Cytomegalovirus gene function and methods for developing antivirals, anti-CMV vaccines, and CMV-based vectors

Abstract
A global functional analysis of HCMV genes is performed by constructing virus gene-deletion mutants and examining their growth phenotypes in different natural HCMV host cells. This systematic analysis of the HCMV genome identified 45 viral ORFs essential for viral replication and characterizes of 115 growth-dispensable viral genes. Of particular interest is the finding that HCMV encodes genes (temperance factors) that repress its own replication on a cell type-specific basis. In addition to HCMV, pathogen temperance may be a strategy employed by other infectious agents to enhance their long-term survivability within their respective host population.
Description

Human cytomegalovirus (HCMV) is among the largest of the DNA viruses, with a genome of over 230 kb. This virus infects various tissue and cell types and, hence, is responsible for a myriad of complications including mental retardation, AIDS-associated retinitis, and vascular diseases. HCMV, is found universally throughout all geographic locations and socioeconomic groups, and infects between 50% and 85% of adults in the United States by 40 years of age. HCMV is also the virus most frequently transmitted to a developing child before birth. For most healthy persons who acquire CMV after birth there are few symptoms and no long-term health consequences, although there is usually a dormant virus infection for life.


However, HCMV infection is problematic for certain high-risk groups. Included among these are infection during pregnancy, and infection of immunocompromised individuals, such as organ transplant recipients and persons infected with human immunodeficiency virus (HIV). HCMV is a major cause of morbidity and mortality in AIDS patients with low CD4 counts, from either primary infection or reactivation of latent infection. Clinical illnesses in patients with HIV infection include chorioretinitis, pneumonia, esophagitis, colitis, encephalitis, polyradiculopathy, adrenalitis and hepatitis


CMV also remains the most important cause of congenital viral infection in the United States. Generalized infection may occur in the infant if infected before birth, and symptoms may range from moderate enlargement of the liver and spleen (with jaundice) to fatal illness. With supportive treatment most infants with CMV disease usually survive. However, from 80% to 90% will have complications within the first few years of life that may include hearing loss, vision impairment, and varying degrees of mental retardation. Another 5% to 10% of infants who are infected but without symptoms at birth will subsequently have varying degrees of hearing and mental or coordination problems.


Although primary HCMV infection in an immunocompromised patient can cause serious disease, the more common problem is the reactivation of the dormant virus. Infection with CMV is a major cause of disease and death in immunocompromised patients, including organ transplant recipients, patients undergoing hemodialysis, patients with cancer, patients receiving immunosuppressive drugs, and HIV-infected patients. Pneumonia, retinitis (an infection of the eyes), and gastrointestinal disease are the common manifestations of disease. Because of this risk, exposing immunosuppressed patients to outside sources of CMV should be minimized. Whenever possible, patients without CMV infection should be given organs and/or blood products that are free of the virus.


Depending on the tissue type and the host's immune state, HCMV engages in three different modes of infection: acute infections with highly productive growth, persistent infections with low levels of replication, and latent infections where no viral progeny are produced. In different cell types, HCMV exhibits various growth rates, suggesting that its replication in a particular cell type is tightly regulated and thus, determines the outcome of diseases in specific tissues. Although there is evidence for a genetic basis of viral cell type-specific infection and growth regulation, many virus-encoded cell-tropism factors have not been identified, and their functional roles in viral replication are unclear.


Methods of controlling and preventing HCMV infection are of broad interest to the scientific community, pharmaceutical and biotech industry. The present invention addresses these issues.


Relevant Literature


The genomic sequence of human cytomegalovirus (AD169) has been deposited with Genbank; accession number NC—001347. The sequence information is reviewed by Davison et al. (2003) J. Gen. Virol. 84 (Pt 1), 17-28; Dargan et al. (1997) J. Virol. 71 (12), 9833-9836; and Chee et al. (1990) Curr. Top. Microbiol. Immunol. 154, 125-169.


SUMMARY OF THE INVENTION

A global functional analysis of HCMV genes was performed by constructing virus gene-deletion mutants and examining their growth phenotypes in different natural HCMV host cells. This systematic analysis of the HCMV genome identified 45 viral ORFs essential for viral replication and characterized 115 growth-dispensable viral genes. Of particular interest is the finding that HCMV encodes genes (herein termed temperance factors) that repress its own replication on a cell type-specific basis. In addition to HCMV, pathogen temperance may be a strategy employed by other infectious agents to enhance their long-term survivability within their respective host population.


Viral temperance factors, genes encoding such temperance factors, and viruses having mutations in temperance factors are provided. Viruses with deletions temperance factor genes exhibit enhanced growth phenotypes, as compared to the wild type virus. These repressors of growth facilitate pathogen temperance. The genetic sequence of such temperance factors in viruses are modified to modulate virus replication, e.g. in the development of vaccine strains, for research purposes, and the like. The temperance factor polypeptides are useful as targets for drug design, as targets for immunological agents, and the like. Drugs mimicking or activating growth inhibitors or temperance factors find use in therapies against infectious diseases. In vitro hyper-growth strains having diminished or absent temperance factors can be used for facile production of large quantity of subunit and attenuated live vaccines.


Genes essential, or dispensable, for replication of HCMV are also identified. The sequence of such essential or dispensable genes can be modified to modulate virus replication, e.g. in the development of vectors and vaccine strains, for research purposes, and the like. Protein products of these genes are useful as targets for drug design, as targets for immunological agents, and the like.


In another embodiment of the invention, methods and compositions for the functional analysis of cytomegalovirus are provided. Such methods include the construction of rescued mutants, and methods for tagging and introducing foreign genes into CMV genome. These approaches can be used for vector and vaccine development. A collection of mutant cytomegaloviruses is provided, where each virus contains a deletion corresponding to one open reading frame in the virus genome. The mutant HCMV are useful in a number of screening methods. Screening methods include the growth of HCMV in different human cell lines.




BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1. Genome organization and genes of HCMV (Towne strain) based on the genome-wide shotgun sequencing of the viral sequence cloned in a BAC. Similar to the HCMV AD169 genome, the Towne genome is composed of a unique long (UL) region and a unique short (US) region, both flanked by inverted repeat regions (RL and RS). RL and RS are shown in a thicker format than UL and US. Each of the ORFs (RL1-RL13, UL2-UL147, IRS1, US1-US34, and TRS1) is color-coded according to the growth properties of their corresponding virus-deletion mutants in HFFs (see Table 6). The ORFs (RL11 and RL12), for which a deletion mutant was not generated, are shown in white. Repeated attempts to delete these two ORFs failed, possibly due to the presence of two copies of these genes at the inverted repeated regions. The vertical dashed lines represent the splicing junctions.



FIG. 2. (A) Procedures for constructing deletion and rescued mutants, as described in Methods. (B) Multiple-step growth (multiplicity of infection [MOI]=0.05) of HCMV mutants in HFFs. Cells were infected with each virus and at different time points post-infection, cells and culture media were harvested and sonicated. The viral titers were determined by plaque assays on HFFs. The values of the viral titer represent the average obtained from triplicate experiments. The standard deviation is indicated by the error bars.



FIG. 3. Analysis of multiple-step growth of different mutants and TowneBAC in HFFs (A) (MOI=0.05), retinal pigment epithelial (RPE) cells (B) (MOI=0.25), and human microvascular endothelial cells (HMVEC) (C) (MOI=0.05). (D) Comparison of the growth properties of 15 mutants in these three cell types with those of TowneBAC. +++, peak titer similar to that of TowneBAC; +++++, peak titer at least 100 times higher than that of TowneBAC; +, peak titer at least 100 times lower than that of TowneBAC. The values of the viral titer represent the average obtained from triplicate experiments. The standard deviation is indicated by the error bars.



FIG. 4. Polymerase chain reaction (PCR) (lanes 1-3) and Southern analyses (lanes 4-6) of the DNAs of the deletion (ΔUL32) and rescued (Rescued-UL32) mutant, and TowneBAC that were isolated from E.coli (lanes 1-3) and human fibroblasts (lanes 4-6). In (A), PCR products were separated on 1% agarose gels and visualized using ethidium bromine staining. In (B), DNAs were digested with Hind III, separated on 0.8% agarose gels, transferred to membranes, and hybridized with a [32P]-labeled probe containing both the KanMX4 and HCMV UL32 sequences. The numbers represent the size of either the PCR DNA products (PCR) or the DNA fragments (Hind III) of BAC-DNAs that were digested with Hind III and hybridized to the radiolabeled probe in Southern analysis.



FIG. 5. Microscopic images of green fluorescent protein (GFP) staining of human foreskin fibroblasts (HFFs) transfected with the DNAs (20 μg/105 cells) of TowneBAC, ΔUL32, and rescued-UL32 at 10 days post-transfection. Viral infection can be visualized using GFP staining since all BAC-DNAs contain a GFP expression cassette.




DETAILED DESCRIPTION OF THE EMBODIMENTS

Using a bacterial artificial chromosome (BAC) engineering and RED recombinase technology in conjunction with growth curve analysis in human fibroblast cells in tissue culture, an open reading frame deletion library spanning the entire human cytomegalovirus genome was constructed. The complete sequence of HCMV Towne strain was determined, and is provided herein as SEQ ID NO:1. The BAC based ORF deletion constructs were then transfected into human fibroblast cells in tissue culture. Constructs with deletions in 45 separate and distinct ORFs in the HCMV genome did not yield any viral progeny upon transfection into the fibroblast cells, indicating that those regions of the genome are essential for viral growth. These essential genes are drug targets for anti CMV therapeutic applications.


In addition, the functional mapping of the genome identified regions in the viral genome dispensable for viral growth. All ORF deletion constructs that yielded viral progeny upon transfection were deemed dispensable for viral growth. Growth curve analyses were performed on the BAC derived mutant virus and ORF deletions categorized as either severe growth defect, moderate growth defect, growth like wild type, or enhanced growth. The identification of these non-essential genes identify which genes can be deleted to create an attenuated virus for use as a vaccine, which genes can be deleted to create a gene therapy vector so as to accommodate the delivery gene of interest without affecting viral propagation in vitro; etc. Further growth kinetic characterization of the constructed mutants were carried out on human retinal epithelial cells, human aortic smooth muscle cells, and human microvascular endothelial cells and compared to the results from the human foreskin fibroblast characterization. This comparative analysis identified open reading frame deletion viruses that replicated differentially, compared to the wild-type virus, in the cell types tested, indicating that these open reading frames encoded cell tropism important factors.


The various methods of the invention will be described below. Although particular methods of tumor suppression are exemplified in the discussion below, it is understood that any of a number of alternative methods, including those described above are equally applicable and suitable for use in practicing the invention. It will also be understood that an evaluation of the vectors and methods of the invention may be carried out using procedures standard in the art, including the diagnostic and assessment methods described above.


The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the scope of those of skill in the art. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook et al., 1989); “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture”) (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Handbook of Experimental Immunology” (D. M. Weir & C. C. Blackwell, eds.); “Gene Transfer Vectors for Mammalian Cells” (J. M. Miller & M. P. Calos, eds., 1987); “Current Protocols in Molecular Biology” (F. M. Ausubel et al., eds., 1987); “PCR: The Polymerase Chain Reaction”, (Mullis et al., eds., 1994); and “Current Protocols in Immunology” (J. E. Coligan et al., eds., 1991).


Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art and the practice of the present invention will employ, conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill of the art.


“Replication” and “propagation” are used interchangeably and refer to the ability of a virus or viral vector of the invention to reproduce or proliferate. These terms are well understood in the art. For purposes of this invention, replication involves production of viral proteins and is generally directed to reproduction of virus. Replication can be measured using assays standard in the art and described herein, such as a virus yield assay, burst assay or plaque assay. “Replication” and “propagation” include any activity directly or indirectly involved in the process of virus manufacture, including, but not limited to, viral gene expression; production of viral proteins, nucleic acids or other components; packaging of viral components into complete viruses; and cell lysis.


An “individual” is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, sport animals, rodents, primates, and pets. A “host cell” includes an individual cell or cell culture which can be or has been a recipient of an viral vector of this invention. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected or infected in vivo with an adenoviral vector of this invention.


A “biological sample” encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay. The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as proteins or polynucleotides. The term “biological sample” encompasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples.


An “effective amount” is an amount sufficient to effect beneficial or desired clinical results. An effective amount can be administered in one or more administrations. For purposes of this invention, an effective amount of a temperance factor or temperance factor mimetic or temperance factor enhancer is an amount that is sufficient to palliate, ameliorate, stabilize, reverse, slow or delay the progression of the viral infection. An effective amount of a virus used in a vaccine is the amount that is sufficient to generate a virus specific immune response in the individual to which it is administered.


As used herein, “treatment” is an approach for obtaining beneficial or desired clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. “Palliating” a disease means that the extent and/or undesirable clinical manifestations of a disease state are lessened and/or time course of the progression is slowed or lengthened, as compared to not administering factors or compounds of the present invention.


