Patent Application
20240294674
The present invention relates to the field of biotechnology drugs, and specifically relates to a construction method for and an application of a nucleic acid multimerization-mediated multivalent protein drug and vaccine.
For many biological macromolecules, their aggregation or multivalent state directly affects their activities and half-lives in vivo. For example, the activation of most immune receptors involves the aggregation of receptors on the cell membrane, thereby activating downstream signaling pathways within the cell.
Therefore, the ability of natural ligands or antibodies of these receptors to activate receptors can often be significantly improved when they form multivalent or high-valent forms. In addition, some protein drugs with lower molecular weights (MW 40 kDa), such as cytokines, growth hormones, synthetic peptides, etc., have high renal clearance efficiencies and short half-lives in vivo; the molecular weights and half-lives of these protein drugs can also be increased by forming high-valent forms.
Therefore, multivalent formation of proteins is a highly concerned process in the field of biomedicine, and there are many existing methods. However, most chemical crosslinking methods have poor connection specificity and uneven connection of multimers. The most widely used method currently is to express and produce proteins in the form of multivalent fusion proteins by cells, which involves fusing drug functional protein regions with proteins that can form oligomers to form chimeras, such as Fc divalent fusion proteins and GCN4 trivalent fusion proteins, etc. These fusion proteins can form even oligomers, but the cellular expression and activity of fusion proteins are often worse than those of original protein drugs, and the presence of Fc regions brings about the activation of the immune system, induction of cytokine release, and risk of cytotoxicity. Therefore, there is an urgent need to develop a simple, flexible, and efficient method in this field that can form even and highly specific multivalent proteins from validated protein drugs in a non-fusion protein manner.
In addition, multivalent formation of proteins is also of great significance for vaccine development. Firstly, in the design of B cell-based vaccines, activating B cell receptors (BCRs) using viral or bacterial proteins as antigens is a crucial step. Like the immune receptors mentioned above, the effective activation of BCR requires the aggregation of receptors on the cell membrane, so high-valent antigens have an absolute advantage over monomeric antigens in activating B cells. Secondly, high-valent antigens may not necessarily form oligomers from a single antigen; high-valent antigens can contain different proteins in a certain virus or mutations and subtypes of the same protein in different virus strains; in this way, diversified antigen presentation can theoretically induce polyclonal response of B cells in the host immune system, producing a wider range of neutralizing antibodies.
One purpose of the present invention is to provide an efficient and stable assembly backbone design for n-order nucleic acid oligomers, suitable for the efficient and stable assembly of nucleic acid coupled protein drugs to form multivalent drugs or vaccines.
The second purpose of the present invention is to provide a simple and efficient method for forming multivalent macromolecules from protein drugs for extending the half-life of drugs and increasing drug activity.
The third purpose of the present invention is to provide a simple, flexible, efficient, and modular method for forming multivalent macromolecular complexes of the same or different protein antigens for activating immune cells and improving the immunogenicity of vaccines.
In the first aspect of the present invention, it provides a multimeric complex based on a complementary nucleic acid backbone, wherein the complex is a multimer formed by complexing n monomers having the complementary nucleic acid backbone, wherein each monomer is a polypeptide having a nucleic acid single strand, and n is a positive integer of 3-6; in the multimer, the nucleic acid single strand of each monomer and the nucleic acid single strands of the other two monomers form complementary double strands by means of base complementation, so as to form complementary nucleic acid backbone structures.
In another preferred embodiment, n is 3, 4, 5, or 6.
In another preferred embodiment, the complex is a trimer, tetramer, or pentamer, preferably with a structure as shown in
In another preferred embodiment, the monomer has a structure of formula I:
Z1-W (I)
In another preferred embodiment, “-” is a covalent bond.
In another preferred embodiment, the nucleic acid sequence is selected from the group consisting of: left-handed nucleic acid, peptide nucleic acid, locked nucleic acid, thio-modified nucleic acid, 2′-fluoro modified nucleic acid, 5-hydroxymethylcytosine nucleic acid, phosphorodiamidate morpholino nucleic acid, and combinations thereof;
In another preferred embodiment, in the multimer, the Z1 of each monomer is the same or different.
In another preferred embodiment, in the multimer, the W of each monomer is different.
In another preferred embodiment, the monomer has a structure of formula II:
D-[L-W]m (II)
In another preferred embodiment, m is 1.
In another preferred embodiment, the monomer has a structure of formula III:
A-[L-W]m (III)
In another preferred embodiment, m is 1.
In another preferred embodiment, the nucleic acid sequence W has the structure shown in formula 1:
X1-R1-X2-R2-X3 (1)
In another preferred embodiment, each of R1 and R2 is independently 10-20 bases, preferably 14-16 bases in length.
In another preferred embodiment, X1 is 0-5 bases in length.
In another preferred embodiment, X3 is 0-5 bases in length.
In another preferred embodiment, X2 is 0-3 bases in length.
In another preferred embodiment, the sequence of X2 is selected from the group consisting of: A, AA, AGA and AAA.
In another preferred embodiment, the R1 of each monomer forms a complementary base pairing structure with the R2 of the left neighbor (or left side) monomer; while the R2 forms a complementary base pairing structure with the R1 of the right neighbor (or right side) monomer.
In another preferred embodiment, the monomer sequence is any sequence or a sequence set thereof selected from the nucleic acid single strand sequences as shown in SEQ ID Nos: 1-60 (see Table 9-1) that form a trimer complex based on the complementary nucleic acid backbone.
In another preferred embodiment, the monomer sequence is any sequence or a sequence set thereof selected from the nucleic acid single strand sequences as shown in SEQ ID Nos: 61-140 (see Table 9-2) that form a tetramer complex based on the complementary nucleic acid backbone.
In another preferred embodiment, the monomer sequence is any sequence or a sequence set thereof selected from the nucleic acid single strand sequences as shown in SEQ ID Nos: 141-240 (see Table 9-3) that forms a pentamer complex based on the complementary nucleic acid backbone.
In another preferred embodiment, the monomer sequence is a phosphorodiamidate morpholino nucleic acid.
In another preferred embodiment, the monomer sequence is any sequence or a sequence set thereof selected from the nucleic acid single strand sequences as shown in SEQ ID Nos: 275-278 that forms a tetramer complex based on the complementary nucleic acid backbone.
In the second aspect of the present invention, it provides a pharmaceutical composition comprising:
In another preferred embodiment, the pharmaceutical composition comprises a vaccine composition.
In another preferred embodiment, the pharmaceutical composition comprises a therapeutic and/or prophylatic pharmaceutical composition.
In another preferred embodiment, the multimeric complex comprises a trimer complex, a tetramer complex, and a pentamer complex.
In the third aspect of the present invention, it provides a nucleic acid sequence library, which comprises a nucleic acid sequence for forming the multimeric complex based on the complementary nucleic acid backbone according to the first aspect.
