DATA PROCESSING, ANALYSIS METHOD OF GENE EXPRESSION DATA TO IDENTIFY ENDOGENOUS REFERENCE GENES

Abstract

Disclosed are data processing and analysis methods for gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in amplifying the identified endogenous reference genes. Introduced with the concepts of “Zero's proportion” and CV, the method allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2,087 genes are first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes is determined by analyzing their expression stability. Of the 2,087 genes, 13 genes show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTS, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

Description

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 24, 2013, is named 84346-CON-301519_ST25.xt and is 8,058 bytes in size.

TECHNICAL FIELD

The present invention relates to a data processing and analysis method of gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes. More particularly, the present invention relates to a data processing and analysis method for identifying novel endogenous reference genes using gene expression data from EST. SAGE and microarray datasets with zero's proportion and coefficient of variation, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

BACKGROUND ART

As many as 50,000-100,000 genes can be found in each human cell, but are selectively used in each cell. Of them, a significant number of genes are involved in basic functions and routine cellular metabolic processes required for the sustenance of the cell. Such genes are called housekeeping genes (hereinafter referred to as “HKG”). In various gene expression analysis methods utilizing the quantification of messenger RNA (hereinafter referred to as “mRNA”) to determine expression levels of specific or multiple genes with the aim of identifying the functions of specific genes, searching for genes directed to specific functions profiling the gene expression of organisms under specific conditions, and describing other biological purposes, endogenous reference genes mean housekeeping genes useful in the normalization of the mRNA level for the relative quantification of genes of interest.

Endogenous reference genes are most widely used to normalize mRNA level for accurate comparison of gene expression between different samples (Vandesompele J et al., Genome Biol 3(7), p. RESEARCH0034, 2002). Endogenous reference genes are usually used in gene expression analysis techniques ranging from conventional reverse transcriptase polymerase chain reaction (hereinafter referred to as “RT-PCR”) to recently developed quantitative real time PCR (hereinafter referred to as “qRT-PCT”), serial analysis of gene expression (hereinafter referred to as “SAGE”) and microarray. Traditional reference genes such as glyceraldehyde-3-phosphate dehydrogenase (hereinafter referred to as “GAPDH”) and β-actin (hereinafter referred to as “ACTB”) have been used without proper validation, assuming that they are expressed at constant levels across different samples, irrespectively cell or tissue type and are not regulated by experimental treatment.

However, it is well known that the expression of traditional reference genes may vary among different tissues and cell types and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states (Bereta and Berets M, Biochem Biophys Res Commun 217(1)363-369, 1995; Tricarico C et a. Anal Biochem 309(2):293-300, 2002; Thellin O et al., J Biotechnol 75(2-3):291-295, 1999; Rubie C et al., Mol Cell Probes 19(2):101-109, 2005; Schmittgen T D and Zakrajaek B A. J Biochem Biophys Methods 46(1-2):69-81, 2000; Zhong H and J Simons W. Biochem Biopbys Res Common 259(3):523-526, 1999; Selvey S et al., Mol Cell Probes 15(5):307-311, 2001; Wu Y Y and LRees J, Acta Derm Venerol 80(1):2-3, 2000; Lee P D et al., Genome Res 12(2):292-297, 2002; Hamalainen H K et al., Anal Biochem 299(1):63-70, 2001). The use of inappropriate reference genes in the relative quantification of gene expression may result in biased expression profile. This concern has already been raised by many researchers (Tricarico C et al., Anal Biochem 309(2):293-300 2002; Dheda K et al., Anal Biochem 344(1):141-143, 2005; de Kok J B et al., Lab invest 85(1):154-159, 2005; Brunner A M et al., BMC Plant Biol 4:14, 2004). Particularly, the selection of proper endogenous reference genes is essential for accurate measurement in qRT-PCR, which is a reliable method for detecting gene expression with high sensitivity and accuracy though accurate normalization, and may not be required in qualitative analysis such as northern blot or conventional RT-PCR (Huggett J et al., Genes Immun 6(4):279-284, 2005).

With the acknowledgement of the importance of the proper validation of traditional reference genes and the identification of more suitable reference genes, a number of studies have been undertaken to select the most suitable genes among commonly used reference genes in specific experimental conditions, or to identify novel genes, which are superior to the traditional gees that are universally used for mRNA quantification. However, most of the previous studies have been focused on the selection (validation) of the most stable genes among commonly used reference genes in specific experimental systems or a given set of limited tissue samples (Goidin D et al., Anal Biochem 295(1):17-21, 2001; Haller P et al., Anal Biochem 335(1): 1-9, 2004; Ohl F et al., J Mol Med 83(12):1014-1024, 2005; Radonic A et al., Biochem Biophys Res Commun 313(4):856-862, 2004). Some programs are now available for identifying the most appropriate genes among multiple reference genes using qRT-PCR results (Vandesompele J ea al, Genome Biol 3(7), p. RESEARCH0034, 2002; Pfaffl M W et al. Biotechnol Let 26(6):509-15, 2004; Andersen C L et al., Cancer Res 64(15):5245-5250, 2004).

In addition, novel endogenous reference genes have been found mostly on the basis of microarray data (Hamalainean H K et al., Anal Biochem 299(1):63-70, 2001; Hoerndli F J et al., Anal Biochem 335(1):30-41, 2004; Czechowski T et al., Plant Physiol 139(1):5-17, 2005; Jin P et al., BMC Genomics, 5(1):55, 2004; Kobayashi M S et al., J. Neurosci Res 76(4):512-518, 2004; Shulzhenko N et al., Biochem Biophys Res Commun 337(1):306-12, 2005). As is well-known, the microarray technique has some problems and limitations (errors) due to the potential for inaccurate cross hybridization between probes and unintended transcripts, the potential for differences in hybridization efficiency between probe seta, and the potential for the incorrect annotation of transcripts (Haverty P M et al., Bioinformatics 20(18):3431-3441, 2004; van Ruissen F et al., BMC Genomics 6:91, 2005). The microarray technique also allows the detection of expression of genes only on the chip, in contrast to expressed sequence tag (hereinafter referred to as “EST”) and SAGE, in which the expulsion profiles of whole transcripts in samples (cDNA libraries) can be measured (van Ruissen F et al., BMC Genomics 691, 2005. The use of gene expression data from different platforms together is expected to complement the limitation of individual platforms. For example, SAGE is far more sensitive than EST for detecting low-abundance transcripts (Sun M et al, BMC Genomics 5(1):1-4, 2004).

Even if an ideal endogenous reference gene does not exist, it is possible to find a more ideal endogenous reference gene applicable to most experimental conditions than traditional reference genes through various, large gene expression data.

Leading to the present invention, intensive and thorough research on accurate comparison of gene expression among different samples, conducted by the present inventors, resulted in the finding that gene expression datasets constructed from microarray data, in addition to EST and SAGE data, are useful in searching for endogenous reference genes, and that novel reference genes identified using the datasets are superior to previously used genes and show more stable expression across a wide range of samples, thus being universally useful for the normalization of gene expression, rather than being limited for use on specific tissue samples or in specific studies.

DISCLOSURE

Technical Problem

Therefore, it is an object of the present invention to provide a method of processing and analyzing gene expression data, with a statistical concept introduced thereinto, to identify endogenous reference genes which are superior to traditional reference genes in terms of expression stability across a wide range of samples, thus being universally useful for the normalization of gene expression, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

Technical Solution

In order to accomplish the above objects, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising: 1) computing expression levels of genes from EST, SAGE and microarray datasets; and 2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero(0)'s proportions thereof.

Also, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

Also there is provided a method for quantifying an expression level of a gene of interest, comprising 1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the a candidate endogenous reference gene with the composition; and 2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

Furthermore, there is provided a method for selecting guide genes, comprising: measuring the candidate endogenous reference genes selected using the method for coefficient of variation (CV); and ranking the endogenous reference genes in an ascending order of CV.

Also, the present invention provides a composition for detecting at least one guide reference gene identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

There is provided a method for quantifying an expression level of a target gene, comprising: 1) synthesizing cDNA from RNA of a subject; 2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and 3) normalizing an expression level of the target gene to that of the candidate endogenous reference gene of step 2).

Moreover, there is provided a method for identifying the amplification of a target gene in genomic DNA, comprising: 1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a subject serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and 2) normalizing an expression level of the target gene to that of the candidate endogenous reference gene.

Advantageous Effects

Introduced with the concepts of ‘Zero's proportion’ and CV, the method of the present invention allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2.087 genes were first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes was determined by analyzing their expression stability. Out of the 2,087 genes 13 genes were found to show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTB, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic view showing a process of identifying endogenous reference genes (ERGs).

FIG. 2 is a graph showing a functional distribution of candidate ERGs classified according to FunCat (Functional Classification Catalogue):

Numeral: numbers of genes

A: protein fate (folding, modification, destination): B: cellular transport, transport facilitation and transport route; C: transcription; D: cellular communication/signal transduction mechanism: E: cell cycle and DNA processing; FP protein synthesis; G: metabolism; H: energy; I: cell fate; J: interaction with cellular environment; K: interaction with environment(systemic); L: organ differentiation: M: development (systemic); N: protein activity regulation; o: tissue differentiation; P: Biogenesis of cellular components; Q: cell rescue, defense and virulence; and R: cell type differentiation.

FIG. 3 shows correlations of gene expression of 2.087 candidates ERG among four datasets [EST (expressed sequence tag). ShortSAGE. LongSAGE and microarray datasets].

FIG. 4 shows correlations of CV (coefficient of variation %) of 2,087 candidates ERGs among four datasets (EST. ShortSAGE. LongSAGE and microarray datasets).

FIG. 5 is a graph showing the comparison of gene expression between the candidate ERGs, selected according to the present invention, and non-candidate ERGs among each dataset:

Box and Whisker plots: expression distribution expressed as natural log value (In):

Bottom surface of box: corresponding to 25% of the total expression level in ascending order, and

Top surface of box: corresponding to 75% of the total expression levels in ascending order.

FIG. 6 shows the comparison of gene expression between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 7 shows the comparison of CV (%) between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 8 is a graph showing mRNA level distributions of the novel and traditional ERGs, determined by real-time PCR, in 48 samples including frozen human tissues and cancer cell lines.

FIG. 9 shows mRNA level distributions, expressed as Cp values determined using real-time PCR, of the novel and traditional ERGs in 48 samples (including frozen human tissues and cancer cell lines) and 60 FFPE (formalin-fixed paraffin-embedded) tissues. In the boxes, the middle lines represent median values of Cp. and the bottom and the top surfaces correspond to 25% and 75% of the total Cp values in ascending order, respectively.

BEST MODE

The terms used herein are defined before embodiments of the present invention are described in detail.

The term “candidate reference gene”, as used herein, is intended to refer to a gene, selected using the method of the present invention, which shows a housekeeping gene (HKG)'s properties of being constitutively expressed across a wide range of tissues.

The term “guide gene”, as used herein, is intended to refer to a gene, selected from among candidate reference genes, which shows as low an expression level and variation in expression level as most transcripts within cells, which is also expressed as “reference gene” or “endogenous reference gene”.

In accordance with an aspect thereof, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising:

1) computing expression levels of genes from EST. SAGE and microarray datasets; and

2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero(0)'s proportions thereof.

Endogenous reference genes (ERG) are most widely used to normalize mRNA levels for an accurate comparison of gene expression between different samples. ERG is usually applied to gene expression analysis, such as RT-PCR (reverse transcriptase polymerase chain reaction), qRT-PCR (quantitative real time PCR), SAGE (serial analysis of gene expression) and microarray. Traditional reference genes, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB), have been used without proper validation, assuming that they are expressed at constant levels across different samples irrespectively the various origins thereof, and we not regulated according to experimental conditions. However, it is well known that the expression of traditional reference genes may differ from one tissue or cell type to another and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states.

In order to search for candidate housekeeping genes (HKG) whose expression is maintained on similar levels in most tissues, first, datasets were constructed using EST and SAGE human gene expression data collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/) and microarray gene expression data obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set. Although the above-mentioned databases were combined to construct new datasets, it should be noted that availability is not limited to the databases. Using the expression data from the datasets, the expression level of a given gene is determined according to the following Mathematical Formulas 1 and 2. The EST (expressed sequence tag) expression levels and the SAGE expression levels of a gene in a given library can be calculated according to Mathematical Formulas 1 and 2, respectively

$〈\mathrm{Mathematical}\mathrm{Formula}1〉$ $\mathrm{ETS}\mathrm{gene}\mathrm{expression}=\frac{\mathrm{No}\mathrm{of}\mathrm{EST}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\mathrm{in}\mathrm{Library}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{ESTs}\mathrm{in}\mathrm{Libaray}}\times 1,000,000$ $〈\mathrm{Mathematical}\mathrm{Formula}2〉$ $\mathrm{Sage}\mathrm{gene}\mathrm{expression}=\frac{\mathrm{No}\mathrm{of}\mathrm{Tags}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\mathrm{in}\mathrm{Library}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tags}\mathrm{in}\mathrm{Libaray}}\times 1,000,000$

In accordance with the present invention, data from the different databases were analyzed to determine their integrity and to identify commonality therebetween. In this regard, the concept of zero (0)'s proportion is introduced to determine the possibility that a given gene might be a housekeeping gene (HKG), which is ubiquitously expressed across most tissues.

$〈\mathrm{Mathematical}\mathrm{Formula}3〉0’s\mathrm{Proportion}=\frac{\mathrm{No}.\mathrm{of}\mathrm{Tissues}\mathrm{with}\mathrm{No}\mathrm{Expression}\mathrm{of}a\mathrm{Given}\mathrm{Gene}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tissues}}$

As expressed by Mathematical Formula 3, zero(0)'s proportion is defined as the ratio of the number of the tissues with no expression of a given gene to the total number of tissues. The lower the 0's proportion is, the higher is the possibility that the given gene might be an HKG. Utilizing the concept of 0's proportion, genes which have low 0's proportions in EST. ShortSAGE, and LongSAGE datasets were sorted, 2.087 genes common to the 3 datasets were selected and categorized as “candidate reference genes” or “candidate ERGs”. The genes which have low 0's proportions refer to genes with 0's proportions less than 0.4 for EST, 0.1 for ShortSAGE, and 0.3 for LongSAGE. The mean gene expression values and CV (%) of the 2,067 candidate reference genes were calculated using another dataset. Affymetrix HG-U133, as well as in EST and SAGE datasets. The expression data of 1,990 UniGene clusters (gene expression data for 5,238 different probe sets, 5317 fragments) corresponding to 2,087 ERGs were obtained.

As a result, a significant correlation of the mean expression values is observed among all of the four datasets (EST (expressed sequence tag). ShortSAGE LongSAGE and microarray dataset)) (see FIG. 3). Correlation analysis on CV showed lower agreement between datasets than on the mean gene expression levels, although a significant correlation was detected (see FIG. 4).

In addition, the candidate ERGs were compared with non-ERGs with regard to gene expression in each dataset. As we expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-ERGs in all of the four datasets (p<0.0001) (see FIG. 5).

In accordance with another aspect thereof, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

