Patent Application
20230127135
The disclosure relates to construction of recombinant Saccharomyces cerevisiae for synthesizing carminic acid and an application thereof, and belongs to the technical field of genetic engineering and bioengineering.
Pigments derived from insects, particularly, scale insects, have been used by human beings since ancient times for dyeing textile, in cosmetics and in paints and for coloring foods. The most commonly used scale insect dyes include Kermesic acid, Laccaic acids and Carminic acid, which share a red color hue due to a similar chromophore structure. These compounds have been reported to be produced by five distantly related scale insects (hemiptera), namely Porphyrophora hamelii (Armenian/Ararat cochineal), Kermes vermilio, Porphyrophora polonica (Polish nematode), Dactylopius coccus (Mexican cochineal) and Kerria lacca (Indian lac insect). These insects have at various points in history, and at different geographical localities, been utilized by humans for large scale production of coccid dyes. Carminic acid and its aluminum salt carmine (E120) is by many considered as the pinnacle of coccid dyes, based on its hue, light, temperature, and oxidation stability, and the yields by which it can be obtained from natural sources, for example, P.hamelii (Asia), P.polonica (Europe) and D.coccus (Central America and South America). Therefore, present day production of carminic acid is based on D.coccus due to its exceptional high pigment content (16-22% of dry weight), low fat content, and the ease by which the insect can be cultured and harvested from leaves of Opuntia cacti.
As a result of restriction in source of raw materials, great fluctuation caused by weather effect and tedious process of extracting and purifying carminic acid from insects, the production mode of producing carminic acid from scale insects cannot be applied widely, and therefore, the market needs cheaper, simpler and more stable production modes. A microbial conversion method, owing to its fast biomass accumulation, short conversion time and the like, is gradually applied in industrial production to prepare various compounds. Frandsen et al (Heterologous production of the widely used natural food colorant carminic acid in Aspergillus nidµLans, publication data: 2018) has constructed a synthetic pathway of semisynthetic carminic acid in Aspergillus nidulans. They have made expression of cyclase Zhul, aromatase ZhuJ and OKS of Octaketide synthase 1 and C-glucosyltransferase UGT2 in A.nidulans and constructed the synthetic pathway of carminic acid. As A.nidulans itself has many gene clusters for the pathway to synthesize polyketides, key genes necessary to the synthetic pathway of carminic acid cannot be clearly analyzed in construction of the synthetic pathway of carminic acid in A.nidulans. In addition, as a result of defects in safety of A.nidulans, complexity in gene editing operation, generation of green conidia and the like, production of A.nidulans for synthesizing carminic acid is restricted.
S.
cerevisiae has been widely applied to cell factories that synthesize various compounds, features clear genetic background and simple gene editing and genetic manipulation, and can tolerate low pH. Compared with prokaryotes, it has a cell pigment P450 enzyme of eucaryons. Furthermore, S.cerevisiae has been regarded as a safe strain capable of being used in industrial production all the time.
This application has dug out and analyzed the key gene necessary to the synthetic pathway of carminic acid so as to construct an entire synthetic pathway of carminic acid in S.cerevisiae, thereby facilitating the synthetic pathway to be of potential guiding value and guiding significance to development of synthetic biology.
4′-phosphopantetheinyl transferase npgA (NCBI Reference Sequence: XP_663744.1, the amino acid sequence thereof as set forth in SEQ ID NO.14) derived from A.nidulans is optimally synthesized according to a codon of S.cerevisiae and is genetically synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the final nucleotide sequence is as set forth in SEQ ID NO.1. Octaketide synthase-encoding OKS (UniProtKB/Swiss-Prot: Q3L7F5.1, the amino acid sequence thereof as set forth in SEQ ID NO.15) derived from Aloe arborescens is optimally synthesized according to a codon of S.cerevisiae and is genetically synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the final nucleotide sequence is as set forth in SEQ ID NO.2. Cyclase Zhul (UniProtKB/Swiss-Prot: Q9F6D3, the amino acid sequence thereof as set forth in SEQ ID NO.16) derived from Streptomyces sp. R1128 and aromatase ZhuJ (UniProtKB/Swiss-Prot: Q9F6D2, the amino acid sequence thereof as set forth in SEQ ID NO.17) are optimally synthesized according to a codon of S.cerevisiae and are genetically synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the final nucleotide sequences thereof are as set forth in SEQ ID NO.3 and SEQ ID NO.4. C-glucosyltransferase UGT2 (GenBank: ATL15304.1, the amino acid sequence thereof as set forth in SEQ ID NO.18) derived from D.coccu is optimally synthesized according to a codon of S.cerevisiae and are genetically synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the final nucleotide sequence thereof is as set forth in SEQ ID NO.5. Monooxygenase aptC (NCBI Reference Sequence: XP_663606.1, the amino acid sequence thereof as set forth in SEQ ID NO.19) derived from A.nidulans is optimally synthesized according to a codon of S.cerevisiae and are genetically synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the final nucleotide sequence thereof is as set forth in SEQ ID NO.6.
