. Nucleic Acids Res. 14:4625-4638.

[0178] Borgia, P. T. and Dodge, C. L. (1992) Characterization of Aspergillus nidulans mutants deficient in cell wall chitin or glucan. J. Bacteriol. 174(2):377-383.

[0179] Breen, J. P. and Crouch, M. L. (1992) Molecular analysis of a Cruciferin storage protein gene family of Brassica napus. Plant Mol. Biol. 19:1049-1055.

[0180] Chen, H., Li, X.-L. and Ljungdahl, L. G. (1997) Sequencing of a 1,3-1,4-β-D-glucanase (lichenase) from the anaerobic fungus Orpinomyces strain PC-2: Properties of the enzyme expressed in Escherichia coli and evidence that the gene has a bacterial origin. J. Bacteriol. 179(19): 6028-6034.

[0181] Chesson, A., Forsberg, C. W. and Grenet, E. (1995) Improving the digestion of plant cell walls and fibrous feeds. In: Recent developments in the nutrition of herbivores, M. Journet, E. Grenet, M.-H. Farce, M. Theriez, C. Demarquilly (eds). Proceedings of the IVth international symposium on the nutrition of herbivores, pp. 249-277. INRA Editions, Paris.

[0182] Cho, M.-J., Jiang, W. and Lemaux, P. G. (1998) Transformation of recalcitrant barley cultivars through improvement of regenerability and decreased albinism. Plant Science 38: 229-244.

[0183] Cohen-Kupiec, R., Broglie, K. E., Friesem, D., Broglie, R. M. and Chet, I. (1999) Molecular characterization of a novel beta-1,3-exoglucanase related to mycoparasitism of Trichoderma harzianum. Gene 226:147-154.

[0184] Copa-Patino, J. L., Reyes, F. and Perez-Leblic, M. I. (1989) Purification and properties of a 1,3-β-glucanase from Penicillium oxalicum autolysates. FEMS Microbiol. Lett. 65:285-292.

[0185] de la Cruz, J., Pintor-Toro, J. A., Benitez, T., Llobell, A. and Romero, L. C. (1995) A novel endo-beta-1,3-glucanase, BGN1 3.1, involved in the mycoparasitism of Trichoderma harzianum. J. Bacteriol. 177:6937-6945.

[0186] Depicker, A., Stachel, S., Dhaese, P., Zambryski, P. and Goodman, H. M. (1982) Nopaline synthase: transcript mapping and DNA sequence Agrobacterium tumefaciens. J. Mol. Appl. Genet. 1:561-573.

[0187] Donzelli, B. G. G., Lorito, M., Scala, F. and Hannan, G. E. (2000) Cloning, sequence and structure of a gene encoding an antifungal glucan 1,3-beta-glucosidase from Trichoderma atroviride (T. harzianum) with a spliced regulatory sequence. GenBank accession no. AF253421.

[0188] Erickson, F. L., Holzberg, S., Calderon-Urrea, A., Handley, V., Axtell, M., Corr, C. and Baker, B. (1999) The helicase domain of the TMV replicase proteins induces the N-mediated defence response in tobacco. Plant J. 18:67-75.

[0189] Fling, M. E., Kopf, I. and Richards, C. (1985) Nucleotide sequence of the rtransposon Tn7 gene encoding an aminoglucoside-modifying enzyme 3″(9)-O-nucleotidyltransferase. Nucleic Acids Res. 13: 7095-7106.

[0190] Fraley, R. T., Rogers, S. G., Horsch, R. B., Sanders, P. R. and Flick, J. S. (1983) Expression of bacterial genes in plant cells Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 80:4803-4807.

[0191] Fraley, R. T., Rogers, S. G., Horsch, R. B., Eichholtz, D. A., Flick, J. S, Fink, C. L., Hoffmann, N. L. and

[0192] Sanders, P. R. (1985) The SEV system: a new disarmed Ti plasmid vector system for plant transformation. Bio/Technology 3:629-635.

[0193] Gelvin, S. B., Schilperoort, R. A. and Verma, D.P.S. (1994) Plant Molecular Biology Manual. Kluwer Academic Publishers. Belgium.

[0194] Giczey, G., Kerenyi, Z. and Hornok, L. (2000) Isolation and characterization of a beta-1,3-glucanase gene from the mycoparasite Coniothyrium minitans. Genbank accession no. AF247649.

