Patent Application
20080008723
The invention is directed at veterinary bacterial pathogens lipopolysaccharide (LPS), comprising one or more epitopes of the inner-core oligosaccharide portion of the LPS. The invention identifies conserved epitopes that are expressed on the LPS of bacterial veterinary pathogens across a range of disease causing isolates including but not necessarily limited to Actinobacillus pleuropneumoniae (Ap), Mannheimia haemolytica (Mh) and Pasteurella multocida (Pm).
Bacterial pathogens are a significant cause of economic loss in commercial farm operations as well as a health issue in a wide range of animal populations, including humans.
Three of the most common bacterial pathogens involved in veterinary diseases are Mannheimia (Pasteurella) haemolytica (Mh), Actinobacillus pleuropneumoniae (Ap) and Pasteurella multocida (Pm). MA is primarily a bovine and ovine pathogen, Ap is a porcine pathogen and Pm is a multi-species pathogen including poultry, cattle and swine, and is also the causative agent of dog and cat bite infections in humans. Taken together they cause diseases resulting in major economic losses to the animal farming industry.
Current practice involves using bacterins or crudely modified live strains as vaccines. Such approaches are not entirely satisfactory as effectiveness can be inadequate and there is a significant incidence of adverse effects.
There is currently no single vaccine available to provide cross-species protection against infections caused by these three species, Mh, Ap and Pm. It would be useful to have a vaccine against the pathogenic bacteria of concern. Vaccine approaches to combat diseases caused by Mh are still mainly based on bacterins and live attenuated strains. More recent versions of live vaccines incorporate secreted or extracted Mh antigens such as neuraminidase, leukotoxin, sialoglycoprotease, outer membrane and uncharacterised proteins. Leukotoxin has traditionally been the main sub-unit vaccine candidate, although immunisation with a mutant strain expressing non-toxic leukotoxin was still partially virulent in a calf challenge model and leukotoxin in combination with capsular polysaccharide was unable to produce a protective immune response. In contrast, LPS has been shown to stabilise leukolytic activity and so a conjugate vaccine based on LPS and detoxified leukotoxin may offer promise [Li, J., and K. D. Clinkenbeard. 1999. Infect. Immun. 67: 2920-2927].
Current vaccine approaches to combat diseases caused by Ap are based on live attenuated strains as they contain the highly labile Apx toxins, which induce neutralizing antibodies required for protection. These Apx toxins form the basis for the major sub-unit vaccine against Ap but only seem to induce partial clinical protection. Adhesins including the core OS of LPS have been proposed as improved vaccine candidates [Van Overbeke I., et al. 2003. J. Vet. Med. B. Infect. Dis. Vet. Public Health. 50: 289-293]. Current vaccines to prevent Pm disease in pigs consist of toxoids and somatic antigens such as capsules and outer membrane proteins. Pm was first shown by Pasteur to induce fowl cholera in chickens and current strategies for protection against this disease utilise an attenuated Pm strain. In general however, this strategy is severely limited as the immune response remains serotype-restricted and fails to provide cross-protection against other serotypes. The LPS of Pm has however been shown to play a partial role in the immunity to infection.
Considerable evidence has accumulated indicating that LPS from each of these organisms may be a good candidate for subunit vaccine design. LPS has been shown to be both visible and a major antigenic determinant on the surface of Mh and mAbs raised to A1 LPS facilitated phagocytosis but not complement mediated killing in vitro [Wilson, C. F., et al. 1992. Vet. Microbiol. 31: 161-168].
In Pm ribosome-LPS vaccines protected chickens against fowl cholera disease from homologous Pm strains [Phillips, M., and R. B. Rimler. 1984. Am. J. Vet. Res. 45: 1785-1789]. Additionally, immunisation with a LPS-protein complex provided 100% protection to mice when challenged with a homologous strain yet when separated the individual components of the complex afforded no protection. MAbs raised to LPS from Pm only afforded partial protection in a mouse model and although they were opsonophagocytic, were not bactericidal in the presence of complement. However in another study a mAb to Pm LPS completely protected mice against homologous challenge and was bactericidal [Wijewardana, T. G., et al. 1990. J. Med. Microbiol. 33: 217-222]. An anti-idiotype vaccine mimicking LPS from type A was protective in a mouse model when challenge was with homologous organisms.
In Ap, the LPS and more specifically the core region of the LPS has been implicated in the adhesive abilities of the bacterium. A conjugate vaccine of BSA linked to Ap serotype 1 LPS was protective against mice following homologous but not heterologous challenge and conjugates of both smooth and rough Ap LPS from serotype 5 and 1 suggested that the carbohydrate portion of the cell wall of Ap plays a significant role in the porcine immune response [Fenwick, B., and B. I. Osburn. 1986. Infect. Immun. 54: 583-586].
In this context the veterinary organisms of interest contain surface exposed carbohydrate moieties that can be considered as vaccine candidates. These carbohydrate moieties include LPS and capsular polysaccharides. Capsular polysaccharides are repeating units of several carbohydrate residues directly linked to the bacterial surface whereas LPS consists of three regions, a lipid A region that links the LPS molecule to the bacterial surface via fatty acid residues, a relatively conserved core oligosaccharide region which links the lipid A region to the third region, the variable polysaccharide antigen (O-antigen). The heterogeneity of the capsular and O-antigenic polysaccharides from strain to strain would ordinarily preclude them as economically viable vaccine candidates due to their ability to provide coverage only to homologous strains. Recent advances in molecular genetics, molecular structure analysis and immunochemistry have provided powerful tools, which have allowed us to identify carbohydrate structures as candidate vaccine antigens.
Lipopolysaccharide (LPS) is an essential and characteristic surface-exposed antigen of Mh, Ap and Pm. (As discussed above, the terms lipopolysaccharide and LPS as used herein encompass short chain lipopolysaccharide and lipooligosaccharide (LOS)). Pm strains express heterogeneous populations of low-molecular-weight LPS, which can exhibit extensive antigenic diversity among multiple oligosaccharide epitopes, whereas strains of Mh and Ap produce both low-molecular-weight LPS and traditional LPS molecules with O-antigenic polymers. The LPS carbohydrate structures of Mh, Ap and Pm described by the Applicant herein can provide a source of protective antigens when they are presented to the host immune system in an appropriate fashion, for example, as a protein-conjugate. LPS proved useful as a vaccine candidate in Applicant's study because unexpectedly surface expressed carbohydrate antigens were identified which possess oligosaccharide epitopes that are genetically and physiologically stable, that are conserved across the range of strains, and that are accessible to host clearance mechanisms across the three species Mh, Ap or Pm.
The carbohydrate regions of Mh, Ap and Pm LPS molecules provide targets for recognition by host immune responses. Determination of structure is crucial to understanding the biology of Mh, Ap and Pm LPS and its role in bacterial virulence. Mh, Ap and Pm LPS comprises a heterogeneous mixture of molecules consisting of a variable oligosaccharide moiety and a membrane anchoring-Lipid A component and in the case of some strains of Mh and Ap a polymeric O-antigen. Based on the experiments described herein, a structural model was developed for Mh, Ap and Pm LPS consisting of a conserved tetra-heptosyl-di-glucosyl inner-core moiety, which is attached via a phosphorylated ketodeoxyoctonoate residue (Kdo) to a lipid A component and which has been found to be conserved and present in every strain so far examined.
From the structural analyses it was clear that the maximum structure absolutely conserved across the three species was that illustrated in Structure I below.
where Kdo is 3-deoxy-D-manno-2-octulosonic acid, Hep is heptose, Glc is glucose, P is phosphate and Lipid A is detoxified.
In order to utilise an antigen for vaccine development, four essential criteria must be fulfilled. That is the immunogenic epitope of the candidate antigen must be:
i) genetically stable;
ii) conserved in all clinically relevant strains across the species
iii) accessible (in vitro and in vivo) to host immune mechanisms; and,
iv) able to induce protective antibodies in vivo.
This invention has identified a conserved LPS carbohydrate epitope that has been shown to satisfy the majority of these criteria.
i) Genetic stability: The genes involved in the biosynthesis of the conserved inner core oligosaccharide have been identified in the genome strains of the three bacterial species, (two Pm strains, one Mh strain and two Ap strains). Genes involved in the different outer core variations exhibited by these bacterial species have been found to be variably present, and these data have been corroborated with structural data on these genome strains and additional strains of each bacterial species. However, both structural and genetic analyses (see Table A) have indicated that the inner core structure is structurally conserved due to the consistent presence of the genes known to be responsible for inner core biosynthesis.
e-values based on Blasting veterinary pathogen genomes with inner core LPS glycosyltransferases from Haemophilus influenzae strain KW-20 (Rd), except lbgB where PM1144 from Pm70 genome was used.
Genome data obtained from: Baylor College of Medicine, Houston (Mh); Department of Microbiology and Immunology, Laboratory for Genomics and Bioinformatics, Oklahoma University Health Sciences Center (Pm-3480 and Ap1); Institute for Biological Sciences, National Research Council, Ottawa, Canada (Ap5); Computational Biology Centre, University of Minnesota (Pm70).
ii) Structural conservation: In every strain investigated by Applicant to date this tetra-heptosyl-di-glucosyl moiety has been contained within the following structural element (Structure II):
where: —R is H or phosphoethanolamine (PEtn), P is phosphate, R′ and R″ are H or oligosaccharide chain extensions, preferably not including β-D-Galp-(1-7)-D-α-D-Hepp-(1-6), and R′″ is a variable O-antigen in Ap, Kdo is 3-deoxy-D-manno-2-octulosonic acid and Lipid A is detoxified.
The first heptose residue (HepI) is the only heptose residue from which core oligosaccharide extension has been shown to occur in all three species, Ap, Mh and Pm. Outer core extension elongates further from the HepIV residue. No core oligosaccharide extension has been observed from HepII or HepIII in any species. O-antigen extension in Ap serotype 5 was found to occur from the HepIII residue [St. Michael, F. et. al. 2004, Carbohydr. Res., 339: 1973-1984], the location of O-antigen attachment to the core OS has not been shown in Mh. No antigenic polymeric repeating units have been observed in Pm. Four genes have been shown to be involved in O-antigen biosynthesis in Ap serotype 1, including rfbP and rfbU, mutants of which result in Ap strains without O-antigen [Labrie, J. et al. 2002, J. Endotox. Res., 8: 27-38]. The inner core of all three species can be further substituted with a phosphoethanolamine residue, either at the 3-position of the HepII residue in Pm strain Pm70, or at the Kdo-P residue in all species Ap, Mh, and Pm. In Pm, a minor population of LPS glycoforms have been shown to elaborate two Kdo residues instead of the Kdo-P or Kdo-P-PEtn moiety, the presence of the second Kdo residue is concomitant with the loss of the inner core α-Glc residue. Outer core variation has been observed both within and between the three species of interest. In Ap serotype 1 the outer core extension has been completely structurally characterised by NMR and shown to contain the rarely encountered open-chain N-acetylgalactosamine structure terminal to the oligosaccharide extension of (1S)-GalaNAc-(1-4,6)-α-Gal-(1-3)-β-Gal. This structure has also been inferred from mass spectrometry in serotypes 9 and 11 also. In Ap serotype 2 the HepIV residue was found to be di-substituted at the 4-position with a β-Glc residue and at the 6-position with a D, D-α-HepV residue. In Ap serotype 5 only the D, D-α-HepV residue is substituting HepIV. A similar outer core extension to that found for Ap serotype 5 is observed in Mh, where the second D, D-α-HepV residue is itself substituted at the 7-position with a β-Gal residue. In Pm, studies on two serotype 1 strains, VP161 and X73 revealed an unusual outer core extension wherein the HepIV residue was symmetrically substituted at both the 4- and 6-positions with β-Gal residues that themselves were mono-substituted with phosphocholine moieties at the 3-positions, or elaborated in addition to the phosphocholine residues, phosphoethanolamine residues at the 6-positions of the β-Gal residues (X73). Another study on the genome sequenced strain Pm70 revealed di-substitution of the HepIV residue at the 4- and 6-positions once again. The 4-position was substituted by a β-glucose residue and at the 6-position with the unusual pentasaccharide α-GalNAc-(1-3)-β-GalNAc-(1-3)-α-Gal-(1-4)-β-Gal-(1-4)-β-Glc.
iii) Accessibility: Since this inner core structure is consistently expressed in these three species it was important to ascertain if epitopes of this inner core structure were accessible and conformationally conserved regardless of the variability in outer core, O-antigen and other cell surface structures. To achieve this the conserved structure needed to be elaborated as a terminal structure and to that end glycosyltransferases were targeted that would expose this structure. The availability of the complete genome sequence of Pm strain Pm70 in conjunction with thorough knowledge of this strains LPS structure (see Example 3), facilitated tentative identification of the glycosyltransferases responsible for the biosynthesis of the Pm70 LPS structure. Other genome sequences are also evolving for a second Pm strain (P-3480), two Ap strains (serotypes 1 and 5) and one Mh strain (serotype A1), and a Bioinformatics approach was utilised in order to identify target genes for mutagenesis. Mh strain A1 was selected for mutagenesis studies, as the amount of O-antigen present in this organism is low compared to Ap and therefore should not interfere with subsequent immunological studies. As illustrated below, candidate glycosyltransferases were identified in both a) Mh strain A1 and b) Ap serotype 1.
A homologue of the H. ducreyi lbgA galactosyltransferase gene [Tullius, M. V. et al 2002, Infect. Immun. 70: 2853-2861] had been identified in Ap located between two genes that were found to be involved in core oligosaccharide biosynthesis by mini-Tn10 transposon mutagenesis [Galarneau, C. et al 2000, Pathogenesis, 1: 253-264]. The adjacent gene in Ap, lbgB showed considerable homology to a
Utilising standard molecular biological techniques, this gene was mutated and the resulting LPS derived from the mutant strain was structurally characterised to show that the targeted conserved inner core structure had been obtained (see Example 7). MAbs and pAbs were raised to this inner core LPS structure in order to examine the degree of conservation and accessibility of this structure across a range of strains of these veterinary pathogens. Polyclonal sera were obtained that were cross-reactive with both LPS and whole cells of each of the three species, Mh, Ap and Pm. Four mAbs (G3, G8, E8 and D8) were obtained from one fusion that were specific for an inner core conformation as it is presented on whole cells of Mh. Three mAbs (3-4, 3-5 and 3-16) were obtained from a subsequent fusion that were capable of cross-reacting with LPS from all of the strains of interest from Ap, Pm and Mh thus establishing the potential of a conserved cross-reactive LPS epitope shared between these three significant veterinary pathogens. Ascites fluid was raised from four of these mAbs (G3, G8, 3-5 and 3-16) and examined by whole cell ELISA which, revealed that the LPS epitopes recognised by these mAbs were accessible on the whole cells, thus demonstrating that the conserved inner core epitopes are accessible on the cell surface. Furthermore, mAbs G3 and G8 facilitated passive protection in a mouse model of Mh infection, illustrating accessibility to this inner core structure in vivo.
iv) Functional antibodies: Polyclonal sera containing antibodies cross-reactive with LPS of the species of interest, and mAbs G8 and G3 were able to facilitate complement-mediated lysis of Mh cells. Passive protection studies were performed in the well established mouse model of Mh infection, which revealed that provision of mAbs (G3 and G8) specific for this conserved inner core LPS structure in Mh were able to protect against disease. Finally a conjugate vaccine was produced linking the conserved carbohydrate structure to the carrier protein HSA, and mouse sera raised following immunisation with this conjugate was found to be cross-reactive with LPS and whole cells from the three species of interest.
The invention provides vaccines, vaccine components, and uses thereof suitable for providing immunity involving B-cell activating molecules derived from veterinary bacterial pathogens lipopolysaccharide (LPS), said molecules comprising one or more epitopes of the inner-core oligosaccharide portion of the lipopolysaccharide. The disclosure herein identifies and characterizes epitopes that are expressed on the LPS of bacterial veterinary pathogens across a range of disease causing isolates including but not necessarily limited to Actinobacillus pleuropneumoniae (Ap), Mannheimia haemolytica (Mh) and Pasteurella multocida (Pm). There is identified herein a defined sub-unit antigen suitable for use in the manufacture of vaccines. Antigens that are vaccine candidates are preferably displayed on the surface of the bacteria, in its natural state, so that the immune response to the vaccine antigen can subsequently target the live organism.
We have found and produced an inner core LPS which is common to all three organisms. LPS has been shown to play a role in the immunity to each of these veterinary pathogens and if the LPS antigen is conformationally conserved the immune response would likely recognise homologous and heterologous strains and indeed species.
Structural analysis data suggested that all these veterinary pathogens shared a common and conserved inner core OS structure. It was decided therefore to explore the potential of a LPS-based vaccine.
A first step in this process was the construction of a mutant strain expressing exclusively the conserved inner core OS epitope as a terminally exposed structure. This study has generated a mutant in the α-1,6-D-glycero-D-manno-heptosyltransferase gene from Mh strain A1 in order to present the conserved inner core epitope as a terminally exposed moiety.
MAbs and pAbs were raised to this inner core LPS structure in order to examine the degree of conservation and accessibility of this structure across a range of strains of these veterinary pathogens. Three mAbs were obtained that were capable of cross-reacting with LPS from all of the strains of interest from Ap, Pm and Mh thus establishing the potential of a conserved cross-reactive LPS epitope shared between these three significant veterinary pathogens.
