Patent Application
20050272089
The increasing presence of antibiotic resistant bacteria in the clinical setting has renewed interest within the pharmaceutical industry for the development of new classes of antimicrobial agents. One strategy for the identification of potential new antibiotics is to develop molecular screens against novel antibacterial targets that are essential for the survival of the bacterium. Essential gene products traditionally have been identified through the isolation of conditional lethal mutants or the directed deletion of the target gene in the presence of a complementation vector. However these approaches are time consuming, laborious, and limited to bacteria with well defined genetic systems. The complete sequence analysis of many microbial genomes has led to the development of in vitro transposon mutagenesis as a more rapid method for identifying essential genes in bacteria. Transposon mutagenesis results in the disruption of the gene into which the transposon has inserted. Following recombination into the host chromosome, if the insertion allows the bacteria to survive and form colonies then it is unlikely that the gene is essential for bacterial viability under those conditions.
Haemophilus influenzae is a small, gram-negative, facultative anaerobic bacilli that frequently resides in the human upper respiratory tract. Infection by H. influenzae occurs most commonly in children, where it causes meningitis, sepsis, epiglotlitis, pneumonia, sinusitis, and where it is isolated in up to 25% of cases of otitis media. H. influenzae infection occurs in adults, typically those compromised by other conditions including diabetes and AIDS.
In the past, antibiotics were often effective to treat H. influenzae infections; however, antibiotic resistant strains have become prevalent. Thus, there continues to exist a need for new agents useful for treating bacterial infections, particularly those caused by antibiotic-resistant H. influenzae, and for methods of identifying such new agents. Such methods ideally would identify agents that are unrelated to existing antimicrobials and that target different aspects of H. influenzae pathogenesis in the host, compared to existing antimicrobials.
The present invention provides isolated polynucleotides. A polynucleotide may include a nucleotide sequence of the coding sequence in SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complements thereof. In another aspect, a polynucleotide may include a coding sequence encoding a critical polypeptide having structural similarity, for instance, at least about 95 percent structural similarity, with an amino acid sequence of SEQ ID NO: 282, 283, 285, 286, 289, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 307, 308, 311, 312, 314, 315, 318, 321, 322, 323, 324, 327, 328, 329, 340, 341, 343, 345,325, 326, 444-498 or may include a coding sequence encoding an essential polypeptide having structural similarity, for instance, at least about 95 percent structural similarity, with an amino acid sequence selected from the group consisting of SEQ ID NO: 282, 283, 285, 286, 289, 293, 294, 295, 296, 297, 300, 301, 302, 304, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 325, 326, and 444-498.
The present invention also provides isolated polypeptides. A polypeptide may include an amino acid sequence of SEQ ID NO:282, 283, 285, 286, 289, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 307, 308, 311, 312, 314, 315, 318, 321, 322, 323, 324, 327, 328, 329, 340, 341, 343, 345, 325, 326, and 444-498. In another aspect, the polypeptide is a critical polypeptide, preferably, an essential polypeptide, may have an amino acid sequence having structural similarity, for instance, at least about 95 percent structural similarity, with an amino acid sequence of SEQ ID NO: 282, 283, 285, 286, 289, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 307, 308, 311, 312, 314, 315, 318, 321, 322, 323, 324, 327, 328, 329, 340, 341, 343, 345, 325, 326, and 444-498.
Also provided by the present invention is a method for identifying an agent that binds a polypeptide. The method includes combining a polypeptide and an agent to form a mixture, and determining whether the agent binds the polypeptide. The polypeptide is encoded by a polynucleotide of the present invention. Determining whether the agent binds the polypeptide can include an assay, for instance, an enzyme assay, a binding assay, or a ligand binding assay.
The method may further include determining whether the agent decreases the growth rate of a microbe. Determining whether the agent decreases the growth rate includes combining a microbe with the agent, incubating the microbe and the agent under conditions suitable for growth of a microbe that is not combined with the agent, and determining the growth rate of the microbe combined with the agent. A decrease in growth rate compared to the microbe that is not combined with the agent indicates the agent decreases the growth rate of the microbe. Preferably the microbe is H. influenzae, and preferably, the microbe is in vitro or in vivo. The present invention includes an agent identified by the method.
In another aspect of such methods for identifying an agent that binds a polypeptide, the polypeptide is a critical, preferably, an essential, polypeptide having structural similarity, for instance, at least about 95 percent structural similarity, with a polypeptide of the present invention.
The present invention is also directed to a method for decreasing the growth rate of a microbe. The method includes combining a microbe with an agent that binds to a polypeptide of the present invention. The microbe may by in vitro or in vivo.
The present invention is further directed to a method for making an H. influenzae with reduced virulence. The method includes altering a coding sequence in an H. influenzae to include a mutation, and determining if the H. influenzae including the mutation has reduced virulence compared to an H. influenzae that does not include the mutation. The non-mutagenized coding sequence can include a coding sequence present at a polynucleotide of the present invention. The mutation may be, for instance; a deletion mutation, an insertion mutation, a nonsense mutation, and a missense mutation. The present invention also includes a H. influenzae having reduced virulence, and a vaccine composition that includes the H. influenzae.
The sequence of the H. influenzae genome has been determined and includes about 1,738 coding sequences (see, for instance, Fleischmann et al., Science, 269, 496-512 (1995); GenBank Accession Number L42023 and the Accession Numbers cited therein; and at The Institute for Genomic Research (TIGR) comprehensive microbial resource, Haemophilus influenzae KW20 genome page (www.tigr.org/tigr-scripts/CMR2/GenomePage3.spl?database=ghi)). As used herein, the terms “coding sequence,” “coding region,” and “open reading frame” are used interchangeably herein and refer to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences, expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5′ end and a translation stop codon at its 3′ end. A regulatory sequence is a nucleotide sequence that regulates expression of a coding region to which it is operably linked. Nonlimiting examples of regulatory sequences include promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A regulatory sequence is “operably linked” to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.
The function of some coding sequences of the H. influenzae genome has been hypothesized by comparing an H. influenzae coding sequence with a second coding sequence from another organism, where the second coding sequence has a known function. The putative function of many of the H. influenzae coding sequences is described in Fleischmann et al. (Science, 269, 496-512 (1995)), GenBank Accession Number L42023, and at The Institute for Genomic Research (TIGR) comprehensive microbial resource, Haemophilus influenzae KW20 genome page (www.tigr.org/tigr-scripts/CMR2/GenomePage3.spl?database=ghi). This subset of coding sequences is referred to herein as “known coding sequences.” However, even though the function of these coding sequences can be hypothesized, for many it is unknown if they are required for bacterial growth. Those known coding sequences that are required for bacterial growth are potential novel targets for antimicrobial therapy.
At this time, it is not possible to predict the function of some of the polypeptides that the approximately 1,738 coding sequences of the H. influenzae genome are predicted to encode. This subset of coding sequences is referred to herein as “unknown coding sequences.” Among the unknown coding sequences in the H. influenzae genome, those that are required for cell growth are potential novel targets for antimicrobial therapy.
As used herein, a “critical coding sequence” encodes a polypeptide that is required for a bacterial cell, preferably H. influenzae, H. ducreyi, or H. aegyptius, more preferably, H. influenzae, to grow at a normal growth rate in vitro or in vivo, preferably in vitro. A coding sequence is a critical coding sequence when mutagenesis of the coding sequence in a bacterial cell decreases the growth rate of the bacterial cell to, in increasing levels of preference, less than about 50%, less than about 60%, less than about 80%, most preferably, less than about 90% of the growth rate of the bacterial cell that does not contain the mutated coding sequence. Methods of measuring the growth rate of microbes are well known and routine in the art and include, for instance, measurement by changes in optical density of a liquid culture as a function of time, or measurement by changes in colony diameter as a function of time. A critical coding sequence may encode a polypeptide having a known function, or in some aspects of the invention, encode a polypeptide having an unknown function. Preferably, a critical coding sequence encodes a polypeptide having a known function.
A polypeptide encoded by a critical coding sequence is referred to herein as a “critical polypeptide.” As used herein, the term “polypeptide” refers to a polymer of amino acids and does not refer to a specific length of a polymer of amino acids. Thus, for example, the terms peptide, oligopeptide, protein, and enzyme are included within the definition of polypeptide. This term also includes post-expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like.
As used herein, growth of a microbe “in vitro” refers to growth in, for instance, a test tube or on an agar plate. Growth of a microbe “in vivo” refers to growth in, for instance, a cultured cell or in an animal. As used herein, the term “microbe” and “bacteria” are used interchangeably and include single celled prokaryotic and lower eukaryotic (e.g., fungi) organisms, preferably prokaryotic organisms.
Preferably, a critical coding sequence is an essential coding sequence. An “essential coding sequence,” as used herein, is a coding sequence that encodes a polypeptide that is essential for the bacterial cell, preferably H. influenzae, H. ducreyi, or H. aegyptius, more preferably, H. influenzae, to grow in vitro or in vivo, preferably in vitro. Such polypeptides are referred to herein as “essential polypeptides.” An essential coding sequence may encode a polypeptide having an unknown function, or in some aspects of the invention, encode a polypeptide having a known function. Preferably, an essential coding sequence encodes a polypeptide having a known function.
Identification of these critical coding sequences, preferably essential coding sequences, provides a means for discovering new agents with different targets and mechanisms of action compared to existing agents that are used to inhibit bacteria, preferably H. influenzae, H. ducreyi, or H. aegyptius, more preferably, H. influenzae. As used herein, the term “agent” refers to chemical compounds, including, for instance, an organic compound, an inorganic compound, a metal, a polypeptide, a non-ribosomal polypeptide, a polyketide, or a peptidomimetic compound that binds to a particular polypeptide or nucleotide sequence. The terms “binds to a polypeptide” and “binds a polypeptide” refer to a condition of proximity between an agent and a polypeptide. The association may be non-covalent, wherein the juxtaposition is energetically favored by hydrogen bonding, van der Waals forces, or electrostatic interactions, or it may be covalent. The identification of coding sequences of microbes, preferably H. influenzae, H. ducreyi, or H. aegyptius, more preferably, H. influenzae, that are useful in the present invention can begin by identifying coding sequences predicted to encode a polypeptide. The coding sequences can be identified in databases, including, for instance, the GenBank database, the TIGR Comprehensive Microbial Resource, and the Kyoto Encyclopedia of Genes and Genores. The identification of such coding sequences can include constructing contigs from data present in such databases.