The disclosure provides a recombinant bacterium which integratively expresses 4′-phosphopantetheinyl transferase on a genome of the original strain, and expresses octaketide synthase OKS, cyclase, aromatase, C-glucosyltransferase and monooxygenase, where GAL80 in the genome of the S.cerevisiae is knocked out.
In an embodiment, an ADY2 gene in the genome of the S.cerevisiae is knocked out, and a Gen ID of the ADY2 gene is 85036.
In an embodiment, the amino acid sequence of the 4′-phosphopantetheinyl transferase is as set forth in SEQ ID NO.14, the amino acid sequence of the octaketide synthase is as set forth in SEQ ID NO.15, the amino acid sequence of the C-glucosyltransferase is as set forth in SEQ ID NO.18, the amino acid sequence of the monooxygenase is as set forth in SEQ ID NO.19, the amino acid sequence of the cyclase is as set forth in SEQ ID NO.16, the amino acid sequence of the aromatase is as set forth in SEQ ID NO.17, the nucleotide sequence of the GAL80 is as set forth in SEQ ID NO.21, and the nucleotide sequence of the ADY2 gene is as set forth in SEQ ID NO.22.
In an embodiment, the octaketide synthase OKS, cyclase Zhul, aromatase ZhuJ, C-glucosyltransferase UGT2 and monooxygenase aptC are integrated to a high copy site.
In an embodiment, the high copy site is Ty2Cons site.
In an embodiment, the nucleotide sequence that encodes the OKS of the Octaketide synthase 1 is as set forth in SEQ ID NO.2.
In an embodiment, the nucleotide sequence that encodes the cyclase Zhul is as set forth in SEQ ID NO.3.
In an embodiment, the nucleotide sequence that encodes the aromatase ZhuJ is as set forth in SEQ ID NO.4.
In an embodiment, the nucleotide sequence that encodes the C-glucosyltransferase UGT2 is as set forth in SEQ ID NO.5.
In an embodiment, the nucleotide sequence that encodes the monooxygenase aptC is as set forth in SEQ ID NO.6.
In an embodiment, S.cerevisiae is taken as an original strain.
In an embodiment, GAL80 is knocked out in the genome of the S.cerevisiae, the Gene ID of the GAL80 is 854954, and the nucleotide sequence thereof is as set forth in SEQ ID NO.21.
The disclosure provides a method for producing carminic acid, where the carminic acid is produced by means of fermentation by taking the recombinant bacterium as a fermentation strain. The method includes:
In an embodiment, in step (3), ethanol or acetic acid is added once every 24 h.
In an embodiment, an adding amount of the ethanol is 0.1% by volume of a reaction system.
In an embodiment, a concentration of the acetic acid is 50%, and an adding amount of the acetic acid is 0.1% by volume of the reaction system.
Preferably, a fermentation time in step (3) is 96 h.
Or, the recombinant bacterium subjected to enrichment culture in the YNB culture medium for 24 h is transferred to the YPD culture medium for culture for 72 h, 2 g/L pyruvic acid is added every 24 h, and the recombinant bacterium is fermented for 72-264 h.
In an embodiment, the recombinant bacterium is fermented for at least 168 h.
Preferably, the recombinant bacterium is fermented for 168-264 h.
The disclosure provides a method for synthesizing carminic acid by utilizing S.cerevisiae. 4′-phosphopantetheinyl transferase undergoes integrated expression in a genome of S.cerevisiae, and S.cerevisiae also expresses OKS, cyclase, aromatase, C-glucosyltransferase and monooxygenase.