Whole cell ELISA analyses revealed that these LPS epitopes were recognised by the mAbs on the whole cells, thus demonstrating that the inner core epitopes are accessible on the cell surface. Mabs, which recognised the inner core oligosaccharide were able to facilitate complement-mediated bactericidal lysis of the Mh cells. Passive protection studies were performed in the well established mouse model of Mh infection, which revealed that provision of mAbs specific for this conserved inner core LPS structure were able to protect against disease. Finally a conjugate vaccine was produced linking the conserved carbohydrate structure to the carrier protein HSA, and mouse sera raised following immunisation with this conjugate was found to be cross-reactive with the three species of interest.
In one aspect, the invention provides a lipopolysaccharide moiety comprising a conserved di-glucosyl-tetra-heptosyl inner-core free of variable outer core oligosaccharide chain extensions.
In another aspect, the invention provides a lipopolysaccharide moiety comprising a di-glucosyl-tetra-heptosyl inner-core moiety having the following structure II:
where: —R is H or phosphoethanolamine (PEtn), P is phosphate, R′ and R″ are H or oligosaccharide chain extensions, preferably not including β-D-Galp-(1-7)-D-α-D-Hepp-(1-6), and R′″ is a variable O-antigen in Ap, Kdo is 3-deoxy-D-manno-2-octulosonic acid and Lipid A is detoxified.
In another aspect, the invention provides an immunogenic composition for conferring protection in an animal host against a disease caused by Mh, Ap or Pm, comprising either of the lipopolysaccharide moieties described above.
In another aspect, the invention provides a use of at least one gene in the LPS biosynthetic pathway for the production of lipopolysaccharide in Mh, Ap or Pm, to obtain a mutant strain comprising either of the lipopolysaccharide moieties described above.
In another aspect, the invention provides a use of at least one immunogenic epitope to elicit a functional cross-reactive antibody against Mh, Ap or Pm, wherein the epitope comprises either of the lipopolysaccharide moieties described above.
In another aspect, the invention provides a functional antibody which is cross-reactive against Mh, Ap or Pm, and which is elicited by either of the lipopolysaccharide moieties described above.
In another aspect, the invention provides a method for the production of a functional cross-reactive antibody against Mh, Ap or Pm, which comprises: (a) generating antibodies to either of the lipopolysaccharide moieties described above, (b) testing such antibodies against a plurality of Mh, Ap and Pm strains, and (c) selecting those antibodies which are cross-reactive.
In another aspect, the invention provides a method of immunizing a host against disease caused by infection with Mh, Ap or Pm, which comprises administering to the host an immunoeffective amount of the immunogenic composition described above.
The following conserved inner core LPS structure has been identified in Ap, Mh and Pm. This structure is useful as a vaccine candidate that provides broad coverage to all strains. The unexpected finding that all three species elaborate this identical structural unit, allows the preparation of multi-species vaccines based on this one conserved structure.
Where: —R is H or phosphoethanolamine (PEtn), P is phosphate, R′ and R″ are H or oligosaccharide chain extensions, preferably not including β-D-Galp-(1-7)-D-α-D-Hepp-(1-6), and R′″ is a variable O-antigen in Ap, Kdo is 3-deoxy-D-manno-2-octulosonic acid and Lipid A is detoxified.
The structural analyses performed to characterize these conserved structures in each species are detailed in Examples 1, Mh; 2, Ap and 3-5, Pm. Example 1 describes the structural analysis of the serotype A1 LPS of Pasteurella haemolytica. Example 2 describes the structural analysis of the LPS from several serotypes of Ap whereby the structural relatedness of the inner core molecules of Mh and Ap was first identified. Example 3 describes the structural analysis of the LPS from the genome strain of Pm whereby the structural conservation of the inner core molecules of all three species was first identified. Example 4 describes the structural analysis of the LP of Pm strain VP161. Example 5 describes the structural analysis of the core oligosaccharide of Pm strain X73. Example 6 describes identification of the orfH gene, the Hep III to Hep II heptosyltransferase of Pm. Example 7 describes production of a
Vaccines comprised of capsular polysaccharides are effective at preventing human disease caused by the homologous encapsulated bacteria. These carbohydrate antigens are often poorly immunogenic in humans due to a lack of T-cell dependent response. However, by conjugating the specific polysaccharide antigen to a suitable protein carrier, the immunogenicity of the carbohydrate antigen can be greatly enhanced over the polysaccharide alone. Glycoconjugate vaccines based on the specific capsular polysaccharide of type b H. influenzae (Hib), and type c Neisseria meningitidis e.g. ProHiBit, MenC, have already proven successful in the control of invasive Hib and meningococcal diseases.
The general strategy is to conjugate the conserved inner core LPS molecule in an appropriate manner to a suitable carrier molecule in order to elicit the desired immune response following immunisation of the host.
An immunogenic carrier protein is preferably selected from the group consisting of tetanus toxin/toxoid, diphtheria toxin/toxoid (CRM197), detoxified P. aeruginosa toxin A, cholera toxin/toxoid, pertussis toxin/toxoid, Clostridium perfringens exotoxins/toxoid, hepatitis B surface antigen, hepatitis B core antigen, rotavirus VP 7 protein, respiratory syncytial virus F and G proteins or other suitable carrier.
An adjuvant is preferably selected from the group consisting of Freund's adjuvant, alum and Ribi or any other pharmaceutically acceptable adjuvant.
In an embodiment of the invention there is provided a method of inducing or increasing immunity in an animal, fish or bird against a bacterial pathogen comprising administering a conserved inner core LPS molecule. In some instances the bacterial pathogen will be a variety of Mannheimia, Actinobacillus, or Pasteurella. In some instances the bacterial pathogen will be a veterinary organism of interest. Administration may be by any suitable route, including injection, application to a mucous membrane, transdermal application, oral (preferably suitably coated), etc. In some instances the inner core LPS molecule will be linked or associated with a suitable carrier molecule. In some instances a suitable adjuvant will also be used. In some instances the inner core LPS will be co-administered with an antibacterial drug or another immune stimulation. In some instances the conserved inner core LPS molecule will be the inner core LPS of structure I. In some instances the conserved inner core LPS molecule will be the inner core LPS of structure II without one or both R and R1 as defined therein. In some instances the conserved inner core LPS will be at least one of the following:
and P is phosphate.
In some instances the conserved inner core LPS will be a variant of one or more molecules a-f, above or of one of the generic structures disclosed (with or without R and R1) wherein one or more terminal sugars appears as an isomer or has been modified to preserve it in a particular isomeric form.
In an embodiment of the invention there are provided the antigenic LPS-derived oligosaccharides described above free from covalent bonds to other oligosaccharides.
In an embodiment of the invention there is provided a method of making a vaccine comprising linking a conserved inner core LPS molecule or a portion and/or variant thereof to an immunogenic carrier protein. In some instances an adjuvant may be provided together with the LPS molecule-carrier protein.
1H-NMR spectra of the fully deacylated LPS from Pm strain VP161; a) Glycoform containing one Kdo residue; b) Glycoform containing two Kdo residues. The spectra were recorded in D2O at pH 7.0 and 25° C. Letter designations for each residue are as indicated in Example 4, Table 2. *Low field shifts for the H-4 proton resonances of Gal I (g) and Gal II (h) are due to hydrolysis and migration of PCho residues during KOH treatment.
(B) Comparison of LPS profiles of P. multocida heptosyltransferase mutant AL251 (lane 1); wild-type VP161 (lane 2) and P. multocida wild-type revertants isolated from three different chickens inoculated with AL251 (lanes 3, 4 and 5).
This Example forms the basis of a publication in Can. J. Chem. 80, 1715 (2002). Investigation of M. haemolytica serotype A1. Analysis of the LPS of M. haemolytica serotype A1 revealed Hex3Hep5Kdo as the major core oligosaccharide component. This was determined by 1D 1H NMR and FAB-MS analysis of the oligosaccharide fraction obtained following mild acid hydrolysis (1% HOAc, 100° C., 3 h) of the LPS sample. The core oligosaccharide was found to contain D-glucose, D-galactose, L-D-heptose, and DD-heptose in a molar ratio of 2:1:3:2 in the major fraction as determined by GLC-MS analysis of their alditol acetate and 2-butyl glycoside derivatives. The D-Gal residue was found to be a terminal non-reducing moiety from methylation analysis and was absent in the minor component of the core oligosaccharide fraction, that had the composition of Hex2Hep5Kdo. The occurrence of Kdo in the LPS was established by calorimetric analysis.
Treatment of M. haemolytica LPS with anhydrous hydrazine followed by strong alkali afforded water-soluble, deacylated LPS oligosaccharides. The deacylated LPS sample was representative of the intact backbone oligosaccharide of the native material containing core and lipid A oligosaccharide moieties. This was confirmed by electrospray ionization ESI-MS which gave molecular ions corresponding to Hex3Hep5Kdo1HexN2(H2PO3)3 as the major oligosaccharide component (see Experimental section).
From the proton spectrum (
Standard homo- and hetero-nuclear 2D-NMR analyses were undertaken. From the COSY spectrum in
The Kdo-GlcNII-GlcNI sequence and partial assignments are known from previous studies and are consistent with the assignments made here. The 1D-TOCSYs for residues a and h permitted assignment of the resonances and measurement of proton coupling constants (
For Kdo, the H-4 and H-5 resonances were assigned from 1D-TOCSY experiments with selective excitation of H-3eq or H-3ax. The H-4 resonance is shifted downfield due to a phosphate group at C-4, confirmed by a 31P HMQC. A small J5,6<1 Hz impeded the TOCSY transfer past H-5 (
Residue i was determined to be 6-substituted β-D-glucose denoted as GlcI. The anomeric resonance for residue i overlapped with the H-4 resonance of Kdo. In the 1D-TOCSY for these two overlapping resonances, it was possible to distinguish the resonances for residue i because of the small J5,6 coupling constant for Kdo (
Residue c was determined to be a terminal α-D-glucose denoted as GlcII. From the 1D-TOCSY for c1 (
The terminal galactose, residue j, denoted as Gal, was identified from the 1D-TOCSY of j 1 and resonances up to H-4 were observed (
To assign the heptose residues, model compounds were synthesized to obtain accurate 1H and 13C NMR chemical shifts and JH,H values. These were crucial in assigning the terminal heptose units by chemical shifts comparisons. Also, upon glycosidation, the 13C NMR resonance of the substituted carbon experiences a substantial down-field glycosidation shift. The proton spectra for D-D-heptose and D-L-heptose are shown in
Residues b, d, e, f, and g in A1 were identified as heptoses from their narrow anomeric resonance due to the small J1,2 coupling and lack of transfer of magnetization beyond H-2 from H-1 in a TOCSY experiment. All the heptoses in A1 had the α-D configuration since the only intra-residue NOE from H-1 was to H-2 (
Residue b was determined to be the 2-substituted L-α-D-heptose denoted as HepII. The 1D-TOCSY-TOCSY (b1, b2) identified resonances at 3.64 ppm and 3.9 ppm (
Residue e was determined to be a terminal L-α-D-heptose denoted as HepIII. Although the d1 and e1 resonances overlap, this is of no concern since their H-2 resonances did not overlap. The 1D-TOCSY-TOCSY (de1, e2) identified the e3, e4, and e5 spins (
Residue d was identified as a 3,4,6-trisubstituted L-α-D-heptose denoted as HepI. The 1D-TOCSY-TOCSY (de1, d2) identified a narrow multiplet at 4.17 and a broader one at 4.01 ppm (
As shown below, there should be a 4,6-disubstituted L-α-D-heptose (d′) present due to heterogeneity on the branching heptose (
Residue g was determined to be a 6-substituted D-α-D-heptose denoted as HepIV. The 1D-TOCSY-TOCSY (g1, g2) identified the g3, g4, and g5 spins (
Residue f was determined to be a 7-substituted D-α-D-heptose and denoted as HepV. The 1D-TOCSY-TOCSY (f1, f2) identified spins up to f6 indicating that residue f was a D-D-heptose. The f5 multiplet pattern was quite clear. From a 1D-TOCSY starting on f6, the f7, and f7′ resonances were identified. The 13C NMR assignments were then obtained from the HMQC spectrum and confirmed with the HMQCTOCSY spectrum. Comparison of chemical shifts with those of α-D-D-heptose indicated a 8.8 ppm down-field shift for C-7. A terminal D-α-D-heptose, denoted f′, was only detected due to heterogeneity at this linkage site. As seen in the 1D-TOCSY-TOCSY (f1, f2), the f′5 and f′6 resonance can be detected, along with crosspeaks in the HMQC and HMQC-TOCSY spectra which correspond to those of a terminal D-α-D-heptose similar to those for D-α-D-heptose in Example 1, Table 2.
The sequence of the core octosaccharide was established from the 1D-NOESY spectrum for the anomeric resonances presented in
An unusually large number of long-range NOEs were observed spanning up to five sequential residues. For an α-D sugar, the H-1-H-2 intra-residue NOE is expected. For a β-D-sugar, the H-1-H-3 and H-1-H-5 intra-residue NOEs are expected. The H-1-C-1-O-1-C-x-H-x interglycosidic NOEs are expected for (1-x) linkage. Inter-residue anomeric NOEs between two linked sugars on the H-x±1 and H-x±2 can also occur. Other inter-residue NOEs, not in the vicinity of the glycosidic linkage, are deemed to be long-range NOEs as listed in Example 1, Table 3.
To explain the large number of long-range NOEs, conformational analysis was done using the Metropolis Monte Carlo (MMC) method to vary the glycosidic linkage angles and sample the multiple conformations of the molecule. Using this method for the inner core oligosaccharide with Kdo at the reducing end, it was found that all the observed long-range NOEs could be explained by the close proximity of the e-b branch to the g-i branch. These long range NOEs were possible due to restriction of the inner core residues brought about by the three branching points on HepI.
A minimum energy conformer obtained from the calculation is shown in
In the present study it was established that the lipid A region of the M. haemolytica A1 LPS molecule contains a bis-4,4′-phosphorylated β-1,6 linked D-glucosamine disaccharide moiety. The nature and substitution patterns of the fatty acyl groups attached to this disaccharide have not been reported. The fully acylated LPS molecule makes up the outer most leaflet of the bacterial membrane and is essential for maintaining membrane integrity. The glycose portion of the molecule typically extends out and away from the plane defined by the bacterial membrane. The LPS oligosaccharide portion is important in virulence and is involved in eliciting host immune responses. To gain a perspective of the relative sizes and orientation of the core oligosaccharide and membrane-anchoring lipid A regions of this LPS molecule, a molecular model was constructed using the lipid A fatty acid substitution pattern found in a related organism, Haemophilus influenzae. This is shown in
The core structures of several LPS have been found to be highly branched and this can result in well-defined conformations for the inner core. In a previous study, the LPS of Moraxella catharrhalis was found to adopt an unusual conformation in which a very rare anti conformer was observed. For a highly branched 3,4,6-trisubstituted D-glucose residue in this LPS molecule, a dihedral angle (C-1′-O-1′-C-4-H-4) near 180° was detected for β-D-Glcp-(1-4)-DGlcp linkage to the branched glucose unit.
The results of the present study have provided a detailed picture of the structure of the LPS core oligosaccharide region of M. haemolytica serotype A1. We have previously shown that the oligosaccharide region of M. haemolytica LPS is immunogenic in mice, sheep, and cattle and that eight of the 12 M. haemolytica serotypes (i.e., serotypes A1, A5, A6, A7, A8, A12, A14, and A16) share common core oligosaccharide determinants. The core oligosaccharides from serotypes A1 and A8 show almost identical 1H NMR spectra establishing the presence of a common basal structure. Based on the results of the present study it is apparent that the O-chain deficient LPS elaborated by M. haemolytica serotype A8 lacks the terminal Gal unit in the core oligosaccharide, a residue which possibly provides a site for O-chain attachment. An understanding of LPS structural differences among M. haemolytica serotypes could provide the basis for a vaccine against M. haemolytica bovine pasturellosis. Serotype A1 is the principal microorganism responsible for this disease, accounting for 30% of total cattle deaths globally. The use of a less virulent serotype or antigens thereof in a vaccine formulation could provide an effective disease management strategy.
Experimental for Example 1
Preparation of LPS from M. haemolytica
Pasteurella (Mannheimia) haemolytica serotype A1 (NRCC 4212) was obtained from the Veterinary Infectious Diseases Organization (VIDO), Saskatoon, SK, Canada. LPS was extracted and purified from fermenter-grown bacteria culture by the hot aqueous phenol method as previously described in Severn et al. Carbohydr. Res. 240, 277 (1993).