In another preferred embodiment, the nucleic acid sequence comprises:
In another preferred embodiment, the nucleic acid sequence W has the structure shown in formula 1:
X1-R1-X2-R2-X3 (1)
In the fourth aspect of the present invention, it provides use of the nucleic acid sequence library according to the third aspect in the manufacture of the multimeric complex according to the first aspect or a pharmaceutical composition comprising the multimeric complex.
In the fifth aspect of the present invention, it provides a method of determining a nucleic acid single strand sequence for forming a multimeric complex based on a complementary nucleic acid backbone, comprising steps of:
{circle around (9)} optionally, for n=4, using a symmetric sequence to initialize a sequence set S={S1, S2, . . . , Sn} according to the above parameters;
In another preferred embodiment, in step (a) setting annealing algorithm parameters, it comprises:
In another preferred embodiment, each nucleic acid single strand sequence W has the structure shown in formula 1:
X1-R1-X2-R2-X3 (1)
In another preferred embodiment, in the step (d), the optimized set is a set that satisfies following conditions:
In another preferred embodiment, in the step (d), the optimized set also satisfies following conditions:
In another preferred embodiment, in the step (c), the free energy (ΔG°S) of the DNA oligomer (i.e., the complementary nucleic acid backbone structure) is calculated using the nearest neighbor method.
In another preferred embodiment, in the step (c), the DNA oligomer (i.e., the complementary nucleic acid backbone structure) is decomposed into 10 different nearest neighbor pairing interactions, which are: AA/TT; AT/TA; TA/AT; CA/GT; GT/CA; CT/GA; GA/CT; CG/GC; GC/CG; and GG/CC; and the corresponding ΔG° value is calculated and obtained respectively based on the enthalpy (ΔH°) and entropy (ΔS°) of these pairing interactions; then, the free energies of the pairing interactions included in the complementary nucleic acid backbone structure are merged (or summed) to obtain the free energy of the complementary nucleic acid backbone structure.
In another preferred embodiment, the method comprises repeating the steps (b), (c), and (d) for multiple times (i.e., performing n1 iterations) to obtain the global optimal solution during the iteration process.
In another preferred embodiment, during the iteration process, a poor solution is limitedly accepted according to the Metropolis criterion, and the probability of accepting the poor solution is gradually approaching zero, so as to find the global optimal solution at all possible when the algorithm terminates.
In another preferred embodiment, the following optimized objective function is used for the iteration of the simulated annealing algorithm to optimize the free energy of the non-target pairing region:
In the sixth aspect of the present invention, it provides a nucleic acid single strand sequence set for forming a multimeric complex based on a complementary nucleic acid backbone, which is determined using the method of the fifth aspect.
In another preferred embodiment, the set is selected from the group consisting of:
ACACCTGGTTGTTGGATAAATCGTTGAAG
ATCCTAGCCTTCAACGAAAAAACTAGAGT
ATCGGCGGACTCTAGTTAAAATCCAACAA
ATGCGTTGAGTTCCAGTAAAGGCAACATC
AATGTGGTGATGTTGCCAAATCTGAATCC
AAGCACGAGGATTCAGAAAAACTGGAAC
ATTCCAATCGTCCTGTGAAAAGTTCCGCT
AAACTCAGAGCGGAACTAAACTGGCAGA
ATTCATCCATCTGCCAGAAACACAGGACG
ACGAGGCAAGTTCTGTGAAAATGACTACC
ACGGACCTGGTAGTCATAAAATCCACTGA
ATTCAGCGTCAGTGGATAAACACAGAACT
ATAGTTCGTTGCTCGGAAAAGGCATTGAG
AAGGTCCTCTCAATGCCAAAATGGTGATG
ACAAGCGACATCACCATAAATCCGAGCAA
AGTCGTGTGCTTCCAAGAAATAGCCAGGT
AAGTCCTCACCTGGCTAAAAAACAGCGGA
AATGACACTCCGCTGTTAAACTTGGAAGC
AACGCATCGCTTGATAGAAAAGAGGAGC
AATAACCGTGCTCCTCTAAAGTAGGCAAT
AATGGTGGATTGCCTACAAACTATCAAGC
AGTCGTTCCACCGAACAAAATGGCTCTGG
ATCAATGACCAGAGCCAAAAAATCGCAC
ACCTGAGATGTGCGATTAAATGTTCGGTG
AGCGGAGTGACCATAGTAAAAGGCAGGA
AGAACAATGTCCTGCCTAAAGTGCTCGTC
ATCTTCACGACGAGCACAAAACTATGGTC
AATTGGACCGCTCTACTAAAATGGCACCA
ATTGACTGTGGTGCCATAAACAGGCTATC
AGGATGCTGATAGCCTGAAAAGTAGAGC
ACCATTGAGCCAGTGATAAAAACCGTTGT
AGCAACTCACAACGGTTAAATCGCACACC
ATACGACAGGTGTGCGAAAAATCACTGGC
AAGTGAAGAAGCAGCCTAAAGTTGTCATC
AGGTGTGCGATGACAACAAAATGTCGTAA
ATCCACGGTTACGACATAAAAGGCTGCTT
AATAGCGTCTTGAGCCTAAATGGAGGACA
AGTCGGTATGTCCTCCAAAAGGTCACAGT
AAGCAGCAACTGTGACCAAAAGGCTCAA
ATGCCGTGTTCAGATTCAAATGTGCGTCT
ATCAATCCAGACGCACAAAAAGACAGGT
AATCGGACCACCTGTCTAAAGAATCTGAA
ATTCAGGACAGCGTCATAAAACCGACTGG
AAGTTGCTCCAGTCGGTAAAGATGCCTTC
ACTCACACGAAGGCATCAAAATGACGCTG
AGCAGCCAAGGTTATCTAAACAATGACAC
AATCCTCCGTGTCATTGAAAGTGATTCGC
AGTCTGGTGCGAATCACAAAAGATAACCT
ACCACCGTGTATGACCTAAAAGTGACAGC
AGCGATGTGCTGTCACTAAAACAGGCTCT
ATCCTCGTAGAGCCTGTAAAAGGTCATAC
AACTACGGAGCGAAGATAAATCCTGACCA
AAGCAAGTTGGTCAGGAAAAGACTGGCT
ATCGTGTTCAGCCAGTCAAAATCTTCGCT
AGTTCCTGATCCAGCCTAAACATCCTTGTC
ATGGCAAGACAAGGATGAAACACGACCG
ACTTCTAAGCGGTCGTGAAAAGGCTGGAT
ATATCGCACTCCAGCATAAACCGTGTGAA
ACCTGATGTTCACACGGAAAAGCCTACGA
ACCAAGTCTCGTAGGCTAAAATGCTGGAG
AAGCGTCGTGAATCCAAATGAGCCTGC
ACATTGGCAGGCTCAAAACCGAAGTCA
AAGCGTTGACTTCGGAAAACTATGGAC
ATCGCCGTCCATAGTAAAGGATTCACG
AATGGCGAGCAATCCAAATGAGCCTGG
ATTGGTCCAGGCTCAAAACCGAACGCT
AATCACAGCGTTCGGAAAACTATCGTG
