Coryneform bacteria which produce chemical compounds II

Abstract

The invention relates to coryneform bacteria which, instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, and optionally at least a third copy of the open reading frame (ORF), gene or allele in question at a further gene site, and processes for the preparation of chemical compounds by fermentation of these bacteria.

Description

BACKGROUND

[0002] Chemical compounds, which means, in particular, L-amino acids, vitamins, nucleosides and nucleotides and D-amino acids, are used in human medicine, in the pharmaceuticals industry, in cosmetics, in the foodstuffs industry and in animal nutrition.

[0003] Numerous of these compounds are prepared by fermentation from strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of their great importance, work is constantly being undertaken to improve the preparation processes. Improvements to the process can relate to fermentation measures, such as, for example, stirring and supply of oxygen, or the composition of the nutrient media, such as, for example, the sugar concentration during the fermentation, or the working up to the product form by, for example, ion exchange chromatography, or the intrinsic output properties of the microorganism itself.

[0004] Methods of mutagenesis, selection and mutant selection are used to improve the output properties of these microorganisms. Strains which are resistant to antimetabolites or are auxotrophic for metabolites of regulatory importance and which produce the particular compounds are obtained in this manner.

[0005] Methods of the recombinant DNA technique have also been employed for some years for improving the strain of Corynebacterium strains, by amplifying individual biosynthesis genes and investigating the effect on production.

[0006] A common method comprises amplification of certain biosynthesis genes in the particular microorganism by means of episomally replicating plasmids. This procedure has the disadvantage that during the fermentation, which in industrial processes is in general associated with numerous generations, the plasmids are lost spontaneously (segregational instability).

[0007] Another method comprises duplicating certain biosynthesis genes by means of plasmids which do not replicate in the particular microorganism. In this method, the plasmid, including the cloned biosynthesis gene, is integrated into the chromosomal biosynthesis gene of the microorganism (Reinscheid et al., Applied and Environmental Microbiology 60(1), 126-132 (1994); Jetten et al., Applied Microbiology and Biotechnology 43(1):76-82 (1995)). A disadvantage of this method is that the nucleotide sequences of the plasmid and of the antibiotic resistance gene necessary for the selection remain in the microorganism. This is a disadvantage, for example, for the disposal and utilization of the biomass. Moreover, the expert expects such strains to be unstable as a result of disintegration by “Campbell type cross over” in a corresponding number of generations such as are usual in industrial fermentations.

OBJECT OF THE INVENTION

[0008] The inventors had the object of providing new measures for improved fermentative preparation of chemical compounds using coryneform bacteria.

SUMMARY OF THE INVENTION

[0009] The invention provides coryneform bacteria, in particular of the genus Corynebacterium, which produce one or more desired chemical compounds, characterized in that

[0010] a) instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), these have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0011] b) optionally have at least a third copy of the open reading frame (ORF), gene or allele in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0012] The invention also provides processes for the preparation of one or more chemical compounds, which comprise the following steps:

[0013] a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which

[0014] i) instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0015] ii) optionally have at least a third copy of the said open reading frame (ORF), gene or allele at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,

[0016] under conditions which allow expression of the said open reading frames (ORFs) genes or alleles,

[0017] b) concentration of the chemical compound(s) in the fermentation broth and/or in the cells of the bacteria,

[0018] c) isolation of the chemical compound(s), optionally

[0019] d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

DETAILED DESCRIPTION OF THE INVENTION

[0020] Chemical compounds are to be understood, in particular, as meaning amino acids, vitamins, nucleosides and nucleotides. The biosynthesis pathways of these compounds are known and are available in the prior art.

[0021] Amino acids mean, preferably, L-amino acids, in particular the proteinogenic L-amino acids, chosen from the group consisting of L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-proline and L-arginine and salts thereof, in particular L-lysine, L-methionine and L-threonine. L-Lysine is very particularly preferred.

[0022] Proteinogenic amino acids are understood as meaning the amino acids which occur in natural proteins, that is to say in proteins of microorganisms, plants, animals and humans.

[0023] Vitamins mean, in particular, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B5 (pantothenic acid), vitamin B6 (pyridoxines), vitamin B12 (cyanocobalamin), nicotinic acid/nicotinamide, vitamin M (folic acid) and vitamin E (tocopherol) and salts thereof, pantothenic acid being preferred.

[0024] Nucleosides and nucleotides mean, inter alia, S-adenosyl-methionine, inosine-5′-monophosphoric acid and guanosine-5′-monophosphoric acid and salts thereof.

[0025] The coryneform bacteria are, in particular, those of the genus Corynebacterium. Of the genus Corynebacterium, the species Corynebacterium glutamicum, Corynebacterium ammoniagenes and Corynebacterium thermoaminogenes are preferred. Information on the taxonomic classification of strains of this group of bacteria is to be found, inter alia, in Kämpfer and Kroppenstedt (Canadian Journal of Microbiology 42, 989-1005 (1996)) and in U.S. Pat. No. 5,250,434.

[0026] Suitable strains of the species Corynebacterium glutamicum (C. glutamicum) are, in particular, the known wild-type strains

[0027] Corynebacterium glutamicum ATCC13032

[0028] Corynebacterium acetoglutamicum ATCC15806

[0029] Corynebacterium acetoacidophilum ATCC13870

[0030] Corynebacterium lilium ATCC15990

[0031] Corynebacterium melassecola ATCC17965

[0032] Corynebacterium herculis ATCC13868

[0033] Arthrobacter sp ATCC243

[0034] Brevibacterium chang -fua ATCC14017

[0035] Brevibacterium flavum ATCC14067

[0036] Brevibacterium lactofermentum ATCC13869

[0037] Brevibacterium divaricatum ATCC14020

[0038] Brevibacterium taipei ATCC13744 and

[0039] Microbacterium ammoniaphilum ATCC21645

[0040] and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.

[0041] Suitable strains of the species Corynebacterium ammoniagenes (C. ammoniagenes) are, in particular, the known wild-type strains

[0042] Brevibacterium ammoniagenes ATCC6871

[0043] Brevibacterium ammoniagenes ATCC15137 and

[0044] Corynebacterium sp. ATCC21084

[0045] and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.

[0046] Suitable strains of the species Corynebacterium thermoaminogenes (C. thermoaminogenes) are, in particular, the known wild-type strains

[0047] Corynebacterium thermoaminogenes FERM BP-1539

[0048] Corynebacterium thermoaminogenes FERM BP-1540

[0049] Corynebacterium thermoaminogenes FERM BP-1541 and

[0050] Corynebacterium thermoaminogenes FERM BP-1542

[0051] and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.

[0052] Strains with the designation “ATCC” can be obtained from the American Type Culture Collection (Manassas, Va., USA). Strains with the designation “FERM” can be obtained from the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba Central 6, 1-1-1 Higashi, Tsukuba Ibaraki, Japan). The strains of Corynebacterium thermoaminogenes mentioned (FERM BP-1539, FERM BP-1540, FERM BP-1541 and FERM BP-1542) are described in U.S. Pat. No. 5,250,434.

[0053] Open reading frame (ORF) describes a section of a nucleotide sequence which codes or can code for a protein or polypeptide or ribonucleic acid to which no function can be assigned according to the prior art.

[0054] After assignment of a function to the nucleotide sequence section in question, it is in general referred to as a gene.

[0055] Alleles are in general understood as meaning alternative forms of a given gene. The forms are distinguished by differences in the nucleotide sequence.

[0056] In the context of the present invention, endogenous, that is to say species-characteristic, open reading frames, genes or alleles are preferably used. These are understood as meaning the open reading frames, genes or alleles or nucleotide sequences thereof present in the population of a species, such as, for example, Corynebacterium glutamicum.

[0057] A “singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus)” is understood as meaning the circumstances that a gene in general naturally occurs in one (1) copy in the form of its nucleotide sequence at its site or gene site in the corresponding wild-type or corresponding parent organism or starting organism. This site is preferably in the chromosome.

[0058] Thus, for example, the lysC gene or an lysCFBR allele which codes for a “feed back” resistant aspartate kinase is present in one copy at the lysC site or lysC locus or lysC gene site and is flanked by the open reading frame orfX and the leuA gene on one side and by the asd gene on the other side.

[0059] “Feed back” resistant aspartokinases are understood as meaning aspartokinases which, compared with the wild-type form, have a lower sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC (aminoethylcysteine) and threonine or lysine by itself or AEC by itself. Strains which produce L-lysine typically contain such “feed back” resistant or desensitized aspartokinases.

[0060] The nucleotide sequence of the chromosome of Corynebacterium glutamicum is known and can be found in the patent application EP-A-1108790 and Access Number (Accession No.) AX114121 of the nucleotide sequence databank of the European Molecular Biologies Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK). The nucleotide sequences of orfX, the leua gene and the asd gene have the Access Numbers AX120364 (orfX), AX123517 (leuA) and AX123519 (asd).

[0061] Further databanks, such as, for example, that of the National Center for Biotechnology Information (NCBI, Bethesda, Md., USA) or that of the Swiss Institute of Bioinformatics (Swissprot, Geneva, Switzerland) or that of the Protein Information Resource Database (PIR, Washington, D.C., USA) can also be used.

[0062] “Tandem arrangement” of two or more copies of an open reading frame (ORF), gene or allele is referred to if these are arranged in a row directly adjacent in the same orientation.

[0063] “A further gene site” is understood as meaning a second gene site, the nucleotide sequence of which is different from the sequence of the ORF, gene or allele which has been at least duplicated at the natural site. This further gene site, or the nucleotide sequence present at the further gene site, is preferably in the chromosome and is in general not essential for growth and for production of the desired chemical compounds.

[0064] The “further gene sites” mentioned include, of course, not only the coding regions of the open reading frames or genes mentioned, but also the regions or nucleotide sequences lying upstream which are responsible for expression and regulation, such as, for example, ribosome binding sites, promoters, binding sites for regulatory proteins, binding sites for regulatory ribonucleic acids and attenuators. These regions in general lie in a range of 1-800, 1-600, 1-400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region. In the same way, regions lying downstream, such as, for example, transcription terminators, are also included. These regions in general lie in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.

[0065] Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used for this.

[0066] Examples of regions of the Corynebacterium glutamicum chromosome representing intergenic regions, prophages, defective phages or phage components are shown in tables 12 and 13. The positions of the DNA regions refer to the genome map of Corynebacterium glutamicum ATCC 13032 as presented in EP-A-1108790 or in the databank of the European Molecular Biologies Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK).

[0067] A prophage is understood as meaning a bacteriophage, in particular the genome thereof, where this is replicated together with the genome of the host and the formation of infectious particles does not take place. A defective phage is understood as meaning a prophage, in particular the genome thereof, which, as a result of various mutations, has lost the ability to form so-called infectious particles. Defective phages are also called cryptic.

[0068] Prophages and defective phages are often present in integrated form in the chromosome of their host. Further details exist in the prior art, for example in the textbook by Edward A. Birge (Bacterial and Bacteriophage Genetics, 3rd ed., Springer-Verlag, New York, USA, 1994) or in the textbook by S. Klaus et al. (Bakterienviren, Gustav Fischer Verlag, Jena, Germany, 1992).

[0069] To produce the coryneform bacteria according to the invention, the nucleotide sequence of the desired ORF, gene or allele, preferably including the expression and/or regulation signals, is isolated, at least two copies are arranged in a row, preferably in tandem arrangement, these are then transferred into the desired coryneform bacterium, preferably with the aid of vectors which do not replicate or replicate to only a limited extent in coryneform bacteria, and those bacteria in which two copies of the ORF, gene or allele are incorporated at the particular desired natural site instead of the singular copy originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus).

[0070] The expression and/or regulation signals mentioned, such as, for example, the ribosome binding sites, promoters, binding sites for regulatory proteins, binding sites for regulatory ribonucleic acids and attenuators lying upstream of the coding region of the ORF, gene or allele, are in general in a range of 1-800, 1-600, 1-400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region. The expression and/or regulation signals mentioned, such as, for example, the transcription terminators lying downstream of the coding region of the ORF, gene or allele, are in general in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.

[0071] Preferably, also, no residues of sequences of the vectors used or species-foreign DNA, such as, for example, restriction cleavage sites, remain on the flanks of the ORFs, genes or alleles amplified according to the invention. In each case a maximum of 24, preferably a maximum of 12, particularly preferably a maximum of 6 nucleotides of such DNA optionally remain on the flanks.

[0072] At least a third copy of the open reading frame (ORF), gene or allele in question is optionally inserted at a further gene site, or several further gene sites, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0073] Preferably, also, no residues of sequences of the vectors used or species-foreign DNA, such as, for example, restriction cleavage sites, remain at the further gene site. A maximum of 24, preferably a maximum of 12, particularly preferably a maximum of 6 nucleotides of such DNA upstream or downstream of the ORF, gene or allele incorporated optionally remain at the further gene site.

[0074] The invention accordingly also provides a process for the production of coryneform bacteria which produce one or more chemical compounds, characterized in that

[0075] a) the nucleotide sequence of a desired ORF, gene or allele, preferably including the expression and/or regulation signals, is isolated

[0076] b) at least two copies of the nucleotide sequence of the ORF, gene or allele are arranged in a row, preferably in tandem arrangement

[0077] c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,

[0078] d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and

[0079] e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and

[0080] f) at least a third copy of the open reading frame (ORF), gene or allele in question is optionally introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

[0081] By the measures according to the invention, the productivity of the coryneform bacteria or of the fermentative processes for the preparation of chemical compounds is improved in respect of one or more of the features chosen from the group consisting of concentration (chemical compound formed, based on the unit volume), yield (chemical compound formed, based on the source of carbon consumed) and product formation rate (chemical compound formed, based on the time) by at least 0.5-1.0% or at least 1.0 to 1.5% or at least 1.5-2.0%.

[0082] Instructions on conventional genetic engineering methods, such as, for example, isolation of chromosomal DNA, plasmid DNA, handling of restriction enzymes etc., are found in Sambrook et al. (Molecular Cloning—A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press). Instructions on transformation and conjugation in coryneform bacteria are found, inter alia, in Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), in Schäfer et al. (Journal of Bacteriology 172, 1663-1666 (1990) and Gene 145, 69-73 (1994)) and in Schwarzer and Pühler (Bio/Technology 9, 84-87 (1991)).

[0083] Vectors which replicate to only a limited extent are understood as meaning plasmid vectors which, as a function of the conditions under which the host or carrier is cultured, replicate or do not replicate. Thus, a temperature-sensitive plasmid for coryneform bacteria which can replicate only at temperatures below 31° C. has been described by Nakamura et al. (U.S. Pat. No. 6,303,383).

[0084] The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L-lysine, characterized in that

[0085] a) instead of the singular copy of an open reading frame (ORF), a gene or allele of lysine production naturally present at the particular desired site (locus), these have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0086] b) optionally have at least a third copy of the said open reading frame (ORF), gene or allele of L-lysine production at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0087] The invention also furthermore provides a process for the preparation of L-lysine, which comprises the following steps:

[0088] a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which

[0089] i) instead of the singular copy of an open reading frame (ORF), gene or allele of lysine production present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0090] ii) optionally have at least a third copy of the open reading frame (ORF), gene or allele of L-lysine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,

[0091] under conditions which allow expression of the said open reading frames (ORFs), genes or alleles,

[0092] b) concentration of the L-lysine in the fermentation broth,

[0093] c) isolation of the L-lysine from the fermentation broth, optionally

[0094] d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

[0095] A “copy of an open reading frame (ORF), gene or allele of lysine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alleles of which enhancement/over-expression can have the effect of improving lysine production. Enhancement is understood as meaning an increase in the intracellular concentration or activity of the particular gene product, protein or enzyme.