The term “polynucleotide” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, this term includes single-, double- and triple-stranded DNA, as well as single- and double-stranded RNA, RNA-DNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be a oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucleic Acids Res. 24: 1841-8; Chaturvedi et al. (1996) Nucleic Acids Res. 24: 2318-23; Schultz et al. (1996) Nucleic Acids Res. 24: 2966-73. A phosphorothioate linkage can be used in place of a phosphodiester linkage. Braun et al. (1988) J. Immunol. 141: 2084-9; Latimer et al. (1995) Mol. Immunol. 32: 1057-1064. Preferably, the polynucleotide is DNA. As used herein, “DNA” includes not only bases A, T. C, and G, but also includes any of their analogs or modified forms of these bases, such as methylated nucleotides, internucleotide modifications such as uncharged linkages and thioates, use of sugar analogs, and modified and/or alternative backbone structures, such as polyamides. In addition, a double-stranded polynucleotide can be obtained from the single-stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.


The term “gene” is well understood in the art and is a polynucleotide encoding a polypeptide. In addition to the polypeptide coding regions, a gene includes non-coding regions including, but not limited to, introns, transcribed but untranslated segments, and regulatory elements upstream and downstream of the coding segments.


The term “virus target” is used to generally refer to a complete virus particle or virion, a nucleocapsid, capsid, or macromolecule from the virus, which may be a lipid, polysaccharide, protein, etc., usually an envelope or capsid protein. Viruses are infectious agents, usually comprising only one kind of nucleic acid as their genome. The nucleic acid is encased in a protein shell of capsid proteins, which forms the nucleocapsid particle. The nucleocapsid may be further surrounded by a lipid containing membrane, into which are typically inserted envelope proteins.


Viruses may be classified according to their genome composition. DNA viruses include parvoviruses, papovaviruses, adenoviruses, herpesviruses, poxviruses and hepanaviruses. RNA containing viruses include caliciviruses, reoviruses, arboviruses, togaviruses, flaviviruses, arenoviruses, coronaviruses, retroviruses, bunyaviruses, orthomyxoviruses, paramyxoviruses, and rhabdoviruses.


Herpesvirus is a class of viruses containing several important human pathogens. An important property of herpesviruses is their ability to establish life-long persistant infection of the host, and to undergo periodic reactivation. Their frequent reactivation in immunosuppressed patients frequently causes health problems. The reactivated infection may be clinically very different from the disease caused by primary infection.


There are eight herpesviruses known to infect humans: herpes simplex viruses 1 and 2; varicella-zoster virus, cytomegalovirus, Epstein-Barr virus, human herpesvirus 6 and 7, and Kaposi's Sarcoma associated herpesvirus (HHV-8). All herpesviruses have a core of double-stranded DNA surrounded by a protein coat having icosahedral symmetry. The nucleocapsid is surrounded by an envelope that is derived from the nuclear membrane of the host cell, and contains viral glycoprotein spikes.


The sub-family of P-herpesvirus include humanherpesvirus 5 (Human cytomegalovirus); muromegalovirus Murid (beta) herpesvirus 1 (Mouse cytomegalovirus); Suid herpesvirus 2 (Pig cytomegalovirus); Equid (beta) herpesvirus 2 (Equine cytomegalovirus); Porcine herpesvirus 2 (inclusion body rhinitis virus); Bovine herpesvirus 4 (bovine cytomegalovirus); Murid herpesvirus 2 (Rat cytomegalovirus); and Caviid herpesvirus 1 (guineapig cytomegalovirus). The sub-family of α-herpesvirus include the simplexviruses: Simplexvirus Human herpesvirus 1 (Herpes simplex virus 1); Human herpesvirus 2 (Herpes simplex virus 2); Bovine herpesvirus 1 (Bovine Mammilitis virus 1); and the Varicellovirus Herpesviridae: Duck Enteritis Virus (Duck enteritis herpesvirus (DEHV), Duck enteritis virus, Duck plague virus, Anatid Herpesvirus, Avian herpesvirus 2); Human herpesvirus 3 (Varicella-zoster virus); Suid herpesvirus 1 (Pseudorabies/Aujesky's disease virus); Bovine herpesvirus 1 (Infectious bovine rhinotracheitis virus); Equine herpesvirus 1 (Equine abortion virus); Equine herpesvirus 4 (Respiratory infection virus); Feline herpesvirus 1 (FHV-1); Canine herpesvirus (CHV) (“Fading puppy” syndrome virus); Equine herpesvirus 3 (Coital exanthema); and Avian herpesvirus (Infectious laryngotracheitis of chicken).


Characterization of HCMV Gene Sequences according to their Effect on Growth

The present invention provides for the classification of open reading frames (genes) in HCMV according to the effect that such sequences have on growth of the virus. Sequences are classified according to the effect on a virus when the sequence is deleted, and are: essential for growth, causing a severe growth deficit, causing a moderate growth deficit, having no effect on growth, and causing enhanced growth. In the tables setting forth the open reading frames in these categories, the sequences are referred to by the ORF, which are diagrammed in FIG. 1.


In order to unambiguously define the sequence of each ORF in the HCMV Towne strain, the genetic sequence of the HCMV is provided herein, as SEQ ID NO:1. Also provided are upstream primer sequences adjacent to the ATG start codon of each ORF; and downstream primers that are adjacent to the sequence 1 nt past the stop codon of each ORF. The sequence of the complete ORF can easily be determined by one of skill in the art, by using the primer sequences provided to delineate the ORF in SEQ ID NO:1. An ORF may thus be defined as the sequence of SEQ ID NO:1 that is bounded by the corresponding up and down primer. For example, the ORF of US26 comprises the sequence of SEQ ID NO:1 that is 3′ of the upstream primer and 5′, less 1 nucleotide, of the downstream primer.


The orientation of the primers (i.e. whether the primer is complementary or identical to the corresponding region of SEQ ID NO:1) with respect to SEQ ID NO:1 depends on the the orientation of the open reading frame in question. This can be determined by looking at the numerical identifers of the primers. These identifiers are three digit numbers followed by “Up2” and a letter, either “W” or “C” (eg. 006_Up2W or 453_Up2C). If the letter is a “W” then the upstream primer located is complementary to the SEQ ID NO:1 and the downstream primer is identical to the sequence in SEQ ID NO:1. If the letter is “C” then the upstream primer is identical to the sequence and the downstream primer is complementary. The 3′ end of the upstream primers ends directly adjacent to the ATG start codon of the ORF. The 3′ end of the downstream primers stop 1 nt. beyond the stop codon (i.e. there is a 1 nt. gap between the stop codon and the 3′ end of the downstream primer).