The candidate endogenous reference gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 120(PRDX6), Accession No. Hs 142(SULT1A1), Accession No. Hs 202(BZRP), Accession No. Hs 429(ATP5G3), Accession No. Hs 695(CSTB), Accession No. Hs 808(HNRPF), Accession No. Hs 861(MAPK3), Accession No. Hs 1063(SNRPC), Accession No. Hs 1103(TGPB1), Accession No. Hs 2430(TCFL1), Accession No. Hs 2533(ALDH9A1), Accession No. Hs 2795(LDHA), Accession No. Hs 2853(PCBP1), Accession No. Hs 3100(KARS), Accession No. Hs 3254(MRPL23), Accession No. Hs 3353(G3BP), Accession No. Hs 3416(ADFP), Accession No. Hs 439(STOML2), Accession No. Hs 3530(PUSIP1), Accession No. Hs 3989(PLXNB2), Accession No. Hs 4055(KLF6), Accession No. Hs 4742(GPAA1), Accession No. Hs 4747(DKC1), Accession No. Hs 4766(FAM32A), Accession No. Hs 4859(CCNL1), Accession No. Hs 4997(RBM23), Accession No. Hs 4998(TMOD3), Accession No. Hs 5062(TM4SF8), Accession No. Hs 5086(MGC10433), Accession No. Hs 5120(DNCL1), Accession No. Hs 5158(ILK), Accession No. Hs 5245(FLJ20643), Accession No. Hs 5258(MAGED1), Accession No. Hs 5268(ZDHHC4), Accession No. Hs 5298(ADIPOR1), Accession No. Hs 5308(UBA52), Accession No. Hs 5324(C2orf25), Accession No. Hs 5345(RNPEPL1), Accession No. Hs 5662(GNB2L1), Accession No. Hs 5710(CREG1), Accession No. Hs 5719(CNAP1), Accession No. Hs 5912(FBXO7), Accession No. Hs 5947(RAB8A), Accession No. Hs 6396(JTB), Accession No. Hs 6454(RGS19IP1), Accession No. Hs 6459(OPR172A), Accession No. Hs 6551(ATP6AP1), Accession No. Hs 6891(SFRS6), Accession No. Hs 7101(ANAPC5), Accession No. Hs 7236(NOSIP), Accession No. Hs 7476(ATP6V0B), Accession No. Hs 7527(DKFZP566E144), Accession No. Hs 7744(NDUFV1), Accession No. Hs 7753(CALU), Accession No. Hs 7768(FIBP), Accession No. Hs 7862(PNRC2), Accession No. Hs 7910(RYBP), Accession No. Hs 7917(HIG1), Accession No. Hs 8102(RPS20), Accession No. Hs 8372(UQCR), Accession No. Hs 8737(WDR6), Accession No. Hs 8752(TMEM4), Accession No. Hs 8765(DDX42), Accession No. Hs 8859(CANT1), Accession No. Hs 8867(CYR61), Accession No. Hs 9003(FIJ13868), Accession No. Hs 9015(MGC52000), Accession No. Hs 9043(C14orf120), Accession No. Hs 9234(NIFIE14), Accession No. Hs 9235(NME4), Accession No. Hs 9527(C2orf28), Accession No. Hs 9534(SEC11L1), Accession No. Hs 9573(ABCF1), Accession No. Hs 9589(UBQLN1), Accession No. Hs 9788(NDFIP1), Accession No. Hs 9825(CGI-128), Accession No. Hs 9857(DCXR), Accession No. Hs 10326(COPE), Accession No. Hs 10842(RAN. Accession No. Hs 10848(BMS1L), Accession No. Hs 11125(SPCS1), Accession No. Us 11184(UBE2R2), Accession No. Hs 11223(IDH1), Accession No. Hs 11355(TMPO), Accession No. Hs 11463(UMP-CMPK), Accession No. Hs 12013(ABCE1), Accession No. Hs 12084(TUFM), Accession No. Hs 12102(SNX3), Accession No. Hs 12107(BC-2), Accession No. Hs 12109(WDR39), Accession No. Hs 12144(KIAA1033), Accession No. Hs 12152(SRPRB), Accession No. Hs 12272(BECN1), Accession No. Hs 12341(ADAR), Accession No. Hs 12457(NUP133), Accession No. Hs 12865(NSFL1C), Accession No. Hs 13662(MGC5508), Accession No. Hs 14317(NOLA3), Accession No. Hs 14333(FLJ10349), Accession No. Hs 14745(C10orf9), Accession No. Hs 14839(POLR2G), Accession No. Hs 14846(SLC7A1), Accession No. Hs 14894(TGOLN2), Accession No. Hs 15277(C16orf33), Accession No. Hs 15591(COPS6), Accession No. Hs 15738(RAB7), Accession No. Hs 16059(HSPC009), Accession No. Hs 16130(E2-230K), Accession No. Hs 16349(KIAA0431), Accession No. Hs 17118(FLJ11730), Accession No. Hs 17250(MGC4767), Accession No. Hs 17680(FUCA2), Accession No. Hs 17731(FLJ12892), Accession No. Hs 17883(PPM 1G), Accession No. Hs 18069(LGMN), Accession No. Hs 18128(C20orf44), Accession No. Hs 18349(MRPL15), Accession No. Hs 19673(MAF1), Accession No. Hs 20013(P29), Accession No. Hs 20107(KNS2), Accession No. Hs 20157(CDK5RAP3), Accession No. Hs 20521(HRMT1L2), Accession No. Hs 20529(LOC127262), Accession No. Hs 20573(IGF1R), Accession No. Hs 20716(TIMM17A), Accession No. Hs 22393(DENR), Accession No. Hs 22543(UBE3A), Accession No. Hs 22546(CYBASC3), Accession No. Hs 22616(KIAA0664), Accession No. Hs 23033(LOC92912), Accession No. Hs 23111(FARSLA), Accession No. Hs 23978(SAFB), Accession No. Hs 24301(POLR2E), Accession No. Hs 24379(TRAPPC1), Accession No. Hs 24601(FBLN1), Accession No. Hs 24950(RGS5), Accession No. Hs 25155(NET1), Accession No. Hs 25450(SLC29A1), Accession No. Hs 25723(MTVR1), Accession No. Hs 26010(PFKP), Accession No. Hs 26023(FOXJ3), Accession No. Hs 26136(MGC14156), Accession No. Hs 26232(MAN2C1), Accession No. Hs 26403(GSTZ1), Accession No. Hs 26518(TM4SF7), Accession No. Hs 27222(NOLA2), Accession No. Hs 28491(SAT), Accession No. Hs 28914(APRT), Accession No. Hs 29203(GBL), Accession No. Hs 29665(CLSTN1), Accession No. Hs 30011(MGC2963), Accession No. Hs 30026(HSPC182), Accession No. Hs 30345(TRAP1), Accession No. Hs 30954(PMVK), Accession No. Hs 31053(CKAP1), Accession No. Hs 31334(C20orf14), Accession No. Hs 31387(DKFZP564J0123), Accession No. Hs 34045(CDCA4), Accession No. Hs 34576(TAX1BP1), Accession No. Hs 34906(BLOC1S2), Accession No. Hs 35052(TEGT), Accession No. Hs 35828(MARK3), Accession No. Hs 36587(PPP1R7), Accession No. Hs 36927(HSPH1), Accession No. Hs 37616(STRA13), Accession No. Hs 37916(DPP7), Accession No. Hs 42806(Cab45) Accession No. Hs 43297(MTPN), Accession No. Hs 47062(POLR21) Accession No. Hs 50098(NDUFA4), Accession No. Hs 50308(HIP2), Accession No. Hs 50425(TEBP), Accession No. Hs 53066(HSPBP1), Accession No. Hs 54277(FAM50A), Accession No. Hs 54457(CD81), Accession No. Hs 54642(MAT2B), Accession No. Hs 54649(RY1), Accession No. Hs 55682(EIF3S7), Accession No. Hs 55847(MRPL51), Accession No. Hs 58488(CTNNAL1), Accession No. Hs 58992(SMC4L1), Accession No. Hs 59486(HSDL2), Accession No. Hs 61812(PTPN12), Accession No. Hs 65234(DDX27), Accession No. Hs 65238(RNF40), Accession No. Hs 66048(BPY2IP1), Accession No. Hs 66915(C22orf16), Accession No. Hs 68714(SFRS1), Accession No. Hs 9293(HEXB), Accession No. Hs 69554(RNF26), Accession No. Hs 69853(UNR), Accession No. Hs 71465(SQLE), Accession No. Hs 71787(MRPS7), Accession No. Hs 73527(CSNK2B), Accession No. Hs 73722(APEX1), Accession No. Hs 73799(GNAI3), Accession No. Hs 73965(SFRS2), Accession No. Hs 74047(ETFB), Accession No. Hs 74050(FVT1), Accession No. Hs 74137(TMP21), Accession No. Hs 74375(DVL1), Accession No. Hs 74405(YWHAQ), Accession No. Hs 74471(GJA1), Accession No. Hs 74563(OAZ2), Accession No. Hs 74564(SSR2), Accession No. Hs 74576(GDI1), Accession No. Hs 75056(TIMM13), Accession No. Hs 75061(MARCKSL1), Accession No. Hs 75066(TSN), Accession No. Hs 75087(FASTK) Accession No. Hs 75117(ILF2), Accession No. Hs 75133(TFAM), Accession No. Hs 75139(ARPIP2), Accession No. Hs 75189(DAP), Accession No. Hs 75227(NDUFA9), Accession No. Hs 75243(BRD2), Accession No. Hs 75249(ARL6IP), Accession No. Hs 75234(IRP3), Accession No. Hs 75318(TUBA1), Accession No. Hs 75348(PSME1), Accession No. Hs 75438(QDPR), Accession No. Hs 75527(ADSL), Accession No. Hs 75724(COPB2), Accession No. Hs 75798(C20orf111), Accession No. Hs 75841(C12orf8), Accession No. Hs 75890(MBTPS1), Accession No. Hs 75914(RNP24), Accession No. Hs 76111(DAG1), Accession No. Hs 76394(ECHS1), Accession No. Hs 76480(UBL4), Accession No. Hs 76662(ZDHHC16), Accession No. Hs 76686(GPX1), Accession No. Hs 76847(GANAB), Accession No. Hs 77060(PSMB6), Accession No. Hs 77269(GNA12), Accession No. Hs 77313(CDK10), Accession No. Hs 77422(PLP2), Accession No. Hs 77558(HMGN3), Accession No. Hs 77578(USP9X), Accession No. Hs 77793(CSK), Accession No. Hs 77897(SF3A3), Accession No. Hs 77961(HLA-B), Accession No. Hs 77978(DKFZp76112123), Accession No. Hs 78466(PSMD8), Accession No. Hs 78601(UROD), Accession No. Hs 78771(PGK1), Accession No. Hs 78880(ILVBL), Accession No. Hs 78888(DBI), Accession No. Hs 78989(ADH5), Accession No. Hs 79064(DHPS), Accession No. Hs 79081(PPP1CC), Accession No. Hs 79088(RCN2), Accession No. Hs 79101(CCN1), Accession No. Hs 79110(NCL), Accession No. Hs 79322(QARS), Accession No. Hs 79335(SMARCD1), Accession No. Hs 79387(PSMC5), Accession No. Hs 79402(POLR2C), Accession No. Hs 79411(RPA2), Accession No. Hs 79625(C20orf149), Accession No. Hs 80545(RPL37), Accession No. Hs 80919(SYPL), Accession No. Hs 80986(ATP5G1), Accession No. Hs 81328(NFKBIA), Accession No. Hs 81424(SUMO1), Accession No. Hs 81848(RAD21), Accession No. Hs 81964(SEC24C), Accession No. Hs 82201(CSNK2A2), Accession No. Hs 82327(GSS), Accession No. Hs 82719(MGC21416), Accession No. Hs 82793(PSMB3), Accession No. Hs 82887(PPP1R11), Accession No. Hs 82890(DAD1), Accession No. Hs 82916(CCT6A), Accession No. Hs 82927(AMPD2), Accession No. Hs 83190(FASN), Accession No. Hs 83347(AAMP), Accession No. Hs 83383(PRDX4), Accession No. Hs 83734(STX4A), Accession No. Hs 83753(SNRPB), Accession No. Hs 83765(DHFR), Accession No. Hs 83916(NDUPA5), Accession No. Hs 84359(GABARAP), Accession No. Hs 84753(FLJ2442), Accession No. Hs 85155(ZFP36L1), Accession No. Hs 85769(ERBP), Accession No. Hs 85962(DERPC), Accession No. Hs 86131(FADD), Accession No. Hs 87752(MSN), Accession No. Hs 89545(PSMB4), Accession No. Hs 89643(TKT), Accession No. Hs 89649(EPHX1), Accession No. Hs 89781(UBTF), Accession No. Hs 89864(SKIV2L), Accession No. Hs 90061(PGRMC1), Accession No. Hs 90093(HSPA4), Accession No. Hs 90107(ADRM1), Accession No. Hs 90443(NDUPS8), Accession No. Hs 91142(KHSRP), Accession No. Hs 91531(MLLT6), Accession No. Hs 93659(ERP70), Accession No. Hs 93832(LOC54499), Accession No. Hs 95577(CDK4), Accession No. Hs 96530(COX11), Accession No. Hs 96852(FLJ21128), Accession No. Hs 96996(HNRPA0), Accession No. Hs 97616(SH3GL1), Accession No. Hs 97887(RCN1), Accession No. Hs 98751(FUBP3), Accession No. Hs 98791(ACTR1B), Accession No. Hs 102696(MCTS1), Accession No. Hs 102798(PSMA1), Accession No. Hs 103561(ARL6IP4), Accession No. Hs 103834(MGC5576), Accession No. Hs 104839(TIMP2), Accession No. Hs 105547(NPDC1), Accession No. Hs 106185(RALGDS), Accession No. Hs 106876(ATP6V0D1), Accession No. Hs 106909(ANAPC13), Accession No. Hs 107003(CCNB11P1), Accession No. Hs 107101(FLJ31031), Accession No. Hs 107387(C7orf20), Accession No. Hs 107393(C3orf4), Accession No. Hs 108029(SH3BGRL), Accession No. Hs 108080(CSRP1), Accession No. Hs 108371(E2F4), Accession No. Hs 108408(APH-1A), Accession No. Hs 108957(RPS27L), Accession No. Hs 108969(PTD008), Accession No. Hs 109051(SH3BGRL3), Accession No. Hs 109052(C14orf2), Accession No. Hs 109672(SIAT7F), Accession No. Hs 109798(C6orf48), Accession No. Hs 110695(SF3B5), Accession No. HS 110849(ESRRA), Accession No. Hs 111286(MRPS11), Accession No. Hs 111577(ITM2C), Accession No. Hs 111801(ARS2), Accession No. Hs 112058(SIVA), Accession No. Hs 112318(TOMM7), Accession No. Hs 112955(NUDT5), Accession No. Hs 114033(SSR1), Accession No. Hs 114286(CD9), Accession No. Hs 114412(TXNL1), Accession No. Hs 115474(RPC3), Accession No. Hs 115792(EXOSC7), Accession No. Hs 116448(GLS), Accession No. Hs 117176(PABPN1), Accession No. Hs 117715(ST5), Accession No. Hs 118110(BST2), Accession No. Hs 118400(FSCN1), Accession No. Hs 118463(PNPLA2), Accession No. Hs 118638(NME1), Accession No. Hs 118722(FUT8), Accession No. Hs 118964(p66alpha), Accession No. Hs 118983(GSDMDC1), Accession No. Hs 19177(ARP3), Accession No. Hs 119192(H2AFZ), Accession No. Hs 119251(UQCRC1), Accession No. Hs 119591(AP2S1), Accession No. Hs 119598(RPL3), Accession No. Hs 120323(DNAPTP6), Accession No. Hs 121088(NUP153), Accession No. Hs 121549(CDIPT), Accession No. Hs 122363(WIPI-2), Accession No. Hs 122523(SND1), Accession No. Hs 124126(ARPC1A), Accession No. Hs 124147(PBXL11), Accession No. Hs 124246(C10orf119), Accession No. Hs 124366(BBX), Accession No. Hs 125113(CCT8), Accession No. Hs 125867(EVL), Accession No. Hs 125898(GNAS), Accession No. Hs 126497(AEBP2), Accession No. Hs 126774(RAMP), Accession No. Hs 126938(NAPA), Accession No. Hs 127092(DHX38), Accession No. Hs 127249(EAP30), Accession No. Hs 127386(MAMDC2), Accession No. Hs 127764(RAB5C), Accession No. Hs 128065(CTSC), Accession No. Hs 128199(SEPT11), Accession No. Hs 128548WDR1), Accession No. Hs 129634(CINP), Accession No. Hs 129673(EIF4A1), Accession No. Hs 130031(TRIO), Accession No. Hs 130098(DDX23), Accession No. Hs 130293(CROP), Accession No. Hs 130413(TM9SF2), Accession No. Hs 131226(BNIP3L), Accession No. Hs 132497(PRNPIP), Accession No. Hs 132513 HSD17812), Accession No. Hs 133892(TPM1), Accession No. Hs 134074(SLC35E1) Accession No. Hs 134688(PSMD13), Accession No. Hs 135406(CEBPZ), Accession No. Hs 136905(UREB1), Accession No. Hs 136947(RALY), Accession No. Hs 137510(NCOR2), Accession No. Hs 138860(ARHGAP1), Accession No. Hs 139896(MAEA), Accession No. Hs 140452(M6PRBP1), Accession No. Hs 142442(HP1-BP74), Accession No. Hs 143187(DDX49), Accession No. Hs 143766(DRPLA), Accession No. Hs 143873(S100A10), Accession No. Hs 144058(EBSP), Accession No. Hs 144468(MGC3234), Accession No. Hs 144835(EEP1G), Accession No. Hs 144868(VTI1B), Accession No. Hs 144941(MUF1), Accession No. Hs 144949(ZNF313), Accession No. Hs 144980(SCAMP4), Accession No. Hs 145049(PLEKHM2), Accession No. Hs 145442(MAP2K1), Accession No. Hs 145575(UBL3), Accession No. Hs 146070(TPM3), Accession No. Hs 146393(HERPUD1), Accession No. Hs 146602(QP-C), Accession No. Hs 146804(SPIN), Accession No. Hs 146806(CUL1), Accession No. Hs 147433(PCNA), Accession No. Hs 148078(RBAF600), Accession No. Hs 148272(CCM2), Accession No. Hs 148330(ARF4), Accession No. Hs 148340(PTPRG), Accession No. Hs 148670(RHOBTB1), Accession No. Hs 149004(PBXO31), Accession No. Hs 149957(RPS6KA1), Accession No. Hs 149983(PEX14), Accession No. Hs 150107(BIRC6), Accession No. Hs 150540(BC002942), Accession No. Hs 150580(SUI1), Accession No. Hs 150837(TXNDC5), Accession No. Hs 151134(OXA1L), Accession No. Hs 151220(KIAA0992), Accession No. Hs 151413(GMPB), Accession No. Hs 151787(US-116KD), Accession No. Hs 152536(p44S10), Accession No. Hs 153177(RPS28), Accession No. Hs 154023(TXNDC4), Accession No. Hs 154073(SLC35B1), Accession No. Hs 155165(ZFPL1), Accession No. Hs 155218(HNRPUL1), Accession No. Hs 155396(NFE2L2), Accession No. Hs 155829(KIAA0676), Accession No. Hs 156171(PSMC6), Accession No. Hs 156367(RPS29), Accession No. Hs 156667(KIAA1536), Accession No. Hs 157160(MRPS34), Accession No. Hs 157351(PTD004), Accession No. Hs 157379(H2APV), Accession No. Hs 157394(HAGH), Accession No. Hs 159014(PRPF4B), Accession No. Hs 159118(AMD1), Accession No. Hs 159130(RAF1), Accession No. Hs 159161(ARHGDIA), Accession No. Hs 159699(FBXO21), Accession No. Hs 159799(THRAP2), Accession No. Hs 160958(CDC37), Accession No. Hs 161357(PDHB), Accession No. Hs 162032(HBP1), Accession No. Hs 162233(CHD4), Accession No. Hs 162877(PACSIN2), Accession No. Hs 163645(MOCS2), Accession No. Hs 163776(UBE2J I) Accession No. Hs 163893(PICALM), Accession No. Hs 165195(VAPA), Accession No. Hs 166011(CTNND1), Accession No. Hs 166204(PHF1), Accession No. Hs 166463(HNRPU), Accession No. Hs 166924(SEC13L1), Accession No. Hs 166975(SFRS5), Accession No. Hs 167535(SRP54), Accession No. Hs 168073(TRPC4AP), Accession No. Hs 168799(METTL3), Accession No. Hs 16961(DIABLO), Accession No. Hs 169718(CNN2), Accession No. Hs 170107(UQCRFS1), Accession No. Hs 170131(NFIC), Accession No. Hs 170553(CNOT7), Accession No. Hs 170622(CFL1), Accession No. Hs 171626(SKP1A), Accession No. Hs 172550(PTBP1), Accession No. Hs 172755(BRP44L), Accession No. Hs 172928(COL1A1), Accession No. Hs 173024(NYREN18), Accession No. Hs 173162(NOC4), Accession No. Hs 173381(DPYSL2), Accession No. Hs 173464(FKBP8), Accession No. Hs 173611(NDUFS2), Accession No. Hs 173705(LOC401152), Accession No. Hs 173724(CKB), Accession No. Hs 174050(EDF1), Accession No. Hs 174195(IFITM2), Accession No. Hs 175473(AK1), Accession No. Hs 175955(YT521) Accession No. Hs 177530(ATP5E), Accession No. Hs 177766(PARP1), Accession No. Hs 178551(RPL8), Accession No. Hs 178728(MBD3), Accession No. Hs 179986(FLOT1), Accession No. Hs 180141(CFL2), Accession No. Hs 180312(MRPS16), Accession No. Hs 180414(HSPA8), Accession No. Hs 180877(H3F3B), Accession No. Hs 180903(38418-2), Accession No. Hs 180909(PRDX1), Accession No. Hs 180933(CXXC1), Accession No. Hs 181046(DUSP3), Accession No. Hs 181112(MED4), Accession No. Hs 181163(HMGN2), Accession No. Hs 181244(HLA-A), Accession No. Hs 181368(PRPF8), Accession No. Hs 181444(TMEM9), Accession No. Hs 182255(NHP2L1), Accession No. Hs 182626(C22orf5), Accession No. Hs 182885(SLC35B2), Accession No. Hs 183684(EIF402), Accession No. Hs 13706(ADD1), Accession No. Hs 183800(RANGAP1), Accession No. Hs 183850(DCTD), Accession No. Hs 183994(PPP1CA), Accession No. Hs 184062(C20orf24), Accession No. Hs 184211(PMPCB), Accession No. Hs 184233(HSPA9B), Accession No. Hs 184492(ELAVL1), Accession No. Hs 185172(GNB2), Accession No. Hs 185597(SPG7), Accession No. Hs 187199(MALAT1), Accession No. Hs 187635(RPS15A), Accession No. Hs 187763(BRD4), Accession No. Hs 