Patent Grant
11807877
A sequence listing appendix including an ASCII formatted file accompanies this application. The appendix includes a file named “SD14418_1_ST25.txt,” created on Aug. 12, 2019 (size of 799 kilobytes), which is hereby incorporated by reference in its entirety.
The present invention relates, in part, to methods for detecting nuclease activity, such as the activity of Cas nucleases. Also described herein are compositions for conducting assays, as well as methods for conducting assays in the presence of test compounds.
CRISPR-Cas based systems have emerged as a promising methodology for gene editing. Targeted editing will require further understanding of various components of this system, such as the Cas protein. In addition, it may be beneficial to understand what compounds interact with the Cas protein, which may impact its efficacy. Such biochemical studies would benefit from high-throughput assays. Accordingly, there is a need for synthetic substrates and assay methods to further characterize Cas proteins.
The present invention relates, in part, to methods and compositions useful for detecting nuclease activity (e.g., Cas protein activity). Described herein are cleavage substrates designed to emit a detectable signal upon being cleaved by a Cas protein. In an exemplary embodiment, the cleavage substrate is a duplex including two oligonucleotide strands, in which a first strand includes a fluorophore label and a second strand includes a quencher label. The fluorophore and the quencher form a Forster resonance energy transfer (FRET) pair, in which the two labels are in close proximity within the duplex, such that fluorescence emission is quenched. Upon cleavage of the duplex substrate, the distance between the two labels is increased, thereby allowing for a quantitative increase in fluorescence signal based on extent of nuclease activity. In particular embodiments, use of the substrates herein allow for the quantitative monitoring of Cas9 cleavage activity by fluorescence spectroscopy in a high-throughput microplate format. Additional details follow.
Accordingly, in a first aspect, the present invention features a method for detecting nuclease activity, the method including: combining a target nuclease with a cleavage substrate and a synthetic guiding component, thereby providing a reaction mixture; incubating the reaction mixture, thereby providing an incubated reaction mixture; and quenching the incubated reaction mixture under a denaturation condition configured to denature the target nuclease. In particular embodiments, the present invention also includes: measuring a detectable signal, if any, arising from a reacted cleavage substrate.
In some embodiments, the cleavage substrate includes a duplex having a target strand and a non-target strand, and where at least one of the target or non-target strand includes a detectable label.
In some embodiments, the target strand includes a structure having formula (Ia) of 5′-X-Y-T-Z-3′ or formula (Ib) of 5′-Z-T-Y-X-3′ or a salt thereof, where: X is a first binding region including a nucleic acid sequence, Y is a protospacer adjacent motif-binding region including a nucleic acid sequence configured to bind to a protospacer adjacent motif in the non-target strand, T is a target site including a nucleic acid sequence configured to bind to a targeting portion of the synthetic guiding component, and Z is a second binding region including a nucleic acid sequence.
In some embodiments, the non-target strand includes a structure having formula (IIa) of 5′-A-U-B-C-3′ or formula (IIb) of 5′-C-B-U-A-3′ or a salt thereof, where: A is a third binding region including a nucleic acid sequence configured to bind to Z or a portion thereof, U is a complementary target site including a nucleic acid sequence configured to bind T or a portion thereof, B is the protospacer adjacent motif configured to interact with the target nuclease, and C is a fourth binding region including a nucleic acid sequence configured to bind X or a portion thereof.
In some embodiments, X has a length of from 2 to about 40 nucleotides, Y has a length of from about 0 to 10 nucleotides, T has a length of from about 10 to about 30 nucleotides, Z has a length of from about 10 to about 40 nucleotides, A has a length of from about 10 to about 40 nucleotides, U has a length of from about 10 to about 30 nucleotides, B has a length of from about 0 to 10 nucleotides, and C has a length of from 1 to about 40 nucleotides. In other embodiments, X is longer than C.
In some embodiments, the target strand includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 388-399 or a complement of any of these, or a fragment thereof.
In some embodiments, X includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 20-30, or a complement of any of these, or a fragment thereof; Y includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 31-33, or a complement of any of these, or a fragment thereof; and Z includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 34-38, or a complement of any of these, or a fragment thereof.
In some embodiments, the non-target strand includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 2, 4, 6, 8, and 400-417 or a complement of any of these, or a fragment thereof.
In some embodiments, A includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 39-43, or a complement of any of these, or a fragment thereof; B includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 44-46, or a complement of any of these, or a fragment thereof, and C includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 47-58, or a complement of any of these, or a fragment thereof.
In some embodiments, the target strand includes a fluorescent label at the 5′-end and where the non-target strand includes a quencher label at the 3′-end. In other embodiments, the target strand does not include the detectable label, and where the non-target strand includes an internal fluorescent label, an optional internal quencher label, and a quencher label at the 3′-end.
In some embodiments, the synthetic guiding component is configured to interact with the target nuclease, and where the cleavage substrate is configured to interact with the synthetic guiding component.
In some embodiments, the synthetic guiding component includes a structure having formula (IIIa) of 5′-D-V-E-L-F-3′ or formula (IIIb) of 5′-F-L-E-V-D-3′ or a salt thereof, where: D is an optional third portion including a nucleic acid sequence of from about 1 to 20 nucleic acids; V is a targeting portion including a nucleic acid sequence configured to bind to a target site of the cleavage substrate; E is a first portion including a nucleic acid sequence configured to interact with a nuclease configured to bind and/or cleave the cleavage substrate; L is a linker; and F is a second portion including a nucleic acid sequence configured to interact with the target nuclease and E or a portion thereof.
In other embodiments, the synthetic guiding component includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 9-12, 350-387, 537-564, 672-699, 801-814, 879-902, 982-1003, 1047-1056, 1151-1172, and 1200-1219 or a complement of any of these, or a fragment thereof.
In some embodiments, D has a length of from 0 to about 20 nucleotides, V has a length of from about 10 to about 30 nucleotides, E has a length of from about 10 to about 40 nucleotides, L has a length of from 0 to about 10 nucleotides, and/or F has a length of from about 10 to about 100 nucleotides.
In some embodiments, E includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 150-159, 184-189, 213-220, 249-264, 282-287, 308-311, 331-336, 445-462, 485-496, 520-535, 610-627, 640-645, 664-671, 716-721, 729-734, 740-745, 753-756, 765-770, 779-784, 795-800, 845-852, 861-862, 871-878, 923-931, 940-946, 958-968, 975-981, 1010-1017, 1027-1038, 1078-1083, 1092-1101, 1111-1118, 1135-1150, and 1194-1199 or a complement of any of these, or a fragment thereof.
In some embodiments, L includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 160-165, 190-195, 221-227, 265-270, 288-294, 312-317, 337-341, 435-444, 475-484, 508-519, 595-609, 634-639, 658-663, 713-715, 726-728, 737-739, 749-752, 761-764, 775-778, 791-794, 841-844, 857-860, 867-870, 919-922, 937-939, 955-957, 972-974, 1018-1022, 1039-1042, 1074-1077, 1090-1091, 1108-1110, 1127-1134, and 1192-1193 or a complement of any of these, or a fragment thereof.
In some embodiments, F includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:166-183, 196-212, 228-248, 271-281, 295-307, 318-330, 342-349, 425-434, 463-474, 498-507, 580-594, 628-633, 646-657, 710-712, 722-725, 735-736, 746-748, 757-760, 771-774, 785-790, 825-840, 853-856, 863-866, 915-918, 932-936, 947-954, 969-971, 1023-1026, 1043-1046, 1070-1073, 1084-1089, 1102-1107, 1119-1126, and 1180-1191 or a complement of any of these, or a fragment thereof.
In some embodiments, the target nuclease is a Cas protein or a modified form thereof. In some embodiments, the target nuclease includes an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:100-105, 110-126, 420-422, 570-573, 700-707, 820-822, 910-913, 1005-1006, 1060-1066, and 1175-1177, or a fragment thereof.
In some embodiments, the reaction mixture further includes a nuclease buffer, blood, plasma, a biological fluid, an organism, and/or a cell.
In some embodiments, the incubating step occurs at an ambient temperature.
In some embodiments, the denaturation condition includes an elevated temperature of from about 60° C. to about 100° C. In other embodiments, the denaturation condition includes formamide, urea, guanidine, sodium dodecyl sulfate, or a salt thereof.
In a second aspect, the present invention features a method for testing a drug for nuclease activity, the method including: combining a target nuclease (e.g., any herein) with a cleavage substrate (e.g., any herein) and a synthetic guiding component (e.g., any herein), thereby providing a reaction mixture; introducing one or more drugs to the reaction mixture; incubating the reaction mixture, thereby providing an incubated reaction mixture; quenching the incubated reaction mixture under a denaturation condition configured to denature the target nuclease; and measuring a detectable signal, if any, arising from a reacted cleavage substrate, thereby determining whether the drug inhibits or activates the target nuclease.
In a third aspect, the present invention features a cleavage substrate including a duplex having a target strand and a non-target strand, where: the target strand includes a structure having formula (Ia) of 5′-X-Y-T-Z-3′ or formula (Ib) of 5′-Z-T-Y-X-3′ or a salt thereof and includes a first detectable label, where: X is a first binding region including a nucleic acid sequence, Y is a protospacer adjacent motif-binding region including a nucleic acid sequence configured to bind to a protospacer adjacent motif in the non-target strand, T is a target site including a nucleic acid sequence configured to bind to a targeting portion of the synthetic guiding component, and Z is a second binding region including a nucleic acid sequence; and the non-target strand includes a structure having formula (IIa) of 5′-A-U-B-C-3′ or formula (IIb) of 5′-C-B-U-A-3′ or a salt thereof, and includes a second detectable label, where: A is a third binding region including a nucleic acid sequence configured to bind to Z or a portion thereof, U is a complementary target site including a nucleic acid sequence configured to bind T or a portion thereof, B is the protospacer adjacent motif configured to interact with the target nuclease, and C is a second binding region including a nucleic acid sequence configured to bind X or a portion thereof, where the first detectable label is located in proximity to the second detectable label.
In a fourth aspect, the present invention features a cleavage substrate including a duplex having a target strand and a non-target strand, where: the target strand includes a structure having formula (Ia) of 5′-X-Y-T-Z-3′ or formula (Ib) of 5′-Z-T-Y-X-3′ or a salt thereof, where: X is a first binding region including a nucleic acid sequence, Y is a protospacer adjacent motif-binding region including a nucleic acid sequence configured to bind to a protospacer adjacent motif in the non-target strand, T is a target site including a nucleic acid sequence configured to bind to a targeting portion of the synthetic guiding component, and Z is a second binding region including a nucleic acid sequence; and the non-target strand includes a structure having formula (IIa) of 5′-A-U-B-C-3′ or formula (IIb) of 5′-C-B-U-A-3′ or a salt thereof, and includes a first detectable label and a second detectable label, where: A is a third binding region including a nucleic acid sequence configured to bind to Z or a portion thereof, U is a complementary target site including a nucleic acid sequence configured to bind T or a portion thereof, B is the protospacer adjacent motif configured to interact with the target nuclease, and C is a second binding region including a nucleic acid sequence configured to bind X or a portion thereof, where the first detectable label is located in proximity to the second detectable label.
In some embodiments, X and/or C has a length of from 1 to about 40 nucleotides (e.g., of from about 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 11, 1 to 12, 1 to 13, 1 to 14, 1 to 15, 1 to 16, 1 to 17, 1 to 18, 1 to 19, 1 to 20, 1 to 21, 1 to 22, 1 to 23, 1 to 24, 1 to 25, 1 to 26, 1 to 27, 1 to 28, 1 to 29, 1 to 30, 1 to 35, 1 to 35, 2 to 3, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 2 to 11, 2 to 12, 2 to 13, 2 to 14, 2 to 15, 2 to 16, 2 to 17, 2 to 18, 2 to 19, 2 to 20, 2 to 21, 2 to 22, 2 to 23, 2 to 24, 2 to 25, 2 to 26, 2 to 27, 2 to 28, 2 to 29, 2 to 30, 2 to 35, 2 to 35, 2 to 40, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 3 to 11, 3 to 12, 3 to 13, 3 to 14, 3 to 15, 3 to 16, 3 to 17, 3 to 18, 3 to 19, 3 to 20, 3 to 21, 3 to 22, 3 to 23, 3 to 24, 3 to 25, 3 to 26, 3 to 27, 3 to 28, 3 to 29, 3 to 30, 3 to 35, 3 to 35, 3 to 40, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 4 to 11, 4 to 12, 4 to 13, 4 to 14, 4 to 15, 4 to 16, 4 to 17, 4 to 18, 4 to 19, 4 to 20, 4 to 21, 4 to 22, 4 to 23, 4 to 24, 4 to 25, 4 to 26, 4 to 27, 4 to 28, 4 to 29, 4 to 30, 4 to 35, 4 to 35, 4 to 40, 6 to 7, 6 to 8, 6 to 9, 6 to 10, 6 to 11, 6 to 12, 6 to 13, 6 to 14, 6 to 15, 6 to 16, 6 to 17, 6 to 18, 6 to 19, 6 to 20, 6 to 21, 6 to 22, 6 to 23, 6 to 24, 6 to 25, 6 to 26, 6 to 27, 6 to 28, 6 to 29, 6 to 30, 6 to 35, 6 to 35, 6 to 40, 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 8 to 35, 8 to 35, 8 to 40, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 10 to 35, 10 to 40, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 11 to 35, 11 to 40, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 12 to 35, 12 to 40, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 13 to 35, 13 to 40, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 14 to 35, 14 to 40, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 15 to 35, 15 to 40, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 16 to 35, 16 to 40, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 17 to 35, 17 to 40, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 18 to 35, 18 to 40, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 19 to 35, 19 to 40, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 20 to 35, 20 to 40, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 21 to 35, 21 to 40, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 22 to 35, 22 to 40, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 23 to 35, 23 to 40, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 24 to 35, 24 to 40, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 25 to 35, 25 to 40, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 26 to 35, 26 to 40, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, 28 to 35, 28 to 40, 29 to 30, 29 to 35, 29 to 40, 30 to 35, 30 to 40, or 35 to 40 nucleotides).
In some embodiments, Y and/or B has a length of from 0 to about 20 nucleotides (e.g., of from about 0 to 4, 0 to 5, 0 to 6, 0 to 7, 0 to 8, 0 to 9, 0 to 10, 0 to 15, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 5, 1 to 20, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 2 to 15, 2 to 20, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 3 to 15, 3 to 20, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 4 to 15, 4 to 20, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 5 to 5, 5 to 20, 10 to 15, 10 to 20, or 15 to 20 nucleotides, and optionally including one or more modified nucleotides, such as any described herein).