Deacylation of LPS to give Backbone Oligosaccharides
Backbone oligosaccharide was prepared as previously described in Severn et al. J. Bacteriol. 178, 1731 (1996) by modification of the deacylation procedure of Holst et al. Ester-bound fatty acids were removed from the lipid A of the LPS by treatment of a sample (400 mg) with anhydrous hydrazine at ambient temperature (20 mL, 37° C., 30 min). Excess hydrazine was destroyed by addition of acetone (three volumes) to the cooled reaction mixture (0° C.). The precipitated O-deacylated LPS product was isolated by centrifugation (5000 rpm, 10 min), washed with acetone, and lyophilized from water. Removal of N-acyl groups was achieved by heating the O-deacylated sample (200 mg) in aq KOH (4 M, 10 mL) at 100° C. for 20 h. The reaction mixture was cooled (0° C.), neutralized with 4 M HCl, and the precipitated fatty acids removed by centrifugation (12000×g, 30 min). The supernatants were filtered in an Amicon concentration cell with a 500-molecular-weight-cutoff membrane (Amicon; YC05) and washed with deionized water until the eluant was free of chloride ions (as determined with aq AgNO3). The dialyzed material was lyophilized to give deacylated LPS (ca. 80 mg). The oligosaccharide was purified by anion-exchange chromatography on DEAE A-25. The backbone oligosaccharide fraction (ca. 50 mg) showed a doubly charged ion at m/z 1124.8 in the positive ion ESI-MS as the major ion which corresponded to a composition of Hex3Hep5Kdo HexN2(H2PO3)3 (M, 2246.9). MS-MS of the doubly charged ion gave characteristic fragments at m/z 500 (HexN2(H2PO3)2) and 801 (KdoHexN2(H2PO3)2) corresponding to deacylated lipid A and the Kdo-P substituted units, respectively.
D-glycero-L-manno-Heptose
The heptose was prepared by the condensation of D-galactose with nitromethane in alkaline methanol. The crystalline 1-deoxy-1-nitro-D-glycero-L-manno-heptitol obtained from the aqueous solution of the deionized products (mp 158° C., 21% yield) was converted to its sodium salt. On treatment with dilute sulphuric acid (35° C.), followed by deionization with Rexyn 101(H+) and Amberlite A4(OH−) ion-exchange resins, the solution was lyophilized to give the heptose as a syrup (80% yield). The product was fractionated by cellulose column chromatography using butan-1-ol-water (1:10 v/v) as the eluant. Fractions containing the heptose were concentrated to dryness under reduced pressure. The D-glycero-L-manno-heptose having [α]D −14° (c 0.2, water) was pure by paper chromatography and its reduced (NaBH4) and acetylated product on GLC gave a single peak corresponding in retention time with that of authentic hepta-O-acetyl-D-glycero-L-manno-heptitol, establishing its purity.
D-glycero-D-manno-Heptose
The heptose was prepared from D-altrose via its condensation with nitromethane to yield 1-deoxy-1-nitro-D-glycero-Dmanno-heptitol (mp 109° C., [α]D −7.0° (c 1.1, EtOH), 27% yield)) whose aqueous sodium salt solution on slow dropwise addition to stirred 20% (v/v) sulfuric acid maintained at 0° C. was converted to D-glycero-D-manno-heptose. The reaction mixture was neutralized with sat. Ba(OH)2 solution, filtered, passed through Rexyn 101(H+) and Duolite A4(OH−) ion-exchange resins to remove residual ionic material, and was concentrated to a syrup (92% yield). The heptose product, as indicated by paper chromatography, was contaminated with altrose and unchanged 1-deoxy-1-nitro-D-glycero-D-manno-heptitol (ca. 2 to 3%). The product was purified by cellulose column chromatography using butan-1-ol-water (1:10 v/v) as the mobile phase. The D-glycero-D-mannomannose had [α]D +22° (c 2, MeOH). A reduced (NaBH4) and acetylated sample on GLC gave a single peak corresponding to authentic hepta-O-acetyl-D-glycero-D-manno-Dheptitol indicating the identity and purity of the synthesized heptose.
Electrospray Mass Spectrometry
Samples were analyzed on a VG Quattro triple quadrupole mass spectrometer (Micromass, Manchester, U.K.) fitted with an electrospray ion source. Backbone oligosaccharide was dissolved in acetonitrile-water (approx. 1:2 v/v) containing 0.5% acetic acid. Injection volumes were 10 μL and the flow rate was set at 4 mL min−1. The electrospray tip voltage was typically 2.7 kV and the mass spectrometer was scanned from m/z 50 to 2500 with a scan time of 10 s. For MS-MS experiments, precursor ions were selected using the first quadrupole and fragment ions formed by collisional activation with argon in the RF-only quadrupole cell, were mass analyzed by scanning the third quadrupole. Collision energies were typically 60 ev (laboratory frame of reference).
Nuclear Magnetic Resonance
NMR spectra were performed on a Bruker AMX 600, AMX 500, or a Varian Inova 600 spectrometer using standard software. All measurements were made at 300 K and at pH 3, containing 10 mg of sample dissolved in 0.6 mL of D2O. Measurements were done at pH 3 to improve resolution of the proton spectrum as done previously (Cox, 1996). Acetone was used as an internal or external reference at 2.225 ppm for 1H spectra and 31.07 ppm for 13C spectra. Standard homo- and heteronuclear correlated 2D techniques were used for general assignments of the core oligosaccharide: COSY, TOCSY, NOESY, triple quantum homonuclear correlated experiment, HMQC, HMQC-TOCSY, and HMBC and 31P HMQC. Spin simulations for the heptose monosaccharides were performed with standard Varian software. Accurate chemical shifts and coupling constants were obtained from the parameters used to perform the spin simulation and not from the peak listing of the spectra.
Selective 1D-TOCSY, 1D-NOESY, 1D-TOCSY-TOCSY, 1D-TOCSY-NOESY, and 1D-NOESY-TOCSY experiments were performed for complete residue assignment and for determination f inter-residue 1H—1H nuclear Overhauser enhancements. The nomenclature used to describe the use of the 1D selective sequences will be 1D EXP (spin, mixing time) and 1D EXP1-EPX2 (spin1, mixing time; spin2, mixing time), where EXP, EXP1, and EXP2 stand for either TOCSY or NOESY. Also, in the figures, the selected resonances are underlined. A doubly underlined resonance means that this resonance was selected as the second selection step. As shown in
On the AMX spectrometers, selective excitation was achieved by means of half-Gaussian pulses. The mixing time used for a TOCSY depended on the spin system. Usually a range of mixing times (spin lock times) from 30 to 180 ms was used to assign the spin system. The mixing time for a 1D-NOESY depended on the correlation time of the molecule and internal motion about the glycosidic linkage. NOESY mixing times were in the range from 150 to 400 ms. To detect inter-residue NOEs for the terminal Gal residue, a 1D-ROESY experiment was done with a mixing time of 500 ms. For the doubly selective experiments, the selective pulses were kept as short as possible to avoid loss of signal intensity due to relaxation effects. Each part was optimized one at a time. The 1D-TOCSY could be carried out in a matter of minutes. The 1D-NOESY took from minutes to hours depending on the magnitude of the NOE. Some doubly selective experiments took up to 12 h. The 1D-TOCSYTOCSY and 1D-TOCSY-NOESY were the most efficient. As the sample degraded with time, some experiments were also performed on an Inova 600 spectrometer making use of pulse field gradients.
Molecular Modeling
The conformational analysis was done using the Metropolis Monte Carlo method as previously described (Peters et al. Carbohydr. Res. 238, 49 (1993)). The PFOS potential was used. Minimized coordinates for the monosaccharides were obtained using MM3 available from the Quantum Chemistry Program Exchange (QCPE). The minimum energy conformation for each disaccharide was used as the starting conformation. Starting from the Kdo at the reducing end, calculations were performed for various oligosaccharides up to the complete structure. For the inner core octosaccharide, 5×104 macro moves were used with a step length of 5° for the glycosidic linkage and a temperature of 1×103 K resulting in an acceptance ratio of 0.36. The molecular model for the inner core octosaccharide was generated using the minimum energy conformer. Distances were extracted from the saved coordinates at each macro move. The complete LPS with lipid A was generated using the lipid A structure and the minimum energy conformer for the Kdo linkage. Molecular drawings were done using Schaka197 from E. Keeler, University of Freiburg, Germany.
Note:
Measured at 600 MHz (1H) in D2O, 25° C. and pH 3 from HMQC and HMBC data with the CH3 signal of external acetone set at 2.225 ppm for 1H NMR and 31.07 ppm for 13C NMR. Average error of ±0.2 ppm for δc and ±0.02 ppm for δH. The minor component for f due to heterogeneity is indicated by f.
Note:
Measured at 600 MHz (1H) in D2O at 25° C. from 1H spin simulations and from the 13C spectra (150 MHz) with the CH3 signal of acetone set at 2.225 ppm for 1H NMR and 31.07 ppm for 13C NMR. δC and δH are in ppm with an average error of ±0.005 ppm for δC and ±0.003 ppm for δH. JH,H values are in Hz with an average error of ±0.2 Hz.
aJC1,H1 = 171 ± 1 Hz.
bJC1,H1 = 160 ± 1 Hz measured from the undecoupled 13C NMR spectrum.
aFor the j and f residues in the Gal-(1-7)-HepV-(1-6)-HepIV sequence (j-f-g), the average distances from MMC calculations are given.
This Example forms the basis of a publication in Carbohydr. Res. 339: 1973 (2004). Investigation of A. pleuropneumoniae Serotypes 5a, b, 2 and 1.
Sugar analysis of the column-fractionated LPS revealed glucose (Glc), galactose (Gal), N-acetyl-glucosamine (GlcNAc),
LPS-OH was prepared and fractionated by gel filtration chromatography. A fraction eluting at a volume consistent with containing a low proportion of O-antigen was analysed by CE-ES-MS (Example 2, Table 1). A simple mass spectrum was observed corresponding to a molecule of 2537 amu consistent with a composition of 2Hex, 5Hep, Kdo, P, Lipid A-OH. CE-MS/MS analysis (data not shown) on the doubly charged ion, m/z 1268, gave two singly charged peaks at m/z 951 and 1584, confirming the size of the O-deacylated lipid A as 952 amu and the core OS as 1584. The O-deacylated lipid A species (952 amu) consists of a disaccharide of N-acylated (3-OH C 14:0) glucosamine residues, each residue being substituted with a phosphate molecule. ES-MS and CE-ES-MS analyses of the fractionated OS sample revealed a mass of 1505 Da, consistent with a composition of 2Hex, 5Hep, Kdo (Ex. 2, Table 1) (
Methylation analysis was performed on the core OS in order to determine the linkage pattern of the molecule. Analysis on a fraction corresponding to core OS alone revealed the presence of approximately equimolar amounts of terminal Glc, 6-substituted Glc, terminal DD-Hep, terminal LD-Hep, 6-substituted DD-Hep, 2-substituted LD-Hep and 3,4,6-tri-substituted LD-Hep. Analysis of an earlier fraction of the OS, containing predominantly O-antigen, revealed the presence of 6-substituted Gal (the O-antigenic component) confirming the linkage pattern of the O-antigen.
In order to elucidate the exact locations and linkage patterns of the OS, NMR studies were performed on the OS fraction enriched for the absence of O-antigen (
In the selective spectra of the Ap 5a OS, spin systems arising from heptose residues (Hep I, (
The sequence of the glycosyl residues in the OS was determined from the inter-residue 1H-1H NOE measurements between anomeric and aglyconic protons on adjacent glycosyl residues and confirmed and extended the methylation analysis data. The linkage pattern for the Ap 5a OS was determined in this way (
Investigation of A. pleuropneumoniae Serotype 5b
All analyses of LPS, LPS-OH and OS from serotype 5b were identical or very similar to the previous analyses described for serotype 5a (Example 2, Tables 1 and 2;
Investigation of A. pleuropneumoniae Serotype 2
Sugar analysis of the intact LPS revealed the presence of Glc, DD-Hep, LD-Hep, Rha, Gal, GlcNAc and GalNAc in the approximate ratio 8:2:2:1:2:1:2 consistent with the presence of O-antigen and capsular polysaccharide in this material. Sugar analysis of the fractionated acid hydrolysate revealed the presence of Glc, Rha, Gal and GalNAc in an early eluting fraction, in the approximate ratio 2:1:1:1 consistent with a fraction enriched for O-antigen. A later fraction enriched for the absence of O-antigen revealed the presence of only Glc, DD-Hep and LD-Hep in the approximate ratio of 3:2:3 consistent with the absence of O-antigen from this core OS fraction.
LPS-OH was prepared and fractionated by gel filtration chromatography. A fraction eluting at a volume consistent with containing a low proportion of O-antigen was analysed by CE-ES-MS in the negative ion mode (Example 2, Table 1). A simple mass spectrum was observed corresponding to a molecule of 2700 amu consistent with a composition of 3Hex, 5Hep, Kdo, P, Lipid A-OH with minor amounts of a second molecule indicated with a mass of 80 amu lower, consistent with the absence of a phosphate residue. CE-MS/MS analysis (data not shown) on the triply charged ion m/z 899 gave a singly charged peak at m/z 951 confirming the size of the O-deacylated lipid A as 952 amu for the major molecule of mass 2700 amu. CE-ES-MS analyses of the fractionated core OS sample enriched for absence of the O-antigen revealed a mass of 1667 Da, consistent with a composition of 3Hex, 5Hep, Kdo (Example 2, Table 1). Mass spectrometric analyses therefore indicated that the core OS of serotype 2 contained an additional glucose residue than the core OS from serotypes 5a and 5b.
Methylation analysis of the core OS fraction enriched for absence of O-antigen revealed the presence of terminal Glc, 6-substituted Glc, terminal DD-Hep, terminal LD-Hep, 2-substituted DD-Hep, 2-substituted LD-Hep, 4,6-di-substituted DD-Hep, and 3,4,6-tri-substituted LD-Hep in the approximate ratio 6:3:3:2:1:2:3:2. The main discrepancy between the methylation data for the serotype 2 and 5b OS was the replacement of the mono-6-substituted DD-Hep with a 4,6-di-substituted DD-Hep tentatively identifying the 4-position of the internal DD-Hep residue as the point of attachment of the additional glucose residue. The ratio of terminal glucose residues, identified by methylation analyses, between serotypes 2 and 5b is also consistent with the presence of an additional terminal glucose residue in the core OS of serotype 2.
1H-NMR data (Example 2, Table 2, (
Investigation of A. pleuropneumoniae Serotype 1
Sugar analysis of the column-fractionated LPS revealed the presence of Rha, Glc, Gal, GlcNAc, DD-Hep and LD-Hep in an approximate ratio of 1:3:1:0.5:1:3. The identification of Rha and GlcNAc suggested some O-antigenic components were still present in this fraction. Sugar analysis of a core OS fraction enriched for absence of O-antigen revealed Glc, Gal, DD-Hep, and LD-Hep in the ratio 2:1.5:1:3. Sugar analysis on earlier fractions containing full length O-antigen revealed Rha, Glc and GlcNAc in an approximate ratio of 2:1:1 consistent with the published structure for the O-antigen of this serotype.
LPS-OH was prepared and fractionated by gel filtration chromatography. A fraction eluting at a volume consistent with containing a low proportion of O-antigen was analysed by ES-MS and CE-ES-MS in the negative ion mode (Example 2, Table 1). A simple mass spectrum was observed corresponding to a molecule of 2874 amu consistent with a composition of 4Hex, HexNAc, 4Hep, Kdo, P, Lipid A-OH with minor amounts of a second molecule indicated with a mass of 123 amu higher, consistent with the presence of an additional phosphoethanolamine residue and a third molecule with a mass of 80 amu lower, consistent with the absence of a phosphate residue. CE-MS/MS analysis (data not shown) on the triply charged ion m/z 957 gave a singly charged peak at m/z 951 confirming the size of the O-deacylated lipid A as 952 amu for the major molecule of mass 2874 amu and a doubly charged ion at m/z 959 corresponding to the core OS. ES-MS and CE-ES-MS analyses on several core OS fractions enriched for absence of the O-antigen revealed a mass of 1840 Da, consistent with a composition of 4Hex, HexNAc, 4Hep, Kdo (Example 2, Table 1). CE-MS/MS analysis in positive ion mode on the doubly charged ion at m/z 930 revealed singly charged ions consistent with the presence of the following groups of residues in serotype 1 core OS including, HexNAc m/z 204, Hex-Hex-HexNAc m/z 528, Hep-Hex-Hex-HexNAc m/z 720 (
Methylation analysis on a core OS fraction enriched for absence of O-antigen revealed the presence of terminal Glc, 6-substituted Glc, 3-substituted Gal, terminal LD-Hep, 4,6-disubstituted Gal, 4-substituted DD-Hep, 2-substituted LD-Hep and 3,4,6-trisubstituted LD-Hep in approximately equimolar amounts. Once again the absence of any evidence for a HexNAc residue was perplexing.