006_up2WAAGAAACTCCATAAAATAGGCTGCCAAGTGCCGCTC006_down2WTTTATTTGTATTCCTTTCCTGTTTTGTACTCGTAAAUS 26CACGCCGCGGCACCCTGTTGACGTTGTT014_up2WCCCCACTTGCCGCTGTACAACGAATTCACCAGCTTT014_down2WGTGCCACCGGTCCAGGTGAGAAAGAGAAGCCGCAATUL116CGCCTGCCCACCTCCCGGGCGGCGGCAC017_up2WGCCGCCCGAGCTGAAGCAGACGCGCGTCAACCTGCC017_down2WTAGACATCACAGTTCACCACCTTGTCTCCCCGGTGTUL 114GGCTCACTCGCGCTGTCTATTATCATCA019_up2WCCGCACTCGGTCAGCACCCGCAGAATCCCCGGATCT019_down2WAAAAGCACAGGGCCAGGAAAAGCAACCAGCCCCGCCUL117CGGGCCCTGCGGCCATCGCCGCCGCCGC020_up2WCGGCGCCAACTGGCTCCTTACCGTCACACTCTCATC020_down2WACGCGAGCCTGCTCGTCGGGGGTTAACAGAGAGCCTUL 115GTGCCGCAGACTTGTTATTATCAGCAAT024_up2WCCGCCATGAAGGCAAGAGCAGCAGCAGCAACGACGT024_down2WTGNGGCCTATAAGGTGTCTTCTATCACGGTGGCTTGUL109CACTACGATGATTGTTCATCGCTTGGCG036_up2WCCTTCGTCCCAGACGGACGGCTATCGGTTCGCGCGC036_down2WGCTGCTCTTGCCTTCATGGCGGTATTTCTCTTCCTCUL110TCGTCTTTTCTTCGCCCCCTAACCCCAT046_up2WTCGCCCCGAGGCGCTGCTCTGAAGCCAAGTGCCGAC046_down2WAGCGTCACAACTGACGTGGGTTGGGTACTGACGTGCUS 33GGCGCTTTGGCTTTAGGATATTACGCGA064_up2WGACGCCGCGCCGACGCTCAAGCTCTGGGACTGGACT064_down2WTGTGAAAAAGAATTCTCGTAAGCATGTTGACAACTGTRS 1TGGCCACGGTGGTGCAAAATAAAACCAT070_up2WATTACTAATCCATAACATGGCTCTTTGCCACAACTA070_down2WGCACACTGGTGGTGGTGGGCATTGTGCTGTGCCTAAUL125TCTCTATTGGCTATGTCTGGCCTCCACT073_up2WAGAGTAAAGATTAACTCTTGCATGTGAGCGGGGCAT073_down2WACAATAGTGACGTGGGATCCATAACAGTAACTGATAUL 123CGAGATAGCGATAATATATATACAATAG079_up2WCGCGTCCTTTCAAGGTGATTATTAAACCGCCCGTGC079_down2WACGGGGAATCACTATGTACAAGAGTCCATGTCTCTCul 122CTCCCGCGCCTATCTTTCCAGTTTTTCA083_up2WCTGTTTAATAAAAGTAGCTTTTTTTATACATCTCCG083_down2WTAGTTACCCTCTCGACGTCGCCGGCTGTCAATGACGUL121TCTCTGGTCTCGTGTGCCTGCGTCAGTG085_up2WTCACCTATCCCATCTACGCCGTGTACGGGACTCGCT085_down2WGAAGTCAGCGAAATAAAGACAACACAGCAGCCGCTCUL118TGAACGCTACCACGCTCTCGTTTCTGGC094_up2WCTCGGCCAGGGGGTACCGAGGCGGTGCCCGCGACTC094_down2WGTTGGGTGTGGCCGGAAGCGCTCGGGGTCGACGGTGUL62GCCCCTCCTCCAAGGGCCGCCATGACAC097_up2WATCAGCAGCTCGCACAGGCGCTGGGCTAGCTGCATC097_down2WAGATGAGACCGCTGCCGGGGGGCGGGTCACCGGCGCUL70GTGCCGGCGCGACGCGTGGAAAGTGAGG098_up2WCTATATATACATCAGCGTGCCCGAACGTGACCTTCC098_down2WTAACGGGATAAGGGACAGCAATCATCACGCACAACAUL69TAGCGACGACGGCCCCCTTCACTCTCTT099_up2WGCCGCCGCCGCGGTTGCTACTACTTTCTTAAGTGAT099_down2WATAAACGTTCTCAACAGGTATGAAATGAACAAACTAUL67GCGAATTGGTGGCTGATGATGCTATAAC100_up2WCCAGTGTTCCTTGGAGAGACGAAAAGCGAGCGTGTT100_down2WCAAATACGGTCGTGGCCGAGCGCAAAAAAACGCACCUL65TCACGAGATGGCTGATCGACACCACACC110_up2WGAGCCTGAGATGATGATGATGGCTACGAAGGACGGG110_down2WTAATGACAGAATGAACTCCATGTTATACGCTCTTTAUL64CGGACGGGCAAACGTATAGTTTCTCTGC114_up2WGATGCTTAGAGCGTGGAGATTGATGGTACTACTTGC114_down2WTAAACACAATAGCTACAGCTGCGCGGTTCTGTGGAAUL 4CGCGTACTGTTATTCTTCACGTGCGATC115_up2WTATTGTGTTTACGTTGCTTTTGAAATGTTAAGCGTC115_down2WACAAATATGCAAAAGCAAAACACAACAAACTATACAUL5CCTACGCCGCTAACCAGCTGGCTAACTA116_up2WTGGAAAGACAGTAAACAGTATGGACAAGTGTTCATG116_down2WTGAGCTGAAAAATAAACGTACATAGCTTTTAGTTTCUL9ACGGACACAGAACTCTCGACGGTGATTC117_up2WGTAAACATAATGACGTACATATACGTGGTTATACAA117_down2WTATATTCAAACAGTGAGTTTGAAACCGGACATATCCUL10CAGGTGTTTGTGCTGTCCGCTCACGATA119_up2WACCGTGGCCTGTCCGCCCCGAGAACCCCCGCATCGT119_down2WTTCCGTTTTCCTGCCGTGACTGCGAATCATCCGCTTUL14GCCCTGTTTCGTCTCATGGCTCTCCTCG121_up2WCCCGTGGACGGGTCTCTTTGACACGAGCGCGGCACG121_down2WTTTGACCCCTCCTATCTTCTTTGATGATGTATCCTCUL17CCGTTGCCACGAGCTTAGCCGTGTGTTG122_up2WCTGAAAGTATATAACGCCGATCATGTCCGAGGAACT122_down2WCGGGGGCACGCGGTAACCGACGTCGAAACAGCTCATUL 18GTTAATAAAACGCCACAGGGCGTTGATG129_up2WAGTACTGTTTGAGCGTGACTGTTTCCAAATCGTACC129_down2WCGGGCTAGTCATTGTGGGCACAAAACCTTCTCCCTGUL7GTGGTAAATAAATCATAAAAAGCACATT130_up2WCAGAATTATAGTAATGTGCTTTTTATCAGGGAGAAG130_down2WGTGTACAAAGAATGATTGTTATCCATCGAAGTAATAUL8GTTTTGTGCCCACAACGCGTACCGGAAC133_up2WCCCTGATTCCCTTCATAAAGCTGTTGACCGGCCCTA133_down2WACGCATAAGCGACCGGGGATGGGGGGAAATAAAGGAUL13GAAAGACCAAGAGCATGGCTCGGTGTAT136_up2WGGGCTCCATGCTGACGTAGGTACCGACTGGGGTCAA136_down2WGGCCTTCTTATAGCAGCGTGAACGTTGCACGTGGCCUL16AAGCCTCGGTACTTTTTGCGGTTATCCG138_up2WTGGAACGGTCTTTATATATACAAACGCCGTTATGCT138_down2WTTATGGAAAATATGTAGTCCGTACCGCTTCGGGCTCUL20CAGTGTCCGGCAAGAGAGTCCAAAGTCC143_up2WGAGAGTCTGAAACGGGGTGGGAGGGACTTTTGCGGG143_down2WTACCACGGTACGATTTGGAAACAGTCACGCTCAAACUL6TAGTGCACGCTAAGAGTACTTTTTATTT147_up2WGGGACAGTCCCTACGGAACCTGAGAACATGTGGAAA147_down2WGGAGTTGGCGTTTCACAGTGATTTCATGCAATCATTUL 11 UL13TCACCTGTGGTACATCCTACGCGACTTG153_up2WTACCTACGTAACCTGGCCTTTGCGTGGCGCTATCGC153_down2WACGGACGTAGGTTATTTTGAAAACCTACGTTAATCCUL19AAGGTCCGGTCGTCTGAACGCGTTTCGT179_up2WCTCTCTAGGTAGGGGACTACCTCCTCGACGGTCCAT179_down2WGCATGGCCATCTTTCTCACGTTGTTGCTCATGCTCTUS 20TCTAGCGGGACGACCGGGTCCCCGTTGG238_up2WATGGCTAATTGCCAATATTGATTCAATGTATAGATC238_down2WATCAGTACCTGGAGAGCGTTAAGAAACACAAACGGCUL127GATATGCATTGGCCTGGATGTGTGCCGC249_up2WGAAAAGTAAAAGATGACCGCGCCCTCGGAGTCCTTT249_down2WGATACATTAATAAATATATTATATCTGGTGTATATATRL7TTTCCTTTTCAATCCTGAATGCTGCTGG250_up2WGGGTACTAAAAAAGTGTTTAATATTGGGGTTTAATG250_down2WAGTCATCATCCTAAAATTCAGATATAAATGAACACATRL6ATAAAATCCAGGTTTGTCGTATGGGATT252_up2WCCTTTTTATGTGAGTTTCTCTTCCGCGTCTCCCGGC252_down2WTGTGCAGGGCATGCGGGGAATCAGGACCGGACACGGTRL4CGTACCATCCACCCGATAATTTCATCTA257_up2WTGAGAGTCGATTCGATCGGTAAACATCGTAAGCATC257_down2WATGGAAACCTTACCCCGCCGGAACACCGCCGGCCTGUL73GTGGCGGTGGTGTGTGAACCTGTCCACC261_up2WTCCCCGGAGAGGGTATATTCGTTCGGCGAGAGCGGG261_down2WTGACGTAATTTATCTGCCACTTTTCTCCCCGCTGCCUL78CGGCGGTGGTGGGTGTACAACGCCGCCG263_up2WGAGCTCAGCGGCTGTCCGCGCGACATCTTCTCGCTA263_down2WTATCACGGTGTAGAAAAAAAAGAGAGGGAAGCCCTAUL80ATCTGTAATATTAGAATATAGCGTCTCT272_up2WCCTTCTCCTGTTCCCTCCGCCCCCAAAACTGTCAGC272_down2WTGGTCGAGCACCAGATGTAGAGGCAATTGCTCATCGUL92GACGCTCAGACGTCTCAGCGAACCGCGC276_up2WGTGCTAGACCGTTGGAGTCGCGACCTGTCCCGCAAG276_down2WGTGTCCCATTCCCGACTCGCGAATCGTACGCGAGACUL 99ACGAACCTACCGATCTGAAAGTTTATGG278_up2WCATGGCGATAGCGGCGCCCCGCTCGCTCGGGAGGCG278_down2WGCGGCGTAGCTGGCGCGATGCACAGCACGCACCTCAUL101ATGGGGGCGCGCCGGCCGGCGGCAGACG285_up2WCGATGTCATTGGCCGCTGCGAAGGGAGAAGAGGGGA285_down2WGCGGTCGCCGCGTCAGACGGGGTGGCGGGTCCCGTGUL76CACGCGAGTAAGTCATGGCATCGTGCCG312_up2WGTTGACGGCAGTTCTGAACCCACGTCGCCGCGAGCG312_down2WCATGGCCACCTACCTGTGTGACGAGATACACGCCATUL88CGGTTTGCATCACGCCGTTTCAGGGTCA316_up2WGCGCGCCCATAAAAACGAAAGTGTCCTCGTCGCCAC316_down2WCGTAGAGCGAGTGTAACTGGATCTCCTCGGTAAACGUL91CCGCCACAGCCGCCCGTTCTGGACGTGCUL92317_up2WTAGTCGTAAGAAGCGCGAGGACGCGCTTCTGAAACA317_down2WCGGTAGAGCAACAGCAACTGGCATAAGATACACGAGUL93GATGCGTTCCGAATCTGTCGTCCTCCGG320_up2WTCGGTGTGGTAGCTAGTGCAGCTCTAGGAACAGGGA320_down2WTACCTTCTCTGTCGCCTTTCCCCTCAGCAACCGTCAUL97AGACTGTCGCCACTCGTTCCGCGTCCCG321_up2WAGAAGGTACAAACCCACCGGCGGGGAAAATACCGAG321_down2WGAGGGATGTTGTCGTAGCAGCGTAGAGACACCTGGCUL 98GCGCCGCCATCATCGACCCAGAGCATCT325_up2WGTCGGCGAAAAAACACCCCGCGGGCCTTCGCGACTC325_down2WTTTTTACTAGTATCCACGTCACTTACCCACGTAGTTUL102TCTTCTGTCCGAGGCCCCTACGTGACTC331_up2WTTTCGACCTGTGTACCGATTCTGTTCTGGACTATCT331_down2WCCCTCTCCGGGGACGCTCGCCCTTTATGCAGCAAGCUL77GGGACGGCGTCAGGGACACGTGGTGGAA339_up2WGGCGTGAGCGCGAGGCGTCGGAGCTCGGGGAAAGCA339_down2WTCGGACGCTCCTCCGGACGAAACGCCGCGGCGGCAGUL87GCGCGACCCGGAGACGGCCGCGGCTTCC345_up2WTTACTGGGTGCTGCCGGGCGGCTTTGCTGTGTTCTC345_down2WTCCTTTTTTTGTTGTTTCTTGTTTCTTCTCCCCGTGUL94GCGCGTCACTCTTCAACTGTCAGACCCC347_up2WGCAGCTCCGCGTAGCGCTCCTGGATCTTGGCGGCCG347_down2WGCTGACGCGCTCGTCTCGACCGCACAAGCGCCGGCCUL95AGTCTCCGCGCAACCCGCCGCCGCCACC348_up2WTTGCTGGACGCCCTCTCGCTGAACGACGCGGGTCTC348_down2WTTTTTTTTTAATAAAATCTGAACAGAGGCGTGACGGUL96ATCACGTTGAATCTGGATTGCTATACCT362_up2WTATAAAATTCACTCAGTGGCGGCGTAGCCATTGTCT362_down2WTGTTGCGATGCTCGTGGCTGCGGCGGCCGTTGTCGCUL 57TCCGTTCATCCACCGCCGTCTGCTGGCG366_up2WCAAGAGACCACGACGCGCCTCATCGCTGCTGGATTT366_down2WATCACAAGTCTCTGTCACTTTTTTTGTCTAGTTTTTUL 55GGCCCGCGACGAACTTTTCTCCTCTTGG378_up2WTCACTTTATTGAAATCTACCTGATTTCTTTGTTATT378_down2WAAGACGCCCGGCGTCTAATAATACAGCCGCGCCGAGUL 45TTCCTCGTAAACTTCCAGCGGGCCCCCG379_up2WCTAGAGCGCGTGCCCGGGCACGCGGCCTGCGCGCAC379_down2WGACGGCGACGGTGGTAACTGTGGTGGAGACGGTACCUL43GGCGCGGTCCCGCGGACGGCGTCCGCGG380_up2WTCGGTACCGTCTCCACCACAGTTACCACCGTCGCCG380_down2WTTATTCCGTAGCAGCAATGATGGTACAGTCAAGCACUL42TCACTGCCACCGACATGATCTATTTCCC382_up2WGATGTACGTACCACGGTACGGACATTAACGTCACTT382_down2WGAGAACTACGGCGCGGCGGCACGGCCTTTATAGACAUL37CCAACGCCACGAGTCTATCAGCGTTGAC384_up2WGCTGTCAGGAATACCTGCACCCCTTTGGCTTCGTCG384_down2WAAACATGCACATAAACAAACGGGACCACCGTGCTCGUL36AGGGTCCGGGCTTTTCATCCTCTCCTCA388_up2WCGGGCGCAGTCCGGGGCGACGACGCTTCCGGGTTCT388_down2WTCACTATCCGATGGTTTCATTAAAAAGTACGTCTGCUL32GGAGAAAAGCCAGCGTGTGTCTTTATTA393_up2WGTTGAAAACGCGCATGATCTCGCGGAGCCATCTACG393_down2WTCCACACGCTCAGCCGCGACTGAGCGCCGGGGCGCGUL30CGCCTGTCAGGGAGCCGCTACTTGGGTT394_up2WACTGCTGCTTCTGCTTTTTTGTCTCCTGTGGATCGT394_down2WCGGTTATAAAAACACCGTCGCCCTATTTCTGGGCGTUL29CGCGGACTGCCGGCGTGTACACTGATGA397_up2WGGGGCCCTCGGTGCGCTACCGGGCCCACATTCAAAA397_down2WCTCTGTCTTCTCCGGGTTTTTTTTTTCATGTTTTTTUL26GTTTGAGCGTCTTCTTTCTTCCTATTTT398_up2WAGAGGCCCCGCCTAGGTGGGCGGAGCGGTAATTTTC398_down2WAATCATCTCTGATGACGTAGCGAGCGAAGCGAGCTAUL60CACCGCCGCGGCCCCGTCATCAGTCCGT400_up2WCACCGCCTCGCCGGCCACGGGGTTGATTCCTGTTCT400_down2WAAAGATCCGAACTTTAAAATTGTGTATTTTTATTTTUL59TATGCCGACACCAGCCCATCCCCCTCTT407_up2WATTTGCTTTGTGATTTTGCTTCGTAAGCTGTCAGCC407_down2WAGTCTCAGCAGCATTATCACCGTCCCCAGTCACCACUL 