ATGCCGCACGATAGTAAAGGATTGCTC
ATGACCACGCAATCCAAATGAGCCAAC
ATGGAGGTTGGCTCAAAACCGAACAGC
AAAGCTGCTGTTCGGAAAACTATCTGC
AAGGCGGCAGATAGTAAAGGATTGCGT
ATGTCGCACCAATCCAAATGAGCAAGC
AACGAGGCTTGCTCAAAACCGAACGCT
AATGACAGCGTTCGGAAAACTATGTGG
ATGCCGCCACATAGTAAAGGATTGGTG
ATGCTGGCACAATCCAAATGAGCGACG
AAACCTCGTCGCTCAAAACCGAAGTGC
AAACTGGCACTTCGGAAAACTATGAGG
AAGCCGCCTCATAGTAAAGGATTGTGC
ATGTCGCACCAATCCAAATGAGCAGGT
ATGCCAACCTGCTCAAAACCGAACGCT
ATTGACAGCGTTCGGAAAACTATCAGC
AAGGCGGCTGATAGTAAAGGATTGGTG
ATGTGGTCGCAATCCAAATGAGCACCT
ATTGGCAGGTGCTCAAAACCGAACGTG
AATCGTCACGTTCGGAAAACTATCAAC
AGCGGCGTTGATAGTAAAGGATTGCGA
AAGCGTCGTCAATCCAAATGAGCACGG
ACATTGCCGTGCTCAAAACCGAAGTGA
AAGCGTTCACTTCGGAAAACTATGGCT
AAGGCGAGCCATAGTAAAGGATTGACG
ATGTGGCGACAATCCAAATGAGCAAGC
ATGGAGGCTTGCTCAAAACCGAAGACG
AAACAGCGTCTTCGGAAAACTATCGTG
ATGCCGCACGATAGTAAAGGATTGTCG
ATGCTGCCACAATCCAAATGAGCCTGG
ATGGTTCCAGGCTCAAAACCGAACGCA
AATGACTGCGTTCGGAAAACTATCGCC
AAGAGCGGCGATAGTAAAGGATTGTGG
ATGCGTCGTCAATCCAAATGAGCTTGG
ACCTTGCCAAGCTCAAAACCGAACGTG
AAACAGCACGTTCGGAAAACTATGGAG
AAGCCGCTCCATAGTAAAGGATTGACG
AACTGCCAGCAATCCAAATGAGCCTCG
ATGGAACGAGGCTCAAAACCGAAGTTG
AACTGCCAACTTCGGAAAACTATCGCC
ACAAGCGGCGATAGTAAAGGATTGCTG
ATGCGTCGTCAATCCAAATGAGCCTCC
AAACCTGGAGGCTCAAAACCGAATGAC
AAGCGTGTCATTCGGAAAACTATGGCG
AACTGCCGCCATAGTAAAGGATTGACG
AAGCGTCGTGAATCCAAATGAGCCATC
ATGGACGATGGCTCAAAACCGAATGTG
AACCAGCACATTCGGAAAACTATGCGG
AGGTTGCCGCATAGTAAAGGATTCACG
ATTGCCAGGATGCTGAATCACGGTCGG
ATGTCCGACCGTGATAGTCGCAGAAGG
AATGCCTTCTGCGACATAGTACAACGC
AGCGGCGTTGTACTAACAGCATCCTGG
AGGCGATCACAATCCAAATGAGCGTGT
ACCGTAACACGCTCAAAACCGAAGTGC
AAATTGGCACTTCGGAAAACTATGCGG
AAGCAGCCGCATAGTAAAGGATTGTGA
ATGGTCCAACACGCTAAGCCTCACCGT
AAAGACGGTGAGGCTATCGCACAACCT
AACCAGGTTGTGCGAATCGGAGTGGCA
ATTCTGCCACTCCGAAAGCGTGTTGGAC
AACCTTGGTGTGCGAAACTCCTGGCAG
ATTGCTGCCAGGAGTAAGCGTGTGGTT
ATGGAACCACACGCTATGAGGACCGTC
AAACGACGGTCCTCAATCGCACACCAA
ATGCCAAGTCCGAGAATGCTGCGAACT
AACCAGTTCGCAGCAAAGAGCCTGAAC
AACGGTTCAGGCTCTAACGACGCTTGA
ATGGTCAAGCGTCGTATCTCGGACTTGG
AAGCAGCCTCGTTGAATCGCCAAGACA
AAGGTGTCTTGGCGAAAGTTGCTCCGA
ATCGTCGGAGCAACTAAGCGGTTCTGT
ATCCACAGAACCGCTATCAACGAGGCT
ATCAGGCGACCTCTTAAAACCACCATCGT
AGCAACGATGGTGGTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAA
AGGCGACGATGTCTTAAAACCTGGTTGCT
ATCCAGCAACCAGGTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAA
ATGGAACCTGGTGCTAAATGCTCGCCTGT
ATTGACAGGCGAGCAAAAAATCCAAATG
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAG
ATGGTCAGGCGACTTAAAAGGACGAGGTT
AAGCAACCTCGTCCTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAA
ATGCTGGACCACCTTAAATCAGATGGAGG
ATCGCCTCCATCTGAAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAA
AAACGTCCAGGAGCTAAATCTCGTCGCCT
ATTCAGGCGACGAGAAAAAATCCAAATG
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAG
ACCACGACCATTGCTAAAAACTTCAGGCG
ACGTCGCCTGAAGTTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAG
AAGGCGAGGTCTTCAAAATGGTTGCTGGA
ATCGTCCAGCAACCAAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAATGA
ATCAAGGCGACCAGTAAAAAGCTCCTCGA
ATCGTCGAGGAGCTTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAACT
ATTCAGGCGACTCCTAAAAGCACGACGAT
AACCATCGTCGTGCTAAAAATCCAAATGA
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCT
AAGCAGCCGCATAGTAAAGGATTAAAAG
AAGCACCTGCAATCCAAATCGCCAGGACA
AACTTGTCCTGGCGAAAATGAGCAACCAT
AGGCATGGTTGCTCAAAACCGAACGTCGT
AATCACGACGTTCGGAAAACTATGGAGCG
AAGCCGCTCCATAGTAAAGGATTGCAGGT
AACCTGCTGCAATCCAAATCGCCACCTCA
ATCTTGAGGTGGCGAAAATGAGCCTGGAC
AAACGTCCAGGCTCAAAACCGAACTGGTG
AAAGCACCAGTTCGGAAAACTATGCCGCT
AAGGAGCGGCATAGTAAAGGATTGCAGC
AAGCTGGTGCAATCCAAATCGCCTCCTGA
ATTGTCAGGAGGCGAAAATGAGCAAGGTT
AGCCAACCTTGCTCAAAACCGAACGCAGA
AACATCTGCGTTCGGAAAACTATGGAGCG
ATGCCGCTCCATAGTAAAGGATTGCACCA
ATGCACGCACAATCCAAATCGCCATCAGA
AACCTCTGATGGCGAAAATGAGCTGCCTC
AATGGAGGCAGCTCAAAACCGAACGTCGT
AATGACGACGTTCGGAAAACTATCGAGCG
AAGCCGCTCGATAGTAAAGGATTGTGCGT
AAGCGTCGTGAATCCAAATCGCCATCAGA
ATGGTCTGATGGCGAAAATGAGCAAGGCT
AACGAGCCTTGCTCAAAACCGAACCAGCT
AACAAGCTGGTTCGGAAAACTATGCGGCA
AACCTGCCGCATAGTAAAGGATTCACGAC
ATCAGCACGCAATCCAAATCGCCAGTTCA
AGGTTGAACTGGCGAAAATGAGCAAGCA
AAGCCTGCTTGCTCAAAACCGAACGTGGT
AAACACCACGTTCGGAAAACTATGGAGCG
ATGCCGCTCCATAGTAAAGGATTGCGTGC
AAGCTGCACCAATCCAAATCGCCAGAAGG
ATGACCTTCTGGCGAAAATGAGCACGACG
AATGCGTCGTGCTCAAAACCGAACAACCT
AAGCAGGTTGTTCGGAAAACTATGGAGCG
ATGCCGCTCCATAGTAAAGGATTGGTGCA
AACGCTCGTCAATCCAAATCGCCTCAGGA
ATTGTCCTGAGGCGAAAATGAGCCAACGA
AAGGTCGTTGGCTCAAAACCGAAGCTGGT
AAACACCAGCTTCGGAAAACTATGCCGCA
AAGGTGCGGCATAGTAAAGGATTGACGA
AAGTGCGTCGAATCCAAATCGCCAAGACC
ATGAGGTCTTGGCGAAAATGAGCAGGCTG
ATTCCAGCCTGCTCAAAACCGAAGCAACG
AACACGTTGCTTCGGAAAACTATGCCGCT
AAGGAGCGGCATAGTAAAGGATTCGACG
ATCACGCAGCAATCCAAATCGCCATCACA
ACGTTGTGATGGCGAAAATGAGCACGAGC
AAAGGCTCGTGCTCAAAACCGAAGGTTGC
AAGTGCAACCTTCGGAAAACTATGCCGCT
ATGGAGCGGCATAGTAAAGGATTGCTGCG
In the seventh aspect of the present invention, it provides a device for determining the nucleic acid single strand sequence for forming the multimeric complex based on the complementary nucleic acid backbone, which comprises:
In another preferred embodiment, the optimized constraint parameters further comprises: for a tetramer (n=4), using a symmetric sequence to initialize a sequence set S={S1, S2, . . . , Sn} according to the above parameters;
It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a new or preferred technical solution, which are not redundantly repeated one by one due to space limitation.