187866(SDFR1), Accession No. Hs 187946(SLC20A1), Accession No. Hs 188501(PAPAH1B2), Accession No. Hs 188614(PLEKHA5), Accession No. Hs 188879(RBM6), Accession No. Hs 188882(NUDT3), Accession No. Hs 189075(PTK9), Accession No. Hs 189119(CXXC5), Accession No. Hs 189329(SMURF1), Accession No. Hs 189716(NDUFAB1), Accession No. Hs 189772(CCT2), Accession No. Hs 190028(GSTO1), Accession No. Hs 190086(MRCL3), Accession No. Hs 190334(RAP1A), Accession No. Hs 190384(COPS4), Accession No. Hs 190722(HSPC142), Accession No. Hs 190904(STRN4), Accession No. Hs 191186(TTC17), Accession No. Hs 191346(SEPT7), Accession No. Hs 191518(DHX9), Accession No. Hs 191987(UBE2J2), Accession No. Hs 192316(CDC2L1), Accession No. Hs 192374(TRA1), Accession No. Hs 192425(EIF3S8), Accession No. Hs 193118(RAI17), Accession No. Hs 193163(BIN1), Accession No. Hs 193491(TUBB6), Accession No. Hs 194329(TCEAL4), Accession No. Hs 194718(ZNF265), Accession No. Hs 195464(FLNA), Accession No. Hs 195642(C17orf27), Accession No. Hs 196983(SSFA2), Accession No. Hs 198281(PKM2), Accession No. Hs 199561(RANBP2), Accession No. Hs 199625(HAX1), Accession No. Hs 200063(HDAC7A), Accession No. Hs 200600(SCAMP3), Accession No. Hs 200804(SDCBP), Accession No. Hs 201253(ch-TOG), Accession No. Hs 201390(WDR45L), Accession No. Hs 201712(GLG1), Accession No. Hs 202011(GK001), Accession No. Hs 202065(VDAC1), Accession No. Hs 202166(HNRPH1), Accession No. Hs 202179(SMN2), Accession No. Hs 203099(KIAA0261), Accession No. Hs 203910(SGTA), Accession No. Hs 204041(AHSA1), Accession No. Hs 204773(MEP50), Accession No. Hs 205163(MRPL3), Accession No. Hs 206500(CTTN), Accession No. Hs 206824(MGC71993), Accession No. Hs 208597(CTBP1), Accession No. Hs 209983(STMN1), Accession No. Hs 210469(ELMO2), Accession No. Hs 210532(KIAA0141), Accession No. Hs 211463(DNM2) Accession No. Hs 211594(PSMC4), Accession No. Hs 211914(NDUFS7), Accession No. Hs 212102(TXNDC7), Accession No. Hs 212395(CIZ1), Accession No. Hs 213061(NUCKS), Accession No. Hs 213470(PSMB7), Accession No. Hs 213541, Accession No. Hs 213666(KIAA0460), Accession No. Hs 213724(SUPT16H), Accession No. Hs 216653(FBXO9), Accession No. Hs 220950(FOXO3A), Accession No. Hs 221847(SLC38A2), Accession No. Hs 222510(DAZAP1), Accession No. Hs 223141(DDX21), Accession No. Hs 224607(SDC1), Accession No. Hs 226007(RDH11), Accession No. Hs 226117(H10), Accession No. Hs 226755(YWHAH), Accession No. Hs 227067(ATAD3A), Accession No. Hs 227253(TOMM70A), Accession No. Hs 227777(PTP4A1), Accession No. Hs 229641(PC4), Accession No. Hs 231295(PITPNC1), Accession No. Hs 231616(HSPC123), Accession No. Hs 232194(KIAA0174), Accession No. Hs 232543(PDCD4), Accession No. Hs 233458(NPYC), Accession No. Hs 233552(CDC2L5), Accession No. Hs 233952(PSMA7), Accession No. Hs 234521(MAPKAPK3), Accession No. Hs 236030(SMARCC2), Accession No. Hs 237536(MGC20781), Accession No. Hs 237971(XTP3TPA), Accession No. Hs 238839(SCYL1), Accession No. Hs 240170(MGC2731), Accession No. Hs 241336(ATPIF1), Accession No. Hs 241543(POLDIP2), Accession No. Hs 241558(ARIH2), Accession No. Hs 241575(GNPTG), Accession No. Hs 241576(DERL1), Accession No. Hs 241579(SERPINH1), Accession No. Hs 242458(SPG21), Accession No. Hs 242947(DGKI), Accession No. Hs 246112(ASCC3L1), Accession No. Hs 246310(ATP5J), Accession No. Hs 246413(CPNE1), Accession No. Hs 246781FBXO11), Accession No. Hs 247077(RHOA), Accession No. Hs 247186(FBS1), Accession No. Hs 247975(HSPD1), Accession No. Hs 248267(MPST), Accession No. Hs 248941(TAF9), Accession No. Hs 49600(DLGAP4), Accession No. Hs 250009(ARL10C), Accession No. Hs 250429(SUPT6H), Accession No. Hs 250758(PSMC3), Accession No. Hs 250899(HSBP1), Accession No. Hs 250905(LOC51234), Accession No. Hs 251531(PSMA4), Accession No. Hs 252457(MVD), Accession No. Hs 252713(TTC15), Accession No. Hs 252967 DKFZp566C0424), Accession No. Hs 253726(PAPOLA), Accession No. Hs 253903(STOM), Accession No. Hs 254042(BAT1), Accession No. Hs 255015(VPS24), Accession No. Hs 255093(PFKL), Accession No. Hs 255932(XRN2), Accession No. Hs 255935(BTG1), Accession No. Hs 255973(CRI1), Accession No. Hs 256301(MGC13170), Accession No. Hs 256549(NUBP2), Accession No. Hs 257008(PLD3), Accession No. Hs 257341(SAV1), Accession No. Hs 57761(SH3BPS), Accession No. Hs 258551(DNPEP), Accession No. Hs 258563(FEZ2), Accession No. Hs 258798 C10orf86), Accession No. Hs 259461(PALM2-AKAP2), Accession No. Hs 260603(PIPSK2B), Accession No. Hs 262823(FLJ10326), Accession No. Hs 265829(ITGA3), Accession No. Hs 268488(KIAA1185), Accession No. Hs 268530(GPS1), Accession No. Hs 268742(C13orf12), Accession No. Hs 268849(GLO1), Accession No. Hs 268939(MATR3), Accession No. Hs 269528(MAK3), Accession No. Hs 269577(PTPRA), Accession No. Hs 269782(GNAQ), Accession No. Hs 269944(MTCH2), Accession No. Hs 270291(ACTN4), Accession No. Hs 270428(SUCLG1), Accession No. Hs 270525(LASS5), Accession No. Hs 270869(ZNP410), Accession No. Hs 271135(ATP5C1), Accession No. Hs 271695(NOB1P), Accession No. Hs 272062(PTPRF), Accession No. Hs 272168(TDE1), Accession No. Hs 272630(ATP6V1D), Accession No. Hs 272927(SEC23A), Accession No. Hs 273077(TMEM14B), Accession No. Hs 274184(TFE3), Accession No. Hs 274772(C15orf15), Accession No. Hs 274873(CARS), Accession No. Hs 275243(S100A6), Accession No. Hs 275775(SEPP1), Accession No. Hs 275865(PCNP), Accession No. Hs 276878(NUP93), Accession No. Hs 277035(MGLL), Accession No. Hs 277517(C11orf2), Accession No. Hs 278186(ARHGEF1), Accession No. Hs 278362(MEA), Accession No. Hs 278426(PDAP1), Accession No. Hs 278429(C9orf78) Accession No. Hs 278500(GNPDA1), Accession No. Hs 278569(SNX17), Accession No. Hs 278573(CD59), Accession No. Hs 278721(SLC39A7), Accession No. Hs 279061(C17orf25), Accession No. Hs 279245(TACC1), Accession No. Hs 279257(PCMT1), Accession No. Hs 279413(POLD1), Accession No. Hs 279529(PX19), Accession No. Hs 279583(DREV1), Accession No. Hs 279623(SEPX1), Accession No. Hs 279640(TPR), Accession No. Hs 279652(MRPLA), Accession No. Hs 279669(TUBG1), Accession No. Hs 279696(SUMF2), Accession No. Hs 279806(DDX5), Accession No. Hs 79836(COMMD9), Accession No. Hs 279920(YWHAB). Accession No. Hs 279929(TMED9), Accession No. Hs 80202(SBF1), Accession No. Hs 280342(PRKAR1A), Accession No. Hs 280378(SNRPB2), Accession No. Hs 282410(CALM1), Accession No. Hs 282700(SPCS2), Accession No. Hs 282901(RNPC2), Accession No. Hs 282998(RBM9), Accession No. Hs 283111(C14orf124), Accession No. Hs 283454(BNIP2), Accession No. Hs 283521(RHEB), Accession No. Hs 283610(APG4B), Accession No. Hs 283652(IDI1), Accession No. Hs 283739(UBQLN4), Accession No. Hs 284208(ANKRD25), Accession No. Hs 284279(HMOX2), Accession No. Hs 284286(MRPS24), Accession No. Hs 284491(PDXK), Accession No. Hs 285354(MAX), Accession No. Hs 285976(LASS2), Accession No. Hs 286221(ARF1), Accession No. Hs 286226(MYO1C), Accession No. Hs 288193(KPNA4), Accession No. Hs 288856(PPDN5), Accession No. Os 288969(HSCARG), Accession No. Hs 289008(C6orf58), Accession No. Hs 289092(COTL1), Accession No. Hs 289123(DCTN2), Accession No. Hs 289271(CYC1), Accession No. Hs 290243(GBF1), Accession No. Hs 290404(SLC25A3), Accession No. Hs 290758(DDB1), Accession No. Hs 291587(ARID1B), Accession No. Hs 292026(EIF4E2), Accession No. Hs 292063(EIF4B), Accession No. Hs 292078(LARP), Accession No. Hs 292265(ZMYND11), Accession No. Hs 292437. Accession No. Hs 292493(G22P1), Accession No. Hs 292524(CCNH), Accession No. Hs 292579(PTDSS1), Accession No. Hs 293563(FLJ12666), Accession No. Hs 295917(ATP6V1B2), Accession No. Hs 297324(TIMP3), Accession No. Hs 298198(CKLFSF3), Accession No. Hs 298280(ATP5A1), Accession No. Hs 298654(DUSP6), Accession No. Hs 299002(FBL), Accession No. Hs 299035(GDI2), Accession No. Hs 300141(RPL39), Accession No. Hs 300684(RCP9), Accession No. Hs 300772(TPM2), Accession No. Hs 300816 RAB1B), Accession No. Hs 300834(GALNT2), Accession No. Hs 301404(RBM3), Accession No. Hs 301412(Ufc1), Accession No. Hs 302742(MRPS6), Accession No. Hs 302903(UBE21), Accession No. Hs 303676(G3BP2), Accession No. Hs 304192(DSTN), Accession No. Hs 304682(CST3), Accession No. Hs 306123(MAGEF1), Accession No. Hs 306242(RANBP9), Accession No. Hs 306329(ZA20D3), Accession No. Hs 306425(IBTK), Accession No. Hs 308122(ITPK1), Accession No. Hs 308340(NUP188), Accession No. Hs 308709(ORP58), Accession No. Hs 309090(SFRS7), Accession No. Hs 309231(C6orf153), Accession No. Hs 309641(RNF11), Accession No. Hs 309753(STARD3NL), Accession No. Hs 309849(C14orf159), Accession No. Hs 310542(TOMM40), Accession No. Hs 310645(RAB1A), Accession No. Hs 311072(MRPS35), Accession No. Hs 311346(CMAS), Accession No. Hs 311609(DDX39), Accession No. Hs 311640(RPS27A), Accession No. Hs 312098(ADAM15), Accession No. Hs 313847(TXNDC1), Accession No. Hs 314263(BAZ2A), Accession No. Hs 314339(EIF3S12), Accession No. Hs 315177(IFRD2), Accession No. Hs 315230(GC20), Accession No. Hs 319334(NASP), Accession No. Hs 321391(MGC4549), Accession No. Hs 321541(RAB11A), Accession No. Hs 323363(APG9L1), Accession No. Hs 323489(FLJ20758), Accession No. Hs 324250(NDUPB2), Accession No. Hs 324844(VKORC1), Accession No. Hs 325650(EHD2), Accession No. Hs 326387(MORF4L2), Accession No. Hs 330384(CORO1C), Accession No. Hs 331431(SCC-12), Accession No. Hs 333388(EEF1D), Accession No. Hs 333579(HSPC152), Accession No. Hs 333786(PSMA2), Accession No. Hs 333823(MRPL13), Accession No. Hs 334017(K-ALPHA-1), Accession No. Hs 334479(TRAF7), Accession No. Hs 334534(GNS), Accession No. Hs 334587(RBPMS), Accession No. Hs 334713(BMSC-UbP), Accession No. Hs 334851(LASP1), Accession No. Hs 334868(PPP2R5E), Accession No. Hs 335003(ANKRD11), Accession No. Hs 335057(SEPT2), Accession No. Hs 335163(KIAA1102), Accession No. Hs 335918(FDPS), Accession No. Hs 337295(STIP1), Accession No. Hs 337766(TXNRD1), Accession No. Hs 339278(COPB), Accession No. Hs 339639(COX7A2L), Accession No. Hs 339697(GRINA), Accession No. Hs 343911(E124), Accession No. Hs 345694(KCMF1), Accession No. Hs 346868(EBNA1BP2), Accession No. Hs 348418(DR1), Accession No. Hs 349656(SCARB2), Accession No. Hs 350194(ZMAT2), Accession No. Hs 350229(CASC3), Accession No. Hs 350268(IRF2BP2), Accession No. Hs 350364(C9orf100S), Accession No. Hs 350927(SLC25A6), Accession No. Hs 351099(FLJ10241), Accession No. Hs 351296(LOCS1035), Accession No. Hs 351316(TM4SF1), Accession No. Hs 351474(PAQR4), Accession No. Hs 351680. Accession No. Hs 351875(COX6C), Accession No. Hs 352341(STCH), Accession No. Hs 352656(GHITM), Accession No. Hs 352768(PSMB1), Accession No. Hs 354056(POR), Accession No. Hs 355141(TNIP1), Accession No. Hs 355606(MGC23909), Accession No. Hs 355643(RNPS1), Accession No. Hs 355708(FL20507), Accession No. Hs 355750(MGC5306), Accession No. Hs 355753(DKFZp86M1819), Accession No. Hs 355867(MARS), Accession No. Hs 355927(VDAC2), Accession No. Hs 355934(SFPQ), Accession No. Hs 355983(BZW1), Accession No. Hs 356061(MAP1LC3B), Accession No. Hs 356096(FLJ10350), Accession No. Hs 356190(UBB), Accession No. Hs 356270(SDHD), Accession No. Hs 356285(HMGN1), Accession No. Hs 356331(PPIA), Accession No. Hs 356366(RPS2), Accession No. Hs 356371(RPL28), Accession No. Hs 356377(LOC149603), Accession No. Hs 356467(MGC2747), Accession No. Hs 356501(PHF6), Accession No. Hs 356502(RPLP1), Accession No. Hs 356549(SNRPD3), Accession No. Hs 356630(NUTF2), Accession No. Hs 356647(SNX6), Accession No. Hs 356654(PSMC1), Accession No. Hs 567660, Accession No. Hs 356769(MAN2B1), Accession No. Hs 356799, Accession No. Hs 357901(SOX4), Accession No. Hs 362728(SEP15), Accession No. Hs 365116(U2AF1), Accession No. Hs 368084(LRPPRC), Accession No. Hs 368149(CCT7), Accession No. Hs 368157(PYGB), Accession No. Hs 368240(DYRK1A), Accession No. Hs 68264(PPP2R5C), Accession No. Hs 368376(SRPR), Accession No. Hs 368402(LOCS1337), Accession No. Hs 368404(EXT2), Accession No. Hs 368525(PDLIM1), Accession No. Hs 368598(LEREPO4), Accession No. Hs 368934(MGC40157), Accession No. Hs 368985(TRIP12), Accession No. Hs 369017(RAB2), Accession No. Hs 369052(SELT), Accession No. Hs 369068(DNCLI2), Accession No. Hs 369125(PSMD14), Accession No. Hs 369285(DKLZP4341B168), Accession No. Hs 369356(MLL5), Accession No. Hs 369606(CPSF6), Accession No. Hs 369607(GAK), Accession No. Hs 369614(COPS2), Accession No. Hs 369615(FIJ20551), Accession No. Hs 369761(DAZAP2), Accession No. Hs 369785(MGC2749), Accession No. Hs 369920(RAP1B), Accession No. Hs 370024(SEC31L1), Accession No. Hs 370247(APLP2), Accession No. Hs 370292(BCCIP), Accession No. Hs 370312(FNTA), Accession No. Hs 370408(COMT), Accession No. Hs 370581(CAP1), Accession No. Hs 370770(XPO1), Accession No. Hs 370771(CDKN1A), Accession No. Hs 370895(RPN2), Accession No. Hs 370927(PRO1855), Accession No. Hs 370937(TAPBP), Accession No. Hs 371001(EIF3S9), Accession No. Hs 371416(CARM1), Accession No. Hs 371563(RAB14), Accession No. Hs 371788(DKPZP547E1010), Accession No. Hs 371889(ATP1A1), Accession No. Hs 372003(C9orf10), Accession No. Hs 372050(SMAP-5), Accession No. Hs 372286(CUL3), Accession No. Hs 372331(SPTAN1), Accession No. Hs 372541(KBTBD2), Accession No. Hs 372616(ARL1), Accession No. Hs 372914(NDRG1), Accession No. Hs 373550(TGIF), Accession No. Hs 373741(HM13), Accession No. Hs 373763(HNRPR), Accession No. Hs 373952(CAMTA2), Accession No. Hs 373959(VGLL4), Accession No. Hs 374043(ASXL1), Accession No. Hs 374257(SIAT4A), Accession No. Hs 374378(CKS1B), Accession No. Hs 374477(EWSR1), Accession No. Hs 374503(MORF4L1), Accession No. Hs 374588(RPL17), Accession No. Hs 374596(TFT1), Accession No. Hs 374650(IFITM3), Accession No. Hs 374973(PRPF4), Accession No. Hs 375001(TLN1), Accession No. Hs 375108(CD24), Accession No. Hs 375217(RNF31), Accession No. Hs 376046(BTN3A2), Accession No. Hs 376933(GUK1), Accession No. Us 377155(LYRIC), Accession No. Hs 378103(RPS5), Accession No. Hs 378532(HBS1L), Accession No. Hs 378808(eIF2A), Accession No. Hs 380403(PCGF4), Accession No. Hs 380774(DDX3X), Accession No. Hs 380953(RPL38). Accession No. Hs 380973(SUMO2), Accession No. Hs 381008(HLA-E), Accession No. Hs 381058(KIAA016), Accession No. Hs 381072(PPIF), Accession No. Hs 381123(RPL21), Accession No. Hs 381126(RPS14), Accession No. Hs 381189(CBX3), Accession No. Hs 381219. Accession No. Hs 381256(GLTP), Accession No. Hs 382044(MRPS2), Accession No. Hs 382168(NCOA3), Accession No. Hs 385913(ANP32E), Accession No. Hs 385986(UBE2B). Accession No. Hs 386434(ANXA7), Accession No. Hs 386465(CHERP), Accession No. Hs 386939(USP7), Accession No. Hs 387208(FAU), Accession No. Hs 387804(PABPC1), Accession No. Hs 388034(RXRB), Accession No. Hs 38864(ATP6V1G1) Accession No. Hs 388664(RPL11), Accession No. Hs 388739(XRCC5), Accession No. Hs 388927(YY1), Accession No. Hs 388956(C19orf22), Accession No. Hs 389037(MCM3APAS), Accession No. Hs 389107(ATP6V0C), Accession No. Hs 389171(PINK1), Accession No. Hs 389649(DDX48), Accession No. Hs 389734(TCEAL8), Accession No. Hs 389996(CHCHD2), Accession No. Hs 390667(OSTK1), Accession No. Hs 393201(ACTR2), Accession No. Hs 395482(PTK2), Accession No. Hs 396644(PAIP2), Accession No. Hs 396740(NIP30), Accession No. Hs 396783(SLC9A3R1), Accession No. Hs 397609(RPS16), Accession No. Hs 399800(AKAP8L), Accession No. Hs 400295(RPL30), Accession No. Hs 401509(RBM10), Accession No. Hs 401903(COX5A), Accession No. Us 401929(RPL10), Accession No. Hs 403917(STK24), Accession No. Hs 404056(EIF3S1), Accession No. Hs 404321(GARS), Accession No. Hs 405144(SFRS3), Accession No. Hs 405410(OGT), Accession No. Hs 405514(LOC284058), Accession No. Hs 405590(EIF3S6), Accession No. Hs 405880(MRPS21), Accession No. Hs 405942(LOC339229), Accession No. Hs 406062(NDUFA11), Accession No. Hs 406068(UBE2M), Accession No. Hs 406096(ZA20D2), Accession No. Hs 406277(SF3A1), Accession No. Hs 406300(RPL23), Accession No. Hs 406423(SF3B2), Accession No. Hs 406510(ATP5B), Accession No. Hs 406520(LOC389541), Accession No. Hs 406534(HMG20B), Accession No. Hs 406590(PGR1), Accession No. Hs 406620(RPS10), Accession No. Hs 406683(RPS15), Accession No. Hs 406799(RAB18), Accession No. Hs 406840(SLC35A4), Accession No. Hs 407368(C19orf13), Accession No. Hs 407580(PKP4), Accession No. Hs 407995(MIF), Accession No. Hs 408018(RPL36), Accession No. Hs 408073(RPS6), Accession No. Hs 408236(TXNL5), Accession No. Hs 408257(NDUFS6), Accession No. Hs 408293(KAB), Accession No. Hs 408324(FLJ10769), Accession No. Hs 408428(CHES1), Accession No. Hs 408581(SVIL), Accession No. Hs 408909(GOLPH3), Accession No. Hs 409140(ATP5O), Accession No. Hs 409223(SSR4), Accession No. Hs 409230(AGPAT1), Accession No. Hs 409834(PHPT1), Accession No. Hs 410197(NDH30), Accession No. Hs 410596(HAN11), Accession No. Hs 410817(RPL13), Accession No. Hs 411480(AUP1), Accession No. Hs 411641(EIF4EBP1), Accession No. Hs 411847(MAPK6), Accession No. Hs 412103(EFHA1), Accession No. Hs 412117(ANXA6), Accession No. Hs 412196(ESRRBL1), Accession No. Hs 412433(ALP), Accession No. Hs 412468(KLHDC3), Accession