Patent Application
20110311511
The invention relates to the X-ray crystal structure of PfA-M1 aminopeptidase alone, and in complex with the phosphinate dipeptide analogue hPheP[CH2]Phe. The present invention further relates to the use of the X-ray crystal structures as drug target models for anti-malarial drug design.
In this specification where a document, act or item of knowledge is referred to or discussed, this reference or discussion is not an admission that the document, act or item of knowledge or any combination thereof was at the priority date, publicly available, known to the public, part of common general knowledge; or known to be relevant to an attempt to solve any problem with which this specification is concerned.
There are 300-500 million cases of clinical malaria annually, and 1.4-2.6 million deaths. Malaria is caused by parasites of the genus Plasmodium, with Plasmodium falciparum the most lethal of the four species that infect humans. Clinical manifestations begin when parasites enter host erythrocytes and most anti-malaria drugs, such as chloroquine, exert their action by preventing the parasite development within these cells (Rosenthal, P. J. J. Exp. Biol. 206, 3735-3744 (2003)). Intra-erythrocytic parasites have limited capacity for de novo amino acid synthesis and rely on degradation of host haemoglobin to maintain protein metabolism and synthesis (Rosenthal, P. J. J. Exp. Biol. 206, 3735-3744 (2003); Liu, J., Istvan, E. S., Gluzman, I. Y., Gross, J. & Goldberg, D. E. Proc Natl Acad Sci USA 103, 8840-5 (2006)).
Haemoglobin (Hb) is initially degraded by endoproteases within a digestive vacuole (DV) to di- and tri-peptide fragments (Klemba, M., Gluzman, I. & Goldberg, D. E. J Biol Chem 279, 43000-7 (2004); Rosenthal, P. J. Curr Opin Hematol 9, 140-5 (2002)) that are then exported to the parasite cytoplasm (Curley, G. P. et al. J Eukaryot Microbiol 41, 119-23 (1994); Kolakovich, K. A., Gluzman, I. Y., Duffin, K. L. & Goldberg, D. E. Mol Biochem Parasitol 87, 123-35 (1997)) (
Release of amino acids involves two metallo-exopeptidases; an alanyl aminopeptidase, PfA-M1, and a leucine aminopeptidase PfA-M17 (Curley, G. P. et al. J Eukaryot Microbiol 41, 119-23 (1994); Allary, M., Schrevel, J. & Florent, I. Parasitology 125, 1-10 (2002); Gavigan, C. S., Dalton, J. P. & Bell, A. Mol Biochem Parasitol 117, 37-48 (2001); Stack, C. M. et al. J Biol Chem 282, 2069-80 (2007)). Phosphinate dipeptide analogues that inhibit metallo-aminopeptidases prevent the growth of wild-type and the chloroquine-resistant parasites in culture and one compound, hPheP[CH2]Phe (termed Compound 4, Co4), reduced a murine infection of P. c. chabaudi by 92% compared to controls (Grembecka, J., Mucha, A., Cierpicki, T. & Kafarski, P. J Med Chem 46, 2641-55 (2003); Skinner-Adams, T. S. et al. J. Med. Chem. 50, 6024-6031 (2007)).
There is a large number of different anti-malaria drugs available. They all have different modes of action and different side effects. No currently available malarial drug is 100% effective in preventing malaria and some are not effective in certain parts of the world. Accordingly, there is a great deal of scope for improving anti-malarial medication.
Irrespective of this, there is a paucity of new anti-malarial drugs entering the development pipeline. Modern drug development focuses on the development of drug targets, that is, genes or cellular chemicals that are associated with a specific disease. In the field of anti-malarial drugs there is a need for development of viable, validated drug target models. In particular there is a need for model structures and structural data that can facilitate the design of drugs that can inhibit malarial parasites.
It has now been found that malaria neutral aminopeptidase, PfA-M1, can be functionally characterised and validated as a drug target.
The present invention provides functional characterisation of PfA-M1 in terms of its three-dimensional structure alone and in complex with Co4.
The present invention therefore provides the structure coordinates of PfA-M1. The complete coordinates are listed in Table A.
The present invention further provides the structure coordinates of PfA-M1 in complex with Co4. The complete coordinates are listed in Table B.
The present invention further provides a crystal of PfA-M1 consisting of a primitive orthorhombic P212121 space group with unit cell dimensions of a=75.7±2.1 Å, b=108.7±2.1 Å and c=118.0±2.1 Å.
The present invention further provides a crystal of PfA-M1 in complex with Co4 consisting of a primitive orthorhombic P212121 space group with unit cell dimensions of a=75.9±2.0 Å, b=108.6±2.0 Å and c=118.3±2.0 Å.