The data obtained from the databases may contain the nucleotide sequence of genomic clones and predicted open reading frames. However, even though the putative coding sequences may have been known, there was no indication that the coding sequences were in fact expressed, or in fact critical coding sequences. For instance, there is limited data known in the art regarding regulatory regions required for the transcription of a nucleotide sequence in H. influenzae. Moreover, prior to the experiments described herein, there was generally no evidence that the critical coding sequences and essential coding sequences identified herein were actually expressed. Thus, a person of ordinary skill, having the polynucleotide sequence of a genomic clone, would not be able to predict that an open reading frame would be transcribed, or that a coding sequence was critical, preferably, essential.
Typically, whether a coding sequence is a critical coding sequence, preferably, an essential coding sequence, can be determined by inactivating the coding sequence in a bacterial cell and determining the growth rate of the bacterial cell. Growth can be measured in vitro or in vivo, preferably in vitro. Inactivating a coding sequence may be done by mutating a coding sequence present in a bacterial cell. Mutations include, for instance, a deletion mutation (i.e., the deletion of nucleotides from the coding sequence), an insertion mutation (i.e., the insertion of additional nucleotides, for instance, a transposon, into the coding sequence), a nonsense mutation (i.e., changing a nucleotide of a codon so the codon encodes a different amino acid), and a missense mutation (i.e., changing a nucleotide of a codon so the codon functions as a stop codon). Some insertion mutations and some deletion mutations result in frame-shift mutations. Preferably, a coding sequence in a bacterial cell is engineered to contain an insertion.
Methods for engineering a coding sequence to contain an insertion are known in the art. Preferably, the insertion is a transposon. In general, a selected coding sequence can be subjected to transposon mutagenesis by isolating or synthesizing the coding sequence by methods known in the art, including, for instance, the polymerase chain reaction (PCR). Preferably, the coding sequence includes about 1,000 base pairs (bp) flanking the coding sequence (i.e., about 500 bp upstream and about 500 bp downstream of the coding sequence), more preferably, about 2,000 bp flanking the coding sequence. Optionally, the coding sequence may be ligated to a vector. Preferably, a vector is a suicide vector, i.e., it is unable to replicate in H. influenzae. An example of a suicide plasmid that can be used with H. influenzae is pBR322. A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polypeptide encoded by the coding region, i.e., an expression vector. Preferably the vector is a plasmid.
The coding sequence is subjected to in vitro transposon mutagenesis using routine methods known in the art. Preferably, in vitro mutagenesis is accomplished by using Tn7, available under the trade designation GPS-M (New England Biolabs, Beverly, Mass.), or using Tn5 as described by Goryshin and Reznikoff, J. Biol. Chem., 273, 7367-7374 (1998), and available under the trade designation EZ::TN (Epicentre, Madison, Wis.). The transposon typically includes a coding sequence that encodes a selectable marker. A selectable marker can render a cell resistant to an antibiotic, for example kanamycin, ampicillin, chloramphenicol, tetracycline, and neomycin.
Following mutagenesis, the coding sequence may be introduced to a bacterial cells, preferably an H. influenzae strain, using methods known in the art, and the transformed strains are incubated under conditions that select for those transformants containing the transposon present in the chromosome. A solid medium (e.g., media containing about 1.5 % agar) or liquid medium may be used. Examples of rich media include brain heart infusion, and others are known in the art (see, for instance, Atlas, Handbook of Microbiological Media, 2 ed., CRC Press (1997)). Preferably, the medium used is solid, containing brain heart infusion supplemented with about 5% Fildes Enrichment. Typically, at least about 40 individual transformants are subjected to DNA amplification of a region of the selected coding sequence that corresponds to about the first 300 bp of the coding sequence, more preferably, the first 500 bp of the coding sequence. If no insertions are found in this region, and subsequent analysis indicates transposon insertions are present upstream or downstream of the coding sequence, the coding sequence that was the target of mutagenesis is considered essential. If insertions are found in this region, but the transformants containing insertions in this region have a decreased growth rate, the coding sequence that was the target of mutagenesis is considered to be a critical coding sequence.
Using these methods, the following critical coding sequences have been identified: the coding sequence present in SEQ ID NO: 11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 150, 165, 170, 180, 185, 200, 205, 210, 215, 220, 232, 237, 242, 247, 252, 267, 357, 389-443, nucleotides 936-2429 of SEQ ID NO:225, and nucleotides 2443-3809 of SEQ ID NO:225. The polypeptides encoded by these coding sequences are SEQ ID NO: 282, 283, 285, 286, 289, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 307, 308, 311, 312, 314, 315, 318, 321, 322, 323, 324, 327, 328, 329, 340, 341, 343, 345, 444-498, 325, and 326, respectively. Using these methods, the following essential coding sequences have been identified: the coding sequence present in SEQ ID NO: 11, 16, 26, 31, 46, 69, 74, 79, 84, 89, 104, 109, 114, 124, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 389-443, nucleotides 936-2429 of SEQ ID NO:225, and nucleotides 2443-3809 of SEQ ID NO:225. The polypeptides encoded by these coding sequences are SEQ ID NO: 282, 283, 285, 286, 289, 293, 294, 295, 296, 297, 300, 301, 302, 304, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 444-498, 325, and 326, respectively.
The coding sequences of the present invention include critical coding sequences, preferably, essential coding sequences, that are similar to the coding sequences present in SEQ ID NO: 11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complement thereof. The similarity is referred to as structural similarity and is determined by aligning the residues of the two polynucleotides (i.e., the nucleotide sequence of the candidate coding sequence and the nucleotide sequence of the coding region of SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complement thereof) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order. A candidate coding region is the coding region being compared to a coding region present in SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complement thereof. A candidate coding region can be isolated from a microbe, preferably H. influenzae, or can be produced using recombinant techniques, or chemically or enzymatically synthesized. Preferably, two coding regions are compared using the blastn program of the BLAST search algorithm, which is described by Altshul et al., (Nucl. Acids Res., 25, 3389-3402 (1997)), and available at the National Center for Biotechnology Information (for instance, www.ncbi.nlm.nih.gov/BLAST/, or www.ncbi.nlm.nih.gov/Microb_blast/unfinishedgenome.html). Preferably, the default values for all BLAST search parameters are used. In the comparison of two coding regions using the BLAST search algorithm, structural similarity is referred to as “identities.” Preferably, a polynucleotide includes a coding region having a structural similarity with the coding region of SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complement thereof, of, in increasing order of preference, at least about 40%, at least about 60%, at least about 80%, at least about 90%, most preferably at least about 95% identity.
Typically, such a candidate coding region having structural similarity to a coding region of one of the listed sequences has activity, i.e., it is a critical coding region or an essential coding region. Whether such a candidate coding region is critical or essential can be determined by evaluating whether the candidate coding region encodes a polypeptide that is able to complement a mutation of the appropriate coding region in H. influenzae, preferably the H. influenzae available from the American Type Culture Collection as ATCC 51907. For instance, to determine if a coding region having structural similarity to the coding region present in SEQ ID NO:64 is a critical coding region, the coding region can be expressed in an H. influenzae containing a mutation in the coding region present at SEQ ID NO:64. If the growth rate of the H. influenzae is restored, then the candidate coding region is a critical coding region. Likewise, to determine if a coding region having structural similarity to the coding region present in SEQ ID NO:11 is an essential coding region, the coding region can be expressed in a H. influenzae containing a mutation in the coding region present at SEQ ID NO:11. If the growth rate of the H. influenzae is restored, then the candidate coding region is an essential coding region. For example, a candidate coding region can be introduced into H. influenzae on a plasmid and expressed, and using the methods described herein, the chromosomal copy of the appropriate coding region can be inactivated. If insertions of the chromosomal copy of the appropriate coding region are identified, then the candidate coding region is an essential coding region.
Preferably the polynucleotides of the present invention are isolated. As used herein, an “isolated” polypeptide or polynucleotide means a polypeptide or polynucleotide that has been either removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized. Typically, an isolated polynucleotide of the present invention does not include the entire genome of the microbe, preferably, H. influenzae, from which the polynucleotide was obtained. Preferably, a polypeptide or polynucleotide of this invention is purified, i.e., essentially free from any other polypeptides or polynucleotides and associated cellular products or other impurities.
The present invention includes the critical polypeptides and essential polypeptides encoded by the coding sequences of the present invention. Preferably, a polypeptide of the present invention is isolated, more preferably, purified. The critical, preferably, essential, polypeptides of the present invention include polypeptides that are similar to the polypeptides present in SEQ ID NO: 282, 283, 285, 286, 289, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 325, 326, 292, 299, 305, 308, 315, 318, 343, 444-498. The similarity is referred to as structural similarity and is determined by aligning the residues of the two polypeptides (i.e., the amino acid sequence of the candidate polypeptide and the amino acid sequence of SEQ ID NO:282, 283, 285, 286, 289, 293, 294, 295, 296, 297, 300, 301, 302, 304, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 325, 326, 292, 299, 305, 308, 315, 318, 343, 444-498 to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared amino acids, although the amino acids in each sequence must nonetheless remain in their proper order. A candidate amino acid sequence is the polypeptide being compared to one of SEQ ID NO:282, 283, 285, 286, 289, 293, 294, 295, 296, 297, 300, 301, 302, 304, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 325, 326, 292, 299, 305, 308, 315, 318, 343, 444-498. A candidate amino acid sequence can be isolated from a microbe, preferably H. influenzae, or can be produced using recombinant techniques, or chemically or enzymatically synthesized. Preferably, two amino acid sequences are compared using the tblastn program of the BLAST search algorithm, which is described by Altshul et al., (Nucl. Acids Res., 25, 3389-3402 (1997)), and available at the National Center for Biotechnology Information (for instance, www.ncbi.nlm.nih.gov/Microb_blast/unfinishedgenome.html, or www.ncbi.nlm.nih.gov/BLAST/). Preferably, the default values for all BLAST search parameters are used. In the comparison of two amino acid sequences using the BLAST search algorithm, structural similarity is referred to as “identities.” Preferably, a polypeptide includes an amino acid sequence having a structural similarity with SEQ ID NO:282, 283, 285, 286, 289, 293, 294, 295, 296, 297, 300, 301, 302, 304, 307, 311, 312, 314, 321, 322, 323, 324, 327, 328, 329, 340, 341, 345, 325, 326, 292, 299, 305, 308, 315, 318, 343, 444-498 of, in increasing order of preference, at least about 56%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, most preferably at least about 95% identity.