No. Hs 412842(C10orf7), Accession No. Hs 413036(WBSCR22), Accession No. Hs 413482(C21orf33), Accession No. Hs 414579(SCOTIN), Accession No. Hs 415342(KIAA1049), Accession No. Hs 416049(TNPO2), Accession No. Hs 416436(TRIM50A), Accession No. Hs 417004(S100A11), Accession No. Hs 417029(DERP6), Accession No. Hs 418123(CTSL), Accession No. Hs 418175(VPS28), Accession No. Hs 418233(MRPL24), Accession No. Hs 418450(MRPL11), Accession No. Hs 418533(BUB3), Accession No. Hs 418668(ATP5D), Accession No. Hs 419640(PARK7), Accession No. Hs 420269(COL6A2), Accession No. Hs 420272(H2AFY), Accession No. Hs 421257(RPL7), Accession No. Hs 421509(CCT4), Accession No. Hs 422113(ZNF511), Accession No. Hs 423935(RDBP), Accession No. Hs 423968(TTC11), Accession No. Hs 424126(SERF2), Accession No. Hs 424908(LSM5), Accession No. Hs 425777(UBE2L6), Accession No. Hs 426296(C10orf104), Accession No. Hs 426359(DKFp564J157), Accession No. Hs 429052(ITGB1), Accession No. Hs 429353(SEPN1), Accession No. Hs 429581(RTN4), Accession No. Hs 429819(PITPNA), Accession No. Hs 429839(MGC23908), Accession No. Hs 430425(GNB1), Accession No. Hs 430551(IQGAP1), Accession No. Hs 430606(CS), Accession No. Hs 430657(ARF5), Accession No. Hs 430733(CLNS1A), Accession No. Hs 431101(GNG12), Accession No. Hs 431367(C6orf55), Accession No. Hs 431498(FOXPI), Accession No. Hs 431550(MAP4K4), Accession No. Hs 431668(COX6B1), Accession No. Hs 431850(MAPK1), Accession No. Hs 431861(PPP5C), Accession No. Hs 431926 NFKB1), Accession No. Hs 432121(PRDX2), Accession No. Hs 432438(EML4), Accession No. Hs 432491(ESD), Accession No. Hs 432690(SLC39A9), Accession No. Hs 432760(CAPZB), Accession No. Hs 432898(RPL4), Accession No. Hs 432976(NRIH2), Accession No. Hs 433154(PISCR3), Accession No. Hs 433201(CDK2AP1), Accession No. Hs 433222(NPC2), Accession No. Hs 433291(ARD1), Accession No. Hs 433307(BCKDHA), Accession No. Hs 433343(SRRM2), Accession No. Hs 433345, Accession No. Hs 433419(COX411), Accession No. Hs 433512(ACTR3), Accession No. Hs 433529(RPS11), Accession No. Hs 433540(DNAJC8), Accession No. Hs 433573(Bles03), Accession No. Hs 433615(TUBB2), Accession No. Hs 433701(RPL37A), Accession No. Hs 433722(K1AA1967), Accession No. Hs 33732(CLK1), Accession No. Hs 433750(EIF4G1), Accession No. Hs 433759(BANF1), Accession No. Hs 433795(SHC1), Accession No. Hs 433863(PBP), Accession No. Hs 433901(COX8A), Accession No. Hs 433951(GPX4), Accession No. Hs 434102(HMGB1), Accession No. Hs 434207(HARS2), Accession No. Hs 434219(ANKHD1), Accession No. Hs 434401(ZNP638), Accession No. Hs 434937(PPIB), Accession No. Hs 434953(HMGB2), Accession No. Hs 434980(APP), Accession No. Hs 435044(TBC1D22A), Accession No. Hs 435064(KIAA1608), Accession No. Hs 435120(KIF1C), Accession No. Hs 435136(TXN), Accession No. Hs 435166(LBR), Accession No. Hs 435231(ZFR), Accession No. Hs 435255(UBXD1), Accession No. Hs 435326(ACTL6A), Accession No. Hs 435512(PFP3CA), Accession No. Hs 435535(ZNF395), Accession No. Hs 435610(WAC), Accession No. Hs 435741(GCSH), Accession No. Hs 435759(THAP4), Accession No. Hs 435771(API5), Accession No. Hs 435841(TNRC15), Accession No. Hs 435850(LYPLA1), Accession No. Hs 435933(PHF10), Accession No. Hs 435948(ATAD1), Accession No. Hs 435952(CDK5RAP1), Accession No. Hs 435974(MTHFD1), Accession No. Hs 436035(TUBA6), Accession No. Hs 436093(BAT2), Accession No. Hs 4362041ZNF289), Accession No. Hs 436298(EMP1), Accession No. Hs 436405(IDH3B), Accession No. Hs 436437(ALDH2), Accession No. Hs 436446(ARMET), Accession No. Hs 436500(DBNL), Accession No. Hs 436568(CD74), Accession No. Hs 436578(POLR2F), Accession No. Hs 436657(CLU), Accession No. Hs 436687(SET), Accession No. Hs 436803(VBP1), Accession No. Hs 437056(SUPT5H), Accession No. Hs 437060(CYCS), Accession No. Hs 437110(ANXA2), Accession No. Hs 437178(ACADVL), Accession No. Hs 437256(GRINL1A), Accession No. Hs 437277(MGAT4B), Accession No. Hs 437367(GBAS), Accession No. Hs 437388(PIGT), Accession No. Hs 437403(PP), Accession No. Hs 437594(RPLP2, Accession No. Hs 437638(XBP1), Accession No. Hs 437779(C11orf10), Accession No. Hs 437831(C14orf32), Accession No. Hs 438072(UNC84A), Accession No. Hs 438219(GPS2), Accession No. Hs 438429(RPS19), Accession No. Hs 438678(TALDO1), Accession No. Hs 438720(MCM7), Accession No. Hs 438970(TBL1XR1), Accession No. Hs 438974(CUTL1), Accession No. Hs 439480(RBM5), Accession No. Hs 439481(SUPT4H1), Accession No. Hs 439548(FLJ22875), Accession No. Hs 439552, Accession No. Hs 439815(HBXIP), Accession No. Hs 440382(RFP), Accession No. Hs 440544(CLIC4), Accession No. Hs 440599(DDX1), Accession No. Hs 440604(PSMD7), Accession No. Hs 440899(TTYH3), Accession No. Hs 440932(SEPT9), Accession No. Hs 440960(RAD23A), Accession No. Hs 440961(CAST), Accession No. Hs 441072(POLR2L), Accession No. Hs 441550(C20orf22, Accession No. Hs 442344(IRS2), Accession No. Hs 442798(RNF10), Accession No. Hs 443134(GBA2), Accession No. Hs 443379(PSMD11), Accession No. Hs 443837(NPEPPS), Accession No. Hs 443914(SOD1), Accession No. Hs 444279(DKFZp761C169), Accession No. Hs 444356(GRB2), Accession No. Hs 444468(CTDSP1), Accession No. Hs 444472(SDHC), Accession No. Hs 444569(VMP1), Accession No. Hs 444673(CRR9. Accession No. Hs 444724(AZI2), Accession No. Hs 444818(CGGBP1), Accession No. Hs 444931(CRSP6), Accession No. Hs 444969(C2orf4), Accession No. Hs 444986(METAP2), Accession No. Hs 445081(NS5ATP13TP2), Accession No. Hs 445351(LGALS1), Accession No. Hs 445394(VPS29), Accession No. Hs 445498(SKIIP), Accession No. Hs 445511(RIOK3), Accession No. Hs 445570(CD63), Accession No. Hs 445803(DC2), Accession No. Hs 445893(KHDRBS1), Accession No. Hs 445977(GTF3A), Accession No. Hs 446017(WSB1), Accession No. Hs 446091(WTAP), Accession No. Hs 446123(CAPZA2), Accession No. Hs 446149(LDHB), Accession No. Hs 446260(PSMA6), Accession No. Hs 446336(PXN), Accession No. Hs 446345(FTH1), Accession No. Hs 446414(CD47), Accession No. Hs 446427(OAZ1), Accession No. Hs 446445(YIP1) Accession No. Hs 446450(ITM2B), Accession No. Hs 446574(TMSB10), Accession No. Hs 446588(RPS13), Accession No. Hs 446623(HNRPL), Accession No. Hs 446628(RPS4X), Accession No. Hs 446641(ARAF), Accession No. Hs 446852(EIF3S6IP), Accession No. Hs 447477(ST13), Accession No. Hs 447492(PGAM1), Accession No. Hs 447547(VPS35), Accession No. Hs 48226(RPLP0), Accession No. Hs 448588(NGFRAP1), Accession No. Hs 448646(RPL27A), Accession No. Hs 448879, Accession No. Hs 449114(HNRPC), Accession No. Hs 449171(HNRPK), Accession No. Hs 454534(USF2), Accession No. Hs 454699(IL6ST), Accession No. Hs 456507(PKD1-like), Accession No. Hs 456557(FLJ10597), Accession No. Hs 438320(DC12), Accession No. Hs 458358(TSPYL1), Accession No. Hs 458414(IFITM1), Accession No. Hs 458458(C19orf27), Accession No. Hs 458747(ANP32A), Accession No. Hs 459106(OAZ1N), Accession No. Hs 459149(BTBD1), Accession No. Hs 459174(FLJ23790), Accession No. Hs 459211(AKAP13), Accession No. Hs 459596(MPG), Accession No. Hs 459649(CLCN7), Accession No. Hs 459927(PTMA), Accession No. Hs 459940(LITAF), Accession No. Hs 460238(SH3GLB2), Accession No. Hs 460317(ALS4), Accession No. Hs 460336(GGA2), Accession No. Hs 460468(XPO6), Accession No. Hs 460499(ATXN2L), Accession No. Hs 460574(LOC124446), Accession No. Hs 460923(CNOT1), Accession No. Hs 460929(0(12), Accession No. Hs 460978(APPBP1), Accession No. Hs 461047(G6PD), Accession No. Hs 461131(CYB5-M), Accession No. Hs 461361(CFDP1), Accession No. Hs 461379(GABARAPL2), Accession No. Hs 461722(HSPC176) Accession No. Hs 461777(PCOLN3), Accession No. Hs 461896(CRK), Accession No. Hs 461925(RPA1), Accession No. Hs 462035(UBE2G1), Accession No. Hs 462086(RIP), Accession No. Hs 462306(UBE2S), Accession No. Hs 462316(TTC19), Accession No. Hs 462492(USP22), Accession No. Hs 462550(PIGS), Accession No. Hs 462956(PPARBP), Accession No. Hs 462998(IGFBP4), Accession No. Hs 463010(SMARCE1), Accession No. Hs 463035(FKBP10), Accession No. Hs 463041(RERE), Accession No. Hs 463059(STAT3), Accession No. Hs 463295(CDC27), Accession No. Hs 463506(AKAP1), Accession No. Hs 463702(BCAS3), Accession No. Hs 463797(C1orf33), Accession No. Hs 464071(PGD), Accession No. Hs 464137(ACOX1), Accession No. Hs 464210(SYNGR2), Accession No. Hs 464336(P4HB), Accession No. Hs 464438(AGTRAP), Accession No. Hs 464472(MRLC2), Accession No. Hs 464595(PPP4R1), Accession No. Hs 464652(TNFSF5IP1), Accession No. Hs 464912(P5IRS), Accession No. Hs 465224(NARS), Accession No. Hs 465374(EFHD2), Accession No. Hs 465498(TXNL4A), Accession No. Hs 465529(MIDN), Accession No. Hs 465543(BTBD2), Accession No. Hs 465627(MAP2K2), Accession No. Hs 465645(C19orf0), Accession No. Hs 465808(HNRPM), Accession No. Hs 465849(PIN1), Accession No. Hs 465924(SDHB), Accession No. Hs 466044(PKN1), Accession No. Hs 466088(TPM4), Accession No. Hs 466148(NR2F6), Accession No. Hs 466471(GPI), Accession No. Hs 466693(SIRT2), Accession No. Hs 466766(LTBP4), Accession No. Hs 466775(SNRPA), Accession No. Hs 467084(EIF4G3), Accession No. Hs 467097(SNRP70), Accession No. Hs 467192(PPP2R1A), Accession No. Hs 467279(LENG4), Accession No. Hs 467284(RPS9), Accession No. Hs 467408(TRIM28), Accession No. Hs 467637(CDC42), Accession No. Hs 467696(HPCAL1), Accession No. Hs 467701(ODC1), Accession No. Hs 467807(LAPTM4A), Accession No. Hs 467824(PUM2), Accession No. Hs 467960(RAB10), Accession No. Hs 468018(PPP1CB), Accession No. Hs 468415(PIGF), Accession No. Hs 468442(CALM2), Accession No. Hs 468760(AFTIPHILIN), Accession No. Hs 469022(DGUOK), Accession No. Hs 469171(DKFZP564D0478), Accession No. Hs 469331(STARD7), Accession No. Hs 469820(RALB), Accession No. Hs 469863(YWHAZ), Accession No. Hs 469925(FLJ14346), Accession No. Hs 469970(SFRS4) Accession No. Hs 470091(YWHAE), Accession No. Hs 470233(ARL5), Accession No. Hs 470417. Accession No. Hs 470477(FTP4A2), Accession No. Ha 470577(EIF2S2), Accession No. Hs 470588(KPNA6), Accession No. Hs 470943(STAT1), Accession No. Hs 471011(SF3B1), Accession No. Hs 471104(NOP5/NOP58), Accession No. Hs 471207(NDUFS1), Accession No. s 471441(PSMB2), Accession No. Hs 471461(ACSL3), Accession No. Hs 471593(CAB39), Accession No. Hs 471768(MGC4796), Accession No. Hs 471818(M11S1), Accession No. Hs 471851(HDLBP), Accession No. Hs 471873(DTYMK), Accession No. Hs 471933(PKBP1A), Accession No. Hs 471975(C2orf16), Accession No. Hs 472010(PRNP), Accession No. Hs 472024(C20orf30), Accession No. Hs 472031(UBB2D3), Accession No. Hs 472038(CG1-94), Accession No. Hs 472056(SYNCRIP), Accession No. Hs 472119(MKKS), Accession No. Hs 472185(NDUFS5), Accession No. Hs 472213(RRBP1), Accession No. Hs 472330(C20orf3), Accession No. Hs 472475(MACF1) Accession No. Hs 472535(AKIP), Accession No. Hs 472558(SDBCAG84), Accession No. Hs 472651(BLCAP), Accession No. Hs 472737(TOP1), Accession No. Hs 473296(TPD2L2), Accession No. Hs 473583(NSEP1), Accession No. Hs 473648(GART), Accession No. Hs 473721(SLC2A1), Accession No. Hs 473761(RTN3), Accession No. Hs 473788(OTUB1), Accession No. Hs 474005(SUMO3), Accession No. Hs 474010(PTTG1IP), Accession No. Hs 474053(COL6A1), Accession No. Hs 474083(B4GALT2), Accession No. Hs 474213(UFD1L), Accession No. Hs 474584(AKR1A1, Accession No. Hs 474643(HSPC117), Accession No. Hs 474751(MYH9), Accession No. Hs 474833(CSNK1E), Accession No. Hs 474914(RUTBC3), Accession No. Hs 474938(SLC25A17), Accession No. Hs 474949(RBX1), Accession No. Hs 474982(ACO2), Accession No. Hs 475125(ATXN10), Accession No. Hs 475319(LRRFIP2), Accession No. Hs 475382(FL122405), Accession No. Hs 475392(LOC55831), Accession No. Hs 475663(RAB5A), Accession No. Hs 475733(TOP2B), Accession No. Hs 475812(SIMP), Accession No. Hs 476018(CTNNB1), Accession No. Hs 476033(TLP19), Accession No. Hs 476179(SMARCC1), Accession No. Hs 476221(IHPK2), Accession No. Hs 76231(IMPDH2), Accession No. Hs 476308(ALAS1), Accession No. Hs 476365(SCP2), Accession No. Hs 476448(FLNB), Accession No. Hs 476706(MRPL37), Accession No. Hs 476930(DKFZP564O123), Accession No. Hs 477157(DULLARD), Accession No. Hs 477789(ATP1B3), Accession No. Hs 477892(GYG), Accession No. Hs 478000(MBNL1), Accession No. Hs 478044(PA2G4), Accession No. Hs 478553(EIF4A2), Accession No. Hs 479208(FBXL5), Accession No. Hs 479264(LAP3), Accession No. Hs 479634(SLC30A9), Accession No. Hs 479693(SFRS11), Accession No. Hs 479728(GAPD), Accession No. Hs 479747(BCAR1), Accession No. Hs 479814(POLR2B), Accession No. Hs 480073(HNRPD), Accession No. Hs 480311(PDLIM5), Accession No. Hs 480465(SCYE1), Accession No. Hs 80653(ANXA5), Accession No. Hs 481571(UQCRH), Accession No. Hs 481720(MYO10), Accession No. Hs 481898(KAT3), Accession No. Hs 482144(RPL26), Accession No. Hs 482363(SLC30A5), Accession No. Hs 482526(TINP1), Accession No. Hs 482868(KIAA0372), Accession No. Hs 483036(PJA2), Accession No. Hs 483067(C8orf13), Accession No. Hs 483305(HINT1), Accession No. Hs 483408(PPP2CA), Accession No. Hs 483454(CNN3), Accession No. Hs 483486(JMJD1B), Accession No. Hs 484138(FBXW11), Accession No. Hs 484188(ATP6V0E), Accession No. 484242(ETEA), Accession No. Hs 484288(DDX41), Accession No. Hs 484363(RNF130), Accession No. Hs 484551(CPM), Accession No. Hs 484813(DEK), Accession No. Hs 485155(RPL35), Accession No. Hs 485195(SORT1), Accession No. Hs 485246(PSMA5), Accession No. Hs 485262(MTCH1. Accession No. Hs 485365(AHCYL1), Accession No. Hs 485616(DST), Accession No. Hs 486542(BCLAF1), Accession No. Hs 487027(VIL2), Accession No. Hs 487054(TCP1), Accession No. Hs 487635(BZW2), Accession No. Hs 487774(HNRPA2B1), Accession No. Hs 488171(KIAA068), Accession No. Hs 488181(OGDH), Accession No. Hs 488307(DKFZP564K0822), Accession No. Hs 488478(FLJ10099), Accession No. Hs 488671(BAZ1B), Accession No. Hs 489207(ASNS), Accession No. Hs 489284(ARPC1B), Accession No. Hs 489287(CPSF4), Accession No. Hs 489336(SYAP1), Accession No. Hs 489615(PBEF), Accession No. Hs 490203(CALD1), Accession No. Hs 490394(SSBP1), Accession No. Hs 490415(ZYX), Accession No. Hs 490745(DNAJB6), Accession No. Hs 490795(CHR2SYT), Accession No. Hs 490874(MTX1), Accession No. Hs 491336(ELP3), Accession No. Hs 491359(LMNA), Accession No. Hs 491440(PPP2CB), Accession No. Hs 491494(CCT3), Accession No. Hs 491597(VDAC3), Accession No. Hs 491695(UBE2V2), Accession No. Hs 491745(TCEA1), Accession No. Hs 491988(TRAM 1), Accession No. Hs 492236(WDR42A), Accession No. Hs 492314(LAPTM4B), Accession No. Hs 492445(EDD), Accession No. Hs 492599(EIP3S3). Accession No. Hs 492805(CGI-07), Accession No. Hs 493362(AK3L1), Accession No. Hs 493750(WDR40A), Accession No. Hs 494173(ANXA1), Accession No. Hs 494419(LAMP1), Accession No. Hs 494457(NINJ1), Accession No. Hs 494604(ANP32B), Accession No. Hs 494614(XTP2), Accession No. Hs 494691(PFN1), Accession No. Hs 494700(CDW92), Accession No. Hs 494985(FBXW2), Accession No. Hs 495039(NDUPA8), Accession No. Hs 495349(KIAA0515), Accession No. Hs 495471(PMPCA), Accession No. Hs 495605(CD99), Accession No. Hs 495851(MC4825), Accession No. Hs 495960(ATP6AP2), Accession No. Hs 496068(PCTK1), Accession No. Hs 496098(DKFZp761A052), Accession No. Hs 496271. Accession No. Hs 496487(ATF4), Accession No. Hs 496646(IL13RA1), Accession No. Hs 496684(LAMP2), Accession No. Hs 497183(IVNS1ABP), Accession No. Hs 497599(WARS), Accession No. Hs 497692(C1orf48), Accession No. Hs 497893(ENAH), Accession No. Hs 498239(FH), Accession No. Hs 498313(ADSS), Accession No. Hs 498317(PNAS-4), Accession No. Hs 498455(KIAA0217), Accession No. Hs 498548(RBM17), Accession No. Hs 498727(DHCR24), Accession No. Hs 499145(YME1L1), Accession No. Hs 499158(GGA1), Accession No. Hs 499594(TIMM23), Accession No. Hs 499833(C10orf74), Accession No. Hs 499891(HNRPH3), Accession No. Hs 499925(VPS26), Accession No. Hs 499960(SARA1), Accession No. Hs 500067(PP3CB), Accession No. Hs 500101(VCL), Accession No. Hs 500375(ENTPD6), Accession No. Hs 500409(GLUD1), Accession No. Hs 500546(IDE), Accession No. Hs 500674(SMBP), Accession No. Hs 500775(ZNF207), Accession No. Hs 500842(MGEA5), Accession No. Hs 500874(CUEDC2), Accession No. Hs 501012(ADD3), Accession No. Hs 501023(MXI1), Accession No. Hs 501203(TIAL1), Accession No. Hs 501293(BSG), Accession No. Hs 501309(CIRBP), Accession No. Hs 501353(PLEKHJ1), Accession No. Hs 501376(UROS), Accession No. Hs 501420(NCLN), Accession No. Hs 501629(IER2), Accession No. Hs 501684(NAPIL4), Accession No. Hs 501735(STIM1), Accession No. Hs 501853(C11orf15), Accession No. Hs 501924(USP47), Accession No. Hs 501991(MLSTD2), Accession No. Hs 502302(CAT), Accession No. Hs 502328(CD44), Accession No. Hs 502461(DGKZ), Accession No. Hs 502528(NDUFS3), Accession No. Hs 502630(C11orf31), Accession No. Hs 502659(RHOC), Accession No. Hs 502705(PRP19), Accession No. Hs 502745(FADS2), Accession No. Hs 502769(SLC3A2), Accession No. Hs 502773(MTCBP-1), Accession No. Hs 502823(PRDX5), Accession No. Hs 502829(SF1), Accession No. Hs 502836(ARL2), Accession No. Hs 502842(CAPN1), Accession No. Hs 502872(MAP3K11), Accession No. Hs 502876(RHOB), Accession