The present invention also provides a machine-readable data storage medium which comprises a data storage material encoded with machine readable data defined by the structure coordinates of PfA-M1 according to Table A or a homologue of this structure.
The present invention also provides a machine-readable data storage medium which comprises a data storage material encoded with machine readable data defined by the structure coordinates of PfA-M1 in complex with Co4 according to Table B or a homologue of this structure
The present invention thus provides a structural model for the unique active site structure of PfA-M1 alone, and in complex with the anti-malarial Co4. The use of the PfA-M1 structural model and the use of the PfA-M1 Co4 complex structural model have been validated. The structural model, having been validated, can be used for the identification of novel class of anti-malarials using high-throughput chemical screening and medicinal chemistry methods.
While PfA-M1 functions in the terminal stages of haemoglobin digestion releasing amino acids essential for parasite protein anabolism, Co4 also inhibits the second important neutral aminopeptidase of malaria, PfA-M17 (Stack, C. M. et al. J Biol Chem 282, 2069-80 (2007); Gardiner, D. L., Trenholme, K. R., Skinner-Adams, T. S., Stack, C. M. & Dalton, J. P. J Biol. Chem. 281, 1741-5 (2006)). Thus the structural model of the PfA-M1 and Co4 complex of the present invention provides a useful tool for development of a two-target or combination therapy that would be more resilient to the emergence of drug resistant malaria parasites. The structure of PfA-M1 reveals two openings to the active site cavity. Analysis of the Co4-bound rPfA-M1 structure revealed that it is essentially identical to the inhibitor-free enzyme.
Accordingly, the present invention also provides a method for determining at least a portion of the three-dimensional structure of a species, such as a molecule or molecular complex which can bind with the active site, or the active site cavity. The molecule or molecular complex may for example stabilise, alter the conformation of, or interact with the active site or active site cavity. It is preferred that these molecules or molecular complexes correspond to at least part of the active binding site defined by structure coordinates of rPfA-M1 according to Table A or the Co4-bound PfA-M1 according to Table B.
The present invention further provides a method for screening molecules or molecular complexes for anti-malarial activity comprising the steps of:
The part of the active site cavity with which the candidate compound interacts is typically the C-terminal domain IV opening, the groove at the junction of domains I and IV or the active site. Our interpretation is that the larger C-terminal channel is the entrance whereby Hb-derived peptides access the buried active site leaving the smaller sized opening for exit of released amino acids. Accordingly the candidate molecule or molecular complex will block the entrance of Hb-derived peptides to the buried active site, and/or block the exit of released amino acids.
One of the advantages of using a structure based model as a drug target is that it has a high degree of specificity, that is, the model makes it possible to choose or design a molecule or molecular complex that blocks the PfA-M1 protease, but does not adversely affect other proteases that may be beneficial, or essential to a host.
The present invention further provides a method for screening molecules or molecular complexes for anti-malarial activity comprising the steps of:
In a particularly preferred embodiment step (ii) consists of identifying candidate molecules or molecular complexes that interact with one or more of the following (inclusively numbered) residues that line the active site of the malaria protease: 303-305; 314-325; 458-463; 489-526 (incorporating ‘catalytic residues’ His-496; His-500 and Glu-519); 570-582; and 1022-1038.
The present invention further provides an active binding site or active binding site cavity in rPfA-M1 or the Co4-bound rPfA-M1 structure as well as methods for designing or selecting molecules or molecular complexes for use as anti-malarial drugs using information about the crystal structures disclosed herein. The present invention further provides anti-malarial drugs or drug candidates designed or selected according to said method.
In a preferred embodiment the methods, drugs or drug candidates of the present invention are suitable for modulating PfA-M1 or the Co4-bound PfA-M1 complex to inhibit at least part of their activity, more preferably all of their activity. In a particularly preferred embodiment, the inhibition will stop degradation of haemoglobin. In situ this means that the parasite from which the protease originated will be deprived of materials to maintain protein metabolism and synthesis.
Various embodiments/aspects of the invention will now be described with reference to the following drawings in which,
PfA-M1 is a 1085 residue metallo-exoprotease, highly conserved between different Plasmodium spp. (
Recombinant PfA-M1 (rPfA-M1) displayed a broad specificity, cleaving N-terminal hydrophobic, basic, and aromatic amino acids (Table 1).