In some embodiments, D has a length of from 0 to about 20 nucleotides (e.g., of from about 0 to 4, 0 to 5, 0 to 6, 0 to 7, 0 to 8, 0 to 9, 0 to 10, 0 to 15, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 5, 1 to 20, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 2 to 15, 2 to 20, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 3 to 15, 3 to 20, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 4 to 15, 4 to 20, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 5 to 5, 5 to 20, 10 to 5, 10 to 20, or 15 to 20 nucleotides, and optionally including one or more modified nucleotides, such as any described herein).
In some embodiments, V is configured to bind to the target site of a target strand derived from a human RNA target sequence or a pathogen target sequence (e.g., a viral sequence).
In some embodiments, T, Z, A, U, and/or V has a length of from about 10 to about 40 nucleotides (e.g., of from about 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 10 to 35, 11 to 5, 11 to 6, 11 to 7, 11 to 8, 11 to 9, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 11 to 35, 11 to 40, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 12 to 35, 12 to 40, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 13 to 35, 13 to 40, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 14 to 35, 14 to 40, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 15 to 35, 15 to 40, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 16 to 35, 16 to 40, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 17 to 35, 17 to 40, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 18 to 35, 18 to 40, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 19 to 35, 19 to 40, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 20 to 35, 20 to 40, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 21 to 35, 21 to 40, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 22 to 35, 22 to 40, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 23 to 35, 23 to 40, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 24 to 35, 24 to 40, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 25 to 35, 25 to 40, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 26 to 35, 26 to 40, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, 28 to 35, 28 to 40, 29 to 30, 29 to 35, 29 to 40, 30 to 35, 30 to 40, or 35 to 40 nucleotides).
In some embodiments, E has a length of from about 10 to about 50 nucleotides (e.g., of from about 10 to 20, 10 to 25, 10 to 30, 10 to 35, 10 to 40, 10 to 45, 15 to 20, 15 to 25, 15 to 30, 15 to 35, 15 to 40, 15 to 45, 15 to 50, 20 to 25, 20 to 30, 20 to 35, 20 to 40, 20 to 45, 20 to 50, 25 to 30, 25 to 35, 25 to 40, 25 to 45, 25 to 50, 30 to 35, 30 to 40, 30 to 45, 30 to 50, 35 to 40, 35 to 45, 35 to 50, 40 to 45, 40 to 50, or 45 to 50 nucleotides, and optionally including one or more modified nucleotides, such as any described herein).
In some embodiments, L has a length of from 0 to about 15 nucleotides (e.g., L is a bond, an C1-10 alkylene, a C1-10 heteroalkylene, or has a length of from about 0 to 10 nucleotides, such as 0 to 2, 0 to 4, 0 to 6, 0 to 8, 0 to 10, 0 to 15, 2 to 4, 2 to 6, 2 to 8, 2 to 10, 2 to 15, 4 to 6, 4 to 8, 4 to 10, 4 to 15, 6 to 8, 6 to 10, 6 to 15, 8 to 10, 8 to 15, 10 to 15, or 13 to 15 nucleotides).
In some embodiments, F has a length of from about 10 to about 100 nucleotides (e.g., of from about 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, 20 to 100, 30 to 40, 30 to 50, 30 to 60, 30 to 70, 30 to 80, 30 to 90, 30 to 100, 40 to 50, 40 to 60, 40 to 70, 40 to 80, 40 to 90, 40 to 100, 50 to 60, 50 to 70, 50 to 80, 50 to 90, 50 to 100, 60 to 70, 60 to 80, 60 to 90, 60 to 100, 70 to 80, 70 to 90, 70 to 100, 80 to 90, 80 to 100, or 90 to 100 nucleotides).
In any embodiment herein, the synthetic guiding construct has a length of from about 80 to about 300 nucleotides (e.g., of from about 80 to 90, 80 to 100, 80 to 125, 80 to 150, 80 to 175, 80 to 200, 80 to 225, 80 to 250, 80 to 275, 90 to 100, 90 to 125, 90 to 150, 90 to 175, 90 to 200, 90 to 225, 90 to 250, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 125 to 150, 125 to 175, 125 to 200, 125 to 225, 125 to 250, 125 to 275, 125 to 300, 150 to 175, 150 to 200, 150 to 225, 150 to 250, 150 to 275, 150 to 300, 175 to 200, 175 to 225, 175 to 250, 175 to 275, 175 to 300, 200 to 225, 200 to 250, 200 to 275, 200 to 300, 250 to 275, 250 to 300, or 275 to 300 nucleotides).
In any embodiment herein, a nucleic acid sequence can have at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any sequence described herein.
In any embodiment herein, a fragment can include of from about 10 to about 50 nucleotides, such as of from about 10 to 15, 10 to 20, 10 to 25, 10 to 30, 10 to 35, 10 to 40, 10 to 45, 12 to 15, 12 to 20, 12 to 25, 12 to 30, 12 to 35, 12 to 40, 12 to 45, 12 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 35, 15 to 40, 15 to 45, 15 to 50, 20 to 25, 20 to 30, 20 to 35, 20 to 40, 20 to 45, 20 to 50, 25 to 30, 25 to 35, 25 to 40, 25 to 45, or 25 to 50 nucleotides. In another embodiment, a fragment can include of from about 10 to about 100 nucleotides, such as of from about 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, 20 to 100, 30 to 40, 30 to 50, 30 to 60, 30 to 70, 30 to 80, 30 to 90, 30 to 100, 40 to 50, 40 to 60, 40 to 70, 40 to 80, 40 to 90, 40 to 100, 50 to 60, 50 to 70, 50 to 80, 50 to 90, 50 to 100, 60 to 80, 60 to 90, 60 to 100, 70 to 80, 70 to 90, 70 to 100, 80 to 90, 80 to 100, or 90 to 100 nucleotides. In yet another embodiment, a fragment can include of from about 75 to 250 nucleotides, such as of from about 75 to 100, 75 to 150, 75 to 200, 80 to 100, 80 to 150, 80 to 200, 80 to 250, 90 to 100, 90 to 150, 90 to 200, 90 to 250, 100 to 150, 100 to 200, 100 to 250, 150 to 200, 150 to 250, or 200 to 250 nucleotides (e.g., in which the length can either include or exclude D and/or V).
In any embodiment herein, an amino acid sequence can have at least 80% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any sequence described herein.
In any embodiment herein, a fragment can include of from about 500 to 1800 amino acids, such as of from about 500 to 1700, 500 to 1600, 500 to 1500, 500 to 1400, 500 to 1300, 500 to 1200, 500 to 1100, 500 to 1000, 500 to 950, 500 to 900, 600 to 1800, 600 to 1700, 600 to 1600, 600 to 1500, 600 to 1400, 600 to 1300, 600 to 1200, 600 to 1100, 600 to 1000, 600 to 950, 600 to 900, 700 to 1800, 700 to 1700, 700 to 1600, 700 to 1500, 700 to 1400, 700 to 1300, 700 to 1200, 700 to 1100, 700 to 1000, 700 to 950, 700 to 900, 800 to 1800, 800 to 1700, 800 to 1600, 800 to 1500, 800 to 1400, 800 to 1300, 800 to 1200, 800 to 1100, 800 to 1000, 800 to 950, 800 to 900, 900 to 1800, 900 to 1700, 900 to 1600, 900 to 1500, 900 to 1400, 900 to 1300, 900 to 1200, 900 to 1100, 900 to 1000, 900 to 950, 1000 to 1800, 1000 to 1700, 1000 to 1600, 1000 to 1500, 1000 to 1400, 1000 to 1300, 1000 to 1200, 1000 to 1100, 1100 to 1800, 1100 to 1700, 1100 to 1600, 1100 to 1500, 1100 to 1400, 1100 to 1300, 1100 to 1200, 1200 to 1800, 1200 to 1700, 1200 to 1600, 1200 to 1500, 1200 to 1400, 1200 to 1300, 1300 to 1800, 1300 to 1700, 1300 to 1600, 1300 to 1500, 1300 to 1400, 1400 to 1800, 1400 to 1700, 1400 to 1600, 1400 to 1500, 1500 to 1800, 1500 to 1700, 1500 to 1600, 1600 to 1800, 1600 to 1700, or 1700 to 1800 amino acids.
In any embodiment herein, the nuclease can be a fusion protein including a Cas9 domain and another domain (e.g., a polymerase (e.g., a RNA-dependent RNA polymerase), a riboswitch, a ribozyme, a transcriptional activator, a repressive transcriptional domain, or an epigenetic effector domain.
As used herein, the term “about” means +/−10% of any recited value. As used herein, this term modifies any recited value, range of values, or endpoints of one or more ranges.
As used herein, the terms “top,” “bottom,” “upper,” “lower,” “above,” and “below” are used to provide a relative relationship between structures. The use of these terms does not indicate or require that a particular structure must be located at a particular location.
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., 2001, “Molecular Cloning: A Laboratory Manual”; Ausubel, ed., 1994, “Current Protocols in Molecular Biology” Volumes I-III; Celis, ed., 1994, “Cell Biology: A Laboratory Handbook” Volumes I-III; Coligan, ed., 1994, “Current Protocols in Immunology” Volumes I-III; Gait ed., 1984, “Oligonucleotide Synthesis”; Hames & Higgins eds., 1985, “Nucleic Acid Hybridization”; Hames & Higgins, eds., 1984, “Transcription And Translation”; Freshney, ed., 1986, “Animal Cell Culture”; IRL.
The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-stranded (e.g., sense or antisense), double-stranded, or multi-stranded ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or hybrids thereof, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. Polynucleotides can have any useful two-dimensional or three-dimensional structure or motif, such as regions including one or more duplex, triplex, quadruplex, hairpin, and/or pseudoknot structures or motifs. For any sequence herein, U may be T, and T may be U.
The term “modified,” as used in reference to nucleic acids, means a nucleic acid sequence including one or more modifications to the nucleobase, nucleoside, nucleotide, phosphate group, sugar group, and/or internucleoside linkage (e.g., phosphodiester backbone, linking phosphate, or a phosphodiester linkage).
The nucleoside modification may include, but is not limited to, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine, and combinations thereof.
A sugar modification may include, but is not limited to, a locked nucleic acid (LNA, in which the 2′-hydroxyl is connected by a C1-6 alkylene (e.g., a multivalent (e.g., bivalent, trivalent, tetravalent, etc.) form of an alkyl group) or C1-6 heteroalkylene (e.g., a divalent form of an alkylene group containing one, two, three, or four non carbon heteroatoms (e.g., independently selected from the group consisting of nitrogen, oxygen, phosphorous, sulfur, or halo) bridge to the 4′-carbon of the same ribose sugar), replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene), addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl), ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane), ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone), multicyclic forms (e.g., tricyclic), and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with a-L-threofuranosyl-(3′→2′)), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar.
A backbone modification may include, but is not limited to, 2′-deoxy- or 2′-O-methyl modifications. A phosphate group modification may include, but is not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, phosphotriesters, phosphorodithioates, bridged phosphoramidates, bridged phosphorothioates, or bridged methylene-phosphonates. Additional exemplary modifications include modifications to the 2′ position of a nucleic acid, such as 2′-O-methyl, 2′-halo (e.g., 2′-fluoro, 2′-chloro, etc.), 2′-alkyl (e.g., 2′-methyl, 2′-ethyl, 2′-propyl, 2′-allyl, etc.), 2′-aryl (e.g., 2′-phenyl), 2′-alkaryl (e.g., 2′-benzyl), 2′-amino (e.g., 2′-NH2, 2′-NRN1RN2, which each of RN1 and RN2 is, independently, H, alkyl, or alkaryl), 2′-alkoxy (e.g. 2′-O-methoxy, 2′-O-ethoxy, etc.), 2′-alkylamine (e.g., 2′-O-methylamine, 2′-O-ethylamine, etc.), 2′-O-alkylamine (e.g., 2′-O-methylamine, 2′-O-ethylamine, etc.), 2′-azido, 2′-O-cyanoalkyl (e.g., 2′-O-cyanomethyl), 2′-O-alkoxylalkyl (e.g., 2′-O-(2-methoxyethyl)), etc.
A phosphate group modification may include, but is not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, phosphotriesters, phosphorodithioates, bridged phosphoramidates, bridged phosphorothioates, or bridged methylene-phosphonates.
“Complementarity” or “complementary” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types, e.g., form Watson-Crick base pairs and/or G/U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength. As is known in the art, standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). In addition, it is also known in the art that for hybridization between two RNA molecules (e.g., dsRNA), guanine (G) base pairs with uracil (U). A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” or “sufficient complementarity” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
“Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence. Hybridization and washing conditions are well known and exemplified in Sambrook J, Fritsch E F, and Maniatis T, “Molecular Cloning: A Laboratory Manual,” Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein; and Sambrook J and Russell W, “Molecular Cloning: A Laboratory Manual,” Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The conditions of temperature and ionic strength determine the “stringency” of the hybridization.
Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of complementation between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g., complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches becomes important (see Sambrook et al., supra, 11.7-11.8). Typically, the length for a hybridizable nucleic acid is at least about 10 nucleotides. Illustrative minimum lengths for a hybridizable nucleic acid are: at least about 15 nucleotides; at least about 20 nucleotides; at least about 22 nucleotides; at least about 25 nucleotides; and at least about 30 nucleotides). Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation.
It is understood in the art that the sequence of polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide can comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul S F et al., J. Mol. Biol. 1990; 215:403-10; Zhang J et al., Genome Res. 1997; 7:649-56) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith T F et al., Adv. Appl. Math. 1981; 2(4):482-9).
By “protein,” “peptide,” or “polypeptide,” as used interchangeably, is meant any chain of more than two amino acids, regardless of post-translational modification (e.g., glycosylation or phosphorylation), constituting all or part of a naturally occurring polypeptide or peptide, or constituting a non-naturally occurring polypeptide or peptide, which can include coded amino acids, non-coded amino acids, modified amino acids (e.g., chemically and/or biologically modified amino acids), and/or modified backbones.