No. Hs 503093(ZFP36L2), Accession No. Hs 503222(RAB6A), Accession No. Hs 503251(PME-1), Accession No. Hs 503597(HSPC148), Accession No. Hs 503709(PORIMIN), Accession No. Hs 503716(MGC2714), Accession No. Hs 503787(DARS), Accession No. Hs 504237(ITM1), Accession No. Hs 504517(RPS27), Accession No. Hs 504613(PTMS), Accession No. Hs 504620(REA), Accession No. Hs 504687(MYL9), Accession No. Hs 504828(DDX47), Accession No. Hs 504895(STRAP), Accession No. Hs 505033(KRAS2), Accession No. Hs 505059(PSMD4), Accession No. Hs 505625(C12orf10), Accession No. Hs 505652(COPZ1), Accession No. Hs 505676(C1P29), Accession No. Hs 5053705(MYL6), Accession No. Hs 505806(PBXIP1), Accession No. Hs 505824(CGI-51), Accession No. Hs 506215(RARS), Accession No. Hs 506325(NUDT4), Accession No. Hs 06759(ATP2A2), Accession No. Hs 506861(DDX54), Accession No. Hs 507074(KIAA0152), Accession No. Hs 507162(FUL12750), Accession No. Hs 507584(MGC9850), Accession No. Hs 507680(PFAAP5), Accession No. Hs 507910(PGRMC2), Accession No. Hs 507916(TGFB114), Accession No. Hs 508010(FNDC3A), Accession No. Hs 508644(FLJ10154), Accession No. Hs 509163(KIAA1181), Accession No. Hs 509226(FKBP3), Accession No. Hs 509264(KLHDC2), Accession No. Hs 509414(KTN1), Accession No. Hs 509622(ROL2), Accession No. Hs 509736(HSPCB), Accession No. Hs 509791(ERH), Accession No. Hs 509909(NUMB), Accession No. Hs 510087(ENSA), Accession No. Hs 510328(DDX24), Accession No. Hs 510402(MCP), Accession No. Hs 511067(FLJ10579), Accession No. Hs 511138(DKFZP564G2022), Accession No. Hs 511149(SNAP23), Accession No. Hs 511425(SRP9), Accession No. Hs 511504(TC12), Accession No. Hs 511862, Accession No. Hs 511952(CBX6), Accession No. Hs 512005(ARPC3), Accession No. Hs 512465(SURF4), Accession No. Hs 512525(RPS17), Accession No. Hs 512607(MIRI6), Accession No. Hs 512640(PRKCSH), Accession No. Hs 512661(KIAA1160), Accession No. Hs 512676, Accession No. Hs 512693(FLJ20859), Accession No. Hs 512756(THAP7), Accession No. Hs 512815(AP3D1), Accession No. Hs 512857(CD151), Accession No. Hs 512867(163), Accession No. Hs 512908(ARPP-19), Accession No. Hs 513043(C15orf12), Accession No. Hs 513055(REC14), Accession No. Hs 513057(RANBP5), Accession No. Hs 513058(TMED3), Accession No. Hs 513071(MESDC1), Accession No. Hs 513083(RPL9), Accession No. Hs 513141(IDH2), Accession No. Hs 513145(NEUGRIN), Accession No. Hs 513153(FURIN), Accession No. Hs 513230(MRPL28). Accession No. Hs 513242(RHOT2), Accession No. Hs 513261(C16orf34), Accession No. Hs 513266(NDUFB10), Accession No. Hs 513470(NFATC21P), Accession No. Hs 513488(MVP), Accession No. Hs 513490(ALDOA), Accession No. Hs 513520(BCKDK), Accession No. Hs 513522(FUS), Accession No. Hs 513631(ARL2BP), Accession No. Hs 513856(DPH2L1), Accession No. Hs 513984(FLII), Accession No. Hs 514012(MAP2K3), Accession No. Hs 514036(SDP2), Accession No. Hs 514038(FLOT2), Accession No. Hs 514174(JUP), Accession No. Hs 514196(RPL27), Accession No. Hs 514211(MGC4251), Accession No. Hs 514216(CGI-69), Accession No. Hs 514220(GRN), Accession No. Hs 514297(PLJ13855), Accession No. Hs 514303(PHB), Accession No. Hs 514435(SP3B3), Accession No. Hs 514489(WBP2), Accession No. Hs 514535(LGAL3BP), Accession No. Hs 514581(ACTG1), Accession No. Hs 514590(HGS), Accession No. Hs 514819(AP2B1), Accession No. Hs 514870(ATP5F1), Accession No. Hs 514920(NDP52), Accession No. Hs 514934(CAPZA1), Accession No. Hs 515003(C9orf6), Accession No. Hs 515005(STK11), Accession No. Hs 515018(GNAI3), Accession No. Hs 515053(AES), Accession No. Hs 515070(EEF2), Accession No. Hs 515092(CLPP), Accession No. Hs 515155(MGC2803), Accession No. Hs 515162(CALR), Accession No. Hs 515164(GADD45GIP1), Accession No. Hs 515210(DNAJB1), Accession No. Hs 515255(LSM4), Accession No. Hs 515266(RENT1), Accession No. Hs 515271(SFRS14), Accession No. Hs 515329(RPL22), Accession No. Hs 515371(CAPNS1), Accession No. Hs 515406(AKT2), Accession No. Hs 515417(EGLN2), Accession No. Hs 515432(DEDD2), Accession No. Hs 515472(SNRPD2), Accession No. Hs 515475(SYMPK), Accession No. Hs 515487(CALM3), Accession No. Hs 515494(SLC1A5), Accession No. Hs 515500(SAE1), Accession No. Hs 515515(KDELR1), Accession No. Us 515517(RPL18), Accession No. Hs 515524(NUCB1), Accession No. Hs 515540(PTOV1), Accession No. Hs 515550(LOC284361), Accession No. Hs 515598(PRPF31), Accession No. Hs 515607(PPP1R12C), Accession No. Hs 515642(GPSN2), Accession No. Hs 515785(BLVRB), Accession No. Hs 551846(RUVBL2), Accession No. Hs 515848(HADHB), Accession No. Hs 515890(YPEL5), Accession No. Hs 516075(TIA1), Accession No. Hs 516077(FJ14668), Accession No. Hs 516087(TEX261), Accession No. Hs 516111(DCTN1), Accession No. Hs 516114(WBP1), Accession No. Hs 516157(MAT2A), Accession No. Hs 516450(FLJ20297), Accession No. Hs 516522(FLJ21919), Accession No. Hs 516539(HNRPA3), Accession No. Hs 516587(UBE2Q), Accession No. Hs 516633(NCKAP1), Accession No. Hs 516711(CHPF), Accession No. Hs 516790(ARHGEF2), Accession No. Hs 516807(STK25), Accession No. Hs 516826(TRIB3), Accession No. Hs 516855(CENPB), Accession No. Hs 517080(SLC35C2), Accession No. Hs 517106(CEBPB), Accession No. Hs 5171134(C20orf43), Accession No. Hs 517145(ENOI), Accession No. Hs 517168(TAGLN2), Accession No. Hs 517216(PEA15), Accession No. Hs 517232(PEX19), Accession No. Hs 517240(IFNGR2), Accession No. Hs 517262(SON), Accession No. Hs 517293(F11R), Accession No. Hs 517338(ATP6V1E1), Accession No. Hs 17342(DEDD), Accession No. Hs 517356(COL18A1), Accession No. Hs 517357(DGCR2), Accession No. Hs 517421(PCQAP), Accession No. Hs 517438(ASCC2), Accession No. Hs 517517(EP300), Accession No. Hs 517543(PES1), Accession No. Hs 517582(MCM5), Accession No. Hs 517622(UNC84B), Accession No. Hs 517641(L3MBTL2), Accession No. Hs 517666(DIA1), Accession No. Hs 517731(PP2447), Accession No. Hs 517768(DKPZP64B167), Accession No. Hs 517792(C3orf10), Accession No. Hs 517817(MGC3222), Accession No. Hs 517821, Accession No. Hs 517888(CRTAP), Accession No. Hs 517948(DHX30), Accession No. Hs 517949(MAP4), Accession No. Hs 517969(APEH), Accession No. Hs 517981(TUSC2), Accession No. Hs 518060(ARL6IP5), Accession No. Hs 518123(TFG) Accession No. Hs 518236(SEC61A1), Accession No. Hs 518244(RPN1), Accession No. Hs 518249(ZNP9), Accession No. Hs 518250(COPG) Accession No. Hs 518265(1141), Accession No. Hs 518326(SERP1), Accession No. Hs 518346(SSR3), Accession No. Hs 518374(QSCN6), Accession No. Hs 518424(NDUFB5), Accession No. Hs 518460(AP2M1), Accession No. Hs 518464(PSMD2), Accession No. Hs 518525(GLUL), Accession No. Hs 518551(RPL31), Accession No. Hs 518608(PP784), Accession No. Hs 518609(ARPC5), Accession No. Hs 518750(OCIAD1), Accession No. Hs 18805(HMGA1), Accession No. Hs 518827(CCNI), Accession No. Hs 519276(MAPKAPK2), Accession No. Hs 519304(PELO), Accession No. Hs 519346(ERBB2IP), Accession No. Hs 519347(SFRS12), Accession No. Hs 519520(RPS25), Accession No. Hs 519523(SERPINB6), Accession No. Hs 519557(TMEM14C), Accession No. Hs 519718(TTC1), Accession No. Hs 519756(STK10), Accession No. Hs 519818(MGAT1), Accession No. Hs 519909(MARCKS), Accession No. Hs 519930(C6orf62), Accession No. Hs 520026(VARS2), Accession No. Hs 520028(HSPA1A), Accession No. Hs 520037(NEU1), Accession No. Hs 520070(C6orf82), Accession No. Hs 520140(SRF), Accession No. Hs 520189(ELOVL5), Accession No. Hs 520205(EIF2AK1), Accession No. Hs 520210(KDELR2), Accession No. Hs 520287(C6orf111), Accession No. Hs 520313(CD164), Accession No. Hs 520383(STX7), Accession No. Hs 520421(PERP), Accession No. Hs 520459(GTF21), Accession No. Hs 520623(C7orf27), Accession No. Hs 520640(ACTB), Accession No. Hs 520740(SCRN1), Accession No. Hs 520794(YKT6), Accession No. Hs 520898(CTSB), Accession No. Hs 520943(WBSCR1), Accession No. Hs 520967(MDH2), Accession No. Hs 520973(HSPB1), Accession No. Hs 520974(YWHAG), Accession No. Hs 521064(ZNF655), Accession No. Hs 521151(FLJ22301), Accession No. Hs 521289(REPIN1), Accession No. Hs 521487(MGC8721), Accession No. Hs 521640(RAD23B), Accession No. Hs 521809(COBRA1), Accession No. Hs 521903(LY6E), Accession No. Hs 521924(SIAHBP1), Accession No. Hs 521969(NDUFB11), Accession No. Hs 521973(WDR13), Accession No. Hs 522074(DSIPI), Accession No. Hs 522110(CRBB3), Accession No. Hs 522114(CLTA), Accession No. Hs 522310(NANS), Accession No. Hs 522373(GSN), Accession No. Hs 522394(HSPA5), Accession No. Hs 522463(EEF1A1), Accession No. Hs 522507(FBXW5), Accession No. Hs 522584(TMSB4X), Accession No. Hs 522590(EIF1AX), Accession No. Hs 522632(TIMP1), Accession No. Hs 522665(MAGED2), Accession No. Hs 522675(F1J2525), Accession No. Hs 522752(PSMD10), Accession No. Hs 522817(BCAP31), Accession No. Hs 522819(IRAK1), Accession No. Hs 522823(EMD), Accession No. Hs 522932(NCOA4), Accession No. Hs 522995(EIF4BBP2, Accession No. Hs 523004(PSAP), Accession No. Hs 523012(DDIT4), Accession No. Hs 523054(SMP1), Accession No. Hs 523131 TRAPPC3), Accession No. Hs 523145(DDOST), Accession No. Hs 523215(NDUFB8), Accession No. Hs 523238(NOLC1), Accession No. Hs 523262(C1orf8), Accession No. Hs 523299(EIF3S10), Accession No. Hs 523302(PRDX3), Accession No. Hs 523560(HSPCA), Accession No. Hs 523680(SSRP1), Accession No. Hs 523789(TncRNA), Accession No. Hs 523829(POLD4), Accession No. Hs 523836(GSTP1), Accession No. Hs 523852(CCND1), Accession No. Hs 523875(INPPL1), Accession No. Hs 524009(AASDHPPT), Accession No. Hs 524081(DPAGT1), Accession No. Hs 524084(RNF26), Accession No. Hs 524161(RSU1), Accession No. Hs 524171(RAD52), Accession No. Hs 524183(PKBP4. Accession No. Hs 524195(ARHGAP21), Accession No. Hs 524214(MLF2), Accession No. Hs 524219(TPI1), Accession No. Hs 524271(PHC2), Accession No. Hs 524367(CBARA1), Accession No. Hs 524395(TUBA3), Accession No. Hs 524464(ATPSG2), Accession No. Hs 524502(RNF41), Accession No. Hs 524530(CTDSP2), Accession No. Hs 524590(RAB21), Accession No. Hs 524599(NAPIL1), Accession No. Hs 524690(PPIE), Accession No. Hs 524788(RAB35), Accession No. Hs 524809(RSN), Accession No. Hs 524899(SAP18), Accession No. Hs 524920(ZFP91), Accession No. Hs 524969(Ufm1), Accession No. Hs 525134(FU20277), Accession No. Hs 525163(ANKRD10), Accession No. Hs 525232(LRP10), Accession No. Hs 525238(C14orf119), Accession No. Hs 525330(ARF6), Accession No. Hs 525391(FLJ20580), Accession No. Hs 525527(RER1), Accession No. Hs 525626(PACS1L), Accession No. Hs 525899(C6orf49), Accession No. Hs 526464(PML), Accession No. Hs 526521(MDH1), Accession No. Hs 527105(HNRPDL), Accession No. Hs 527193(RPS23), Accession No. Hs 527348(AKAP9), Accession No. Hs 527412(ASAHI), Accession No. Hs 527861(06-9), Accession No. Hs 527862(PKD1), Accession No. Hs 527980(DUT), Accession No. Hs 528050(HARS), Accession No. Hs 528222(NDUFS4), Accession No. Hs 528300(PITRM1), Accession No. Hs 528305(DDX17), Accession No. Hs 528572(SCAM-1), Accession No. Hs 528668(RPL6), Accession No. Hs 528780(GSPT1), Accession No. Hs 528803(UQCRC2), Accession No. Hs 529059(EIF3S4), Accession No. Hs 529132(SEPW1), Accession No. Hs 529244(NCK2), Accession No. Hs 529280(ANAPC7), Accession No. Hs 529303(ARPC2), Accession No. Hs 529369(APAP), Accession No. Hs 529400(IFNAR1), Accession No. Hs 529420(UBE2G2), Accession No. Hs 529591(TLOC1), Accession No. Hs 529618(TFRC), Accession No. Hs 529631(RPL35A), Accession No. Hs 529782(VCP), Accession No. Hs 529798(BTP3), Accession No. Hs 529862(CSNK1A1), Accession No. Hs 529890(CANX), Accession No. Hs 529892(SQSTM1), Accession No. Hs 529957(SEC63), Accession No. Hs 530096(EIF3S2), Accession No. Hs 530118(LUC7L2), Accession No. Hs 530291(ANXA11), Accession No. Hs 530314(SSNA1), Accession No. Hs 530331(PDHA1), Accession No. Hs 530381(PIM3), Accession No. Hs 530412(PAI-RBP1), Accession No. Hs 530436(STXBP3), Accession No. Hs 530479(PMF1), Accession No. Hs 530687(RNH), Accession No. Hs 530734(MRPL16), Accession No. Hs 530753(FL20625), Accession No. Hs 530823(COPS7A), Accession No. Hs 530862(PRKAG1), Accession No. Hs 531081(LGALS3), Accession No. Hs 531089(PSMA3), Accession No. Hs 531176(SARS), Accession No. Hs 531330(CBWD1), Accession No. Hs 531614(BTBD14B), Accession No. Hs 531752(RANBP3), Accession No. Hs 531856(GAS5), Accession No. Hs 531876(DNCL2A), Accession No. Hs 531879(RAD1) Accession No. Hs 532359(RPL5), Accession No. Hs 532399(KIAA0663), Accession No. Hs 532755(GTL3), Accession No. Hs 532790(NMT1), Accession No. Hs 532793(KPNB1), Accession No. Hs 532803(HN1), Accession No. Hs 532826(MCL1), Accession No. Hs 532853(NDUFB7), Accession No. Hs 533030(HRIHFB2122), Accession No. Hs 533059(TUBB), Accession No. Hs 533122(SFRS10), Accession No. Hs 533136(LRPAP1), Accession No. Hs 533192(TOMM20), Accession No. Hs 533222(HSA9761), Accession No. Hs 533245(DDX46), Accession No. Hs 533282(NONO), Accession No. Hs 533306(PPP2R5D), Accession No. Hs 533317(VIM), Accession No. Hs 533437(TCEB1), Accession No. Hs 533440(WWP1), Accession No. Hs 533474(PPP1R8), Accession No. Hs 533479(LYPLA2), Accession No. Hs 533526(ATRX), Accession No. Hs 533624(H3F3A), Accession No. Hs 533712(RBM4), Accession No. Hs 533732(SRP14), Accession No. Hs 533771(STUB1), Accession No. Hs 533782(KRT8), Accession No. Hs 533977(TXNIP), Accession No. Hs 533985(BXOC7), Accession No. Hs 533986(ZNF258), Accession No. Hs 534125(HLA-C), Accession No. Hs 534168(NDUFA1), Accession No. Hs 534212(SEC22L1), Accession No. Hs 534255(B2M), Accession No. Hs 534307(CCND3), Accession No. Hs 534314(EIF5A), Accession No. Hs 534326(ITGB4BP), Accession No. Hs 534338(PPP4C), Accession No. Hs 534346(RPS7), Accession No. Hs 534350(SMARCB1), Accession No. Hs 534453(GRIM9), Accession No. Hs 534456(ANAPC11), Accession No. Hs 534457(C4orf166), Accession No. Hs 534473(TOMM22), Accession No. Hs 534483(MGC2941), Accession No. Hs 536275(PACS1), Accession No. Hs 541269(NDUFB9), Accession No. Hs 546248(CTSD), Accession No. Hs 546250(DNCI2), Accession No. Hs 546253(FDFT1), Accession No. Hs 546261(HNRPA1), Accession No. Hs 546269(RPL10A), Accession No. Hs 546271(PCBP2), Accession No. Hs 546286(RPS3), Accession No. Hs 546289(RPS12), Accession No. Hs 546290(RPS18), Accession No. Hs 546291(NET-5), Accession No. Hs 546339(SMAP), Accession No. Hs 546356(RPL13A), Accession No. Hs 546394(HSPC016), Accession No. Hs 547759(SSBP3), Accession No. Hs 549178(C9orf86), Accession No. Hs 552590(HTF9C), Accession No. Hs 553496(PGM3), Accession No. Hs 553512(C3F), Accession No. Hs 554767(NUP88), Accession No. Hs 554776(SREBF1), Accession No. Hs 554894(FLJ12953), Accession No. Hs 554896(MGC11257) Accession No. Hs 555194(FAM36A), Accession No. Hs 555866(C1QBP), Accession No. Hs 555873(HNRPAB), Accession No. Hs 555875(IDH3A), Accession No. Hs 555889(PSMC2), Accession No. Hs 555890(RBBP4), Accession No. Hs 555911(RBM8A), Accession No. Hs 555969(RIC8), Accession No. Hs 555971(PP1201), Accession No. Hs 555973(MRPS25), Accession No. Hs 555994(LONP), Accession No. Hs 556267(PBXL10), Accession No. Hs 556461(NDUFV2), Accession No. Hs 556795(PAICS), Accession No. Hs 557550(NPM1), Accession No. Hs 558296(ACP1), Accession No. Hs 558313(COX6A1), Accession No. Hs 558322(EEF1B2), Accession No. Hs 558325(EIF5), Accession No. Hs 558328(PFKBP5), Accession No. Hs 558330(FTL), Accession No. Hs 558338(HSPBE1), Accession No. Hs 558345(IK), Accession No. Hs 558354(LAMR1), Accession No. Hs 558360(NDUFB4), Accession No. Hs 558361(NME2), Accession No. Hs 558362(NUMA1), Accession No. Hs 558376(RAC1), Accession No. Hs 558381(RNU65), Accession No. Hs 558382(RPL15), Accession No. Hs 358383(RPL18A), Accession No. Hs 558384(RPL19), Accession No. Hs 558385(RPL23A), Accession No. Hs 558386(RPL34), Accession No. Hs 558388(RPS3A), Accession No. Hs 558389(RPS8), Accession No. Hs 558390(RPS24), Accession No. Hs 558391(RPS26), Accession No. Hs 558396(SCD), Accession No. Hs 558424(CSDA), Accession No. Hs 558426(EIF3S5), Accession No. Hs 558429(010), Accession No. Hs 558431(RPL14), Accession No. Hs 558442(PDCD6IP), Accession No. Hs 558448(TXNL2), Accession No. Hs 558453(ATPSL), Accession No. Hs 558454(NUDC), Accession No. Hs 558458(COPS8), Accession No. Hs 558473(C8orf10), Accession No. Hs 558499(8D6A), Accession No. Hs 558511(PSARL), Accession No. Hs 558521(C2orf33), Accession No. Hs 558591(ORMDL1), Accession No. Hs 558825(PDE4DIP), Accession No. Hs 558995, Accession No. Hs 567260(CD2BP2), Accession No. Hs 567263(C15orf43), Accession No. Hs 567267(ATP2C1) and Accession No. Hs 567279(HCNGP). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the candidate reference gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 bp, corresponding to a sense or antisense sequence of the selected candidate reference gene, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 bp in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, the primers used in the present invention can be any length. The primers may be designed using a well-known primer design program. Additionally, the primers me not limited as to their position on the gene, as long as they can be used in the amplification of the gene.