54TCTCACGGTCCGCTCGCCGCCGCTGTTT411_up2WTACTCGGATTCATGGCGATCGGCGCCGCTGATTGAG411_down2WATCCTGATGGAGAACCTTGTTCATCTCCATCGCACCUL51GACGCGGAAAAAGAGACGCCACCGCCGA423_up2WCCCGCAGCTGCTCTATCAACTTTTTGAAATCTACCG423_down2WTGTGTTTATTTTTTTCTTCTGTGTCTCCTCCCCGTAUL46TGCGCCTCGCCATCTGCTGTCAGCGCCG426_up2WTTTCAAGACGACGTGAGACCCACACGCGGGTTTCAC426_down2WAGTCCCTTCTTATACTATCCCGGAGTCTGTGGTTTTUL37TTCTTTCTTTAATTTTTGTTTACCCCTG452_up2WGGCCGGCGCCAGACCGGACGACAGCGTCTCCTACGT452_down2WCCACGAGTAGAAGATGAGGAAACCGCAGCACCCAGAUL56GAGCGAGTCGAGTCCAGACGATACACAA459_up2WCCCGCTGGTGCTGGCTCTCCTGCTGGTGCTGGCTCT459_down2WTGACGGTCTTTTTCGTCCCGCTTGTTGGCCACCGTGUL49GCTGTGGCGCGGTCGGTCCCGGCGCGGT471_up2WTTTCGCTCGCTCGCGCCCGCTCCTTAGTCGAGACTT471_down2WTCCATCGCGGGACCGCGCCGTGCGCGCAGGCCGCGTUL44GCACGCTGTCCGGGGCCCGGGCACGCGC472_up2WAGAAGGGACTTTACCGCTATTGCTGCTATTCATAGA472_down2WACTACAAAAAAAAAAAGCTGAACATGGTCATCTAGCUL38GAAGGATAGAAAGGAGCAAAGTTCTCCT484_up2WCCACGGCGGGTCGTTGGCTCCCGCTGTGCTGGCCGC484_down2WGGCGGTAAAGCCAAACACCGGCTATATAGCTAGTCAUL28CGCTGCACGGCATCTCACAGTCTCCTCC485_up2WCCGCCGTCGCTCCGCGTCGCTTCGCCGCCACCTTCT485_down2WGCGCCTCGTCGGTCGATGACCCCACGGTGCTTATAAUL27TCTTCCTCTCAGTCCGCGCCGCCACGGC490_up2CTTCAGAACGAGGTGCTCATCAACTACTGCGACATCG490_down2CGTGGTTTTTACCCTGCTCAATAAAGTCACGTTTTCCUL105CCGACAACTGGGTCTTACACGGTGTTGT504_up2CTCCAACGCGCCTGTGGAGGGCCAATCGGACCGCGGG504_down2CAATACAAATAAAAAAAGACGCTGTGACACTTTGGCTUS25AGCTCTCCAAGTGGCTTTCCTGTGCACC511_up2CAGACGGTGCAGGAGTCCGAGGCGGCGGCGACGGCGG511_down2CAATGTCCAAGCGCGTCCTGTTTCATAATTTTTCCGGUL 113CGGCTGCGGGGTTATCTCGGCTCGGTTT520_up2CGCTCCACGGCCTCCGACGAGCGTTGCGCTCGCGCTT520_down2CCCACCAGCGCACCAACACCGCTCGCCTGCTCGCTCGUL 112TGCGCCGCCGCGTCTGCGCTACGGGGGG526_up2CCTACCTGGGACGCGCAGTTGGGCGGCGGACTGGGGC526_down2CTCGAGCCACACGGAGTAGTCGTCCTCACGTTGCTACUL 111aGGCATGCTGCGGTGAAGAGGAAAACTAC530_up2CTCTTTTTTCTTTTTAGTCGATGGAACTTTTCTTCGG530_down2CAAGGATCATATATATCTCGTCAGGGAAATACAAGTTUL108TACGGGTTCTTGTTAGACCATAATGTTG542_up2CCGACATCGGTGACACAGCTTCAGAAACAACGTGTGT542_down2CAAAGACAAATGAGACGCTGAAGGCCGCGATCAGCCTUS 30GGCGCACGCTACTTCCCGTCTCTTTATT543_up2CGTCGGTGTCTCGTCGGTGAGACGAGGCCGCCGCCCG543_down2CCCCCGCAGATATCCGGTTGATGTAGCCAGTCGCCTAUS31ACAAGTTCGATCTCCACGCGACTTATCG544_up2CCGTTGTCATCCGGCTTAGAGCAAACCGTCCTTTTAT544_down2CCACACATCACACGGGGATTTACGCTATGTTGTTTATUS 32CATCTTCCGTCGCCTGTCATGCCGTGTT546_up2CCGCCGTCGGCACTTGGCTTCAGAGCAGCGCCTCGGG546_down2CATCGCGGCACAACGACTGGACGACGTCGTTTACGTAUS 34GCGATGCGACGGCGATTTTAAGAAGAAT557_up2CGTGCGTGGACCAGACGGCGTCCATGCACCGAGGGCA557_down2CAGAGGGGGCGGACACGGGGTTTGTATGAAAAGGCCGUS 28GAACTGGTGCTATCAGGTAGCGCTTTTT558_up2CCGGAAAAGTTTATGGGGAAAAAGACGTAGGAAAGGA558_down2CCGGCACTGTTCTCGAATGGACATGTTTCGTCCGACAUS 29TCATGTAGAAAAACTCGACAGTGCAGCC582_up2CCTTGGCAGAGGACTCCATCGTGTCAAGGACGGTGAC582_down2CTTTACAAATTCACATATACAACAACGCCGTCCCCCGUL124TGCAGAAAAGACCCTGCCCGCAGTTTTT592_up2CGGGAAGACGCAGTGATCCGTCGGTGTCTGCGAGAGT592_down2CGTACTCGTCGTGTCCGTGATCACGTACGTTTTCCAAUL71ACGTTGGCGACTATAACGTGCCAGGCTG626_up2CTTTTTTCCGGATCGGCCCGATTTCTTTTTGTCCACC626_down2CATTTACAGGAACGGGGAAAAAAAAGGCACACGGTCCUL23GACGCGCGACCGCGGTGGGAGACGCGGG627_up2CTTTTTAGAGCAGAACCTTACAGCTTTTTAATAAAAA627_down2CGCGCAGGTAAACAGGTAAGAAATACAAAAAATAACGUL 20aACAAGATAGTCAACTGATTGTGAACGCG639_up2CAAAGAACAAAAAACACCCATCCCAGCGGTACCGTAC639_down2CCACGACCTGCGCCACTCGGACCGCTCCTGCGACCTAUL15CTCGGCGACGCTCCGCTTTCGGATCTCG642_up2CGCAGCGGGAGCAGATGATAACGCAAGAAGCGACCGC642_down2CTACCGCAAAAGCTGTGGCTGCTCTGGCAGCATGACAUL12AGTGGGCCCACAGCAGCACGGCATCGTG650_up2CTTTACCGTACCCAGACAACGGTGCTTTATAGACTCA650_down2CTACTGAGCGTGCGAACCGGGTAGGGTGCCGAACGACUL3TCACTTAAGGCGGGGGGTATGCGTCGTC653_up2CGGATTCTTCTCAGGGCGGCCAGAGCGTGCCGGTATC653_down2CCGTCGGTGTTTTATGCCCCAAGCAGCGTCGTCGTCAUL48TCAACGGATGGAACCTCGTGGCGTCACA655_up2CGCGTCTGGCTGTGTGCCGTTAAATACCTTGGGTGAC655_down2CGATGTAAATAAAATGCTTTTATTTAAAACTGGTCCCUL21GACATCTCGAGGTCAATGTTCTTCGGGA666_up2CGATTCCAAACCGGATACGCTACATACCTGCCACAGT666_down2CGCTATGTTACCACAGGAGATCACGGAACATAAATGTUL2GGGCAGCTTTTACCTTTCTCCGTATGTT670_up2CCGCTTTGTGTATTTAGACGAATCTCGGCGATAACCG670_down2CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGUS 21CCGGCGTTGCCGCCCCGCGGACACGTCG676_up2CCGGAACTGGTTTTCGGACAGAGCAGCCGTTTCCAGA676_down2CTCTCCATGTCGGGACCGCAGCGCCCGGCGGCGTATCUS 15GAACGCAGCGCACCCGCAAGGTCTCGAA679_up2CTTTCGCGCAGCGCGCTTTATCCGACTCGCTGTCGAG679_down2CTGCAGAATCATAAGTTTATGATGAATAAAAACGGGGUS22ACGGCTCCGCCGGCAAAGGGAATCTGCT680_up2CCGTGACCTCGGTGGTGTGCGATACGCAGGACATCCT680_down2CAGCATGGCGACAAGCGCGGCTGCTGTGAAAACGGGCUS 20GCACGACATCGAGTGCGGTTTTATAGGC681_up2CGTTTTCACAGCAGCCGCGCTTGTCGCCATGCTTCAT681_down2CCGTCTTATCAGCACCCGGTTACCGCGGATTTGATTCUS 19GTCGTCCCGCTAGAACGTCACGAGTGTG682_up2CACTGTTTCATCGACGCCTACCTTAGACCGACAGCGG682_down2CGAAGGTGGGGAACGTTTAAGCGAGCAGGAGCGTGTCUS 18TCGTAAGCGGCAGCATCTCCCCCATCTT683_up2CACACTCTATAAACGGTTTTTCATACGCGCCTTTTGA683_down2CATTGGTGGAGACGGCCGGCGCGGCGGGTGGGGGAAAUS 17TCGCCACCGCCGTCCGACGACTTTTTCCUS12684_up2CCCCCACGGATCTCGCGCCTTAGACGCACGGTCATAT684_down2CGCGTTCTCTGGAAACGGCTGCTCTGTCCGAAAACCAUS 16AGCCTCCGGCTGTCGTTCCGAACGAAAA686_up2CAAGACTCCACCGAGACGCTCACCCGTTCACTCGGGC686_down2CGCTTCAGGTACCCGGCAAGTTTTATAGAGAAAGGGGUS 13GCATCACCCGCCTCGACGATGGGTGGTG687_up2CCTCTTTCTCTGCTTCTTTTCTGGGGTGTCTAGCTGG687_down2CAGCAGCGTCAGACGAATCGCGGCTGGTGGCCCTGGGUS 23CGGCCTCTTTTGACGGTGGGACGCGCCG692_up2CCTAATGCCTATAAAACCGCGCCCGTTTTCACAGCAG692_down2CGACGTCACCAGTGTGGTCAAACCGTGGCGGCACCCTUS 19CCGCGCTTGTCGCCGTATCCGACCCGTCUS12FAMILY696_up2CCTGTAGCTTCGAGACCTTGCGGATACGCCGCCGGGC696_down 2CCGAGTGAACGGGTGAGCGTCTCGGTGGAGTCTTCTTUS 14GCTGCGGTCCCGACATAAACCAGCGGAG700_up2CCCTCGCCTATTTAACCTCCACCCACTTCAACACACA700_down2CGCGTGGCGGCGAAATACGCGATCCCTGGGCTGGTAGTRL1CCTGCCGCACAATCATCCCCCTACCCCG710_up2CGGACGAGGACGACGACGTCTGACAAGGAAGGCGAGA710_down2CTATTTGCGTATATGATGACTTGTTCCACCGTCGATGTRL 11ACGTGTTTTGCACCTTGTGTGCGCATCT720_up2CGGGGTGGCGGTAGTGGTGCTGCTGATGGTAGTCGGG720_down2CATACCATGGGACCCCTTTTCGTCACACACGTCTTTCTRL5ACGGAGGAGAGACGCGCTTACTCAACGC735_up2CGAGTTCAGCGTGCCGCTCTTTGCCAACTAGCCTGCG735_down2CGACCCAATAGCAGCCACAACGCCGTCAAGAACGGCGUL130TCACGGGAAATAATTCAGGTTTTTGGGA738_up2CCCATCCCGAGCACTCCACACGCTATAACAGACCACG738_down2CCAAACCTCGGTTTCTTCCTATTCTTAAGTTTTCCCTTRL2GACACGGCAAATGCAGTATATTTGCCTC746_up2CTGCGGCGGCGACGACGACAGCTGCGATTTGTCGGCC746_down2CAGGAAACTGGAGAGAGCCACAACAGAAACAGCGTGGTRL8GACATGCCGATGGTGACTGTCCGCTGTT747_up2CGTGGTCAAAGAAGAGCACCAGCAATCCCAGGAGGAG747_down2CCTGTCCATCTCCCTGTCTTTTCGCGCCGCCGGTCCCTRL9CAACAAGCCCTCACCCCCAAACCATGTC748_up2CGTGCGGGGAGGATCGACGTGTGCGGTGCTTGTGGAA748_down2CAGGGGGGTGCTGTAGGTCTGCATGGTGCAAAACACGTRL10CACGGTGTTTTAATTTCTCGCCTTCCTT755_up2CACACGTCGTTCGCGGACATAACGAGAAATCCACGTC755_down2CCGAGGTGATGGGGCGGGGAAAGAGTTGGAACCGAAAUL132GCCACGTCTCAAGAGACAAAAAAAAAAG758_up2CTTGTGGCTGCTATTGGGTCACAGCCGCGTGCCGCGG758_down2CCTGTAGCAGACTTCGCCGTCCGGACACCGCAGCCTGUL129GTGCGCGCAGAAGATGGATTCATGAAAA773_up2CTAGTGGCGTGCGCGACCCCCAGTCGGTTGAGTTCCG773_down2CTTGTCCTCGGATGCTTTGTGTAGAGAGGAGACAGAAUL90CCAGCAACGAGTTCAAGGGACTCTTATG774_up2CCCAGTGACGCCACGTGTTTCTTGACGCGCCTCAACA774_down2CTTCTGCCGATGCCGGCGTCAGTCGCCGGCACCTGGTUL89ATGCGCCCTTTGACGGCTCTGCTGCGTG778_up2CCGCGCTGCTTTCCCCGAGCTCCGACGCCTCGCGCTC778_down2CGGTGACTCGCCGCTAACCTGCGGTCGTCGCCGTCCTUL 86ACGCCGCCGCCGCGCCTCACCGGACGGC779_up2CCGACGAGATCGCGCGGCTGTCGGCGCTTTTCGTCAT779_down2CCCGTATCGCGCGGACGCCTAGTGTCCGTTTCCCATCUL 84GCTGCGACAGCTGGACCAGGGTTCTCTG780_up2CGCCGCAGAGGGCGCGCCGCTCAGTCGCCTACACCCG780_down2CGTGGACGTGGGTTTTTATAGAGTCGTCCTAAGCGCGUL 83TACGCGCAGGCAGCTGCGCGGCGGGTGG781_up2CCCGTTCACCTTTGCGCATCCCCTGACCCCCCCCCTC781_down2CAAATACAGGGAATGGGAAAAACACGCGGGGGGAAAAUL 82ATCCCGCCTTCGCGCAAAGAAGTCTCTC783_up2CTCGTCCATCGTCATTGTCGTCACCGTCGCTACCCGC781_down2CGCGGCGTTGTACGGCAGCGGGGAGAAAAGTGGCAGAUL79TCACCGAGCGAACGTAAATTACGTCAGG794_up2CCGGTAGTTGCGGCAGAGGGGTTGTTATCTGTCGTTC794_down2CCCGCGCACCGTAAAGTCGAGCACTTGCGGCTCCATGUL104GTTCAACGCGACTGATCATCACATTCTG819_up2CGCCAACCACCACCTGGATCACGCCGCTGAACCCAGC819_down2CATGTCTTTAACTTTCTCTGTCCCTTTTCTCATAAACUL 75GGCGCGGCCGCGCTTGTCAGGTTCTACA823_up2CCACGGCAGACGAGGAGCGGCGCGGCCCAGAGCGTGT823_down2CACTACGTGTTGCGTGTTTTTTTTTCTATGATATGCGUL103CGGCCGATTTCGAATGTCTAGTTCGCTT827_up2CCATCGGCGCGCCCCCATCGCCTCCCGAGCGAGCGGG827_down2CTGTCTCTTTTTTATGTCCATGTCTCCAAGTCTGGTGUL 100CCGCCGCTATCGCCCGGGTGGCGGCGGG832_up2CCCTCTCGCCGCTGCCGCCTAACCTCCGCTCGCACCA832_down2CGTGTTCCTGTCCGGTGCTTAAGAACCTAGTGCACTAUL89CCGCCGCCGCCATCACGGGGTCTGACAG839_up2CGTTGTTCGTCTCCGCTTCTCCTCCGTCGCGGCCACG839_down2CTTGGGGTCGGCGCGTGGCATGCTTGGTGTCTGCGGGUL85ATTTCACCGCCGCTCGCGAGAGGGCCGG851_up2CGCAAGCCAAACCACAAGGCAGACGGACGGTGCGGGG851_down2CTTCTCATGGGAGTTTTTTGTATCGTACTACGACATTUL74TCTCCTCCTCTGTCGCTGTTTCCAGAAC852_up2CCATGTATGCAGGTAAGCAACTGAGCCGAACGCACCT852_down2CTCCTGTGACTTTTTATCATAAACCGTTCCGCCCTGCUL25CAGCAGACGAGAGGTGCTTCGTTCCACC857_up2CCCGCCTAGAACCGCAGTACCAGTACTCCGCATGTCA857_down2CGGGGAAATGGCGACGGGTTCTGGTGCTTTCTGAATAUL33ACAGTACCTGTAACAAGTAACAGGAAAG860_up2CACACACACCACACGTCACGACACCGATCGATTTTCT860_down2CGAAAGCGCTTTTGGGCTCACCCATCTGCAGTCCTGTUL39TTATTCTTAGTGTGTGCCTGAACGAGCA868_up2CATCGACCCGCCCGCCGGCTCGACATCGGTGTCCCTG868_down2CAAAAACGATAAAAAGCCTATTGTTTTTATTACCCGCUL48CCGCCGGCCTCGCCTACTGTCAGTGTCC896_up2CGGCCCGCTCGCACGGACCTATACTATTACCGCCCCA896_down2CAAAACCAGAGCGGAACTTGAGAAATCAACGCTTTATUL34CCGCCGTCGTCGTCTGTTCTCCAGTGAC897_up2CTTCTCAAGTTCCGCTCTGGTTTTGGTTTCGTTTTCA897_down2CTATCAACGTCTCGTCCTGAGACAGACACGTATAAAAUL35AAGGGAGCCCCATCAGAGGAAAACCGCG911_up2CTGTCCTCGTCGGCCGGGTCGCGCGGCCGTTTGGCCA911_down2CGCGCTCCAAAGCGAGCGATGTCGCCCTGGTGGCAGCUL47CCGCGCGCGCGTCCTGGCCTGCGTGACT918_up2CTAGCCCAGGACATTCTTTTTCCGCGTCCTCAATCAG918_down2CAGGGAGCGCAAGGCTGAGCGTCGTTCGCGCGGCGTGUL52CGGCGCCGATCGCCCGCACGCCGCTCAC950_up2CAGTCGGCTACATGCGCCCTGGGTCTGACGCTCCAAA950_down2CTAATGAAACCATCGGATAGTGACGTGTCGGGAAAGGUL31GCGTACGCAGTCTGAGGACGGACGGAGG986_up2CGGAGAGTTGCGACATCAAGCTGCTGGACCCCACGTA986_down2CTGGTGCTGCCGCGGCGCTTGCACTTGGAGCCGGCTTUL53CGTGATAGACAAGTTTCTGCCGTACAGT