[0096] These include, inter alia, the following open reading frames, genes or alleles: accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2, gdh, gnd, lysc, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsI, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwa1, zwf and zwf A213T. These are summarized and explained in Table 1.

[0097] These include, in particular, the lysCFBR alleles which code for a “feed back” resistant aspartate kinase. Various lysCFBR alleles are summarized and are explained in Table 2.

[0098] The following lysCFBR alleles are preferred: lysC A279T (replacement of alanine at position 279 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by threonine), lysC A279V (replacement of alanine at position 279 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by valine), lysc S301F (replacement of serine at position 301 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by phenylalanine), lysC T308I (replacement of threonine at position 308 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine), lysC S301Y (replacement of serine at position 308 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by tyrosine), lysC G345D (replacement of glycine at position 345 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by aspartic acid), lysc R320G (replacement of arginine at position 320 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by glycine), lysC T311I (replacement of threonine at position 311 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine), lysc S381F (replacement of serine at position 381 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by phenylalanine).

[0099] The lysCFBR allele lysc T311I (replacement of threonine at position 311 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine), the nucleotide sequence of which is shown as SEQ ID NO: 3, is particularly preferred; the amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO: 4.

[0100] The following open reading frames, genes or nucleotide sequences, inter alia, can be used as the “further gene site” which is not essential for growth or lysine production: aecD, ccpA1, ccpA2, citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysR1, lysR2, lysR3, menE, mqo, pck, pgi, poxB and zwa2, in particular the genes aecD, gluA, gluB, gluC, gluD and pck. These are summarized and explained in Table 3. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used.

TABLE 1
Open reading frames, genes and alleles of lysine production
	Description of the coded enzyme or		Access
Name	protein	Reference	Number
accBC	Acyl-CoA Carboxylase	Jäger et al.	U35023
	EC 6.3.4.14	Archives of	AX123524
	(acyl-CoA carboxylase)	Microbiology	AX066441
		(1996) 166: 76-82
		EP1108790;
		WO0100805
accDA	Acetyl-CoA Carboxylase	EP1055725	AX121013
	EC 6.4.1.2	EP1108790	AX066443
	(acetyl-CoA carboxylase)	WO0100805
cstA	Carbon Starvation Protein A	EP1108790	AX120811
	(carbon starvation protein A)	WO0100804	AX066109
cysD	Sulfate Adenylyltransferase	EP1108790	AX123177
	sub-unit II
	EC 2.7.7.4
	(sulfate adenylyltransferase small chain)
cysE	Serine Acetyltransferase	EP1108790	AX122902
	EC 2.3.1.30	WO0100843	AX063961
	(serine acetyltransferase)
cysH	3′-Phosphoadenyl Sulfate Reductase	EP1108790	AX123178
	EC 1.8.99.4	WO0100842	AX066001
	(3′-phosphoadenosine 5′-
	phosphosulfate reductase)
cysK	Cysteine Synthase	EP1108790	AX122901
	EC 4.2.99.8	WO0100843	AX063963
	(cysteine synthase)
cysN	Sulfate Adenylyltransferase sub-unit I	EP1108790	AX123176
	EC 2.7.7.4	AX127152
	(sulfate adenylyltransferase)
cysQ	Transport protein CysQ	EP1108790	AX127145
	(transporter cysQ)	WO0100805	AX066423
dapA	Dihydrodipicolinate Synthase	Bonnassie et	X53993
	EC 4.2.1.52	al. Nucleic	Z21502
	(dihydrodipicolinate synthase)	Acids Research	AX123560
		18: 6421 (1990)	AX063773
		Pisabarro et
		al., Journal of
		Bacteriology
		175: 2743-2749
		(1993)
		EP1108790
		WO0100805
		EP0435132
		EP1067192
		EP1067193
dapB	Dihydrodipicolinate Reductase	EP1108790	AX127149
	EC 1.3.1.26	WO0100843	AX063753
	(dihydrodipicolinate reductase)	EP1067192	AX137723
		EP1067193	AX137602
		Pisabarro et	X67737
		al., Journal of	Z21502
		Bacteriology	E16749
		175: 2743-2749	E14520
		(1993)	E12773
		JP1998215883	E08900
		JP1997322774
		JP1997070291
		JP1995075578
dapC	N-Succinyl Aminoketopimelate	EP1108790	AX127146
	Transaminase	WO0100843	AX064219
	EC 2.6.1.17	EP1136559
	(N-succinyl diaminopimelate
	transaminase)
dapD	Tetrahydrodipicolinate Succinylase	EP1108790	AX127146
	EC 2.3.1.117	WO0100843	AX063757
	(tetrahydrodipicolinate	Wehrmann et al.	AJ004934
	succinylase)	Journal of
		Bacteriology
		180: 3159-3165
		(1998)
dapE	N-Succinyl Diaminopimelate	EP1108790	AX127146
	Desuccinylase	WO0100843	AX063749
	EC 3.5.1.18	Wehrmann et al.	X81379
	(N-succinyl diaminopimelate	Microbiology
	desuccinylase)	140: 3349-3356
		(1994)
dapF	Diaminopimelate Epimerase	EP1108790	AX127149
	EC 5.1.1.7	WO0100843	AX063719
	(diaminopimelate epimerase)	EP1085094	AX137620
ddh	Diaminopimelate Dehydrogenase	EP1108790	AX127152
	EC 1.4.1.16	WO0100843	AX063759
	(diaminopimelate dehydrogenase)	Ishino et al.,	Y00151
		Nucleic Acids	E14511
		Research	E05776
		15: 3917-3917	D87976
		(1987)
		JP1997322774
		JP1993284970
		Kim et al.,
		Journal of
		Microbiology
		and
		Biotechnology
		5: 250-256 (1995)
dps	DNA Protection Protein	EP1108790	AX127153
	(protection during starvation
	protein)
eno	Enolase	EP1108790	AX127146
	EC 4.2.1.11	WO0100844	AX064945
	(enolase)	EP1090998	AX136862
		Hermann et al.,
		Electrophoresis
		19: 3217-3221
		(1998)
gap	Glyceraldehyde 3-Phosphate	EP1108790	AX127148
	Dehydrogenase	WO0100844	AX064941
	EC 1.2.1.12	Eikmanns et	X59403
	(glyceraldehyde 3-phosphate	al., Journal of
	dehydrogenase)	Bacteriology
		174: 6076-6086
		(1992)
gap2	Glyceraldehyde 3-Phosphate	EP1108790	AX127146
	Dehydrogenase	WO0100844	AX064939
	EC 1.2.1.12
	(glyceraldehyde 3-phosphate
	dehydrogenase 2)
gdh	Glutamate Dehydrogenase	EP1108790	AX127150
	EC 1.4.1.4	WO0100844	AX063811
	(glutamate dehydrogenase)	Boermann et	X59404
		al., Molecular	X72855
		Microbiology
		6: 317-326
		(1992)
		Guyonvarch et
		al. NCBI
gnd	6-Phosphogluconate Dehydrogenase	EP1108790	AX127147
	EC 1.1.1.44		AX121689
	(6-phosphogluconate dehydrogenase)	WO0100844	AX065125
lysC	Aspartate Kinase	EP1108790	AX120365
	EC 2.7.2.4	WO0100844	AX063743
	(aspartate kinase)	Kalinowski et	X57226
		al., Molecular
		Microbiology
		5: 1197-204
		(1991)
lysCFBR	Aspartate Kinase feedback resistent (fbr)	see Table 2
	EC 2.7.2.4
	(aspartate kinase fbr)
lysE	Lysine Exporter	EP1108790	AX123539
	(lysine exporter protein)	WO0100843	AX123539
		Vrljićet al.,	X96471
		Molecular
		Microbiology
		22: 815-826
		(1996)
msiK	Sugar Importer	EP1108790	AX120892
	(multiple sugar import protein)
opcA	Glucose 6-Phosphate Dehydrogenase	WO0104325	AX076272
	(subunit of glucose 6-phosphate
	dehydrogenase)
oxyR	Transcription Regulator	EP1108790	AX122198
	(transcriptional regulator)		AX127149
ppcFBR	Phosphoenol Pyruvate Carboxylase	EP0723011
	feedback resistent	WO0100852
	EC 4.1.1.31
	(phosphoenol pyruvate carboxylase
	feedback resistant)
ppc	Phosphoenol Pyruvate Carboxylase	EP1108790	AX127148
	EC 4.1.1.31	O'Reagan et	AX123554
	(phosphoenol pyruvate carboxylase)	al., Gene	M25819
		77(2): 237-251
		(1989)
pgk	phosphoglycerate Kinase	EP1108790	AX121838
	EC 2.7.2.3	WO0100844	AX127148
	(phosphoglycerate kinase)	Eikmanns,	AX064943
		Journal of	X59403
		Bacteriology
		174: 6076-6086
		(1992)
pknA	Protein Kinase A	EP1108790	AX120131
	(protein kinase A)		AX120085
pknB	Protein Kinase B	EP1108790	AX120130
	(protein kinase B)		AX120085
pknD	Protein Kinase D	EP1108790	AX127150
	(protein kinase D)		AX122469
			AX122468
pknG	Protein Kinase G	EP1108790	AX127152
	(protein kinase G)		AX123109
ppsA	Phosphoenol Pyruvate Synthase	EP1108790	AX127144
	EC 2.7.9.2		AX120700
	(phosphoenol pyruvate synthase)		AX122469
ptsH	Phosphotransferase System Protein H	EP1108790	AX122210
	EC 2.7.1.69	WO0100844	AX127149
	(phosphotransferase system		AX069154
	component H)
ptsI	Phosphotransferase System Enzyme I	EP1108790	AX122206
	EC 2.7.3.9		AX127149
	(phosphotransferase system enzyme
	I)
ptsM	Glucose-specific	Lee et al.,	L18874
	Phosphotransferase System Enzyme	FEMS
	II	Microbiology
	EC 2.7.1.69	Letters 119(1-2):
	(glucose phosphotransferase-system	137-145
	enzyme II)	(1994)
pyc	Pyruvate Carboxylase	WO9918228	A97276
	EC 6.4.1.1	Peters-Wendisch	Y09548
	(pyruvate carboxylase)	et al.,
		Microbiology
		144: 915-927
		(1998)
pyc	Pyruvate Carboxylase	EP1108790
P458S	EC 6.4.1.1
	(pyruvate carboxylase)
	amino acid exchange P458S
sigC	Sigma Factor C	EP1108790	AX120368
	EC 2.7.7.6		AX120085
	(extracytoplasmic function
	alternative sigma factor C)
sigD	RNA Polymerase Sigma Factor D	EP1108790	AX120753
	EC 2.7.7.6		AX127144
	(RNA polymerase sigma factor)
sigE	Sigma Factor E	EP1108790	AX127146
	EC 2.7.7.6		AX121325
	(extracytoplasmic function
	alternative sigma factor E)
sigH	Sigma Factor H	EP1108790	AX127145
	EC 2.7.7.6		AX120939
	(sigma factor SigH)
sigM	Sigma Factor M	EP1108790	AX123500
	EC 2.7.7.6		AX127153
	(sigma factor SigM)
tal	Transaldolase	WO0104325	AX076272
	EC 2.2.1.2
	(transaldolase)
thyA	Thymidylate Synthase	EP1108790	AX121026
	EC 2.1.1.45		AX127145
	(thymidylate synthase)
tkt	Transketolase	Ikeda et al.,	AB023377
	EC 2.2.1.1	NCBI
	(transketolase)
tpi	Triose Phosphate Isomerase	Eikmanns,	X59403
	EC 5.3.1.1	Journal of
	(triose phosphate isomerase)	Bacteriology
		174: 6076-6086
		(1992)
zwal	Cell Growth Factor 1	EP1111062	AX133781
	(growth factor 1)
zwf	Glucose 6-Phosphate 1-	EP1108790	AX127148
	Dehydrogenase	WO0104325	AX121827
	EC 1.1.1.49		AX076272
	(glucose 6-phosphate 1-
	dehydrogenase)
zwf	Glucose 6-Phosphate 1-	EP1108790
A213T	Dehydrogenase
	EC 1.1.1.49
	(glucose 6-phosphate 1-
	dehydrogenase)
	amino acid exchange A213T

[0101]

TABLE 2
lysCFBR alleles which code for feed back resistant aspartate kinases
Name of the	Amino acid		Access
allele	replacement	Reference	Number
lysCFBR-E05108		JP 1993184366-A	E05108
		(sequence 1)
lysCFBR-E06825	lysC A279T	JP 1994062866-A	E06825
		(sequence 1)
lysCFBR-E06826	lysC A279T	JP 1994062866-A	E06826
		(sequence 2)
lysCFBR-E06827		JP 1994062866-A	E06827
		(sequence 3)
lysCFBR-E08177		JP 1994261766-A	E08177
		(sequence 1)
lysCFBR-E08178	lysC A279T	JP 1994261766-A	E08178
		(sequence 2)
lysCFBR-E08179	lysC A279V	JP 1994261766-A	E08179
		(sequence 3)
lysCFBR-E08180	lysC S301F	JP 1994261766-A	E08180
		(sequence 4)
lysCFBR-E08181	lysC T308I	JP 1994261766-A	E08181
		(sequence 5)
lysCFBR-E08182		JP 1994261766-A	E08182
lysCFBR-E12770		JP 1997070291-A	E12770
		(sequence 13)
lysCFBR-E14514		JP 1997322774-A	E14514
		(sequence 9)
lysCFBR-E16352		JP 1998165180-A	E16352
		(sequence 3)
lysCFBR-E16745		JP 1998215883-A	E16745
		(sequence 3)
lysCFBR-E16746		JP 1998215883-A	E16746
		(sequence 4)
lysCFBR-I74588		US 5688671-A	I74588
		(sequence 1)
lysCFBR-I74589	lysC A279T	US 5688671-A	I74589
		(sequence 2)
lysCFBR-I74590		US 5688671-A	I74590
		(sequence 7)
lysCFBR-I74591	lysC A279T	US 5688671-A	I74591
		(sequence 8)
lysCFBR-I74592		US 5688671-A	I74592
		(sequence 9)
lysCFBR-I74593	lysC A279T	US 5688671-A	I74593
		(sequence 10)
lysCFBR-I74594		US 5688671-A	I74594
		(sequence 11)
lysCFBR-I74595	lysC A279T	US 5688671-A	I74595
		(sequence 12)
lysCFBR-I74596		US 5688671-A	I74596
		(sequence 13)
lysCFBR-I74597	lysC A279T	US 5688671-A	I74597
		(sequence 14)
lysCFBR-X57226	lysC S301Y	EP0387527	X57226
		Kalinowski et
		al., Molecular
		and General
		Genetics
		224: 317-324
		(1990)
lysCFBR-L16848	lysC G345D	Follettie and	L16848
		Sinskey
		NCBI Nucleotide
		Database (1990)
lysCFBR-L27125	lysC R320G	Jetten et al.,	L27125
	lysC G345D	Applied
		Microbiology
		Biotechnology
		43: 76-82 (1995)
lysCFBR	lysC T311I	WO0063388
		(sequence 17)
lysCFBR	lysC S301F	US3732144
lysCFBR	lysC S381F
lysCFBR		JP6261766
		(sequence 1)
lysCFBR	lysC A279T	JP6261766
		(sequence 2)
lysCFBR	lysC A279V	JP6261766
		(sequence 3)
lysCFBR	lysC S301F	JP6261766
		(sequence 4)
lysCFBR	lysC T308I	JP6261766
		(sequence 5)