Typically, such a candidate polypeptide having structural similarity to an amino acid sequence of the present invention has activity, i.e., it is a critical polypeptide or an essential polypeptide. Whether such a candidate polypeptide is critical or essential can be determined by evaluating whether it is able to complement a mutation of the appropriate coding region in H. influenzae, preferably the H. influenzae available from the American Type Culture Collection as ATCC 51907. For instance, to determine if a polypeptide having structural similarity to SEQ ID NO:292 is a critical polypeptide, the ability of the candidate polypeptide to complement an H. influenzae that contains a mutation such that it does not express a polypeptide having the sequence SEQ ID NO:292 may be determined. If the growth rate of the H. influenzae is restored, then the candidate polypeptide is a critical polypeptide. Likewise, to determine if a polypeptide having structural similarity to SEQ ID NO:282 is an essential polypeptide; the ability of the candidate polypeptide to complement an H. influenzae that contains a mutation such that it does not express a polypeptide having the sequence SEQ ID NO:282 may be determined. If the growth rate of the H. influenzae is restored, then the candidate coding region is an essential coding region. For example, a coding region encoding a candidate polypeptide can be introduced into H. influenzae on a plasmid and expressed, and using the methods described herein, the chromosomal copy of the appropriate coding region can be inactivated. If insertions of the chromosomal copy of the appropriate gene are identified, then the candidate polypeptide is an essential polypeptide.
Insertional inactivation of critical coding sequences, preferably, essential coding sequences, allows different classes of coding sequences to be identified. Examples of different classes include, for instance, coding sequences encoding proteins involved in cell surface metabolism, enzymes involved in cellular biosynthetic pathways including cell wall biosynthesis and assembly, components of the TCA cycle, proteins similar to oligopeptide transport proteins of the ATP-binding cassette (ABC) transporter superfamily, and involved in cellular regulatory and repair processes, and coding sequences affecting morphogenesis and cell division, secretion and sorting of proteins, and signal transduction systems.
The critical coding sequences, preferably, essential coding sequences may be cloned by PCR, using microbial, preferably H. influenzae, H. ducreyi, or H. aegyplius, more preferably, H. influenzae, genomic DNA as the template. When H. influenzae is used, genomic DNA may be obtained from the American Type Culture Collection as ATCC 51907D. For ease of inserting the open reading frame into vectors, preferably expression vectors, PCR primers may be chosen so that the PCR-amplified coding sequence has a restriction enzyme site at the 5′ end preceding the initiation codon ATG, and a restriction enzyme site at the 3′ end after the termination codon TAG, TGA or TAA. If desirable, the codons in the coding sequence may be changed, without changing the amino acids, to optimize expression of a polypeptide encoded by an essential coding sequence. For instance, if an essential coding sequence is to be expressed in E. coli, the codons of the coding sequence can be changed to comply with the E. coli codon preference (see, for instance, Grosjean and Fiers, Gene, 18, 199-209 (1982), and Konigsberg et al., Proc. Natl. Acad. Sci., USA, 80, 687-691 (1983)). Optimization of codon usage may lead to an increase in the expression of the encoded polypeptide when produced in a microbe other than the microbe from which the essential coding sequence was isolated. If the polypeptide is to be produced extracellularly, either in the periplasm of, for instance, E. coli or other bacteria, or into the cell culture medium, the coding sequence may be cloned without its initiation codon and placed into an expression vector behind a signal sequence.
Proteins may be produced in prokaryotic or eukaryotic expression systems using known promoters, vectors, and hosts. Such expression systems, promoters, vectors, and hosts are known to the art. A suitable host cell may be used for expression of the polypeptide, such as E. coli, other bactena, including Bacillus and H. influenzae, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused to a polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a protein typically requires a signal peptide (also known as pre-sequence); a number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein.
The polypeptide encoded by a critical coding sequence, preferably, an essential coding sequence, may be isolated. To simplify the isolation process, a purification tag may be added either at the 5′ or 3′ end of the coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Pat. Nos. 5,284,933 and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra, Protein Engineering, 6, 109-122 (1993), a FLAG peptide (Hopp et al, Biotechnology, 6, 1205-1210 (1988)), glutathione S-transferase (Smith and Johnson, Gene, 67, 31-40 (1988)), and thioredoxin (LaVallie et al., Bio/Technology, 11, 187-193 (1993)). To remove these tags, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa, thrombin, and enterokinase.
The identification of critical coding sequences, preferably, essential coding sequences, renders them useful in methods of identifying new agents according to the present invention. Such methods include assaying potential agents for the ability to interfere with expression of a critical coding sequence, preferably, an essential coding sequence, thereby preventing the expression and decreasing the concentration of a polypeptide encoded by the coding sequence. Without intending to be limiting, it is anticipated that agents can~act by, for instance, interacting with a critical coding sequence, preferably, an essential coding sequence, interacting with a nucleotide sequence (e.g., a promoter sequence) that is adjacent to a critical coding sequence, preferably, an essential coding sequence, or inhibiting expression of a polypeptide involved in regulating expression of a critical coding sequence, preferably, an essential coding region. Agents that can be used to inhibit the expression of a critical coding sequence, preferably, an essential coding region include, for instance, the use of anti-sense polynucleotides that are complementary to the mRNA molecules transcribed from the coding sequence, and double stranded RNA (Fire et al., Nature, 391, 806-11 (1998)).
Such methods also include assaying potential agents for the ability to bind to a polypeptide encoded in whole or in part by a nucleotide sequence set forth in any one of the coding sequence present in SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or the complementary strand thereof. Optionally, agents that bind to such a polypeptide can be further evaluated to determine if they inhibit the function of the polypeptide to which they bind.
A polypeptide produced by a critical coding sequence, preferably, an essential coding sequence, may be used in assays including, for instance, high throughput assays, to screen for agents that inhibit the function of the polypeptide. The sources for potential agents to be screened include, for instance, chemical compound libraries, fermentation media of Streptomycetes, other bacteria and fungi, and cell extracts of plants and other vegetations. For proteins with known enzymatic activity, assays may be established based on the activity, and a large number of potential agents can be screened for ability to inhibit the activity. Such assays are referred to herein as “enzyme assays.” Enzyme assays vary depending on the enzyme, and typically are known to the art.
For proteins that interact with another protein or nucleic acid, assays may be established to measure such interaction directly, and the potential agents screened for the ability to inhibit the binding interaction (referred to herein as “binding assays”). In another aspect of the invention, assays can be established allowing the identification of agents that bind to a polypeptide encoded by an essential coding sequence (referred to herein as “ligand binding assays”).
For proteins that interact with another protein or nucleic acid, such binding interactions may be evaluated indirectly using the yeast two-hybrid system described in Fields and Song, Nature, 340, 245-246 (1989), and Fields and Sternglanz, Trends in Genetics, 10, 286-292 (1994). The two-hybrid system is a genetic assay for detecting interactions between two polypeptides. It can be used to identify proteins that bind to a known protein of interest, or to delineate domains or residues critical for an interaction. Variations on this methodology have been developed to clone coding sequences that encode DNA-binding proteins, to identify polypeptides that bind to a protein, and to screen for drugs. The two-hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA-binding domain that binds to an upstream activation sequence (UAS) of a reporter coding sequence, and is generally performed in yeast. The assay requires the construction of two hybrid coding sequences encoding (1) a DNA-binding domain that is fused to a protein X, and (2) an activation domain fused to a protein Y. The DNA-binding domain targets the first hybrid protein to the UAS of the reporter coding sequence; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the reporter coding sequence. The second hybrid protein, which contains the activation domain, cannot by itself activate expression of the reporter because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of protein X and protein Y tethers the activation domain to the UAS, activating transcription of the reporter coding sequence. When the polypeptide encoded by, for instance, an essential coding sequence (protein X, for example) is already known to interact with another protein or nucleic acid (protein Y, for example), this binding assay can be used to detect agents that interfere with the interaction of X and Y. Expression of the reporter coding sequence is monitored as different test agents are added to the system; the presence of an inhibitory agent inhibits binding and results in lack of a reporter signal.
When the function of a polypeptide encoded by, for instance, an essential coding sequence is unknown and no ligands are known to bind the polypeptide, the yeast two-hybrid assay can also be used to identify proteins that bind to the polypeptide. In an assay to identify proteins that bind to protein X (the target protein), a large number of hybrid coding sequences, each containing a different protein Y, are produced and screened in the assay. Typically, Y is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated to the activation domain. This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of protein Y. The system is highly sensitive and can detect interactions not revealed by other methods; even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein. When a protein is identified that binds to an essential polypeptide, the two-hybrid system can be used in a binding assay to identify agents that inhibit binding and result in lack of a reporter signal.
Ligand binding assays known to the art may be used to search for agents that bind to the target protein. Without intending to be limiting, one such screening method to identify direct binding of test ligands to a target protein is described in Bowie et al. (U.S. Pat. No. 5,585, 277). This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states. When a test ligand binds to the folded form of a target protein (i.e., when the test ligand is a ligand of the target protein), the target protein molecule bound by the ligand remains in its folded state. Thus, the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded state of the target protein. The function of the target protein need not be known in order for this assay to be performed.
Another method for identifying ligands for a target protein is described in Wieboldt et al., Anal. Chem., 69, 1683-1691 (1997). This technique screens combinatorial libraries of 20-30 agents at a time in solution phase for binding to the target protein. Agents that bind to the target protein are separated from other library components by centrifugal ultrafiltration. The specifically selected molecules that are retained on the filter are subsequently liberated from the target protein and analyzed by HPLC and pneumatically assisted electrospray (ion spray) ionization mass spectroscopy. This procedure selects library components with the greatest affinity for the target protein, and is particularly useful for small molecule libraries.