In contrast to previously reported traditional HKGs, in which genes encoding metabolism and ribosome proteins are contained in high proportions (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsiao L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found at a high proportion within the candidate ERGs when they are classified by FunCat (Functional Classification Catalogue Version 2.0. Ruepp A et al., Nucleic Acids Res 32:5539-45, 2004) (see FIG. 2). Further, analysis on the 2,087 genes shows a high frequency of CpG islands, which is in line with the results of previous reports (Larsen P et al., Genomics 13:1095-107, 1992; Ponger L et al., Genome Res 1:1854-60, 2001) (see TABLE 1).

Moreover, the genes can be detected using microarray. SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR). Out of the genes, the most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (see Table 2).

In addition, the reference genes selected and identified according to the present invention are adopted as candidate reference genes which may be useful in the analysis of the genes of interest through the validation of expression stability.

In accordance with a further aspect thereof, the present invention provides a method for quantifying an expression level of a gene of interest, comprising:

1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

In accordance with still a further aspect thereof, the present invention provides a method for selecting guide genes, comprising measuring the selected candidate endogenous reference genes for coefficient of variation (CV) and ranking the endogenous reference genes in an ascending order of CV.

In an embodiment, the guide genes are expressed in most human body tissues. The guide genes can be used to normalize expression levels for relative quantification of gene expression between different samples. The higher the coefficient of variation (CV) is, the more greatly the gene expression varies from one tissue to another.

CVs of the candidate reference genes, selected using the selection method of the present invention, were calculated for each UniGene cluster in the datasets including EST, ShortSAGE. LongSAGE and microarray, and the genes were arranged in ascending order of CV. From the candidate ERG were selected the reference genes which were found to be stably expressed across a wide range of tissues. Out of the 400 genes (corresponding to about 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs common to all four datasets were selected (see FIG. 1 and Table 3). The 13 reference genes are identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

In other words, the reference genes am genes that show lower expression variations than do the other genes among the 2,087 genes expressed in most tissues. The reference genes identified according to the present invention are expressed in a manner similar to that in which the majority of the intracellular transcripts are expressed at low abundance.

In an aspect of gene expression level and CV, the 13 reference genes identified according to the present invention were compared with 13 traditional reference genes (see Table 4). In all datasets, six of the 13 traditional reference genes showed relatively high mean expression levels, while the other traditional reference genes indicated expression levels similar to or lower than those of the reference genes of the present invention. In terms of both expression level and CV, the traditional reference genes are generally greater than the endogenous reference genes of the present invention (see FIGS. 6 and 7).

In order to validate the suitability of the 13 genes for reference genes, they were examined for gene copy number variation with reference to the Database of Genomic Variants(//projects.teag.ca/variation)(see Table 5). As a result, only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found on chromosome regions known for gene copy variation, whereas many (ACTB, GAPDH, PGK1, B2M, TBP, TFRC, ALAS1) of the traditional reference genes were located in such chromosome regions.

Furthermore, the quantitative real-time RT-PCR (qRT-PCR) analysis (see Table 7) of ERG on human tissue samples and cancer cell lines (see Table 6) indicated that the 13 novel ERGs were expressed in all 48 samples, including frozen human tissues and cancer cell lines (see FIG. 8). The novel 13 ERGs ranged from 19 to 29 in Cp (Crossing Point, the cycle number at which fluorescence crosses the background signal upon qRT-PCR) (see FIG. 9). In addition, using geNorm v3.4 software (Vandesonpele et al., Genome Biol 3:RESEARCH0034, 2002) and NormFinder software (Andersen C L et al., Cancer Res 64:5245-50, 2004). ERGs were analyzed for expression stability according to the following Mathematical Formula 4 in consideration of the efficiency of the PCR performed above (see Table 8). All of the 13 novel ERGs according to the present invention were found to show higher expression stability than were the traditional ERGs as calculated by the geNorm and NormFinder programs (see Table 9). In Table 9, lower expression stability values (M by geNorm. S by NormFinder) mean more stable expression.

Relative Expression=(1+E)^ΔCp  <Mathematical Formula 4>

• • ΔCp=Minimum Cp−Sample Cp;
  • Minimum Cp=lowest Cp value; and
  • E=PCR Efficiency

There was no significant correlation between the M values, which were calculated with geNorm (M) and CV in microarray and LongSAGE datasets, but significance was found in EST and ShortSAGE datasets. Likewise, as for the stability values(S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed highest agreement with CV in ShortSAGE (see Table 10).

These results indicate that the reference genes identified according to the present invention are more stably expressed than are the traditional reference genes.

In consideration of the fact that the majority of intracellular transcripts are expressed in low abundance (Warrington J A et al., Physiol Genomics 2(3):143-147, 2000), traditional reference genes, having high expression levels, may not be suitable for use in normalization. A reference gene with an expression level similar to that of a target gene is recommended, so that the measurement can be done on the same linear scale (Szabo A et al., Genome Biol 5(8):R59, 2004; RocheAppliedScience Technical Note No. LC 15/2005). Therefore, the endogenous reference genes identified according to the present invention are believed to be more suitable and widely used because they show relatively lower expression and lower variability than do the traditional reference genes (Czechowski T et al., Plant Physiol 139(1):5-17, 2005).

In accordance with still another aspect thereof, the present invention provides a composition for detecting at least one of the guide genes identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

In an embodiment of this aspect, the guide genes feature low expression levels, like most low-abundance intracellular transcripts. The guide gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the guide gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 bp corresponding to sense or antisense sequence of the identified guide genes, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 bp in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, any length of primers can be used in the present invention. The primers may be designed using a well-known primer design program. Additionally, the primers are not limited by the position on the gene as long as they can be used in the amplification of the gene.

In addition, the detection method is preferably conducted using microarray. SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR).

In accordance with yet a further aspect thereof, the present invention provides a method for quantifying an expression level of a target gene, comprising:

1) synthesizing cDNA from RNA of a subject;

2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

In accordance with yet another aspect thereof, the present invention provides a method for identifying the amplification of a target gene in genomic DNA, comprising:

1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a subject serving as a template and than performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

Mode for Invention

A better understanding of the present invention may be obtained though the following examples which are set forth to illustrate, but are not to be construed as the limit of the present invention.

Example 1: Gene Expression Dataset Construction

EST (expressed sequence tag) and SAGE (serial analysis of gene expression) human gene expression data were collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/). Microarray gene expression data were obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set.

Out of a total of 8.633 libraries in Hs_LibData.dat (31 Oct. 2005) file, 77 libraries meeting the requirements: 1) non-normalized and 2) >10,000 sequences, were included in the EST dataset constructed from the CGAP site. EST frequency in each library was obtained from Hs_ExprData.dat (31 Oct. 2005) file, 29 different tissues, including normal and tumor samples, and 26,117 UniGene clusters were included in these libraries.

SAGE short data for all 280 libraries (Hs_shout.frequencies.gz, 5 Dec. 2006), representing 38,290 UniGene clusters, and SAGE long data (Hs_long.frequencies.gz 5 Dec. 2006) for 46 libraries, representing 21.868 UniGene clusters, were used in creating the dataset for SAGE short (ShortSAGE) and long (LongSAGE), respectively. Also, SAGE tags were mapped to UniGene clusters using the files Hs_short.best.gene.nz (5 Dec. 2006) and Hs_long.best_gene.gz (5 Dec. 2006). ShortSAGE and LongSAGE contained information on SAGE expression in 28 and 9 different tissues, including normal and tumor samples, respectively.