The mass spectrometric, sugar and methylation analyses data were therefore consistent with the inner core structure observed for serotypes 2, 5a and 5b and 1H NMR data corroborated these inferences (
A series of selective 1D experiments from the H-1 1H-resonance of the HexNAc residue at 4.88 ppm with mixing times ranging from 30-150 ms revealed the H-2 1H-resonance at 4.34 ppm and weak signals assigned to H-3 at 4.13 ppm and H-4 at 3.36 ppm. To confirm these inferences and complete assignment of this HexNAc residue further selective experiments were performed. A 1-D TOCSY experiment was obtained from the H-4 1H-resonance at 3.36 ppm, which confirmed the H-2 and H-3 assignments and identified the H-5 and H-6, 6′ resonances at 3.93, 3.66 and 3.64 ppm respectively (
Structural analysis of the core OS's from the 1, 2, 5a and 5b serotypes was therefore complete and had identified a conserved inner core structure in all strains with different decoration beyond this conserved structure as illustrated in
Structural analysis of core oligosaccharides from serotypes 1, 2, 5a and 5b representing core types I, II, II and II, revealed a relatively conserved structure. The inner core OS was identical for each strain consisting of a trisaccharide of L-glycero-D-manno-heptose residues linked to a Kdo residue. In each serotype the proximal heptose residue (Hep I) was substituted at the 3-position by the second L-glycero-D-manno-heptose residue (Hep II) of the L-glycero-D-manno-heptose trisaccharide, at the 4-position by a β-glucose residue (Glc I) and at the 6-position by an α-glucose residue (Glc II). A D-glycero-D-manno-heptose residue (Hep IV) was found at the 6-position of the Glc I residue in each strain. A second D-glycero-D-manno-heptose residue (Hep V) substitutes Hep IV at the 6-position in serotypes 2, 5a and 5b. The only difference between serotypes 2 and 5a, 5b was an additional glucose residue linked to the 4-position of the Hep IV residue in serotype 2. There was a striking similarity between these OS structures and that found previously for the OS from M. haemolytica serotype A1. The only difference between the 5b, 5a OS structures and M. haemolytica serotype A1 core OS was the absence of the additional terminal galactose residue at Hep V found in M. haemolytica A1 OS. In serotype 1 there is no Hep V residue, Hep IV is alternatively substituted at the 4-position by a trisaccharide of α-GaloNAc-(1-4,6)-α-Gal-(1-3)-β-Gal-, wherein the HexNAc residue was of the rarely encountered open-chain configuration. The structural arrangement identified as the initial trisaccharide extension from Hep I in serotype 1 is identical to that previously found for Haemophilus ducreyi strain 2665 LPS, however the serotype 1 LPS has a different extension beyond the Gal I residue when compared to the DD-Hep interrupted lacto-N-neotetraose structure found in H. ducreyi.
A structural explanation has therefore been attained for the SDS-PAGE observation of two core types in Ap LPS. Serotypes 2, 5a and 5b of core type II have very similar LPS structures differing only by an additional glucose residue in serotype 2. However serotype 1 of core type I has lost a DD-Hep residue, but gained two hexoses and a novel open chain HexNAc residue. To investigate if this novel open chain HexNAc residue was found in other core type I serotypes LPS from serotypes 6, 9 and 11 were examined. Evidence for the open chain HexNAc was seen by both MS and NMR studies (data not shown) in serotypes 9 and 11 but not in serotype 6. Closer examination of SDS-PAGE profiles that had been used to categorise core types revealed that serotype 6 had both LPS migration patterns of the two core types and therefore it is possible that the serotype 6 strain we examined only had a core type II profile.
Few data are available on the genetic control of LPS biosynthesis in Ap. A recent paper by Galarneau et al identified three genes following transposon mutagenesis that appeared to be involved in the biosynthesis of the core OS region of Ap serotype 1 LPS. These genes were tentatively identified as glycosyltransferases based on homology to other glycosyltransferases. The three genes were postulated to be lbgB, an α-1,6-DD-heptosyltransferase, lbgA a β-1,4-galactosyltransferase and a hexose or N-acetyl-hexosamine transferase. The former two genes, lbgAB, are consistent with the structure identified here in serotype 1 core OS, and have the same locus arrangement as found in H. ducreyi LPS. Another paper by Rioux et al identified a gene galU, the structural gene for UTP-α-D-glucose-1-phosphate uridyltransferase. SDS-PAGE of LPS isolated from a serotype 1 Ap galU mutant strain had an altered migration pattern of the core-lipid A region, and this mutant strain was less adherent to pig tracheal cells and was less virulent in pigs, suggesting that an alteration in the nature or presentation of the core OS region could have an effect on the virulence of this animal pathogen.
The identification of a novel open chain HexNAc residue was of interest. This structure has only previously been identified in two Proteus species and recently in Shewanella oneidensis and its significance is unknown. As found in the existing literature, the open chain residue identified here was found to concurrently di-substitute the neighbouring residue at the 4- and 6-positions, so this could be a common arrangement for such residues.
The identification of a DD-Hep residue in the oligosaccharide extension from Hep I has been observed before for several strains including M. haemolytica, H. ducreyi and non-typable H. influenzae. In M. haemolytica two DD-Hep residues were observed, whereas in H. ducreyi and H. influenzae only one DD-Hep residue was found. In Ap both scenarios exist, with serotypes 2 and 5a, 5b having two DD-Hep residues and serotype 1 having just one DD-Hep residue in the oligosaccharide extension from Hep I. The tri-LD-heptosyl inner core group has also been observed previously in M. haemolytica, H. ducreyi and H. influenzae. The 3,4,6-trisubstituted Hep I residue found here for all strains of App studied has been observed before in M. haemolytica LPS, however H. ducreyi LPS only elaborates the 3,4-di-substituted Hep I residue as also found in H. influenzae.
The identification of the 7-position of the Hep III residue as the point of attachment of the O-antigen galactose residue in serotype 5a was of interest and consistent with the observation that three variously truncated core oligosaccharide mutants in serotype 1 still elaborated an O-antigen, as the anticipated function of the three mutated gene products would not interfere with the biosynthesis of the inner core LD-heptosyl trisaccharide unit and therefore the acceptor for O-antigen attachment would still be present in the mutant LPS core oligosaccharide.
This study has structurally characterised the core oligosaccharide region of several strains of Ap, representative of the two core types, identifying a conserved inner-core structure and a novel outer-core constituent. This region is known to be involved in adherence of Ap and is therefore implicated in virulence. This study will therefore better enable future studies on the relevance of the structure of the core oligosaccharide region of Ap LPS to the potential virulence of this organism.
Materials and Methods
Ap serotypes 1 (strain 4074), 2 (strain 4226), 5a (strain K17) and 5b (strain L20) were initially grown overnight on chocolate agar plates at 37° C. and growths were used to inoculate 1 L of brain-heart infusion (BHI) medium supplemented with β NAD (Sigma N-7004) to a final concentration of 5 ug/ml, haemin (Sigma H-2250) to a final concentration of 5 ug/ml and 1% glucose (10 g). Cultures were then incubated at 37° C. at 200 rpm for 6 hours and used to inoculate 23 L BHI medium (supplemented as above) in a 28 L NBS fermenter. The cultures were then grown at 37° C., with 24 lmin−1 aeration and stirring at 200 rpm for 18 hours. Cells were killed (2% phenol w/v, for 4 hours) and harvested by using a Sharples continuous centrifuge (˜40 g wet weight).
Isolation and Purification of Lipopolysaccharide
The lipopolysaccharide (LPS) was isolated from the dried cell mass by the hot water/phenol method, following washing of the dried cell mass with organic solvents for serotypes 5a and 5b. The aqueous phase was dialyzed against water and lyophilised and in the case of serotype 2 the LPS was isolated from the extensively dialysed phenol phase. The dried sample was dissolved in water to give a 1-2% solution (w/v) and treated with deoxyribonuclease I (DNase) (0.01 mg/ml) and ribonuclease (RNase) (0.01 mg/ml) for 3 hrs at 37° C., then treated with proteinase K (0.01 mg/ml) for 3 hrs. The dialysed, dried sample was dissolved in water to make a 1% solution and ultracentrifuged (5 hrs, 100,000 g). The LPS pellet was redissolved in water and lyophilised, purified by gel-filtration on a column of Bio-Gel P-2 (1 cm×100 cm) with water as eluent and fractions containing sugar were pooled and lyophilised. Purified LPS was treated with anhydrous hydrazine with stirring at 37° C. for 1 hr to prepare O-deacylated LPS (LPS-OH). The reaction was cooled in an ice bath and gradually cold acetone (−70° C., 5 vols.) was added to destroy excess hydrazine and the precipitated LPS-OH was isolated by centrifugation. The sample was then purified down a Bio-Gel P-2 column as described above. The core oligosaccharide (OS) was isolated by treating the purified LPS with 1% acetic acid (10 mgml−1, 100° C., 1.5 hr) with subsequent removal of the insoluble lipid A by centrifugation (5000 g). The lyophilised OS was further purified down a Bio-Gel P-2 column with individual fractions lyophilised.
Analytical Methods
Sugars were determined as their alditol acetate derivatives by GLC-MS. Samples were hydrolysed for 4 hrs using 4 M trifluoroacetic acid at 100° C. The hydrolysate was reduced (NaBD4) overnight in H2O and acetylated with acetic anhydride at 100° C. for 2 h using residual sodium acetate as catalyst. The GLC-MS was equipped with a 30 M DB-17 capillary column (180° C. to 260° C. at 3.5° C./min) and MS was performed in the electron impact mode on a Varian Saturn II mass spectrometer. Methylation analysis was carried out by the NaOH/DMSO/methyl iodide procedure and analysed by GLC-MS as above.
Mass Spectrometry
ESI-MS was performed in the negative ion mode on a VG Quattro Mass Spectrometer (Micromass, Manchester, U.K.) by direct infusion of samples in 25% aqueous acetonitrile containing 0.5% acetic acid. Capillary electrophoresis (CE)-ESI-MS was performed on a crystal Model 310 (CE) instrument (AYI Unicam) coupled to an API 3000 mass spectrometer (Perkin-Elmer/Sciex) via a microIonspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 μL/min to a low dead volume tee (250 μm i.d., Chromatographic Specialties). All aqueous solutions were filtered through a 0.45-μm filter (Millipore) before use. An electrospray stainless steel needle (27 gauge) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column. The separations were obtained on about 90 cm length bare fused-silica capillary using 10 mM ammonium acetate/ammonium hydroxide in deionized water, pH 9.0, containing 5% methanol. A voltage of 20 kV was typically applied at the injection. The outlet of the capillary was tapered to ca. 15 μm i.d. using a laser puller (Sutter Instruments). Mass spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in full-mass scan mode. The MS/MS data were acquired with dwell times of 1.0 ms per step of 1 m/z unit. Fragment ions formed by collision activation of selected precursor ions with nitrogen in the RF-only quadrupole collision cell, were mass analyzed by scanning the third quadrupole.
Nuclear Magnetic Resonance
NMR experiments were acquired on Varian Inova 400, 500 and 600 MHz spectrometers using a 5 mm or 3 mm triple resonance (1H, 13C, 31P) probe. The lyophilised sugar sample was dissolved in 600 μL (5 mm) or 140 μL (3 mm) of 99% D2O. The experiments were performed at 25° C. with suppression of the HOD (deuterated H2O) signal at 4.78 ppm. The methyl resonance of acetone was used as an internal reference at 2.225 ppm for 1H spectra and 31.07 ppm for 13C spectra. Standard homo and heteronuclear correlated 2D pulse sequences from Varian, COSY, TOCSY, NOESY, 13C-1H HSQC, 13C—1H HSQC-TOCSY and 13C—1H HMBC, were used for general assignments. Selective 1D-TOCSY with a Z-filter and 1D-NOESY experiments and 1-D analogues of 3-D NOESY-TOCSY and TOCSY-NOESY experiments were performed for complete residue assignment and for the determination of 1H—1H nuclear Overhauser enhancements. The pulse width of the selective pulses was 30-80 Hz. Mixing times of 30-150 ms were used for the 1D-TOCSY experiments. Mixing times of 400-800 ms were used for the 1D-NOESY experiments.
Example 2,
aThe major ion corresponded to the molecular ion - 18 (loss of H20).
Example 2,
aInner core data derived from serotype 5a; letter designation of residues as indicated in parentheses. Chemical shifts from other serotypes inner core residues were virtually identical
bData for substituted Hep III residue in serotypes 5a and 5b
cData for terminal Hep III residue of serotypes 1 and 2
dFor serotype 1 1H-resonances, Glc I H-6a and H-6b are 4.15 and 3.74 ppm respectively.
This Example forms the basis of a publication in Glycobiology. 15: 323 (2005). Investigation of P. multocida strain Pm70
Sugar analysis of the purified LPS revealed glucose (Glc), galactose (Gal) and
O-deacylated LPS (LPS-OH) was prepared and fractionated by gel filtration chromatography and analysed by CE-MS (Example 3, Table 1). A simple mass spectrum was observed with one major triply charged ion of m/z 1173.8 corresponding to a molecule of 3525 amu consistent with a composition of HexNAc2, Hep4, Hex6, PEtn, Kdo, P, Lipid A-OH with low amounts of ions consistent with the loss or gain of one PEtn residue from the major species indicated by m/z 1132.93− and 1215.23−. CE-MS/MS analysis (data not shown) on the triply charged ion m/z 1173.8 gave a singly charged peak of m/z 951 and a doubly charged ion of m/z 1236.5, confirming the size of the O-deacylated lipid A as 952 amu and the core OS as 2475 amu. The O-deacylated lipid A basal species (952 amu) consists of a disaccharide of N-acylated (3-OH C 14:0) glucosamine residues, each residue being substituted with a phosphate molecule. Interestingly, small amounts of glycoforms that would correspond to the losses of a hexose and phosphate molecules with the concomitant gain of a Kdo molecule were indicated by m/z 1125.73− and 1166.73−, suggesting the presence of two distinct arrangements of the Kdo region of the molecule with either a Kdo-P or a Kdo-Kdo arrangement (Example 3, Table 1). A similar mixture of one and two Kdo residue-containing glycoforms were observed in the CE-MS spectrum of KOH treated LPS (Example 3, Table 1). ES-MS and CE-MS analyses of the fractionated core OS sample revealed a mass of 2492 Da, consistent with a composition of HexNAc2, Hep4, Hex6, PEtn, Kdo (Example 3, Table 1) (
Methylation analysis was performed on the core OS in order to determine the linkage pattern of the molecule revealing the presence of terminal Glc, 6-substituted Glc, 4-substituted Glc, 4-substituted Gal, 3-substituted Gal, terminal LD-Hep and 4,6-disubstituted LD-Hep, in the approximate molar ratio of 2:1:1:1:1:1:1 with lesser amounts of terminal Gal, 2-substituted
In order to elucidate the exact locations and linkage patterns of the OS, NMR studies were performed on the OS fraction that gave the most resolved and homogeneous spectrum and the fully deacylated (KOH treated) material (
In the 1H-NMR spectrum of the Pm70 OS and KOH treated LPS, spin systems arising from heptose residues (Hep I (E), Hep II (F), Hep III (G) and Hep IV (J)) were readily identified from their anomeric 1H resonances at 5.10OS (OS sample)/5.19KOH (KOH treated sample) (Hep I, E), 5.87OS/5.74KOH (Hep II, F), 5.23OS&KOH (Hep III, G) and 5.12OS&KOH (Hep IV, J) ppm coupled with the appearance of their spin systems which pointed to manno-pyranosyl ring systems. Heterogeneity was observed for the anomeric protons of Hep I in the OS sample due to the presence of various rearrangement products of the neighbouring Kdo molecule following acid hydrolysis (assignments from the major Hep I signal in the OS sample are detailed). The α-configurations were evident for the heptosyl residues from the occurrence of intra-residue NOE's between the H1 and H2 resonances only. Two of the remaining residues in the α-anomeric region at 5.22OS&KOH ppm (Glc II, H) and 5.09OS/5.53KOH ppm (GalNAc II/GalN II, P) were determined to be gluco- and galacto-pyranose sugars respectively, based upon the appearance of their spin systems. The galacto-configured residue at 5.09OS/5.53KOH ppm was determined to be an amino sugar by virtue of its 1H resonance of its H-2 proton at 4.24OS/3.65KOH ppm correlating to a 13C chemical shift of 50.4OS/51.5KOH ppm in 13C—1H HSQC experiments. The 13C chemical shift being consistent with a nitrogen substituted carbon atom. The remaining residue in the o-anomeric region at 4.95OS/4.99KOH ppm (Gal II, N) was determined to be a galacto-pyranose sugars, based upon the appearance of its characteristic spin system to the H-4 resonance in a TOCSY experiment (
The sequence of the glycosyl residues in the OS was determined from the inter-residue 1H—1H NOE measurements between anomeric and aglyconic protons on adjacent glycosyl residues and confirmed and extended the methylation analysis data. The linkage pattern for the Pm70 deacylated oligosaccharide was determined in this way (
The linkages of the Hep I-Kdo-Lipid A region (E-C-B-A) were confirmed from analyses on the KOH treated LPS as
The availability of the genome sequence for the Pm70 strain (May et al, 2001) along with a thorough knowledge of the OS structure, coupled with information about the glycosyltransferases that put similar OS structures together in the structurally and taxonomically related species enabled several candidate glycosyltransferases for the biosynthesis of the Pm70 OS to be identified (
Discussion
Structural analysis of the oligosaccharide of the Pm70 genome strain of Pm has revealed a structure with similarities to the previously determined LPS core oligosaccharide structures for the related species Mh (Brisson et al, 2000), Ap (St. Michael et al, 2004), Hd (Schweda et al, 1994) and Hi (Cox et al, 2001a). In each case the core OS contains an identically linked tri-heptosyl unit that is attached to a Kdo residue. Interestingly in Pm the 3-position of the HepII residue is substituted in the majority of cases with a PEtn residue, whereas Ap, Hd and Mh do not contain a PEtn residue and Hi elaborates a PEtn residue at the 6-position of Hep II. The substitution pattern at the Hep I residue of Pm is identical to that found for the veterinary pathogens Ap and Mh with two glucose residues at the 4- and 6-positions, whereas the Hep I residue in Hi and Hd is only substituted at the 4-position. Additionally the glucose residue at the 4-position of Hep I is consistently substituted at the 6-position with a heptose residue in the three veterinary pathogens, Hd and in some strains of Hi. However in Pm (and in some strains of Hi) the heptose residue substituting the glucose residue is L-glycero-D-manno configured compared to a
Based on the Pm70 OS structure homologues to glycosyltransferases with similar specificities were identified in the Pm70 genome. Considering the novel finding of two LPS populations depending upon the presence of one or two Kdo residues it was interesting to note that only one homologue to Kdo transferases was identified in the Pm genome. This is not surprising since the pleiotropic nature of Kdo transferases is well documented, i.e. the same Kdo transferase can transfer a Kdo residue to lipid A and a second Kdo residue to the initial Kdo residue. The novel feature of Pm LPS though, is that populations with both one and two Kdo residues have been identified, that has to our knowledge not been observed previously. However, it was observed that there were two good homologues in the Pm70 genome for Hep I (E) to Kdo (C) (α-1,5 heptosyltransferase) transferases. One transferase had the highest homology to HI 0261 (OpsX) of Hi wherein the LPS structure contains one Kdo residue; and the second transferase had the highest homology to WaaC from Escherichia coli and Klebsiella pneumoniae that have two Kdo residues in their LPS structures. The identification of two Hep I transferases is therefore consistent with the presence of two structural arrangements in the Kdo region of the Pm70 LPS, and it will be intriguing to understand the regulation of the Kdo transferase from this organism.