Another method allows the identification of ligands present in a sample using capillary electrophoresis (CE) (see Hughes et al., U.S. Pat. No. 5,783,397). The sample and the target protein are combined and resolved. The conditions of electrophoresis results in simultaneously fractionating the components present in the sample and screening for components that bind to the target molecule. This method is particularly useful for complex samples including, for instance, extracts of plants, animals, microbes, or portions thereof and chemical libraries produced by, for instance, combinatorial chemistry.
The agents identified by the initial screens are evaluated for their effect on survival of microbes, preferably H. influenzae, H. ducreyi, or H. aegyplius, more preferably, an H. influenzae. Agents that interfere with bacterial survival are expected to be capable of preventing the establishment of an infection or reversing the outcome of an infection once it is established. Agents may be bacteriocidal (i.e., an agent kills the microbe and prevents the replication of the microbe) or bacteriostatic (i.e., an agent reversibly prevents replication of the microbe). Preferably, the agent is bacteriocidal. Such agents will be useful to treat a subject infected with H. influenzae, H. ducreyi, or H. aegyptius, more preferably, an H. influenzae, or at risk of being infected by H. influenzae, H. ducreyi, or H. aegyptius, more preferably, an H. influenzae.
The identification of H. influenzae critical coding sequences, preferably, essential coding sequences, also provides for microorganisms exhibiting reduced virulence, which may be useful in vaccines. The term “vaccine” refers to a composition that, upon administration to a subject, will provide protection against H. influenzae, H. ducreyi, or H. aegyptius, more preferably, an H. influenzae. Administration of a vaccine to a subject will produce an immunological response to the H. influenzae and result in immunity. A vaccine is administered in an amount effective to result in some therapeutic benefit or effect so as to result in an immune response that inhibits or prevents an infection by H. influenzae in a subject, or so as to result in the production of antibodies to an H. influenzae.
Such microorganisms that can be used in a vaccine include H. influenzae, H. ducreyi, or H. aegyptius, more preferably, an H. influenzae, mutants containing a mutation in a coding sequence represented by any one of the coding sequence present in SEQ ID NO:11, 16, 26, 31, 46, 64, 69, 74, 79, 84, 89, 99, 104, 109, 114, 124, 129, 145, 165, 170, 180, 205, 210, 215, 220, 232, 237, 242, 247, 252, 357, 150, 185, 200, 267, 389-443, nucleotides 936-2429 of SEQ ID NO:225, nucleotides 2443-3809 of SEQ ID NO:225, or a coding sequence having structural similarity thereto. Optionally, an H. influenzae, H. ducreyi, or H. aegyptius, more preferably, an H. influenzae, includes more than one mutation. The reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject. Animal models useful for evaluating H. influenzae virulence in a variety of conditions, including for example, otitis media in gerbils and chinchilla, are known in the art.
While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing a suitable adjuvant(s) and a pharmaceutically acceptable diluent(s) or carrier(s). The carrier(s) must be “acceptable” in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen free. The subject to be immunized is a subject needing protection from a disease caused by a virulent form of H. influenzae.
Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate), bacteria lipopolysaccharide (LPS), peptidoglycans (i.e., mumins, mucopeptides, or glycoprotelns such as N-Opaca, muramyl dipeptide (MDP), or MDP analogs), proteoglycans (e.g., extracted from Klebsiela spp.), streptococcal preparations (e.g., OK432), the “Iscoms” of EP 109 942, EP 180 564 and EP 231 039, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, the Ribi adjuvant system (see, for example GB-A-2 189 141), or adjuvants available under the trade designation BIOSTIM (e.g., 01K2) and PLURONIC polyols. Recently, an alternative adjuvant consisting of extracts of Amycolata, a bacterial genus in the order Actinomycetales, has been described in U.S. Pat. No. 4,877,612. Additionally, proprietary adjuvant mixtures are commercially available. The adjuvant used will depend, in part, on the recipient organism. The amount of adjuvant to administer will depend on the type and size of animal. Optimal dosages may be readily determined by routine methods.
The vaccine compositions optionally may include pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl-andpropylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.
The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, sachet, cachet, gelatin, paper or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets.
The vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, vaginal, or transdermal delivery; or by surgical implantation, e.g., embedded under the splenic capsule or in the cornea. The treatment may consist of a single dose or a plurality of doses over a period of time. It will be appreciated that the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be immunized may be a human or an animal, for example, cows, sheep, pigs, horses, dogs, cats, and poultry such as chickens, turkeys, ducks and geese.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
Materials and Methods
Bacterial strains and growth conditions: Haemophilus influenzae Rd was obtained from the American Type Culture Collection as ATCC 51907 and grown in brain-heart infusion (Becton Dickinson, Sparks, Md.) supplemented with 5% Fildes Enrichment (Becton Dickinson) (sBHI) at 37° C. in 5% CO2.
Oligonucleotide synthesis: All of the oligonucleotides were synthesized by Genosys (The Woodlands, Tex.).
Target gene amplification and vector cloning: The target gene with flanking sequences was PCR amplified from 1 microgram (μg) of H. influenzae genomic DNA with the N/C primer set following the AMPLITAQ GOLD (Applied Biosystems, Foster City, Calif.) amplification protocol: 94° C. for 5 minutes (1 cycle); 94° C. for 30 seconds, 55° C. for 1 minute and 72° C. for 3 minutes (30 cycles); and 72° for 5 minutes (1 cycle). The resulting amplicon was cloned into the vector pCR2.1 following the enclosed directions of the Invritrogen cloning kit (Invitrogen, Carlsbad, Calif.) and transformed into competent E. coli InvαF′ cells purchased from Invitrogen. Colonies were screened by restriction analysis to confirm the presence K of the PCR insert. Vector DNA was isolated using columns purchased from Qiagen, Inc. (Valencia, Calif.).
New England Biolabs GPS-M Tn mutagenesis protocol: Transposon mutagenesis of the vector DNA was performed following the enclosed directions of the GPS-M Mutagenesis kit purchased from New England Biolabs (Beverly, Mass.). Briefly, 320 nanograms (ng) of vector DNA was added to 8 μl 10× GPS buffer, 4 μl GPS buffer 3 and dH2O to 32 μl. After adding 4 μl of TnsABC transposase, the reaction was incubated for 10 minutes at 37° C. Four μl of Start Solution was then added and the reaction was incubated for 1 hour at 37° C. Following heat inactivation at 75° for 10 minutes, the reaction was phenol extracted, ethanol precipitated and resuspended in 84 μl 10 mM Tris-1 mM EDTA, pH 8.0 (TE). The transposon insertion sites were repaired by adding 4 μl DNA Polymerase I (E. coli) (New England Biolabs, Beverly, Mass.), 12 μl 10× PolA buffer (New England Biolabs), and 12 μl 300 μl dNTP mix to the resuspended vector and incubating for 15 min at room temperature. Four μl 30 mM ATP and 4 μl T4 DNA ligase were then added to ligate the transposon into the vector overnight at 16° C. The vector was then phenol extracted, ethanol precipitated and resuspended in 25 μl TE for transformation into H. influenzae.
Epicentre Transposon mutagenesis protocol: The target gene with flanking sequences was PCR amplified from 1 μg of H. influenzae genomic DNA with the N/C primer set following the GibcoBRL Platinum Taq amplification protocol: 94° C. for 5 minutes (1 cycle); 94° C. for 30 seconds, 55° C. for 1 minute and 72° C. for 3 minutes (30 cycles); and 72° C. for 5 minutes (1 cycle). Fifty microliters of the reaction was loaded onto a 1.2% agarose gel and the amplicon was isolated. Following the enclosed directions of the Epicentre (Madison, Wis.) EZ::TN <KAN-2> insertion kit, 100 nanograms (ng) of the PCR amplicon was mutagenized for 2 hours at 37° C. After heat inactivation of the transposase at 70° C. for 10 minutes, 20 μl of sterile water was then added and the reaction was passed through a Millipore Ultrafree column (Bedford, Mass.) to remove the enzyme. Gap repair was performed by adding 3 μl 10× E. coli PolA buffer, 3 μl 300 mM dNTP mix and 1.5 μl DNA polymerase I to the reaction and incubating for 15 minutes at room temperature.
Competent cell preparation and transformation of H. influenzae: Competent cells of H. influenzae were prepared following the protocol outlined by Barcak et al. (Methods in Enzymology, 204, 321-342 (1991)) for transformation using chemically defined M-IV medium. For DNA uptake and transformation a 1 milliliter (ml) vial of stored H. influenzae competent cells was pelleted for 5 minutes and resuspended in 1 ml of freshly prepared M-IV medium. One hundred nanograms of the mutagenized vector DNA was added to the cells. Following incubation for 30 minutes at 37° C., the cells were added to 5 mls sBHI medium and grown for 3 hours with shaking at 37° C. Cell aliquots of 100 μl, 250 μl, and 500 μl were plated onto sBHI plates supplemented with 30 μg/ml kanamycin and incubated overnight at 37° C. with 5% CO2.
Colony screening: Individual isolates were initially screened for transposon inserts within the 5′ end of the target gene by PCR amplification using the K/Z primer set as follows: 94° C. for 5 minutes (1 cycle); 94° C. for 30 seconds, 55° C. for 1 minute and 72° C. for 1.5 minutes (25 cycles); and 72° C. for 5 minutes. Ten μl of each reaction was analyzed on a 1.2% agarose gel. If no inserts were detected, the plates were reincubated overnight and additional isolates were then screened targeting small colonies with reduced growth rates. PCR screening for transposon inserts within the entire target amplicon was performed using the N/C primer set as follows: 94° C. for 5 minutes (1 cycle); 94° C. for 30 seconds, 55° C. for 1 minute and 72° C. for 3 minutes (30 cycles); and 72° C. for 5 minutes.
PCR sequencing: PCR products synthesized with either the K/Z or N/C primer pairs were isolated using the Qiagen MinElute columns. One hundred nanograms of PCR product, 100 ng of Epicentre Kan-2 FP-1 transposon sequencing primer ACCTACAACAAAGCTCTCATCAACC (SEQ ID NO:499) and sterile water to a final volume of 12 μl were added to a single tube and the nucleotide sequence determined.