[0195] Gielen, J., De Beuckeleer, M., Seurinck, J., Deboeck, F. and De Greve, H. (1984) The complete nucleotide sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5. EMBO J. 3:835-846.

[0196] Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25: 989-994.

[0197] Henrissat, B. Claeyssens, M., Tomme, P., Lemesle, L. and Mornon, J.-P. (1989) Cellulase families revealed by hydrophobic cluster analysis. Gene 81:83-95.

[0198] Henrissat, B. and Bairoch, A. (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similiarities. Biochem. J. 293: 781-788.

[0199] Hoj, P. B. and Fincher, G. B. (1995) Molecular evolution of plant ,B-glucan endohyrolases. Plant J. 7(3):367-379.

[0200] Huang, H. C. and Hoes, J. A. (1976) Penetration and infection of Sclerotinia sclerotiorum by Coniothyrium minitans. Can. J. Bot. 54:2843-2489.

[0201] Huang, H. C. and Kokko, E. G. (1987) Ultrastructure of hyperparasitism of Coniothyrium minitans on sclerotia of Sclerotinia sclerotiorum. Can. J. Bot. 65:2843-2489.

[0202] Huang, H. C. and Kokko, E. G. (1988) Penetration of hyphae of Sclerotinia sclerotiorum by Coniothyrium minitans without the formation of appressoria. Phytopath. Zeit. 123:133-139.

[0203] Jones, D., Gordon, A. H. and Bacon, J. S. D. (1974) Co-operative action by endo- and exo-β-(1,3)-glucanases from parasitic fungi in the degradation of cell-wall glucans of Sclerotinia sclerotiorum (Lib.) de Bary. Biochem. J. 140:47-55.

[0204] Kay, R., Chan, A., Daly, M. and McPherson, J. (1987) Duplication of CaMV 35S orimoter sequences creates a strong enhancer for plant genes. Science 236:1299-1302.

[0205] McElroy, D., Blowers, A. D., Jenes, B. and Wu, R. (1991) Construction of expression vectors based on the rice actin 1 (Act1) 5′ region for use in monocot transformation. Mol. Gen. Genet. 231:150-160.

[0206] Miller, G. L. (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugars. Anal. Chem. 31:426-428.

[0207] Moloney, M. M., Walker, J. M. and Sharma, K. K. (1989) High efficiency transformation of Brassica napus using Agrobacterium vectors. Plant Cell Reports 8:238-242.

[0208] Nielsen, H., J. Engelbrecht, S. Brunak, and G. V. Heijne. (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Prot. Eng. 10:1-6.

[0209] Odell, J. T., Nagy, F. and Chua, N.-H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313:810-812.

[0210] Peberdy, J. F. (1990) Fungal cell wall—a review. In: Biochemistry of cell walls and membranes in fungi, P. J. Kuhn, A. P. J. Trinci, M. J. Jung, M. W. Goosey and L. G. Cooping (eds.), pp. 5-24.

[0211] Petter J. G., and Vimr, E. R. (1993) Complete nucleotide sequence of the bacteriophage K1F tail gene encoding endo-N-acylneuraminidase (endo-N) and comparison to an endo-N homolog in bacteriophage PK1E. J. Bacteriol. 175(14):4354-4363.

[0212] Rotem, Y., Yarden, O. and Sztejnberg, A. (1997) The mycoparasite Ampelomyces quisqualis express several exo-beta-1,3-glucanases in culture and during mycoparasitism. GenBank accession no. AF029354.

[0213] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning, A Laboratory Manual. Cold Spring Harbour Laboratory Press.

[0214] Schaeffer, H. J., Leykam, J. and Walton, J. D. (1994) Cloning and targeted gene disruption of EXG1, encoding exo-beta 1,3-glucanase, in the phytopathogenic fungus Cochliobolus carbonum. Appl. Environ. Microbiol. 60(2):594-598.

[0215] Scofield. S. R. and Crouch. M. L. (1987) Nucleotide sequence of a member of the napin storage protein family from Brassica napus. J. Biochem. 262:12202-12208.