After extensive and intensive research, the inventors have developed a multivalent protein drug and its library, as well as a preparation method and application thereof for the first time. By using the drug library and preparation method of the present invention, short-acting protein drugs can be quickly, efficiently formed into multivalent complexes at low-cost, and with high yield, to increase the drug half-life, or form high valent antigens with monomer antigens to enhance their immunogenicity according to needs. On this basis, the inventors have completed the present invention.
Specifically, the present invention provides a multivalent protein drug, comprising n protein drug units, wherein each drug unit comprises a drug element moiety of the same kind and different nucleic acid element moieties connected to the drug element moiety; n is a positive integer≥2; n of different nucleic acid element moieties form n-multimers through nucleic acid base complementation, thereby forming the multivalent protein drug; a stable pairing structure with nucleic acid base complementation (rather than complex peptide bonds or other chemical modifications, etc.) of the multivalent protein drug of the present invention can be formed through rapid assembly (such as 1 minute). Experiments have shown that the molecular weight of the drug of the present invention can be increased through high-valent formation, thereby extending its half-life in animals.
In addition, based on the same implementation method, the drug element can also be an antigen used for vaccine development; the difference is that each antigen unit comprises the same or different antigen element moiety, as well as different nucleic acid element moieties connected to the antigen element moiety; n of different nucleic acid element moieties can form a n-multimer through nucleic acid base complementation, thereby forming the multivalent antigen.
Finally, the present invention provides a highly optimized nucleic acid sequence library, including nucleic acid sequence groups that can be efficiently and accurately assembled into 2-5 aggregates, for rapid and accurate self-assembly of the aforementioned drugs or antigen units into multivalent macromolecular complexes.
Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by common technicians in the art to which the present invention belongs. As used herein, when referring to specific listed values, the term “about” means that the values can vary by no more than 1% from the listed values. For example, as used herein, the expression of “about 100” includes all values between 99 and 101 (such as 99.1, 99.2, 99.3, 99.4, etc.).
In the present invention, the drug element moiety comprises protein drugs and polypeptide drugs.
Typically, the protein drugs include but are not limited to cytokines, hormones (such as insulin, growth hormone, etc.), antibody drugs, and polypeptides.
In a preferred embodiment of the present invention, the protein drug is G-CSF for treating leukopenia.
The present invention provides an antigen library, which comprises N of antigen units;
In the present invention, the antigen element moiety is partially selected from M of different antigen proteins in the library, M≤N; M of different antigen proteins contain different proteins in a certain virus or mutants of the same protein from different virus strains;
In a preferred embodiment of the present invention, the protein antigen is derived from novel coronavirus SARS-COV-2; specifically, it is a high-valent antigen formed by the receptor binding domain (RBD) of the viral spike protein.
Left-handed nucleic acid refers to the mirror image of the natural right-handed nucleic acid (D-nucleic acid), which can be divided into left-handed DNA (L-DNA) and left-handed RNA (L-RNA). Left-handed (chiral center) mainly exists in the deoxyribose or ribose portion of nucleic acids, exhibiting mirror flipping. Therefore, Left-handed nucleic acid cannot be degraded by ubiquitous nuclease (such as exonuclease and endonuclease) in plasma.
According to the present invention, an L-nucleic acid strand framework is formed by base complementation of two or more L-nucleic acid single strands. The 5′ end or 3′ end of each L-nucleic acid single strand is activated into groups (such as NH2, etc.) that can be subsequently modified, and then one end of the linker (such as SMCC, SBAP, etc.) is coupled with the activate group on the L-nucleic acid single strand. L-nucleic acids with the linkers can be assembled into the desired L-nucleic acid strand framework. In another preferred embodiment, the activated functional groups at the 5′ or 3′ end of the L-nucleic acid single strand (such as aldehide, maleimide, etc.) are already included in nucleic acid synthesis. After confirming that the L-nucleic acid with the linker can successfully self-assemble into a framework, the L-nucleic acid single strand with the linker can be separately coupled with antibodies for subsequent assembly. The L-nucleic acid framework of the present invention can be prepared by the following steps.