Results
The initial overall strategy for targeted gene disruption is outlined in
Inactivation of a non-essential gene: We began our assessment of transposon mutagenesis by selecting a known non-essential H. influenzae gene for targeted insertional inactivation. The galK gene (HI0819) and flanking sequences (
Identification of an essential gene: Having shown that a known non-essential gene could be insertionally inactivated by this method, we then chose a gene expected to be essential for mutagenesis. The H. influenzae tmk gene (HI0456) and flanking sequences (
E. coli confirmation of an essential gene: One advantage to using the vector system for mutagenesis is that confirmation of the H. influenzae results can be obtained using E. coli. The mutagenized pCR2.1 vector containing the tmk gene was transformed into E. coli. Transformants were screened by PCR to identify three individual colonies, one containing a vector with a transposon insert in the upstream flanking region, one containing a transposon insert in the downstream flanking region, and one containing a transposon insert in the tmk gene itself. Plasmid DNA was isolated from all three individual colonies and separately transformed into H. influenzae. Kanamycin selected recombinants were then screened by PCR for the presence of the original transposon insert. None were found within the tmk gene or the downstream holB gene, even though each transformed vector contained a transposon insert within these genes. This confirmed that tmk and holB gene were essential. Inserts were again found within the upstream region suggesting that this gene may not be essential. These results are in agreement with the paper published by Akerley et al. (Proc. Nat. Acad. Sci. USA, 95, 8927-8932 (1998)) in which it was determined that tmk and holB are essential, whereas the upstream conserved hypothetical protein is not.
Direct mutagenesis of the target gene PCR product: There are several inherent difficulties associated with the vector method for insertional inactivation. In vitro mutagenesis results in transposons inserting within the entire vector sequence, not just the target region. This causes high backgrounds and increases the number of recombinants that have to be screened for insertions within the target region. Cloning can be time-consuming and not all PCR products can be cloned into the pCR2.1 vector. The cloned target region may also contain errors from the PCR amplification. To overcome these difficulties, we chose to evaluate if we could perform in vitro mutagenesis on the target PCR product itself and subsequently transform it directly into H. influenzae since H. influenzae has a natural single-stranded DNA uptake system. This protocol is outlined in
Evaluation of potential antibacterial targets: A list of potential new antibacterial targets was assembled for insertional inactivation to determine their essentiality in H. influenzae. The list included aroC (chorismate synthase), coaD (phosphopantetheine adenylyltransferase), rhlB (an ATP-dependent RN A helicase), ribB (3,4-dihydroxy-2-butone 4-phosphate synthase), ribF (riboflavin kinase), the conserved hypothetical proteins yihZ and yfgB. All of the gene sequences, flanking regions and PCR primer pairs are shown in
1Refers to the coding sequence present at each SEQ ID NO.
2Information obtained through the TIGR Haemophilus influenzae KW20 locus search page (www.tigr.org/tigr-scripts/CMR2/LocusNameSearch.spl?db=ghi).
Inserts were found in rhlB, yihZ, yfgB, suhB and yhbJ. Since the K primer sequence occurred upstream of the ATG start codon for yihZ, yfgB, and yhbJ, one recombinant containing an insert was sequenced with a transposon primer to determine the exact location of the insert within each gene. All three transposons inserted within the 5′ essential region (
This demonstrates the use of rapid transposon insertional inactivation to evaluate 15 additional H. influenzae coding sequences.
Materials and Methods
The materials and methods used are described in Example 1.
Results
The following genes were subjected to insertional inactivation: efp (elongation factor P), fba (fructose-biphosphate aldolase), fmt (methionyl-tRNA formyltransferase), IF-1 (translation initiation factor 1), IF-2 (translation initiation factor 2), IF-3 (translation initiation factor 3), ispA (geranyl transferase), ispB (octaprenyl-diphosphate synthase), nusA (N utilization substance protein A), tmk (thymidylate kinase), trxB (thioredoxin reductase), pth (peptidyl-tRNA hydrolase), uppS (undecaprenyl pyrophosphate synthetase), L27 (ribosomal protein rpL27) and lepA (GTP-binding membrane protein). All of the gene sequences, flanking regions and PCR primer pairs are shown in
*Exhibit a slow growth phenotype when insertion is present in the coding sequence.
1Refers to the coding sequence present at each SEQ ID NO.
2Information obtained through the TIGR Haemophilus influenzae KW20 locus search page (www.tigr.org/tigr-scripts/CMR2/LocusNameSearch.spl?db=ghi).
3“+”, gene was inactivated; “−”, gene was not inactivated.
Inserts were found in efp, IF-1, ispA, ispB, pth, trxB, L27 and lepA. Since the K primer sequence occurred upstream of the ATG start codon for ispA, L27 and trxB, one recombinant containing an insert was sequenced with a transposon primer to determine the exact location of the insert within each gene. All three transposons inserted within the 5′ essential region (
Discussion
The unexpected results with several of the genes illustrates the importance of determining gene essentiality in a variety of organisms when selecting potential targets for broad spectrum antibiotic development. In this study fmt (methionyl-tRNA formyltransferase) is essential in H. influenzae whereas it is not essential in E. coli (Mazel et al., EMBO J., 13, 914-923 (1994)). Likewise efp (elongation factor P) and ispB (octaprenyl-diphosphate synthase) are essential in E. coli (Aoki et al., J. Biol. Chem., 272, 32254-32259 (1997); Okada et al., J. Bacteriol., 179, 3058-3060 (1997)), but not essential in H. influenzae. These results show that even organisms within broad categories such as gram-negatives or gram-positives can require different genes for bacterial survival.
The design of the K/Z primer pair is of critical importance when determining essentiality based on PCR results. If the K primer is designed upstream of the ATG start codon for the practical considerations of GC content and secondary structure, there is the possibility that transposons can insert prior to the. ATG. K/Z screening simply detects transposon inserts anywhere within the K/Z fragment. It does not determine the position of the insertion; therefore, those clones containing insertions downstream of the K primer but upstream of the ATG (not within the target gene) would yield the same PCR product as those clones containing insertions within the actual gene sequence. Hence, it is critical to sequence map clones containing insertions if the K primer is upstream of the ATG codon. Likewise sequence mapping of potential insertions is critical for those genes whose Z primer encompasses the C-terminal end of the gene, since it is possible for essential genes to contain insertions within this region. This most commonly occurs with small genes (<400 bp in length). Our results with pth and IF-1 illustrate, this point. Based on their K/Z PCR product results, both genes were initially determined to be non-essential. However, only after sequence mapping of the inserted clones was it determined that since all of the detected insertions occurred within the C-terminal region of each gene, pth and IF-1 were really essential.
Materials and Methods
The materials and methods used are described in Example 1.
Results
There are 28 genes associated with cell wall biosynthesis in H. influenzae. The genes directly involved in the biosynthesis of peptidoglycan include glmS (glucosamine-fructose-6P-transferase), glmU (UDP-N-acetylglucosamine pyrophosphorylase), murZ (UDP-NAcGlu 1-carboxyvinyltransferase), murB (UDP-N-acetylenolpyruvoylglucosamine reductase), murC (UDP-N-acetylmuramate-alanine ligase), murD (UDP-N-acetylmuramoylalanine-D-glutamate ligase), murE (UDP-N-acetylmuramyl-tripeptide synthetase), murF (UDP-MurNAc-pentapeptide synthetase), murG (UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl UDP N-acetylglucosamine transferase), murI (glutamate racemase), mraY (phospho-N-acetylmuramoyl-pentapeptide-transferase E), alr (alanine racemase), and ddlB (D-alanine-D-alanine ligase). The seven penicillin-binding proteins include ponA (penicillin-binding protein 1A), ponB (penicillin-binding protein 1B), pbp2 (penicillin-binding protein 2), ftsI (penicillin-binding protein 3), dacB (penicillin-binding protein 4), dacA (penicillin-binding protein 5), and pbpG (penicillin-binding protein 7, putative). The remaining genes are those associated with cell wall biosynthesis. They include amiB (N-acetylmuramoyl-L alanine amidase), glnA (glutamine synthase), lpp (lipoprotein PCP precursor), mepA (penicillin-insensitive murein peptidase), mtgA (peptidoglycan transglycosylase), nagA (N-acetylglucosamine-6P-deacetylase), pal (outer membrane protein p6 precursor), and slt (soluble lytic murein transglycosylase).
All of the gene sequences, flanking regions and PCR primer pairs are shown in
1Refers to the coding sequence present at each SEQ ID NO.
2Information obtained through the TIGR Haemophilus influenzae KW20 locus search page (www.tigr.org/tigr-scripts/CMR2/LocusNameSearch.spl?db=ghi).
3The murE coding sequence is nucleotides 936-2429 of SEQ ID NO: 225.
4The murF coding sequence is nucleotides 2443-3809 of SEQ ID NO: 225.
*exhibit a slow growth phenotype when insertion is present in the coding sequence.
1Refers to the coding sequence present at each SEQ ID NO.
2Information obtained through the TIGR Haemophilus influenzae KW20 locus search page (www.tigr.org/tigr-scripts/CMR2/LocusNameSearch.spl?db=ghi).
Multiple insertions were found in amiB, dacA, dacB, glmS, glnA, lpp, mepA, mtgA, murG, pbp2, pbpg, ponA, ponB, and slt. Since the K primer sequence occurred upstream of the ATG start codon for dacA, dacB, glmS, lpp, mepA, mtgA, murG and pbpG, recombinants containing an insert from each gene were sequenced with a transposon primer to determine the exact location of the insert. All of the transposons inserted within the 5′ essential region except for murG; therefore dacA, dacB, glmS, lpp, mepA, mtgA, and pbpG are non-essential. Of the ten recombinants sequenced for murG, all ten contained insertions upstream of the ATG codon; therefore, murG was determined to be essential. Only one out of 96 recombinants screened for nagA contained an insertion. Sequence analysis mapped the transposon upstream of the ATG start codon, so nagA was also determined to be essential. The K/Z primer pairs for amiB, glnA, pbp2, ponA, ponB, and slt are within the 5′ coding region; therefore, these genes are non-essential. No insertions were found within alr, ddlB, ftsI, glmU, mraY, murB, murC, murD, murE, murF, murI, murZ and pal. Recombinant colonies were then′ re-screened with their N/C primer pair to identify inserts within the flanking regions. Inserts were found in,the flanking regions of all 13 genes; therefore, alr, ddlB, ftsI, glmU, mraY, murB, murC, murD, murE, murF, murI, murZ, and pal were determined to be essential.