[0102]

TABLE 3
Further gene sites for integration of open reading frames,
genes and alleles of lysine production
Gene	Description of the coded		Access
name	enzyme or protein	Reference	Number
aecD	beta C-S Lyase	Rossol et al., Journal	M89931
	EC 2.6.1.1	of Bacteriology
	(beta C-S lyase)	174(9): 2968-77 (1992)
ccpA1	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX127147
	(catabolite control
	protein A1)
ccpA2	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX121594
	(catabolite control
	protein A2)
citA	Sensor Kinase CitA	EP1108790	AX120161
	(sensor kinase CitA)
citB	Transcription Regulator	EP1108790	AX120163
	CitB
	(transcription regulator
	CitB)
citE	Citrate Lyase	WO0100844	AX065421
	EC 4.1.3.6	EP1108790	AX127146
	(citrate lyase)
fda	Fructose Bisphosphate	von der Osten et al.,	X17313
	Aldolase	Molecular Microbiology
	EC 4.1.2.13	3(11): 1625-37 (1989)
	(fructose 1,6-
	bisphosphate aldolase)
gluA	Glutamate Transport ATP-	Kronemeyer et al.,	X81191
	binding Protein	Journal of Bacteriology
	(glutamate transport	177(5): 1152-8 (1995)
	ATP-binding protein)
gluB	Glutamate-binding	Kronemeyer et al.,	X81191
	Protein	Journal of Bacteriology
	(glutamate-binding	177(5): 1152-8 (1995)
	protein)
gluC	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177(5): 1152-8 (1995)
	system permease)
gluD	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177(5): 1152-8 (1995)
	system permease)
luxR	Transcription Regulator	WO0100842	AX065953
	LuxR	EP1108790	AX123320
	(transcription regulator
	LuxR)
luxS	Histidine Kinase LuxS	EP1108790	AX123323
	(histidine kinase LuxS)		AX127153
lysR1	Transcription Regulator	EP1108790	AX064673
	LysR1		AX127144
	(transcription regulator
	LysR1)
lysR2	Transcription Activator	EP1108790	AX123312
	LysR2
	(transcription regulator
	LysR2)
lysR3	Transcription Regulator	WO0100842	AX065957
	LysR3	EP1108790	AX127150
	(transcription regulator
	LysR3)
menE	O-Succinylbenzoic Acid	WO0100843	AX064599
	CoA Ligase	EP1108790	AX064193
	EC 6.2.1.26		AX127144
	(O-succinylbenzoate CoA ligase)
mqo	Malate-Quinone	Molenaar et al., Eur.	AJ224946
	Oxidoreductase	Journal of Biochemistry
	(malate-quinone-	1; 254(2): 395-403 (1998)
	oxidoreductase)
pck	Phosphoenol Pyruvate	WO0100844	AJ269506
	Carboxykinase		AX065053
	(phosphoenol pyruvate carboxykinase)
pgi	Glucose 6-Phosphate	EP1087015	AX136015
	Isomerase	EP1108790	AX127146
	EC 5.3.1.9
	(glucose-6-phosphate isomerase)
poxB	Pyruvate Oxidase	WO0100844	AX064959
	EC 1.2.3.3	EP1096013	AX137665
	(pyruvate oxidase)
zwa2	Cell Growth Factor 2	EP1106693	AX113822
	(growth factor 2)	EP1108790	AX127146

[0103] The invention accordingly also provides a process for the production of coryneform bacteria which produce L-lysine, characterized in that

[0104] a) the nucleotide sequence of a desired ORF, gene or allele of lysine production, optionally including the expression and/or regulation signals, is isolated

[0105] b) at least two copies of the nucleotide sequence of the ORF, gene or allele of lysine production are arranged in a row, preferably in tandem arrangement

[0106] c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,

[0107] d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and

[0108] e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele of lysine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally

[0109] f) at least a third copy of the open reading frame (ORF), gene or allele of lysine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

[0110] The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L-methionine and/or L-threonine, characterized in that

[0111] a) instead of the singular copy of an open reading frame (ORF), a gene or allele of methionine production or threonine production naturally present at the particular desired site (locus), these have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0112] b) optionally have at least a third copy of the open reading frame (ORF), gene or allele of methionine production or threonine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0113] The invention also furthermore provides a process for the preparation of L-methionine and/or L-threonine, which comprises the following steps:

[0114] a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which

[0115] i) instead of the singular copy of an open reading frame (ORF), gene or allele of methionine production or threonine production present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and

[0116] ii) optionally have at least a third copy of the open reading frame (ORF), gene or allele of methionine production or threonine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,

[0117] under conditions which allow expression of the said open reading frames (ORFs), genes or alleles,

[0118] b) concentration of the L-methionine and/or L-threonine in the fermentation broth,

[0119] c) isolation of the L-methionine and/or L-threonine from the fermentation broth, optionally

[0120] d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

[0121] A “copy of an open reading frame (ORF), gene or allele of methionine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alleles of which enhancement/over-expression can have the effect of improving methionine production.

[0122] These include, inter alia, the following open reading frames, genes or alleles: accBC, accDA, aecD, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dps, eno, fda, gap, gap2, gdh, gnd, glyA, hom, homFBR, lysC, lysCFBR, metA, metB, metE, metH, metY, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsI, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwa1, zwf and zwf A213T. These are summarized and explained in Table 4. These include, in particular, the lysCFBR alleles which code for a “feed back” resistant aspartate kinase (see Table 2) and the homFBR alleles which code for a “feed back” resistant homoserine dehydrogenase.

[0123] The at least third, optionally fourth or fifth copy of the open reading frame (ORF), gene or allele of methionine production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: brnE, brnF, brnQ, ccpA1, ccpA2, citA, citB, citE, ddh, gluA, gluB, gluC, gluD, luxR, luxS, lysR1, lysR2, lysR3, menE, metD, metK, pck, pgi, poxB and zwa2. These are summarized and explained in Table 5. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used for this.

TABLE 4
Open reading frames, genes and alleles of methionine production
			Access
Name	Description of the coded enzyme or protein	Reference	Number
accBC	Acyl-CoA Carboxylase	Jäger et al.	U35023
	EC 6.3.4.14	Archives of	AX123524
	(acyl-CoA carboxylase)	Microbiology	AX066441
		(1996) 166: 76-82
		EP1108790;
		WO0100805
accDA	Acetyl-CoA Carboxylase	EP1055725	AX121013
	EC 6.4.1.2	EP1108790	AX066443
	(acetyl-CoA carboxylase)	WO0100805
aecD	Cystathionine beta-Lyase	Rossol et al.,	M89931
	EC 4.4.1.8	Journal of
	(cystathionine beta-lyase)	Bacteriology
		174: 2968-2977
		(1992)
cstA	Carbon Starvation Protein A	EP1108790	AX120811
	(carbon starvation protein A)	WO0100804	AX066109
cysD	Sulfate Adenylyltransferase	EP1108790	AX123177
	sub-unit II
	EC 2.7.7.4
	(sulfate adenylyltransferase small
	chain)
cysE	Serine Acetyltransferase	EP1108790	AX122902
	EC 2.3.1.30	WO0100843	AX063961
	(serine acetyltransferase)
cysH	3′-Phosphoadenyl Sulfate Reductase	EP1108790	AX123178
	EC 1.8.99.4	WO0100842	AX066001
	(3′-phosphoadenosine 5′-
	phosphosulfate reductase)
cysK	Cysteine Synthase	EP1108790	AX122901
	EC 4.2.99.8	WO0100843	AX063963
	(cysteine synthase)
cysN	Sulfate Adenylyltransferase sub-	EP1108790	AX123176
	unit I		AX127152
	EC 2.7.7.4
	(sulfate adenylyltransferase)
cysQ	Transport protein CysQ	EP1108790	AX127145
	(transporter cysQ)	WO0100805	AX066423
dps	DNA Protection Protein	EP1108790	AX127153
	(protection during starvation
	protein)
eno	Enolase	EP1108790	AX127146
	EC 4.2.1.11	WO0100844	AX064945
	(enolase)	EP1090998	AX136862
		Hermann et al.,
		Electrophoresis
		19: 3217-3221
		(1998)
fda	Fructose Bisphosphate Aldolase	van der Osten et	X17313
	EC 4.1.12.13	al., Molecular
	(fructose bisphosphate aldolase)	Microbiology
		3: 1625-1637
		(1989)
gap	Glyceraldehyde 3-Phosphate	EP1108790	AX127148
	Dehydrogenase	WO0100844	AX064941
	EC 1.2.1.12	Eikmanns et al.,	X59403
	(glyceraldehyde 3-phosphate	Journal of
	dehydrogenase)	Bacteriology
		174: 6076-6086
		(1992)
gap2	Glyceraldehyde 3-Phosphate	EP1108790	AX127146
	Dehydrogenase	WO0100844	AX064939
	EC 1.2.1.12
	(glyceraldehyde 3-phosphate
	dehydrogenase 2)
gdh	Glutamate Dehydrogenase	EP1108790	AX127150
	EC 1.4.1.4	WO0100844	AX063811
	(glutamate dehydrogenase)	Boermann et al.,	X59404
		Molecular	X72855
		Microbiology
		6: 317-326 (1992)
		Guyonvarch et al,
		NCBI
glyA	Glycine/Serine	EP1108790	AX127146
	Hydroxymethyltransferase		AX121194
	EC 2.1.2.1
	(glycine/serine
	hydroxymethyltransferase)
gnd	6-Phosphogluconate Dehydrogenase	EP1108790	AX127147
	EC 1.1.1.44	WO0100844	AX121689
	(6-phosphogluconate dehydrogenase)		AX065125
hom	Homoserine Dehydrogenase	Peoples et al.,	Y00546
	EC 1.1.1.3	Molecular
	(homoserine dehydrogenase)	Microbiology
		2: 63-72 (1988)
homFBR	Homoserine Dehydrogenase feedback	Reinscheid et
	resistant (fbr)	al., Journal of
	EC 1.1.1.3	Bacteriology
	(homoserine dehydrogenase fbr)	173: 3228-30
		(1991)
lysC	Aspartate Kinase	EP1108790	AX120365
	EC 2.7.2.4	WO0100844	AX063743
	(aspartate kinase)	Kalinowski et	X57226
		al., Molecular
		Microbiology
		5: 1197-204 (1991)
lysCFBR	Aspartate Kinase feedback	see Table 2
	resistent (fbr)
	EC 2.7.2.4
	(aspartate kinase fbr)
metA	Homoserine Acetyltransferase	Park et al.,	AF052652
	EC 2.3.1.31	Molecular Cells
	(homoserine acetyltransferase)	8: 286-94 (1998)
metB	Cystathionine γ-Lyase	Hwang et al.,	AF126953
	EC 4.4.1.1	Molecular Cells
	(cystathionine gamma-synthase)	9: 300-308 (1999)
metE	Homocysteine Methyltransferase	EP1108790	AX127146
	EC 2.1.1.14		AX121345
	(homocysteine methyltransferase)
metH	Homocysteine Methyltransferase	EP1108790	AX127148
	(Vitamin B12-dependent)		AX121747
	EC 2.1.1.14
	(homocysteine methyltransferase)
metY	Acetylhomoserine Sulfhydrolase	EP1108790	AX120810
	(acetylhomoserine sulfhydrolase)		AX127145
msiK	Sugar Importer	EP1108790	AX120892
	(multiple sugar import protein)
opcA	Glucose 6-Phosphate Dehydrogenase	WO0104325	AX076272
	(subunit of glucose 6-phosphate
	dehydrogenase)
oxyR	Transcription Regulator	EP1108790	AX122198
	(transcriptional regulator)		AX127149
ppcFBR	Phosphoenol Pyruvate Carboxylase	EP0723011
	feedback resistent	WO0100852
	EC 4.1.1.31
	(phosphoenol pyruvate carboxylase
	feedback resistant)
ppc	Phosphoenol Pyruvate Carboxylase	EP1108790	AX127148
	EC 4.1.1.31	O'Reagan et al.,	AX123554
	(phosphoenol pyruvate carboxylase)	Gene 77(2): 237-251	M25819
		(1989)
pgk	Phosphoglycerate Kinase	EP1108790	AX121838
	EC 2.7.2.3	WO0100844	AX127148
	(phosphoglycerate kinase)	Eikmanns, Journal	AX064943
		of Bacteriology	X59403
		174: 6076-6086
		(1992)
pknA	Protein Kinase A	EP1108790	AX120131
	(protein kinase A)		AX120085
pknB	Protein Kinase B	EP1108790	AX120130
	(protein kinase B)		AX120085
pknD	Protein Kinase D	EP1108790	AX127150
	(protein kinase D)		AX122469
			AX122468
pknG	Protein Kinase G	EP1108790	AX127152
	(protein kinase G)		AX123109
ppsA	Phosphoenol Pyruvate Synthase	EP1108790	AX127144
	EC 2.7.9.2		AX120700
	(phosphoenol pyruvate synthase)		AX122469
ptsH	Phosphotransferase System Protein H	EP1108790	AX122210
	EC 2.7.1.69	WO0100844	AX127149
	(phosphotransferase system		AX069154
	component H)
ptsI	Phosphotransferase System Enzyme I	EP1108790	AX122206
	EC 2.7.3.9		AX127149
	(phosphotransferase system enzyme
	I)
ptsM	Glucose-specific	Lee et al., FEMS	L18874
	Phosphotransferase System Enzyme	Microbiology
	II	Letters 119 (1-2):
	EC 2.7.1.69	137-145 (1994)
	(glucose phosphotransferase-system
	enzyme II)
pyc	Pyruvate Carboxylase	WO9918228	A97276
	EC 6.4.1.1	Peters-Wendisch	Y09548
	(pyruvate carboxylase)	et al.,
		Microbiology
		144: 915-927
		(1998)
pyc	Pyruvate Carboxylase	EP1108790
P458S	EC 6.4.1.1
	(pyruvate carboxylase)
	amino acid exchange P458S
sigC	Sigma Factor C	EP1108790	AX120368
	EC 2.7.7.6		AX120085
	(extracytoplasmic function
	alternative sigma factor C)
sigD	RNA Polymerase Sigma Factor D	EP1108790	AX120753
	EC 2.7.7.6		AX127144
	(RNA polymerase sigma factor)
sigE	Sigma Factor E	EP1108790	AX127146
	EC 2.7.7.6		AX121325
	(extracytoplasmic function
	alternative sigma factor E)
sigH	Sigma Factor H	EP1108790	AX127145
	EC 2.7.7.6		AX120939
	(sigma factor SigH)
sigM	Sigma Factor M	EP1108790	AX123500
	EC 2.7.7.6		AX127153
	(sigma factor SigM)
tal	Transaldolase	WO0104325	AX076272
	EC 2.2.1.2
	(transaldolase)
thyA	Thymidylate Synthase	EP1108790	AX121026
	EC 2.1.1.45		AX127145
	(thymidylate synthase)
tkt	Transketolase	Ikeda et al.,	AB023377
	EC 2.2.1.1	NCBI
	(transketolase)
tpi	Triose Phosphate Isomerase	Eikmanns, Journal	X59403
	EC 5.3.1.1	of Bacteriology
	(triose phosphate isomerase)	174: 6076-6086
		(1992)
zwal	Cell Growth Factor 1	EP1111062	AX133781
	(growth factor 1)
zwf	Glucose 6-Phosphate 1-	EP1108790	AX127148
	Dehydrogenase	WO0104325	AX121827
	EC 1.1.1.49		AX076272
	(glucose 6-phosphate 1-
	dehydrogenase)
zwf	Glucose 6-Phosphate 1-	EP1108790
A213T	Dehydrogenase
	EC 1.1.1.49
	(glucose 6-phosphate 1-
	dehydrogenase)
	amino acid exchange A213T