Genes essential for replication of HCMV are identified. As set forth in Table 1, the ORFs essential for replication include the following ORFs:

TABLE 1SequenceGeneORFConservationFunctionUL32β-herpesTegumentUL34CMVUnknown (Transcription)UL37.1β-herpes/CMVAnti-ApoptoticUL44CoreDNA replicationUL46CoreCapsidUL48CoreTegumentUL48.5CoreCapsid proteinUL49CoreUnknownUL50CoreEgressUL51CoreDNA packaging/cleavageUL52CoreDNA packaging/cleavageUL53CoreEgressUL54CoreDNA polymeraseUL55CoreGlycoprotein BUL56CoreDNA packaging/cleavageUL57CoressDNA binding proteinUL60CMVUnknown (OriLyt)UL70CoreHelicase/primaseUL71CoreUnknownUL73CoreGlycoprotein NUL75CoreGlycoprotein HUL76CoreUnknownUL77CoreDNA packaging/cleavageUL79CoreUnknownUL80CoreCapsid assemblyUL84β-herpesDNA replicationUL85CoreCapsidUL86CoreCapsidUL87CoreUnknownUL89.1CoreDNA packaging/cleavageUL90CMVUnknownUL91β-herpesUnknownUL92β-herpesUnknownUL93CoreUnknownUL94CoreUnknown (Tegument)UL95CoreUnknownUL96β-herpesUnknownUL98CoreAlkaline nucleaseUL99CoreTegumentUL100CoreGlycoprotein MUL102CoreHelicase/PrimaseUL104CoreDNA packaging/cleavageUL105CoreHelicase/PrimaseUL115CoreGlycoprotein LUL122β-herpesIE2 (transcription)
The sequence conservation indicates whether an ORF is strongly conserved with the core group of herpesviruses, with the β-herpesviruses, or only with cytomegaloviruses. See Table 6 for genes previously identified as essential for replication.


In one embodiment of the invention, a cytomegalovirus comprising a deletion in one or more ORFs essential for replication is provided. As described below, libraries of such cytomegalovirus may also be provided.


In another embodiment of the invention, open reading frames essential for viral growth are targeted by ant-viral drugs designed to treat a cytomegalovirus infection in humans. Screening for such agents may involve contacting a polypeptide encoded by an ORF essential for replication with a candidate agent. Some types of therapeutic agents that may be developed against these identified viral genes may include, but are not limited to, polynucleotide based compounds that target the mRNA transcribed from these essential regions, small molecule compounds designed to inhibit or bind to the protein molecules coded by these essential genes, or recombinant protein based molecules such as monoclonal antibodies which may bind to the protein products encoded by these essential genes.


In one embodiment of the invention, a cytomegalovirus comprising a deletion in one or more ORFs designated as severe to moderate growth defects. Such viruses can be used to construct human cytomegalovirus vaccines. As described below, libraries of such cytomegalovirus may also be provided. The deletion of these genes results in attenuated viral growth in tissue culture ranging from 10-fold less than wild-type to severe growth defect compared to wild-type. These ORFs can be deleted to create an attenuated or weakened virus, which can then be used for vaccination for human cytomegalovirus infection.


Open reading frames identified as non-essential for growth, but which have a severe or moderate growth defect when deleted include the following ORFs:

TABLE 2SEVERE GROWTH DEFECT (12 mutants)GenesConservationFunctionUL21CMVUnknownUL26CMVTegument (transcription)UL28β-herpesUnknownUL30CMVUnknownUL69CoreTegument (transcription)UL82β-herpesTegument (transcription)UL112β-herpesMajor early proteinUL113β-herpesMajor early proteinUL117β-herpesUnknownUL123CMVIE1UL124CMVLatent transcript(ORF 152)Us26β-herpesUnknown









TABLE 3










MODERATE GROWTH DEFECT (23 mutants)











Genes
Conservation
Function







UL2
CMV
Unknown



UL11
CMV
Glycoprotein



UL12
CMV
Unknown



UL14
CMV
Unknown



UL20
CMV
TCR homolog



UL29
β-herpes
Unknown



UL31
β-herpes
Transcription



UL35
β-herpes
Tegument/Transcription



UL38
β-herpes
Unknown



UL47
Core
Tegument-DNA release



UL65
CMV
Unknown (pp67 virion protein)



UL72
Core
dUTPase



UL74
β-herpes
Glycoprotein O



UL88
β-herpes
Tegument



UL97
Core
Protein kinase



UL103
Core
Unknown



UL108
CMV
Unknown



UL114
Core
Uracil DNA glycosylase



UL129
CMV
Unknown



UL132
CMV
Unknown



US13
CMV
Unknown



US23
β-herpes
Unknown



TRS1
CMV
Transcription/egress










In one embodiment of the invention, a cytomegalovirus comprising a deletion in one or more ORFs designated as severe to moderate growth defects. Such viruses can be used to construct human cytomegalovirus vaccines. As described below, libraries of such cytomegalovirus may also be provided. The deletion of these genes results in attenuated viral growth in tissue culture ranging from 10-fold less than wild-type to severe growth defect compared to wild-type. These ORFs can be deleted to create an attenuated or weakened virus, which can then be used for vaccination for human cytomegalovirus infection.


Open reading frames identified as lacking an effect on growth can be deleted for construction of gene therapy vectors. Deletion of growth like wide type genes results in no significant deviation of viral growth from that of wild-type levels. This indicates that these regions can be deleted from the viral genome without affecting viral growth in vitro. Deletion of these genes can make more space in the viral genome to accommodated foreign genes being expressed in a gene therapy procedure. Identification of these wild type-like growth genes presents an advantage over other attenuated dispensable genes in that high-titers of the gene therapy vector can be attained due to the conservation of near to wild-type like growth characteristics in tissue culture.

TABLE 4GROWTH LIKE WILD TYPE (66 mutants, 76 ORFs)GenesConservationFunctionUL3CMVUnknownUL4CMVGlycoproteinUL5CMVUnknownUL6CMVUnknownUL7CMVUnknownUL8CMVUnknownUL10CMVUnknownUL13CMVUnknownUL15CMVUnknownUL16CMVImmunomodulationUL17CMVUnknownUL18CMVMHC homologUL19CMVUnknownUL24β-herpesTegumentUL25β-herpesTegumentUL27β-herpesUnknownUL33β-herpesG protein receptorUL36β-herpesAnti-apoptoticUL37.3β-herpesUnknownUL39CMVUnknownUL42CMVUnknownUL43β-herpes tTegumenUL45CoreRibonucleotide reductaseUL59CMVUnknownUL62CMVUnknownUL64CMVUnknownUL67CMVUnknownUL78CMVG protein receptorUL83β-herpesTegumentUL89.2CoreDNA packaging/cleavageUL109CMVUnknownUL110CMVUnknownUL111aCMVIL-10 homologUL116CMVUnknownUL119CMVFc receptorUL121CMVUnknownUL127CMVUnknownUL130CMVUnknownUL146CMVChemokineUL147CMVChemokine homolog(US1)CMVUnknown(US2)CMVImmunomodulation(US3)CMVImmunomodulation(US6)CMVImmunomodulation(US7)CMVUnknown(US8)CMVImmunomodulation(US9)CMVUnknown(US10)CMVImmunomodulation(US11)CMVImmunomodulation(US12)CMVUnknownUS14CMVUnknownUS15CMVUnknownUS16CMVUnknownUS17CMVUnknownUS18CMVUnknownUS19CMVUnknownUS20CMVUnknownUS21CMVUnknownUS22β-herpesUnknownUS24CMVUnknownUS25CMVUnknownUS27CMVG-protein receptorUS28β-herpesG-protein receptorUS29CMVUnknownUS31CMVUnknownUS32CMVUnknownUS33CMVUnknownUS34CMVUnknownRL1CMVUnknownRL2CMVUnknownRL4CMVEarly proteinRL6CMVUnknownRL9CMVUnknownRL10CMVGlycoproteinRL13CMVUnknown


Virus encoded temperance factors that suppress viral replication are identified as follows:

TABLE 5ENHANCED GROWTH (4 mutants)GenesConservationFunctionUL9CMVUnknownUL20aCMVUnknownUL23β-herpesTegumentUS30CMVUnknown


These ORFs encode repressors of growth that facilitate pathogen temperance. Counterparts of temperance factors can be found in related viruses. The genetic sequence of such temperance factors can be modified to modulate virus replication, e.g. in the development of vaccine strains, for research purposes, and the like. The temperance factor polypeptides are useful as targets for drug design, as targets for immunological agents, and the like. Drugs mimicking or activating growth inhibitors or temperance factors find use in therapies against infectious diseases. Temperance factors may also be cell type specific, affecting viral tropism.


Furthermore, ORFs identified as encoding cell tropism factors can also be deleted in vaccine constructs in order to prevent the vaccine strain from potentially causing disease in specific tissues. For example, ORFs encoding tropism factors for HCMV replication in human retinal epithelial cells can be deleted from the vaccine construct to prevent the possibility that the vaccine may cause HCMV retinitis.


Among the tropism factors are the following: The ORF UL24-deletion mutant grows normally in retinal epithelial cells and fibroblasts, but are significantly defective in growth in endothelial cells. The ORF UL64-deletion mutant grows normally in fibroblasts and endothelial cells, but is significantly growth defective in retinal epithelial cells. The ORF UL10 deletion mutant grows normally in fibroblasts and endothelial cells, but has increased growth relative to wild type in retinal epithelial cells. The ORF UL16 deletion mutant grows normally in retinal epithelial cells and fibroblasts, but has increased growth relative to wild type in endothelial cells.