Discussion
The genes necessary for the synthesis of peptidoglycan were essential (
Surprisingly, of the seven penicillin-binding proteins examined, only ftsI proved to be essential. FtsI has been shown to be essential in E. coli (Goffin et al., J. Bacteriol., 178, 5402-5409 (1996)), and the ftsI homolog in S. aureus (pbp-1) has also been shown to be essential (Wada and Watanabe, J. Bacteriol., 180, 2759-2765 (1998)).
Insertional inactivation of the cell wall genes presented several new technical challenges. As shown in
The determination of the essentiality of murE and murF was particularly challenging. In this region of the biosynthetic operon there are only 9 bases in the intergenic region between ftsI and murE, 13 bases in the intergenic region between murE and murF, and no bases between murF and mraY as the TAA stop codon of murF overlaps with the ATG start codon of mraY (
One major concern with insertional inactivation is the possibility of polar effects on downstream genes contained within an operon. Our results with the cell wall biosynthetic operon provide numerous examples of the lack of polarity of the transposon insert. Colonies containing insertions in the conserved hypothetical protein upstream of ftsI, as well as in the intergenic regions between ftsI and murE, mraY and murD, murG and murC, and murC and ddlB were all viable. Mapping studies showed that in all cases the transposon had inserted with its kanamycin gene in the same transcriptional directional as the biosynthetic genes, suggesting that the kanamycin promoter was transcribing the downstream essential genes. Both the small size of the mini-transposon and the strength of the kanamycin promoter may help to compensate for polar effects.
The H. influenzae genome contains several regions of chromosomal duplication, and one such region encompasses mrsA (glmM in E. coli). MrsA is involved in the second step of the pathway, converting glucosamine-6-phosphate to glucosamine-1-phosphate, and is encoded by both HI1337 and HI1463. In order to determine the essentiality of mrsA, two strains were constructed containing a deletion of either the HI1337 or the HI1463 mrsA gene. Each deletion strain was then independently evaluated for the insertional inactivation of the remaining mrsA gene. In both strains, the second mrsA gene could not be insertionally inactivated; therefore mrsA is essential. A related cell wall biosynthesis study was undertaken to determine if the essential gene murI (glutamate racemase) could be insertionally inactivated in the presence of D-glutamate. MurI is essential in E. coli, but murI mutants auxotrophic for D-glutamate have been identified (Doublet et al., J. Bacteriol., 175, 2970-2979 (1993)). We were unable to generate H. influenzae murI mutants in the presence of D-glutamate suggesting that H. influenzae, unlike E. coli, does not transport D-glutamate.
Materials and Methods
Bacterial strains and growth conditions: H. influenzae Rd was obtained from the American Type Culture Collection as ATCC 51907 and grown in brain-heart infusion supplemented with 5% Fildes Enrichment (sBHI) at 37° C. in 5% CO2. Plasmid pACYC 184 was purchased from New England Biolabs. D-glutamate (Sigma G-1001) was supplemented at 100 mg/ml. sBHI selection plates were supplemented with 1 mg/ml chloramphenicol (CM), 30 mg/ml kanamycin (KAN) or a combination of both CM and KAN.
Oligonucleotide synthesis: All of the oligonucleotides used in this report were synthesized by Genosys and are shown in
Construction of the mrsA gene deletion fragment: The PCR amplification scheme used to construct the mrsA gene deletion fragment is outlined in
Chromosomal DNA isolation. Chromosomal DNA was isolated from strains 1337D and 1463D following the enclosed directions of the Qiagen DNeasy Tissue Kit.
Transposon mutagenesis and PCR colony screening: The protocols for Epicentre EZ::TN <KAN-2> mutagenesis, transformation into H. influenzae, and PCR screening of recombinant colonies was performed as described herein with the following modification: competent cells of 1337D and 1463D transformed with the mutagenized mrsA fragment were plated onto sBHI plates supplemented with CM and KAN.
Results
Determination of MrsA essentiality: Construction of the deletion strains began with transforming the mrsA deletion fragment ABC into competent cells of H. influenzae and plating onto sBHI supplemented with 1 mg/ml CM. Since segments A and C were synthesized from sequence contained within the duplicated chromosomal region, the mrsA deletion fragment could recombine at either the HI1337 or HI1463 mrsA coding sequence. Surviving colonies were first screened with primers 1337-N or 1463-N (unique sequences upstream of the duplicated mrsA chromosomal region) and primer CM-NR (the 5′ end of the CM coding sequence) to determine which mrsA coding sequence had undergone recombination. Of 16 colonies screened with the 1337-N/CM-NR primer set, 12 appeared to contain a deletion of the 1337 mrsA coding sequence. Of the 16 additional colonies screened with the 1463-N/CM-NR primer set, 5 appeared to contain a deletion of the 1463 mrsA coding sequence. Two colonies of each were purified and subjected to additional PCR analysis with primer sets 1337-C/CM-CR and 1463-C/CM-CR to confirm the presence of the 3′ end of the CM coding sequence, as well as primer sets 1337-N/mrsA-Z and 1463-N/mrsA-Z to confirm the absence of the respective mrsA coding sequence. One strain of each was selected and designated 1337D and 1463D.
The mrsA coding sequence, the flanking regions, and the PCR primer pairs are shown in
To further demonstrate the ability of the mutagenized mrsA PCR product to recombine into the chromosome, the PCR product was transformed into wild type H. influenzae. Kanamycin resistant colonies were then screened for the presence of Tn insertions within one of the two mrsA coding sequences. Of the eight colonies screened with the mrsA KZ primer pair, four were found to contain two PCR products. The 439 bp band represented the KZ fragment with no Tn insert and the 1660 bp band represented the KZ fragment containing the 1221 bp transposon, indicating that within these four colonies one of the two mrsA coding sequences was insertionally inactivated. Additional PCR analysis showed that two of the colonies contained insertions in HI1337 and the remaining two colonies contained insertions in HI1463. All four colonies (1337::Tn#1, 1337::Tn#3, 1463::Tn#15 and 1463::Tn#19) were subsequently sequenced to confirm the insertion of the transposon within the identified mrsA-terminus (
The N/C primer pair was then used on chromosomal DNA isolated from strains 1337::Tn#1 and 1463::Tn#19 to generate PCR products containing Tn insertions within each mrsA coding sequence. The PCR product from 1337::Tn#1 was used to transform 1463D, and the PCR product from 1463::Tn#19 was used to transform 1337D in an attempt to replace the remaining mrsA coding sequence with an insertionally inactivated mrsA coding sequence. Transformed cells were plated onto sBHI supplemented with 1 mg/ml CM and 30 mg/ml KAN. Of the ninety-six colonies screened from each transformation, none contained insertions within′ the remaining mrsA coding sequence. To confirm that the insertionally inactivated mrsA coding sequences could recombine into the chromosome, the 1337::Tn#1 and 1463::Tn#19 PCR products were individually transformed into wild type H. influenzae. Kanamycin resistant colonies were then screened for the presence of Tn insertions within the respective mrsA coding sequence. Of the 16 colonies screened from each transformation, all 16 contained insertions in the respective mrsA coding sequence. This provided final confirmation that phosphoglucosamine mutase is an essential enzymatic step in H. influenzae cell wall biosynthesis.
Insertional inactivation of murI in the presence of D-glutamate. In order to determine if insertionally inactivated murI mutants auxotrophic for D-glutamate could be obtained in H. influenzae, wild type H. influenzae was transformed with the Tn mutagenized murI PCR fragment and plated onto sBHI supplemented with mg/ml KAN and 100 mg/ml D-glutamate. Of the ninety-six colonies screened, none contained an insertion in murI. Therefore, H. influenzae murI mutants cannot be obtained by supplementing with D-glutamate. This finding suggests that H. influenzae is unable to take up D-glutamate.
Many antimicrobial compounds target the bacterial ribosome. This list includes the oxazolidinones, the macrolides, the aminoglycosides, the streptogramins, the tetracyclines, lincomycin, and chloramphenicol. Recently the 50S and 30S ribosomal subunits have been crystallized (Ramakrishnan et al., Cell, 108(4), 557-72 (2002)), thus making it possible to use structural design in the development of new anti-ribosomal compounds as well as improving known anti-ribosomal classes. To determine which ribosomal genes are essential in Haemophilus influenzae, the essentiality of all 58 H. influenzae ribosomal genes was systematically determined by targeted gene disruption. With this method, a PCR amplicon consisting of the target gene and flanking sequences is mutagenized in vitro using the EZ::TN <Kan-2> transposon and transformed directly into H. influenzae. Recombinant colonies are then screened by PCR for the presence of a transposon insert within the 5′ essential region of the target gene. If an insert is found, the gene is determined to be non-essential. If no inserts are found within the 5′ essential region but are found within the flanking sequences, then the gene is determined to be essential.
Materials and Methods
Bacterial strains and growth conditions: Haemophilus influenzae Rd was obtained from the American Type Culture Collection as ATCC 51907 and grown in brain-heart infusion supplemented with 5% Fildes Enrichment (sBHI) at 37° C. in 5% CO2. Transformants were plated on sBHI supplemented with either 30 mg/ml kanamycin (Kan), 1 mg/ml chloramphenicol (Cm), or both (Kan/Cm).
Oligonucleotide synthesis: All of the oligonucleotides used in this report were synthesized by Genosys.
Tn mutagenesis and PCR colony screening: The protocols for Epicentre EZ::Tn <Kan-2> mutagenesis, transformation into H. influenzae, PCR screening of recombinant colonies, and sequence determination of the Tn insertion site are as described in the previous examples.
Gene deletion protocol: The protocol for deleting H. influenzae genes by replacement with an antibiotic resistance marker is as described in the previous examples.
PCR sequencing: PCR products synthesized with either the K/Z or N/C primer pairs were isolated using the Qiagen MinElute columns. One hundred nanograms of PCR product, 100 ng of Epicentre Kan-2 FP-1 transposon sequencing primer and sterile water to a final volume of 12 ml were added to a single tube and subjected to rough draft sequencing.