[0124]

TABLE 5
Further gene sites for integration of open reading frames,
genes and alleles of methionine production
Gene	Description of the coded		Access
name	enzyme or protein	Reference	Number
brnE	Transporter of	EP1096010	AX137709
	branched-chain amino		AX137714
	acids
	(branched-chain amino
	acid transporter)
brnF	Transporter of	EP1096010	AX137709
	branched-chain amino		AX137714
	acids
	(branched-chain amino
	acid transporter)
brnQ	Carrier protein of	Tauch et al., Archives	M89931
	branched-chain amino	of Microbiology	AX066841
	acids	169 (4): 303-12 (1998)	AX127150
	(branched-chain amino	WO0100805
	acid transport system	EP1108790
	carrier protein)
ccpA1	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX127147
	(catabolite control
	protein A1)
ccpA2	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX121594
	(catabolite control
	protein A2)
citA	Sensor Kinase CitA	EP1108790	AX120161
	(sensor kinase CitA)
citB	Transcription Regulator	EP1108790	AX120163
	CitB
	(transcription
	regulator CitB)
citE	Citrate Lyase	WO0100844	AX065421
	EC 4.1.3.6	EP1108790	AX127146
	(citrate lyase)
ddh	Diaminopimelate	Ishino et al., Nucleic	S07384
	Dehydrogenase	Acids Research 15: 3917 (1987)	AX127152
	EC 1.4.1.16	EP1108790
	(diaminopimelate
	dehydrogenase)
gluA	Glutamate Transport	Kronemeyer et al.,	X81191
	ATP-binding Protein	Journal of Bacteriology
	(glutamate transport	177 (5): 1152-8 (1995)
	ATP-binding protein)
gluB	Glutamate-binding	Kronemeyer et al.,	X81191
	Protein	Journal of Bacteriology
	(glutamate-binding	177 (5): 1152-8 (1995)
	protein)
gluC	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177 (5): 1152-8 (1995)
	system permease)
gluD	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177 (5): 1152-8 (1995)
	system permease)
luxR	Transcription Regulator	WO0100842	AX065953
	LuxR	EP1108790	AX123320
	(transcription
	regulator LuxR)
luxS	Histidine Kinase LuxS	EP1108790	AX123323
	(histidine kinase LuxS)		AX127153
lysR1	Transcription Regulator	EP1108790	AX064673
	LysR1		AX127144
	(transcription
	regulator LysR1)
lysR2	Transcription Activator	EP1108790	AX123312
	LysR2
	(transcription
	regulator LysR2)
lysR3	Transcription Regulator	WO0100842	AX065957
	LysR3	EP1108790	AX127150
	(transcription
	regulator LysR3)
menE	O-Succinylbenzoic Acid	WO0100843	AX064599
	CoA Ligase	EP1108790	AX064193
	EC 6.2.1.26		AX127144
	(O-succinylbenzoate CoA ligase)
metD	Transcription Regulator	EP1108790	AX123327
	MetD		AX127153
	(transcription regulator MetD)
metK	Methionine Adenosyl	WO0100843	AX063959
	Transferase	EP1108790	AX127148
	EC 2.5.1.6
	(S-adenosylmethionine
	synthetase)
pck	Phosphoenol Pyruvate	WO0100844	AJ269506
	Carboxykinase		AX065053
	(phosphoenol pyruvate
	carboxykinase)
pgi	Glucose 6-Phosphate	EP1087015	AX136015
	Isomerase	EP1108790	AX127146
	EC 5.3.1.9
	(glucose-6-phosphate isomerase)
poxB	Pyruvate Oxidase	WO0100844	AX064959
	EC 1.2.3.3	EP1096013	AX137665
	(pyruvate oxidase)
zwa2	Cell Growth Factor 2	EP1106693	AX113822
	(growth factor 2)	EP1108790	AX127146

[0125] A “copy of an open reading frame (ORF), gene or allele of threonine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alleles of which enhancement/over-expression can have the effect of improving threonine production.

[0126] These include, inter alia, the following open reading frames, genes or alleles: accBC, accDA, cstA, cysD, cysE, cysH, cysI, cysN, cysQ, dps, eno, fda, gap, gap2, gdh, gnd, hom, homFBR, lysC, lysCFBR, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsI, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, thrB, thrC, thrE, zwa1, zwf and zwf A213T. These are summarized and explained in Table 6. These include, in particular, the lysCFBR alleles which code for a “feed back” resistant aspartate kinase (See Table 2) and the homFBR alleles which code for a “feed back” resistant homoserine dehydrogenase.

[0127] The at least third, optionally fourth or fifth copy of the open reading frame (ORF), gene or allele of threonine production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: ccpA1, ccpA2, citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, ilvBN, ilvC, ilvD, luxR, luxS, lysR1, lysR2, lysR3, mdh, menE, metA, metD, pck, poxB, sigB and zwa2. These are summarized and explained in Table 7. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used for this.

TABLE 6
Open reading frames, genes and alleles of threonine production
			Access
Name	Description of the coded enzyme or protein	Reference	Number
accBC	Acyl-CoA Carboxylase	Jäger et al.	U35023
	EC 6.3.4.14	Archives of	AX123524
	(acyl-CoA carboxylase)	Microbiology	AX066441
		(1996) 166: 76-82
		EP1108790;
		WO0100805
accDA	Acetyl-CoA Carboxylase	EP1055725	AX121013
	EC 6.4.1.2	EP1108790	AX066443
	(acetyl-CoA carboxylase)	WO0100805
cstA	Carbon Starvation Protein A	EP1108790	AX120811
	(carbon starvation protein A)	WO0100804	AX066109
cysD	Sulfate Adenylyltransferase	EP1108790	AX123177
	sub-unit II
	EC 2.7.7.4
	(sulfate adenylyltransferase small
	chain)
cysE	Serine Acetyltransferase	EP1108790	AX122902
	EC 2.3.1.30	WO0100843	AX063961
	(serine acetyltransferase)
cysH	3′-Phosphoadenyl Sulfate Reductase	EP1108790	AX123178
	EC 1.8.99.4	WO0100842	AX066001
	(3′-phosphoadenosine 5′-phosphosulfate
	reductase)
cysK	Cysteine Synthase	EP1108790	AX122901
	EC 4.2.99.8	WO0100843	AX063963
	(cysteine synthase)
cysN	Sulfate Adenylyltransferase sub-unit I	EP1108790	AX123176
	EC 2.7.7.4		AX127152
	(sulfate adenylyltransferase)
cysQ	Transport protein CysQ	EP1108790	AX127145
	(transporter cysQ)	WO0100805	AX066423
dps	DNA Protection Protein	EP1108790	AX127153
	(protection during starvation protein)
eno	Enolase	EP1108790	AX127146
	EC 4.2.1.11	WO0100844	AX064945
	(enolase)	EP1090998	AX136862
		Hermann et al.,
		Electrophoresis
		19: 3217-3221
		(1998)
fda	Fructose Bisphosphate Aldolase	van der Osten	X17313
	EC 4.1.2.13	et al.,
	(fructose bisphosphate aldolase)	Molecular
		Microbiology
		3: 1625-1637
		(1989)
gap	Glyceraldehyde 3-Phosphate Dehydrogenase	EP1108790	AX127148
	EC 1.2.1.12	WO0100844	AX064941
	(glyceraldehyde 3-phosphate	Eikmanns et	X59403
	dehydrogenase)	al., Journal of
		Bacteriology
		174: 6076-6086
		(1992)
gap2	Glyceraldehyde 3-Phosphate Dehydrogenase	EP1108790	AX127146
	EC 1.2.1.12	WO0100844	AX064939
	(glyceraldehyde 3-phosphate
	dehydrogenase 2)
gdh	Glutamate Dehydrogenase	EP1108790	AX127150
	EC 1.4.1.4	WO0100844	AX063811
	(glutamate dehydrogenase)	Boermann et	X59404
		al., Molecular	X72855
		Microbiology
		6: 317-326
		(1992)
		Guyonvarch et
		al, NCBI
gnd	6-Phosphogluconate Dehydrogenase	EP1108790	AX127147
	EC 1.1.1.44	WO0100844	AX121689
	(6-phosphogluconate dehydrogenase)		AX065125
hom	Homoserine Dehydrogenase	Peoples et al.,	Y00546
	EC 1.1.1.3	Molecular
	(homoserine dehydrogenase)	Microbiology
		2: 63-72 (1988)
hornFBR	Homoserine Dehydrogenase feedback	Reinscheid et
	resistant (fbr)	al., Journal of
	EC 1.1.1.3	Bacteriology
	(homoserine dehydrogenase fbr)	173: 3228-30
		(1991)
lysC	Aspartate Kinase	EP1108790	AX120365
	EC 2.7.2.4	WO0100844	AX063743
	(aspartate kinase)	Kalinowski et	X57226
		al., Molecular
		Microbiology
		5: 1197-204
		(1991)
lysCFBR	Aspartate Kinase feedback resistent	see Table 2
	(fbr)
	EC 2.7.2.4
	(aspartate kinase fbr)
msiK	Sugar Importer	EP1108790	AX120892
	(multiple sugar import protein)
opcA	Glucose 6-Phosphate Dehydrogenase	WO0104325	AX076272
	(subunit of glucose 6-phosphate
	dehydrogenase)
oxyR	Transcription Regulator	EP1108790	AX122198
	(transcriptional regulator)		AX127149
ppcFBR	Phosphoenol Pyruvate Carboxylase	EP0723011
	feedback resistent	WO0100852
	EC 4.1.1.31
	(phosphoenol pyruvate carboxylase
	feedback resistant)
ppc	Phosphoenol Pyruvate Carboxylase	EP1108790	AX127148
	EC 4.1.1.31	O′Reagan et	AX123554
	(phosphoenol pyruvate carboxylase)	al., Gene	M25819
		77(2): 237-251
		(1989)
pgk	Phosphoglycerate Kinase	EP1108790	AX121838
	EC 2.7.2.3	WO0100844	AX127148
	(phosphoglycerate kinase)	Eikmanns,	AX064943
		Journal of	X59403
		Bacteriology
		174: 6076-6086
		(1992)
pknA	Protein Kinase A	EP1108790	AX120131
	(protein kinase A)		AX120085
pknB	Protein Kinase B	EP1108790	AX120130
	(protein kinase B)		AX120085
pknD	Protein Kinase D	EP1108790	AX127150
	(protein kinase D)		AX122469
			AX122468
pknG	Protein Kinase G	EP1108790	AX127152
	(protein kinase G)		AX123109
ppsA	Phosphoenol Pyruvate Synthase	EP1108790	AX127144
	EC 2.7.9.2		AX120700
	(phosphoenol pyruvate synthase)		AX122469
ptsH	Phosphotransferase System Protein H	EP1108790	AX122210
	EC 2.7.1.69	WO0100844	AX127149
	(phosphotransferase system component H)		AX069154
ptsI	Phosphotransferase System Enzyme I	EP1108790	AX122206
	EC 2.7.3.9		AX127149
	(phosphotransferase system enzyme I)
ptsM	Glucose-specific Phosphotransferase	Lee et al.,	L18874
	System Enzyme II	FEMS
	EC 2.7.1.69	Microbiology
	(glucose phosphotransferase-system	Letters 119(1-2):
	enzyme II)	137-145
		(1994)
pyc	Pyruvate Carboxylase	WO9918228	A97276
	EC 6.4.1.1	Peters-Wendisch	Y09548
	(pyruvate carboxylase)	et al.,
		Microbiology
		144: 915-927
		(1998)
pyc	Pyruvate Carboxylase	EP1108790
P458S	EC 6.4.1.1
	(pyruvate carboxylase)
	amino acid exchange P458S
sigC	Sigma Factor C	EP1108790	AX120368
	EC 2.7.7.6		AX120085
	(extracytoplasmic function alternative
	sigma factor C)
sigD	RNA Polymerase Sigma Factor D	EP1108790	AX120753
	EC 2.7.7.6		AX127144
	(RNA polymerase sigma factor)
sigE	Sigma Factor E	EP1108790	AX127146
	EC 2.7.7.6		AX121325
	(extracytoplasmic function alternative
	sigma factor E)
sigH	Sigma Factor H	EP1108790	AX127145
	EC 2.7.7.6		AX120939
	(sigma factor SigH)
sigM	Sigma Factor M	EP1108790	AX123500
	EC 2.7.7.6		AX127153
	(sigma factor SigM)
tal	Transaldolase	WO0104325	AX076272
	EC 2.2.1.2
	(transaldolase)
thrB	Homoserine Kinase	Peoples et al.,	Y00546
	EC 2.7.1.39	Molecular
	(homoserine kinase)	Microbiology
		2: 63-72 (1988)
thrC	Threonine Synthase	Han et al.,	X56037
	EC 4.2.99.2	Molecular
	(threonine synthase)	Microbiology
		4: 1693-1702
		(1990)
thrE	Threonine Exporter	EP1085091	AX137526
	(threonine export carrier)
thyA	Thymidylate Synthase	EP1108790	AX121026
	EC 2.1.1.45		AX127145
	(thymidylate synthase)
tkt	Transketolase	Ikeda et al.,	AB023377
	EC 2.2.1.1	NCBI
	(transketolase)
tpi	Triose Phosphate Isomerase	Eikmanns,	X59403
	EC 5.3.1.1	Journal of
	(triose phosphate isomerase)	Bacteriology
		174: 6076-6086
		(1992)
zwal	Cell Growth Factor 1	EP1111062	AX133781
	(growth factor 1)
zwf	Glucose 6-Phosphate 1-Dehydrogenase	EP1108790
	EC 1.1.1.49	WO0104325
	(glucose 6-phosphate 1-dehydrogenase)
zwf	Glucose 6-Phosphate 1-Dehydrogenase	EP1108790	AX127148
A213T	EC 1.1.1.49		AX121827
	(glucose 6-phosphate 1-dehydrogenase)		AX076272
	amino acid exchange A213T

[0128]