Affymetrix GeneChips gene expression data from 567 different samples representing 13 different tissues including the brain, the breast, the colon, the esophagus, the kidney, the liver, the lung, the lymph node, the ovary, the pancreas, the prostate, the rectum and the stomach were also analyzed (Table 11). Affymetrix (CA) HG-U133 and 44,760 different probe sets (total 44.928 probe sets) were included in the microarray dataset.

Example 2: Selected of Candidate ERG

Using the datasets constructed in Example 1, expression level was calculated for UniGene clusters so as to search for housekeeping genes which are constitutively expressed in most human tissues.

Gene expression levels of EST dataset for each gene were calculated as the number of ESTs of a gene in a given library, divided by the total number of ESTs in all genes in a given library and then multiplied by 1,000,000, as expressed by Mathematical Formula 1.

Likewise. Gene expression levels of SAGE dataset for each gene were calculated as the number of tags (sum of tag frequency) of a gene in a given library, divided by the total number of tags and then multiplied by 1,000,000, as expressed by Mathematical Formula 2.

$〈\mathrm{Mathematical}\mathrm{Formula}1〉$ $\mathrm{ETS}\mathrm{gene}\mathrm{expression}=\frac{\mathrm{No}\mathrm{of}\mathrm{EST}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\mathrm{in}\mathrm{Library}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{ESTs}\mathrm{in}\mathrm{Libaray}}\times 1,000,000$ $〈\mathrm{Mathematical}\mathrm{Formula}2〉$ $\mathrm{SAGE}\mathrm{gene}\mathrm{expression}=\frac{\mathrm{No}\mathrm{of}\mathrm{Tags}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\mathrm{in}\mathrm{Library}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tags}\mathrm{in}\mathrm{Libaray}}\times 1,000,000$

Expression levels in Microarray dataset were represented by the signal intensity calculated for each transcript by the analysis algorithm of Affymetrix Microarray Suite 5.0. Mean gene expression was defined as the average of gene expression level of a given gene in all libraries.

HKGs for use in identifying endogenous reference genes, which are expressed in most human tissues, were investigated using EST and SAGE datasets. In order to examine whether a given gene might be an HKG which is constitutively expressed across a wide range of tissues, the proportion of the tissues not expressing the given gene to the total tissues of the EST and SAGE datasets was calculated. If gene expression frequency is found in any one library of multiple libraries corresponding to one tissue, that gene was considered to be expressed in that tissue. For this, the 0's proportion, which is defined as the ratio of the number of the tissues in which a given gene was not expressed to the total number of tissues, was introduced. In the 0's proportion, “0” indicates that the gene is expressed in all tissues, and conversely, “1” means that the gene is not expressed in any tissue.

$〈\mathrm{Mathematical}\mathrm{Formula}3〉0’s\mathrm{Proportion}=\frac{\mathrm{No}.\mathrm{of}\mathrm{Tissues}\mathrm{with}\mathrm{No}\mathrm{Expression}\mathrm{of}a\mathrm{Given}\mathrm{Gene}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tissues}}$

In a study of 101 samples obtained from 47 different human tissues and cell lines, cutoff values for the 0's proportion were determined in each of EST and SAGE datasets so as to include most of the 575 housekeeping genes identified from previous microarray data using the Affymetrix U95A chip (CA), containing 2,600 probes (Eisenberg E and Levanon E Y. Trends Genet, 19(7), 362-365, 2003). Genes with 0's proportion <0.4 for EST (EST, 4,027 UniGene clusters), 0.1 for ShortSAGE (4,758 UniGene clusters) and 0.3 for LongSAGE (4.569 UniGene clusters) were sorted, 2,087 genes common to the three datasets were selected

Out of the 575 genes obtained by U95A, 451(78.43%) in EST, 432(75.13%) in ShortSAGE, and 446(77.57%) in LongSAGE were included in the selected housekeeping genes, respectively. A majority of the 575 HKGs was found to have low 0's proportion in the constructed datasets, EST. ShortSAGE and LongSAGE even though some genes showed the 0's proportion greater than 0.5 unexpectedly. Traditional reference genes like RPLP0, ACTB, PPIA. GAPDH, PGK1. B2M and were TFRC also found in the 2,087 genes.

The mean gene expression value and CV (%) of the housekeeping genes selected from the EST and SAGE datasets were calculated in the microarray dataset (Affymetrix HG-U133, CA). The microarray expression data of 5,238 different probe sets (gene expression data for 5317 fragments, 1,990 UniGene clusters) corresponding to the selected HKGs were obtained.

UniGene clusters were used to allow respective gene probes to correspond thereto in the datasets. On the chip set HG-U133 were found cases where multiple probe sets, which show various expression intensities, correspond to one gene or UniGene cluster. In such cases, one probe set for one UniGene cluster, showing the lowest CV among several probe sets, was selected.

The 2.087 HKGs obtained above were categorized as “candidate ERGs” or “candidate reference genes” in accordance with the present invention.

Experimental Example 1: Analysis of Candidate ERG

<1-1> Functional Classification of Candidate ERG

Using FunCat (Functional Classification Catalogue, Version 2.0. Ruepp, A., t al. Nucleic Acids Res. 32, 5539-45, 2004), the 2.087 genes obtained above were classified.

Out of the 2,087 candidate ERGs, 1,689 UniGene clusters were associated with GO terms allocated to MIPS (Munich information Center for Protein Sequences) FunCat (Functional Catalogue). Among the 1,689 UniGene clusters, 1,318 UniGene clusters were functionally classified to be associated with GO terms corresponding to biological processes. These 1,318 genes were identified to be involved in various basic cellular functions. While a high proportion of the previously reported traditional HKGs encode metabolism and ribosome proteins (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsia L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found in large amounts in the candidate ERGs (FIG. 2).

<1-2> Analysis of Candidate ERGs for CpG Island

Sequences upstream of the annotated transcription start site of the ERGs according to the present invention were obtained from the UCSC site (//hgdownload.cse.ucsc.edu/goldenPath/hg18/bigZips/). CpG islands located 1,000, 2.000 and 5.000 bp upstream of the transcription start points on the basis of a DNA sequence longer than 500 bp, and having a O+C content of 55% and a CpG observed/expected ratio of 0.65 (Takai D & Jones P A Proc Nad Acad Sci USA, 99, 3740-5, 2002), were searched for using CpGIE software (Wang. Y & Leung, FC Bioinformatics, 20, 1170-7, 2004).

The Z-test (R program, //www.R-project.org) was applied to assess whether there was a statistical significance of differences in the frequency of genes with CpG island between the candidate ERGs and non-candidate ERGs. P<0.05 was considered to be significant.

In line with the previous repots (Larsen, P., et al., Genomics, 13, 1095-107, 1992; Ponger. L, et al., Genome Res, 11, 1854-60, 42, 2001), moat candidate ERGs were found to show high frequencies of CpG islands in upstream sequences (1000 bp; 70%, 2000 bp; 73%, 5000 bp; 76%). In contrast. CpG islands were found at low frequencies in the upstream sequences of non-candidate ERGO (p<0.001. Table 1).

TABLE 1
Comparison of the Proportion of Genes with CpG Islands
in Upstream Sequences of the transcription start site in
Candidate ERG and Non-Candidate ERG
	Candidate ERG	Non-Candidate ERG
	(No. = 2002)	(No. = 14848)
		Ratios of		Ratios of
Upstream	No. of	Genes with	No. of	Genes with
Bp	Genes	CpG Islands	Genes	CpG Islands	p-values
5000	1516	76%	8036	54%	<0.001
2000	1456	73%	7410	50%	<0.001
1000	1410	70%	7048	47%	<0.001

Experimental Example 2: Correlation Analysis

Correlation analysis was performed using a correlation coefficient, which indicates linear association between two groups, with a significance level of p<0.05. All calculations and scatter plots were produced with the statistical analysis program R-Package (//www.r-project.org).

First, Pearson and Spearman's rank correlation analysis were performed to compare the candidate ERGs selected from the four datasets in terms of gene expression and CV. FIG. 3 is a scatter plot of gene expression for the four datasets of the candidate ERGs. It was observed that there was a significant correlation of expression values between all four datasets. ShortSAGE versus LongSAGE showed the highest Spearman correlation coefficient of 0.853 (p<0.0001) and the lowest Spearman correlation of 0.339 between EST and Microarray (p<0.0001).

Next, the coefficient of variation (CV, %) was computed to investigate the consistency of the expression level of the candidate ERGs across various libraries in each dataset. Pearson and Spearman's rank correlation analyses were performed on the CV thus obtained, indicating that the CV was less similar between datasets (Spearman correlation coefficient<0.5) than was the gene expression level although a significant correlation was still found (p≤0.001) (FIG. 4).

These results may be attributed to the difference in the kind and number of samples between datasets because expression levels may vary depending on the kind and number of the samples.

Experimental Example 3: Comparison Between Candidate ERG and Non-Candidate ERG

A t-test was conducted to examine whether there was a significant difference in mean gene expression between candidate ERG and non-candidate ERG. FIG. 5 shows the distribution of the gene expressions of candidate ERG and non-candidate ERG for each dataset. As was expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-candidate ERGs in all four datasets (p<0.0001). These results are in line with previous reports (Eisenberg E and Levanon E Y. Trends Genet. 19(7), 362-365, 2003).

Gene expression levels were found to range from 73.83 to 9324.87 in EST, from 28.58 to 4086.25 in ShortSAGE, from 17.47 to 4621.60 in LongSAGE, and from 1.47 to 18598.26 in HG-U133 microarray. A significant number of genes encoding ribosomal proteins showed the highest expression levels in all four datasets. The most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (Table 2)