UL10 and US16 encode cell-type specific functions for virus-growth inhibition. UL24 and UL64 encode cell-type specific functions for viral replication in HMVEC and RPE, respectively.


In one embodiment of the invention, a cytomegalovirus comprising a deletion in one or more ORFs designated as temperance factors. As described below, libraries of such cytomegalovirus may also be provided. In vitro hyper-growth strains having diminished or absent temperance factors can be used for facile production of large quantity of subunit and attenuated live vaccines.


Recombinant Cytomegalovirus

As described in the examples, a collection of viruses having a defined deletion in a single open reading frame are generated. It will be understood by those of skill in the art that various methods can be used to alter virus in a site specific manner. Such mutant viruses are useful in vaccine construction, in testing candidate drugs, investigating growth in different cell types, etc. The mutant virus also provides a basis for further genetic alteration, e.g. in deletion of a second ORF, to add back genetically engineered versions of the deleted ORF, and the like. Of particular interest are sequences of herpesviruses, e.g. alpha-herpesviruses, beta-herpesviruses, etc., particularly cytomegaloviruses, more particularly human cytomegaloviruses.


The panel of viruses may be provided in the form of isolated polynucleotides, in the form of viral particles, in the form of cells comprising the virus polynucleotides, and the like. Where the panel is provided with cells, there may be an array of different cells type, e.g. retinal epithelial cells, fibroblasts, endothelial cells, neural cells, hematopoietic cells, etc. Further, cells may be of one or more species, preferably including human cells.


In one embodiment, a set of recombinant viruses are provided, which set is useful in investigating the effects of drugs, growth conditions, cells, etc. on a variety of mutations. The following sets of viruses may be used individually, or may be combined, e.g. normal growth and enhanced growth, normal growth and growth essential, and the like. Sets of mutant viruses may comprise, without limitation, at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, up to 45 different viruses, each having deletions in unique growth essential genes, as described above. A set of mutant viruses may also comprise, without limitation, at least 2, at least 5, at least 10, at least 12 different viruses, each having deletions in unique severe growth defect genes, as described above. Another set of viruses may comprise, without limitation, at least 2, at least 5, at least 10, at least 15, at least 20, at least 23 different viruses, each having deletions in unique moderate growth defect genes, as described above.


Another virus collection of interest comprises the virus temperance factors, which may comprise 1, 2, 3, or 4 or more viruses having deletions in unique temperance factors. Such a virus collection may further comprise one or more viruses having deletions in unique tropism factors.


Another virus collection of interest includes viruses having deletions in the set of deletions resulting in normal growth. Sets of mutant viruses may comprise, without limitation, at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75 and up to 76 different viruses, each having deletions in unique genes that do not affect growth.


Recombinant viruses may be constructed according to the following methods. Two oligonucleotide primers are constructed to contain: sequences homologous to an antibiotic resistance cassette, a sequence providing a unique barcode tag, a common primer, and a region homologous to the sequence adjacent to either the start or stop codon of the ORF being targeted for deletion. By amplification reactions, a product is having the antibiotic resistance cassette, flanked by homologous sequences targeting the ORF to be deleted. Transformation of a host cell carrying a genetic construct of the CMV genome with the PCR product results in the replacement of the target gene upon selection for antibiotic resistance. The unique barcode sequences are covalently linked to the sequence that targeted them to the HCMV genome, creating a permanent association and genetic linkage between a particular deletion strain and the tag sequence. The ability of the genetically altered virus to cause disease may be tested in one or more experimental models, e.g. using a variety of human cell lines.


Nucleic Acids

The sequences of the provided HCMV Towne strain, the specific identified ORFs genes and recombinant viruses find use in research and therapeutic methods, for the recombinant production of the encoded polypeptide, and the like. The nucleic acids of the invention include nucleic acids having a high degree of sequence similarity or sequence identity to one of the sequences provided in Table 6. Of particular interest are sequences of other viruses, which may include, without limitation, other herpesviruses, e.g. alpha-herpesviruses, beta-herpesviruses, etc. Sequence identity can be determined by hybridization under stringent conditions, for example, at 50° C. or higher and 0.1×SSC (9 mM NaCl/0.9 mM Na citrate). Hybridization methods and conditions are well known in the art, see, e.g., U.S. Pat. No. 5,707,829. Nucleic acids that are substantially identical to the provided nucleic acid sequence, e.g. allelic variants, genetically altered versions of the gene, etc., bind to one of the sequences provided in Table 1 under stringent hybridization conditions. Further specific guidance regarding the preparation of nucleic acids is provided by Fleury et al. (1997) Nature Genetics 15:269-272; Tartaglia et al., PCT Publication No. WO 96/05861; and Chen et al., PCT Publication No. WO 00/06087, each of which is incorporated herein in its entirety.


The sequences can be isolated from suitable sources, or a suitable nucleic acid can be chemically synthesized. Direct chemical synthesis methods include, for example, the phosphotriester method of Narang et al. (1979) Meth. Enzymol. 68: 90-99; the phosphodiester method of Brown et al. (1979) Meth. Enzymol. 68: 109-151; the diethylphosphoramidite method of Beaucage et al. (1981) Tetra. Lett., 22: 1859-1862; and the solid support method of U.S. Pat. No. 4,458,066. Chemical synthesis produces a single stranded oligonucleotide. This can be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. While chemical synthesis of DNA is often limited to sequences of about 100 bases, longer sequences can be obtained by the ligation of shorter sequences. Alternatively, subsequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes.


Coding sequences of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3′ and 5′ untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5′ or 3′ end of the transcribed region. The genomic DNA flanking the coding region, either 3′ or 5′ may contains sequences required for expression.


Probes specific to the nucleic acid of the invention can be generated using the nucleic acid sequence disclosed in Table 1. The probes are preferably at least about 18 nt, 25 nt, 50 nt or more of the corresponding contiguous sequence of one of the sequences provided in Table 1, and are usually less than about 2, 1, or 0.5 kb in length. Preferably, probes are designed based on a contiguous sequence that remains unmasked following application of a masking program for masking low complexity. Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. The probes can be labeled, for example, with a radioactive, biotinylated, or fluorescent tag.


The nucleic acids of the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome. Usually, the nucleic acids, either as DNA or RNA, will be obtained substantially free of other naturally-occurring nucleic acid sequences, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant,” e.g., flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.


The nucleic acids of the invention, including genomes of mutant HCMV, can be provided as a linear molecule or within a circular molecule, and can be provided within autonomously replicating molecules (vectors) or within molecules without replication sequences. The nucleic acids of the invention can be introduced into suitable host cells using a variety of techniques available in the art, such as transferrin polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated DNA transfer, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, gene gun, calcium phosphate-mediated transfection, and the like.


For use in amplification reactions, such as PCR, a pair of primers will be used. The exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other. For hybridization probes, it may be desirable to use nucleic acid analogs, in order to improve the stability and binding affinity. The term “nucleic acid” shall be understood to encompass such analogs.


Polypeptides

Polypeptides encoded by the ORFs identified herein are of interest for screening methods, as reagents to raise antibodies, as therapeutics, and the like. Such polypeptides can be produced through isolation from natural sources, recombinant methods and chemical synthesis. In addition, functionally equivalent polypeptides may find use, where the equivalent polypeptide may contain deletions, additions or substitutions of amino acid residues that result in a silent change, thus producing a functionally equivalent differentially expressed on pathway gene product. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. “Functionally equivalent”, as used herein, refers to a protein capable of exhibiting a substantially similar in vivo activity as the polypeptide encoded by an ORF as provided in Table 1.


The polypeptides may be produced by recombinant DNA technology using techniques well known in the art. Methods which are well known to those skilled in the art can be used to construct expression vectors containing coding sequences and appropriate transcriptional/translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. Alternatively, RNA capable of encoding the polypeptides of interest may be chemically synthesized.


Typically, the coding sequence is placed under the control of a promoter that is functional in the desired host cell to produce relatively large quantities of the gene product. An extremely wide variety of promoters are well-known, and can be used in the expression vectors of the invention, depending on the particular application. Ordinarily, the promoter selected depends upon the cell in which the promoter is to be active. Other expression control sequences such as ribosome binding sites, transcription termination sites and the like are also optionally included. Constructs that include one or more of these control sequences are termed “expression cassettes.” Expression can be achieved in prokaryotic and eukaryotic cells utilizing promoters and other regulatory agents appropriate for the particular host cell. Exemplary host cells include, but are not limited to, E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines. In mammalian host cells, a number of viral-based expression systems may be used, including retrovirus, lentivirus, adenovirus, adeno-associated virus, and the like.


Specific initiation signals may also be required for efficient translation of the genes. These signals include the ATG initiation codon and adjacent sequences. In cases where a complete gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the gene coding sequence is inserted, exogenous translational control signals must be provided. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc.


In addition, a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, etc.


For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the differentially expressed or pathway gene protein may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements, and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines that express the target protein. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the *** protein. A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase, kanamycin resistance, hypoxanthine-guanine phosphoribosyltransferase, and adenine phosphoribosyltransferase genes. Antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418; and hygro, which confers resistance to hygromycin.


The polypeptide may be labeled, either directly or indirectly. Any of a variety of suitable labeling systems may be used, including but not limited to, radioisotopes such as 125I; enzyme labeling systems that generate a detectable colorimetric signal or light when exposed to substrate; and fluorescent labels. Indirect labeling involves the use of a protein, such as a labeled antibody, that specifically binds to the polypeptide of interest. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library.


Once expressed, the recombinant polypeptides can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, ion exchange and/or size exclusivity chromatography, gel electrophoresis and the like (see, generally, R. Scopes, Protein Purification, Springer—Verlag, N.Y. (1982), Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification., Academic Press, Inc. N.Y. (1990)).


As an option to recombinant methods, polypeptides and oligopeptides can be chemically synthesized. Such methods typically include solid-state approaches, but can also utilize solution based chemistries and combinations or combinations of solid-state and solution approaches. Examples of solid-state methodologies for synthesizing proteins are described by Merrifield (1964) J. Am. Chem. Soc. 85:2149; and Houghton (1985) Proc. Natl. Acad. Sci., 82:5132. Fragments of a *** protein can be synthesized and then joined together. Methods for conducting such reactions are described by Grant (1992) Synthetic Peptides: A User Guide, W. H. Freeman and Co., N.Y.; and in “Principles of Peptide Synthesis,” (Bodansky and Trost, ed.), Springer-Verlag, Inc. N.Y., (1993).


Compound Screening

Compound screening may be performed using an in vitro model, a cell infected with a mutant CMV as provided herein, or a panel of cells infected with individual mutant viruses as provided herein, or purified protein corresponding to any one of the provided ORFs. One can identify ligands or substrates that bind to, modulate or mimic the action of the encoded polypeptide.


The polypeptides include those encoded by the ORFs, as well as nucleic acids that, by virtue of the degeneracy of the genetic code, are not identical in sequence to the disclosed nucleic acids, and variants thereof. Variant polypeptides can include amino acid (aa) substitutions, additions or deletions. The amino acid substitutions can be conservative amino acid substitutions or substitutions to eliminate non-essential amino acids, such as to alter a glycosylation site, a phosphorylation site or an acetylation site, or to minimize misfolding by substitution or deletion of one or more cysteine residues that are not necessary for function. Variants can be designed so as to retain or have enhanced biological activity of a particular region of the protein (e.g., a functional domain and/or, where the polypeptide is a member of a protein family, a region associated with a consensus sequence). Variants also include fragments of the polypeptides disclosed herein, particularly biologically active fragments and/or fragments corresponding to functional domains. Fragments of interest will typically be at least about 10 aa to at least about 15 aa in length, usually at least about 50 aa in length, and can be as long as 300 aa in length or longer, but will usually not exceed about 500 aa in length, where the fragment will have a contiguous stretch of amino acids that is identical to the provided polypeptide sequence.


Compound screening identifies agents that modulate function of the HCMV polypeptides. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, e.g. binding assays of a compound to a polypeptide, effect of a compound on HCMV replication, effect on tissue specificity, and the like. Compounds may be assayed for inducing temperance of viral infection, for preventing infection, for preventing replication, etc.


The term “agent” as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of an HCMV polypeptide according to any of the provided growth categories, e.g. growth essential, growth enhancing, and the like. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.


Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.


Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs. Test agents can be obtained from libraries, such as natural product libraries or combinatorial libraries, for example. A number of different types of combinatorial libraries and methods for preparing such libraries have been described, including for example, PCT publications WO 93/06121, WO 95/12608, WO 95/35503, WO 94/08051 and WO 95/30642, each of which is incorporated herein by reference.


Where the screening assay is a binding assay, one or more of the molecules may be joined to a label, where the label can directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin, etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.


A variety of other reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.


Preliminary screens can be conducted by screening for compounds capable of binding to the polypeptide. The binding assays usually involve contacting a polypeptide with one or more test compounds and allowing sufficient time for the protein and test compounds to form a binding complex. Any binding complexes formed can be detected using any of a number of established analytical techniques. Protein binding assays include, but are not limited to, methods that measure co-precipitation, co-migration on non-denaturing SDS-polyacrylamide gels, and co-migration on Western blots (see, e.g., Bennet, J. P. and Yamamura, H. I. (1985) “Neurotransmitter, Hormone or Drug Receptor Binding Methods,” in Neurotransmitter Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89.