The term “fragment” is meant a portion of a nucleic acid or a polypeptide that is at least one nucleotide or one amino acid shorter than the reference sequence. This portion contains, preferably, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 1800, or more nucleotides; or 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 640, or more amino acids. In another example, any polypeptide fragment can include a stretch of at least about 5 (e.g., about 10, about 20, about 30, about 40, about 50, or about 100) amino acids that are at least about 40% (e.g., about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 87%, about 98%, about 99%, or about 100%) identical to any of the sequences described herein can be utilized in accordance with the invention. In certain embodiments, a polypeptide to be utilized in accordance with the invention includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations (e.g., one or more conservative amino acid substitutions, as described herein). In yet another example, any nucleic acid fragment can include a stretch of at least about 5 (e.g., about 7, about 8, about 10, about 12, about 14, about 18, about 20, about 24, about 28, about 30, or more) nucleotides that are at least about 40% (about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 87%, about 98%, about 99%, or about 100%) identical to any of the sequences described herein can be utilized in accordance with the invention.
The term “conservative amino acid substitution” refers to the interchangeability in proteins of amino acid residues having similar side chains (e.g., of similar size, charge, and/or polarity). For example, a group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; a group of amino acids having amide containing side chains consisting of asparagine and glutamine; a group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains consists of lysine, arginine, and histidine; a group of amino acids having acidic side chains consists of glutamic acid and aspartic acid; and a group of amino acids having sulfur containing side chains consists of cysteine and methionine. Exemplary conservative amino acid substitution groups are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glycine-serine, glutamate-aspartate, and asparagine-glutamine.
As used herein, when a polypeptide or nucleic acid sequence is referred to as having “at least X % sequence identity” to a reference sequence, it is meant that at least X percent of the amino acids or nucleotides in the polypeptide or nucleic acid are identical to those of the reference sequence when the sequences are optimally aligned. An optimal alignment of sequences can be determined in various ways that are within the skill in the art, for instance, the Smith Waterman alignment algorithm (Smith T F et al., J. Mol. Biol. 1981; 147:195-7) and BLAST (Basic Local Alignment Search Tool; Altschul S F et al., J. Mol. Biol. 1990; 215:403-10). These and other alignment algorithms are accessible using publicly available computer software such as “Best Fit” (Smith T F et al., Adv. Appl. Math. 1981; 2(4):482-9) as incorporated into GeneMatcher Plus™ (Schwarz and Dayhof, “Atlas of Protein Sequence and Structure,” ed. Dayhoff, M. O., pp. 353-358, 1979), BLAST, BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, T-COFFEE, MUSCLE, MAFFT, or Megalign (DNASTAR). In addition, those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve optimal alignment over the length of the sequences being compared. In general, for polypeptides, the length of comparison sequences can be at least five amino acids, preferably 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, or more amino acids, up to the entire length of the polypeptide. For nucleic acids, the length of comparison sequences can generally be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, or more nucleotides, up to the entire length of the nucleic acid molecule. It is understood that for the purposes of determining sequence identity when comparing a DNA sequence to an RNA sequence, a thymine nucleotide is equivalent to a uracil nucleotide.
By “substantial identity” or “substantially identical” is meant a polypeptide or nucleic acid sequence that has the same polypeptide or nucleic acid sequence, respectively, as a reference sequence, or has a specified percentage of amino acid residues or nucleotides, respectively, that are the same at the corresponding location within a reference sequence when the two sequences are optimally aligned. For example, an amino acid sequence that is “substantially identical” to a reference sequence has at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the reference amino acid sequence. For polypeptides, the length of comparison sequences will generally be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 90, 100, 150, 200, 250, 300, or 350 contiguous amino acids (e.g., a full-length sequence). For nucleic acids, the length of comparison sequences will generally be at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides (e.g., the full-length nucleotide sequence). Sequence identity may be measured using sequence analysis software on the default setting (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis., 53705). Such software may match similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications.
A “target sequence” as used herein is a polynucleotide (e.g., as defined herein, including a DNA, RNA, or DNA/RNA hybrid, as well as modified forms thereof) that includes a “target site.” The terms “target site” is used to refer to a nucleic acid sequence present in a non-target strand or a target genomic sequence (e.g., DNA or RNA in a host or pathogen) to which a primer (e.g., any herein) will bind provided sufficient conditions (e.g., sufficient complementarity) for binding to exist. Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA/RNA binding conditions (e.g., conditions in a cell-free system) are known in the art; see, e.g., Sambrook, supra.
By “cleavage” it is meant the breakage of the covalent backbone of a target sequence (e.g., a nucleic acid molecule). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, a complex comprising a guiding component and a nuclease is used for targeted double-stranded DNA cleavage or single-stranded DNA cleavage.
“Nuclease” and “endonuclease” are used interchangeably herein to mean an enzyme which possesses catalytic activity for cleavage of a nucleic acid sequence.
By “cleavage domain” or “active domain” or “nuclease domain” of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage. A cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides. A single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.
By “linker” is meant any useful multivalent (e.g., bivalent) component useful for joining to different portions or segments. Exemplary linkers include a nucleic acid sequence, a chemical linker, etc. For example, the linker can have a length of from about 3 nucleotides (nt) to about 90 nt, from about 3 nucleotides (nt) to about 80 nt, from about 3 nucleotides (nt) to about 70 nt, from about 3 nucleotides (nt) to about 60 nt, from about 3 nucleotides (nt) to about 50 nt, from about 3 nucleotides (nt) to about 40 nt, from about 3 nucleotides (nt) to about 30 nt, from about 3 nucleotides (nt) to about 20 nt or from about 3 nucleotides (nt) to about 10 nt. For example, the linker can have a length of from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt.
In some embodiments, the linker of a single-molecule guiding component is 4 nt. Other exemplary linkers include polyethylene glycol, an alkane chain, an alkyene group, a click-chemistry linker, a polynucleotide (e.g., poly(T), (T)n, poly(G), (G)n, (GGGS)n, where n is any useful integer, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.), and/or a carbocyclic ring (e.g., an aromatic ring, such as a phenyl group).
“Operably linked” or “operatively linked” or “operatively associated with,” as used interchangeably, refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A first component can be operably linked to a second component by way of any useful bond (e.g., a covalent bond, a non-covalent bond, and/or linked via van der Waals forces, hydrogen bonds, and/or other intermolecular forces, such as those including a π-π interaction, a salt bridge, or a cation-π interaction) or any useful linker (e.g., any herein).
A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another nucleic acid segment, i.e., an “insert”, may be attached so as to bring about the replication of the attached segment in a cell.
By “salt” is meant an ionic form of a compound or structure (e.g., any nucleic acid sequence, reagent, compounds, or compositions described herein), which includes a cation or anion compound to form an electrically neutral compound or structure. Salts are well known in the art. For example, non-toxic salts, pharmaceutically acceptable salts are described in Berge S M et al., “Pharmaceutical salts,” J. Pharm. Sci. 1977 January; 66(1):1-19; and in “Handbook of Pharmaceutical Salts: Properties, Selection, and Use,” Wiley-VCH, April 2011 (2nd rev. ed., eds. P. H. Stahl and C. G. Wermuth). The salts can be prepared in situ during the final isolation and purification of the compounds of the invention or separately by reacting the free base group with a suitable organic acid (thereby producing an anionic salt) or by reacting the acid group with a suitable metal or organic salt (thereby producing a cationic salt). Representative anionic salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, camphorate, camphorsulfonate, chloride, citrate, cyclopentanepropionate, digluconate, dihydrochloride, diphosphate, dodecylsulfate, edetate, ethanesulfonate, fumarate, glucoheptonate, glucomate, glutamate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, hydroxyethanesulfonate, hydroxynaphthoate, iodide, lactate, lactobionate, laurate, lauryl sulfate, malate, maleate, malonate, mandelate, mesylate, methanesulfonate, methylbromide, methylnitrate, methylsulfate, mucate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, polygalacturonate, propionate, salicylate, stearate, subacetate, succinate, sulfate, tannate, tartrate, theophyllinate, thiocyanate, triethiodide, toluenesulfonate, undecanoate, valerate salts, and the like. Representative cationic salts include metal salts, such as alkali or alkaline earth salts, e.g., barium, calcium (e.g., calcium edetate), lithium, magnesium, potassium, sodium, and the like; other metal salts, such as aluminum, bismuth, iron, and zinc; as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, pyridinium, and the like. Other cationic salts include organic salts, such as chloroprocaine, choline, dibenzylethylenediamine, diethanolamine, ethylenediamine, methylglucamine, and procaine.
By “pharmaceutically acceptable salt” is meant a salt that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit/risk ratio.
By “pharmaceutically acceptable excipient” is meant any ingredient other than a compound or structure (e.g., any formulas, compounds, or compositions described herein) and having the properties of being nontoxic and non-inflammatory in a subject. Exemplary, non-limiting excipients include adjuvants, antiadherents, antioxidants, binders, carriers, coatings, compression aids, diluents, disintegrants, dispersing agents, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), isotonic carriers, lubricants, preservatives, printing inks, solvents, sorbents, stabilizers, suspensing or dispersing agents, surfactants, sweeteners, waters of hydration, or wetting agents. Any of the excipients can be selected from those approved, for example, by the United States Food and Drug Administration or other governmental agency as being acceptable for use in humans or domestic animals. Exemplary excipients include, but are not limited to alcohol, butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, glycerol, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactated Ringer's solution, lactose, magnesium stearate, maltitol, maltose, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, Ringer's solution, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium chloride injection, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, stearic acid, sucrose, talc, titanium dioxide, vegetable oil, vitamin A, vitamin E, vitamin C, water, and xylitol.
By an “effective amount” or a “sufficient amount” of an agent, as used herein, is that amount sufficient to effect beneficial or desired results, such as clinical results, and, as such, an “effective amount” depends upon the context in which it is being applied. For example, in the context of administering an agent that is a repressor of a gene, an effective amount of an agent is, for example, an amount sufficient to achieve a reduction in that gene's expression, as compared to the response obtained without administration of the agent.
By “subject” is meant a human, a non-human animal (e.g., a mammal), a host (e.g., a subject exposed to a pathogen, such as a human host exposed to a pathogen), a plant, a bacterium, or a pathogen (e.g., a virus, a phage, a bacterium, or a fungus).
By “treating” a disease, disorder, or condition in a subject is meant reducing at least one symptom of the disease, disorder, or condition by administrating a therapeutic agent to the subject. By “treating prophylactically” a disease, disorder, or condition in a subject is meant reducing the frequency of occurrence of or reducing the severity of a disease, disorder or condition by administering a therapeutic agent to the subject prior to the onset of disease symptoms. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease, disorder, or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease, disorder, or condition; delay or slowing the progress of the disease, disorder, or condition; amelioration or palliation of the disease, disorder, or condition; and remission (whether partial or total), whether detectable or undetectable.
Other features and advantages of the invention will be apparent from the following description and the claims.
The present invention relates, in part, to a CRISPR-Cas based assay by employing a cleavage substrate. In particular embodiments, the cleavage substrate forms a duplex having two strands: a target strand and a non-target strand. The target strand includes a target site configured to bind to the targeting portion of a synthetic guide RNA (sgRNA), and the non-target strand includes a protospacer adjacent motif (PAM). The targeting portion can be any use length (e.g., about 20 nucleotides).
The target strand and the non-target strand can include one or more labels. In one non-exemplary configuration, the target strand includes a fluorophore at the 5′-end, and the non-target strand includes a quencher at the 3′-end. In another exemplary configuration, the target strand does not include a label, and the non-target strand includes a first label within the strand and a second label at the 3′-end.
The cleavage substrate includes various regions, including a target strand 101 having a first binding region 113, a complementary PAM region 112 (e.g., a sufficiently complementary PAM region), a target site 111, and a second binding region 114. The non-target strand 102 includes a third binding region 124, a complementary target site 121 (e.g., a sufficiently complementary target site), a PAM region 122, and a fourth binding region 123. As seen in
As can be seen, the cleavage substrate and the synthetic guiding component can be designed to interact with a particular nuclease (e.g., by way of the PAM region in the cleavage substrate and by way of the first portion, linker, and second portion in the synthetic guiding component). Furthermore, the synthetic guiding component can be designed to interact with the cleavage substrate by selecting sufficiently complementary targeting portions and target sites. Also, the target strands and non-target strands can be designed to form a duplex by selecting sufficiently complementary regions in proximity to the target site and the PAM site (e.g., binding region 113 sufficiently complementary to binding region 123, and binding region 114 sufficiently complementary to binding region 124).
Furthermore, the sgRNA also binds to the cleavage substrate, thereby facilitating nuclease cleavage of the substrate at the cleavage site. The resultant cleavage products include a first cleaved portion that is unlabeled 1001, a second cleaved portion including the fluorophore 1002, and a third cleaved portion including a quencher 1003. Optionally, one or more denaturation steps are conducted to facilitate release of the substrate by the nuclease. Exemplary protein denaturation conditions include, e.g., use of a chaotropic agent, such as any herein; or use of heat to denature the protein.
As also seen in
Upon providing a synthetic guiding component (e.g., a synthetic guide RNA, sgRNA) and a nuclease, interactions between the nuclease, sgRNA, and cleavage substrate can facilitate nuclease cleavage of the substrate at the cleavage site. The resultant cleavage products include a first cleaved portion including the fluorophore 2001, a second cleaved portion that is unlabeled 2002, and a third cleaved portion including a quencher 2003. Optionally, one or more denaturation steps are conducted to facilitate release of the substrate by the nuclease.
Target Strands and Non-Target Strands
Target strands and non-target strands can be designed to form a duplex, in which cleavage of at least one of the strands includes a label (e.g., any described herein) provide a detectable signal. In one instance, the target strand is not labeled, and the non-target strand includes two or more labels.
In another instance, an internal quencher is employed. For example, the non-target strand can include a first label upstream of the cleavage site, a second label downstream of the cleavage site, and a third label further downstream of the cleavage site. As seen in
In other instances, the target strand can include a first label, and the non-target strand can include a second label. For instance, the target strand can include a first label at the 5′-end, and the non-target strand can include a second label at the 3′-end, in which the first label is a quencher and the second label is fluorophore (
The target strand can have any useful structure. In one instance, the target strand includes a structure having formula (Ia) of 5′-X-Y-T-Z-3′ or formula (Ib) of 5′-Z-T-Y-X-3′ or a salt thereof, wherein: X is a first binding region including a nucleic acid sequence, Y is a PAM-binding region including a nucleic acid sequence configured to bind to a PAM in the non-target strand, T is a target site including a nucleic acid sequence configured to bind to a targeting portion of the synthetic guiding component, and Z is a second binding region including a nucleic acid sequence (e.g., any described herein). In some embodiments, the target strand includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 282-293 or a complement of any of these, or a fragment thereof.