This study has structurally characterised the core OS region of the genome strain of Pm and identified putative glycosyltransferases for the complete biosynthesis of the core OS.
Materials and Methods
Media and Growth Conditions
Pm strain Pm70 (NRCC # 6232) was initially grown overnight on chocolate agar plates at 37° C. and growths were used to inoculate 1 L of brain-heart infusion (BHI) medium supplemented with β NAD (Sigma N-7004) to a final concentration of 5 ug/ml, haemin (Sigma H-2250) to a final concentration of 5 ug/ml and 1% glucose (10 g). Cultures were then incubated at 37° C. at 200 rpm for 6 hours and used to inoculate 24 L BHI medium (supplemented as above) in a 28 L NBS fermenter. The cultures were then grown at 37° C., with 24 lmin−1 aeration and stirring at 200 rpm for 18 hours with 20% O2 saturation. Following treatment with hyaluronidase (1 g, Sigma,) cells were killed (2% phenol w/v, for 4 hours) and harvested by using a Sharples continuous centrifuge (˜240 g wet weight).
Isolation and Purification of Lipopolysaccharide
Following washing of the lyophilised cell mass (˜70 g) with organic solvents yielding ˜50 g, the lipopolysaccharide (LPS) was isolated from 10 g of the washed, lyophilised cell mass by the hot water/phenol method (Westphal and Jann, 1965). The aqueous phase was dialysed against water and lyophilised. The dried sample was dissolved in water to give a 1-2% solution (w/v) and treated with deoxyribonuclease I (DNase) (0.01 mg/ml) and ribonuclease (RNase) (0.01 mg/ml) for 3 hrs at 37° C., then treated with proteinase K (0.01 mg/ml) for 3 hrs. The dialysed, dried sample was dissolved in water to make a 1% solution and ultra-centrifuged at 45 K following a low speed spin at 8K to remove any insoluble material (124 mg). The LPS pellet from the 45K spin was redissolved in water and lyophilised (180 mg). Purified LPS (75 mg) was treated with anhydrous hydrazine with stirring at 37° C. for 1 hr to prepare O-deacylated LPS (LPS-OH). The reaction was cooled in an ice bath and gradually cold acetone (−70° C., 5 vols.) was added to destroy excess hydrazine and the precipitated LPS-OH was isolated by centrifugation (60 mg). The sample was then purified down a Bio-Gel P-2 column as described above. The core oligosaccharide (OS) was isolated by treating the purified LPS (100 mg) with 1% acetic acid (10 mgml−, 100° C., 1.5 hr) with subsequent removal of the insoluble lipid A by centrifugation (5000 g). The lyophilised OS (50 mg) was further purified down a Bio-Gel P-2 column with individual fractions lyophilised. Fully deacylated LPS was isolated by treatment of LPS-OH (20 mg) with 4N KOH at 125° C. for 16 h and following neutralisation were fractionated by anion-exchange liquid chromatography as described previously (Vinogradov, E and Bock, K. 1999).
Analytical Methods
Sugars were determined as their alditol acetate derivatives by GLC-MS (Sawardeker et al, 1965). Samples were hydrolysed for 4 hrs using 4 M trifluoroacetic acid at 100° C., then reduced (NaBD4) overnight in H2O and acetylated with acetic anhydride at 100° C. for 2 h using residual sodium acetate as catalyst. The GLC-MS was equipped with a 30 M DB-17 capillary column (180° C. to 260° C. at 3.5° C./min) and MS was performed in the electron impact mode on a Varian Saturn II mass spectrometer. Methylation analysis was carried out by the NaOH/DMSO/methyl iodide procedure (Ciucanu and Kerek, 1994) and analysed by GLC-MS as above. Absolute configurations were determined by GLC analysis of butyl glycoside derivatives (St. Michael et al, 2004).
Mass Spectrometry
ESI-MS was performed in the negative ion mode on a VG Quattro Mass Spectrometer (Micromass, Manchester, U.K.) by direct infusion of samples in 25% aqueous acetonitrile containing 0.5% acetic acid. Capillary electrophoresis (CE)-MS was performed on a Prince CE system (Prince Technologies, The Netherlands) coupled to an API 3000 mass spectrometer (Applied Biosystem/Sciex, Concord, Canada) via a microspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 μL/min to a low dead volume tee (250 μm i.d., Chromatographic Specialties). All aqueous solutions were filtered through a 0.45-μm filter (Millipore) before use. An electrospray stainless steel needle (27 gauge) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column. The separations were obtained on about 90 cm length bare fused-silica capillary using 10 mM ammonium acetate/ammonium hydroxide in deionised water, pH 9.0, containing 5% methanol. A voltage of 20 kV was typically applied at the injection site. The outlet of the capillary was tapered to ca. 15 μm i.d. using a laser puller (Sutter Instruments). Mass spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in fall-mass scan mode. The MS/MS data were acquired with dwell times of 1.0 ms per step of 1 m/z unit. Fragment ions formed by collision activation of selected precursor ions with nitrogen in the RF-only quadrupole collision cell, were mass analyzed by scanning the third quadrupole.
Nuclear Magnetic Resonance
NMR experiments were acquired on Varian Inova 400, 500 and 600 MHz spectrometers using a 5 mm or 3 mm triple resonance (1H, 13C, 31P) probe. The lyophilised sugar sample was dissolved in 600 μL (5 mm) or 140 μL (3 mm) of 99% D2O. The experiments were performed at 25° C. with suppression of the HOD (deuterated H2O) signal at 4.78 ppm. The methyl resonance of acetone was used as an internal reference at 2.225 ppm for 1H spectra and 31.07 ppm for 13C spectra. Standard homo and heteronuclear correlated 2D pulse sequences from Varian, COSY, TOCSY, NOESY, 13C—1H HSQC, 13C—1H HSQC-TOCSY and 13C—1H HMBC, were used for general assignments. The 2D 1H-31P HSQC experiment was acquired on a Varian Inova 400 spectrometer for 6 h. The coupling constant was optimised at 12 Hz by performing an array of 1D-HSQC experiments. The sweep width in the F2 (1H) dimension was 6.0 ppm and in the F1 (31P) dimension was 16.2 ppm. Water presaturation during the relaxation delay was 1.5 s, acquisition time in t2 was 0.21 s, and 32 increments with 180 (HMQC) scans per increment were obtained. The 2D 1H—31P HSQC-TOCSY experiment was acquired on a Varian Inova 400 spectrometer for 8 h using the same parameters as the HSQC experiment with a TOCSY mixing time of 80 ms
Example 3,
Example 3,
aData from KOH treated LPS;
bData from core OS sample;
abData from both KOH treated LPS and core OS, assignments identical; except
cH-1 chemical shift of residue I from KOH treated LPS is 4.60 ppm and
dH-2 chemical shift of residue J from KOH treated LPS is 4.11 ppm.
Example 3,
This Example forms the basis of a publication in Carbohydrate Research 340, 59 (2005). Structural analysis of the lipopolysaccharide of Pasteurella multocida strain VP161.
In this example the structure of the lipopolysaccharide from the Pasteurella multocida strain VP161 was elucidated. The lipopolysaccharide was subjected to a variety of degradative procedures. The structures of the purified products were established by monosaccharide and methylation analyses, NMR spectroscopy and mass spectrometry. The following structures for the lipopolysaccharides were determined on the basis of the combined data from these experiments,
where based on the NMR data all sugars were found in pyranose ring forms and Kdo is 2-keto-3-deoxy-octulosonic acid,
Pasteurella multocida (Pm) is a Gram-negative bacterium and multi-species pathogen that causes serious diseases in food animals and humans. This bacterium is the causative agent of fowl cholera in chickens and turkeys, hemorrhagic septicaemia in cattle, atrophic rhinitis in pigs, and dog and cat bite infections in humans. Several Pm virulence factors have previously been identified, including the capsule in serogroups A and B, and LPS. However, there are conflicting reports as to the endotoxic properties of LPS isolated from Pm. LPS isolated from a serotype B:2 strain was shown to be endotoxic and intravenously administered LPS could reproduce clinical signs of hemorrhagic septicemia in buffalo. However, turkey poults were found to be relatively resistant to the lethal effects of LPS isolated from serogroup A strains of Pm, although the inflammatory response and microscopic hepatic lesions were similar to those observed in mammalian hosts. In contrast, chicken embryos and mice were found to be highly susceptible to the toxic effects of Pm LPS.
Pm strains are classified into Heddleston serotypes based on the antibody responses to LPS, whilst antibodies raised against heat-killed Pm vaccines are primarily directed against LPS and protect the host against strains within the same serotype. Early studies demonstrated that LPS purified using the hot phenol/water method and injected into mice and rabbits resulted in a poor antibody response and no protection against Pm infection, however the same LPS when injected into chickens induced a good antibody response that passively protected recipients against disease. Monoclonal antibodies raised against the LPS from a serotype A strain were shown to be bactericidal and to completely protect mice against homologous challenge. In addition, an opsonic monoclonal antibody against a serotype B strain of Pm LPS was shown to partially protect mice against Pm infection.
A modified LPS structure clearly affects the viability of Pm in vivo. Recently three strongly attenuated mutants of Pm strain VP161 were identified that each had a single transposon insertion in the gene pm1294 (designated waaQPM). This gene was subsequently shown to encode a heptosyltransferase, mutation of which resulted in a highly truncated LPS structure. Furthermore, a Pm galE mutant has been constructed previously and was attenuated in mice although no structural analysis of the LPS was reported. Pm isolates may be grouped serologically based on their capsular antigens into 5 serogroups A, B, D-F using a passive haemaglutination test with erythrocytes sensitised with capsular antigen. Structural information is available for the capsules of serogroups A (hyaluronic acid), D (heparin) and F (chondroitin) each being an example of the well-studied glycosaminoglycans. Somatic (LPS) typing can also be used for the identification of strains and there have been two main systems reported. The Namioka system is based on a tube agglutination test and is able to recognise 11 serotypes, whereas the Heddleston system using a gel diffusion precipitation test and can recognise 16 serotypes and is currently the preferred method.
In 1981 a standard system for the identification of P. multocida serotypes was recommended that utilized both the Carter capsular typing identified by the letters A, B, D, E and F, and the Heddleston somatic typing system identified by numbers. Pm expresses LPS molecules that do not have the polymeric O-antigen, so-called rough LPS. Recently we analysed the LPS structure of the genome strain Pm70 that exhibited a rough LPS structure. The latter study also suggested that the LPS contain variation in the Kdo region of the molecule. This study was carried out on another strain of Pm, VP161, a highly virulent serotype A: 1 strain, in order to gain further insight into Pm LPS structure and to examine if the variability in the Kdo region was also present in this strain. We had previously characterised the core OS of a heptosyltransferase mutant in VP161 and here we report the complete structure for the LPS including the novel arrangement in the Kdo region of the LPS molecule.
Experimental
Media and Growth Conditions
P. multocida strain VP161 was initially grown for 16 h on a chocolate agar plate at 37° C. and growth was used to inoculate 1 L of brain-heart infusion (BHI) medium supplemented with β NAD (Sigma N-7004) to a final concentration of 5 ug/ml, haemin (Sigma H-2250) to a final concentration of 5 ug/ml and 1% glucose (10 g). Cultures were then incubated at 37° C. at 200 rpm for 6 h and used to inoculate the fermenter. P. multocida strain VP161 was then grown in a 28 L fermenter in 24 L of BHI broth for 18 h at 37° C. with 20% DO saturation. The cells were killed by addition of phenol to 2%, and 3 h post-phenol 1 g of hyaluronidase (Roche Chemicals) was added and stirred for 1 h before harvesting cells by using a Sharples continuous flow centrifuge (˜210 g).
Isolation, Purification and Degradation of Lipopolysaccharide
P. multocida cells (˜210 g wet wt.) were freeze-dried, yielding ˜56 g. Freeze-dried cells were washed with organic solvents (1× ethanol, 2× acetone, 2× light petroleum ether) to remove lipids and other lipophilic components to enhance the efficiency of the LPS extraction. Washed cells (10 g from ˜42 g) were extracted by the hot phenol/water method and the aqueous phases combined and dialysed against running water for 48 h. The retentate was freeze-dried yielding ˜1.6 g, made up to a 2% solution in water and treated with DNase and RNase at 37° C. for 4 h followed by proteinase K treatment at 37° C. for 4 h. Small peptides were removed by dialysis. After freeze-drying, the retentate (˜0.2 g) was made up to a 2% solution in water, centrifuged at 8,000 g for 15 min (yielding an 8K pellet of ˜85 mg) followed by further centrifugation of the supernatant at 100,000 g for 5 h. The pellet, containing purified LPS, was redissolved and freeze-dried (yielding ˜17 mg). 8K pellet material (˜40 mg) was treated with anhydrous hydrazine with stirring at 37° C. for 1 h to prepare O-deacylated LPS (LPS-OH). The reaction was cooled in an ice bath and gradually, cold acetone (−70° C., 5 vols.) was added to destroy excess hydrazine and the precipitated LPS-OH was isolated by centrifugation and lyophilisation of the redissolved pellet (˜35 mg). The sample was then purified down a Bio-Gel P-2 column with individual fractions lyophilised. The core oligosaccharide (OS) was isolated by treating separately the 8K pellet material (˜45 mg) and the LPS (˜17 mg) with 1% acetic acid (10 mg/ml, 100° C., 1.5 h) with subsequent removal of the insoluble lipid A by centrifugation (5,000×g). The lyophilised OS sample from the 8K pellet was subsequently further purified down a Bio-Gel P-2 column as above. Fully deacylated LPS was isolated by treatment of LPS-OH (˜12 mg) with 4N KOH at 125° C. for 16 h and following neutralisation were fractionated by anion-exchange liquid chromatography.
Analytical Methods
Sugars were determined as their alditol acetate derivatives by GLC-MS. Samples were hydrolysed for 4 h using 4 M trifluoroacetic acid at 100° C. The hydrolysate was reduced (NaBD4) for 16 h in H2O and acetylated with acetic anhydride at 100° C. for 2 h using residual sodium acetate as catalyst. The GLC-MS was equipped with a 30 M DB-17 capillary column (180° C. to 260° C. at 3.5° C./min) and MS was performed in the electron impact mode on a Varian Saturn II mass spectrometer. Methylation analysis was carried out by the NaOH/DMSO/methyl iodide procedure and analysed by GLC-MS. Absolute configurations were determined by GLC analysis of butyl glycoside derivatives.
Mass Spectrometry
ESIMS was performed in the negative ion mode on a VG Quattro Mass Spectrometer (Micromass, Manchester, U.K.) by direct infusion of samples in 25% aqueous acetonitrile containing 0.5% acetic acid. Capillary electrophoresis (CE)-MS was performed on a Prince CE system (Prince Technologies, The Netherlands) coupled to an API 3000 mass spectrometer (Applied Biosystem/Sciex, Concord, Canada) via a microspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 μL/min to a low dead volume tee (250 μm i.d., Chromatographic Specialties). All aqueous solutions were filtered through a 0.45-μm filter (Millipore) before use. An electrospray stainless steel needle (27 gauge) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column. The separations were obtained on about 90 cm length bare fused-silica capillary using 10 mM ammonium acetate/ammonium hydroxide in deionized water, pH 9.0, containing 5% methanol. A voltage of 20 kV was typically applied at the injection. The outlet of the capillary was tapered to ca. 15 μm i.d. using a laser puller (Sutter Instruments). Mass spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in full-mass scan mode. The MS/MS data were acquired with dwell times of 1.0 ms per step of 1 m/z unit. Fragment ions formed by collision activation of selected precursor ions with nitrogen in the RF-only quadrupole collision cell, were mass analyzed by scanning the third quadrupole.