The required multivalent number n (such as a trimer, tetramer) is determined; the required number n of L-nucleic acid single strands based on the multivalent number n is determined; a corresponding number of L-nucleic acid single strand sequences is designed, and the stability of the target nucleic acid framework is regulated by optimizing base pairing, and the possibility of non-specific pairing between nucleic acid strands is reduced. The details of nucleic acid sequence design are specifically described in the summary of the invention and embodiments.
The activation of L-nucleic acid involves modification of its active group at the 5′ end (X1) or 3′ end (X3) and subsequent conjugation with the linkers. The modification of active groups can be customized by nucleic acid synthesis companies; The linkers generally have a bifunctional group, that is, one end can be coupled with an active nucleic acid group, and the other end can be connected to specific sites on the protein (such as NH3, SH).
According to a preferred embodiment of the present invention, all L-nucleic acids that make up the framework are modified with aldehydes at the 5′ end, thereby completing the activation of L-nucleic acids and subsequently coupling to the N-terminal a-amine of the protein.
First, the 5′ or 3′ end of L-nucleic acids is modified with aldehydes, and then, the aldehyde groups of L-nucleic acids are specifically connected to the N-terminal NH3 of the protein through a reductive amination reaction under low pH (5-6) conditions.
The present invention also provides a method and device of determining a nucleic acid single strand sequence for forming a multimeric complex based on a complementary nucleic acid backbone. Preferably, the method comprises a preferred algorithm of the present invention.
Typically, the nucleic acid sequence library optimized by computer algorithms of the present invention can include: (a) a nucleic acid sequence that can self-assemble into a trimer through base complementation; (b) a nucleic acid sequence that can self-assemble into a tetramer through base complementation; and (c) a nucleic acid sequence that can self-assemble into a pentamer through base complementation.
The complexes formed by representative nucleic acid sequences are trimer molecules, tetramer molecules, and pentamer molecules as shown in
Preferably, the nucleic acid sequence W of the present invention has the structure shown in formula 1:
In the present invention, the self-pairing of any region of the nucleic acid sequence belongs to non-target pairing, which needs to be avoided in design.
Preferably, the nucleic acid sequence of the present invention can be designed or optimized using a computer algorithm of Simulated Annealing (SA).
The computer algorithm minimizes the free energy (ΔG°) of the DNA double strand structure formed by target pairing, while maximizing the ΔG° of non-target pairing;
Using the thermodynamic values in Table 1, the enthalpy ΔH° and free energy ΔG° values of DNA oligomers can be effectively predicted by the nearest neighbor method. Taking the complementary pairing of GGAATTCC/CCTTAAGG as an example, using the nearest neighbor method, it is calculated to be ΔG°=−14.63 kcal/mol. The annealing algorithm not only optimizes the ΔG°NS values, but also implements constraints on the dissociation temperature of nucleic acid sequence pairing (Tm) to ensure Tm>50° C. (when L=14 bases) of R1 and R2 regions. The nearest neighbor model is based on thermodynamic calculations and accurately predicts the stability of DNA double strands. The prediction of a given base sequence is provided by the model based on the nearest neighbor base pairs. The calculation of the unwinding temperature involves enthalpy (ΔH°) and entropy (ΔS°), and the calculation method is as follows:
Simulated annealing is a universal probability algorithm, and it is a method for approximate optimal solution of the problem, which is designed according to Monte Carlo's ideas, aiming to find the approximate optimal solution in a large searching space within a certain period of time. The idea of simulated annealing algorithm originates from the annealing process of solid materials in physics: first, the solid is fully heated, and then slowly cooled. When heated, the internal energy of free motion of particles inside the solid increases. Later, as the temperature gradually decreases, the particles tend to become orderly and reach equilibrium at each temperature. If the temperature drops slowly enough near the condensation point, the ground state can be reached, and the internal energy is minimized. According to the Metropolis criterion, the probability of a particle reaching equilibrium at temperature T is exp(−ΔE/(KT)), wherein the E is the internal energy at temperature T, the ΔE is its variation, and the K is the Boltzmann constant. For the combinatorial optimization problem, there is a similar process. The solid micro state i is simulated as a solution X, the objective function is equivalent to the internal energy Ei of state i, and the solid temperature is simulated with the control parameter T. The iteration process of “generating a new solution→calculating the objective function difference→judging whether to accept→accepting/discarding” for each value of T is repeated, and the T value is gradually attenuated. During the iteration process, a poor solution is limitedly accepted according to the Metropolis criterion, and the probability of accepting the poor solution is gradually approaching zero, so as to find the global optimal solution at all possible when the algorithm terminates.
In the present invention, the free energy of the non-target pairing region between the single strands of a multimeric nucleic acid is simulated as internal energy. While ensuring the free energy and dissociation temperature of the target pairing region between the nucleic acid single strands, the free energy of the non-target pairing region is optimized through iteration of a simulated annealing algorithm. Finally, the optimized single strand is more conducive to the assembly of the multimer. The optimized objective function used herein is as follows:
wherein, the larger the negative value, the more beneficial it is to reduce the non-target pairing. Therefore, an objective function is constructed based on the idea of minimizing energy using a degradation algorithm, and a minus sign is added before ΔG°(Si, Sj), converting it into a positive number. At this point, the smaller the value of Σi=1nΣj=i−ΔG°(Si, Sj), the more beneficial it is to reduce non-target pairing.
The flowchart of a representative algorithm of the present invention is shown in
In the present invention, the simulated annealing algorithm introduces random factors, and in each iteration update process, it will accept a solution that is worse than the current one with a certain probability, so it is possible to jump out of the local optimal solution and reach the global optimal solution.
The present invention also provides a multivalent macromolecular complex with improved drug half-life and activity, which is formed by using the nucleic acid multimer to mediate protein drugs, wherein the nucleic acid multimer is designed using the above algorithm.
Preferably, the nucleic acid sequence is a nucleic acid sequence set which can be specifically assembled into n-multimers in a nucleic acid sequence library;
Typically, each nucleic acid strand of the nucleic acid sequence set is connected to the protein drug, forming a protein drug-nucleic acid strand unit, with the structure shown in formula 2:
D-[L-Wi], i=1 to n (2)
In another preferred embodiment, the drug element moiety is selected from the group consisting of: protein drugs and polypeptide drugs that need to increase their molecular weights, thereby increasing their half-lives, and protein drugs and peptide drugs that need multivalent formation to increase their activities;
In another preferred embodiment, the L has aldehyde, NHS ester, or similar functional groups near the D-end, for connecting the N-terminal α-amine or lysine ε-amine on D;
In another preferred embodiment, the L has a maleimide functional group or haloacetyl (such as bromoacetyl, iodoacetyl, etc.) functional group near the D end, for connecting the free thiol (—SH) functional group on D;
In another preferred embodiment, the D is selected from the group consisting of: natural proteins, recombinant proteins, chemically modified proteins, and synthesized polypeptides;
In another preferred embodiment, the D can have a site-directed modification or site-directed addition of non-natural amino acids for connecting the L-Wi of formula 1;
The present invention also provides a multivalent macromolecular complex which enhances the effectiveness of vaccines in inducing neutralizing antibody production in vivo, and it is formed by using the nucleic acid multimer to mediate one or more antigens, wherein the nucleic acid multimer is designed using the above algorithm;
The present invention will be further illustrated below with reference to the specific examples. It should be understood that these examples are only to illustrate the invention, not to limit the scope of the invention. The experimental methods with no specific conditions described in the following examples are generally performed under the conventional conditions (e.g., the conditions described by Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's instructions. Unless indicated otherwise, percentages and portions are weight percentages and weight portions.