The most efficiently cleaved residues were (at the P1 position) Leu, Ala, Arg and Phe that represent 32% of haemoglobin residues (Table 1). rPfA-M1 displayed optimal activity at pH 7.0 with <20% activity below pH 6.0, similar to alanyl aminopeptidases activity within soluble extracts of malaria parasites, and consistent with a function within the cytosol (
The X-ray crystal structures of the ligand-free and Co4-bound rPfA-M1 were determined to 2.1 Å and 2.0 Å, respectively (see Table 2 and the methods set out in the Examples).
aValues in parentheses refer to the highest resolution shell.
bAgreement between intensities of repeated measurements of the same reflections and can be defined as: Σ(Ih, i − <Ih>)/Σ Ih, i, where Ih, i are individual values and <Ih> is the mean value of the intensity of reflection h.
cN = 12522, 1.75 Å-2.25 Å (44)
dN = 9033, 1.4 Å-1.9 Å (44)
Inspection of the molecular surface of PfA-M1 reveals two openings to the active site cavity. The first opening comprises a shallow 8 Å long groove at the junction of domains I and IV (
Analysis of the Co4-bound rPfA-M1 structure revealed that it is essentially identical to the inhibitor-free enzyme (r.m.s.d. of 0.13 Å over 890 Cy residues). The omit electron density of Co4 within the active site was well-defined (
Various aspects of the invention will now be described with reference to the following non-limiting examples and outline of the experimental procedures.
P. falciparum clone D10 was cultured as described (Trager, W. & Jensen, J. B. Science 193, 673-5 (1976)). For experiments investigating the stage specific expression of PfA-M1, parasites were synchronized using two rounds of sorbitol treatment (Lambros, C. & Vanderburg, J. P. J. Parasitol 65, 418-420 (1979)), and stage specific parasites harvested at ring, trophozoite and schizont stage.
The P. falciparum M1 Alanyl Aminopeptidase Gene, Codon Optimization, and Gene Synthesis.
The M1 alanyl aminopeptidase gene sequence (MAL13P1.56) also known as PfA-M1 (Florent, I. et al. Mol Biochem Parasitol 97, 149-60 (1998)), as annotated by PlasmoDB, is located on chromosome 13 of P. falciparum and is a single copy gene. The gene is 3257 by in length and encodes a protein of 1085-amino acids with a predicted molecular mass of ˜126.064 kDa with an isoelectric point 7.64.
Expression and Purification of Recombinant Malarial M1 Alanyl Aminopeptidase (rPfA-M1) in E. coli.
A truncated form of the P. falciparum M1 aminopeptidase (residues 195-1085, rPfA-M1) was prepared by PCR amplification using the synthesized gene as a template followed by directional cloning into the bacterial expression vector pTrcHis2B (Invitrogen). The primers used were M1 forward 5′-CTGCAGAACCAAAGATCCAC-3′, and M1 reverse 5′-GGTACCTCAATGATGATGATGATGATGTGGGCCCAACTTGTTTGT-3′. Unique PstI and KpnI sites (underlined) were introduced at the 5′ and 3′ ends of the amplified product. A C-terminal His-tag was introduced into the M1 reverse primer (italics).
Aminopeptidase activity was determined by measuring the release of the fluorogenic leaving group, 7-amino-4-methyl-coumarin (NHMec) from the fluorogenic peptide substrates H-Leu-NHMec, H-Ala-NHMec, H-Arg-NHMec, H-Met-NHMec, H-Phe-NHMec, H-Gly-NHMec, H-Val-NHMec, H-Ile-NHMec and H-Pro-NHMec. Reactions were carried out in 96-well microtitre plates (200 μl total volume, 30 min, 37° C.) using a spectrofluorimeter (Bio-Tek KC4) with excitation at 370 nm and emission at 460 nm. Enzyme was first added to 50 mM Tris-HCl pH 8.0 before the addition of 10 μM H-Leu-NHMec. Initial rates were obtained at 37° C. over a range of substrate concentrations spanning KM (0.2-500 μM) and at fixed enzyme concentrations in 50 mM Tris-HCl, pH 8.0. Inhibition experiments were carried out in the presence of substrate.