In an embodiment, S.cerevisiae is a chassis cell C800, the GAL80 gene is knocked out in the chassis cell C800, and the Gene ID of the GAL80 gene is 854954.
In an embodiment, NCBI Reference Sequence of 4′-phosphopantetheinyl transferase is XP_663744.1, UniProtKB/Swiss-Prot of OKS is Q3L7F5.1 of the OKS, GenBank of C-glucosyltransferase ATL15304.1, and NCBI Reference Sequence of monooxygenase is XP_663606.1.
In an embodiment, the nucleotide sequence that encodes the cyclase Zhul is as set forth in SEQ ID NO.3.
In an embodiment, the nucleotide sequence that encodes the aromatase ZhuJ is as set forth in SEQ ID NO.4.
In an embodiment, the nucleotide sequence that encodes the C-glucosyltransferase UGT2 is as set forth in SEQ ID NO.5.
In an embodiment, S.cerevisiae is used to produce carminic acid in a fermentation system containing pyruvic acid.
The disclosure further provides the recombinant bacterium, or the method for producing carminic acid, or an application of the method for synthesizing carminic acid by utilizing S.cerevisiae in preparation of products containing carminic acid.
The disclosure has the following beneficial effects:
The disclosure has constructed a recombinant plasmid pY26-CA pathway A based on a known synthetic pathway of carminic acid, deduced and dug out key gene necessary to synthesize carminic acid based on change of functional groups synthesized by carminic acid, and integrated the key gene npgA to a genome site to express based on a CRISPR-Cas9 technology, so as to obtain recombinant S.cerevisiae C800-npgA. Another key gene aptC of the synthetic pathway is constructed based on pY26-CA pathway A, so as to obtain a recombinant plasmid pY26-CA pathway B. The recombinant plasmids pY26-CA pathway A and pY26-CA pathway B are respectively expressed in recombinant S.cerevisiae C800 and recombinant S.cerevisiae C800-npgA, so as to construct recombinant S.cerevisiae CA-A1, CA-B1, CA-A2 and CA-B2 respectively. Through shake-flask fermentation and HPLC detection, carminic acid is not detected in the recombinant S.cerevisiae CA-A1, CA-B1 and CA-A2 and is detected in the recombinant S.cerevisiae CA-B2. Further verified by LCMS, the compound is carminic acid. The disclosure has analyzed the key gene necessary to synthesize carminic acid clearly, authenticated the process of the synthetic pathway of carminic acid and constructed the synthetic pathway of carminic acid in S.cerevisiae successfully. By means of the constructed recombinant S.cerevisiae, the yield of the fermented carminic acid can reach 52.7 µg/L. On this basis, OKS, cyclase, aromatase, C-glucosyltransferase and monooxygenase relevant to carminic acid are integrated to a high copy site, which can remarkably improve the yield of carminic acid. The yield of carminic acid can be increased to 2664.6 ug/L by optimizing fermentation conditions, and the fermentation time is shortened significantly.
An LB culture medium: a liquid culture medium was prepared from 10 g/L peptone, 5 g/L yeast powder and 10 g/L sodium chloride; and 20 g/L agar strip was added into the liquid culture medium to prepare an LB solid culture medium.
A YNB culture medium was prepared from 6.74 g/L yeast nitrogen base culture medium (without ammonium sulfate), 5 g/L ammonium sulfate, 20 g/L glucose and amino acids (5 g/L uracil, 10 g/L tryptophan, 10 g/L leucine and 10 g/L histidine, with proper amino acid deletion as needed).
An YPD culture medium was prepared from 20 g/L peptone, 10 g/L yeast powder and 20 g/L glucose.
Preparation of 200 g/L pyruvic acid solution: 10 g of pyruvic acid was dissolved in 50 mL of ultrapure water.
(III) extraction and concentration of carminic acid: 5 mL of fermentation liquor was collected, isometric extract liquor was added (the extract liquor contained ethyl acetate, normal butanol and formic acid in a volume ratio of 69:30:1), the fermentation liquor was extracted to extract a fermentation product, an organic phase was collected and rotatory-dried by distillation, 1 ml of methanol (with 1% formic acid) was added to resuspend, and the organic phase passed through a membrane for HPLC analysis.