The non-target strand can have any useful structure. In one instance, the non-target strand includes a structure having formula (IIa) of 5′-A-U-B-C-3′ or formula (IIb) of 5′-C-B-U-A-3′ or a salt thereof, wherein: A is a third binding region including a nucleic acid sequence configured to bind to Z or a portion thereof, U is a complementary target site including a nucleic acid sequence configured to bind T or a portion thereof, B is the PAM configured to interact with the target nuclease, and C is a second binding region including a nucleic acid sequence configured to bind X or a portion thereof. In some embodiments, the non-target strand includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 2, 4, 6, 8, and 294-311 (see
Binding regions X and C are generally sufficiently complementary to one another. However, in some instances, X may be longer than C, in which case, alignment of these two regions would include the extended portion of X. X can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:20-30 (see Table 1) or a complement of any of these, or a fragment thereof; or at least 80% sequence identity to a complement of any one of SEQ ID NOs:47-58, or a fragment thereof. C can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:47-58 or a complement of any of these, or a fragment thereof; or at least 80% sequence identity to a complement of any one of SEQ ID NOs:20-30, or a fragment thereof.
Binding regions Y and B are generally sufficiently complementary to one another. Y can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:31-33 or a complement of any of these, or a fragment thereof; or at least 80% sequence identity to a complement of any one of SEQ ID NOs:44-46, or a fragment thereof. B can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:44-46 or a complement of any of these, or a fragment thereof, or at least 80% sequence identity to a complement of any one of SEQ ID NOs:31-33, or a fragment thereof.
Binding regions Z and A are generally sufficiently complementary to one another. Z can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:34-38 or a complement of any of these, or a fragment thereof; or at least 80% sequence identity to a complement of any one of SEQ ID NOs:39-43, or a fragment thereof. A can be any useful nucleic acid sequence, e.g., a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs:39-43 or a complement of any of these, or a fragment thereof, or at least 80% sequence identity to a complement of any one of SEQ ID NOs:34-38, or a fragment thereof.
Any useful PAM sequence can be employed (e.g., in region B). Exemplary PAM sequences include, without limitation, NGG, NGGN, NGGNN, TGGN, GRRN, NGRRT, NGRRN, NNGRRT, NNARRT, NNCRRT, NNTRRT, NNNNACA, NNNNRYAC, NNAGAAW, RGAAN, AGAAN, NNAGAAN, NNANMAN, NGGNG, NNGNK, NTTN, NTTV, NNNNRYAC, NNAGAAW, NNAGAA, NGGNG, NNNNGATT, or NAAAAC, for adenine (A), cytosine (C), guanine (C), thymine (T), uracil (U), G or T or U (K), A or C (M), A, T, U, C, or G (N), A or G (R), A, C, or G (V), A or T or U (W), and C or T or U (Y) (e.g., in which for any of these sequences, T is replaced with U). In particular embodiments, B includes NGG or NGGN, e.g., TGG or TGGN (for Spy); GRRN or NGRRT or NGRRN or NNGRRT, e.g., GAAN, GAGN, TGGAGT, NNGAGT, NNGGGT, NNGAAT, or NNGGAT (for Sau); NNNNACA or NNNNRYAC, e.g., GTGAACA, GGGGACAC, AGGCACAC, (for Cje); NNAGAAW or NNAGAA or NGGNG (for Sth); and NTTN, e.g., TTTG, TTTC, TTTA, GTTA, or GTTC (for Fno). Y may be a sequence that is sufficiently complementary to any PAM sequence described herein.
Also disclosed herein are exemplary structures for the target strand and the non-target strand. In one embodiment, the target strand has a structure of formula (Ia): 5′-X-Y-T-Z-3′ or of formula (Ib): 5′-Z-T-Y-X-3′, in which X is a first binding region, Y is a complementary PAM region (or a PAM-binding region) configured to bind B, T is a target site configured to bind the targeting portion of the synthetic guiding component, and Z is a second binding region. In some embodiments, the label (e.g., a fluorophore) is provided at the 5′-end of the target strand, and X is about 6 nucleic acids in length. In another embodiment, the non-target strand has a structure of formula (IIa): 5′-A-U-B-C-3′ or of formula (IIb): 5′-C-B-U-A-3′, in which A is a third binding region configured to bind Z, U is a complementary target site configured to bind T, B is a PAM region configured to interact with the nuclease, and C is a fourth binding region configured to bind X. In some embodiments, the label (e.g., a quencher) is provided at the 3′-end of the non-target strand, and C is about 4 nucleic acids in length. In other embodiments, X is longer than C. In other embodiments, a first label (e.g., a fluorophore) is provided within region U and a second label (e.g., a quencher) is provided at the 3′-end. In yet other embodiments, a first label (e.g., a fluorophore) is provided within region U and upstream of the cleavage site, a second label (e.g., a quencher) is provided within region U and downstream of the cleavage site, and a third label (e.g., a quencher) is provided at the 3′-end.
In particular embodiments, the target strand does not include a label, and the non-target strand includes labels. In some embodiments, the non-target strand includes a first label (e.g., a fluorophore) upstream (e.g., by about 2 ntds) of the Cas cleavage site and a second label (e.g., a quencher) downstream (e.g., by about 3 ntds) of the PAM region. The target strand and the non-target strand can be annealed to provide a duplex.
In addition, the target strands, non-target strands, and synthetic guiding components can be formed from any useful combination of one or more nucleic acids (or a polymer of nucleic acids, such as a polynucleotide). Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a R-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2′-amino-LNA having a 2′-amino functionalization, and 2′-amino-α-LNA having a 2′-amino functionalization) or hybrids, chimeras, or modified forms thereof. Exemplary modifications include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g., to a linking phosphate/to a phosphodiester linkage/to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications according to the present invention may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof). Additional modifications are described herein.
Synthetic Guiding Component
The synthetic guiding component can have any useful structure.
The synthetic guiding component 1200 also includes a first portion 1201, a second portion 1202, and a linker 1205 that covalently links the first and second portions. These portions at the 3′ end are configured to recruit the nuclease (e.g., a Cas nuclease) in proximity to the site of the target sequence. Thus, these portions include nucleic acid sequences that provide preferential binding (e.g., specific binding) of the nuclease. Once in proximity, the nuclease can bind and/or cleave the target sequence or a sequence in proximity to the target sequence in a site-specific, programmable manner. In some embodiments, the first and second portions interact by way of non-covalent binding 1222, thereby providing secondary structure that beneficially interacts with the nuclease.
The synthetic guiding component 1200 can optionally include a third portion 1203 at the 5′ end 1206. The sequence and/or the nucleic acid modifications of the third portion can be optimized to promote binding to the target site or to provide a more accessible substrate to ribonucleoprotein complex. Also provided are guiding components including duplex binding (
The synthetic guiding component can have portions arranged in any useful manner. For instance, as seen in
The first portion, second portion, and linker can be derived in any useful manner. In one instance, the first portion can include a crRNA sequence, a consensus sequence derived from known crRNA sequences, a modified crRNA sequence, or an entirely synthetic sequence known to bind a Cas nuclease or determined to competitively bind a Cas nuclease when compared to a known crRNA sequence. Exemplary sequences for a first portion (e.g., for Cas9, such as any described herein) are described in
In another instance, the second portion can include a tracrRNA sequence, a consensus sequence derived from known tracrRNA sequences, a modified tracrRNA sequence, or an entirely synthetic sequence known to bind a Cas nuclease or determined to competitively bind a Cas nuclease when compared to a known tracrRNA sequence. Exemplary sequences for a second portion are described in
The linker can be any useful linker (e.g., including one or more transcribable elements, such as a nucleotide or a nucleic acid, or including one or more chemical linkers). Further, the linker can be derived from a fragment of any useful tracrRNA sequence (e.g., any described herein). The first and second portions can interact in any useful manner. For example, the first portion can have a sequence portion that is sufficiently complementary to a sequence portion of the second portion, thereby facilitating duplex formation or non-covalent bonding between the first and second portion. In another example, the second portion can include a first sequence portion that is sufficiently complementary to a second sequence portion, thereby facilitating hairpin formation within the second portion. Exemplary sequences for a linker are described in
In one instance, the synthetic guiding component includes a structure having formula (IIIa) of 5′-D-V-E-L-F-3′ or formula (IIIb) of 5′-F-L-E-V-D-3′ or formula (IIIc) 5′-E-V-D-3′ or (IIId) 5′-(E-V)e-D-3′ or a salt thereof, wherein: D is an optional third portion including a nucleic acid sequence of from about 1 to 20 nucleic acids; V is a targeting portion including a nucleic acid sequence configured to bind to a target site of the cleavage substrate; E is a first portion including a nucleic acid sequence configured to interact with a nuclease configured to bind and/or cleave the cleavage substrate; L is a linker; and F is a second portion including a nucleic acid sequence configured to interact with the target nuclease and E or a portion thereof. In particular embodiments, e is an integer of from about 1 to about 20. In some embodiments, the synthetic guiding component includes a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 9-12, 350-387, and 388-399 (see
Further synthetic guiding components, first portions, second portions, third portions, and linkers are described in
Nuclease
The nuclease may be a Cas9 homolog or ortholog. In some embodiments, the nuclease is codon-optimized for expression in a eukaryotic cell. In some embodiments, the nuclease directs cleavage of one or two strands at the location of the target sequence.
Any useful Cas protein or complex can be employed that binds to and/or cleaves a double-stranded sequence. Exemplary Cas proteins or complexes include those involved in Type I, Type II, or Type III CRISPR/Cas systems, including but not limited to the CRISPR-associated complex for antiviral defense (Cascade, including a RAMP protein), Cas3 and/or Cas 7 (e.g., for Type I systems, such as Type I-E systems), Cas9 (formerly known as Csn1 or Csx12, e.g., such as in Type II systems), Csm (e.g., in Type III-A systems), Cmr (e.g., in Type III-B systems), Cas10 (e.g., in Type III systems), as well as subassemblies or sub-components thereof and assemblies including such Cas proteins or complexes. Additional Cas proteins and complexes are described in Makarova K S et al., “Evolution and classification of the CRISPR-Cas systems,” Nat. Rev. Microbiol. 2011; 9:467-77, which is incorporated herein by reference in its entirety. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a, Cas12b, CasY, CasX, Cas13a, Cas13b, Cas13d, Cas14, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.
In some instances, the nuclease can include one or more mutations, with respect to a corresponding wild-type enzyme, such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence (e.g., including one or more mutations, such as D10A, N580A, H840A, N854A, and/or N863A in SEQ ID NO:101 or in an amino acid sequence sufficiently aligned with SEQ ID NO:101). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. In aspects of the invention, nickases may be used for genome editing via homologous recombination. The nuclease can include a nuclear localization sequence (NLS).
As a further example, two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III) may be mutated to produce a mutated Cas9 substantially lacking all DNA cleavage activity. In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity. In some embodiments, a CRISPR enzyme is considered to substantially lack all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower with respect to its non-mutated form. Other mutations may be useful; where the Cas9 or other CRISPR enzyme is from a species other than S. pyogenes, mutations in corresponding amino acids may be made to achieve similar effects.
Further exemplary nucleases are provided in
Labels and Quenchers
The target strands and/or non-target strands herein can include any useful label, including fluorescent labels and quencher labels at any useful position in the nucleic acid sequence (e.g., at the 3′-end, at an internal location between the 3′- and 5′-ends, appended to a nucleic acid as a side chain (e.g., a dT nucleic acid), inserted into the nucleic acid backbone (e.g., into the phosphate-pentose backbone), and/or at the 5′-end).
Exemplary fluorescent labels include a quantum dot, a fluorophore), etc. Examples of fluorescence labels include fluorescein, 6-FAM™ (Applied Biosystems, Carlsbad, Calif.), TET™ (Applied Biosystems, Carlsbad, Calif.), VIC™ (Applied Biosystems, Carlsbad, Calif.), MAX, HEX™ (Applied Biosystems, Carlsbad, Calif.), TYE™ (ThermoFisher Scientific, Waltham, Mass.), Yakima Yellow® (ELITech Group, Puteaux, France), TYE665, TYE705, TEX, JOE, Cy™ (Amersham Biosciences, Piscataway, N.J.) dyes (Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7), Texas Red® (Molecular Probes, Inc., Eugene, Oreg.), Texas Red-X, AlexaFluor® (Molecular Probes, Inc., Eugene, Oreg.) dyes (e.g., AlexaFluor 350, AlexaFluor 405, AlexaFluor 430, AlexaFluor 488, AlexaFluor 500, AlexaFluor 532, AlexaFluor 546, AlexaFluor 568, AlexaFluor 594, AlexaFluor 610, AlexaFluor 633, AlexaFluor 647, AlexaFluor 660, AlexaFluor 680, AlexaFluor 700, AlexaFluor 750), DyLight™ (ThermoFisher Scientific, Waltham, Mass.) dyes (e.g., DyLight 350, DyLight 405, DyLight 488, DyLight 549, DyLight 594, DyLight 633, DyLight 649, DyLight 755), ATTO™ (ATTO-TEC GmbH, Siegen, Germany) dyes (e.g., ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 520, ATTO 532, ATTO 550, ATTO 565, ATTO Rho101, ATTO 590, ATTO 594, ATTO 610, ATTO 620, ATTO 633, ATTO 635, ATTO 637, ATTO 647, ATTO 647N, ATTO 655, ATTO 665, ATTO 680, ATTO 700, ATTO 725, ATTO 740), BODIPY® (Molecular Probes, Inc., Eugene, Oreg.) dyes (e.g., BODIPY FL, BODIPY R6G, BODIPY TMR, BOPDIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665), HiLyte Fluor™ (AnaSpec, Fremont, Calif.) dyes (e.g., HiLyte Fluor 488, HiLyte Fluor 555, HiLyte Fluor 594, HiLyte Fluor 647, HiLyte Fluor 680, HiLyte Fluor 750), AMCA, AMCA-S, Cascade® Blue (Molecular Probes, Inc., Eugene, Oreg.), Cascade Yellow, Coumarin, Hydroxycoumarin, Rhodamine Green™-X (Molecular Probes, Inc., Eugene, Oreg.), Rhodamine Red™-X (Molecular Probes, Inc., Eugene, Oreg.), Rhodamine 6G, TMR, TAMRA™ (Applied Biosystems, Carlsbad, Calif.), 5-TAMRA, ROX™ (Applied Biosystems, Carlsbad, Calif.), Oregon Green® (Life Technologies, Grand Island, N.Y.), Oregon Green 500, IRDye® 700 (Li-Cor Biosciences, Lincoln, Nebr.), IRDye 800, WeIIRED D2, WeIIRED D3, WeIIRED D4, and Lightcycler® 640 (Roche Diagnostics GmbH, Mannheim, Germany). In some embodiments, bright fluorophores with extinction coefficients>50,000 M−1 cm−1 and appropriate spectral matching with the fluorescence detection channels can be used.