[0216] Stahmann, K.-P., Schimz, K.-L. and Sahm, H. (1993) Purification and characterization of four extracellular 1,3-β-glucanases of Botrytis cinerea. J. Gen. Microbiol. 139:2833-2840,

[0217] Stalker, D. M., Thomas, C. M. and Helinski, D. R. (1981) Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2. Mol. Gen. Genet. 181:8-12.

[0218] Svanem, B.I.G., Skjaak-Braek, G., Ertesvaag, H. and Valla, S. (1999) Cloning and expression of three new Azotobacter vinelandii genes closely related to a previously described gene family encoding mannuronan C-5-epimerases. J, Bacteriol. 181(1):68-77,

[0219] Teather, R. M. and Erfle, J. D. (1990) DNA sequence of a Fibrobacter succinogenes mixed-linkage beta-glucanase (1,3-1,4-beta-D-glucan 4-glucanohydrolase) gene. J. Bacteriol. 172(7): 3837-3841.

[0220] Thomson, J. A. (1993) Molecular biology of xylan degradation-FEMS Microbiol. Rev. 104: 65-82.

[0221] Tingay, S., McElroy, D-, Kalla, R., Fieg, S.. Wang, M., Thornton, S. and Brettell, R. (1997) Agrobacierium tumefaciens-mediated barley transformation. Plant J. 11:1369-1376.

[0222] Torki, M., Mandaron, P,, Thomas, F., Quigley, F., Mache, R. and Falconet, D. (1999) Differential expression of a polygalacturonase gene family in Arabidopsis thaliana. Mol. Gen. Genet. 2261(6): 948-952.

[0223] Trick, H. N. and Finer, J. J. (1997) SAAT: sonication-assisted Agrobacterium-mediated transformation. Transgenic Res, 6:329-336.

[0224] Umemoto, N., Kakitani, M., Iwamatsu, A., Yoshikawa, M., Yamaoka, N. and Ishida, I. (1997) The strUcture and function of a soybean β-glucan-elicitor-binding protein. Proc. Natl. Acad. Sci. 94:1029-1034.

[0225] Vazquez-Garciduenas, S., Leal-Morales, C. A. and Herrera-Estrella, A. (1998) Analysis of the β-1,3-glucanolytic system of the biocontrol agent Trichoderma hazarium. Appl. Environ. Microbiol. 64(4):1442-1446.

[0226] Vlcek, C. and Paces, V. (1986) Nucleotide sequence of the late region of Bacillus phage phi-29 completes the 19285-bp sequence of phi-29 genome: comparison with the homologous sequence of phage PZA. Gene 46:215-225.

[0227] Wan, Y. and Lemaux, P. G. (1994) Generation of large numbers of independently transformed fertile barley plants Plant Physiol. 104:37-48.

[0228] Weeks, J. T., Anderson, O. D. and Blechl, A. L. (1993) Rapid production of multiple independent lines of fertile transgenic wheat (Triticum aesivum). Plant Physiol. 102:1077-1084.

[0229] White, J., Chang, S. Y., Bibb, M. J. and Bibb, M .J. (1990) A casssette containing the bar gene of Streptomyces hygroscopious: a selectable marker for plant transformation. Nucleic Acids Res 18.1062.

[0230] Wolf, M., Geczi, A-, Simon, O. and Borriss, R. (1995) Genes encoding xylan and beta-glucan hydrolysing enzymes in Bacillus subtilis: characterization, mapping and construction of strains deficient in lichenase, cellulase and xylanase. Microbiology 141(2):291-290.

PATENT DOCUMENTS

[0231] Huang, H. C., Cheng, K.-J,, Zantinge, J. and Laroche, A. (1998) Strains of Coniothyrium minitans having 1,3 and 1,4 beta-glucanase activity. International Publication No- WO 99/02662.

[0232] Swanson, R. V., Feldman, R. A. and Schleper, C. (2000) Nucleic acids and proteins from Cenarchaeum symbiosum, International Publication No. WO 00/18909.

[0233] All publications mentioned in this specification are indicative of the level of skill in the art to which this invention pertains, All publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0234] Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity and understanding it will be understood that certain changes and modifications may be made without departing from the scope or spirit of the invention as defined by the following claims.

Coniothyrium minitans beta-(1,3) exoglucanase gene cbeg1

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

CROSS-REFERENCE TO RELATED APPLICATIONS

Provisional Applications (1)