Results and Discussion
There are a total of 58 ribosomal genes in H. influenzae. The 30S ribosomal genes include rpsA, rpsB, rpsC, rpsD, rpsE, rpsF, rpsG, rpsH, rpsI, rpsJ, rpsK, rpsL, rpsM, rpsN, rpsO, rpsP, rpsQ, rpsR, rpsS, rpsT and rpsU. The 50S ribosomal genes include rplA, rplB, rplC, rplD, rpE, rplF, rplI, rplJ, rplK, rplL, rplM, rplN, rplO, rplP, rplQ, rplR, rplS, rplT, rplU, rplV, rplW, rplX, rplY, rpmA, rpmB, rpmC, rpmD, rpmE, rpmF, rpmG, rpmH, rpmI, and rpmJ. Three additional genes associated with ribosome assembly include rimK (probable 50S protein S6 modification protein), rimL (ribosomal protein alanine transferase) and prmA (50S ribosomal protein L11 methyltransferase).
All of the gene sequences, flanking regions and PCR primer pairs are shown in
Twenty-one of the twenty-two 30S ribosomal genes were found to be essential. These results are summarized in Table 5. The only gene determined to be non-essential was a duplicate copy of the rpsO gene HI1468(S15). Five of the 33 genes associated with the 50S ribosome were insertionally inactivated: rplI, rpmA, rpmE, rpmF and rpmG. The remaining 28 genes were all essential. These results are summarized in Table 7. The three genes associated with ribosome assembly rimK, rimL and prmA were all insertionally inactivated; therefore all three genes are non-essential. These results are summarized in Table 6. These three strains have been designated HI11604623 (rimK::Tn), HI111633 (rimL::Tn), and HI11036389 (prmA::Tn).
To confirm the non-essentiality of the five 50S ribosomal subunit genes rplI, rpmA, rpmE, rpmF, and rpmG, the five genes were individually deleted by homologous recombination of a PCR product containing the chloramphenicol resistance gene substituted for the targeted gene. The five deletion strains have been designated HI0544D (rplI), HI0879D (rpmA), HI0758D (rpmE), HI0158D (rpmF) and HI0950D (rpmG). In addition, an attempt was made to construct double mutant strains of the 5 non-essential 50S ribosomal genes in all possible combinations. Three double mutants were successfully constructed. Strain HI1158544 contains a deletion of the rpmF gene and an insertional inactivation of the rplI gene. Strain HI158758 contains a deletion of the rpmF gene and an insertional inactivation of the rpmE gene. Strain HI758950 contains a deletion of the rpmE gene and an insertional inactivation of the rpmG gene.
As shown in Tables 5-7, we have determined that 9 of the 58 H. influenzae ribosomal genes are non-essential. This is in contrast to E. coli, where 18 of the 58 ribosomal genes are non-essential. These include rpS6, rpS9, rpS13, rpS17, rpS20, rpL1, rpL9, rpL11, rpL15, rpL19, rpL24, rpL27, rpL28, rpL29, rpL30, rpL33, and the 3 genes associated with ribosome assembly rimK, rimL and prmA (Table 8). Two genes that are essential in E. coli were shown in this report to be non-essential in H. influenzae: rplI (rpL9) and rpmF (rpL32). These results illustrate the importance of determining gene essentiality in a variety of organisms when selecting potential targets for broad spectrum antibiotic development as individual organisms can require different genes for bacterial survival.
A search of the H. influenzae genomic database for the ribosomal proteins revealed two genes encoding for the S15 ribosomal protein rpsO: HI1328 (see
The described methodology details the use of a single K/Z primer pair encompassing the 5′ end of the target gene for screening purposes. Due to the small size (<200 basepairs) of many of the ribosomal genes and their proximity to adjacent ribosomal genes, a single K!Z primer pair was designed to encompass the 5′ region of one-target gene through the 5′ region of an adjacent target gene. The following sets of ribosomal genes were screened with a single K/Z primer pair as shown in the accompanying figures: HI0516/HI0517 (
Insertional inactivation of the ribosomal genes presented a technical challenge in that 26 of the genes are tightly clustered in a 15 kb segment and have the same transcriptional directionality. It is likely that these genes are co-transcribed in a limited number of operons. The established protocol for determining essentiality requires screening recombinants with the K/Z primer pair, followed by re-screening with the N/C primer pair for inserts in the flanking regions if no inserts are found in the 5′ essential region. However within this extended ribosomal operon the flanking genes are also expected to be essential, so one would not expect to find inserts within the entire mutagenized PCR fragment. Distinguishing between failed mutagenesis and true essentiality relied on amplifying large fragments containing multiple genes flanked by at least one region not containing any ribosomal gene and detecting inserts within this one flanking region. Genes HI0776-HI0786 were synthesized as a single 6.6 kb fragment with inserts detected in the N-terminal flanking region. Genes HI0788-HI0797 were also synthesized as a single 5.6 kb fragment with inserts again detected in the N-terminal region. Due to the large size of these mutagenized fragments in proportion to the K/Z fragment length for each individual targeted gene, 192 recombinant colonies were screened with the KJZ primer pair per gene as opposed to the standard 96 colonies.
Repeated attempts at synthesizing and mutagenizing the last five genes in this large operon, HI0798.1, HI0799, HI0800, HI0801 and HI0803, failed to detect inserts in the flanking regions. To determine the essentiality of these five genes, we used an alternate method of vector mutagenesis. With this technique, the target genes are synthesized individually as a PCR fragment, cloned into an E. coli vector and mutagenized with the EZ::Tn <KAN-2> transposon. Following transformation, individual colonies are screened with the target gene K/Z primer pair to identify vectors containing Tn inserts within this gene. Vector DNA is then isolated and used for PCR amplification with the original N/C primer pair to produce an amplicon containing a known insertion within the target gene. This fragment is then transformed into H. influenzae and kanamycin selected recombinants are screened by PCR with the K/Z primer pair for the presence of the original Tn insert. If no inserts are detected even though each transformed amplicon contained a Tn insert within the target gene sequence, then the gene is determined to be essential.
The target gene with flanking sequences was PCR amplified from 1 mg of H. influenzae genomic DNA with the N/C primer set following the Platinum Taq™ amplification protocol: 94° C. for 5 min (1 cycle); 94° C. for 30 sec, 55° C. for 1 min and 72° C. for 3 min (30 cycles); and 72° C. for 5 min (1 cycle). The resulting amplicon was cloned into the pScript vector following the enclosed directions of the Stratagene cloning kit and transformed into competent E. coli InvαF′ cells purchased from Invitrogen. Colonies were screened by restriction analysis to confirm the presence of the PCR insert. Vector DNA was isolated using columns purchased from Qiagen.
Following the package directions of the Epicentre EZ::Tn™<KAN-2> insertion kit, 100 ng of the vector was mutagenized for 2 hours at 37° C. After heat inactivation of the transposase at 70° C. for 10 minutes, 20 μl of sterile water was then added and the reaction was passed through a Millipore Ultrafree column to remove the enzyme. 20 ng of vector was then transformed directly into E. coli InvαF′ cells. Transformants were selected on Luria broth plates containing 30 μg/ml kanamycin. 48 colonies were screened with the respective K/Z primer pair to identify a vector containing a single insertion within each target gene. Vector DNA was isolated and the respective N/C primer pair was used to amplify the target gene containing the Tn insert within the gene. 100ng of the PCR product was transformed into competent cells of H. influenzae and plated onto sBHI supplemented with 30 μg/ml kanamycin. After 48 hours of incubation at 37° C., all resulting colonies were screened with their respective K/Z primer pair to detect Tn inserts within the targeted gene. None were found in any of these five genes. Therefore, we concluded that HI0798.1, HI0799, HI0800, HI0801 and HI0803 are essential.
Ribosomal gene essentiality determined by the targeted gene disruption method of the present invention compared to ribosomal gene essentiality determined using a whole-genome approach reported by Akerley et al. (Proc. Natl. Acad. Sci. USA 99(2), 966-971 (2002)) is shown in Table 9. Thirty-nine genes were found to be essential and two genes were found to be non-essential by both methods. The results differed on six genes: rplL, rpsO (HI1468), rimI, rimK, prmA, and rpmE. The essentiality of the remaining 12 genes was not determined by the whole-genome approach. There are several benefits to identifying essential genes by targeted analysis. This approach generates a mutant library of individual clones that can be sequenced to determine the exact transposon insertion site, whereas results from genomic approaches are derived from mutant pools. The resulting individual clones are also available for further genetic analysis. Small genes (<300 bp) can be directly evaluated without relying on their proximity to anchoring PCR primers for accurate gel mapping. Targeted analysis also identifies insertionally inactivated genes whose protein product loss has a negative effect on the growth rate of the cell. The targeted approach is able to address the essentiality of cellular function when two or more genes encode f6r the same protein by using transposons with different selectable markers or by using insertional inactivation in combination. with gene deletion (i.e. rpsO encoded by both HI1328 and HI1468). Targeted analysis does sacrifice the overall speed of the genomic approach. However, the gains made in the accuracy of the data can offset the additional time required for essential determination.
Expanding on the above comparison of gene essentiality determined the targeted gene disruption method of the present invention to gene essentiality determined using the whole-genome approach reported by Akerley et al., the following genes were found to be essential by both methods: aroC, coaD, yrdC, IF-1, IF-2, IF-3, pth, tmk, alr, ddlB, ftsI, murC, murD, murE, murF, murG, nagA, emrB, pyrH, rpsA, rpsB, rpsC, rpsD, rpsE, rpsF, rpsG, rpsH, rpsI, rpsK, rpsL, rpsM, rpsN, rpsP, rpsQ, rpsR, rpsS, rplB, rplD, rplE, rplF, rplJ, rplK, rplM, rplN, rplO, rplP, rplQ, rplR, rplS, rplT, rplV, rplW, rplX, rplY, rpmC, rpmD, rpmH, rpmI, and dnaE. The following genes were determined to be essential by the targeted gene disruption method of the present invention, but were determined to be non-essential by the whole-genome approach of Akerley: fba, fmt, uppS, pal, rplL, cdsA, and coaE. The following genes have been determined to be essential by the targeted gene disruption method of the present invention, while essentiality has not been determined using the whole-genome approach of Akerley: ribB, ribF, nusA, glmU, mraY, murB, murZ, murI, rpS15 (HI1328), rpsJ, rpsT, rpsU, rplA, rplC, rplU, rpmB, rpmJ, and mesJ.