(IV) HPLC detection of carminic acid: by utilizing a chromatographic column (250*4.6 mm, 5 µm, Thermo-Fisher, MA, USA), a mobile phase was eluted with an aqueous solution (A) containing 0.1% formic acid and acetonitrile containing 0.1% formic acid at a flow rate of 1 mL/min by using an SPD-20A detector (SHIMADZU, Japan) under 40° C. detection condition, a detection wavelength being 494 nm, an elution condition being 0-20 min, 10%-100% B; 20-25 min, 100% B; 25-27 min, 100%-10%B; and 28-30 min, 10%B.
A S. cerevisiae cell was streaked on an YPD panel and cultured at 30° C. for 3 days, a single colony was picked and inoculated to a 5 mL YPD liquid culture medium and was subjected to shaking culture at 30° C. at 220 rpm for 16 h, a bacterial solution was diluted till an OD600 value was 0.3 and was then transferred to 50 mL of fresh YPD liquid culture media and was subjected to shaking culture at 30° C. at 220 rpm for about 5 h till the OD600 value was 1.2-1.6.
The bacterial solution was collected and pre-cooled for 5 min on ice, the bacterial solution was centrifugalized at 5000*g for 5 min to collect bacterial cells, 25 mL of pre-cooled sterile water was added to resuspend the bacterial cells, the bacterial cells was centrifugalized at 5000*g for 5 min to collect precipitates, namely the bacterial cells, 1 mL of 0.1 mM lithium acetate was added into the bacterial cells to resuspend the bacterial cells, the bacterial cells was centrifugalized at 5000*g for 1 min to collect precipitates, namely the bacterial cells, 400 µL of 0.1 mM lithium acetate solutions was added into the bacterial cells to resuspend the bacterial cells, 50 µL of resuspended solutions was added into 240 µL of PEG3350, 36 µL of 1 mM lithium acetate solutions and 25 µL of 2 mg/mL ssDNA respectively, the mixture was subjected to shaking for 30 s to evenly mix the system, then the system was cultured at 30° C. for 30 min, the system was then subjected to hot shock in a 42° C. water bath after culture for 25 min, the system was centrifugalized at 5000*g for 1 min to collect bacterial cells, 1 mL of sterile resuspended bacterial cells was added, and 100 µL of bacterial cells resuspended solution was smeared to a corresponding YNP panel, and was cultured at 30° C. for 3 days.
A reaction system: 50 ng of DNA fragments was added, 100 ng of vectors was added, 5 µL of Gibson mix was added, and sterilize ultrapure water was added till the system was 10 µL.
A reaction condition: a reaction was performed at 50° C. for 60 min, and the system was placed on ice immediately after the reaction was finished to obtain a reaction solution. 10 µL of the reaction solutions was converted into an E. coli competent JM109.
(VII) Construction of chassis cell C800: the chassis cell with GAL80 knocked out was constructed based on S.cerevisiae CEN.PK2-1D cell (GAL80 was involved in galactose metabolic regulation, the constitutive expression of a GAL7 promoter could be realized after knockout instead of inducible expression); GAL80 (Gene ID: 854954) was knocked out according to a principle of homologous recombination of yeast, and the C800 chassis cell was constructed by taking G418 as a selection marker. A specific construction process was seen in literature Promoter-Library-Based Pathway Optimization for Efficient (2S)-Naringenin Production From p-Coumaric Acid in S.cerevisiae, Song Gao, Hengrui Zhou, Jingwen Zhou, Jian Chen. J Agric Food Chem, 2020 Jun 24.
Ectopic expression means the occurrence of gene expression in a tissue in which it is normally not expressed.
Integrated expression means expression that occurs when a gene is integrated into the genome.
By taking a synthetic sequence of Zhul (the nucleotide sequence was as set forth in SEQ ID NO.3) as a template, a primer pair F1/R1 was designed, PCR amplification was performed with the primer pair by using a high fidelity enzyme pfu enzyme of Primer Star MasterMix under the following conditions: predegeneration was performed at 95° C. for 3 min; 30 cycles was performed in an amplification stage according to 95° C., 10 s, 55° C., 10 s and 72° C., 30 s; extension was performed at 72° C. for 5 min, a PCR product was purified to obtain a fragment Zhul; and by taking a vector pY26 as a template, PCR amplification was performed with a primer pair F2/R2, and a product was purified. The fragment Zhul and the vector pY26 were recombined by means of the Gibson assembling method to obtain a recombinant vector, the recombinant vector was converted into Escherichia coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pY26-Zhul.