Active test agents identified by the screening methods described herein that affect polypeptide activity and/or virus growth can serve as lead compounds for the synthesis of analog compounds. Typically, the analog compounds are synthesized to have an electronic configuration and a molecular conformation similar to that of the lead compound. Identification of analog compounds can be performed through use of techniques such as self-consistent field (SCF) analysis, configuration interaction (Cl) analysis, and normal mode dynamics analysis. Computer programs for implementing these techniques are available. See, e.g., Rein et al., (1989) Computer-Assisted Modeling of Receptor-Ligand Interactions (Alan Liss, New York).


Theraputic/Prophylactic Treatment Methods

Agents that modulate activity of the provided HCMV ORFs provide a point of therapeutic or prophylactic intervention, particularly agents that inhibit replication of the virus. Numerous agents are useful in modulating this activity, including agents that directly modulate expression, e.g. expression vectors, antisense specific for the targeted polypeptide; and agents that act on the protein, e.g. specific antibodies and analogs thereof, small organic molecules that block catalytic activity, etc.


Methods can be designed to selectively deliver nucleic acids to certain cells. When liposomes are utilized, substrates that bind to a cell-surface membrane protein associated with endocytosis can be attached to the liposome to target the liposome to targeted cells and to facilitate uptake.


Antisense molecules can be used to down-regulate expression in cells. The antisense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such antisense molecules as RNA. The antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products. Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance. One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.


Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule. Alternatively, the antisense molecule is a synthetic oligonucleotide. Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. It has been found that short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).


A specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence. Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in vitro or in an animal model. A combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.


Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra. and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.


Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates. Achiral phosphate derivatives include 3′-O′-5′-S-phosphorothioate, 3′-S-5′-O-phosphorothioate, 3′-CH2-5′-O-phosphonate and 3′-NH-5′-O-phosphoroamidate. Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity. The alpha.-anomer of deoxyribose may be used, where the base is inverted with respect to the natural .beta.-anomer. The 2′-OH of the ribose sugar may be altered to form 2′-O-methyl or 2′-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2′-deoxycytidine and 5-bromo-2′-deoxycytidine for deoxycytidine. 5-propynyl-2′-deoxyuridine and 5-propynyl-2′-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.


The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees centigrade; and pressure is at or near atmospheric.


Experimental

Genetic manipulation to generate herpesvirus mutants has been possible through mutagenesis of the viral genome in human cells or maintained as a bacterial artificial chromosome (BAC). A construct, TowneBAC, was produced by inserting a BAC sequence into the HCMV genome (Towne strain) and replacing the dispensable, 10 kb US1-US12 region (Marchini et al. (2001) J Virol 75, 1870-8). The TowneBAC DNA, while maintained as a BAC-based plasmid in E.coli, produces infectious progeny in human fibroblasts and retains wild type growth characteristic in vitro.


The cloned HCMV Towne sequence in the TowneBAC construct was determined (Genbank accession number AY315197) using the shotgun sequencing approach (Venter et al. (1998) Science 280, 1540-2). The Towne sequence present in the TowneBAC construct is predicted to encode 152 unique ORFs, with nine of these present in two copies in the RL elements (FIG. 1). Taking into account the 10 putative ORFs within the deleted US1-US12 region, the Towne strain potentially encodes at least 162 unique ORFs, many of which have homologues in the recently-reanalyzed HCMV AD169 strain genome (Davison et al. (2003) J Gen Virol 84, 17-28).


To systematically analyze the function of each ORF in viral replication, we employed a rapid bacterial homologous recombination system and generated a collection of mutants in E. coli by deleting each of the predicted ORFs from TowneBAC (Lee et al. (2001) Genomics 73, 56-65). Each gene was precisely deleted from the start to stop codons and replaced with a kanamycin resistance cassette (FIG. 2A). Each deletion was verified using PCR screening, restriction digest profiling, and Southern analysis (FIG. 4). In total, 150 of the 152 genes were deleted (Table 1).


The mutant BAC-DNAs were isolated from bacteria and transfected into cultured human foreskin fibroblasts (HFFs). Of the 150 constructed mutants, 105 produced viral progeny, indicating that the mutated genes are not essential for HCMV replication in HFFs. In contrast, 45 mutants did not yield infectious progeny even after repeated transfection and extensive incubation. To further confirm their non-growth phenotype, revertant BAC clones were constructed for several mutants (e.g. ΔUL32) by restoring the deletion with the intact ORF sequence (FIG. 2A, FIG. 4). The rescued mutant (e.g. rescued-UL32) produced progeny and grew as well as the TowneBAC, thereby confirming that deleting the ORF sequence causes the no-growth phenotype (FIGS. 4-5).


Of the 45 essential ORFs in HFFs, 37 had not been previously reported, of which 15 had not even been suggested to be essential based on the studies of other herpesviruses (Table 6). Over 90% of the essential genes are conserved among all herpesviruses (core genes) or β-herpesviruses (Table 6). In contrast, about 70% of the non-essential genes are HCMV-specific and are not conserved among β-herpesviruses.

TABLE 6A list of HCMV Towne strain genes categorized by the growthproperties of their respective deletion mutants in cultured HFFs.Also shown are the sequence conservations of these ORFs with thosein HCMV AD169 strain and other herpesviruses, the genome sequenceof which are currently available5-7,30, and their functions andthe functions of their homologues in other herpesviruses that have beenshown or implicated from previous studies. Although virus mutantswith a deletion in each of the 10 ORFs in the US1-US12 region(marked with parentheses) were not individually constructed, theseORFs are listed as dispensable since they were collectively deletedand were not present in TowneBAC. RL11 and RL12, for whicha deletion mutant were not generated, are not included.GenesConservationFunctionGrowthNO GROWTH (45 mutants)UL32β-herpesTegument¶EssentialUL34CMVUnknown (Transcription)*EssentialUL37.1β-herpes/CMVAnti-Apoptotic*EssentialUL44CoreDNA replication*EssentialUL46CoreCapsid*EssentialUL48CoreTegument*EssentialUL48.5CoreCapsid protein*EssentialUL49CoreUnknown*EssentialUL50CoreEgress*EssentialUL51CoreDNA packaging/cleavage*EssentialUL52CoreDNA packaging/cleavage*EssentialUL53CoreEgress*EssentialUL54CoreDNA polymerase*EssentialUL55CoreGlycoprotein B¶EssentialUL56CoreDNA packaging/cleavage*EssentialUL57CoressDNA binding protein*EssentialUL60CMVUnknown (OriLyt ?)*EssentialUL70CoreHelicase/primase*EssentialUL71CoreUnknown*EssentialUL73CoreGlycoprotein N¶EssentialUL75CoreGlycoprotein H¶EssentialUL76CoreUnknown*EssentialUL77CoreDNA packaging/cleavage*EssentialUL79CoreUnknown*EssentialUL80CoreCapsid assembly¶EssentialUL84β-herpesDNA replication*EssentialUL85CoreCapsid*EssentialUL86CoreCapsid*EssentialUL87CoreUnknown*EssentialUL89.1CoreDNA packaging/cleavage*EssentialUL90CMVUnknown*EssentialUL91β-herpesUnknown*EssentialUL92β-herpesUnknown*EssentialUL93CoreUnknown*EssentialUL94CoreUnknown(Tegument)*EssentialUL95CoreUnknown*EssentialUL96β-herpesUnknown*EssentialUL98CoreAkaline nuclease*EssentialUL99CoreTegument*EssentialUL100CoreGlycoprotein M¶EssentialUL102CoreHelicase/Primase*EssentialUL104CoreDNA packaging/cleavage*EssentialUL105CoreHelicase/Primase*EssentialUL115CoreGlycoprotein L¶EssentialUL122β-herpesIE2(transcription)¶EssentialSEVERE GROWTH DEFECT(12 mutants)UL21CMVUnknown*<2 × 10−4UL26CMVTegument (transcription)*<2 × 10−4UL28β-herpesUnknown*<2 × 10−4UL30CMVUnknown*<2 × 10−4UL69CoreTegument(transcription)¶<2 × 10−4UL82β-herpesTegument(transcription)¶<2 × 10−4UL112β-herpesMajor early protein*<2 × 10−4UL113β-herpesMajor early protein*<2 × 10−4UL117β-herpesUnknown*<2 × 10−4UL123CMVIE1¶<2 × 10−4UL124CMVLatent transcript(ORF152)†<2 × 10−4Us26β-herpesUnknown*<2 × 10−4MODERATE GROWTH DEFECT (23 mutants)UL2CMVUnknown¶10−1-10−2UL11CMVGlycoprotein*10−2-10−3UL12CMVUnknown*10−1-10−2UL14CMVUnknown*10−2-10−3UL20CMVTCR homolog¶10−2-10−3UL29β-herpesUnknown*10−2-10−3UL31β-herpesTranscription*10−2-10−3UL35β-herpesTegument/Transcription*10−2-10−3UL38β-herpesUnknown*10−2-10−3UL47CoreTegument-DNA release¶10−3-10−4UL65CMVUnknown (pp67 virion protein)*10−2-10−3UL72CoredUTPase*10−3-10−4UL74β-herpesGlycoprotein O¶10−3-10−4UL88β-herpesTegument*10−2-10−3UL97CoreProtein kinase¶10−2-10−3UL103CoreUnknown*10−2-10−3UL108CMVUnknown*10−2-10−3UL114CoreUracil DNA glycosylase¶10−3-10−4UL129CMVUnknown*10−2-10−3UL132CMVUnknown*10−2-10−3US13CMVUnknown†10−1-10−2US23β-herpesUnknown*10−2-10−3TRS1CMVTranscription/egress¶10−2-10−3GROWTH LIKE WILD TYPE (66 mutants, 76 ORFs)UL3CMVUnknown¶DispensableUL4CMVGlycoprotein¶DispensableUL5CMVUnknown¶DispensableUL6CMVUnknown¶DispensableUL7CMVUnknown¶DispensableUL8CMVUnknown¶DispensableUL10CMVUnknown¶DispensableUL13CMVUnknown*DispensableUL15CMVUnknown*DispensableUL16CMVImmunomodulation¶DispensableUL17CMVUnknown*DispensableUL18CMVMHC homolog¶DispensableUL19CMVUnknown*DispensableUL24β-herpesTegument*DispensableUL25β-herpesTegument*DispensableUL27β-herpesUnknown*DispensableUL33β-herpesG protein receptor¶DispensableUL36β-herpesAnti-apoptotic¶DispensableUL37.3β-herpesUnknown¶DispensableUL39CMVUnknown*DispensableUL42CMVUnknown¶DispensableUL43β-herpesTegument¶DispensableUL45CoreRibonucleoide reductase¶DispensableUL59CMVUnknown*DispensableUL62CMVUnknown*DispensableUL64CMVUnknown*DispensableUL67CMVUnknown*DispensableUL78CMVG protein receptor¶DispensableUL83β-herpesTegument¶DispensableUL89.2CoreDNA packaging/cleavage*DispensableUL109CMVUnknown*DispensableUL110CMVUnknown*DispensableUL111aCMVIL-10 homolog*DispensableUL116CMVUnknown*DispensableUL119CMVFc receptor*DispensableUL121CMVUnknown*DispensableUL127CMVUnknown¶DispensableUL130CMVUnknown*DispensableUL146CMVChemokine*DispensableUL147CMVChemokine homolog*DispensableIRSCMVTranscription¶Dispensable(US1)CMVUnknown¶Dispensable(US2)CMVImmunomodulation¶Dispensable(US3)CMVImmunomodulation¶Dispensable(US6)CMVImmunomodulation¶Dispensable(US7)CMVUnknown¶Dispensable(US8)CMVImmunomodulation¶Dispensable(US9)CMVUnknown¶Dispensable(US10)CMVImmunomodulation¶Dispensable(US11)CMVImmunomodulation¶Dispensable(US12)CMVUnknown¶DispensableUS14CMVUnknown¶DispensableUS15CMVUnknown*DispensableUS16CMVUnknown*DispensableUS17CMVUnknown*DispensableUS18CMVUnknown*DispensableUS19CMVUnknown*DispensableUS20CMVUnknown*DispensableUS21CMVUnknown*DispensableUS22β-herpesUnknown*DispensableUS24CMVUnknown*DispensableUS25CMVUnknown*DispensableUS27CMVG-protein receptor¶DispensableUS28β-herpesG-protein receptor¶DispensableUS29CMVUnknown*DispensableUS31CMVUnknown*DispensableUS32CMVUnknown*DispensableUS33CMVUnknown*DispensableUS34CMVUnknown*DispensableRL1CMVUnknown*DispensableRL2CMVUnknown*DispensableRL4CMVEarly protein¶DispensableRL6CMVUnknown¶DispensableRL9CMVUnknown¶DispensableRL10CMVGlycoprotein¶DispensableRL13CMVUnknown¶DispensableENHANCED GROWTH(4 mutants)UL9CMVUnknown*1 × 10UL20aCMVUnknown*1 × 10UL23β-herpesTegument*1 × 10US30CMVUnknown*1 × 10
*, results from this study only;

¶, results from this study consistent with those from previous studies4;

†, results from this study not consistent with those from previous studies4.

*Results from this study

¶Results in this study consistent with previous studies4.

†Results in this study different from those in previous studies4.