TABLE 7
Further gene sites for integration of open reading frames,
genes and alleles of threonine production
Gene	Description of the coded		Access
name	enzyme or protein	Reference	Number
ccpA1	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX127147
	(catabolite control
	protein A1)
ccpA2	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX121594
	(catabolite control
	protein A2)
citA	Sensor Kinase CitA	EP1108790	AX120161
	(sensor kinase CitA)
citB	Transcription Regulator	EP1108790	AX120163
	CitB
	(transcription regulator
	CitB)
citE	Citrate Lyase	WO0100844	AX065421
	EC 4.1.3.6	EP1108790	AX127146
	(citrate lyase)
ddh	Diaminopimelate	Ishino et al., Nucleic	S07384
	Dehydrogenase	Acids Research 15: 3917 (1987)	AX127152
	EC 1.4.1.16
	(diaminopimelate	EP1108790
	dehydrogenase)
gluA	Glutamate Transport ATP-binding	Kronemeyer et al.,	X81191
	Protein	Journal of Bacteriology
	(glutamate transport ATP-binding	177 (5): 1152-8 (1995)
	protein)
gluB	Glutamate-binding Protein	Kronemeyer et al.,	X81191
	(glutamate-binding	Journal of Bacteriology
	protein)	177 (5): 1152-8 (1995)
gluC	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177 (5): 1152-8 (1995)
	system permease)
gluD	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of Bacteriology
	(glutamate transport	177 (5): 1152-8 (1995)
	system permease)
glyA	Glycine	WO0100843	AX063861
	Hydroxymethyltransferase		AF327063
	EC 2.1.2.1
	(glycine
	hydroxymethyltransferase)
ilvA	Threonine Dehydratase	Möckel et al., Journal	A47044
	EC 4.2.1.16	of Bacteriology 174	L01508
	(threonine dehydratase)	(24), 8065-8072 (1992)	AX127150
		EP1108790
ilvBN	Acetolactate Synthase	Keilhauer et al.,	A48648
	EC 4.1.3.18	Journal of Bacteriology	L09232
	(acetolactate synthase)	175 (17): 5595-603 (1993)	AX127147
		EP1108790
ilvC	Reductoisomerase	Keilhauer et al.,	C48648
	EC 1.1.1.86	Journal of Bacteriology	AX127147
	(ketol-acid	175 (17): 5595-603 (1993)
	reductoisomerase)	EP1108790
ilvD	Dihydroxy-acid	EP1006189	AX136925
	Dehydratase
	EC 4.2.1.9
	(dihydroxy-acid
	dehydratase)
luxR	Transcription Regulator	WO0100842	AX065953
	LuxR	EP1108790	AX123320
	(transcription regulator
	LuxR)
luxS	Histidine Kinase LuxS	EP1108790	AX123323
	(histidine kinase LuxS)		AX127153
lysR1	Transcription Regulator	EP1108790	AX064673
	LysR1		AX127144
	(transcription regulator
	LysR1)
lysR2	Transcription Activator	EP1108790	AX123312
	LysR2
	(transcription regulator
	LysR2)
lysR3	Transcription Regulator	WO0100842	AX065957
	LysR3	EP1108790	AX127150
	(transcription regulator
	LysR3)
mdh	Malate Dehydrogenase	WO0100844	AX064895
	EC 1.1.1.37
	(malate dehydrogenase)
menE	O-Succinylbenzoic Acid	WO0100843	AX064599
	CoA Ligase	EP1108790	AX064193
	EC 6.2.1.26		AX127144
	(O-succinylbenzoate CoA
	ligase)
metA	Homoserine O-	Park et al., Molecular	AX063895
	Acetyltransferase	Cells 30; 8 (3): 286-94	AX127145
	EC 2.3.1.31	(1998)
	(homoserine O-	WO0100843
	acetyltransferase)	EP1108790
metD	Transcription Regulator	EP1108790	AX123327
	MetD		AX127153
	(transcription regulator
	MetD)
pck	Phosphoenol Pyruvate	WO0100844	AJ269506
	Carboxykinase		AX065053
	(phosphoenol pyruvate
	carboxykinase)
poxB	Pyruvate Oxidase	WO0100844	AX064959
	EC 1.2.3.3	EP1096013	AX137665
	(pyruvate oxidase)
sigB	RNA Polymerase	EP1108790	AX127149
	Transcription Factor
	(RNA polymerase
	transcription factor)
zwa2	Cell Growth Factor 2	EP1106693	AX113822
	(growth factor 2)	EP1108790	AX127146

[0129] The invention accordingly also provides a process for the production of coryneform bacteria which produce L-methionine and/or L-threonine, characterized in that

[0130] a) the nucleotide sequence of a desired ORF, gene or allele of methionine production or threonine production, optionally including the expression and/or regulation signals, is isolated

[0131] b) at least two copies of the nucleotide sequence of the ORF, gene or allele of methionine production or threonine production are arranged in a row, preferably in tandem arrangement

[0132] c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,

[0133] d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and

[0134] e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele of methionine or threonine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally

[0135] f) at least a third copy of the open reading frame (ORF), gene or allele of methionine production or threonine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

[0136] The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L-valine, characterized in that

[0137] a) instead of the singular copy of an open reading frame (ORF), a gene or allele of valine production naturally present at the particular desired site (locus), these have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0138] b) optionally have at least a third copy of the open reading frame (ORF), gene or allele of valine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0139] The invention also furthermore provides a process for the preparation of L-valine, which comprises the following steps:

[0140] a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which

[0141] i) instead of the singular copy of an open reading frame (ORF), gene or allele of valine production present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and

[0142] ii) optionally have at least a third copy of the open reading frame (ORF), gene or allele of valine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,

[0143] under conditions which allow expression of the said open reading frames (ORFs), genes or alleles,

[0144] b) concentration of the L-valine in the fermentation broth,

[0145] c) isolation of the L-valine from the fermentation broth, optionally

[0146] d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

[0147] A “copy of an open reading frame (ORF), gene or allele of valine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alleles of which enhancement/over-expression can have the effect of improving valine production.

[0148] These include, inter alia, the following open reading frames, genes or alleles: brnE, brnF, brnEF, cstA, cysD, dps, eno, fda, gap, gap2, gdh, ilvB, ilvN, ilvBN, ilvC, ilvD, ilvE msiK, pgk, ptsH, ptsI, ptsM, sigC, sigD, sigE, sigH, sigM, tpi and zwa1. These are summarized and explained in Table 8. These include in particular the ilvBN alleles which code for a valine-resistant acetolactate synthase.

[0149] The at least third, optionally fourth or fifth copy of the open reading frame (ORF), gene or allele of valine production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: aecD, ccpA1, ccpA2, citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, luxR, lysR1, lysR2, lysR3, panB, panC, poxB and zwa2. These are summarized and explained in Table 9. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used for this.

TABLE 8
Open reading frames, genes and alleles of valine production
	Description of the coded enzyme or		Access
Name	protein	Reference	Number
brnEF	Export of branched-chain amino	EP1096010	AF454053
	acids	Kennerknecht et
	(branched chain amino acid export)	al., NCBI
cstA	Carbon Starvation Protein A	EP1108790	AX120811
	(carbon starvation protein A)	WO0100804	AX066109
dps	DNA Protection Protein	EP1108790	AX127153
	(protection during starvation
	protein)
eno	Enolase	EP1108790	AX127146
	EC 4.2.1.11	WO0100844	AX064945
	(enolase)	EP1090998	AX136862
		Hermann et al.,
		Electrophoresis
		19: 3217-3221
		(1998)
fda	Fructose Bisphosphate Aldolase	van der Osten et	X17313
	EC 4.1.2.13	al., Molecular
	(fructose bisphosphate aldolase)	Microbiology
		3: 1625-1637
		(1989)
gap	Glyceraldehyde 3-Phosphate	EP1108790	AX127148
	Dehydrogenase	WO0100844	AX064941
	EC 1.2.1.12	Eikmanns et al.,	X59403
	(glyceraldehyde 3-phosphate	Journal of
	dehydrogenase)	Bacteriology
		174: 6076-6086
		(1992)
gap2	Glyceraldehyde 3-Phosphate	EP1108790	AX127146
	Dehydrogenase	WO0100844	AX064939
	EC 1.2.1.12
	(glyceraldehyde 3-phosphate
	dehydrogenase 2)
gdh	Glutamate Dehydrogenase	EP1108790	AX127150
	EC 1.4.1.4	WO0100844	AX063811
	(glutamate dehydrogenase)	Boermann et al.,	X59404
		Molecular
		Microbiology
		6: 317-326
		(1992);
		Guyonvarch et	X72855
		al., NCBI
ilvBN	Acetolactate Synthase	Keilhauer et	L09232
	EC 4.1.3.18	al., Journal of
	(acetolactate synthase)	Bacteriology
		175 (17): 5595-603
		(1993)
		EP1108790	AX127147
ilvC	Isomeroreductase	Keilhauer et	C48648
	EC 1.1.1.86	al., Journal of	AX127147
	(acetohydroxy acid	Bacteriology
	isomeroreductase)	175 (17): 5595-603
		(1993)
		EP1108790
ilvD	Dihydroxy-acid Dehydratase	EP1006189	AX136925
	EC 4.2.1.9
	(dihydroxy acid dehydratase)
ilvE	Transaminase B	EP1108790	AX127150
	EC 2.6.1.42		AX122498
	(transaminase B)
msiK	Sugar Importer	EP1108790	AX120892
	(multiple sugar import protein)
pgk	Phosphoglycerate Kinase	EP1108790	AX121838
	EC 2.7.2.3	WO0100844	AX127148
	(phosphoglycerate kinase)	Eikmanns,	AX064943
		Journal of,	X59403
		Bacteriology
		174: 6076-6086
		(1992)
ptsH	Phosphotransferase System Protein H	EP1108790	AX122210
	EC 2.7.1.69	WO0100844	AX127149
	(phosphotransferase system		AX069154
	component H)
ptsI	Phosphotransferase System Enzyme I	EP1108790	AX122206
	EC 2.7.3.9		AX127149
	(phosphotransferase system enzyme I)
ptsM	Glucose-specific Phosphotransferase	Lee et al., FEMS	L18874
	System Enzyme II	Microbiology
	EC 2.7.1.69	Letters 119 (1-2):
	(glucose phosphotransferase-system enzyme II)	137-145 (1994)
sigC	Sigma Factor C	EP1108790	AX120368
	EC 2.7.7.6		AX120085
	(extracytoplasmic function
	alternative sigma factor C)
sigD	RNA Polymerase Sigma Factor D	EP1108790	AX120753
	EC 2.7.7.6		AX127144
	(RNA polymerase sigma factor)
sigE	Sigma Factor E	EP1108790	AX127146
	EC 2.7.7.6		AX121325
	(extracytoplasmic function
	alternative sigma factor E)
sigH	Sigma Factor H	EP1108790	AX127145
	EC 2.7.7.6		AX120939
	(sigma factor SigH)
sigM	Sigma Factor M	EP1108790	AX123500
	EC 2.7.7.6		AX127153
	(sigma factor SigM)
tpi	Triose Phosphate Isomerase	Eikmanns,	X59403
	EC 5.3.1.1	Journal of
	(triose phosphate isomerase)	Bacteriology
		174: 6076-6086
		(1992)
zwa1	Cell Growth Factor 1	EP1111062	AX133781
	(growth factor 1)

[0150]

TABLE 9
Further gene sites for integration of open reading frames,
genes and alleles of valine production
Gene	Description of the coded		Access
name	enzyme or protein	Reference	Number
aecD	beta C-S Lyase	Rossol et al.,	M89931
	EC 2.6.1.1	Journal
	(beta C-S lyase)	of Bacteriology
		174(9): 2968-77
		(1992)
ccpA1	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX127147
	(catabolite control
	protein A1)
ccpA2	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX121594
	(catabolite control
	protein A2)
citA	Sensor Kinase CitA	EP1108790	AX120161
	(sensor kinase CitA)
citB	Transcription Regulator	EP1108790	AX120163
	CitB
	(transcription regulator
	CitB)
citE	Citrate Lyase	WO0100844	AX065421
	EC 4.1.3.6	EP1108790	AX127146
	(citrate lyase)
ddh	Diaminopimelate	Ishino et al.,	S07384
	Dehydrogenase	Nucleic Acids	AX127152
	EC 1.4.1.16	Research 15: 3917
	(diaminopimelate	(1987) EP1108790
	dehydrogenase)
gluA	Glutamate Transport ATP-	Kronemeyer et al.,	X81191
	binding Protein	Journal of
	(glutamate transport ATP-	Bacteriology 177(5):
	binding protein)	1152-8 (1995)
gluB	Glutamate-binding Protein	Kronemeyer et al.,	X81191
	(glutamate-binding	Journal of
	protein)	Bacteriology 177(5):
		1152-8 (1995)
gluC	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of
	(glutamate transport	Bacteriology 177(5):
	system permease)	1152-8 (1995)
gluD	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of
	(glutamate transport	Bacteriology 177(5):
	system permease)	1152-8 (1995)
glyA	Glycine	WO0100843	AX063861
	Hydroxymethyltransferase		AF327063
	EC 2.1.2.1
	(glycine
	hydroxymethyltransferase)
ilvA	Threonine Dehydratase	Mockel et al.,	A47044
	EC 4.2.1.16	Journal of	L01508
	(threonine dehydratase)	Bacteriology 174	AX127150
		(24), 8065-8072
		(1992) EP1108790
luxR	Transcription Regulator	WO0100842	AX065953
	LuxR	EP1108790	AX123320
	(transcription regulator
	LuxR)
lysR1	Transcription Regulator	EP1108790	AX064673
	LysR1		AX127144
	(transcription regulator
	LysR1)
lysR2	Transcription Activator	EP1108790	AX123312
	LysR2
	(transcription regulator
	LysR2)
lysR3	Transcription Regulator	WO0100842	AX065957
	LysR3	EP1108790	AX127150
	(transcription regulator
	LysR3)
panB	Ketopantoate	US6177264	X96580
	Hydroxymethyltransferase
	EC 2. 1. 2. 11
	(ketopantoate
	hydroxymethyltransferase)
panC	Pantothenate Synthetase	US6177264	X96580
	EC 6.3.2.1
	(pantothenate synthetase)
poxB	Pyruvate Oxidase	WO0100844	AX064959
	EC 1.2.3.3	EP1096013	AX137665
	(pyruvate oxidase)
zwa2	Cell Growth Factor 2	EP1106693	AX113822
	(growth factor 2)	EP1108790	AX127146

[0151] The invention accordingly also provides a process for the production of coryneform bacteria which produce L-valine, characterized in that

[0152] a) the nucleotide sequence of a desired ORF, gene or allele of valine production, optionally including the expression and/or regulation signals, is isolated

[0153] b) at least two copies of the nucleotide sequence of the ORF, gene or allele of valine production are arranged in a row, preferably in tandem arrangement

[0154] c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,

[0155] d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and

[0156] e) coryneform bacteria which have at least two copies of the desired open ORF, gene or allele of valine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally

[0157] f) at least a third copy of the open reading frame (ORF), gene or allele of valine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

[0158] The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L-tryptophane, characterized in that

[0159] a) instead of the singular copy of an open reading frame (ORF), a gene or allele of tryptophane production naturally present at the particular desired site (locus), these have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these

[0160] b) optionally have at least a third copy of the open reading frame (ORF), gene or allele of tryptophane production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

[0161] The invention also furthermore provides a process for the preparation of L-tryptophane, which comprises the following steps:

[0162] a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which

[0163] iii) instead of the singular copy of an open reading frame (ORF), gene or allele of tryptophane production present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and

[0164] iv) optionally have at least a third copy of the open reading frame (ORF), gene or allele of tryptophane production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,

[0165] under conditions which allow expression of the said open reading frames (ORFs), genes or alleles,

[0166] b) concentration of the L-tryptophane in the fermentation broth,

[0167] c) isolation of the L-tryptophane from the fermentation broth, optionally

[0168] d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

[0169] A “copy of an open reading frame (ORF), gene or allele of tryptophane production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alleles of which enhancement/over-expression can have the effect of improving tryptophane production.