Nuclear Magnetic Resonance
NMR experiments were acquired on Varian Inova 400, 500 and 600 MHz spectrometers using a 5 mm or 3 mm triple resonance (1H, 13C, 31P) probe. The lyophilised sugar sample was dissolved in 600 μL (5 mm) or 140 μL (3 mm) of 99% D2O. The experiments were performed at 25° C. with suppression of the HOD (deuterated H2O) signal at 4.78 ppm. The methyl resonance of acetone was used as an internal reference at 2.225 ppm for 1H spectra and 31.07 ppm for 13C spectra. Standard homo and heteronuclear correlated 2D pulse sequences from Varian, COSY, TOCSY, NOESY, 13C—1H HSQC, 13C—1H HSQC-TOCSY and 13C—1H HMBC, were used for general assignments. The 1D 31P experiment was carried out on a Varian Inova 200 spectrometer with a sweep width of 40 ppm, 20000 transients and acquisition time of 1.6 s. The 2D 1H—31P HSQC experiment was acquired on a Varian Inova 400 spectrometer for 6 h. The coupling constant was optimised at 10 Hz by performing an array of 1D-HSQC experiments. The sweep width in the F2 (1H) dimension was 6.0 ppm and in the F1 (31P) dimension was 16.2 ppm. Water presaturation during the relaxation delay was 1.5 s, acquisition time in t2 was 0.21 s, and 32 increments with 180 (HMQC) scans per increment were obtained. The 2D 1H—31P HSQC-TOCSY experiment was acquired on a Varian Inova 400 spectrometer for 8 h using the same parameters as the HSQC experiment with a TOCSY mixing time of 150 ms.
Results & Analysis
Investigation of P. multocida Strain VP161
Sugar analysis of the purified LPS and 8K pellet material revealed glucose (Glc), galactose (Gal) and
LPS-OH was prepared from LPS of fermenter-grown cells and analysed by CE-MS (Example 4 Table 1). Triply charged ions were observed at m/z 992.0, 999.0 and 1040.0 corresponding to a composition of 2PCho, 4Hep, 3Hex, 2 Kdo, Lipid A-OH for the smallest molecule. As shown below the larger glycoforms corresponded to molecules with a phosphate molecule in place of the second Kdo residue, one more hexose residue in the core oligosaccharide and for the largest glycoform (m/z 1040.0) an additional PEtn residue on the Kdo-P. Following growth on chocolate agar plates additional glycoforms were indicated from triply charged ions of m/z 1033.0 and 1081.0 (Example 4 Table 1). MS/MS analysis revealed that two different lipid A-OH species were found in the mixture of glycoforms, a basal species with a molecular mass of 952 amu as indicated by doubly and singly charged ions of m/z 475.5 and 951.5 following MS/MS and a species containing an additional PEtn residue by virtue of a doubly charged ion of m/z 536.5 observed following MS/MS (
MS analysis on the core oligosaccharides alone (derived from both LPS and 8K pellet material; giving the same spectra), revealed different fragmentation patterns from the doubly charged positive ions at m/z 903.0 and 984.0, that correspond to the doubly charged negative ions at m/z 902.0 and 983.0 in Example 4 Table 1, consistent with the presence or absence of a hexose residue at the proximal heptose residue (Hep I) to Kdo. MS/MS on the doubly charged ion of m/z 903 (
Methylation analysis was performed on the O-deacylated LPS (LPS-OH) in order to determine the linkage pattern of the molecule revealing the presence of terminal Glc, 6-substituted Glc, terminal LD-Hep, 2-substituted LD-Hep and 4,6-disubstituted LD-Hep in the approximate molar ratio of 1:1:1:1:1, with lesser amounts of terminal Gal, 3,4-disubstituted LD-Hep and 3,4,6-trisubstituted LD-Hep being observed. Following HF treatment to remove phosphate residues that preclude optimal release of phosphorylated sugars on hydrolysis, methylation analysis was repeated which revealed the same sugars in the same ratio apart from the t-Gal residue which was now double the amount of the other components suggesting that the PCho residues had been substituting Gal sugars.
In order to elucidate the exact locations and linkage patterns of the OS, NMR studies were performed on the OS fraction that gave the most resolved and homogeneous spectra. The assignment of 1H resonances of the OS sample was achieved by COSY and TOCSY experiments with reference to the structurally related core OS from Pasteurella multocida strain Pm70 and from the related species Mannheimia haemolytica and Actinobacillus pleuropneumoniae (Example 4 Table 2). The inner core residues (to Hep IV (f/f′)) were linked identically to the inner-core from the recently published Pasteurella multocida strain Pm70 and the assignments listed in Example 4 Table 2 were consistent with that. However there was no PEtn residue at the 3-position of Hep II (b) in the VP161 core OS. Interestingly for the core OS sample, the presence or absence of the Glc II residue (e) at Hep I (a) led to the identification of two sets of signals for the remaining inner core residues (
In order to explore further the novel arrangements in the Kdo region of the molecule deacylated samples were examined following KOH treatment. It was possible to separate fully deacylated LPS fractions that contained one and two Kdo residues (
Structural analysis of the oligosaccharide of the VP161 strain of Pasteurella multocida (Pm) has revealed a structure with similarities to and differences from the previously determined LPS core oligosaccharide structures for the genome strain Pm70 of Pm and the related species Mannheimia haemolytica (Mh), Actinobacillus pleuropneumoniae (App). In each case the core OS contains an identically linked tri-heptosyl unit that is attached to a Kdo residue. Interestingly in Pm70 the 3-position of the HepII residue is substituted in the majority of cases with a PEtn residue, whereas in strain VP161, and in the related species App and Mh no inner core PEtn residues were observed. Apart from this variation in the substitution of Hep II with PEtn, both Pm strains and the related veterinary species Mh and App share a relatively conserved inner core structure. The only other differences in the inner core structure of Pm are the identification of a L-glycero-D-manno configured heptose residue in the extension from the Glc I residue at Hep I compared to the D-glycero-D-manno configured heptose residues encountered in App and Mh, and the variable presence of the Glc II residue in the Pm inner core, apparently due to the variability of the Kdo region of the molecule. This Glc II residue was stoichiometrically found in the inner core LPS of App and Mh. A different extension beyond this conserved inner core region was observed in strain VP161, whereby the Hep IV residue was di-substituted with two PCho-Gal moieties at the 4- and 6-positions. To our knowledge this structural arrangement has not been observed previously. It is rare to encounter two PCho residues in the same LPS molecule; non-typable Hi carriage strains 11 and 16 are the only documented examples of such an arrangement. The presence of PCho residues could be implicated in the virulence of the Pm organism, as a role for PCho in adherence and colonisation in the respiratory tract has been documented. It was also found that a mutant of strain VP161 that presented a truncated LPS structure lacking the two PCho residues was attenuated in both a mouse model and in chickens. A previous study by other authors had also observed a decrease in virulence of a galE mutant serotype D strain of Pm that could be due to alteration of the LPS structure. The most intriguing aspect of the VP161 LPS structure however is the variation observed in the Kdo region; where both one Kdo and two Kdo containing glycoforms have been observed. Additionally the impact on the inner core structure, i.e. the presence or absence of Glc II at Hep I, caused by the variability of the Kdo region arrangement is interesting. The α-1,6glucosyltransferase responsible for the transfer of Glc II to the Hep I residue is not known. It was interesting to note that only one homologue to Kdo transferases was identified in the Pm genome of strain Pm70 whose LPS also contained populations with both one Kdo and two Kdo containing species. It would also be of interest to compare the sequence of the Kdo transferase genes from Pm, App and Mh in order to investigate any sequence differences that could be attributed to the “bi-functional” nature of the Pm transferase or if other regulatory factors are involved in this variability. This study has identified the LPS structure of a second Pm strain, both strains share a similar inner core structure but a variable outer core decoration, and both exhibit an interesting variation in the Kdo region of the molecule, the significance of which remains to be investigated.
Example 4,
Example 4,
aData from KOH treated LPS is from the Kdo residue containing glycoform;
bData from core OS sample;
abData from both KOH treated LPS and core OS, assignments identical. Data from Gal-I and Gal-II for the KOH treated LPS is not included due to considerable heterogeneity introduced by hydrolysis and migration of PCho residues.
This Example forms the basis of a publication in Carbohydrate Research 340, 1253 (2005). Structural analysis of the core oligosaccharide from Pasteurella multocida strain X73.
In this example the structure of the core oligosaccharide region of the lipopolysaccharide from the Pasteurella multocida strain X73 was elucidated. The lipopolysaccharide was subjected to a variety of degradative procedures. The structure of the purified oligosaccharide was established by monosaccharide and methylation analyses, NMR spectroscopy and mass spectrometry. The following structure illustrates a similar structure to the recently identified oligosaccharide from another P. multocida strain VP161, but with additional symmetrical substitution of the terminal galactose residues with phosphoethanolamine moieties,
where based on the NMR data all sugars were found in pyranose ring forms and Kdo is 2-keto-3-deoxy-octulosonic acid,
Pasteurella multocida (Pm) is a Gram-negative bacterium and multi-species pathogen that causes serious diseases in food animals and humans. Structural analyses on the lipopolysaccharide (LPS) of the genome strain Pm70 and a virulent serotype A: 1 strain VP161 have revealed a conserved inner core oligosaccharide (OS) structure with variable outer core OS structures. This study was carried out on another virulent serotype A strain X73 and structural analysis of the purified LPS products revealed a similar OS structure to that found for strain VP161 but with an additional symmetrical phosphorylation pattern to the outer core OS. Sugar analysis of the purified LPS and 8K pellet material from strain X73 revealed a similar profile to strain VP161 containing the sugars glucose (Glc), galactose (Gal) and
MS analysis on the core oligosaccharides alone, revealed a series of ions consistent with the compositions inferred from the LPS-OH data, indicating the presence of additional PEtn residues when compared to strain VP161. The location of the PEtn residues was determined from MS/MS experiments in positive ion mode. Fragmentation of the doubly charged ion of m/z 1108 corresponding to the largest glycoform produced several product ions including m/z 183.5+ (PCho), 450.5+ (PCho-Hex-PEtn), 547.52+ (2PCho, 2PEtn, 2Hex, Hep) and 916.52+ (M-Kdo-Hex). The doubly charged ion at m/z 547.52+ was of particular interest when compared to the doubly charged ion observed at m/z 4242+ in strain VP161, as it would indicate a glycoform with a mass 246 amu higher consistent with the presence of two PEtn residues. MS/MS/MS analysis on the doubly charged ion at m/z 916.52+ revealed the product ion spectrum shown in
In order to confirm and extend these inferences NMR experiments were performed on the fractionated core OS sample that contained both PEtn residues (as determined by MS—data not shown). Apart from the two terminal galactose residues all assignments were identical to those obtained on the core OS from strain VP161. Chemical shifts for the H-1 and H-2 resonances of the galactose residues were as observed for the VP161 sample, but the H-3 and H-4 resonances were shifted slightly downfield from 4.17 and 4.12 to 4.21 and 4.17 ppm respectively. Inter-NOE contacts from the galactose residues were as observed previously although the intra-NOE contact to the H-5 residue was now observed at 3.94 ppm as opposed to 3.80 and 3.76 ppm for strain VP161 (Example 5 Table 2). In order to identify the locations of the two PEtn residues a 31P—1H-HSQC experiment was performed that identified a resonance at 4.07 ppm as the point of attachment of each PEtn residue, a subsequent 31P—1H-HSQC-TOCSY experiment identified the H-5 resonance of the galactose residues at 3.94 ppm (
This study has therefore identified a similar core OS structure from the LPS of a second serotype A strain. Further studies will extend LPS structural analyses to other serotypes to examine if this novel terminal structure is present in other serotypes. The identification of PEtn at the 6-position of a six-carbon sugar is somewhat unusual. PEtn is commonly found at the 6-position of heptose residues in both Neisseria meningitidis and Haemophlilus influenzae. Recent studies in our laboratory have identified PEtn at the 6-position of a terminal GalNAc residue in several Haemophilus influenzae strains and a recent poster also found a PEtn residue at the 6-position of a 3-linked galactose molecule in Citrobacter sp. PCM1443 (serotype O39) with similar chemical shifts to those observed here.
1. Experimental
1.1 Growth of Bacteria, Isolation and Fractionation of LPS
P. multocida strain X73 (NRCC#6235) was grown and isolated. Briefly, P. multocida cells (˜210 g wet wt.) were freeze-dried, yielding ˜56 g. Freeze-dried cells were washed with organic solvents (1× ethanol, 2× acetone, 2× light petroleum ether) to remove lipids and other lipophilic components to enhance the efficiency of the LPS extraction. Washed cells (10 g from ˜42 g) were extracted by the hot phenol/water method and the aqueous phases combined and dialysed against running water for 48 h. The retentate was freeze-dried yielding ˜0.57 g, made up to a 2% solution in water and treated with DNase and RNase at 37° C. for 4 h followed by proteinase K treatment at 37° C. for 4 h. Small peptides were removed by dialysis. After freeze-drying, the retentate (˜0.42 g) was made up to a 2% solution in water, centrifuged at 8,000 g for 15 min (yielding an “8K pellet” of −265 mg) followed by further centrifugation of the supernatant at 100,000 g for 5 h. The pellet, containing purified LPS, was redissolved and freeze-dried (yielding ˜3 mg). LPS-OH and core OS were isolated and fractionated. Briefly, 8K pellet material (˜15 mg) and LPS (˜3 mg) were treated with anhydrous hydrazine with stirring at 37° C. for 1 h to prepare LPS-OH yielding ˜10 mg from the 8K preparation and ˜1 mg from the LPS. The core OS was isolated by treating the 8K pellet material (˜115 mg) with 1% acetic acid (10 mg/ml, 100° C., 1.5 h) with subsequent removal of the insoluble lipid A by centrifugation (5,000×g). The lyophilised supernatant was subsequently further purified down a Bio-Gel P-2 column with separate fractions lyophilised yielding ˜40 mg.
1.2 Analytical Methods
Sugars were determined as their alditol acetate derivatives by GLC-MS. Methylation analysis was carried out by the NaOH/DMSO/methyl iodide procedure and analysed by GLC-MS.
1.3 Mass Spectrometry and NMR Spectroscopy
All mass spectrometry and NMR experiments were performed as described above.
Example 5,
Example 5,
This example forms the basis of a publication in Infect. Immun. 72: 3436 (2004). A heptosyltransferase mutant of Pasteurella multocida produces a truncated lipopolysaccharide structure and its virulence is attenuated
Analysis of the P. multocida VP161 wild type LPS indicated a “rough” LPS, similar to the LPS or lipooligosaccharide isolated from gram-negative mucosal pathogens such as Haemophilus influenzae., H. ducreyi, Neisseria meningitides, and N. gonorrhoeae, with only a short non-repeating polysaccharide unit attached to the lipid A. The inner-core structure of P. multocida LPS is similar to that described for H. influenzae, Mannheimia haemolytica, and H. ducreyi with a triheptose unit liked via a KDO residue to lipid A (
Materials and Methods
Bacterial strains, plasmids, media and growth conditions. The bacterial strains and plasmids used in this study are shown in Example 6, Table 1. Escherichia coli was grown routinely in Luria-Bertani broth. P. multocida strains were grown in either brain heart infusion (BHI) or nutrient broth (NB) supplemented with yeast extract (3%) (Oxoid, Basingstoke, United Kingdom). Solid media were obtained with the addition of 1.5% agar. When required, the media were supplemented with tetracycline at 2.5 μg/ml. For structural studies, P. multocida strains VP161 and AL251 were grown in a 28 L fermenter in 24 L of BHI broth for 18 h at 37° C. with 20% DO saturation. The cells were killed by addition of phenol to 2%, and 3 h post-phenol 1 g of hyaluronidase (Roche Chemicals) was added and stirred for 1 h before harvesting cells by using a Sharples continuous flow centrifuge.
Transposon stability studies. P. multocida AL251 was grown in 10 ml of NB, shaken at 37° C. After approximately 10, 34 and 58 generations, samples of the culture were taken, diluted appropriately, and plated onto NB agar. After overnight incubation 100 colonies were patched onto NB with tetracycline and incubated overnight at 37° C. Transposon loss was expressed as the percentage of tetracycline sensitive colonies.
SDS-PAGE and silver staining. Analysis of LPS was performed with a Bio-Rad mini protein gel apparatus using SDS-PAGE as described in Laemmli, Nature 227, 680 (1970). LPS was then visualized by silver staining.
DNA manipulations. Restriction digests, ligations and polymerase reactions were performed according to the manufacturers' instructions using enzymes obtained from NEB (Beverley, Mass.) or Roche Diagnostics GmbH (Mannheim, Germany). Plasmid DNA was prepared using alkaline lysis and purified using Qiagen columns (QIAGEN GmbH, Germany) or by PEG precipitation (Ausubel, 1995). Genomic DNA was prepared using the CTAB method. PCR amplification of DNA was performed using Taq DNA polymerase or Expand High Fidelity PCR System (Roche Diagnostics) and purified using the Qiagen PCR Purification Kit. The oligonucleotides used in this study are listed in Example 6, Table 1. The DNA Sequence was determined on a Model 373A DNA Sequencing System (Applied Biosystems) and analyzed with Sequencher Version 3.1.1 (GenCodes, Ann Arbor, Mich.).