Three nucleic acids that can be paired according to the shape shown in
Sequence initialization: pairing sequences R={R1, R3, R5} are initialized based on parameters, and R6, R2 and R4 are obtained according to base complementation. After splicing the six sequences as shown in
Generation of new solution: new solutions S′ are obtained by updating the sequence set S. First, ∥−αG°(Si, Sj)∥∞ is calculated to identify the two sequences Si and Sj of non-specific pairings that have the greatest impact on the target pairing in the set S. Then, Si or Sj in non-target pairing regions is randomly selected for update according to the ΔG°NS(Si, Sj), thereby obtaining a new nucleic acid sequence. The dissociation temperature of the pairing regions (Tm) of this nucleic acid sequence is tested to see if it is greater than 54° C., and the free energy of the pairing regions (ΔG°S) is tested at the same time to see if it is less than −29 kcal/mol. If the constraint requirements of dissociation temperature and pairing region free energy (ΔG°S) are not met, the update will be repeated. If the constraint requirements of dissociation temperature and pairing region free energy (ΔG°S) are met, the S is updated according to the principle of base complementation, and finally obtaining a new sequence set S′. If the new nucleic acid sequence obtained after fifteen updates still does not meet the constraints of dissociation temperature and pairing region free energy (ΔG°S), in order to prevent a dead cycle, the set S becomes the new solution S′.
Optimization judgment: the objective function values Ei and Ei+1 of the set S and S′ are calculated respectively according to formula 2. If Ei+1−Et≥0, it indicates that the update has optimized the non-target pairing free energy (ΔG°NS), then S←S′, the new solution S′ becomes S. If Ei+1−Ei<0, it indicates that the update has obtained a deteriorating solution. According to the Metropolis criterion, the probability p=exp(−ΔE/To) is calculated and r is randomly generated, rε[0,1). If p>r, then accept the deteriorating solution, otherwise reject the deteriorating solution. Finally, the annealing initial temperature decays to 0.98 of the current value, generating the next new solution until it decays to the annealing termination temperature, thereby obtaining an optimized sequence set S.
The optimized sequences in Table 2_1 are obtained through the above algorithm optimization. The purpose of the 5′ end A of each sequence is to modify the active group for the subsequent coupling with linkers. In the non-target pairing free energy (ΔG°NS) matrix table and the target pairing region parameter index table, some main parameter values are counted. The schematic diagram of specific sequence pairing of the trimer optimized sequences is shown in
AGTGATCCGAAGTCGACAAACGTATTAGCGC
AATCGAGCGCTAATACGAAAGTGCAATGCGT
ACATCGACGCATTGCACAAAGTCGACTTCGG
ACCACCGTGTATGACCTAAAAGTGACAGCAC
AGCGATGTGCTGTCACTAAAACAGGCTCTAC
ATCCTCGTAGAGCCTGTAAAAGGTCATACAC
Four nucleic acids that can be paired according to the shape shown in
The specific implementation steps for optimization are as follows:
Sequence initialization: pairing sequences R={R1, R3, R5, R7} are initialized based on parameters, and R8, R2, R4, and R6 are obtained according to base complementation. After splicing the eight sequences as shown in
Generation of new solution: the same as the generation of new solution in Example 1. The difference is that if a fixed core structure is used, the update will not include the fixed core structure part; constraint parameters need to be strictly followed, the dissociation temperature (Tm) of the pairing regions of the new nucleic acid sequence should be greater than 52° C., and the free energy of the pairing regions (ΔG°S) should be less than −27.4 kcal/mol.
Optimization judgment: the same as the optimization judgment in Example 1.
The optimized sequences in Table 4_1 are obtained through the above algorithm optimization, and the specific pairing diagram thereof is shown in
The above implementing steps for tetramers mainly optimize the non-specific pairing free energy between sequences, and the secondary structure formed by the self-folding of sequences also has a significant impact on the assembly of tetramers. If the dissociation temperature of the secondary structure formed by the sequence itself is too high, once this stable secondary structure is formed, it is difficult to break this state, making it difficult for the tetramer to assemble. Therefore, it is necessary to control the dissociation temperature of the secondary structures corresponding to the four sequences of the assembled tetramer to be not too high. For tetramers, it is necessary to control the dissociation temperature of the secondary structures of the four nucleic acid sequences. If a symmetric structure is used (as shown in
AACCTGGTACAATCCAAATGAGCTACACTA
AGCTAGTGTAGCTCAAAACCGAAGTATCGA
AAATCGATACTTCGGAAAACTATAGTGAGT
ACAACTCACTATAGTAAAGGATTGTACCAG
AGGCGATCACAATCCAAATGAGCGTGTTAC
ACCGTAACACGCTCAAAACCGAAGTGCCA
AAATTGGCACTTCGGAAAACTATGCGGCTG
AAGCAGCCGCATAGTAAAGGATTGTGATC
The tetramer optimized sequences exhibit excellent assembly performance, largely due to the lack of pairing in the central region of the tetramer, which means that the fixed core structure provides sufficient freedom for the tetramer and does not form complicated complexes in the central region. Therefore, in order to integrate the tetramer sequences and the fixed core structure in the optimization of the pentamer sequences, two schemes of utilizing the tetramer sequences and the fixed core structure in Example 2 are explored and designed.
The first conversion scheme: five nucleic acids that can be paired according to the shape shown in
In this scheme, a complete tetramer fixed core structure is used, and the nucleic acid sequence W5 is developed based on the nucleic acid sequence of formula 4, while the nucleic acid sequence W6 is developed based on the nucleic acid sequence of formula 4. W5 has the structure of formula 7, and W6 has the structure of formula 8:
This scheme includes sequences of four structures: formula 1, formula 4, formula 5, and formula 6.