[0170] These include, inter alia, the following open reading frames, genes or alleles: aroA, aroB, aroC, aroD, aroE, aroG, aroK, cstA, eno, gap, gap2, gnd, ppsA, rpe, serA, serB, serC, tal, thyA, tkt, tpi, trpA, trpB, trpc, trpD optionally comprising at least one of the amino acid exchanges selected from the group consisting of A215T (exchange of alanine at position 215 against threonine), D138A (exchange of aspartic acid at position 138 against alanine), S149F (exchange of serine at position 149 against phenylalanine) and A162E (exchange of alanine at position 162 against glutamic acid), trpE, trpEFBR comprising e.g. the amino acid exchange S38R (exchange of serine at position 38 against arginine), trpG, trpL optionally comprising the mutation W14*, zwa1, zwf optionally comprising the amino acid exchange A213T (exchange of alanine at position 213 against threonine). These are summarized and explained in Table 10. These include in particular the tryptophane operon comprising trpL, trpE, trpG, trpD, trpc and trpA. Furthermore these include in particular a trpEFBR allele which codes for a tryptophane-resistant anthranilate synthase.

[0171] The at least third, optionally fourth or fifth copy of the open reading frame (ORF), gene or allele of tryptophane production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: ccpA1, ccpA2, citA, citB, citE, cysE, gluA, gluB, gluC, gluD, glyA, luxR, luxS, lysR1, lysR2, lysR3, menE, pgi, pheA, poxB and zwa2. These are summarized and explained in Table 11. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages or DNA coding for phage components contained in the chromosome can be used for this.

TABLE 10
Open reading frames, genes and alleles of tryptophane
production
Gene	Description of the coded enzyme or		Access-
name	protein	Reference	Number
aroA	Enolpyruvylshikimate Phosphate	O'Donohue et al.,	AF114233
	Synthase	NCBI
	EC 2.5.1.19
	(enolpyruvylshikimate 3-phosphate synthase)
aroB	Dehydroquinate Synthetase	Burke et al.,	AF124600
	EC 4.6.1.3	NCBI
	(dehydroquinate synthetase)
aroC	Chorismate Synthase	Burke et al.,	AF124600
	EC 4.6.1.4	NCBI
	(chorismate synthase)
aroD	Dehydroquinate Dehydratase	Joy et al.,	AF124518
	EC 4.2.1.10	NCBI
	(dehydroquinate dehydratase)
aroE	Shikimate Dehydrogenase	Joy et al.,	AF124518
	EC 1.1.1.25	NCBI
	(shikimate dehydrogenase)
aroG	Dehydro-3-Deoxyphosphoheptonate	Chen et al.,	L07603
	Aldolase	FEMS
	EC 4.1.2.15	Microbioliology
	(dehydro-3-deoxyphosphoheptonate	Letters
	aldolase)	107: 223-230
		(1993).
aroK	Shikimate Kinase	Burke et al.,	AF124600
	EC 2.7.1.71	NCBI
	(shikimate kinase)
cstA	Carbon Starvation Protein A	EP1108790	AX120811
	(carbon starvation protein A)	WO0100804	AX066109
eno	Enolase	EP1108790	AX127146
	EC 4.2.1.11	WO0100844	AX064945
	(enolase)	EP1090998	AX136862
		Hermann et al.,
		Electrophoresis
		19: 3217-3221
		(1998)
gap	Glyceraldehyde-3-Phosphate	EP1108790	AX127148
	Dehydrogenase	WO0100844	AX064941
	EC 1.2.1.12	Eikmanns et al.,	X59403
	(glyceraldehyde-3-phosphate	Journal of
	dehydrogenase)	Bacteriology
		174: 6076-6086
		(1992)
gap2	Glyceraldehyde-3-Phosphate	EP1108790	AX127146
	Dehydrogenase	WO0100844	AX064939
	EC 1.2.1.12
	(glyceraldehyde-3-phosphate
	dehydrogenase 2)
gnd	6-Phosphogluconate Dehydrogenase	EP1108790	AX127147
	EC 1.1.1.44	WO0100844	AX121689
	(6-phosphogluconate dehydrogenase)		AX065125
ppsA	Phosphoenolpyruvate Synthetase	EP1108790	AX127144
	Ec 2.7.9.2		AX120700
	(phosphoenolpyruvate-synthase)
rpe	Ribulose-Phosphate Epimerase	EP1108790	AX127148
	EC 5.1.3.1		AX121852
	(ribulose-phosphate-epimerase)
serA	Phosphoglycerate Dehydrogenase	EP1108790	AX127147
	EC 1.1.1.95		AX121499
	(phosphoglycerate-dehydrogenase)
serB	Phosphoserine Phosphatase	EP1108790	AX127144
	EC 3.1.3.3		AX120551
	(phosphoserine phosphatase)
serC	Phosphoserine Aminotransferase	EP1108790	AX127145
	EC 2.6.1.52		AX121012
	(phosphoserine aminotransferase)
tal	Transaldolase	WO0104325	AX076272
	EC 2.2.1.2
	(transaldolase)
thyA	Thymidylate Synthase	EP1108790	AX121026
	EC 2.1.1.45		AX127145
	(thymidylate synthase)
tkt	Transketolase	Ikeda et al.,	AB023377
	EC 2.2.1.1	NCBI
	(transketolase)
tpi	Triose-phosphate Isomerase	Eikmanns,	X59403
	EC 5.3.1.1	Journal of
	(triose-phosphate isomerase)	Bacteriology
		174: 6076-6086
		(1992)
trpA	Tryptophane Synthase (alpha Kette)	Matsui et al.,	X04960
	EC 4.2.1.20	Nucleic Acids
	(tryptophan synthase (alpha chain))	Research
		14: 10113-10114
		(1986)
trpB	Tryptophane Synthase (beta Kette)	Matsui et al.,	X04960
	EC 4.2.1.20	Nucleic Acids
	(tryptophan synthase (beta chain))	Research
		14: 10113-10114
		(1986)
trpC	Phosphoribosylanthranilate	Matsui et al.,	X04960
	Isomerase	Nucleic Acids
	EC 5.3.1.24	Research
	(phosphoribosylanthranilate	14: 10113-10114
	isomerase)	(1986)
trpD	Anthranilate	Matsui et al.,	X04960
	Phosphoribosyltransferase	Nucleic Acids
	EC 2.4.2.18	Research
	(anthranilate	14: 10113-10114
	phosphoribosyltransferase)	(1986)
trpD	Anthranilate	O'Gara et al.,
A125T,	Phosphoribosyltransferase	Applied and
D138A,	EC 2.4.2.18	Environmental
S149F,	anthranilate	Microbiology
A162E	(phosphoribosyltransferase)	61: 4477-4479
	amino acid exchanges A125T, D138A,	(1995)
	S149F, A162E
trpE	Anthranilate Synthase Komponente I	Matsui et al.,	X04960
	EC 4.1.3.27	Nucleic Acids
	(anthranilate synthase component I)	Research
		14: 10113-10114
		(1986)
trpE	Anthranilat Synthase Component I	Matsui et al.,
fbr	feedback resistent	Journal of
	EC 4.1.3.27	Bacteriology
	(anthranilate synthase component I	169: 5330-5332
	feedback resistant)	(1987)
	amino acid exchange S38R
trpG	Anthranilate Synthase Komponente II	Matsui et al.,	X04960
	EC 4.1.3.24	Nucleic Acids
	(anthranilate synthase component	Research
	II)	14: 10113-10114
		(1986)
trpL	Trp Operon Leader Peptide	Matsui et al.,	X04960
	(trp operon leader peptide)	Nucleic Acids
		Research
		14: 10113-10114
		(1986)
trpL	Trp Operon Leaderpeptid	Herry et al.,
W14*	(trp operon leader peptide	Applied and
	mutation W14*)	Environmental
		Microbiology
		59: 791-799
		(1993)
zwa1	Cell Growth Factor 1	EP1111062	AX133781
	(growth factor 1)
zwf	Glucose-6-phosphat1-1-Dehydrogenase	EP1108790	AX127148
	EC 1.1.1.49	WO0104325	AX121827
	(glucose-6-phosphate-1-		AX076272
	dehydrogenase)
zwf	Glucose-6-phosphate-1-Dehydrogenase	EP1108790
A213T	EC 1.1.1.49
	(glucose-6-phosphate-1-
	dehydrogenase)
	amino acid exchange A213T

[0172]

TABLE 11
Further gene sites for integration of open reading frames,
genes and alleles of tryptophane production
Gene	Description of the coded		Access
name	enzyme or protein	Reference	Number
ccpA1	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX127147
	(catabolite control
	protein A1)
ccpA2	Catabolite Control	WO0100844	AX065267
	Protein	EP1108790	AX121594
	(catabolite control
	protein A2)
citA	Sensor-Kinase CitA	EP1108790	AX120161
	(sensor kinase CitA)
citB	Transcription Regulator	EP1108790	AX120163
	CitB
	(transcription regulator
	CitB)
citE	Citrate-Lyase	WO0100844	AX065421
	EC 4.1.3.6	EP1108790	AX127146
	(citrate lyase)
cysE	Serine O-	EP1108790	AX122902
	Acetyltransferase
	EC 2.3.1.30
	(serine O-
	acetyltransferase)
gluA	Glutamate Transport ATP-	Kronemeyer et al.,	X81191
	binding Protein	Journal of
	(glutamate transport ATP-	Bacteriology 177(5):
	binding protein)	1152-8 (1995)
gluB	Glutamate-binding Protein	Kronemeyer et al.,	X81191
	(glutamate binding	Journal of
	protein)	Bacteriology 177(5):
		1152-8 (1995)
gluC	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of
	(glutamate transport	Bacteriology 177(5):
	system permease)	1152-8 (1995)
gluD	Glutamate Transport	Kronemeyer et al.,	X81191
	Permease	Journal of
	(glutamate transport	Bacteriology 177(5):
	system permease)	1152-8 (1995)
glyA	glycine	JP1997028391	E12594
	hydroxymethyltransferase
	EC 2.1.2.1
	(glycine
	hydroxymethyltransferase)
luxR	Transkription Regulator	WO0100842	AX065953
	LuxR	EP1108790	AX123320
	(transcription regulator
	LuxR)
luxS	Histidine Kinase LuxS	EP1108790	AX123323
	(histidine kinase LuxS)		AX127153
lysR1	Transkription Regulator	EP1108790	AX064673
	LysR1		AX127144
	(transcription regulator
	LysR1)
lysR2	Transkription Activator	EP1108790	AX123312
	LysR2
	(transcription regulator
	LysR2)
lysR3	Transkription Regulator	WO0100842	AX065957
	LysR3	EP1108790	AX127150
	(transcription regulator
	LysR3)
menE	O-Succinylbenzoic acid-	WO0100843	AX064599
	CoA-Ligase	EP1108790	AX064193
	EC 6.2.1.26		AX127144
	(O-succinylbenzoate-CoA
	ligase)
pgi	Glucose-6-Phosphate-	EP1087015	AX136015
	Isomerase	EP1108790	AX127146
	EC 5.3.1.9
	(glucose-6-phosphate
	isomerase)
pheA	Prephenate Dehydratase	Follettie et al.,	M13774
	EC 4.2.1.51	Journal of
	(prephenate dehydratase)	Bacteriology 167:
		695-702 (1986)
poxB	Pyruvate-Oxidase	WO0100844	AX064959
	EC 1.2.3.3	EP1096013	AX137665
	(pyruvate oxidase)
zwa2	Cell Growth Factor 2	EP1106693	AX113822
	(growth factor 2)	EP1108790	AX127146

[0173] The invention accordingly also provides a process for the production of coryneform bacteria which produce L-tryptophane, characterized in that

[0174] a) the nucleotide sequence of a desired ORF, gene or allele of tryptophane production, optionally including the expression and/or regulation signals, is isolated

[0175] b) at least two copies of the nucleotide sequence of the ORF, gene or allele of tryptophane production are arranged in a row, preferably in tandem arrangement

[0176] c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,

[0177] d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and

[0178] e) coryneform bacteria which have at least two copies of the desired open ORF, gene or allele of tryptophane production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally

[0179] at least a third copy of the open reading frame (ORF), gene or allele of tryptophane production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

TABLE 12
Intergenic regions as target sites for integration of open
reading frames, genes and alleles
			Position of	Position of
		Access	sequence	sequence
	Reference	number	start	end
	EP1108790	AX120085	192176	194501
	EP1108790	AX127145	235840	237311
	EP1108790	AX127145	236096	237311
	EP1108790	AX127148	322628	330877
	EP1108790	AX127148	334045	336467
	EP1108790	AX127148	289565	291841
	EP1108790	AX127149	154823	161111
	EP1108790	AX127149	190088	193497
	EP1108790	AX127149	27398	28707
	EP1108790	AX127149	61478	62944
	EP1108790	AX127149	116234	117561
	EP1108790	AX127149	140847	144605
	EP1108790	AX127150	113274	114324
	EP1108790	AX127152	244281	246403

[0180]

TABLE 13
Target sites coding for phages or phage components suitable
for integration of open reading frames, genes and alleles
			Position of	Position of
		Access	sequence	sequence
	Reference	number	start	end
	EP1108790	AX127149	50474	51049
	EP1108790	AX127149	67886	68587
	EP1108790	AX127151	72893	73480
	EP1108790	AX127149	88231	89445
	EP1108790	AX127148	139781	140155
	EP1108790	AX127148	140546	141001
	EP1108790	AX127149	194608	195294
	EP1108790	AX127147	200185	200940
	EP1108790	AX127147	208157	208450
	EP1108790	AX127149	269616	269948
	EP1108790	AX127148	336468	338324
	EP1108790	AX127148	342235	342681
	EP1108790	AX127148	343518	345356
	EP1108790	AX127148	345872	346207

[0181] During work on the present invention, it was possible to incorporate two copies, arranged in tandem, of an lysCFBR allele at the lysC gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remain at the lysC gene site. Such a strain is, for example, the strain DSM13992lysCFBR::lysCFBR.

[0182] The plasmid pK18mobsacB2xlysCSma2/1, with the aid of which two copies of an lysCFBR allele can be incorporated into the lysC gene site of Corynebacterium glutamicum, is shown in FIG. 1.

[0183] During work on the present invention, it was furthermore possible to incorporate two copies, arranged in tandem, of the lysE gene at the lysE gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remained at the lysE gene site. Such a strain is, for example, the strain ATCC21513—17lysE::lysE.

[0184] A plasmid with the aid of which two copies of an lysE gene can be incorporated into the lysE gene site of Corynebacterium glutamicum is shown in FIG. 2. It carries the name pK18mobsacB2xlysESma1/1.

[0185] During work on the present invention, finally, it was possible to incorporate two copies, arranged in tandem, of the zwa1 gene at the zwa1 gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables

[0186] transposition and no nucleotide sequence which imparts resistance to antibiotics remained at the zwa1 gene site. Such a strain is, for example, the strain ATCC21513—17zwa1::zwa1.

[0187] A plasmid with the aid of which two copies of a zwa1 gene can be incorporated into the zwa1 gene site of Corynebacterium glutamicum is shown in FIG. 3. It carries the name pK18mobsacBzwa1zwa1.

[0188] The coryneform bacteria produced according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of production of chemical compounds. A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).