The comparison of non-essential ribosomal genes between E. coli and H. influenzae (Table 8) reveals many differences f6r these two closely related bacteria. Although ribosomal RNA and ribosomal proteins retain strong homology across species, accumulated subtle changes in the ribosome can collectively engender significant macromolecular structural differences in the ribosomes from different bacterial species.
Targeted gene disruption was used to determine the essentiality of the 58 ribosomal genes in H. influenzae. Forty-nine genes were found to be essential. The remaining 9 genes were found to be non-essential: rimI, rimK, prmA, rplI (rpL9), rpmA (rpL27), rpmE (rpL31), rpmF (rpL32), rpmG (rpL33), and the duplicate copy of rpsO (rpS15) encoded by HI1468.
(rpS)
The insertional inactivation results of the 22 genes associated with the 30S ribosomal unit. Twenty-one genes were determined to be essential; the only non-essential gene is the duplicate copy of the rspO HI1468.
*Alternative gene name is given in parenthesis.
The insertional inactivation results of the three proteins associated with ribosome synthesis. All three genes were determined to be non-essential.
The insertional inactivation results of the 33 proteins associated with the 50S ribosomal subunit. All but five were determined to be essential. Genes rplI, rpmA, rpmE, rpmF and rpmG are not essential.
*Alternative gene name is given in parenthesis.
H. influenzae and E. coli
H. flu
There are 9 non-essential genes in H. influenzae and 18 non-essential genes in E. coli.
*Alternative gene name is given in parenthesis.
1Dabbs, Biochimie, 73: 639-645 (1991).
2Dabbs, J Bac, 140(2): 734-737 (1979).
3Dabbs, Mol Gen Genet, 192: 301-308 (1983).
4Dabbs, J Mol Biol, 149: 553-578 (1981).
5Stoffler et al., Mol Gen Genet, 181: 164-168 (1981).
6Lotti et al., Mol Gen Genet, 192: 295-300 (1983).
7Herold et al., Mol Gen Genet, 203: 281-287 (1986).
8Kang et al., Mol Gen Genet, 217: 281-288 (1989).
9Isono and Isono, Mol Gen Genet, 177: 645-651 (1980).
10Vanet et al., Mol Microbiol, 14(5): 947-958 (1994).
Comparison of ribosome essentiality as determined by targeted gene disruption verses whole-genome analysis.
This example demonstrates the essentiality of six additional H. influenzae coding sequence.
Materials and Methods
The materials and methods used are described in Example 1.
Results.
The following genes were subjected to insertional activation: dnaE (DNA polymerase III, alpha subunit), mesJ (cell cycle protein), cdsA (CDP-diglyceride synthetase), pyrH (uridylate kinase), coaA (dephosphocoenzyme A kinase) and emrB (multidrug resistance protein B). All of the gene sequences, flanking regions and PCR primer pairs are shown in
Materials and Methods
Genomic Sequence and DNA. Sequence of H. influenzae imk was obtained from the GenBank database through the PubMed web interface, accession number NC—000907. Genomic DNA from H. influenzae strain Rd (KW20) was obtained from American Type Culture Collection (ATCC 51907D).
PCR Protocol. PCR conditions were followed according to the Platinum PCR Enzyme System (GIBCO). 100 ng of genomic DNA was used with 200 nM primer concentration. Reactions were thermocycled in a GENEAMP PCR System 9700 (Perkin Elmer). Amplification was performed according to the following protocol: the reaction was incubated at 94° C. for 5 minutes, then cycled 30 times at 94° C. for 30 seconds (denaturation of DNA), 55° C. for 30 seconds (annealing of primers), and extension at 72° C. for 1 minute. The reaction finished with a final extension step performed at 72° C. for 30 minutes.
General Cloning Procedures. PCR products were ligated into pCR4-TOPO (Invitrogen) according to the manufacturer's protocol: 2-4 μL PCR product was mixed with 1 μL salt solution, 1 μL TOPO vector/enzyme solution, and 0-2 μL water to a final volume of 6 μL, and the reaction was incubated for 25-30 minutes at room temperature. Transformation was achieved by incubating 2 μL ligation mixture with 50 μL One Shot TOP10 cells on ice for 30 minutes, followed by heat shock at 42° C. for 45 seconds. After placing the cells on ice for 2 minutes, 250 μL SOC media was added, and the cells were incubated with shaking at 37° C. for 1 hour. Cells were spread on LB-Kanamycin (50 μg/mL) plates and incubated overnight at 37° C.
Overnight broth cultures (10 mL) of selected transformants underwent plasmid purification using the Qiagen QlAprep Spin Miniprep Kit. Plasmids exhibiting the proper restriction pattern were DNA sequenced to confirm nucleotide sequence of the insert.
The expression vector pET15b (Novagen) was digested with appropriate restriction enzymes and eletrophoresed in 0.8% SEAKEM GTG agarose (FMC Bioproducts). The appropriate bands were purified via the QIAEXII Gel Extraction Kit (Qiagen) and were ligated using T4 DNA ligase (Fermentas) and transformed via heat shock into TOP10 cells. Plasmids were purified and digested from selected atransformants to confirm proper ligation of insert into vector, and positive plasmid clones were transformed via heat shock into strains BL21 (DE3) and/or BL21 (DE3)pLysS (Novagen) according to manufacturer's instructions.
Cloning of Haemophilus influenzae tmk encoding a C-terminal hexahistidine tag. PCR was used to amplify tmk from Haemophilus influenzae strain Rd (KW20) genomic DNA (ATCC 51907D) as described in the general procedures above. Primers were designed to contain a 5′ NcoI and a 3′ BamHI site for cloning into the NcoI-BamHI sites of the expression vector pET15b. The 5′ primer used to clone H. influenzae tmk was also designed to encode a MGSS sequence at the N-terminus to improve efficiency of expression, while the 3′ primer was designed to encode a dual alanine linker segment followed by the hexahistidine encoding sequence (AAHHHHHH (residues 214-221 of SEQ ID NO:501)). Primer sequences were 5′-CCATGGGCAGCAGCAAAGGAAAGTTTA-TTGTCATTGAGGGC (N-terminal primer) (SEQ ID NO:502) and GGATCCTCAATGGTGATGGTGATGGTGAGCTGCTTTTTCGTTTGATTTCC A-CCAATTTTTTACCGCAC (C-terminal primer) (SEQ ID NO:503).
Expression. A single colony was picked from a fresh streak plate into NS86 seed medium containing ampicillin (100 μg/ml), grown to an absorbance of about 1 at 550 nanometers (˜1 A550) at 30° C. and frozen ampules (20% glycerol was added as a cryoprotectant) prepared. Ampules were stored in the vapor phase of liquid nitrogen.
To prepare seeds, cells were grown in NS86 medium (2.6 g/l K2HPO4, 10.9 g/l NaNH4HPO4.4H2O, 2.1 g/l citric acid, 0.67 g/l (NH4)2SO4, 0.25 g/l MgSO4.7H2O, 10.4 g/l yeast extract and 5 g/l glycerol) containing ampicillin (100 μg/ml). Shake flask medium was MIM (32 g/l tryptone, 20 g/l yeast extract, 6 g/l Na2HPO4, 3 g/l KH2PO4, 0.5 g/l NaCl, and 1 g/l NH4Cl) containing ampicillin (100 μg/ml).
Seeds were prepared by the inoculation of 0.1 ml thawed ampule-contents into 25 mls of NS86 medium and grown overnight at 30° C. Flasks (500 ml volume) containing 50 mls MIM medium were inoculated at 0.1 A550. Cells were grown at 25° C. or 30° C. and induced at a density of ˜1 A550 by the addition of IPTG.
SDS/PAGE analysis of culture samples was performed using the Laemmmeli procedure under reducing conditions. For Tmk titer estimation, 0.1 A-ml (where A-ml refers to A550 absorbance units per ml) cells pellets (lysed in sample buffer) were loaded; product was quantitated from the dried gels by densitometry using a Molecular Dynamics densitometer (Model 375A). Titer was estimated based on an external BSA standard (2 μg); specific expression level (% total cell protein, TCP) was calculated from the titer and the cell density using the conversion factors 1 A550=0.26 g dry weight=0.14 g protein.
To assess soluble product, a 50 A-ml cell pellet was resuspended in 5 mls of cold PBS and the cells disrupted using a French Press. Following centrifugation (38, 700×g, 1 hour), a sample of the supernatant (soluble), as well as a sample of the unspun resuspension (total), were subjected to electrophoresis as described above. Densitometry on the dried gel provided a direct comparison of soluble to total product.
Results
PCR amplification of tmk genes was performed using genomic DNA template as indicated in Materials and Methods. PCR products were ligated into pCR4-TOPO and transformed into E. coli TOP10. Recombinant plasmids were purified from selected transformants and DNA sequenced for confirmation. DNA sequencing results and the corresponding amino acid sequence is show in
Expression of H. influenzae Tmk was evaluated at both 25° C. and 30° C. and induction with 0.1 or 1 mM final concentration of IPTG. Both temperature and IPTG level had a dramatic effect on the expression as shown in Table 11. The ‘control’ conditions, 30° C. and 1 mM IPTG, resulted in a product titer of 288 mg/l (36% of total cell protein). When cells were induced with 0.1 mM IPTG (30° C.) the Tmk titer increased ˜2.5 times and reached 50% of the total cell protein. Dropping the temperature to 25° C. (0.1 mM IPTG resulted in titers that were ˜2 times that of the control (˜38% of total cell protein). Under all conditions, the Tmk was expressed exclusively in the soluble form.
1HiTmk 6XCT; H. influenzae Tmk protein modified to encode a hexahistidine tag at the C-teminus of the protein.
2% of total cell protein
The complete disclosure of all patents, patent applications, and publications, and electronically available material (e.g., GenBank amino acid and nucleotide sequence submissions, and computer programs) cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
This application claims the benefit of U.S. Provisional Application Ser. No. 60/345,438, filed Oct. 19, 2001, which is incorporated by reference herein.
| Number | Date | Country | |
|---|---|---|---|
| 60345438 | Oct 2001 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10274586 | Oct 2002 | US |
| Child | 11194246 | Aug 2005 | US |