By taking a synthetic sequence of ZhuJ (the nucleotide sequence was as set forth in SEQ ID NO.4) as a template, a primer pair F3/R3 was designed, PCR amplification was performed with the primer pair and a product was purified to obtain a fragment ZhuJ; by taking the vector pY26-Zhul as a template, a primer pair F4/R4 was designed, PCR amplification was performed with the primer pair and a product was purified to obtain a fragment of the vector pY26-Zhul. The fragment ZhuJ and the vector pY26-Zhul were recombined by means of the Gibson assembling method to construct a recombinant vector pY26-Zhul-ZhuJ, the recombinant vector pY26-Zhul-ZhuJ was converted into E.coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pY26-Zhul-ZhuJ.
By taking a synthetic sequence of OKS (the nucleotide sequence was as set forth in SEQ ID NO.2) as a template, PCR amplification was performed with a primer pair F5/R5 and a product was purified to obtain a fragment OKS; by taking a promoter pINO1 (the nucleotide sequence was as set forth in SEQ ID NO.7), PCR amplification was performed with a primer pair F6/R6 and a product was purified to obtain a fragment pINO1; by taking a terminator tPGK1 (the nucleotide sequence was as set forth in SEQ ID NO.8) as a template, PCR amplification was performed with a primer pair F7/R7 and a product was purified to obtain a fragment tPGK1. By taking a pMD19T-simple as a template, PCR amplification was performed with a primer pair F8/R8 and a product was purified to obtain a vector fragment of the pMD19T-simple. The OKS, pINO1, tPGK1 and vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a vector pMD19T-pINO1-OKS-tPGK1, the obtained vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pMDl9T-pIN01-OKS-tPGK1.
By taking a synthetic sequence of UGT2 (the nucleotide sequence was as set forth in SEQ ID NO.5) as a template, PCR amplification was performed with a primer pair F9/R9 and a product was purified to obtain a fragment UGT2; by taking the promoter pTDH1 (the nucleotide sequence was as set forth in SEQ ID NO.9) as a template, PCR amplification was performed with a primer pair F10/R10 and a product was purified to obtain a fragment pTDH1; by taking a terminator ter-pGAL7 (the nucleotide sequence was as set forth in SEQ ID NO.10) as a template, PCR amplification was performed with a primer pair F11/R11 and a product was purified to obtain a fragment ter-pGAL7; and by taking pMD19T-simple as a template, PCR amplification was performed with a primer pair F12/R12 and a product was purified to obtain a linearized vector pMD19T-simple. The fragments UGT2, pTDH1 and ter-pGAL7 and the vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a recombinant vector pMD19T-pTDH1-UGT2-ter-pGAL7, the obtained recombinant vector was converted into E.coli JM109, and a plasmid was extracted, sequenced and verified, so as to obtain a correct recombinant vector pMD19T-pTDH1-UGT2-ter-pGAL7.
By taking a synthetic sequence of aptC (the nucleotide sequence was as set forth in SEQ ID NO.6) as a template, PCR amplification was performed with a primer pair F13/R13 and a product was purified to obtain a fragment aptC; by taking a terminator tVPS13 (the nucleotide sequence was as set forth in SEQ ID NO.11) as a template, PCR amplification was performed with a primer pair F14/R14 and a product was purified to obtain a fragment tVPS13; and by taking pMD19T-simple as a template, PCR amplification was performed with a primer pair F15/R15 and a product was purified to obtain a linearized vector pMD19T-simple. The fragments aptC and tVPS13 and the vector pMD19T-simple were assembled by means of the Gibson assembling method to obtain a recombinant vector pMD19T-aptC-tVPS13, and the obtained recombinant vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pMD19T-aptC-tVPS13.