[0189] The culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981).

[0190] Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid or lactic acid, can be used as the source of carbon. These substances can be used individually or as a mixture.

[0191] Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen. The sources of nitrogen can be used individually or as a mixture.

[0192] Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus. The culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances, such as amino acids and vitamins, can be employed in addition to the above-mentioned substances. Suitable precursors can moreover be added to the culture medium. The starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner.

[0193] Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH of the culture. Antifoams, such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective action, such as e.g. antibiotics, can be added to the medium to maintain the stability of plasmids. To maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as e.g. air, are introduced into the culture. The temperature of the culture is usually 20° C. to 45° C., and preferably 25° C. to 40° C. Culturing is continued until a maximum of the desired chemical compound has formed. This target is usually reached within 10 hours to 160 hours.

[0194] It has been found that the coryneform bacteria according to the invention, in particular the coryneform bacteria which produce L-lysine, have an unexpectedly high stability. They were stable for at least 10-20, 20-30, 30-40, 40-50, preferably at least 50-60, 60-70, 70-80 and 80-90 generations or cell division cycles.

[0195] The following microorganisms have been deposited:

[0196] The Corynebacterium glutamicum strain DSM13992lysCFBR::lysCFBR was deposited in the form of a pure culture on Jun. 5, 2002 under number DSM15036 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0197] The plasmid pK18mobsacB2xlysCSma2/1 was deposited in the form of a pure culture of the strain E. coli DH5αmcr/pK18mobsacB2xlysCSma2/1 (=DH5alphamcr/pK18mobsacB2xlysCSma2/1) on Apr. 20, 2001 under number DSM14244 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0198] The Corynebacterium glutamicum strain ATCC21513—17lysE::lysE was deposited in the form of a pure culture on Jun. 5, 2002 under number DSM15037 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0199] The Corynebacterium glutamicum strain ATCC21513—17zwa1::zwa1 was deposited in the form of a pure culture on Jun. 5, 2002 under number DSM15038 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

EXAMPLE 1

[0200] Generation of a Tandem Duplication of the lysCFBR Allele lysC T311I in the Chromosome of Corynebacterium glutamicum

[0201] 1.1. Construction of the Tandem Vector pK18mobsacB2xlysCSma2/1

[0202] From the Corynebacterium glutamicum strain DSM13994, chromosomal DNA is isolated by the conventional methods (Eikmanns et al., Microbiology 140: 1817-1828 (1994)).

[0203] The strain DSM13994 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032. The strain is resistant to the lysine analogue S-(2-aminoethyl)-L-cysteine and has a feed back-resistant aspartate kinase which is insensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM). The nucleotide sequence of the lysCFBR allele is shown as SEQ ID NO: 3. It is also called lysC T311I in the following. The amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO: 4. A pure culture of this strain was deposited on Jan. 16, 2001 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0204] With the aid of the polymerase chain reaction, a DNA section which carries the lysC gene or allele is amplified. On the basis of the sequence of the lysC gene known for C. glutamicum (Kalinowski et al., Molecular Microbiology, 5 (5), 1197-1204(1991); Accession Number X57226), the following primer oligonucleotides were chosen for the PCR:

[0205] lysC1beg (SEQ ID No: 15):

[0206] 5′ TA(G GAT CC)T CCG GTG TCT GAC CAC GGT G 3′

[0207] lysC2end: (SEQ ID NO: 16):

[0208] 5′ AC(G GAT CC)G CTG GGA AAT TGC GCT CTT CC 3′

[0209] The primers shown are synthesized by MWG Biotech and the PCR reaction is carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press). The primers allow amplification of a DNA section of approx. 1.7 kb in length, which carries the lysC gene or allele. The primers moreover contain the sequence for a cleavage site of the restriction endonuclease BamHI, which is marked by parentheses in the nucleotide sequence shown above.

[0210] The amplified DNA fragment of approx. 1.7 kb in length which carries the lysCFBR allele lysC T311I of the strain DSM13994 is identified by electrophoresis in a 0.8% agarose gel, isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden).

[0211] Ligation of the fragment is then carried out by means of the Topo TA Cloning Kit (Invitrogen, Leek, The Netherlands, Cat. Number K4600-01) in the vector PCRII-TOPO. The ligation batch is transformed in the E. coli strain TOP10 (Invitrogen, Leek, The Netherlands). Selection of plasmid-carrying cells is made by plating out the transformation batch on kanamycin (50 mg/l)-containing LB agar with X-Gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside, 64 mg/l).

[0212] The plasmid obtained is checked by means of restriction cleavage, after isolation of the DNA, and identified in agarose gel. The resulting plasmid is called pCRIITOPOlysC.

[0213] The nucleotide sequence of the amplified DNA fragment or PCR product is determined by the dideoxy chain termination method of Sanger et al. (Proceedings of the National Academy of Sciences USA, 74:5463-5467 (1977)) using the “ABI Prism 377” sequencing apparatus of PE Applied Biosystems (Weiterstadt, Germany). The sequence of the coding region of the PCR product is shown in SEQ ID No: 3.

[0214] The amino acid sequence of the associated aspartate kinase protein is shown in SEQ ID NO: 4.

[0215] The base thymine is found at position 932 of the nucleotide sequence of the coding region of the lysCFBR allele of strain DSM13994 (SEQ ID NO: 3). The base cytosine is found at the corresponding position of the wild-type gene (SEQ ID NO: 1).

[0216] The amino acid isoleucine is found at position 311 of the amino acid sequence of the aspartate kinase protein of strain DSM13994 (SEQ ID No: 4). The amino acid threonine is found at the corresponding position of the wild-type protein (SEQ ID No: 2).

[0217] The lysC allele, which contains the base thymine at position 932 of the coding region and accordingly codes for an aspartate kinase protein which contains the amino acid isoleucine at position 311 of the amino acid sequence, is called the lysCFBR allele lysC T311I in the following.

[0218] The plasmid pCRIITOPOlysC, which carries the lysCFBR allele lysC T311I, was deposited in the form of a pure culture of the strain E. coli TOP 10/pCRIITOPOlysC under number DSM14242 on Apr. 20, 2001 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ=German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0219] Plasmid DNA was isolated from the strain DSM14242, which carries the plasmid pCRIITOPOlysC, and cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysCFBR-containing DNA fragment approx. 1.7 kb long is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and the overhanging ends are completed with Klenow polymerase (Boehringer Mannheim) and employed for ligation with the mobilizable cloning vector pK18mobsacB described by Schäfer et al., Gene, 14, 69-73 (1994). This is cleaved beforehand with the restriction enzyme SmaI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim), mixed with the lysCFBR-containing fragment of approx. 1.7 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany).

[0220] The E. coli strain DH5α (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, N.Y., 1989). Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 25 mg/l kanamycin.

[0221] Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme HindIII and subsequent agarose gel electrophoresis. The plasmid is called pK18mobsacB1xlysCSma2.

[0222] In a second step, the plasmid pCRII-TOPOlysC is in turn cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysCFBR-containing fragment of approx. 1.7 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pK18mobsacB1xlysCSma2 described in this Example. This is cleaved beforehand with the restriction enzyme BamHI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim), mixed with the lysCFBR-containing fragment of approx. 1.7 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany).

[0223] The E. coli strain DH5a (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, N.Y., 1989). Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 25 mg/l kanamycin.

[0224] Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme HindIII and subsequent agarose gel electrophoresis. The plasmid is called pK18mobsacB2xlysCSma2/1. A map of the plasmid is shown in FIG. 1.

[0225] The plasmid pK18mobsacB2xlysCSma2/1 was deposited in the form of a pure culture of the strain E. coli DH5αmcr/pK18mobsacB2xlysCSma2/1 (=DH5alphamcr/pK18mobsacB2xlysCSma2/1) on Apr. 20, 2001 under number DSM14244 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0226] 1.2. Generation of a Tandem Duplication of the lysCFBR allele lysC T311I in C. glutamicum strain DSM13992

[0227] The vector pK18mobsacB2xlysCSma2/1 mentioned in Example 1.1 is transferred by a modified protocol of Schäfer et al. (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain DSM13992.

[0228] The Corynebacterium glutamicum strain DSM13992 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032. The strain is resistant to the antibiotic streptomycin and phenotypically resistant to the lysine analogue S-(2-aminoethyl)-L-cysteine. However, the strain has a wild-type aspartate kinase (see SEQ ID NO: 1 and 2), which is sensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM). A pure culture of this strain was deposited on Jan. 16, 2001 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0229] The vector pK18mobsacB2xlysCSma2/1 cannot replicate independently in DSM13992 and is retained in the cell only if it has integrated into the chromosome.

[0230] Selection of clones with integrated pK18mobsacB2xlysCSma2/1 is carried out by plating out the conjugation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 15 mg/l kanamycin and 50 mg/l nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/l kanamycin and incubated for 16 hours at 33° C. To achieve excision of the plasmid with only one copy of the lysC gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pK18mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.

[0231] Only those clones in which the pK18mobsacB2xlysCSma2/1 integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin”. During the excision, either two copies of the lysC gene or only one can be excised together with the plasmid.

[0232] To demonstrate that two copies of lysC have remained in the chromosome, approximately 20 colonies which show the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin” are investigated with the aid of the polymerase chain reaction by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press). A DNA fragment which carries the lysC gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR.

lysCK1:
5′ TCG GTG TCA TCA GAG CAT TG 3′ (SEQ ID NO: 5)
lysCK2:
5′ TCG GTT GCC TGA GTA ATG TC 3′ (SEQ ID NO: 6)

[0233] The primers allow amplification of a DNA fragment approx. 1.9 kb in size in control clones with the original lysC locus. In clones with a second copy of the lysC gene in the chromosome at the lysC locus, DNA fragments with a size of approx. 3.6 kb are amplified.

[0234] The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysC gene copy and clones with two chromosomal lysC gene copies.

[0235] 10 clones with two complete copies of the lysC gene on the chromosome are investigated with the aid of the LightCycler of Roche Diagnostics (Mannheim, Germany) in order to demonstrate whether the two copies are lysCFBR alleles with the mutation lysC T311I or whether the original wild-type lysC is present alongside an lysCFBR allele lysC T311I. The LightCycler is a combined apparatus of Thermocycler and flourimeter.

[0236] A DNA section approx. 500 bp in length which contains the mutation site is amplified in the first phase by means of a PCR (Innis et al., PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the following primer oligonucleotides.

LC-lysC1-fbr:
5′ aaccgttctgggtatttccg 3′ (SEQ ID No: 7)
LC-lysC2-fbr:
5′ tccatgaactctgcggtaac 3′ (SEQ ID No: 8)

[0237] In the second phase, with two additional oligonucleotides of different lengths and marked with different fluorescent dyestuffs (Lightcycler(LC)-Red640 and fluorescein), which hybridize in the region of the mutation site, the presence of the mutation is detected with the aid of the “Fluorescence Resonance Energy Transfer” method (FRET) using a melting curve analysis (Lay et al., Clinical Chemistry, 43:2262-2267 (1997)).

lysC311-C:	5′ LC-Red640-gcaggtgaagatgatgtcggt-(P) 3′	(SEQ ID No: 9)
lysC311-A:	5′ tcaagatctccatcgcgcggcggccgtcggaacga-fluorescein 3′	(SEQ ID No: 10)

[0238] The primers shown are synthesized for the PCR by MWG Biotech and oligonucleotides shown for the hybridization are synthesized by TIB MOLBIOL (Berlin, Germany).

[0239] A clone which contains the base thymine at position 932 of the coding regions of the two lysC copies and thus has two lysCFBR alleles lysC T311I was identified in this manner.

[0240] The strain was called C. glutamicum DSM13992lysCFBR::lysCFBR.

[0241] The strain was deposited as C. glutamicum DSM13992lysCFBR::lysCFBR on Jun. 5, 2002 under number DSM15036 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

EXAMPLE 2

[0242] Generation of a Tandem Duplication of the lysE Gene in the Chromosome of Corynebacterium glutamicum

[0243] 2.1. Construction of the Tandem Vector pK18mobsacB2xlysESma1/1

[0244] Plasmid DNA was isolated from the Escherichia coli strain DSM12871 (EP-A-1067193), which carries the plasmid pEC7lysE.

[0245] The plasmid contains the lysE gene which codes for lysine export. A pure culture of this strain was deposited on Jun. 10, 1999 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0246] The plasmid pEC71lysE is cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysE fragment of approx. 1.1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and the overhanging ends are completed with Klenow polymerase (Boehringer Mannheim) and employed for ligation with the mobilizable cloning vector pK18mobsacB described by Schäfer et al., Gene, 14, 69-73 (1994). This is cleaved beforehand with the restriction enzyme SmaI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim), mixed with the lysE fragment of approx. 1.1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany).

[0247] The E. coli strain DH5α (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, N.Y., 1989). Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 25 mg/l kanamycin.

[0248] Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes BamHI and EcoRI and subsequent agarose gel electrophoresis. The plasmid is called pK18mobsacB1 xlysESma1.

[0249] In a second step, the plasmid pEC7lysE is in turn cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysE fragment of approx. 1.1 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pK18mobsacB1xlysESma1 described in this Example. This is cleaved beforehand with the restriction enzyme BamHI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim), mixed with the lysE fragment of approx. 1.1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany).

[0250] The E. coli strain DH5α (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, N.Y., 1989). Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 25 mg/l kanamycin.

[0251] Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes EcoRI and SalI or ScaI and subsequent agarose gel electrophoresis. The plasmid is called pK18mobsacB2xlysESma1/1. A map of the plasmid is shown in FIG. 2.

[0252] 2.2. Generation of a Tandem Duplication of the lysE Gene in C. glutamicum Strain ATCC21513—17

[0253] The vector pK18mobsacB2xlysESma1/1 mentioned in Example 2.1 is transferred by a modified protocol of Schafer et al. (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain ATCC21513—17.

[0254] The Corynebacterium glutamicum strain ATCC21513—17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513. The strain is resistant to the lysine analogue S-(2-aminoethyl)-L-cysteine and both leucine- and homoserine-prototrophic.

[0255] The vector cannot replicate independently in ATCC21513—17 and is retained in the cell only if it has integrated into the chromosome.

[0256] Selection of clones with integrated pK18mobsacB2xlysESma1/1 is carried out by plating out the conjugation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 15 mg/l kanamycin and 50 mg/l nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/l kanamycin and incubated for 16 hours at 33° C. To achieve excision of the plasmid with only one copy of the lysE gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pK18mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.

[0257] Only those clones in which the pK18mobsacB2xlysESma1/1 integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin”. During the excision, either two copies of the lysE gene or only one can be excised together with the plasmid.

[0258] To demonstrate that two copies of lysE have remained in the chromosome, approximately 20 colonies which show the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin” are investigated with the aid of the polymerase chain reaction by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press). A DNA fragment which carries the lysE gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR.

lysEK-1:
5′ TGC TTG CAC AAG GAC TTC AC 3′ (SEQ ID NO: 11)
lysEK-2:
5′ TAT GGT CCG CAA GCT CAA TG 3′ (SEQ ID NO: 12)

[0259] The primers allow amplification of a DNA fragment approx. 1.2 kb in size in control clones with the original lysE locus. In clones with a second copy of the lysC gene in the chromosome at the lysE locus, DNA fragments with a size of approx. 2.3 kb are amplified.

[0260] The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysE gene copy and clones with two chromosomal lysE gene copies. It could thus be demonstrated that the strain ATCC21513—17 carries two complete copies of the lysE gene on the chromosome.