PCR forward primers for the truncated sequences (ggatccatgccaaaaatacattataggaaagattat) were designed against the PfA-M1 gene (MAL13P1.56) and contained a BamHI restriction site (highlighted in bold). A reverse primer (ctgcagtaat-ttatttgttaatc) contained a PstI site with the putative stop codon removed to facilitate the addition of a sequence encoding the cmyc reporter tag. PCR products were cloned into pGEM using a TA cloning system (Promega, USA) and sequenced to confirm that no Taq associated errors had occurred. Selected clones were digested out of the pGEM vector using BamHI and PstI and subcloned into the Gateway™ compatible entry vector pHcmycB (Gateway, InvitroGen) which had previously been digested using the same enzymes. A cmyc-tag was ligated in-frame at the 3′ end of the introduced gene sequence, respectively (Gardiner, D. L., Trenholme, K. R., Skinner-Adams, T. S., Stack, C. M. & Dalton, J. P. J Biol Chem 281, 1741-5 (2006)). These introduced genes were under the control of the HSP86 promoter. Using those entry vectors and Gateway™ compatible destination vectors with a destination cassette and a second cassette containing the human dihydrofolate reductase synthase gene under the control of the P. falciparum calmodulin promoter as a selectable marker, clonase reactions were then performed. The final plasmid, designated pHTB-PfA-M1-cmycB (cmyc-tag) was transfected into ring stage parasites by electroporation as described (Spielmann, T., Gardiner, D. L., Beck, H. P., Trenholme, K. R. & Kemp, D. J. Mol Microbiol 59, 779-94 (2006). Parasites resistant to WR99210 were obtained up to 25 days later.
Total RNA was extracted and Northern blotting performed essentially as described by Kyes et al. (2000) with the following modifications: 100 μL pellet volumes of infected red blood cells were collected from cultures at approximately 5% parasitemia, lysed and stored in TRIzol (Invitrogen, U.S.A). Samples were separated on a 1% TBE agarose gel containing 10 mM guanidine thiocynate (Sigma-Aldrich, Australia), soaked in 50 mM NaOH for 30 minutes and transferred onto a Hybond N+ membrane (Amersham Biosciences, U.K.).
Blots were probed with a 1500 by PCR product amplified from a full length PfA-M1 pGem clone using primers PfA-M1IntF (tacaatgggctttagaatgtc), and PfA-M1 IntR (aattcatcatcttttga). This product was labelled with α-32P-dCTP by random priming using a Decaprime II kit (Ambion, U.S.A. The probe was hybridized overnight at 40° C. in a hybridization buffer containing formamide (Northern Max; Ambion). The filter was washed once at low stringency and twice at high stringency (Northern Max; Ambion), then exposed overnight to Super Rx Medical X-Ray film (Fuji, Japan), and developed using a Kodak X-OMAT 3000RA processor (Kodak, Australia).
Parasite protein fractions were extracted using 0.03% saponin (Sigma-Aldrich Australia) and prepared as described previously (Spielmann, T., Gardiner, D. L., Beck, H. P., Trenholme, K. R. & Kemp, D. J. Mol Microbiol 59, 779-94 (2006)). SDS-PAGE was performed using 10% acrylamide gels and run on Miniprotein II rigs (BioRad, U.S.A). Equal loading was estimated using the Bradford method (Bradford, M. M. Anal. Biochem 72, 248-254 (1976)), and by staining gels with Coomassie Brilliant Blue (Bio-rad, U.S.A) with protein proportions visually estimated.
Protein was transferred onto Hybond C+ membranes (Amersham Biosciences, U.K.), which were blocked in 5% skim milk powder for 1 hour at 37° C. or overnight at 4° C. Anti-cmyc (Sigma-Aldrich, Australia) were used as primary antibodies to label transgenic PfA-M1 protein at a 1/3000 dilution. The secondary antibody was an anti-mouse IgG (Chemicon, Australia) used at a dilution of 1/5000. Blots were incubated with ECL Detection Reagents (Amersham Biosciences, U.K.), with exposure times ranging from 5-10 minutes.
The in vitro sensitivity of each parasite population to Co4 was determined using [3H]-hypoxanthine incorporation (Geary, T. G., Delaney, E. J., Klotz, I. M. & Jensen, J. B. Mol Biochem Parasitol 9, 59-72 (1983)). Briefly, serial dilutions of each inhibitor were prepared in culture media (0.2-200 μM) and added with [3H]-hypoxanthine (0.5 μCi/well) to asynchronous cultures. After a 48 hr incubation the amount of [3H]hypoxanthine incorporation was measured IC50 values were determined by linear interpolation of inhibition curves (Huber, W. & Koella, J. C. Acta Trop 55, 257-61 (1993)). Each assay was performed in triplicate on at least two separate occasions.