In a specific embodiment, a fluorescently-labeled target strand and/or a fluorescently-labeled non-target strand is employed as a component of the cleavage substrate. Fluorophores include but are not limited to those described in Haughland, R. P., The Handbook, A Guide to Fluorescent Probes and Labeling Technologies, 10th Ed., 2005; Lakowicz, J. R., Principles of Fluorescence Spectroscopy, Springer, 3rd ed., 2006; 4-acetamido-4′-isothiocyanatostilbene-2,2′ disulfonic acid; acridine and derivatives such as acridine and acridine isothiocyanate; 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate, Lucifer Yellow VS; N-(4-anilino-1-naphthyl)maleimide; anthranilamide, Brilliant Yellow; BODIPY fluorophores (4,4-difluoro-4-bora-3a,4a-diaza-s-indacenes); coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcoumarin (Coumaran 151); cyanosine; DAPDXYL sulfonyl chloride; 4′,6-diaminidino-2-phenylindole (DAPI); 5′,5″-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4′-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4′-diisothiocyanatodihydro-stilbene-2,2′-disulfonic acid; 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid; 5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride); 4-4′-dimethylaminophenylazo)benzoic acid (DABCYL); 4-dimethylaminophenylazophenyl-4′-isothiocyanate (DABITC); EDANS (5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid), eosin and derivatives such as eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium such as ethidium bromide; fluorescein and derivatives such as 5-carboxyfluorescein (FAM), hexachlorofluorescenin, 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE) and fluorescein isothiocyanate (FITC); fluorescamine; green fluorescent protein and derivatives such as EBFP, EBFP2, ECFP, and YFP; IAEDANS (5-({2-[(iodoacetyl)amino]ethyl}amino)naphthalene-1-sulfonic acid), Malachite Green isothiocyanate; 4-methylumbelliferone; orthocresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerytnin; o-phthaldialdehyde; pyrene and derivatives such as pyrene butyrate, 1-pyrenesulfonyl chloride and succinimidyl 1-pyrene butyrate; QSY 7; QSY 9; Reactive Red 4 (Cibacron® Brilliant Red 3B-A); rhodamine and derivatives such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (Rhodamine 6G), rhodamine isothiocyanate, lissamine rhodamine B sulfonyl chloride, rhodamine B, rhodamine 123, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N′,N-tetramethyl-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives.
Exemplary quencher labels include a fluorophore, a quantum dot, a metal nanoparticle, etc.). Suitable quenchers include Black Hole Quencher®-1 (Biosearch Technologies, Novato, Calif.), BHQ®-2, Dabcyl, Iowa Black® FQ or Iowa Black® RQ (Integrated DNA Technologies, Coralville, Iowa), IowaBlack RQ, QXL™ (AnaSpec, Fremont, Calif.), QSY 7, QSY 9, QSY 21, QSY 35, and IRDye QC. In one instance, the term “quencher” refers to a substance which reduces emission from a fluorescent donor when in proximity to the donor. Fluorescence is quenched when the fluorescence emitted from the fluorophore is detectably reduced, such as reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more. Numerous fluorophore quenchers are known in the art, including, dabcyl; sulfonyl chlorides such as dansyl chloride; ATTO quenchers (available from ATTO-TEC GmbH, Siegen, Germany), such as ATTO 540Q, ATTO 575Q, ATTO 580Q, and ATTO 612Q; and Black Hole Quencher® labels, such as BHQ®-0, BHQ®-1, BHQ®-2, and BHQ®-3.
Yet other quenchers include those that can be employed in a double-quencher format. Typically, FRET pairs include one fluorescent label at one end of a nucleic acid sequence and one quencher label at the other end. Depending on the length of the nucleic acid sequence, such distances can be about 20-30 bases, in which quenching efficiency is dependent on close proximity between the fluorescent and quencher labels (e.g., about 0.5 to 10 nm). To reduce background signal, internal quenchers can be employed, in which a quencher label is placed between the two ends of the probe. In this double-quencher format, three labels are employed: a first fluorescent label at one end of a nucleic acid sequence, a first quencher label at the other end of the nucleic acid sequence, and a second quencher label disposed between the first fluorescent label and the first quencher label. The second quencher can be provided at any useful location, e.g., within 15, 14, 13, 12, 11, 10, or 9 bases of the first fluorescent label. Exemplary internal quenchers can include ZEN™ quencher or TAO™ quencher (Integrated DNA Technologies, Inc., Coralville, Iowa).
In some instances, a label can be placed internally by employing phosphoramidite chemistry, e.g., thereby placing an internal label between the 5′ and 3′ pentose position in the phosphate-pentose chain. In other instances, a label can be placed within a sequence by employing modified nucleic acid amidite chemistry, e.g., thereby placing a label within the nucleic acid sequence, in which the label is appended as a side chain from a modified nucleic acid, such as deoxythymidine (dT).
Any detection method or system operable to detect a labeled reaction product can be used in methods according to embodiments of the present invention and such appropriate detection methods and systems are well-known in the art. A signal from the fluorescently labeled reaction product is detected, for instance, using a UV light source, a LED light source, a flashlight, etc., such as from a mobile device, a smartphone, or a fluorescence plate reader.
Additional examples of fluorophore/quencher pairs are known in the art, for instance, described in Lakowicz, J. R., Principles of Fluorescence Spectroscopy, Springer, 3rd ed., 2006; and Haughland, R. P., The Handbook, A Guide to Fluorescent Probes and Labeling Technologies, 10th Ed., 2005, which is incorporated herein by reference in its entirety.
Methods of Using a Cleavage Substrate
The present invention also relates to methods of using a cleavage substrate (e.g., any described herein) to determine nuclease activity. In some embodiments, the cleavage substrate facilitates high-throughput assay formats, which may be useful for understanding how a library of compounds (e.g., drugs, such as activators, inhibitors, small molecules, peptides, proteins, antibodies, affibodies, aptamers, vectors, particles, etc.) interact with the nuclease or how a library of different nucleases exhibit enzymatic activity for particular synthetic guiding components in use with the cleavage substrate.
Such methods can be easily adapted to include a test compound (e.g., a drug) to determine the effect of that compound on nuclease activity, which can have implications for controlling and predicting genetic editing when employing a CRISPR-Cas system.
Any useful format can be employed to implement the methods herein. In one non-limiting method, a high-throughput array is employed to allow for high-throughput analysis of a library of nucleases or compounds.
Any useful denaturation conditions can be employed. In one instance, proteins (e.g., such as a nuclease) can be denatured by using an increased temperature (e.g., about 95° C. or of from about 60° C. to about 98° C.). In another instance, a chaotropic agent can be employed to disrupt interactions within the tertiary structure of the protein. Exemplary chaotropic agents include guanidinium, guanidine (e.g., of from about 6M to 8M), urea (e.g., of from about 6M to 8M), lithium perchlorate, formamide, sodium dodecyl sulfate, as well as salts thereof (e.g., guanidine hydrochloride or guanidinium chloride). In yet another instance, an alcohol (e.g., ethanol or isopropanol) can be employed to denature proteins.
Target Sites and Synthetic Guiding Components
Within a cleavage substrate, the target strand can include any useful nucleic acid sequence as the target site. In turn, the synthetic guiding component can be employed to recognize the target site, e.g., by employing a sequence that is complementary to the target site in the target sequence. The synthetic guiding component, with the Cas protein, can be employed to bind and/or cleave the target site of the target strand. Cleavage can include disruption of a single strand within the cleavage substrate or disruption of both strands.
In some instances, the target site is substantially complementary to the targeting portion. In other instances, the targeting portion of the synthetic guiding component and the complementary target site includes nucleic acid sequences that are substantially identical.
Any useful target site may be employed, so long as the target site is sufficiently complementary to the targeting portion. The sequence of target sites may be derived from known sequences of a subject. Exemplary target sites can include a sequence derived from a gene, e.g., a gene in which a mutation (e.g., a deletion, substitution, or insertion) has been identified to impart improper protein expression or regulation, such as, without limitation, AKT, BRCA1, BRCA2, BMD, CCR2, DMD, EGFR, EPM2A, Erb4, IGF, IGFR, IL-10, IL-13, IRAK1, Kras, Met, mGLUR5, MYBPC3, PRKCE, RAC1, VEGF, etc.
Yet other exemplary target sites can include a sequence derived from a bacterium, such as such as Bacillus (e.g., B. anthracis), Enterobacteriaceae (e.g., Salmonella, Escherichia coli, Yersinia pestis, Klebsiella, and Shigella), Yersinia (e.g., Y. pestis or Y. enterocolitica), Staphylococcus (e.g., S. aureus), Streptococcus, Gonorrheae, Enterococcus (e.g., E. faecalis), Listeria (e.g., L. monocytogenes), Brucella (e.g., B. abortus, B. melitensis, or B. suis), Vibrio (e.g., V. cholerae), Corynebacterium diphtheria, Pseudomonas (e.g., P. pseudomallei or P. aeruginosa), Burkholderia (e.g., B. mallei or B. pseudomallei), Shigella (e.g., S. dysenteriae), Rickettsia (e.g., R. rickettsii, R. prowazekii, or R. typhi), Francisella tularensis, Chlamydia psittaci, Coxiella burnetii, Mycoplasma (e.g., M. mycoides), etc.; an allergen, such as mycotoxins, mold spores, or bacterial spores such as Clostridium botulinum and C. perfringens; a toxin, such as ricin, mycotoxin, tetrodotoxin, anthrax toxin, botulinum toxin, staphylococcal entertoxin B, or saxitoxin; a virus, such as Adenoviridae (e.g., adenovirus), Arenaviridae (e.g., Machupo virus), Bunyaviridae (e.g., Hantavirus or Rift Valley fever virus), Coronaviridae, Orthomyxoviridae (e.g., influenza viruses), Filoviridae (e.g., Ebola virus and Marburg virus), Flaviviridae (e.g., Japanese encephalitis virus and Yellow fever virus), Hepadnaviridae (e.g., hepatitis B virus), Herpesviridae (e.g., herpes simplex viruses), Papovaviridae (e.g., papilloma viruses), Paramyxoviridae (e.g., respiratory syncytial virus, measles virus, mumps virus, or parainfluenza virus), Parvoviridae, Picornaviridae (e.g., polioviruses), Poxviridae (e.g., variola viruses), Reoviridae (e.g., rotaviruses), Retroviridae (e.g., human T cell lymphotropic viruses (HTLV) and human immunodeficiency viruses (HIV)), Rhabdoviridae (e.g., rabies virus), and Togaviridae (e.g., encephalitis viruses, yellow fever virus, and rubella virus)); a protozoon, such as Cryptosporidium parvum, Encephalitozoa, Plasmodium, Toxoplasma gondii, Acanthamoeba, Entamoeba histolytica, Giardia lamblia, Trichomonas vaginalis, Leishmania, or Trypanosoma (e.g., T. brucei and T. cruzi); a helminth, such as cestodes (tapeworms), trematodes (flukes), or nematodes (roundworms, e.g., Ascaris lumbricoides, Trichuris trichiura, Necator americanus, or Ancylostoma duodenale); a parasite (e.g., any protozoa or helminths described herein); a fungus, such as Aspergilli, Candidae, Coccidioides immitis, and Cryptococci; a pathogen; an environmental contaminant; a water additive; an agricultural marker; a nucleic acid (e.g., oligonucleotides, polynucleotides, nucleotides, nucleosides, molecules of DNA, or molecules of RNA, including a chromosome, a plasmid, a viral genome, a primer, or a gene of any useful pathogen, such as those described herein); or a genetic modification (e.g., antibiotic resistance marker gene). Targets also include food-borne pathogens, such as Salmonella (e.g., Salmonella Typhimurium), pathogenic E. coli (e.g., O157:H7), Bacillus (e.g., B. cereus), Clostridium botulinum, Listeria monocytogenes, Yersinia (e.g., Y. enterocolitica), Norovirus (e.g., Norwalk virus), Shigella, Staphylococcus aureus, Toxoplasma gondii, Vibrio (e.g., V. vulnificus, V. cholera, V. parahaemolyticus), Campylobacter jejuni, and Clostridium perfringens; and weaponized pathogens, such as Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella (e.g., B. suis), Burkholderia mallei, Burkholderia pseudomallei, Shigella, Clostridium botulinum, Variola (e.g., V. major), Filoviridae (e.g., Ebola virus and Marburg virus), Arenaviridae (e.g., Lassa virus and Machupo virus), Clostridium perfringens, any food-borne pathogen (e.g., Salmonella species, Escherichia coli O157:H7, or Shigella), Chlamydia psittaci, Coxiella burnetii, Staphylococcal aureus, Rickettsia (e.g., R. prowazekii or R. rickettsii), Alphavirus (e.g., Venezuelan equine encephalitis virus, eastern equine encephalitis virus, or western equine encephalitis virus), Vibrio cholerae, Cryptosporidium parvum, Henipavirus (e.g., Nipah virus), Bunyaviridae (e.g., Hantavirus or Rift Valley fever virus), Flaviviridae (e.g., Japanese encephalitis virus and Yellow fever virus), and Coccidioides spp.
The test sample can include any useful sample, such as a microorganism, a virus, a bacterium, a fungus, a parasite, a helminth, a protozoon, a cell, tissue, a fluid, a swab, a biological sample (e.g., blood, serum, plasma, saliva, cerebrospinal fluid, etc.), a plant, an environmental sample (e.g., air, soil, and/or water), etc.
The RNA-guided DNA nuclease Cas9 is widely used for targeted modification of genomes from diverse organisms. Despite the extensive use of CRISPR systems for genome engineering and the rapid discovery and engineering of new CRISPR-associated nucleases, high-throughput assays for measuring enzymatic activity are lacking. The potential for accidental exposure or clinical off-target effects associated with the widespread use of CRISPR technology, underscore the need for therapeutically effective Cas9 inhibitors. Here, we describe a fluorescence assay for monitoring Cas9 nuclease activity and demonstrate its utility with S. pyogenes, S. aureus, and C. jejuni Cas9. The assay was validated by quantitatively profiling the species specificity of published anti-CRISPR (Acr) proteins. A screen of 189,606 small molecules with this assay resulted in six validated inhibitors of Cas9 endonuclease activity. The high-throughput nature of this assay makes it broadly applicable for the discovery of additional Cas9 inhibitors or the characterization of Cas9 enzyme variants.