In trans complementation of waaQPM. The complete waaQPM gene was amplified from P. multocida VP161 genomic DNA using oligonucleotides BAP2146 and BAP2147 (Example 6, Table 1). The amplified 1.1 kb DNA fragment was ligated to SalI and BamHI-digested vector pAL99 (Example 6, Table 1), such that transcription was driven by the P. multocida tpiA promoter. E. coli transformants were screened for the presence of the correct plasmid and one, designated pAL170, was used to transform P. multocida AL251, generating the strain AL298. As a control, the vector pAL99 was transformed separately into AL251 generating strain AL438 (Example 6, Table 1).
Competitive growth assays. Competitive growth assays were performed as described in Harper (2003) and were used to quantify the relative growth rates of the P. multocida LPS mutant AL251 and the complemented mutant AL298. The competitive index (CI) was determined by dividing the percentage of tetracycline resistant colonies obtained from the output culture (in vitro or in vivo) by the percentage of tetracycline colonies obtained from the input culture. The relative competitive index (rCI), which measures the difference between growth in vivo and growth in vitro, was determined by dividing the in vivo CI by the in vitro CI. Mutants were identified as attenuated if the rCI value was significantly less than 1.0 as determined by statistical analysis using the one sided z-test (p<0.05).
Virulence trials. Groups of ten commercially obtained Leghorn-cross chickens aged 12 weeks were infected with P. multocida VP161 or AL251 at two different doses by injection of 100 μl into breast muscle. Blood samples were obtained at various time points after infection with AL251, and the birds deemed incapable of survival were euthanized in accordance with animal ethics requirements. Blood samples were diluted two-fold in BHI containing heparin and plated onto BHI plates. P. multocida colonies isolated from the blood were patched onto NB agar and NB agar with tetracycline.
Serum sensitivity assays. The sensitivity of P. multocida and E. coli to fresh chicken serum was determined as described in Chung et al. Infect. Immun. 69, 2487 (2001).
Purification of LPS. P. multocida cells (210 g, VP161; 254 g of AL251) were freeze-dried, yielding 56 g of VP161 and 52 g of AL251. Freeze-dried cells were washed with organic solvents to remove lipids and other lipophilic components to enhance the efficiency of the LPS extraction. Washed cells (42 g, VP161; 50 g, AL251) were extracted by the hot-phenol/water method and the aqueous phases combined and dialysed against running water for 48 h. The retentate was freeze-dried, made up to a 2% solution in water and treated with DNase and RNase at 37° C. for 4 h followed by proteinase K treatment at 37° C. for 4 h. Small peptides were removed by dialysis. After freeze-drying, the retentate was made up to a 2% solution in water, centrifuged at 8,000 g for 15 min followed by further centrifugation of the supernatant at 100,000 g for 5 h. The pellet, containing purified LPS, was redissolved and freeze-dried. The core oligosaccharide (OS) was isolated by treating the purified LPS with 1% acetic acid (10 mg/ml, 100° C., 1.5 h) with subsequent removal of the insoluble lipid A by centrifugation (5,000×g).
Analytical methods. Sugars were determined by their alditol acetate derivatives by GLC-MS. LPS was hydrolyzed for 4 h using 4 M trifluoroacetic acid at 100° C., reduced overnight with NaBD4 in H2O and then acetylated with acetic anhydride at 100° C. for 2 h using residual sodium acetate as catalyst. The GLC-MS was equipped with a 30 M DB-17 capillary column (180° C. to 260° C. at 3.5° C./min) and MS was performed in the electron impact mode on a Varian Saturn II mass spectrometer. Methylation analysis was carried out by the NaOH/DMSO/methyl iodide procedure and analyzed by GLC-MS as above.
MS analysis. Capillary electrophoresis electrospray ionization MS (CE-ESI-MS) was performed on a crystal Model 310 capillary electrophoresis (CE) instrument (AYI Unicam) coupled to an API 3000 mass spectrometer (Perkin-Elmer/Sciex) via a microIonspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 μL/min to a low dead volume tee (250 μm i.d., Chromatographic Specialties). All aqueous solutions were filtered through a 0.45-μm filter (Millipore) before use.
Nuclear Magnetic Resonance. NMR spectra were acquired on a Varian Inova 500 MHz spectrometer using a 3 mm triple resonance (1H, 13C, 31P) probe. The lyophilized sugar sample was dissolved in 140 μL (3 mm) of 99% D2O. The experiments were performed at 25° C. with suppression of the HOD (deuterated H2O) signal at 4.78 ppm. The methyl resonance of acetone was used as an internal or external reference at 2.225 ppm for 1H spectra and 31.07 ppm for 13C spectra. Standard homo and heteronuclear correlated 2D pulse sequences from Varian, COSY, TOCSY, NOESY, 13C—1H HSQC, 13C—1H HSQC-TOCSY and 13C—1H HMBC, were used for general assignments.
Results
An attenuated P. multocida STM mutant produces a truncated LPS that is restored to full-length LPS by complementation with a functional waaQPM gene. Signature-tagged mutagenesis (STM) was used to identify mutants attenuated for growth in mice and chickens. During this previous analysis a mutant was identified (designated AL251) that was attenuated in both chickens and mice. Sequence analysis of the mutant revealed a single transposon insertion within the gene waaQPM that is predicted to encode a putative heptosyltransferase, a glycosyltransferase responsible for the addition of heptose to LPS.
We compared the LPS profile of AL251 with that of its wild-type parent VP161, and the complemented mutant AL298, using polyacrylamide gel electrophoresis followed by silver staining. The LPS from AL251 migrated further within the gel compared to wild-type LPS indicating that the LPS produced by the mutant was significantly truncated (
Complementation of AL251 with waaQPM also restores in vivo growth to wild-type levels. As complementation of AL251 with waaQPM restored production of wild-type LPS we wanted to determine if complementing the inactivated waaQPM also restored the mutant AL251 to wild-type levels of growth in vivo. Initial studies with the complemented mutant AL298 indicated that there was significant loss of the complementing plasmid pAL170 once antibiotic selection for the plasmid was removed (44% retention after 6 h). For this reason, mice were chosen for the competitive growth assay instead of chickens, as previous studies had demonstrated that the infection time required to harvest bacteria from mice was only 6 h compared with more than 12 h for infections in chickens. Three mice were injected with an equal mix of VP161 and the complemented strain AL298. As controls, two mice were injected with an equal mix of wild-type VP161, and the control strain AL438 (AL251 with vector pAL99). The complemented mutant AL298 was able to compete equally with wild-type VP161 with an average rCI value of 1.0 while the control strain AL438 had an average rCI value of 0.57 (p=0.03), similar to the rCI values previously reported for AL251 in mice. These results demonstrate that waaQPM is required for both production of full-length LPS and for normal growth during infection.
The P. multocida waaQPM mutant is unable to cause disease in chickens. Strain AL251 displayed a profoundly reduced growth rate in chickens. It was desired to determine whether the mutant was still capable of causing disease in these hosts. Chickens were challenged with either VP161 or AL251 at two different doses (Example 6, Table 2). All of the chickens challenged with wild-type VP161 died within 20 h. In contrast, most chickens challenged with AL251 remained well over the first twenty hours but within 4 days all of the chickens inoculated with AL251, irrespective of dose, succumbed to fowl cholera infection. P. multocida was isolated from the blood of AL251-infected chickens in the late or terminal stages of the disease and it was found that all of the isolated P. multocida colonies were tetracycline sensitive indicating that the transposon was no longer present in the bacteria. Sequence analysis of waaQPM from the recovered colonies indicated that in all cases the transposon had excised, thereby reconstituting a functional waaQPM gene. Interestingly, for all but one isolate, the sequence analysis also revealed the presence of nucleotide substitutions at the point of transposon excision resulting in two amino acid changes within waaQPM (amino acids 88,89; Ser to Leu, and Asp to Cys respectively). These amino acid changes did not affect the function of waaQPM, as the LPS profiles of the P. multocida isolates recovered from the chickens challenged with AL251 were all identical to wild type (
Attenuation of the waaQPM mutant in chickens is not due to increased sensitivity to chicken serum. To determine the relative sensitivity of the wild-type P. multocida strain VP161 and the LPS mutant AL251 to complement-mediated killing, mid-log phase cells of each strain and a control strain, E. coli DH5α, were incubated in either normal or heat-treated chicken serum for 3 h. Wild-type P. multocida, strain VP161 was able to grow at the same rate in either the heated or unheated serum, indicating that it is fully serum resistant as previously reported for other P. multocida serotype A strains. The bactericidal activity of the chicken serum was confirmed using the E. coli control strain, which multiplied 19-fold in heat-treated serum, whilst in untreated serum its viability was reduced approximately 9-fold. Interestingly, for the mutant AL251, there was no difference in growth observed between the heat-treated and normal serum with approximately 160-fold increase in growth in the heat-treated serum and an identical growth rate in the normal serum. These results indicate that the attenuation observed for the LPS mutant in chickens was not due to increased sensitivity to complement.
Structural analysis of the LPS from P. multocida VP161 and AL251. Sugar analysis of the LPS from the parent strain VP161 revealed glucose (Glc), galactose (Gal), N-acetyl glucosamine (GlcNAc) and L-glycero-D-manno-heptose (LD-Hep) in the ratio of 2:1:1:3 respectively. In contrast, the LPS from mutant strain AL251 revealed only Glc and LD-Hep in the ratio of 1:3 with traces of Gal and GlcNAc. It is possible that the presence of GlcNAc could be contributed from residual amounts of the hyaluronic acid capsule known for this serogroup in addition to the anticipated two residues in the lipid A region of each LPS molecule. CE-ES-MS analyses of the core OS sample derived from the parent VP161 LPS revealed a simple mass spectrum (
Discussion
The P. multocida LPS mutant AL251, first identified using STM in mice and chickens, was shown to have a transposon insertion in a predicted heptosyltransferase gene waaQPM and was significantly attenuated in chickens and mice. Silver stained polyacrylamide gels of cell lysates from wild-type VP161 and AL251 showed that the LPS from the mutant was significantly truncated (
Analysis of the P. multocida Pm70 genome revealed that the gene waaQPM was probably transcribed independently and therefore the truncated LPS structure and reduced growth in vivo in chickens and mice was due directly to the inactivation of waaQPM and not due to polar effects on downstream genes. This was confirmed by complementation, as introduction of a wild-type waaQPM gene in trans restored both the LPS structure (
Virulence trials in chickens using the LPS mutant AL251 resulted in a delayed onset of fowl cholera symptoms (Example 6, Table 2) and P. multocida isolated from chickens with disease symptoms were tetracycline sensitive, indicating that they no longer carried the transposon. Nucleotide sequence data obtained from P. multocida DNA isolated from infected birds confirmed that the gene waaQPM was intact and in most cases, had nucleotide base changes at the point where the transposon had previously been inserted, resulting in two amino acid changes. The LPS from the P. multocida isolates recovered from the chickens challenged with AL251 showed that they produced wild-type LPS confirming that the waaQPM gene was functional despite the amino acid changes (
Analysis of the P. multocida VP161 wild-type LPS indicated a “rough” LPS, similar to the LPS or lipooligosaccharide (LOS) isolated from Gram-negative mucosal pathogens such as H influenzae, H. ducreyi, N. meningitidis and N. gonorrhoeae, with only a short non-repeating polysaccharide unit attached to the core. The inner core structure of P. multocida LPS is similar to that described for H. influenzae, M. haemolytica and H. ducreyi, with a tri-heptose unit linked via a Kdo residue to lipid A (
The loss of a full length LPS molecule clearly affects the ability of the mutant AL251 to grow in mice and to cause disease in chickens. The specific reasons for this attenuation are not clear. However, in wild-type P. multocida VP161 LPS, two PCho groups were identified while the mutant AL251 contained only a single PCho group in a very minor glycoform (Example 6, Table 3). The presence of more than one PCho residue in the VP161 LPS is unusual; bacteria with PCho-decorated LPS usually have only a single residue attached, although the position of attachment onto the LPS structure varies. Only one other bacterium, a non-typable H. influenzae strain, is known to have two PCho residues attached to the LPS. Interestingly, there are no PCho groups on the LPS of the serotype A turkey isolate, PM70, and this strain is not virulent for chickens.
PCho groups are frequently attached to various bacterial structures on the surface of mucosal pathogens such as H. influenzae, Actinobacillus actinomycetemcomitans, Streptococcus pneumoniae and Neisseria spp., and play a key role in adhesion and invasion of epithelial and endothelial host cells by binding to the platelet-activating receptor (PAF). Non-typable H. influenzae that has PCho positive glycoforms of LPS can attach and invade human bronchial epithelial cells via a series of signalling events. However, in both H. influenzae and Neisseria spp., although expression of PCho on LPS was required for adhesion and invasion of human epithelial cells, its presence reduced survival in some host niches, as strains expressing PCho were more serum sensitive, mediated by binding of PCho to C-reactive protein and subsequent activation of the complement system. Interestingly, the present studies have demonstrated that the LPS mutant AL251 is still highly resistant to the bactericidal action of complement in chicken serum, indicating that a complete wild-type LPS structure is not required for the bacteria to have full serum resistance. This is not surprising, as the capsule of P. multocida serotype A strains confers serum resistance.
In conclusion, a P. multocida waaQPM mutant that expresses a severely truncated LPS. Additionally the inner core structure for both the wild-type P. multocida LPS molecule and the waaQPM mutant molecule was determined and it was demonstrated that a functional waaQPM gene is required for the addition of the third heptose residue to the inner core of the LPS. Thus waaQPM has been identified as a heptosyltransferase III and through virulence trials it has been demonstrated that its activity is required for bacterial virulence in chickens, the natural host for this P. multocida strain. The inactivation of waaQPM leads to the complete absence of the third heptose in the inner core and, as a result, the fall wild-type glycoforms. The majority of glycoforms identified from the mutant LPS lack PCho residues that in LPS of other Gram negative mucosal pathogens play a key role in bacterial virulence.
Example 6,
Example 6,
CFU = colony forming units,
h = hours,
N.D = not determined.
Example 6,
aPCho, phosphocholine; Hep, heptose; Hex, hexose; Kdo, 2-keto-3-deoxyoctulosonic acid.
baKdo refers to anhydro-Kdo derivative
Example 6,
Previous structural studies of the lipopolysaccharides from the veterinary pathogens Mannheimia haemolytica, Actinobacillus pleuropneumoniae and Pasteurella multocida had identified a conserved inner core oligosaccharide structure that was present in all strains investigated. In order to examine the potential of this inner core structure as a vaccine, a mutagenesis strategy was adopted to interrupt a
Polyclonal and monoclonal antibodies were raised in mice to this LPS structure and were found to recognise LPS and whole-cells of all three species, Mannheimia haemolytica, Actinobacillus pleuropneumoniae and Pasteurella multocida.
Bacterins or crudely modified live strains are the traditional vaccines of practice, however, field trials and experimental studies have repeatedly shown that bacterins are not effective and indeed often cause adverse effects. This work seeks to address the need for effective, defined sub-unit vaccines. Antigens that could be considered as vaccine candidates would almost certainly have to be displayed on the surface of the bacteria in its natural state in order for the immune response to the vaccine antigen to subsequently target the live organism.
In this context, the veterinary organisms contain surface exposed carbohydrate moieties that could be utilised as vaccine candidates. The carbohydrate moieties are lipopolysaccharides (LPS) and capsular polysaccharides. Capsular polysaccharides are repeating units of several carbohydrate residues directly linked to the bacterial surface whereas LPS consists of three regions, a lipid A region that links the LPS molecule to the bacterial surface via fatty acid residues, a relatively conserved core oligosaccharide region which links the lipid A region to the third region, the variable polysaccharide antigen (O-antigen). Strain heterogeneity in capsular and O-antigenic polysaccharides would preclude these structures as economically viable vaccine candidates due to their ability to provide coverage only to the homologous strain or to strains producing an identical structure. Alternatively, if a conserved core LPS structure could be identified, this may have a utility as a vaccine candidate that would provide broad coverage to all strains.
Previous and ongoing structural analysis of the LPS structures of these three species in our laboratories had identified a conserved inner core LPS structure in all strains so far investigated, App, Pm and Mh. In order to examine the potential of this conserved inner core unit, it is necessary to expose this structure as a terminal residue by adopting a mutagenesis strategy in which the gene(s) encoding the glycosyltransferases responsible for outer core biosynthesis are disrupted. As a consequence of this mutation the conserved inner core structure is thus exposed.
This study describes the identification, cloning and mutagenesis of a heptosyltransferase gene from Mannheimia haemolytica responsible for the first biosynthetic step in outer core decoration. Subsequent structural analysis of the LPS from the mutant strain confirmed that the LPS was truncated appropriately. The mutant strain was then used to produce antibodies to the conserved LPS structure and those antibodies tested for cross-reactivity amongst strains of the three target species.
Experimental
Bacterial Strains and Growth Conditions.
Mh strains A1 Sh1217 (S. Highlander, Baylor College of Medicine, Houston Tex.) and A1 strain O1A ADRI (Perry Fleming, IBS) were routinely cultured on BHI plates or BHI broth at 37° C. E. coli DH10B (Invitrogen, Carlsbad Calif.) was used for cloning and propagation of recombinant plasmids and was grown on LB medium supplemented with the appropriate antibiotics (ampicillin 100 μg/ml, chloramphenicol 25 μg/ml). When required M. haemolytica strains were cultured in BHI media supplemented with ampicillin (50 μg/ml) and chloramphenicol (5 μg/ml).