Based on their growth properties in fibroblasts, viral mutants carrying deletions in nonessential genes were further categorized into four groups: severe growth defect, moderate growth defect, growth like the wild type, and enhanced growth (Table 6). Twelve mutants were classified to have a severe growth defect in HFFs, thereby precluding the generation of sufficient titers for growth studies. Five of these ORFs have unknown functions, while the remaining seven genes are involved in regulating transcription or genome replication (Mocarski, E. S. & Courcelle, C. T. in Fields Virology (eds. Knipe, D. M. & Howley, P. M.) 2629-2673 (Lippincott-William & Wilkins, Philadelphia, Pa., 2001). “Moderate growth defect” mutants reached a peak titer of 10-10,000 times less than TowneBAC after 14 days in a multiple-step growth analysis (e.g. ΔUL132, FIG. 2B). This group contains 23 viral mutants of which 11 of the deleted ORFs have not been characterized, and their functions are currently unknown.


Sixty-six mutants retained growth properties that ranged from wild type levels to less than 10-fold fewer plaque-forming units at 14 days post-infection (e.g. ΔUL27, FIG. 2B). These “growth like wild type” mutants (Table 1) are considered to have deletions in dispensable genes, the majority of which are HCMV specific ORFs.


The mutant group that showed enhanced growth reached a 10-fold greater peak titer than the wild type virus during a 14-day infection (e.g. ΔUS30, FIG. 2B). We found it intriguing that these mutants were capable of reaching higher titers than the wild type virus. While their functions are currently unknown, recent bioinformatic analyses suggest that these ORFs are all either β-herpesvirus or HCMV-specific transmembrane proteins (Rigoutsos et al. (2003) J Virol 77, 4326-44).


Although 66 ORFs are found to be dispensable for viral replication in HFFs, it is possible that these ORFs encode important functions for HCMV infection in vivo, including those involved in immunomodulation. Due to the lack of an animal model for study of HCMV pathogenesis, cultured natural host cells have been used. In vivo, HCMV infects human retinal pigment epithelial (RPE) cells and microvascular endothelial cells (HMVEC), leading to viral-associated retinitis and vascular diseases, respectively. It is conceivable that some of the ORFs, while dispensable for HCMV growth in fibroblasts, are important for supporting viral replication in other cell types.


To test this hypothesis, HMVEC and RPE cells were individually infected with a collection of 15 viral mutants that grew as well as the wild type virus in HFFs. The growth of each virus in HMVEC and RPE cells was compared to the result found in HFFs. Diverse growth phenotypes of these mutants were observed in HMVEC and RPE cells (FIG. 3). For instance, the UL24-deletion mutant grew as well as the TowneBAC in HFFs and RPE cells, but was significantly defective in growth in HMVEC. Another mutant with a UL64 deletion replicated normally in HMVEC and HFFs, but barely produced viral progeny in RPE cells (FIG. 3). Our results suggest that UL24 and UL64 are important for viral replication in HMVEC and RPE, respectively. Interestingly, a UL10 deletion mutant grew normally in HFFs and HMVEC, but reached a 500-fold higher titer than TowneBAC in RPE cells, while a US16 deletion mutant replicated as well as the TowneBAC in HFFs and RPE cells but grew 100-fold better in HMVEC (FIG. 3). These observations imply that UL10 and US16 encode cell-type specific functions for virus-growth inhibition.


Research during the last two decades has collectively shown that the prototype herpesvirus, herpes simplex virus 1, encodes 37 essential genes and 48 nonessential genes. The majority (78%) of the 45 HCMV genes that are essential for replication in HFFs are highly conserved across all herpesviruses, suggesting that these core ORFs may represent the minimal ancestral genome of all herpesviruses. HCMV may have evolved from the progenitor genome through the acquisition of non-essential genes that are responsible for its infection and pathogenesis in various tissues. This hypothesis is supported by the identification of Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus-specific genes that are involved in their unique latent infections. The functional profiling of HCMV genes reported provides a step toward elucidating the role of each gene in viral infection.


Our analysis of the mutant library suggests the presence of viral encoded factors that regulate viral growth in different cell types. The discovery of HCMV encoded factors that repress viral replication on a cell type-specific basis represents a novel discovery in the field of animal viruses. Deletion of distinct ORFs resulted in mutant viruses with enhanced growth in specific cell types (e.g. ΔUS30 in HFFs, ΔUL10 in RPE cells, and ΔUS16 in HMVEC). While the mechanism by which these genes repress viral replication is currently unknown, we speculate that the genes may either directly block CMV growth or activate cellular antiviral machinery to suppress viral replication.


The presence of these growth-repressor factors may initially seem counterproductive from the perspective of the virus, however, their existence is consistent with the observations that HCMV exhibits different growth rates in various cell types. In vivo, these inhibitors may moderate viral loads to levels optimal for transmission, but prevent viral replication from reaching levels that can result in severe tissue damage or host death. Furthermore, they may suppress productive lytic replication to low levels or cease viral replication, thereby facilitating persistent and latent infections. Therefore, these repressor factors may have the effect of enhancing virus survival. This strategy of pathogen temperance may be a fundamental component in a pathogen's repertoire of factors that function to enhance its long term existence.


The presence of such temperance genes in viruses suggests that pathogen temperance is a prevalent survival strategy and present in other higher order organisms with greater genome content. This is consistent with recent observations in infectious organisms where deletion of certain pathogen-encoded factors resulted in a hypervirulent infection in the host (Parish et al. (2003) Infect Immun 71, 1134-40; Cunningham et al. (2001) Science 292, 285-7). Recognition of pathogen temperance may radically alter the way we perceive the emergence of hyper-growth virulent variants from benign pathogens. The underlying mechanism for hypervirulence may be the loss of these temperance factors, as opposed to the acquisition of virulence genes. Accordingly, drugs that mimic or activate temperance factors may lead to effective therapies against infectious diseases. Further studies of pathogen temperance will provide insight into the evolution of new and emerging virulent pathogens and facilitate the development of novel approaches for controlling future epidemics caused by these virulent strains.


Materials and Methods


Virus and cells. HCMV (Towne strain) (ATCC, Manassas, Va.) and human cells (Clonetics Inc. San Diego, Calif.) were propagated as described previously (Marchini et al. (2001) J Virol 75, 1870-8). The TowneBAC, which contains a green fluorescence protein (GFP) expression cassette, was maintained in human cells and in bacterial strains DH10B and DY380 (Lee et al. (2001) Genomics 73, 56-65).


Genomic sequencing and bioinformatic analysis. TowneBAC DNAs were subjected to genome-wide shotgun sequencing analysis at MWG-Biotech, Inc. (High Point, N.C.). The sequence was determined to an average redundancy of more than 10-fold. The sequence database was manually reviewed before depositing it into Genbank (accession number AY315197). ORFs that potentially encode a protein greater than 100 amino acids were predicted using standard genetic codes, following the guidelines as previously described (Davison, supra.), or the manufacturer's suggestions (MWG-Biotech Inc., High Point, N.C.).


Construction of deletion and rescued mutants. To construct the deletion cassettes, two oligonucleotide primers (up1 and dn1) were constructed and contained the following components (from 3′ to 5′): 18 or 19 homologous nucleotides to the antibiotic resistance cassette KanMX4, a 20 nucleotide unique barcode tag, a common 19 nucleotide primer, and a 25 nucleotide region homologous to the first 25 nucleotide adjacent to either the start or stop codon of the ORF being targeted for deletion. The up1 and dn1 primers were used to amplify the KanMX4 cassette, which contains the kanamycin resistance gene, nptl, fused with an efficient bacterial promoter. A second round of PCR using primers bearing 50 bases of homology to the region upstream and downstream of a particular HCMV ORF yielded a product in which the KanMX4 cassette was flanked by 50 nucleotide homologous sequences targeting the ORF to be deleted in the TowneBAC. Transformation of the TowneBAC-bearing DY380 strain with the PCR product resulted in the replacement of the target gene upon selection for kanamycin resistance. The unique 20-mer barcode sequences were covalently linked to the sequence that targeted them to the HCMV genome, creating a permanent association and genetic linkage between a particular deletion strain and the tag sequence.


All predicted ORFs that potentially encode proteins greater than 100 amino acids in size were initially selected for deletion. The deletion cassette was designed to remove the entire coding sequence for a given ORF. Although ˜10% of HCMV ORFs overlapped with each other, the position of the deletions was not adjusted, nor were there any attempts made to avoid essential genes, genes in which a previous deletion had been constructed, or genes with a well-defined function.


To verify the correct integration of the deletion cassette, BAC-DNAs were prepared from kanamycin-resistant clones and subject to PCR screening using the primers for the corresponding deleted ORF. In restriction profiling and Southern analysis, BAC-DNAs were digested with restriction enzymes, separated on agarose gels, transferred onto membranes, and then probed with a [32P]-labeled probe containing both the target ORF and KanMX4 sequence. Only clones with insertions of the cassette, as confirmed by PCR, restriction profiles, and Southern analysis, were further studied.


Construction of rescued BAC mutants was carried out by adapting a two-step homologous recombination approach in E. coli (FIG. 2A), first replacing the kanamycin cassette of the deletion mutants with a tetracycline and streptomycin (tet/str) cassette by selecting tetracycline-resistant clones, and then replacing the tet/str cassette with the intact ORF sequence by selecting streptomycin-susceptible clones. The latter selection takes advantage of the fact that only bacterial clones lacking the str cassette survive in the presence of streptomycin.


Growth analysis of viral mutants in cells. HFFs were electroporated with TowneBAC DNAs, then plated onto six-well plates, and observed for 3-15 weeks for GFP expression and cytopathic effect (CPE). No viral progeny were produced from TowneBAC DNAs containing deletions of essential genes. Mutants that did not reach more than 30% CPE after 15-weeks post-infection were considered to have severe growth defects, and their titers were not sufficient for the multiple-step growth analysis. Flasks of cells infected with mutants that exhibited moderate growth defects or growth like the wild type reached 30-100% CPE at 3-15 weeks post-infection and were used for the preparation of viral stocks.


In multiple-step growth analyses, 1×105 cells were infected in duplicate with different viruses at a multiplicity of infection (MOI) of either 0.05 plaque forming units (PFU) (for HFFs and HMVEC) or 0.25 PFU per cell (for RPE). The cells and medium were harvested at different times post-infection, and viral stocks were prepared by adding an equal volume of 10% skim milk followed by sonication. The titers of the viral stocks were determined in triplicate as described previously.


It is to be understood that this invention is not limited to the particular methodology, protocols, formulations and reagents described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.


It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a complex” includes a plurality of such complexes and reference to “the formulation” includes reference to one or more formulations and equivalents thereof known to those skilled in the art, and so forth.


Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described.


All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing, for example, the cell lines, constructs, and methodologies that are described in the publications which might be used in connection with the presently described invention. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.

Claims
  • 1. A mutant virus comprising a defined deletion of an open reading frame (ORF) as set forth in Table 6.
  • 2. A mutant virus according to claim 1, wherein said virus is human cytomegalovirus.
  • 3. A mutant virus according to claim 1, wherein said ORF encodes a factor essential for virus replication.
  • 4. A mutant virus according to claim 1, wherein said ORF encodes a factor that causes suppression of viral growth.
  • 5. A mutant virus according to claim 1, wherein said ORF encodes a factor that is not required for viral growth.
  • 6. A mutant virus according to claim 1, wherein said ORF encodes a temperance factor.
  • 7. A mutant virus according to claim 1, wherein said virus exhibits enhanced growth relative to wild type virus.
  • 8. A panel comprising two or more individual mutant virus according to claim 1.
  • 9. The panel according to claim 8, wherein said virus is present in a host cell.
  • 10. The panel according to claim 9, wherein each said mutant virus is present in two or more different host cells.
  • 11. A polynucleotide comprising the sequence set forth in SEQ ID NO:1.
  • 12. A virally encoded temperance factor that regulates viral growth.
  • 13. The temperance factor of claim 12, wherein said factor is derived from a herpesvirus.
  • 14. The temperance factor of claim 13, wherein said factor is a HCMV factor.
  • 15. The temperance factor according to claim 14, wherein said factor is encoded by an ORF set forth in Table 5.
  • 16. A method for developing biologically active agents that modulate virus replication, the method comprising: combining a candidate biologically active agent with any one of: (a) a polypeptide encoded by any one of the sequences set forth in Table 6; or (b) a cell comprising a nucleic acid encoding and expressing a polypeptide encoded by any one of the sequences set forth in Table 6; or (c) a mutant virus comprising a defined deletion of an open reading frame (ORF) as set forth in Table 6; determining the effect of said agent on brain tumor induced molecular and cellular changes.
  • 17. The method according to claim 13, wherein said agent is contacted with a panel of cells as set forth in claim 8.
  • 18. The method according to claim 16, wherein said biologically active agent inhibits or increases activity of said polypeptide.
  • 19. The method according to claim 16, wherein said agent inhibits activity of a temperance factor, and increases replication of said virus.
  • 20. The method according to claim 16, wherein said agent increases activity of a temperance factor, and decreases replication of said virus.
  • 21. The method according to claim 16, wherein said agent inhibits activity of a polypeptide set forth in Table 1, and decreases replication of said virus.
  • 22. A method of decreasing replication of HCMV, the method comprising administering an agent that inhibits a factor essential for viral replication identified in Table 1.
  • 23. A method of decreasing replication of HCMV, the method comprising administering an agent that mimics the activity of a temperance factor identified in Table 5.
Provisional Applications (1)
Number Date Country
60490200 Jul 2003 US