By taking a synthetic sequence of npgA (the nucleotide sequence was as set forth in SEQ ID NO.1) as a template, PCR amplification was performed with a primer pair F16/R16 and a product was purified to obtain a fragment npgA; by taking the promoter pGAL1 as a template, PCR amplification was performed with a primer pair F17/R17 and a product was purified to obtain a fragment pGALl; and by taking a vector pY26 as a template, PCR amplification was performed with a primer pair F18/R18 and a product was purified to obtain a linearized vector pY26. The fragments npgA and pGAL1 and the vector pY26 were recombined by means of the Gibson assembling method to obtain a recombinant vector pY26-pGAL1-npgA, and the obtained recombinant vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-pGAL1-npgA.
GCGAAGAATTTTAAGCAGTAACAGTACCAACACCACCAGCAG
TCTAGAACTAATGAGACATGTTGAACATACTGTTACTGTCG
CATGTCTCATTAGTTCTAGAAAACTTAGATTAGATTGCTATGCTTTCTTTCT
TACTGCTTAAAATTCTTCGCCAGAGGTTTGGTCAA
TTCGACGGATATGTCTGGTAGAAAGACTTTCTTGGATTTGT
GTGACATAACTTAATCTTCTTCTTCTTGTTCGAAAACAGCAACAAC
AGAAGATTAAGTTATGTCACGCTTACATTCACGCC
TACCAGACATATCCGTCGAAACTAAGTTCTGGTGT
TCAATTCAATTTACATCAATGGCAAAGAATGCAACAAAATAGTTTC
AAGAAGTAACATGTCCTCTTTGTCCAACGCTTCC
AAGAGGACATGTTACTTCTTTTTCACTGGAAAAAAAAGGGAATGAAAC
TTCGACGATTGAAGACGATGAGGCCGGTG
TCCAGAGATTTTTGAACCTCATTGTATTTTACGGAAAAGAATATCATACTC
ATTGATGTAAATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTC
CATCGTCTTCAATCGTCGAACGGCAGGC
GAGGTTCAAAAATCTCTGGAAGATCCGCGC
ACAAAACAAAATGGAATTCAGATTATTGATTTTGGCTTTATTCTCTG
AGCTGGCAAATTAGTTCTTCTTCAACTTTTCAGACTTAGAAGAAGACC
TCCAGAGATTGAAACCACACCGTGGGGC
TGAATTCCATTTTGTTTTGTGTGTAAATTTAGTGAAGTACTGTTTTTTGTG
GAAGAACTAATTTGCCAGCTTACTATCCTTCTTGAAAATATGC
TTCGACGATTTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTGATG
TCCCTCAAAAAATCGTCGAACGGCAGGC
GTGTGGTTTCAATCTCTGGAAGATCCGCGC
TCCAGAGATTATGACTTTGCCAGTTTTGATTATTGGTG
TCATATGTGATTAAGCTCTCATCTTTTGCTTTTCAGCGA
GAGAGCTTAATCACATATGAAAGTATATACCCGCTTTTGTACAC
TTCGACGATTGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGT
GTCTACTCTCAATCGTCGAACGGCAGGC
GCAAAGTCATAATCTCTGGAAGATCCGCGC
AAAAACTATAATGGTTCAAGATACTTCTTCAGCTTCTACATC
AATTACATGATTAAGATAAACAATTACAAACACCTGTAGCACATGG
TAACTGATCATTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACG
CTTGAACCATTATAGTTTTTTCTCCTTGACGTTAAAGTATAGAGGTATATTAACAAT
TTTATCTTAATCATGTAATTAGTTATGTCACGCTTACATTCACG
TTCAATATAATGATCAGTTAACTCCGGACCGC
By taking a vector pMDl9T-pIN01-OKS-tPGK1 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F19/R19 and a product was purified to obtain a fragment pINO1-OKS-tPGK1; by taking pMD19T-pTDH1-UGT2-ter-pGAL7 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F20/R20 and a product was purified to obtain a fragment pTDH1-UGT2-ter-pGAL7; and by taking pY26-Zhul-ZhuJ constructed in Example 1 as a template, PCR amplification was performed with a primer pair F21/R21 and a product was purified to obtain a vector fragment pY26-Zhul-ZhuJ. The fragments pINO1-OKS-tPGK1 and pTDH1-UGT2-ter-pGAL7 and the vector pY26-Zhul-ZhuJ were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-CA pathway A (pY26-Zhul-ZhuJ-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7) (see
GTCGTATTACTTTGAACCTCATTGTATTTTACGGAAAAGAATATCATACTC
GTGTGGTTTCGAGGCTTGTCAGTACATCAGCGAT
GACAAGCCTCGAAACCACACCGTGGGGC
GTGAGCGCGCTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTGATG
TCCCTCAAAAGCGCGCTCACTGGCC
GAGGTTCAAAGTAATACGACTCACTATAGGGCGAATTGG
By taking a pMD19T-aptC-tVPS13 constructed in Example 1 as a template, PCR amplification was performed with a primer pair F22/R22 and a product was purified to obtain a fragment aptC-tVPS13; by taking pY26-CA pathway A as a template, PCR amplification was performed with a primer pair F23/R23 to obtain a linearized vector pY26-CA pathway A. The fragment aptC-tVPS13 and the vector pY26-CA pathway A were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pY26-CA pathway B (pY26-Zhul-ZhuJ-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7-aptC-tVPS13) (see