Clustered regularly interspaced palindromic repeats (CRISPR) in the genomes of diverse prokaryotes and archaea combine with CRISPR-associated (Cas) proteins to provide immunity against pathogens. In the native context, Cas9 nuclease binds to a hybridized duplex of processed crRNA and trans-activating CRISPR RNA (tracrRNA) to generate a catalytically primed ribonucleoprotein (RNP) complex.1 The Cas9 RNP surveilles DNA to identify a specific protospacer-adjacent motif (PAM) sequence (which is unique to each species' Cas system) to catalyze duplex unwinding and the formation of an R-loop between the target DNA strand and the 5′ end of the crRNA.2-4 If there is little complementarity between the RNA and DNA the substrate will be rejected without modification. If there is perfect or near-perfect complementarity between the crRNA and the target DNA strand, conformational changes in the Cas9 protein trigger endonuclease hydrolysis of the DNA by the HNH and RuvC active sites.5, 6 Through this complex mechanism, Cas9 uses the sequence of a guide RNA species to cleave both strands of a targeted DNA.
The Cas9 enzyme from S. pyogenes (Spy) in combination with a single guide RNA (sgRNA, a combination of tracrRNA and crRNA in a single ˜100 nucleotides (ntd) species) has been adapted for the editing of genomes in human cell lines7-9 and diverse model organisms.10-13 The introduction of Cas9 and sgRNA into cells results in targeted dsDNA breaks which can undergo error-prone repair through Non-Homologous End-Joining (NHEJ), disrupting the coding sequence of a gene and resulting in knockout.14 Additionally, through the simultaneous addition of a homologous donor DNA, the Cas9-mediated dsDNA break can be repaired by Homologous Recombination (HR)7 or Microhomology-Mediated End Joining (MMEJ)15 to introduce a new sequence at the targeted locus.
Pre-clinical models have demonstrated the enormous potential of Cas9 to repair mutations associated with Duchenne Muscular Dystrophy16-18 and various other genetic diseases.19-26 Numerous viral and non-viral nanoparticle methods have been developed for the delivery of Cas9 with the potential for future human gene therapy use targeting somatic cells.27 In addition, the unique properties of engineered Cas9 variants and Cas9 from additional bacterial species has greatly expanded the potential applications of CRISPR mediated genome engineering. The CRISPR toolbox now includes Cas9 endonucleases that recognize a variety of PAM sequences, have unique functionality (e.g., active at elevated temperatures, ability to target RNA and DNA, etc.), and are smaller in size allowing delivery by viral vectors with limited cargo space.28-30
Because of the risks associated with spurious off-target genome modifications, significant research has been done to understand the factors affecting the fidelity of Cas9 target DNA recognition and cleavage. Previous research has demonstrated that Cas9 fidelity can be increased by using a minimal length of sgRNA guide to limit the bound lifetime at off-target locations31-33 or through the use of engineered Cas9 variants that are better able to kinetically discriminate mismatched targets.5, 34-36 Reducing the lifetime of the Cas9 protein within the cell37, 38 or the use of ligand binding domain-Cas9 fusions for allosterically-controlled activity39-41 also have the potential to reduce off-target effects. An alternative method for temporal control of Cas9 activity is the sequential administration of a Cas9 inhibitor after RNP dosing, a technique that has been demonstrated to substantially reduce off-target modification in mammalian cells.42 The development of Cas9 inhibitors, in addition to efforts to modify the Cas9 and sgRNA, are therefore valuable for ensuring the safety of CRISPR-based gene therapies and providing an antidote in the event of accidental exposure.
The screening of inhibitors of Cas9 activity is complicated: an inhibitor might act to prevent the guide RNA binding, DNA binding, or conformational changes that must occur prior to either cleavage event, thus blocking any DNA strand scission. Therefore, despite the intense research interest in Cas9 proteins, there is no high-throughput compatible activity assay that has been developed. Such an assay should be able to measure cleavage of a DNA substrate by Cas9 (ideally, differentiating double-stranded and nicking activity) with high sensitivity in microliter reaction volumes, using a minimum of reagents and processing steps. Molecular beacon-based binding assays have been used to study Cas9 binding to complementary and mismatched targets,43, 44 but these are not able to report on DNA cleavage. Additional assays using cleavage-coupled DNA amplification45, 46 or electrochemiluminescence signal generation47 have also been reported, but these and simple gel electrophoresis-based assays are not compatible with high-throughput applications.
Here, we describe two designs of fluorophore/quencher-labeled DNA substrate oligonucleotides for monitoring Cas9 strand cleavage events. The optimal substrate design is agonistic to Cas9 DNA binding and is able to discriminate between the wild-type (wt) Cas9 and variants lacking either or both of the nuclease domains. We show that this assay can be adapted to different species of Cas9 by simply altering the PAM sequence. To implement the assay in high-throughput format, we miniaturized the reactions and carried out a 189,606-small molecule screen in low-volume 384-well format. The assay appears suitable for both the development of clinically-useful inhibitors and the rapid characterization of engineered Cas9 proteins with higher-fidelity5, 34-36 or modified PAM sequences.41, 49 Additional details follow.
Chemicals, Substrates, and Plasmids: All reagents were from Fisher BioReagents unless otherwise noted. Bovine serum albumin (BSA), magnesium chloride, polyethylenimine (PEI), and guanidine-hydrochloride (Gdn-HCl) were from Sigma-Aldrich. Ultrapure RNase/DNase-free water and ethylenediaminetetraacetic acid (EDTA) were from Invitrogen. Tris(2-carboxyethyl)phosphine (TCEP), dithiothreitol (DTT), and isopropyl j-D-1-thiogalactopyranoside (IPTG) were from Gold Biotechnology. Carbenicillin and kanamycin were from Teknova. Protease inhibitors were from Pierce Biotechnology. The FDA-approved inhibitor hit compound restocks were purchased from MedChemExpress. The fluorophore/quencher deoxyoligonucleotides were ordered HPLC-purified from Integrated DNA Technologies (IDT). Table 2 lists the sequences of all oligonucleotides.
TAATACGACTCACTATA
GACGCATAAAGATGAGACGCGTTTTAGAGCTAG
TAATACGACTCACTATA
GCTGACGCATAAAGATGAGACGCGTTTTAGTACT
TAATACGACTCACTATA
GCTGACGCATAAAGATGAGACGCGTTTTAGTCCC
The plasmids for the bacterial production of S. pyogenes (Spy) wt, D10A, H840A, and dead Cas9 (Addgene plasmids 39312, 39315, 39316, 39318)1 and S. aureus (Sau) Cas950 as His-MBP-TEV protease site fusions were gifts from Jennifer Doudna. The NLS-Cas9-His6 plasmid was a gift from David Liu (Addgene plasmid 62934).51 The C. jejuni (Cje) Cas9 plasmid was a gift from Seokjoong Kim (Addgene plasmid #89754).30 The plasmid for the bacterial production of AcrIIA4 was generated in a modified pTXB1 plasmid backbone (with a C-terminal His6 tag after the chitin-binding domain) by standard restriction enzyme cloning. The plasmid for the production of AcrIIC1 was generated by modification of Addgene plasmid #39312, replacing the Cas9 gene with AcrIIC1.
In Vitro Transcription of sgRNA: The Spy/Sau/Cje sgRNA were produced by run-off transcription from a linearized plasmid using the NEB HiScribe High Yield T7 RNA Synthesis Kit. The RNA was purified with a Qiagen RNeasy Maxi kit according to manufacturer specifications. The RNA concentration was determined by A260.
Purification of S. pyogenes Cas9 and variants: The Cas9 plasmid was transformed into E. coli BL21(star)DE3, grown to an OD600 of μ0.5, induced with 0.25 mM IPTG and grown at 20° C. for an additional 20 hours. The pellets were lysed in buffer A [50 mM Tris-HCl pH 7.5, 500 mM NaCl, 0.5 mM TCEP, 10% glycerol] containing Pierce protease inhibitor tablets by passage through an Avestin EmulsiFlex-C5 homogenizer. The lysate was clarified, passed through a Ni-NTA column, and eluted with a linear gradient of 10 to 500 mM imidazole in buffer A. The eluted protein was dialyzed overnight against 1 L of buffer [20 mM HEPES pH 8, 200 mM KCl, 0.5 mM TCEP, 10% glycerol] in the presence of 1/30th mass of TEV protease. MacroPrep High S cation exchange chromatography was performed with a linear gradient of low salt buffer [20 mM HEPES pH 8, 100 mM KCl, 0.5 mM TCEP, 10% glycerol] to high salt buffer [20 mM HEPES pH 8, 1000 mM KCl, 0.5 mM TCEP, 10% glycerol]. The eluted protein was passed through a 5 mL Ni-NTA column and the flow-through was collected, concentrated, and exchanged into storage buffer [20 mM HEPES pH 8, 150 mM KCl, 1 mM TCEP, 20% glycerol]. It was flash frozen and stored at −80° C.
Purification of S. aureus and C. jejuni Cas9: The same procedure was performed as above, except the clarified lysate was adjusted to 0.2% PEI by dropwise addition from a 10% stock (pH 7) on ice. After 30 minutes, the precipitated nucleic acid was pelleted at 50,000 g for 30 minutes at 4° C. The supernatant was collected and adjusted to 50% saturated ammonium sulfate on ice. After 30 minutes, the protein precipitate was pelleted at 50,000 g for 30 minutes at 4° C. The pellet was resuspended and purified through Ni-NTA and cation exchange chromatography as described above. The eluted protein was concentrated in high salt buffer and purified by an Enrich SEC 650 column. The protein-containing fractions from the SEC column were pooled and exchanged into storage buffer, then flash frozen and stored at −80° C.
Purification of AcrIIA4: The plasmids were transformed into E. coli BL21(star)DE3, grown, and lysed as described above. The clarified lysate containing AcrIIA4 was passed through a 5 mL Ni-NTA column and eluted with a linear gradient of 10 to 500 mM imidazole in low salt buffer A [50 mM Tris-HCl pH 7.5, 100 mM NaCl, 0.5 mM TCEP, 10 mM imidazole]. The eluted protein was adjusted to 100 mM DTT and incubated at 4° C. to promote cleavage of the CBD-His tag. AcrIIA4 was separated from the tag by a 5 mL MacroPrep High Q anion exchange chromatography step with a linear gradient of low salt [20 mM HEPES pH 8, 100 mM KCl, 0.5 mM TCEP] to high salt buffer [20 mM HEPES pH 8, 1000 mM KCl, 0.5 mM TCEP]. The eluted protein was concentrated, exchanged into buffer [20 mM HEPES pH 8, 100 mM KCl, 0.5 mM TCEP], flash frozen and stored at −80° C.
Purification of AcrIIC1: The plasmid was transformed into E. coli BL21(star)DE3, grown, and lysed as described above. The clarified lysate containing AcrIIC1 was passed through a 5 mL Ni-NTA column and eluted with a linear gradient of 10 to 500 mM imidazole in buffer A. The eluted protein was dialyzed in the presence of 1/30th mass of TEV protease against buffer A overnight at 4° C. The cleaved AcrIIC1 was separated from the tag and TEV protease by two passes through a 5 mL Ni-NTA column. The flow-through was concentrated and exchanged as with AcrIIA4.
Fluorescence Assays for Cas9: Reactions (50 μL) were set up in Cas9 reaction buffer [20 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA] containing 50 nM annealed DNA substrate, 1 μM sgRNA, and 2 μM Cas9 in the wells of a black 384-well plate. The reactions were incubated for 1 hour at ambient temperature, then 50 μL of 8 M Gdn-HCl was added to quench the reaction. For Spy Cas9 this was sufficient to denature the protein and release the cleaved DNA product. For Sau and Cje Cas9 the plates were covered with an aluminum seal and incubated at 55° C. for 1 hour before reading. The fluorescence was read in a Tecan Infinite M1000 or M200 Pro plate spectrofluorometer.
Anti-CRISPR Profiling Against Spy, Sau, and Cje Cas9: Reactions (50 μL) were set up in Cas9 reaction buffer [20 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA] containing 30 nM annealed DNA substrate, 0.4 μM sgRNA, and 0.2 μM Cas9 in the wells of a black 384-well plate. The reactions were incubated for 1 hour at ambient temperature with the indicated concentration of anti-CRISPR protein, then 50 μL of 8 M Gdn-HCl was added to quench the reaction. The plates were covered with an aluminum and incubated at 55° C. for 1 hour before reading on a Tecan Infinite M200 Pro plate spectrofluorometer.
Purification of NLS-Cas9-His6 in High-Throughput Scale: The NLS-Cas9-His6 construct used for the high-throughput screening was purified in 4 to 8 L growth batches through Ni-NTA affinity chromatography as described, then flash-frozen and stored at −80° C. Once sufficient material was obtained, the batches were thawed, pooled, and purified by a 50 mL MacroPrep High S Cation Exchange column, washed with low salt buffer [20 mM HEPES pH 8, 100 mM KCl, 0.5 mM TCEP, 10% glycerol] and eluted in high salt buffer [20 mM HEPES pH 8, 1000 mM KCl, 0.5 mM TCEP, 10% glycerol]. The eluted protein was diluted with glycerol to adjust the final concentration to 40% (approximately 50 μM protein concentration), flash frozen, and stored at −80° C.
High-Throughput Screening Protocol: HTS buffer [20 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 1 mM TCEP, 0.5% Bovine Serum Albumin (BSA)] was dispensed into low-volume black 384 well plates (Greiner Bio-One #784076) with 5 μL/well. 100 nL of compounds in DMSO (1 mM) from the UCLA Molecular Screening Shared Resource were pinned into the wells. Columns 2 and 23 contained only DMSO. The plates were sealed and stored at 4° C. for 1 to 4 days before assay. NLS-Cas9-His6 (0.667 μM) and sgRNA (1.33 μM) were combined in HTS buffer, and 3 μL was dispensed into the wells (from a BioTek EL406 equipped with a 1 μL cassette) and incubated for 30 to 60 minutes. Annealed duplex reporter substrate (10 μM) was diluted to 150 nM in HTS buffer and reactions were initiated by dispensing 2 μL into each well. After 20-30 minutes, the reactions were quenched by dispensing 10 μL of 8 M Gdn-HCl. The fluorescence was measured on a Tecan Infinite M1000 with: 10 second shake using a linear amplitude of 2 mm, excitation wavelength: 624 nm (band width 8 nm), emission wavelength: 680 nm (band width 8 nm), maximal gain, Z-position: 25570 μM. All other settings were left at default. The fluorescence data were normalized relative to the positive and negative controls in the same rows to give a fractional fluorescence of the controls for each well/compound.