rPfA-M1 was extracted and purified from BL21 cells by Ni NTA-agarose chromatography (Stack, C. M. et al. J Biol Chem 282, 2069-80 (2007)). The eluted enzyme was dialyzed against gel filtration buffer (50 mM Hepes pH 8.5; 300 mM NaCl 5% (v/v) glycerol) before size-exclusion chromatography using a Superdex S200 10/30 column. Before crystallization, purified enzyme were concentrated to 5 mg/mL. The crystals were grown using the hanging drop vapour diffusion method, with 1:1 (v/v) ratio of protein to mother liquor (0.5 ml well volume). The crystals appeared overnight in 22% (v/v) polyethylene glycol 8000, 10% (v/v) glycerol, 0.1 M Tris (pH 8.5) and 0.2 M magnesium chloride and reached full size in 3 days. Crystals of the rPfA-M1-Co4 complex were obtained by cocrystallisation under similar conditions in the presence of the ligand at 1 mM. Crystals were dehydrated against reservoir buffer with 15% (v/v) glycerol for 16 hours. Crystals were equilibrated for 5 min in reservoir buffer in the presence of 20% (v/v) glycerol. Cryoannealing was performed three times by blocking the cryostream (100 K) for 5 seconds. Cryoannealing substantially improved the diffraction quality observed. Crystal quality was variable and a large number had to be screened.
Data were collected in-house on a Rikagu RU-3HBR rotating anode generator with helium purged OSMIC focussing mirrors as an X-ray source. Data are collected using an R-AXIS IV++ detector. The diffraction data for the ligand-free and Co4-bound protease were collected to 2.1 and 2.0 Å resolution, respectively. Diffraction images were processed using MOSFLM (Leslie, A. G. W. in Joint CCP4+ESF-EAMCB Newsletter on Protein Crystallography, No. 26. (1992)) and SCALA (Evans, P. Acta Crystallogr D Biol Crystallogr 62, 72-82 (2006)) from the CCP4 suite (CCP4. Acta Crystallogr D50, 760-763 (1994)). 5% of each dataset was flagged for calculation of RFree (Brunger, A. T. Acta Crystallogr D Biol Crystallogr 49, 24-36 (1993)) with neither a sigma nor a low-resolution cut-off applied to the data. A summary of statistics is provided in Table 3. Subsequent crystallographic and structural analysis was performed using the CCP41 interface (Potterton, E., Briggs, P., Turkenburg, M. & Dodson, E. Acta Crystallogr D Biol Crystallogr 59, 1131-7 (2003)) to the CCP4 suite (Evans, P. Acta Crystallogr D Biol Crystallogr 62, 72-82 (2006)), unless stated otherwise. Structure solution preceded using the Molecular Replacement method and the program PHASER (McCoy, A. J., Grosse-Kunstleve, R. W., Storoni, L. C. & Read, R. J. Acta Crystallogr D Biol Crystallogr 61, 458-64 (2005)). A search model was constructed from the crystal structure of aminopeptidase N from Neisseria meningitides (PDB 2GTQ), the closest structural homolog identified using the FFAS server (Jaroszewski, L., Rychlewski, L., Li, Z., Li, W. & Godzik, A. Nucleic Acids Res 33, W284-8 (2005)). A “mixed” model consisting of conserved sidechains (all other non alanine/glycine residues truncated at Cγ atom) was then created using the SCRWL server (Jaroszewski, L., Rychlewski, L., Li, Z., Li, W. & Godzik, A. Nucleic Acids Res 33, W284-8 (2005)).
Maximum likelihood refinement using REFMAC (Murshudov, G. N., Vagin, A. A. & Dodson, E. J. Acta Crystallographica D53, 240-255 (1997)), incorporating translation, liberation and screw-rotation displacement (TLS) refinement was carried out, using a bulk solvent correction (Babinet model with mask). Imposed restraints were guided by manual inspection of the model and RFree. Simulated annealing composite omit maps were generated using CNS (Brunger, A. T. et al. Acta Crystallogr D Biol Crystallogr 54 (Pt 5), 905-21 (1998)) omitting 5% of the model. All model building and structural validation was done using COOT (Emsley, P. & Cowtan, K. Acta Crystallogr D Biol Crystallogr 60, 2126-32 (2004)). Water molecules were added to the model using ARP/wARP (Cohen, S. X. et al. Acta Crystallogr D Biol Crystallogr 64, 49-60 (2008)) when the Rfree reached 25%. Solvent molecules were retained only if they had acceptable hydrogen-bonding geometry contacts of 2.5 to 3.5 Å with protein atoms or with existing solvent and were in good 2Fo-Fo and Fo-Fc electron density.
The coordinates and structure factors are being deposited in the Protein Data Bank.
Pymol were used to produce all structural representations (http://www.pymol.org). CCP4MG (CCP4, 1994) was used to produce
The word ‘comprising’ and forms of the word ‘comprising’ as used in this description does not limit the invention claimed to exclude any variants or additions.
Modifications and improvements to the invention will be readily apparent to those skilled in the art. Such modifications and improvements are intended to be within the scope of this invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2008900700 | Feb 2008 | AU | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/AU2009/000161 | 2/12/2009 | WO | 00 | 4/8/2011 |