TCCCTCAAAAATGACTTTGCCAGTTTTGATTATTGGTG
GTGAGCGCGCGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGTTC
GTCTACTCTCGCGCGCTCACTGGCC
GCAAAGTCATTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTG
The recombinant vector pY26-CA pathway A and the recombinant vector pY26-CA pathway B were converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil at 220 rpm for 24 h; and the following primer pair was designed:
The cultured bacterial solution was subjected to PCR verification with the primer pair, and a correct clone was picked to construct recombinant S.cerevisiae CA-A1 (expressing pY26-CA pathway A based on the chassis cell C800, see
A npgA expression box is integrated to a ADY2 site of the genome to express by utilizing the CRISPR-Cas9 technology, and the following primer pair was designed by taking pY26-pGAL1-npgA as a template:
PCR amplification was performed with the primer pair and a product was purified to obtain a fragment UP60-pGAL1-npgA-ter-DOWN60. The UP60-pGAL1-npgA-ter-DOWN60, the p414-TEF1p-Cas9-CYC1t plasmid and 20 nt sgRNA plasmid pRS426-ADY2-sgRNA containing ADY2 (the nucleotide sequence thereof was as set forth in SEQ ID NO.12) were converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil and tryptophan at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil and tryptophan at 220 rpm for 24 h; and the following primer pair was designed:
PCR verification was performed on the cultured bacterial solution with the primer pair, a correct clone was picked, and a plasmid pRS426-ADY2-sgRNA was eliminated through continuous passage culture and spotting verification of plasmid elimination so as to construct the recombinant S.cerevisiae C800-npgA (see
The correctly sequenced recombinant vector pY26-CA pathway A and the recombinant vector pY26-CA pathway B were respectively converted into the chassis cell C800 by means of a lithium acetate chemical conversion method, and were cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a YNB culture medium without uracil at 220 rpm for 24 h; and the following primer pair was designed:
The cultured bacterial solution was subjected to PCR verification with the primer pair, and a correct clone was picked to construct recombinant S.cerevisiae CA-A2 (expressing pY26-CA pathway A based on the chassis cell C800-npgA, see
By taking a vector pCT23-EGFP (the nucleotide sequence thereof was as set forth in SEQ ID NO.13) constructed in the lab as a template, PCR amplification was performed with a primer pair F28/R28 and a PCR product was purified to obtain a fragment pCT23; by taking pY26-CA pathway B constructed in Example 3 as a template, PCR amplification was performed with a primer pair F29/R29 and a PCR product was purified to obtain a fragment pTEF-Zhul- tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1- UGT2-ter-pGAL7-aptC-tVPS13 of an expression box of a synthetic pathway of carminic acid; the fragments pCT23 and pTEF-Zhul-tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7-aptC-tVPS13 were recombined by means of the Gibson assembling method to obtain a recombinant vector, and the obtained recombinant vector was converted into E.coli JM109, and was sequenced and verified, so as to obtain a correct recombinant vector pCT23-CA (pCT23-pTEF-Zhul-tADH1-pGPD-ZhuJ-tCYC1-pINO1-OKS-tPGK1-pTDH1-UGT2- ter-pGAL7-aptC-tVPS13) (a plasmid profile was shown in
AAAAAGTCTACTCTCTTACAAATGAATAACGAAATGAGACAAAGAAGAGAAC
AGCTGGCGTAATAGCGTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTTTCA
TCAATGAATATTAACGCTATTACGCCAGCTGAATTGGAGC
GTTATTCATTTGTAAGAGAGTAGACTTTTTCTGTGAAATTTAATGAGTTTTTGTTCAC
Based on a homologous recombination capacity of yeast itself, the expression box of the synthetic pathway of carminic acid was integrated to a multi-copy site, Ty2Cons site, of S.cerevisiae through integrated homologous arms upstream and downstream Ty2Cons, and the following primer pair was designed:
PCR amplification was performed on the plasmid pCT23-CA constructed in Example 7 with the primer pair and a product was purified to obtain a fragment Ty2ConsUP- pTEF-Zhul- tADH1-pGPD-ZhuJ- tCYC1-pINO1-OKS-tPGK1- pTDH1- UGT2- ter-pGAL7-aptC- tVPS13-URA3-Ty2ConsDown. The fragment Ty2ConsUP- pTEF-Zhul- tADH1-pGPD-ZhuJ- tCYC1- pINO1-OKS-tPGK1- pTDH1- UGT2- ter-pGAL7-aptC- tVPS13-URA3-Ty2ConsDown was converted into the chassis cell C800-npgA by means of a lithium acetate chemical conversion method, and was cultured on a YNB panel without uracil at 30° C. for 3 days till a single colony grew; the single colony was picked and cultured in a 24-deep well plate with 4 mL of YNB culture media at 220 rpm for 216 h; the bacterial solution was extracted, detected by HPLC, and screened to obtain a high-yield strain CA1. The high-yield strain CA1 was re-screened on a shake flask (the producing strain CA1 for carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, 2 mL of seed solutions was transferred to 30 mL of YPD culture media, and was cultured at 220 rpm for 216 h), and the highest yield of carminic acid could reached 2245.7 µg/L (see
The fermentation conditions were optimized based on the producing strain CA1 of carminic acid, so that the fermentation period was shortened.
A fermentation condition A: the acid producing strain CA1 of carminic was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, 2 mL of seed solutions was transferred to 30 mL of YPD culture media, and was cultured for 216 h at 220 rpm.
A fermentation condition B: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured at 220 rpm for 24 h, and 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured in the YNB culture medium for 48 h for cell enrichment, then resuspended in 10 mL of YPD culture media to ferment, and cultured at 220 rpm for 96 h.
A fermentation condition C: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured for 3 days at 30° C. till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured for 24 h at 220 rpm, 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured for 48 h in the YNB culture medium after cells were enriched and resuspended in 10 mL of YPD culture media to ferment, and it was cultured at 220 rpm for 96 h under a condition of adding 0.1% ethanol every 24 h.
A fermentation condition D: the producing strain CA1 of carminic acid was streaked on the YNB panel without uracil, and cultured at 30° C. for 3 days till a single colony grew; the single colony was picked and inoculated to 5 mL of YNB culture media without uracil, cultured for 24 h at 220 rpm, and 2 mL of seed solutions was transferred to 50 mL of YPD culture media, was cultured in the YNB culture medium for 48 h for cell enrichment, then resuspended in 10 mL of YPD culture media to ferment, and cultured at 220 rpm for 96 h under a condition of adding 0.1% of 50% acetic acid every 24 h.
Yields of carminic acid in the fermentation conditions B, C and D were higher than that of carminic acid in the fermentation condition A. Under the condition of supplementing 0.1% ethanol (the fermentation condition C), after fermentation in YPD for 96 h, the yield of carminic acid was 2664.6 µg/L. Compared with the fermentation condition A (2245.7 µg/L, the fermentation period 216 h), the yield of carminic acid was increased by 18.7%, and the period was shortened by half, thereby greatly saving the time cost and increasing the yield of carminic acid (see
Although disclosed with preferred examples above, the disclosure is not limited by the examples. Any of those skilled in the art may make various alternations and modifications without departing the spirit and scope of the disclosure. Therefore, the scope of protection of the disclosure should be subject to the scope of the disclosure as defined in the claims.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2020108881173 | Aug 2020 | CN | national |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN2021/114793 | Aug 2021 | WO |
| Child | 17818389 | US |