The specific implementation steps for optimization are as follows:
Generation of new solution: Randomly select a sequence from R1, R8, R9 and R10 to update, and obtain a new nucleic acid sequence. Check whether the dissociation temperature of this nucleic acid sequence is greater than 52° C., and whether the free energy of the pairing region (ΔG°S) is less than −27.4 kcal/mol. If the constraint requirements of dissociation temperature and free energy of the pairing regions (ΔG°S) are not met, repeat the update. If the constraint requirements of dissociation temperature and free energy of the pairing region (ΔG°S) are met, update S according to the principle of base complementation to obtain a new sequence set S′. If the new nucleic acid sequence obtained after fifteen updates does not meet the constraint requirements of dissociation temperature and pairing region free energy (ΔG°S), in order to prevent dead circulation, S becomes a new solution S′. Because this scheme uses a complete fixed core structure and part of tetramer sequences, during the process of generating a new solution, it is necessary to ensure that the fixed core structure and the retained tetramer sequences remain unchanged.
Optimization judgment: The same as the optimization judgment in Example 1. The difference is that the annealing initial temperature decays to 0.9 of the current value.
The optimized sequences of the first pentamer conversion scheme in Table 6_1 are obtained through this optimized algorithm, and
ATCACAGAGCGCGTAAAAACGCCACTCATGG
ATCCATGAGTGGCGTAAAAATCCAAATGAGC
ACCGTAACACGCTCAAAACCGAAGTGCCAAT
AAATTGGCACTTCGGAAAACTATGCGGCTGC
AAGCAGCCGCATAGTAAAGGATTAAATACGC
ATTCAGGCGACTCCTAAAAGCACGACGATGG
AACCATCGTCGTGCTAAAAATCCAAATGAGC
ACCGTAACACGCTCAAAACCGAAGTGCCAAT
AAATTGGCACTTCGGAAAACTATGCGGCTGC
AAGCAGCCGCATAGTAAAGGATTAAAAGGAG
The second conversion scheme: five nucleic acids that can be paired according to the shape shown in
The specific implementation steps for optimization are as follows:
Sequence initialization: according to the optimized constraint parameters, initialize the pairing sequence R9 and the set Q={Q1, Q3, Q5, Q7} of sequences with a length of 9 except for the core structure. Based on the principle of base complementation, R8, Q2, Q4, Q6 and Q8 are obtained and concatenated according to Table 7, and finally the initialized sequence set S={S1, S2, S3, S4, S5} is obtained.
Generation of new solution: the same as the generation of new solution in Example 1. The difference is that because this scheme uses a fixed core structure of tetramers, it is necessary to ensure that the fixed core structure remains partially unchanged during the generation of new solution. At the same time, constraint parameters need to be strictly followed, the dissociation temperature of the updated nucleic acid sequence pairing regions is greater than 52° C., and the free energy of the pairing regions (ΔG°S) is less than −27.4 kcal/mol.
Optimization judgment: the same as the optimization judgment in Example 1.
The optimized sequences of the second pentamer conversion scheme in Table 8_1 are obtained through this optimized algorithm, the specific pairing diagram thereof is shown in
ATGAGTGCGCAATCCAAATCGCCAGTCATG
ATGCATGACTGGCGAAAATGAGCGCTCGTT
ATCAACGAGCGCTCAAAACCGAAGTGCCA
AAGTTGGCACTTCGGAAAACTATCGCGCG
AAGTCGCGCGATAGTAAAGGATTGCGCAC
ATCACGCAGCAATCCAAATCGCCATCACAA
ACGTTGTGATGGCGAAAATGAGCACGAGC
AAAGGCTCGTGCTCAAAACCGAAGGTTGC
AAGTGCAACCTTCGGAAAACTATGCCGCT
ATGGAGCGGCATAGTAAAGGATTGCTGCG
In addition, Examples 1, 2, and 3 are repeated to obtain the nucleic acid single strand sequences and sets thereof shown in Tables 9-1, 9-2, and 9-3 (see above) for forming the trimer, tetramer, and pentamer complexes based on the complementary nucleic acid backbone.
The coupling of G-CSF and L-DNA selectively couples L-DNA with aldehyde group modification at the 5′ end to the N-terminal of G-CSF through a reductive amination reaction. Use dilution method or gel filtration chromatography and other methods to replace the buffer solution of G-CSF with acetate buffer solution (20 mM acetate, 150 mM NaCl, pH 5.0) and concentrate the sample to 30 mg/mL. Dissolve 100 OD (1 OD=33 μg) of L-DNA dry powder with aldehyde group modification at the 5′ end in 60 μL acetate buffer. Take 30 mg of sodium cyanide borohydride, dissolve in acetate buffer, and adjust the concentration to 800 mM. Take 50 μL, 60 μL, and 20 μL of G-CSF, L-DNA, and sodium cyanide borohydride at the above concentrations, mix them evenly, and incubate them at room temperature in dark for 48 hours. The samples before and after the reaction are verified by polyacrylamide gel electrophoresis for the effect of coupling reaction. The (L-DNA)-(G-CSF) coupling compound deviated significantly compared to the uncoupled G-CSF on the electrophoresis gel figure, and the coupling efficiency can reach 70%˜80% (
The purification of the (L-DNA)-(G-CSF) conjugate is divided into two steps. The first step is to remove the unreacted G-CSF and the (L-DNA)2-(G-CSF) conjugate connected to two L-DNA strands using Hitrap Q HP (
The purification conditions are as follows:
The purity of (L-DNA)-(G-CSF) conjugate sample obtained by two-step purification method is identified by 2% agarose gel electrophoresis (
Measure the nucleic acid concentrations of S1-G-CSF, S3-G-CSF, S4-G-CSF, S2, S3, and S4 using Nanodrop. Take an appropriate amount of the above components according to the structural design of the monovalent, divalent, and trivalent protein complexes, and mix them in a 1:1:1:1 molar ratio. After mixing, each assembly unit automatically completes assembly according to the principle of base complementation. Before and after assembly, samples are identified by polyacrylamide gel electrophoresis for assembly effect and sample purity (
M-NFS-60 cells (mouse leukemia lymphocytes/G-CSF dependent cells) are inoculated into the resuscitation culture medium (RPMI1640+10% FBS+15 ng/ml G-CSF+1× penicillin-streptomycin), and the cells are resuscitated at 37° C. and 5% CO2 conditions. When the cell density reaches 80%-90%, the cells are subcultured. After two or three times of subculture, the cells are inoculated into 96 well plates for cell plating. The cell plating experiment uses corning 3599 #96 well plates, with a cell plating density of 6000 cells per well. Gradient dilution is performed on different samples (GCSF, NAPPA4-GCSF, NAPPA4-GCSF2, NAPPA4-GCSF3) at working concentrations of (0.001, 0.01, 0.1, 1, 10, 100 ng/mL), with a final volume of 100 μL. Use PBS as a control. After incubating in a constant temperature incubator for 48 hours, add 10 μL of CCK8 solution to each well, and incubate the culture plate in the incubator for 1-4 hours, measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay, and calculate the cell proliferation rate of different samples.