Construction of Recombinant Plasmids Containing Insertion into the losB Gene.
The losB gene was amplified by PCR from chromosomal DNA of strain O1A using flanking primers. The primers that were used were losB-kpn 5′ ATATGGTACCTATCAGCGGTAGAGATTC TAAC and losB-xba 5′ TGCTC TAGACCGAACCTGCACCAAAAAGATTTAACGC. These primers amplified a 2 Kb fragment, which was then cloned into pBluescript following Kpn/Xba restriction enzyme digestion and electroporated into E. coli DH10B. Inverse PCR using this plasmid as template was then performed with the following primers 5′CCGCTGCGAGAGATAAGTGGATACTTTATC-3′ and 5′GACATTGGGATCTTTATTTAGATTTCAAACCGAC-3′ that correspond to sequence within the losB structural gene and the product excised from an agarose gel and purified using a Qiagen gel extraction kit. The modified chloramphenicol acetyl transferase (Cat) cassette (plpCat) was amplified by PCR from pNFplpcat and the product was blunt end ligated to the PCR product above to produce pSK losB::cat. Restriction enzyme mapping and sequencing of the recombinant plasmid confirmed that the Cat cassette was inserted into the losB structural gene in the same orientation as the losB gene.
Selection of losB Strains.
Plasmid pSK losB::cat was introduced into Mh cells by electroporation. Briefly, following electroporation cells were transferred immediately to 1 ml of pre-warmed BHI broth and incubated at 37° C. for 1.5 h. Transformants were selected by plating onto BHI agar containing 5 mg/ml chloramphenicol. To confirm that the transformants no longer harboured pSK losB::cat plasmid colonies were replica plated onto BHI/Amp plates and ampicillin-sensitive colonies were examined by PCR. Insertional inactivation of the losB gene following double recombination was confirmed by PCR. Primers specific to sequences upstream and downstream of losB-Kpn and losB-Xba that had been used in the initial cloning experiments confirmed the insertion of the Cat cassette into the chromosomal copy of the losB gene.
Complementation of losB Mutant with losB Gene in Trans.
The wild type copy of the losB gene from pSK losB (see above) was excised by restriction enzyme digest using Xba and Kpn and cloned into the shuttle plasmid pNF2176 to create pNF2176AalosB. This plasmid was then electroporated into the Mh losB mutant and transformants selected on Amp/Cat.
Mutant LPS Characterisation
LPS was isolated from killed cells by standard techniques. Sugar analysis and partially methylated alditol acetates were prepared as described previously. Core OS and O-deacylated LPS (LPS-OH) were purified. Completely deacylated LPS was purified. Mass spectrometry and nuclear magnetic resonance spectroscopy were performed.
Antibody Production
5 female BALB/c mice were immunised intraperitoneally (ip) on days (D) 0, 14 and 35 with 108 cells of formalin killed, PBS washed Mh losB in 0.5 ml. A trial bleed was performed on D42 removing a small amount of blood from the facial vein of each mouse and the derived sera was examined by ELISA for cross-reactivity to Mh losB and Mh wt LPS. On D54 each mouse received the repeat ip immunisation and mouse # 2 also received an intra-venous (iv) injection of 4×107 cells in 0.2 ml. On D57 the spleen from this mouse was removed and fused to a myeloma cell line. Initial screening antigens for this fusion were purified LPS from Mh losB and Ah wt. Both mouse # 3 and # 5 were boosted on D90 with an ip immunisation of Mh losB whole cells (˜108). Mouse # 3 was boosted both ip and iv with Mh losB cells on D131 in preparation for spleen cell fusion on D134, and mouse # 5 was boosted with ip and iv injections of formalin killed whole cells from Pm strain VP161 on D152 and the spleen cells fused on D155. Initial screening antigens for mice # 3 and # 5 fusions were purified LPS from App serotype 5a and Pm strain VP161. Ascitic fluid of monoclonal antibodies was prepared.
LPS ELISA
Purified and well-characterized wild-type and mutant LPS were used in a solid-phase indirect ELISA to determine the binding specificities of the mAbs.
Whole-Cell ELISA
Phenol-killed cells were used.
Results
Identification of Candidate Glycosyltransferases.
The LPS from the 3 species of interest (Mh, App and Pm) elaborate the same inner core structure (Example 7, Table 1). In order to examine the potential of this conserved inner core structure as a useful vaccine candidate it is necessary to remove the outer core decoration beyond this region. To facilitate this, the approach taken was to identify and mutate the glycosyltransferase gene responsible for the first glycose addition of the outer core decoration. Mh was selected for mutagenesis studies as the amount of O-antigen present in this organism is low compared to App and therefore should not interfere with subsequent immunological studies. Genome sequencing is complete for Pm strain Pm70 [24] and is in progress for Pm (strain P-3480), App (serotypes 1 and 5b) and Mh (A1 strain). As illustrated in
Mutagenesis of losB in Mh
Plasmid pSK losB::cat cannot replicate in Mh and so functions as a suicide plasmid. Following electroporation (5 ug plasmid DNA) into Mh, 136 catR transformants were obtained of which 104 were ampS. Two of these were randomly selected for further studies. Both mutants were confirmed to have undergone a double crossover event by PCR using primers that bracketed the insertion site (data not shown). To ensure that the effect observed on LPS structure (see below) was due to inactivation of the losB gene we complemented the mutant strain with a wild type copy of losB gene in trans on the shuttle vector pNF2176.
Characterisation of the LPS from the losB Mutant
LPS was isolated by standard methods. Sugar analysis of the purified LPS revealed glucose (Glc), D-glycero-D-manno-heptose (DD-Hep), and L-glycero-D-manno-heptose (LD-Hep) in the approximate ratio of 2:1:3 respectively with trace amounts of N-acetyl-glucosamine (GlcNAc) also being observed. This sugar composition is consistent with the anticipated structure of the mutant LPS and moreover suggests that the losB gene mutated is, as predicted from homology data, the specific heptosyltransferase and not a gene involved in heptose biosynthesis as four other heptose residues remain in the mutant LPS. O-deacylated LPS (LPS-OH) was prepared by standard methods and analysed by CE-MS (Example 7, Table 2). A simple MS spectrum was observed (
Antibody Production
Sera from the five mice were examined for the ability to recognise Mh losB and Mh wt LPS following a prime and a boost immunisation (
There is currently no effective vaccine to combat the diseases caused by the veterinary pathogens Mh, Pm and App. Vaccine approaches to combat diseases caused by Mh are still mainly based on bacterins and live attenuated strains. More recent versions of live vaccines incorporate secreted or extracted Mh antigens such as neuraminidase, leukotoxin, sialoglycoprotease, outer membrane and uncharacterised proteins. Leukotoxin has traditionally been the main sub-unit vaccine candidate, although immunisation with a mutant strain expressing non-toxic leukotoxin was still partially virulent in a calf challenge model and leukotoxin in combination with capsular polysaccharide was unable to produce a protective immune response. In contrast, LPS has been shown to stabilise leukolytic activity and so a conjugate vaccine based on LPS and detoxified leukotoxin may offer promise.
Current vaccine approaches to combat diseases caused by App are based on live attenuated strains as they contain the highly labile Apx toxins, which induce neutralizing antibodies required for protection. These Apx toxins form the basis for the major sub-unit vaccine against App but only seem to induce partial clinical protection. Adhesins including the core OS of LPS have been proposed as improved vaccine candidates.
Current vaccines to prevent Pm disease in pigs consist of toxoids and somatic antigens such as capsules and outer membrane proteins. Pm was first shown by Pasteur to induce fowl cholera in chickens and current strategies for protection against this disease utilise an attenuated Pm strain. In general however, this strategy is severely limited as the immune response remains serotype-restricted and fails to provide cross-protection against other serotypes. The LPS of Pm has however been shown to play a partial role in the immunity to infection.
Considerable evidence has accumulated recently indicating that LPS from each of these organisms may be a good candidate for subunit vaccine design. LPS has been shown to be both visible and a major antigenic determinant on the surface of Mh and mAbs raised to A1 LPS facilitated phagocytosis but not complement mediated killing in vitro.
In Pm ribosome-LPS vaccines protected chickens against fowl cholera disease from homologous Pm strains. Additionally, immunisation with a LPS-protein complex provided 100% protection to mice when challenged with a homologous strain yet when separated the individual components of the complex afforded no protection. mAbs raised to LPS from Pm only afforded partial protection in a mouse model and although they were opsonophagocytic, were not bactericidal in the presence of complement. However in another study a mAb to Pm LPS completely protected mice against homologous challenge and was bactericidal. An anti-idiotype vaccine mimicking LPS from type A was protective in a mouse model when challenge was with homologous organisms.
In App, the LPS and more specifically the core region of the LPS has been implicated in the adhesive abilities of the bacterium. A conjugate vaccine of BSA linked to App serotype 1 LPS was protective against mice following homologous but not heterologous challenge, and conjugates of both smooth and rough App LPS from serotype 5 and 1 suggested that the carbohydrate portion of the cell wall of App plays a significant role in the porcine immune response.
As a consequence we undertook this study to produce a conserved truncated core LPS which is common to all three organisms. LPS has been shown to play a role in the immunity to each of these veterinary pathogens and if a conserved LPS antigen can be identified the protective response to homologous strains could possibly be extended to heterologous strains and indeed species. Coupling this with the structural analysis data suggesting that all these veterinary pathogens shared a common and conserved inner core OS structure it was decided to explore the potential of a LPS-based vaccine. A first step in this process is the construction of a mutant strain expressing exclusively the conserved inner core OS epitope as a terminally exposed structure.
This study has generated a mutant in the α-1,6-
Example 7,
For Pasteurella multocida the heptose residue, Hep IV, is of the L-□-D configuration and the glucose residue, □-Glc II, is absent in a minority of glycoforms.
Example 7,
Example 7,
Example 7,
*,˜mAbs 3-3 and 3-4, and mAbs 3-15 and 3-16 were subsequently shown to be from the same clones.
In order to prepare the glycoconjugate the LPS was derivatised as follows. Both LPS (145 mg) and 8K material (104.5 mg) from the Mh losB mutant strain that elaborates the target structure were de-acylated by dissolving in 4N KOH (˜10 mg/ml.) and stirring at 125° C. for 30 h. The solution was cooled to room temperature and neutralised with acetic anhydride, which served to re-N-acetylate the amino groups created by this procedure. Precipitated salt was removed by centrifugation (9 k, 15 min.) and the supernatant was applied to a Sephadex G-25 column and eluted with water as eluent. Carbohydrate-positive fractions were pooled and freeze-dried resulting in ˜20-25% yield of KOH'd LPS (25 mg 8K, 33.3 mg LPS). The resulting material was de-O-acetylated by treatment in 0.1M NaOH (10 mg/ml) at room temperature for 2 h and purified on a Sephadex G-25 column in water, and lyophilised, resulting in ˜20% yield (20 mg 8K, 30 mg LPS) of KOH'd LPS.
Quality control was performed by 1H-NMR spectroscopy and ES-MS analysis. MS analysis revealed some heterogeneity in the KOH-treated LPS material consistent with the variable loss of the terminal heptose and glucose residues (
De-phosphorylation
The resulting material derived from LPS or 8K material was combined and de-phosphorylated by dissolving (˜10 mg/ml.) in 0.1M NH4HCO3 buffer, pH 8.0 with recombinant alkaline phosphatase (Roche) (˜140 units/mg units alk.P/mg KOH'd LPS) and stirred at 37° C. for ˜4 h. The solution was heated to 100° C. for 5 min., cooled and centrifuged at 14K for 10 min. The supernatant was freeze-dried.
The resulting material was de-salted on a Sephadex G-25 column in water, and lyophilised, resulting in ˜20% yield (48 mg) of KOH'd alk. P'd LPS. Quality control was performed by 1H-NMR and CE-ES-MS analysis confirming de-phosphorylation of the KOH treated LPS.
Amination
The resulting aldehydro functional group was aminated by dissolving the dried carbohydrate 48 mg) in 600 ul of DMSO and adding 4800 ul of 2M NH4OAc in MeOH and 120 mg of NaCNBH3 dissolved in 1200 ul of MeOH at pH 8.3 at 50° C. for 72 h. The MeOH was evaporated under N2 and the product lyophilised and purified on a Sephadex G-25 column in water, and lyophilised, resulting in ˜10% 32 mg yield of KOH'd alk. P'd aminated LPS. Quality control was performed by 1H-NMR analysis confirming amination of the KOH treated LPS.
Attachment of Linker Molecule
A linker molecule (squarate) was attached to the resulting amino group by dissolving the dried carbohydrate (32 mg) in 4000 ul of H2O and adding 4000 ul of MeOH and 100 ul of squarate at pH 8.2 (adjust with triethylamine (4 ul)) for 2 h at room temperature, monitoring the pH every 15 min. The MeOH was evaporated under N2 and the product lyophilised and purified on a Sephadex G-25 column in water, and lyophilised, resulting in ˜12% yield (30 mg) of KOH'd alk. P'd aminated squarated LPS. Quality control was performed by 1H— and 13C—1H-NMR and CE-ES-MS analysis confirming attachment of the squarate linker. However MS analysis suggested that only ˜50% of the material carried the squarate linker.
Conjugation to Protein Carrier
˜20 mg of HSA was linked to a 25× molar excess of the squarate linked carbohydrate (30 mg) in 1 ml of 0.02M sodium borate buffer by stirring at room temperature for 24 h at pH 9.2, carbohydrate was added at initiation of the reaction and after ˜6 h. After 24 h an aliquot was removed and examined by MALDI-MS and SDS-PAGE with Western blotting with a carbohydrate specific monoclonal antibody G8 (
Immunisation
6 BALB/c mice, 6-8 weeks old were immunised with conjugate, 3 female BALB/c mice, 6-8 weeks old were immunised as controls with admixed carbohydrate and HSA. All vaccines were in sterile PBS solution and 10 μg carbohydrate per 0.1 ml sc injection in Ribi adjuvant was administered.
The mice were immunised according to the following schedule:—
Trial bleed at D23 and final bleed at D45 revealed that one mouse #V2 had given an IgG response to the carbohydrate antigen, as revealed by LPS ELISA against Mh losB LPS (
Polyclonal sera from mouse #1 D140, which recognises whole cells of Mh (
The bacterial growth was counted and the percentage killing relative to the control wells calculated.
As can be seen in the Tables below and in
Example 9,
SE = SD/√n where n = sample size
Example 9,
SE = SD/√n where n = sample size
The bactericidal activity exhibited by mAbs G3 and G8 and polyclonal sera illustrates that antibodies specific for a conserved inner core LPS epitope in Mh can recognise and are functionally active against live Mh whole cells.
The experiment was performed according to the method of Lopez et al. 1982. Can. J. Comp. Med. 46: 314-316 with methods and modifications as described below.
Mice and Reagents:
IgG from ascitic fluid of mAbs was purified on a protein A column and sterile filtered (
Experimental mAbs G3 and G8. G8, IgG2b, 3.8 mg/ml; G3, IgG2a, 4.7 mg/ml.
Control mAb: L2-16, IgG2b, 1.9 mg/ml.
Balb/c mice: 40 female, 6-8 weeks of age, CRL. 5 mice/group.
M. haemolytica A1: 7.5×107 cfu/mouse.
Experimental Plan and Groups:
iAll mice showed various degrees of clinical signs such as rough coat, dehydration and reluctance to move on DPI 2. However, Groups C and D mice were generally healthy and Groups F and G mice remained active although with a rough coat. On DPI 3, groups A and B mice were severely dehydrated and had loss of weight and Group G mice were also moderately sick.
iiAll mice showed various degrees of lung consolidation and no attempt has been made to quantify the area involved.
iiiThe major difference among the groups was that Groups A, B and E mice overall appeared to have more neutrophils in their lungs than the other groups of mice. However, all mice, regardless of treatments, showed some degrees of pneumonia.
iv++++: rough coat, moderate to severe loss of weight and dehydration, and reluctant to move; +++: rough coat, slight to moderate loss of weight and dehydration, but remain active; ++: rough coat and slight loss of weight; +: slightly rough coat.
v+++: moderate areas of consolidation, ++: small areas of consolidation.
vi+++: moderate degree of bronchopneumonia with the presence of medium to large numbers of neutrophils and marked infiltration of lymphoid cells in the perivascular and peribronchial areas. ++: mild to moderate degree of bronchopneumonia with the presence of small numbers of neutrophils and infiltration of lymphoid cells in the perivascular and peribronchial areas. +: mild degree of bronchopneumonia with the occasional presence of
viiThe number of mice showed clinical symptoms.
Based on this pilot experiment, it appears that the mAb treatment, particularly by in vitro pre-incubation with M. haemolytica, showed a moderate effect on the clinical symptoms and histopathology of the infected mice.
Biological Deposits
A deposit of Mannheimia haemolytica strain A1 losB was made on May 4, 2005 at IDAC. The deposit number is IDAC 040505-01.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2467329 | May 2004 | CA | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA05/00745 | 5/15/2005 | WO | 11/14/2006 |
| Number | Date | Country | |
|---|---|---|---|
| 60571489 | May 2004 | US |