[0261] The strain was called C. glutamicum ATCC21513—17lysE::lysE.

[0262] The strain was deposited as C. glutamicum ATCC21513—17lysE::lysE on Jun. 5, 2002 under number DSM15037 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

EXAMPLE 3

[0263] Generation of a Tandem Duplication of the zwa1 Gene in the Chromosome of Corynebacterium glutamicum

[0264] 3.1. Construction of the tandem vector pK18mobsacBzwa1zwa1

[0265] Plasmid DNA was isolated from the Escherichia coli strain DSM13115 (EP-A-1111062), which carries the plasmid pCR2.1zwa1exp.

[0266] The plasmid contains the zwa1 gene which codes for cell growth factor 1. A pure culture of this strain was deposited on Oct. 19, 1999 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

[0267] The plasmid pCR2.1zwa1exp is cleaved with the restriction enzyme EcoRI (Amersham-Pharmacia, Freiburg, Germany), and after separation in an agarose gel (0.8%) the zwa1 fragment of 1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the mobilizable cloning vector pK18mobsacB described by Schafer et al., Gene, 14, 69-73 (1994). This is cleaved beforehand with the restriction enzyme EcoRI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim), mixed with the zwa1 fragment of 1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany).

[0268] The E. coli strain DH5α (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, N.Y., 1989). Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 25 mg/l kanamycin.

[0269] Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme NheI and subsequent agarose gel electrophoresis. Checking of the plasmid showed that two zwa1 fragments were cloned simultaneously and in the desired orientation in the cloning vector pK18mobsac.

[0270] The plasmid is called pK18mobsacBzwa1zwa1. A map of the plasmid is shown in FIG. 3.

[0271] 3.2. Generation of a Tandem Duplication of the zwa1 Gene in C. glutamicum Strain ATCC21513—17

[0272] The vector pK18mobsacBzwa1zwa1 mentioned in Example 3.1 is transferred by a modified protocol of Schäfer et al. (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain ATCC21513—17.

[0273] The Corynebacterium glutamicum strain ATCC21513—17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513. The strain is resistant to the lysine analogue S-(2-aminoethyl)-L-cysteine and both leucine- and homoserine-prototrophic.

[0274] The vector cannot replicate independently in ATCC21513—17 and is retained in the cell only if it has integrated into the chromosome.

[0275] Selection of clones with integrated pK18mobsacBzwa1zwa1 is carried out by plating out the conjugation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y., 1989), which was supplemented with 15 mg/l kanamycin and 50 mg/l nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/l kanamycin and incubated for 16 hours at 33° C. To achieve excision of the plasmid with only one copy of the zwa1 gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pK18mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.

[0276] Only those clones in which the pK18mobsacBzwa1zwa1 integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin”. During the excision, either two copies of the zwa1 gene or only one can be excised together with the plasmid.

[0277] To demonstrate that two copies of zwa1 have remained in the chromosome, approximately 20 colonies which show the phenotype “growth in the presence of sucrose” and “non-growth in the presence of kanamycin” are investigated with the aid of the polymerase chain reaction by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press). A DNA fragment which carries the zwa1 gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR.

zwal-A2:
5′ CAC TTG TCC TCA CCA CTT TC 3′ (SEQ ID NO: 13)
zwal-E1:
5′ TTC TAC TGG GCG TAC TTT CG 3′ (SEQ ID NO: 14)

[0278] The primers allow amplification of a DNA fragment approx. 1.3 kb in size in control clones with the original zwa1 locus. In clones with a second copy of the zwa1 gene in the chromosome at the zwa1 locus, DNA fragments with a size of approx. 2.3 kb are amplified.

[0279] The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal zwa1 gene copy and clones with two chromosomal zwa1 gene copies. It could thus be demonstrated that the strain ATCC21513—17 carries two complete copies of the zwa1 gene on the chromosome.

[0280] The strain was called C. glutamicum ATCC21513—17zwa1::zwa1. The strain was deposited as C. glutamicum ATCC21513—17zwa1::zwa1 on Jun. 5, 2002 under number DSM15038 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.

EXAMPLE 4

[0281] Preparation of Lysine

[0282] The C. glutamicum strains DSM13992lysCFBR::lysCFBR, ATCC21513—17lysE::lysE and ATCC21513—17zwa1::zwa1 obtained in Examples 1 to 3 are cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.

[0283] For this, the strains are first incubated on an agar plate for 24 hours at 33° C. Starting from this agar plate culture, a preculture is seeded (10 ml medium in a 100 ml conical flask). The medium MM is used as the medium for the preculture. The preculture is incubated for 24 hours at 33° C. at 240 rpm on a shaking machine. A main culture is seeded from this preculture such that the initial OD (660 nm) of the main culture is 0.1 OD. The Medium MM is also used for the main culture.

[0284] Medium MM

	CSL	5	g/l
	MOPS	20	g/l
	Glucose (autoclaved separately)	50	g/l
	Salts:
	(NH4)2SO4	25	g/l
	KH2PO4	0.1	g/l
	MgSO4 * 7 H2O	1.0	g/l
	CaCl2 * 2 H2O	10	mg/l
	FeSO4 * 7 H2O	10	mg/l
	MnSO4 * H2O	5.0	mg/l
	Biotin (sterile-filtered)	0.3	mg/l
	Thiamine * HCl (sterile-filtered)	0.2	mg/l
	CaCO3	25	g/l
	The CSL (corn steep liquor),
	MOPS (morpholinopropanesulfonic acid) and the salt solution are brought to pH 7 with aqueous ammonia and autoclaved.
	The sterile substrate and vitamin solutions, as well as the CaCO3 autoclaved in the dry state, are then added.

[0285] Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Culturing is carried out at 33° C. and 80% atmospheric humidity.

[0286] After 48 hours, the OD is determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich). The amount of lysine formed is determined with an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.

[0287] The result of the experiment is shown in Table 10.

	TABLE 10
		OD	Lysine HCl
	Strain	(660 nm)	g/l
	DSM13992	12.8	18.9
	DSM13992lysCFBR::lysCFBR	12.0	21.6
	ATCC21513_17	10.4	14.0
	ATCC21513_17lysE::lysE	10.0	14.3
	ATCC21513_17zwa1::zwa1	9.9	14.6

BRIEF DESCRIPTION OF THE FIGURES

[0288] The base pair numbers stated are approximate values obtained in the context of reproducibility of measurements.

[0289] FIG. 1: Map of the plasmid pK18mobsacB2xlysCSma2/1.

[0290] The abbreviations and designations used have the following meaning:

KmR:     Kanamycin resistance gene
HindIII: Cleavage site of the restriction enzyme
         HindIII
BamHI:   Cleavage site of the restriction enzyme
         BamHI
lysC:    lysCFBR allele lysC T311I
sacB:    sacB gene
RP4mob:  mob region with the replication origin for
         the transfer (oriT)
oriV:    Replication origin V

[0291] FIG. 2: Map of the plasmid pK18mobsacB2xlysESma1/1.

[0292] The abbreviations and designations used have the following meaning:

KanR:   Kanamycin resistance gene
SalI:   Cleavage site of the restriction enzyme SalI
BamHI:  Cleavage site of the restriction enzyme
        BamHI
EcoRI:  Cleavage site of the restriction enzyme
        EcoRI
ScaI:   Cleavage site of the restriction enzyme ScaI
lysE:   lysE gene
sacB:   sacB gene
RP4mob: mob region with the replication origin for
        the transfer (oriT)
oriV:   Replication origin V

[0293] FIG. 3: Map of the plasmid pK18mobsacBzwa1zwa1.

[0294] The abbreviations and designations used have the following meaning:

KanR:   Kanamycin resistance gene
EcoRI:  Cleavage site of the restriction enzyme
        EcoRI
NheI:   Cleavage site of the restriction enzyme NheI
zwa1:   zwa1 gene
sacB:   sacB gene
RP4mob: mob region with the replication origin for
        the transfer (oriT)
oriV:   Replication origin V

[0295]

Claims

1. Coryneform bacteria which produce chemical compounds, wherein instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), these have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these optionally have at least a third copy of the open reading frame (ORF), gene or allele in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

2. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the coryneform bacteria belong to the genus Corynebacterium.

3. Coryneform bacteria of the genus Corynebacterium according to claim 2 which produce chemical compounds, wherein these belong to the species Corynebacterium glutamicum.

4. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is a compound chosen from the group consisting of L-amino acids, vitamins, nucleosides and nucleotides.

5. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is one or more L-amino acids chosen from the group consisting of L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-proline and L-arginine.

6. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is the amino acid L-lysine.

7. Coryneform bacteria which produce L-lysine, wherein instead of the singular copy of an open reading frame (ORF), gene or allele of lysine production naturally present at the particular desired site (locus), these have at least two copies of the open reading frame (ORF), gene or allele of lysine production in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these optionally have at least a third copy of the open reading frame (ORF), gene or allele of lysine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.

8. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the coryneform bacteria belong to the genus Corynebacterium.

9. Coryneform bacteria of the genus Corynebacterium according to claim 8 which produce L-lysine, wherein these belong to the species Corynebacterium glutamicum.

10. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is one or more of the open reading frames, genes or alleles chosen from the group consisting of accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2, gdh, gnd, lysC, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsI, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwa1, zwf and zwf A213T.

11. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is one or more of the genes or alleles chosen from the group consisting of lysCFBR lysE and zwa1.

12. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is the lysE gene.

13. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is the zwa1 gene.

14. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is an lysCFBR allele which codes for a feed back resistant form of aspartate kinase.

15. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele contains an amino acid sequence according to SEQ ID NO: 2, SEQ ID NO: 2 having one or more amino acid exchanges chosen from the group consisting of A279T, A279V, S301F, T308I, S301Y, G345D, R320G, T311I and S381F.

16. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele has an amino acid sequence according to SEQ ID NO: 4.

17. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the coding region of the lysCFBR allele has the nucleotide sequence of SEQ ID NO: 3.

18. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the further gene site is one or more of the sites chosen from the group consisting of aecD, ccpA1, ccpA2, citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysR1, lysR2, lysR3, menE, mqo, pck, pgi and poxB.

19. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the further gene site is one of more of the sites chosen from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.

20. Processes for the preparation of one or more chemical compounds, which comprise the following steps: a) fermentation of coryneform bacteria, which i) instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and which ii) optionally have at least a third copy of the said open reading frame (ORF), gene or allele at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site, under conditions which allow expression of the said open reading frames (ORFs), genes or alleles, b) concentration of the chemical compound(s) in the fermentation broth and/or in the cells of the bacteria, c) isolation of the chemical compound(s), optionally d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

21. Process according to claim 20, wherein the coryneform bacteria belong to the genus Corynebacterium.

22. Process according to claim 20, wherein the coryneform bacteria of the genus Corynebacterium belong to the species Corynebacterium glutamicum.

23. Process according to claim 20, wherein the chemical compound is a compound chosen from the group consisting of L-amino acids, vitamins, nucleosides and nucleotides.

24. Process according to claim 20, wherein the chemical compound is one or more L-amino acids chosen from the group consisting of L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-proline and L-arginine.

25. Process according to claim 20, wherein the chemical compound is L-lysine.

26. Process for the preparation of L-lysine, which comprises the following steps: a) fermentation of coryneform bacteria, which i) instead of the singular copy of an open reading frame (ORF), gene or allele of lysine production naturally present at the particular desired site (locus), have at least two copies of the said open reading frame (ORF), gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and which optionally ii) have at least a third copy of the said open reading frame (ORF), gene or allele of lysine production at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site, under conditions which allow expression of the said open reading frames (ORFs), genes or alleles, b) concentration of the L-lysine in the fermentation broth and/or in the cells of the bacteria, c) isolation of the L-lysine, optionally d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.

27. Process for the preparation of L-lysine according to claim 26, wherein the coryneform bacteria belong to the genus Corynebacterium.

28. Process for the preparation of L-lysine according to claim 26, wherein the coryneform bacteria of the species Corynebacterium belong to the species Corynebacterium glutamicum.

29. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF), a gene or allele of lysine production is one or more of the open reading frames, genes or alleles chosen from the group consisting of accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2, gdh, gnd, lysC, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsI, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwa1, zwf and zwf A213T.

30. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is one or more of the genes or alleles chosen from the group consisting of lysCFBR, lysE and zwa1.

31. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is the lysE gene.

32. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is the zwa1 gene.

33. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF), gene or allele of lysine production is the lysCFBR allele which codes for a feed back resistant form of aspartate kinase.

34. Process for the preparation of L-lysine according to claim 33, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele contains an amino acid sequence according to SEQ ID NO: 2, SEQ ID NO: 2 having one or more amino acid exchanges chosen from the group consisting of A279T, A279V, S301F, T308I, S301Y, G345D, R320G, T311I and S381F.

35. Process for the preparation of L-lysine according to claim 33, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele has an amino acid sequence according to SEQ ID NO: 4.

36. Process for the preparation of L-lysine according to claim 33, wherein the coding region of the lysCFBR allele has the nucleotide sequence of SEQ ID NO: 3.

37. Process for the preparation of L-lysine according to claim 26, wherein the further gene site is one or more of the sites chosen from the group consisting of aecD, ccpAl, ccpA2, citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysR1, lysR2, lysR3, menE, mqo, pck, pgi and poxB.

38. Process for the preparation of L-lysine according to claim 26, wherein the further gene site is one of more of the sites chosen from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.

39. Process for the production of coryneform bacteria which produce one or more chemical compounds, wherein a) the nucleotide sequence of a desired ORF, gene or allele, optionally including the expression and/or regulation signals, is isolated, b) at least two copies of the nucleotide sequence of the ORF, gene or allele are arranged in a row, preferably in tandem arrangement, c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria, d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally f) at least a third copy of the open reading frame (ORF), gene or allele in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.

40. The plasmid pK18mobsacB2xlysCSma2/1 shown in FIG. 1 and deposited in the form of a pure culture of the strain E. coli DH5αmcr/pK18mobsacB2xlysCSma2/1 (=DH5alphamcr/pK18mobsacB2xlysCSma2/1) under number DSM14244.

41. The Corynebacterium glutamicum strain DSM13992lysCFBR::lysCFBR deposited in the form of a pure culture under number DSM15036.

42. The Corynebacterium glutamicum strain ATCC21513—17lysE::lysE deposited in the form of a pure culture under number DSM15037.

43. The Corynebacterium glutamicum strain ATCC21513—17zwa1::zwa1 deposited in the form of a pure culture under number DSM15038.

44. Coryneform bacteria according to claim 1, wherein the further gene site is selected from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.

45. Coryneform bacteria according to claim 44, wherein the intergenic regions are selected from table 12.

46. Coryneform bacteria according to claim 44, wherein the prophages contained in the chromosome and defective phages contained in the chromosome are selected from table 13.

47. Process according to claim 20, wherein the further gene site is selected from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.

48. Process according to claim 47, wherein the intergenic regions are selected from table 12.

49. Process according to claim 47, wherein the prophages contained in the chromosome and defective phages contained in the chromosome are selected from table 13.

50. Process according to claim 39, wherein the further gene site is selected from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.

51. Process according to claim 50, wherein the intergenic regions are selected from table 12.

52. Process according to claim 50, wherein the prophages contained in the chromosome and defective phages contained in the chromosome are selected from table 13.