Cell proliferation rate (%)=[A(dosing)−A(0 dosing)]/[A(0 dosing)−A(blank)]×100
The activity of a G-CSF linked L-DNA tetramer framework is evaluated using the above activity testing method, and it is found that the L-DNA tetramer framework has no effect on the activity of G-CSF (
In this embodiment, phosphorodiamidate morpholino nucleic acid is used for the experiment. Specifically, the following four PMO single strand sequences are selected (from 5′ to 3′)
The 5′ end is modified with an NH2 group, which is used for coupling the NHS active group of SM(PEG)2.
Dissolve PMO single strand containing 5′-terminal NH2 modification with phosphate buffer (50 mM NaH2PO4, 150 mM NaCl, pH 7.4) to prepare a mother solution with a final concentration of 1 mM. Dissolve SM(PEG)2 (linker molecule) powder with dimethyl sulfoxide (DMSO) and freshly prepare 250 mM of SM(PEG)2 mother solution. Add 10 to 50 times molar amounts of SM(PEG)2 mother solution to the PMO single strand mother solution, quickly mix them, and react at room temperature for 30 minutes to 2 hours. After the reaction is completed, add 10% volume of 1M Tris HCl (pH 7.0) to the reaction solution, mix them and incubate at room temperature for 20 minutes to quench the excessive SM(PEG)2 reaction. After incubation, the SM(PEG)2-PMO is purified using Hitrap Capto MMC. Unreacted SM(PEG)2 flows through the column without binding, while SM(PEG)2-PMO bound to the upper column is eluted with buffer (25 mM BICINE, 200 mM NH4Cl, 1M Arginine monohydrochloride, pH 8.5). The elution results are shown in
Analyze PMO samples before and after coupling using a positive ion mode of liquid chromatography-mass spectrometry. As shown in
Cysteine mutations are introduced into the carboxyl end of nano antibodies for nucleic acid coupling. Optimize the gene sequence of the anti-HSA nano antibody into the yeast preferred codons, and then subclone it into the pPICZ alpha A plasmid. The amino acid sequence of the anti-HSA nano antibody is shown in SEQ ID NO: 279. To facilitate purification, the N-terminal of the nano antibody is labeled with His.
SEQ ID NO: 279, the amino acid sequence of the anti-HSA nano antibody:
Linearize the plasmid and transfer it to Pichia pastoris strain X33, and screen the high copy strain of the target gene using Zeocin concentration gradient YPD agar plate. Cultivate monoclonal strains using GMGY at 30° C. and 250 rpm conditions to obtain sufficient strains. Then, induce the expression and secretion of target nano antibodies using GMMY at 20° C. and 250 rpm conditions, and supplement with 1% methanol every 24 hours.
The expression yield of nano antibodies in laboratory grade glass flasks of the high copy-screened strain can reach 40-80 mg/L.
After SDS-PAGE identification and analysis, the culture supernatant after 72 hours of induction contains a large number of target nano antibody monomers and nano antibody dimers. Purify the nano antibodies in the culture supernatant using His labeled affinity column.
Dialyze the nano antibody sample eluted by His label affinity chromatography (Example 9) with a dialysis buffer containing a reducing agent (20 mM Tris, 15 mM NaCl, pH 7.4). During the dialysis process, the C-terminal thiol group is reduced while removing the small impurities such as free-SH groups. Mix the reduced nano antibody with SM(PEG)2-PMO single strand (prepared in Example 8) in a molar ratio of 1:1 to 2, and react at room temperature for 2 hours after mixing evenly.
As shown in
Using His labeled affinity column to remove unreacted SM(PEG)2-PMO single strands, nano antibodies and nano antibody-PMO mixtures are collected.
Using Superdex™ 75 Increase 10/300 GL to separate nano antibodies and nano antibody-PMO, and the nano antibodies and nano antibody-PMO are effectively separated as shown in
The nano antibodies before and after nucleic acid coupling are analyzed using a positive ion mode of liquid chromatography-mass spectrometry. As shown in
Taking pmo NAPPA4-HSA (1) as an example, the self-assembly process of NAPPA-PMO drugs is introduced below.
Measure the concentrations of anti-HSA Nb-PMO1, PMO2, PMO3, and PMO4 respectively. Take an appropriate amount of the above components and preheat at 37° C. for 5 minutes, then mix them in a 1:1 molar ratio at 37° C. condition and incubate for 1 minute. Complete the assembly of pmo-NAPPA4-HSA (1).
Similarly, the pmo-NAPPA4-HSA (1,2,3) is assembled, and the required modules are anti-HSA Nb-PMO1, anti-HSA Nb-PMO2, anti-HSA Nb-PMO3, and PMO4.
Under low temperature conditions, the assembly of the samples is identified using SDS-PAGE. As shown in
Taking pmo-NAPPA4-HSA (1) as an example, the binding ability of anti-HSA nano antibody, anti-HSA Nb-PMO1 monomer and assembled pmo-NAPPA4-HSA (1) to HSA protein (ACRO Biosystems, HSA-H5220) is tested by ELISA.
Each well of the 96-well ELISA plate is coated with 100 ng of HSA protein overnight at 4° C. Wash the plate with washing solution (PBS containing 0.05% Tween-20) and block it with blocking solution (PBS containing 3% BSA and 0.05% Tween-20), then add gradient diluted Anti-HSA nano antibodies, nano antibodies coupled with PMO, Anti-HSA Nb-PMO1, and assembled pmo-NAPPA4-HSA (1), and incubate at room temperature for 1 hour. After washing three times, add 1:5000 diluted horseradish peroxidase coupled rabbit-anti-camel VHH antibody (Genscript, A02016) and incubate at room temperature for 1 hour. After washing 3 times, add a tetramethylbenzidine substrate solution (Biyuntian, P0209) for development. Use a termination solution (Biyuntian, P0215) to quench the development. Use an enzyme-linked immunosorbent assay (MolecularDevices, SpectraMax i3x) to read the absorbance at 450 nm for each well and calculate the corresponding EC50.
The calculation results in
PMO, as a nucleic acid derivative, can withstand the degradation of various nuclease. In order to verify whether the assembled NAPPA-PMO drugs can also tolerate nuclease or depolymerization, the following experiment is designed. Three common nuclease DNase I (Thermo Scientific, EN0523), T7 Endonuclease I (NEB, M0302S) and S1 Nuclease (Thermo Scientific, EN0321) are selected to incubate the PMO assembly sample pmo-NAPPA4-HSA (1) and the D-DNA assembly sample DDNA-NAPPA4 (control) for one hour at 37° C. The incubated pmo NAPPA4-HSA (1) and DDNA-NAPPA4 are analyzed using SDS-PAGE and 2% agarose electrophoresis, respectively.
As shown in
All documents mentioned in the present invention are incorporated by reference herein as if each document was incorporated separately by reference. Furthermore, it should be understood that after reading the foregoing teachings of the present invention, various changes or modifications can be made to the present invention by those skilled in the art and that these equivalents also fall in the scope of the claims appended to this application.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202011340377.3 | Nov 2020 | CN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/133254 | 11/25/2021 | WO |