Denaturing Gel Electrophoresis Secondary Assay: The 5′ FAM target 50mer and 5′ FAM non-target 63mer oligonucleotides were purified by denaturing PAGE, and annealed at 10 μM. Reactions were performed as above, except that the dual FAM-labeled substrates were used. After 20 minutes, the reactions were quenched by the addition of one volume of 2× formamide loading buffer and were heated to 95° C. for 10 minutes to denature the substrate strands and analyzed by denaturing 8M urea 20% polyacrylamide gel. The gels were imaged for FAM fluorescence by a ProteinSimple FluorChem R imaging system. ImageJ52 was used to analyze the intensity of the intact and cut bands and ratiometric quantitation was performed.
To facilitate high-throughput screening of Cas9 variants with unique activity requirements5, 34-36, 48, 49 and/or inhibitors of Cas9,42 we sought to develop a simple, high-throughput Fluorescence Resonance Energy Transfer (FRET)-based assay for monitoring Cas9 activity. We designed two variants of fluorophore/quencher-labeled DNA substrates: a “same-strand” variant in which a Tao/IowaBlack dual quencher and an internal Cy5 fluorophore are located on either side of the cleavage site in the non-target strand (
Cas9, by virtue of extensive electrostatic interactions and the base-pairing between the bound guide RNA and the target DNA sequence, remains extremely tightly bound to its product even after cleavage.54 The tight binding of Cas9 RNP to the product DNA prevents enzymatic turnover (under in vitro conditions) and release of the cleaved fragments and thus inhibits signal generation from the dissociation of fluorophore quencher pairs. To overcome this limitation, we assayed the substrates both under native conditions in buffer and after the addition of 4M guanidine-hydrochloride (Gdn-HCl) to denature the protein. For the “same-strand” substrate the addition of either wild-type (wt) or nuclease-inactivated dead (dCas9) variants of Cas9 produced a significant increase in fluorescence in the native context (
Another unique aspect of the Cas9 enzyme is its concerted use of two discrete and non-homologous nuclease domains to cleave both strands of a DNA substrate. Therefore, the RuvC or HNH nuclease domains could be inhibited in isolation, blocking just one of the two DNA strand scission reactions. To determine if these two substrate designs can distinguish double stranded cleavage from cleavage of each strand in isolation, we purified and tested the D10A (RuvC KO) and H840A (HNH KO) variants of Cas9. When the reactions were quenched with Gdn-HCl, the “same-strand” substrate showed no increase in fluorescence with the D10A, H840A, or dead Cas9 (
Interestingly, with the “opposite-strand” substrate both the D10A and H840A showed a partial increase in fluorescence, four-to-six-fold, as opposed to the ten-fold increase in signal obtained upon addition of wt Cas9 (
Initial experiments were performed with the well-characterized Spy Cas9. Although Spy Cas9 is the most widely used Cas9 for genome editing, its large size (4.1 kb) prevents it from being packaged with its sgRNA into the efficient in vivo delivery vector, adeno-associated virus (AAV).55 As an alternative, researchers have turned to two smaller Cas9 orthologues with genome editing capabilities, S. aureus (Sau) Cas9 (3.16 kb), and C. jejuni (Cje) Cas9 (2.95 kb), that can be packaged together with their sgRNA into an AAV vector for efficient in vivo delivery. These orthologues are also gaining interest from the research community due to recent publications that indicate these two endonucleases are capable of PAM-independent RNA targeting.50, 56
To broaden the assay to identify inhibitors of these enzymes and demonstrate its versatility for diverse Cas9 PAM sequences, we characterized FRET substrates for Sau and Cje Cas9. The Spy and Sau Cas9 PAM sequences are partially overlapping and complementary such that the same substrate can be used for both enzymes (
To evaluate the ability of the Spy, Sau, and Cje Cas9 cleavage assays to quantitatively measure changes in activity, we used published phage-derived anti-CRISPR proteins AcrIIA4 and AcrIIC1 for validation. AcrIIA4 was discovered as a Spy Cas9 inhibitor,57 and has since been shown to inhibit Spy Cas9 by binding to RNP competitively with PAM-interacting and non-target DNA strand cleavage catalytic pockets.42 AcrIIC1 was reported as a more broad-spectrum Cas9 inhibitor that works against several species, including Cje, but not Spy.51, 59
To measure AcrIIA4 and AcrIIC1 efficacy and specificity, varying concentrations of inhibitor protein were added to reactions measuring the activity of Spy, Sau, and Cje Cas9 on a single 384-well plate. As expected from published results, AcrIIA4 shows extremely potent inhibition of Spy Cas9 (<30 nM, below the active Cas9 concentration required for this assay) (
To reduce reagent use and costs associated with high-throughput screening we sought to identify the minimal concentrations of all reactants required for a robust signal change. Because Cas9 follows single-turnover kinetics, a titration of Cas9 and sgRNA under endpoint conditions can determine the minimal amount sufficient for complete digestion of substrate. For a fixed 30 nM concentration of DNA substrate, a titration of sgRNA (with saturating 500 nM Cas9) (
From these results 30 nM DNA, 200 nM Cas9, and 400 nM sgRNA were selected. These reaction conditions were then adapted from a 50 μL reaction volume in standard 384-well plates to a 10 μL reaction volume in low-volume 384 well-plates. As validation of assay quality the variance around the positive (no inhibitor) and negative controls (without Cas9 RNP) was low and the large signal change between the two was maintained in the low-volume format as indicated by an excellent assay Z-factor (Z′) of 0.755 (
To determine the optimal reaction time before the addition of the Gdn-HCl quench, a time course for the Cas9 nuclease activity was performed (
With the assay developed and optimized for HTS, we performed a screen of 189,606 non-redundant small molecules supplied by the UCLA Molecular Shared Screening Resource using 630 low-volume 384-well plates, and the fluorescence signal was normalized to positive and negative controls on each plate (
To confirm the 437 hits and directly measure the inhibition of the both the RuvC and HNH nuclease domains individually, each hit was screened with the above-described PAGE assay. The gel results were quantitated by densitometry and the fractional RuvC and HNH nuclease activity of controls were calculated and plotted along with the fractional fluorescence of the same compound in the primary screen (
Overall, we report the first high-throughput fluorescence assay for measuring Cas9 nuclease activity. The optimal substrate produced a large (˜10-fold) signal change upon complete digestion, with the single nuclease domain “nickase” proteins producing a ˜5-fold signal change. The near-identical results obtained with the Spy, Sau, and Cje Cas9 substrates lead us to believe that this assay procedure will be broadly applicable for any Cas9 variant, species' or engineered. Because the reported assay is far more scalable than previously published Cas9 assays,3, 61-63 the characterization of Cas9 variants designed to have alternative PAM sequences or increased fidelity could be done with greater expedience and with a minimum amount of DNA and sgRNA. Additionally, given the ongoing research to identify naturally-occurring protein-based anti-CRISPRs,57 the ability to simultaneously measure inhibition of many species of Cas9 on a single 384-well plate will facilitate the rapid classification of Cas9 inhibitors. This is particularly relevant as some anti-CRISPRs show activity against many Cas9 species.′59
When this assay was used to screen for small molecule inhibitors of Cas9, a low hit-rate of 0.2% was obtained. The small number of hits reflects the difficulty of Cas9 as a drug target. The extensive binding contacts between the Cas9 protein and sgRNA or DNA produce an avidity that is difficult for a small molecule with a relatively few possible interactions to surmount. Additionally, there is a very limited opportunity for any reversible inhibitor to block Cas9 DNA cleavage, due to its single turnover kinetics. This is not unlike the challenge of developing small molecule inhibitors of protein-protein interactions, although there has been some success in this area.64 Regardless, the assay showed excellent Z′-factors across the screen, and 6 wells containing Cas9 inhibitors were identified and confirmed from 189,606 starting compounds over the course of approximately 10 days. The low-volume format reduced the reagent consumption to ˜60 nmol of DNA substrate, ˜60 mg of Cas9, and ˜26 mg of sgRNA for screening ˜200,000 compounds. With a high signal-to-noise ratio, easy scalability, and low reagent consumption this assay is therefore useful for numerous applications throughout the broad CRISPR-Cas9 field.
Cas9 protein is one component required for genome modification; however, Cas9 nuclease activity and thus bound guide RNA is required to generate a double-stranded DNA break. To sensitively measure Cas9 activity in bodily fluids, we adapted a fluorescence Cas9 activity assay65 for detection on a centrifugal microfluidic platform (
A fluorophore/quencher-labeled DNA duplex (containing the target sequence of interest) was immobilized on silica microparticles. Briefly, a Cy5 dye-labeled, biotinylated oligonucleotide was annealed with a shorter complementary quencher strand. The quenched duplex strand was then incubated with streptavidin-functionalized 5 mm silica microparticles for 2 h at room temperature and washed three times in Cas9 reaction buffer. The particles were concentrated to 20% w/v from the stock concentration of 1% by centrifugation.
Sample containing Cas9 and guide RNA was incubated with the substrate-functionalized particles, then separated by centrifugation through density medium that denatures the Cas9 protein to release bound DNA. Briefly, 10 mL of particles were incubated with 5 mL of sample for 25 m. The density medium for this experiment consisted of 2.5 M guanidinium hydrochloride to denature the Cas9 proteins bound to the DNA duplex, allowing the quencher strand to dissociate. 75 mL of density medium was added to the disc and spun for 5 s at 4000 rpm. The sample suspension was then added to the disc and spun for 1.5 m at 6000 rpm. Upon cleavage and denaturation, the quencher-conjugated DNA strand dissociates from the bead-immobilized fluorophore strand to generate an increase in fluorescence from the bead pellet that is proportional to Cas9 RNP concentration (
When Cas9 activity was measured directly in serum, only a marginal increase in background fluorescence was observed with the Cas9-dependent increase in fluorescence being almost identical to that in buffer (
To emphasize the importance of simultaneous Cas9 protein and target-specific nuclease activity in a single platform, we analyzed samples consisting of the wt Cas9 protein, the D10A and H840A nickase mutants with one active site disrupted, and the nuclease D10A/H840A dead Cas9. The chemiluminescence signal from all these Cas9 variants was identical, as expected, because the capture and detection antibodies are unlikely to contain an epitope overlapping these mutations (
In contrast, the fluorescence-based Cas9 activity measurements in the presence of guide RNA showed almost no increase in fluorescence with the dCas9 or the nickase variants, but a significant increase in fluorescence with the wt Cas9 (
To test this capability directly in cells, HEK293T human cells containing an integrated Cas9 reporter were transfected with plasmid encoding Cas9 protein and a scrambled (off-target) or on-target AAVS1 guide. The reporter produces red fluorescent protein (RFP) constitutively and, upon Cas9-mediated editing at the AAVS1 site, green fluorescent protein (GFP) is produced. Four days after transfection, the cells showed the expected presence of GFP in the on-target transfection, but no GFP in the off-target transfection or the untransfected control.
Just two days after transfection, the cells were lysed and analyzed for Cas9 protein and on-target nuclease activity. Even at this early time, the presence of Cas9 could be clearly identified as chemiluminescence signal in both the on- and off-target guide transfections, but not in the untransfected control (
All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.
Other embodiments are within the claims.
This application claims the benefit of U.S. Provisional Application No. 62/646,780, filed Mar. 22, 2018, which is hereby incorporated by reference in its entirety.
This invention was made with Government support under Contract No. DE-NA0003525 awarded by the United States Department of Energy/National Nuclear Security Administration. The Government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 6188812 | Kao et al. | Feb 2001 | B1 |
| 6210986 | Arnold et al. | Apr 2001 | B1 |
| 6277257 | Paul et al. | Aug 2001 | B1 |
| 6287440 | Arnold et al. | Sep 2001 | B1 |
| 6428666 | Singh et al. | Aug 2002 | B1 |
| 6495015 | Schoeniger et al. | Dec 2002 | B1 |
| 6572749 | Paul et al. | Jun 2003 | B1 |
| 6843272 | Schoeniger et al. | Jan 2005 | B2 |
| 6960285 | Schoeniger et al. | Nov 2005 | B2 |
| 7022287 | Schoeniger et al. | Apr 2006 | B2 |
| 7368290 | Kruppa et al. | May 2008 | B2 |
| 9024111 | Schoeniger et al. | May 2015 | B1 |
| 9803238 | Koh et al. | Oct 2017 | B1 |
| 10267788 | Schoeniger et al. | Apr 2019 | B1 |
| 20150211058 | Carstens | Jul 2015 | A1 |
| 20160090603 | Carnes et al. | Mar 2016 | A1 |
| 20180028686 | Brinker et al. | Feb 2018 | A1 |
| 20180049984 | Brinker et al. | Feb 2018 | A1 |
| 20180274017 | Abudayyeh et al. | Sep 2018 | A1 |
| 20180298445 | Abudayyeh et al. | Oct 2018 | A1 |
| 20180305773 | Abudayyeh et al. | Oct 2018 | A1 |
| 20180340218 | Abudayyeh et al. | Nov 2018 | A1 |
| 20190062724 | Hsu et al. | Feb 2019 | A1 |
| Number | Date | Country |
|---|---|---|
| WO 2018064352 | Apr 2018 | WO |
| WO 2018064371 | Apr 2018 | WO |
| Entry |
|---|
| Anders, Carolin, and Martin Jinek. “In vitro enzymology of Cas9.” Methods in enzymology. vol. 546. Academic Press, 2014. 1-20. |
| Anders et al. (“In vitro enzymology of Cas9.” Methods in enzymology. vol. 546. Academic Press, 2014. 1-20). |
| Peng et al. “Potential pitfalls of CRISPR/Cas9-mediated genome editing.” The FEBS journal 283.7 (2016): 1218-1231, see pp. 1222-1223). |
| Gasiunas et al. “A catalogue of biochemically diverse CRISPR-Cas9 orthologs.” Nature communications 11.1 (2020): 1-10). |
| Peng, Jingyu, et al. “High-throughput screens in mammalian cells using the CRISPR-Cas9 system.” The FEBS journal 282.11 (2015): 2089-2096.). |
| U.S. Appl. No. 15/008,285, filed Jan. 27, 2016, Meagher et al. |
| U.S. Appl. No. 15/204,804, filed Jul. 7, 2016, Negrete et al. |
| U.S. Appl. No. 15/717,524, filed Sep. 27, 2017, Koh et al. |
| U.S. Appl. No. 16/219,779, filed Dec. 13, 2018, Negrete et al. |
| U.S. Appl. No. 16/443,316, filed Jun. 17, 2019, Negrete et al. |
| U.S. Appl. No. 15/951,977, filed Apr. 12, 2018, Bird et al. |
| Abudayyeh OO et al., “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector,” Science 2016;353:aaf5573 (9 pp.). |
| Abudayyeh OO et al., “RNA targeting with CRISPR-Cas13,” Nature 2017;550:280-4. |
| Burstein D, “New CRISPR-Cas systems from uncultivated microbes,” Nature 2017;542:237-41. |
| Cebrian-Serrano A et al., “CRISPR-Cas orthologues and variants: optimizing the repertoire, specificty and delivery of genome engineering tools,” Mamm. Genome 2017;28:(7-8):247-61. |
| Chen JS et al., “CRISPR-Cas12a target binging unleashes indiscriminate single-stranded DNase activity,” Science 2018;360:436-9. |
| Chen JS et al., “Enhanced proofreading governs CRISPR-Cas9 targeting accuracy,” Nature 2017;550(7676):407-10. |
| Cho SW et al., “Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease,” Nat. Biotechnol. 2013;31(3):230-2. |
| Cinesi C et al., “Contracting CAG/CTG repeats usng the CRISPR-Cas9 nickase,” Nat. Commun. 2016;7:13272 (10 pp.). |
| Cong L et al., “Multiplex genome engineering using CRISPR/Cas systems,” Science 2013;339:819-23. |
| Cox DBT et al., “RNA editing with CRISPR-Cas13,” Science 2017;358:1019-27. |
| Ding Q et al., “Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing,” Circ. Res. 2014;115(5):488-92. |
| Doench JG et al., “Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9,” Nat. Biotechnol. 2015;34(2):184-91. |
| Dugar G et al., “CRISPR RNA-dependent binding and cleavage of endogenous RNAs by the Campylobacter jejuni Cas9,” Mol. Cell. 2018;69(5):893-905. |
| East-Seletsly A et al., “Two distinct RNase activities of CRISPS-C2c2 enable guide-RNA processing and RNA detection,” Nature 2016;538:270-3. |
| Fu Y et al., “Improving CRISPR-Cas nuclease specificity using truncated guide RNAs,” Nat. Biotechnol. 2014;32(3):279-84. |
| Gasiunas G et al., “Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria,” Proc. Nat'l Acad. Sci. 2012;109:E2579-86. |
| Gratz SJ et al., “Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease,” Genetics 2013;194(4):1029-35. |
| Gulei D et al., “CRISPR-based RNA editing: diagnostic applications and therapeutic options,” Expert Rev. Molec. Diagnostics 2019;19:83-8. |
| Harrington LB et al., “A thermostable Cas9 with increased lifetime in human plasma,” Nat. Commun. 2017;8:1424 (8 pp.). |
| Harrington LB et al., “Programmed DNA destruction by miniature CRISPR-Cas14 enzymes,” Science 2018; 362 839-42. |
| Harrington LB et al., “A broad-spectrum inhibitor of CRISPR-Cas9,” Cell 2017;170(6):1224-33. |
| Hirano H et al., “Structure and engineering of Francisella novicida Cas9,” Cell 2016;164:950-61. |
| Hou Z et al., “Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis,” Proc. Nat'l Acad. Sci. 2013;110:15644-9. |
| Hsu PD et al., “DNA targeting specificity of RNA-guided Cas9 nucleases,” Nat. Biotechnol. 2013;31(9):827-32. |
| Hu JH et al., “Evolved Cas9 variants with broad PAM compatibility and high DNA specificity,” Nature 2018;556(7699):57-63. |
| Huang M, “Clustered regularly interspaced short palindromic repeats/Cas9 triggered isothermal amplification for site-specific nucleic acid detection,” Anal. Chem. 2018;90(3):2193-200. |
| Huang M et al., “Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 triggered isothermal amplification for site-specific nucleic acid detection,” Anal Chem. 2018;90(3):2193-200. |
| Hwang WY et al., “Efficient genome editing in zebrafish using a CRISPR-Cas system,” Nat Biotechnol. 2013;31(3):227-9. |
| Jinek M et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 2012;337:816-21. |
| Jinek M et al., “RNA-programmed genome editing in human cells,” eLife 2013;2:e00471 (9 pp.). |
| Karvelis T et al., “Rapid characterization of CRISPR-Cas9 protospacer adjacent motif sequence elements,” Genome Biol. 2015;16(1):253 (13 pp.). |
| Kim E et al., “In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni,” Nat. Commun. 2017;8:14500 (12 pp.). |
| Kleinstiver BP et al., “Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition,” Nat. Biotechnol. 2015:33:1293-8. |
| Kleinstiver BP et al., “Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing,” Nat. Biotechnol. 2019;37(3):276-82. |
| Kleinstiver BP et al., “Engineered CRISPR-Cas9 nucleases with altered PAM specificities,” Nature 2015;523:481-5. |
| Kleinstiver BP et al., “Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells,” Nat. Biotechnol. 2016;34:869-74. |
| Kleinstiver BP et al., “High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects,” Nature 2016;529:490-5. |
| Konermann S et al., “Transcriptome engineering with RNA-targeting type VI-D CRISPR effectors,” Cell 2018;173:665-76. |
| Koo T et al., “Selective disruption of an oncogenic mutant allele by CRISPR/Cas9 induces efficient tumor regression,” Nucleic Acids Res. 2017;45(13):7897-908. |
| Koonin EV et al., “Diversity, classification and evolution of CRISPR-Cas systems,” Curr. Op. Microbiol. 2017;37:67-78. |
| Kulcsár PI et al., “Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage,” Genome Biol. 2017;18(1):190 (17 pp.). |
| Leenay RT et al., “Deciphering, communicating, and engineering the CRISPR PAM,” J. Mol. Biol. 2017;429(2):177-91. |
| Li B et al., “Synthetic oligonucleotides inhibit CRISPR-Cpf1-mediated genome editing,” Cell Rep. 2018;25:3262-72. |
| Liu JJ et al., “CasX enzymes comprise a distinct family of RNA-guided genome editors,” Nature 2019;566:218-23. |
| Liu W et al., “In vitro evaluation of CRISPR/Cas9 function by an electrochemiluminescent assay,” Anal. Chem. 2016;68(17):8369-74. |
| Liu C et al., “Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications,” J. Control. Release 2017;266:17-26. |
| Liu KI et al., “A chemical-inducible CRISPR-Cas9 system for rapid control of genome editing,” Nat. Chem. Biol. 2016;12(11):980-7. |
| Long C et al., “Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA,” Science 2014;345(6201):1184-8. |
| Makarova KS et al., “Evolution and classification of the CRISPR-Cas systems,” Nat. Rev. Microbiol. 2011;9:467-77. |
| Mali P et al., “RNA-guided human genome engineering via Cas9,” Science 2013;339(6121):823-6. |
| Marshall R et al., “Rapid and scalable characterization of CRISPR technologies using an E. coli cell-free transcription-translation system,” Mol. Cell. 2018;69(1):148-57. |
| Mekler V et al., “Kinetics of the CRISPR-Cas9 effector complex assembly and the role of 3′-terminal segment of guide RNA,” Nucleic Acids Res. 2016;44(5):2837-45. |
| Mekler V et al., “Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation,” Proc. Nat'l Acad. Sci. USA 2017;114(21):5443-8. |
| Moreno AM et al., “Therapeutic genome engineering via CRISPR-Cas systems,” WIREs Syst. Biol. Med. 2017;9:e1380 (14 pp.). |
| Murugan K et al., “The revolution continues newly discovered systems expand the Crispr-Cas toolkit,” Mol. Cell. 2017;68:15-25. |
| Murovec J et al., “New variants of CRISPR RNA-guided genome editing enzymes,” Plant Biotechnol. J. 2017;15:917-26. |
| Nakayama T et al., “Simple and efficient CRISPR/Cas9-mediated targeted mutagenesis in Xenopus tropicalis,” Genesis 2013;51(12):835-43. |
| Nelson CE et al., “In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy,” Science 2016;351(6271):403-7. |
| Nishimasu H et al., “Engineered CRISPR-Cas9 nuclease with expanded targeting space,” Science 2018;361:1259-62. |
| Oakes BL et al., “Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch,” Nat. Biotechnol. 2016;34(6):646-51. |
| Ohmori T et al., “CRISPR/Cas9-mediated genome editing via postnatal administration of AAV vector cures haemophilia B mice,” Sci. Rep. 2017;7(1):4159 (11 pp.). |
| Pattanayak V et al., “High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity,” Nat. Biotechnol. 2013;31(9):839-43. |
| Pawluk A et al., “Naturally occurring off-switches for CRISPR-Cas9,” Cell 2016;167(7):1829-38. |
| Pegram LM et al., “Why Hofmeister effects of many salts favor protein folding but not DNA helix formation,” Proc. Nat'l Acad. Sci. USA 2010;107(17):7716-21. |
| Phaneuf CR et al., “Ultrasensitive multi-species detection of CRISPR-Cas9 by a portable centrifugal microfluidic platform,” Anal. Methods 2019;11(5):559-65. |
| Pinto BS et al., “Impeding transcription of expanded microsatellite repeats by deactivated Cas9,” Mol. Cell. 2017;68(3):479-90. |
| Ran FA et al., “In vivo genome editing using Staphylococcus aureus Cas9,” Nature 2015;520(7546):186-91. |
| Rauch BJ et al., “Inhibition of CRISPR-Cas9 with bacteriophage proteins,” Cell 2017;168(1-2):150-8. |
| Rose JC et al., “Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics,” Nat. Methods 2017;14(9):891-6. |
| Schneider CA et al., “NIH Image to ImageJ: 25 years of image analysis,” Nat. Methods 2012;9(7):671-5. |
| Scott DE et al., “Small molecules, big targets: drug discovery faces the protein-protein interaction challenge,” Nat. Rev. Drug Discov. 2016;15(8):533-50. |
| Seamon KJ et al., “Versatile high-throughput fluorescence assay for monitoring Cas9 activity,” Anal. Chem. 2018;90(11):6913-21. |
| Seiple LA et al., “Potent inhibition of human apurinic/apyrimidinic endonuclease 1 by arylstibonic acids,” Mol. Pharmacol. 2008;73(3):669-77. |
| Senturk S et al., “Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization,” Nat. Commun. 2017;8:14370 (10 pp.). |
| Shin J et al., “Disabling Cas9 by an anti-CRISPR DNA mimic,” Sci. Adv. 2017;3:(7):e1701620 (9 pp.). |
| Singh D et al., “Real-time observation of DNA recognition and rejection by the RNA-guided endonuclease Cas9,” Nat. Commun. 2016;7:12778 (8 pp.). |
| Slaymaker IM et al., “Rationally engineered Cas9 nucleases with improved specificity,” Science 2016;351(6268)84-8. |
| Smargon AA et al., “Cas13b is a type VI-B CRISPR-associated RNA-guided RNase differentially regulated by accessory proteins Csx27 and Csx28,” Mol. Cell 2017;65(4):618-30. |
| Sternberg SH et al., “Conformational control of DNA target cleavage by CRISPR-Cas9,” Nature Nov. 5, 2015;527(7576):110-3. |
| Sternberg SH et al., “DNA interrogation by the CRISPR RNA-guided endonuclease Cas9,” Nature 2014;507:(7490):62-7. |
| Strecker J et al., “Engineering CRISPR-Cas12b for human genome editing,” Nat. Commun. 2019;10:212 (8 pp.). |
| Strutt SC et al., “RNA-dependent RNA targeting by CRISPR-Cas9,” eLife 2018;7:e32724 (17 pp.). |
| Suzuki K et al., “In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration,” Nature 2016;540:(7631):144-9. |
| Tabebordbar M et al., “In vivo gene editing in dystrophic mouse muscle and muscle stem cells,” Science 2016;351(6271):407-11. |
| Tang Y et al., “Class 2 CRISPR/Cas: an expanding biotechnology toolbox for and beyond genome editing,” Cell Biosci. 2017;8:59 (13 pp.). |
| Teng F et al., “Repurposing CRISPR-Cas12b for mammalian genome engineering,” Cell Discovery 2018;4:63 (15 pp.). |
| Tsai SQ et al., “GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nuclease,” Nat. Biotechnol. 2015;33(2):187-97. |
| Tu Z et al., “Promoting Cas9 degradation reduces mosaic mutations in non-human primate embryos,” Sci. Rep. 2017;7:42081 (11 pp.). |
| Wang H et al., “One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering,” Cell 2013;153(4):910-8. |
| Wu Y et al., “Correction of a genetic disease in mouse via use of CRISPR-Cas9,” Cell Stem Cell 2013;13(6):659-62. |
| Wu Z et al., “Effect of genome size on AAV vector packaging,” Mol. Ther. 2010;18(1):80-6. |
| Xia H et al., “Developement of single-tube nested real-time PCR assays with long internally quenched probes for detection of norovirus genogroup II,” BioTechniques 2016;60(1):28-34. |
| Yamano T et al., “Crystal structure of Cpf1 in complex with guide RNA and target RNA,” Cell 2016;165:949-62. |
| Yang Y et al., “A dual AAV system enables the Cas9-mediated correction of a metabolic liver disease in newborn mice,” Nat. Biotechnol. 2016;34(3):334-8. |
| Yang H et al., “Inhibition mechanism of an anti-CRISPR suppressor AcrIIA4 targeting SpyCas9,” Mol. Cell. 2017;67(1):117-27. |
| Yao X et al., “CRISPR/Cas9-mediated precise targeted integration in vivo using a double cut donor with short homology arms,” EBioMedicine 2017;20:19-26. |
| Zetsche B et al., “Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system,” Cell 2015;163:759-71. |
| Zhang K et al., “Cas9 cleavage assay for pre-screening of sgRNAs using nicking triggered isothermal amplification,” Chem. Sci., 2016;7(8):4951-7. |
| Zhang JH et al., “A simple statistical parameter for use in evaluation and validation of high throughput screening assay,” J. Biomol. Screen. 1999;4(2):67-73. |
| Zhang JP et al., “Different effects of sgRNA length on CRISPR-mediated gene knockout efficiency,” Sci. Rep. 2016;6:28566 (10 pp.). |
| Zhou W et al., “A CRISPR-Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection,” Nat. Commun. 2018;9:5012 (11 pp.). |
| Zuris JA et al., “Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo,” Nat. Biotechnol. 2015;33(1):73-80. |
| Number | Date | Country | |
|---|---|---|---|
| 62646780 | Mar 2018 | US |