TABLE 2
A list of 2087 candidate endogenous reference genes
				SHORT
UniGene			EST	SAGE
cluster	Symbol	Gene Names	Mean	CV	0's P	Mean
120	PRDX6	Peroxiredoxin 6	458.61	113.71	0.034	222.30
142	SULT1A1	Sulfotransferase family, cytosolic. 1A, phenol-preferring, member 1	248.16	105.30	0.241	177.46
202	TSPO	translocator protein	198.55	80.83	0.207	233.57
429	ATP5G3	ATP synthase. H+ transporting, mitochondrial F0 complex, subuni	211.73	76.87	0.103	522.98
		c (subunit 9) isoform 3
695	CSTB	Cystatin B (stefin B)	138.20	109.45	0.345	151.39
808	HNRPF	Heterogeneous nuclear ribonucleoprotein F	340.14	74.87	0.034	137.03
861	MAPK3	Mitogen-activated protein kinase 3	145.68	106.68	0.241	68.60
1063	SNRPC	Small nuclear ribonucleoprotein polypeptide C	171.26	77.26	0.276	96.52
1103	TGFB1	Transforming growth factor, beta 1 (Camurati-Engelmann disease)	197.32	110.45	0.345	106.49
2430	VPS72	Vacuolar protein sorting 72 homolog (S. cerevisiae)	117.28	76.90	0.241	41.98
2533	ALDH9A1	Aldehyde dehydrogenase 9 family. member A1	119.81	68.68	0.207	60.36
2795	LDHA	Lactate dehydrogenase A	723.58	109.92	0.034	334.22
2853	PCBP1	Poly(rC) binding protein 1	203.55	81.02	0.103	154.67
3100	KARS	Lysyl-tRNA synthetase	242.90	76.66	0.138	67.12
3254	MRPL23	Mitochondrial ribosomal protein L23	105.59	58.85	0.379	97.41
3353	G3BP1	GTPase activating protein (SH3 domain) binding protein 1	221.63	105.29	0.138	78.09
3416	ADFP	Adipose differentiation-related protein	250.88	167.90	0.241	109.67
3439	STOML2	Stomatin (EPB72)-like 2	303.44	78.37	0.069	70.64
3530	FUSIP1	FUS interacting protein (serine/arginine-rich) 1	188.96	77.05	0.138	79.35
3989	PLXNB2	Plexin B2	365.44	108.04	0.138	98.71
4055	KLF6	Kruppel-like factor 6	258.77	121.39	0.276	257.29
4742	GPAA1	GPAA1P anchor attachment protein 1 homolog (yeast)	334.17	107.33	0.207	107.98
4747	DKC1	Dyskeratosis congenita 1, dyskerin	232.08	109.39	0.138	62.19
4766	FAM32A	Family with sequence similarity 32, member A	182.68	72.56	0.138	55.17
4859	CCNL1	Cyclin L1	117.20	67.94	0.379	101.90
4997	RBM23	RNA binding motif protein 23	151.36	66.00	0.345	65.10
4998	TMOD3	Tropomodulin 3 (ubiquitous)	117.77	105.21	0.345	60.81
5062	TSPAN3	Tetraspanin 3	230.30	90.95	0.069	333.07
5086	RBM42	RNA binding motif protein 42	232.32	80.47	0.172	62.72
5120	DYNLL1	Dynein, light chain, LC8-type 1	202.21	103.08	0.103	212.71
5158	ILK	Integrin-linked kinase-2	154.41	64.84	0.138	163.14
5245	PIH1D1	PIH1 domain containing 1	300.56	124.75	0.207	64.41
5258	MAGED1	Melanoma antigen family D. 1	605.46	103.33	0.138	122.13
5268	ZDHHC4	Zinc finger. DHHC-type containing 4	105.02	62.27	0.345	71.67
5298	ADIPOR1	Adiponectin receptor 1	175.47	95.76	0.138	78.91
5308	UBA52	Ubiquitin A-52 residue ribosomal protein fusion product 1	482.46	229.44	0.103	354.49
5324	C2orf25	Chromosome 2 open reading frame 25	665.12	222.84	0.138	73.70
5345	RNPEPL1	Arginyl aminopeptidase (aminopeptidase B)-like 1	174.04	85.31	0.310	69.83
5662	GNB2L1	Guanine nucleotide binding protein (G protein), beta polypeptide 2	2888.02	78.73	0.000	632.04
		like 1
5710	CREG1	Cellular repressor of E1A-stimulated genes 1	186.09	125.07	0.241	58.67
5719	NCAPD2	Non-SMC condensin I complex. subunit D2	285.44	132.20	0.241	289.65
5912	FBXO7	F-box protein 7	203.36	91.84	0.207	53.23
5947	RAB8A	RAB8A, member RAS oncogene family	195.76	70.42	0.138	44.57
6396	JTB	Jumping translocation breakpoint	264.77	96.40	0.172	138.04
6454	GIPC1	GIPC PDZ domain containing family. member 1	283.16	100.25	0.069	233.69
6459	GPR172A	G protein-coupled receptor 172A	180.95	83.98	0.276	117.70
6551	ATP6AP1	ATPase. H+ transporting, lysosomal accessory protein 1	238.13	103.93	0.207	113.84
6891	SFRS6	Splicing factor, arginine/serine-rich 6	131.50	89.49	0.241	113.93
7101	ANAPC5	Anaphase promoting complex subunit 5	248.20	68.36	0.103	57.03
7236	NOSIP	Nitric oxide synthase interacting protein	160.80	86.71	0.310	73.56
7476	ATP6V0B	ATPase, H+ transporting. lysosomal 21 kDa, V0 subunit c″	179.43	84.77	0.241	134.42
7527	REXO2	REX2, RNA exonuclease 2 homolog (S. cerevisiae)	137.24	85.72	0.379	91.89
7744	NDUFV1	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51 kDa	373.45	70.69	0.069	253.95
7753	CALU	Calumenin	251.14	83.95	0.069	200.10
7768	FIBP	Fibroblast growth factor (acidic) intracellular binding protein	149.44	71.07	0.138	81.86
7862	PNRC2	Proline-rich nuclear receptor coactivator 2	165.82	66.37	0.241	93.55
7910	RYBP	RING1 and YY1 binding protein	148.78	147.82	0.310	165.96
7917	HIGD1A	HIG1 domain family, member 1A	1039.59	201.55	0.103	249.49
8102	RPS20	Ribosomal protein S20	808.74	200.51	0.000	918.89
8372	UQCR	Ubiquinol-cytochrome c reductase, 6.4 kDa subunit	171.69	131.04	0.172	357.79
8737	WDR6	WD repeat domain 6	214.98	113.65	0.172	102.30
8752	TMEM4	Transmembrane protein 4	133.39	83.23	0.345	56.83
8765	DDX42	DEAD (Asp-Glu-Ala-Asp) box polypeptide 42	139.51	72.23	0.310	48.25
8859	CANT1	Calcium activated nucleotidase 1	195.72	80.27	0.310	74.83
8867	CYR61	Cysteine-rich, angiogenic inducer. 61	267.57	79.91	0.379	187.29
9003	C16orf58	Chromosome 16 open reading frame 58	148.64	68.89	0.207	73.69
9015	LOC57255	Hypothetical locus LOC572558	130.09	98.43	0.276	184.94
9043	NGDN	Neuroguidin, EIF4E binding protein	117.81	54.04	0.379	56.29
9234	TMEM147	Transmembrane protein 147	129.58	83.82	0.207	68.85
9235	NME4	Protein expressed in non-metastatic cells 4	148.59	103.05	0.379	93.18
9527	C2orf28	Chromosome 2 open reading frame 28	184.04	88.83	0.207	81.51
9534	SEC11A	SEC11 homolog A (S. cerevisiae)	146.99	82.65	0.069	98.58
9573	ABCF1	ATP-binding cassette. sub-family F (GCN20). member 1	173.73	124.13	0.276	46.97
9589	UBQLN1	Ubiquilin 1	111.34	60.19	0.310	75.93
9788	NDFIP1	Nedd4 family interacting protein 1	167.04	73.62	0.172	82.06
9825	FAM96B	Family with sequence similarity 96. member B	139.95	94.16	0.345	76.79
9857	DCXR	Dicarbonyl/L-xylulose reductase	170.77	74.16	0.379	194.06
10326	COPE	Coatomer protein complex, subunit epsilon	383.31	95.38	0.103	164.06
10842	RAN	RAN. member RAS oncogene family	825.56	82.38	0.000	182.70
10848	BMS1	BMS1 homolog, ribosome assembly protein (yeast)	121.69	60.27	0.345	38.94
11125	SPCS1	Signal peptidase complex subunit 1 homolog (S. cerevisiae)	151.97	92.91	0.276	94.29
11184	UBE2R2	Ubiquitin-conjugating enzyme E2R 2	379.09	474.01	0.172	129.52
11223	IDH1	Isocitrate dehydrogenase 1 (NADP+), soluble	199.04	77.27	0.103	52.37
11355	TMPO	Thymopoietin	213.98	130.12	0.172	63.16
11463	CMPK	Cytidylate kinase	180.54	86.53	0.172	123.53
12013	ABCE1	ATP-binding cassette, sub-family E (OABP), member 1	179.59	72.05	0.241	47.30
12084	TUFM	Tu translation elongation factor, mitochondrial	518.02	95.08	0.207	235.78
12102	SNX3	Sorting nexin 3	280.04	91.18	0.207	131.08
12107	CHMP2A	Chromatin modifying protein 2A	108.77	44.44	0.207	76.75
12109	CIAO1	Cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)	127.53	69.27	0.207	66.06
12144	KIAA1033	KIAA1033	109.38	59.10	0.345	39.29
12152	SRPRB	Signal recognition particle receptor, B subunit	197.29	199.04	0.310	64.91
12272	BECN1	Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein)	135.99	56.22	0.310	50.41
12341	ADAR	Adenosine deaminase. RNA-specific	272.66	83.29	0.103	99.54
12457	NUP133	Nucleoporin 133 kDa	134.39	100.25	0.310	69.13
12865	NSFL1C	NSFL1 (p97) cofactor (p47)	137.86	79.36	0.276	48.09
13662	TMEM109	Transmembrane protein 109	180.15	110.32	0.276	52.31
14317	NOLA3	Nucleolar protein family A, member 3 (H/ACA small nucleolar	205.32	119.91	0.310	169.22
		RNPs)
14333	ATPBD1B	ATP binding domain 1 family, member B	159.24	82.57	0.379	150.04
14745	CCNY	Cyclin Y	133.37	75.66	0.276	86.24
14839	POLR2G	Polymerase (RNA) II (DNA directed) polypeptide G	141.30	66.30	0.207	89.01
14846	SLC7A1	Solute carrier family 7 (cationic amino acid transporter, y+ system	139.07	71.59	0.310	60.63
		member 1
14894	TGOLN2	Trans-golgi network protein 2	157.54	69.37	0.241	121.24
15277	C16orf33	Chromosome 16 open reading frame 33	120.09	75.30	0.310	84.56
15591	COPS6	COP9 constitutive photomorphogenic homolog subunit 6	217.83	90.78	0.172	83.92
		(Arabidopsis)
15738	RAB7A	RAB7A, member RAS oncogene family	400.18	95.67	0.069	120.91
16059	CCDC56	Coiled-coil domain containing 56	143.39	86.29	0.345	96.29
16130	UBE2O	Ubiquitin-conjugating enzyme E2O	157.52	114.59	0.241	63.36
16349	ASCIZ	ATM/ATR-Substrate Chk2-Interacting Zn2+-finger protein	122.72	69.67	0.310	39.01
17118	C1orf149	Chromosome 1 open reading frame 149	139.92	85.35	0.310	67.64
17250	COQ5	Coenzyme Q5 homolog, methyltransferase (S. cerevisiae)	91.88	50.52	0.345	105.68
17680	FUCA2	Fucosidase, alpha-L-2. plasma	157.91	93.28	0.276	55.65
17731	CCDC14	Coiled-coil domain containing 14	84.79	48.78	0.379	64.78
17883	PPM1G	Protein phosphatase 1G (formerly 2C). magnesium-dependent.	381.13	94.17	0.103	159.30
		gamma isoform
18069	LGMN	Legumain	189.38	150.90	0.310	74.08
18128	C20orf44	Chromosome 20 open reading frame 44	120.34	63.49	0.276	50.49
18349	MRPL15	Mitochondrial ribosomal protein L15	126.02	62.29	0.310	42.98
19673	MAF1	MAF1 homolog (S. cerevisiae)	208.66	72.97	0.069	71.97
20013	SYF2	SYF2 homolog. RNA splicing factor (S. cerevisiae)	109.39	47.58	0.310	80.86
20107	KLC1	Kinesin light chain 1	158.65	81.31	0.241	78.88
20157	CDK5RAP3	CDK5 regulatory subunit associated protein 3	186.17	71.88	0.276	79.43
20521	PRMT1	Protein arginine methyltransferase 1	270.96	72.70	0.103	131.53
20529	FAM79A	Family with sequence similarity 79, member A	101.33	68.50	0.379	50.65
20573	IGF1R	Insulin-like growth factor 1 receptor	133.12	72.84	0.379	106.46
20716	TIMM17A	Translocase of inner mitochondrial membrane 17 homolog A	378.20	138.09	0.241	84.45
		(yeast)
22393	DENR	Density-regulated protein	147.59	60.97	0.138	66.26
22543	UBE3A	Ubiquitin protein ligase E3A (human papilloma virus E6-associate	180.41	98.42	0.276	92.47
		protein, Angelman syndrome)
22546	CYBASC3	Cytochrome b, ascorbate dependent 3	271.22	114.11	0.276	52.24
22616	KIAA0664	KIAA0664 protein	126.85	69.83	0.276	39.21
23033	UBE2Q2	Ubiquitin-conjugating enzyme E2Q (putative) 2	127.34	80.73	0.379	38.96
23111	FARSA	Phenylalanyl-tRNA synthetase, alpha subunit	239.95	79.63	0.241	48.89
23978	SAFB	Scaffold attachment factor B	195.91	87.35	0.207	63.83
24301	POLR2E	Polymerase (RNA) II (DNA directed) polypeptide E, 25 kDa	345.43	77.04	0.207	85.97
24379	TRAPPC1	Trafficking protein particle complex 1	155.30	123.38	0.172	110.66
24601	FBLN1	Fibulin 1	492.05	242.68	0.345	156.54
24950	RGS5	Regulator of G-protein signalling 5	561.58	225.25	0.345	142.46
25155	NET1	Neuroepithelial cell transforming gene 1	114.28	95.82	0.207	72.57
25450	SLC29A1	Solute carrier family 29 (nucleoside transporters). member 1	201.64	68.32	0.379	64.55
25723	FAM89B	Family with sequence similarity 89, member B	140.19	148.04	0.345	67.63
26010	PFKP	Phosphofructokinase. platelet	268.83	113.15	0.103	141.32
26023	FOXJ3	Forkhead box J3	73.83	44.60	0.379	59.94
26136	PIGY	Phosphatidylinositol glycan anchor biosynthesis. class Y	150.82	96.10	0.345	217.48
26232	MAN2C1	Mannosidase. alpha, class 2C. member 1	117.43	87.14	0.379	35.17
26403	GSTZ1	Glutathione transferase zeta 1 (maleylacetoacetate isomerase)	139.46	92.67	0.345	50.70
26518	TSPAN4	Tetraspanin 4	164.19	75.89	0.310	86.39
27222	NOLA2	Nucleolar protein family A. member 2 (H/ACA small nucleolar	172.83	107.54	0.276	108.00
		RNPs)
28491	SAT1	Spermidine/spermine N1-acetyltransferase 1	578.08	192.92	0.276	378.42
28914	APRT	Adenine phosphoribosyltransferase	160.48	119.31	0.345	95.10
29203	GBL	G protein beta subunit-like	172.86	96.17	0.310	80.31
29665	CLSTN1	Calsyntenin 1	223.34	109.23	0.103	167.80
30011	TMEM93	Transmembrane protein 93	122.56	80.02	0.379	65.81
30026	SSU72	SSU72 RNA polymerase II CTD phosphatase homolog (S.	122.96	77.31	0.138	99.27
		cerevisiae)
30345	TRAP1	TNF receptor-associated protein 1	433.73	106.66	0.103	96.17
30954	PMVK	Phosphomevalonate kinase	168.78	141.42	0.379	53.56
31053	TBCB	Tubulin folding cofactor B	267.45	128.93	0.276	115.61
31334	PRPF6	PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)	278.00	95.93	0.103	96.19
31387	C3orf60	Chromosome 3 open reading frame 60	194.85	96.83	0.276	72.05
34045	CDCA4	Cell division cycle associated 4	142.01	95.48	0.379	33.71
34576	TAX1BP1	Tax1 (human T-cell leukemia virus type I) binding protein 1	166.29	86.39	0.138	127.07
34906	BLOC1S2	Biogenesis of lysosome-related organelles complex-1, subunit 2	110.24	106.36	0.345	62.63
35052	TEGT	Testis enhanced gene transcript (BAX inhibitor 1)	601.46	76.56	0.000	357.59
35828	MARK3	MAP/microtubule affinity-regulating kinase 3	181.74	68.97	0.207	74.00
36587	PPP1R7	Protein phosphatase 1. regulatory subunit 7	147.34	89.65	0.207	55.81
36927	HSPH1	Heat shock 105 kDa/110 kDa protein 1	142.61	62.36	0.241	178.86
37616	STRA13	Stimulated by retinoic acid 13 homolog (mouse)	132.28	87.28	0.310	103.87
37916	DPP7	Dipeptidylpeptidase 7	189.05	126.98	0.207	134.29
42806	SDF4	Stromal cell derived factor 4	395.61	110.02	0.138	55.59
43297	MTPN	Myotrophin	224.31	82.09	0.172	192.32
47062	POLR2I	Polymerase (RNA) II (DNA directed) polypeptide I, 14.5 kDa	136.77	76.60	0.310	77.76
50098	NDUFA4	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9 kDa	444.09	142.87	0.310	773.46
50308	HIP2	Huntingtin interacting protein 2	145.77	68.04	0.207	85.98
50425	PTGES3	Prostaglandin E synthase 3 (cytosolic)	411.83	77.96	0.103	332.11
53066	HSPBP1	Hsp70-interacting protein	202.07	92.49	0.138	68.61
54277	FAM50A	Family with sequence similarity 50, member A	145.83	129.34	0.345	100.96
54457	CD81	CD81 antigen (target of antiproliferative antibody 1)	303.19	99.16	0.069	141.89
54642	MAT2B	Methionine adenosyltransferase II, beta	133.55	71.29	0.207	61.78
54649	RY1	Putative nucleic acid binding protein RY-1	203.85	97.67	0.241	75.69
55682	EIF3S7	Eukaryotic translation initiation factor 3. subunit 7 zeta. 66/67 kDa	455.77	153.84	0.034	89.94
55847	MRPL51	Mitochondrial ribosomal protein L51	122.64	99.22	0.241	154.55
58488	CTNNAL1	Catenin (cadherin-associated protein), alpha-like 1	126.66	70.42	0.379	68.29
58992	SMC4	Structural maintenance of chromosomes 4	228.66	99.66	0.207	72.95
59486	HSDL2	Hydroxysteroid dehydrogenase like 2	129.48	73.68	0.345	63.64
61812	PTPN12	Protein tyrosine phosphatase. non-receptor type 12	108.62	74.97	0.345	108.97
65234	DDX27	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	199.19	91.01	0.241	62.30
65238	RNF40	Ring finger protein 40	193.26	81.38	0.172	54.91
66048	MAP1S	Microtubule-associated protein 1S	131.74	79.04	0.276	47.23
66915	C22orf16	Chromosome 22 open reading frame 16	135.11	102.77	0.379	60.49
68714	SFRS1	Splicing factor, arginine/serine-rich 1 (splicing factor 2. alternate	249.07	79.18	0.103	98.30
		splicing factor)
69293	HEXB	Hexosaminidase B (beta polypeptide)	198.57	153.59	0.276	71.52
69554	RNF126	Ring finger protein 126	161.03	83.35	0.241	55.88
69855	UNR	Cold shock domain containing E1, RNA-binding	657.29	110.51	0.103	304.45
71465	SQLE	Squalene epoxidase	105.27	62.62	0.276	77.51
71787	MRPS7	Mitochondrial ribosomal protein S7	159.90	59.92	0.310	86.87
73527	CSNK2B	Casein kinase 2. beta polypeptide	202.65	73.01	0.207	101.19
73722	APEX1	APEX nuclease (multifunctional DNA repair enzyme) 1	339.50	85.30	0.103	230.38
73799	GNAI3	Guanine nucleotide binding protein (G protein). alpha inhibiting	150.46	62.95	0.207	56.56
		activity polypeptide 3
73965	SFRS2	Hypothetical protein ET	280.26	73.78	0.000	222.54
74047	ETFB	Electron-transfer-flavoprotein, beta polypeptide	168.06	80.53	0.138	68.32
74050	FVT1	Follicular lymphoma variant translocation 1	98.29	70.32	0.379	59.60
74137	TMED10	Transmembrane emp24-like trafficking protein 10 (yeast)	237.09	91.81	0.138	150.00
74375	DVL1	Dishevelled, dsh homolog 1 (Drosophila)	133.54	77.04	0.276	79.92
74405	YWHAQ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	413.13	88.00	0.034	420.70
		activation protein. theta polypeptide
74471	GJA1	Gap junction protein, alpha 1. 43 kDa (connexin 43)	183.35	62.77	0.379	500.49
74563	OAZ2	Ornithine decarboxylase antizyme 2	193.33	73.23	0.103	86.41
74564	SSR2	Signal sequence receptor. beta (translocon-associated protein	312.91	86.38	0.034	107.44
		beta)
74576	GDI1	GDP dissociation inhibitor 1	230.50	117.59	0.138	161.01
75056	TIMM13	Translocase of inner mitochondrial membrane 13 homolog (yeast)	225.25	76.11	0.345	109.02
75061	MARCKSL	MARCKS-like 1	449.23	89.23	0.103	136.56
75066	TSN	Translin	128.46	75.98	0.345	72.68
75087	FASTK	Fas-activated serine/threonine kinase	179.08	68.42	0.345	123.07
75117	ILF2	Interleukin enhancer binding factor 2. 45 kDa	349.26	76.78	0.034	86.61
75133	TFAM	Transcription factor A, mitochondrial	111.21	68.59	0.310	47.20
75139	ARFIP2	ADP-ribosylation factor interacting protein 2 (arfaptin 2)	178.80	116.43	0.345	37.76
75189	DAP	Death-associated protein	217.73	94.24	0.103	143.76
75227	NDUFA9	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39	290.29	122.15	0.138	97.37
75243	BRD2	Bromodomain containing 2	301.76	102.55	0.069	150.65
75249	ARL6IP1	ADP-ribosylation factor-like 6 interacting protein 1	269.13	69.42	0.172	141.78
75254	IRF3	Interferon regulatory factor 3	131.45	93.03	0.345	57.56
75318	TUBA4A	Tubulin, alpha 4a	346.93	95.88	0.276	72.41
75348	PSME1	Proteasome (prosome, macropain) activator subunit 1 (PA28	196.67	85.95	0.138	139.00
		alpha)
75438	QDPR	Quinoid dihydropteridine reductase	239.93	101.27	0.345	88.56
75527	ADSL	Adenylosuccinate lyase	187.36	79.69	0.000	46.87
75724	COPB2	Coatomer protein complex, subunit beta 2 (beta prime)	169.19	70.94	0.172	144.95
75798	C20orf111	Chromosome 20 open reading frame 111	138.12	60.97	0.379	52.53
75841	ERP29	Endoplasmic reticulum protein 29	170.38	80.11	0.276	109.13
75890	MBTPS1	Membrane-bound transcription factor peptidase, site 1	143.96	76.79	0.241	59.34
75914	TMED2	Transmembrane emp24 domain trafficking protein 2	257.34	78.55	0.103	201.28
76111	DAG1	Dystroglycan 1 (dystrophin-associated glycoprotein 1)	185.89	66.32	0.310	97.04
76394	ECHS1	Enoyl Coenzyme A hydratase. short chain. 1. mitochondrial	296.18	99.29	0.207	101.19
76480	UBL4A	Ubiquitin-like 4A	177.47	73.71	0.379	41.09
76662	ZDHHC16	Zinc finger. DHHC-type containing 16	138.92	90.05	0.276	57.18
76686	GPX1	Glutathione peroxidase 1	154.93	84.27	0.276	234.43
76847	GANAB	Glucosidase. alpha; neutral AB	371.62	103.22	0.138	252.72
77060	PSMB6	Proteasome (prosome, macropain) subunit. beta type. 6	258.61	103.69	0.172	150.18
77269	GNAI2	Guanine nucleotide binding protein (G protein), alpha inhibiting	454.86	93.08	0.103	370.28
		activity polypeptide 2
77313	CDK10	Cyclin-dependent kinase (CDC2-like) 10	98.89	72.87	0.345	69.26
77422	PLP2	Proteolipid protein 2 (colonic epithelium-enriched)	189.36	121.71	0.310	104.42
77558	HMGN3	High mobility group nucleosomal binding domain 3	161.44	94.74	0.207	171.44
77578	USP9X	Ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)	143.39	67.26	0.310	52.03
77793	CSK	C-src tyrosine kinase	222.19	95.17	0.310	68.74
77897	SF3A3	Splicing factor 3a, subunit 3, 60 kDa	169.65	127.16	0.276	81.46
77961	HLA-B	Major histocompatibility complex, class I, B	851.44	157.10	0.103	105.86
77978		Hypothetical protein DKFZp761I2123	115.47	65.78	0.345	70.16
78466	PSMD8	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	274.96	128.74	0.241	119.08
78601	UROD	Uroporphyrinogen decarboxylase	187.65	84.63	0.103	96.65
78771	PGK1	Phosphoglycerate kinase 1	681.19	86.72	0.034	423.67
78880	ILVBL	IlvB (bacterial acetolactate synthase)-like	185.37	153.08	0.379	101.11
78888	DBI	Diazepam binding inhibitor (GABA receptor modulator, acyl-	220.96	127.35	0.241	166.57
		Coenzyme A binding protein)
78989	ADH5	Alcohol dehydrogenase 5 (class III), chi polypeptide	179.39	72.64	0.034	89.94
79064	DHPS	Deoxyhypusine synthase	164.95	100.52	0.241	47.03
79081	PPP1CC	Protein phosphatase 1, catalytic subunit. gamma isoform	318.25	84.70	0.103	100.43
79088	RCN2	Reticulocalbin 2, EF-hand calcium binding domain	150.90	75.39	0.207	99.10
79101	CCNG1	Cyclin G1	240.04	67.65	0.069	82.44
79110	NCL	Nucleolin	293.04	63.35	0.034	210.54
79322	QARS	Glutaminyl-tRNA synthetase	402.46	67.92	0.138	149.07
79335	SMARCD1	SWI/SNF related. matrix associated. actin dependent regulator of	146.36	68.95	0.241	54.24
		chromatin, subfamily d, member 1
79387	PSMC5	Proteasome (prosome, macropain) 26S subunit, ATPase. 5	243.74	74.96	0.138	158.29
79402	POLR2C	Polymerase (RNA) Il (DNA directed) polypeptide C, 33 kDa	146.42	65.99	0.241	62.49
79411	RPA2	Replication protein A2. 32 kDa	179.33	111.72	0.345	81.59
79625	C20orf149	Chromosome 20 open reading frame 149	361.43	94.87	0.310	218.44
80545	RPL37	Ribosomal protein L37	755.77	355.66	0.103	2167.23
80919	SYPL1	Synaptophysin-like 1	215.72	101.08	0.207	132.20
80986	ATP5G1	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	209.65	91.99	0.276	223.23
		c (subunit 9), isoform 1
81328	NFKBIA	Nuclear factor of kappa light polypeptide gene enhancer in B-cells	186.76	120.33	0.345	367.44
		inhibitor, alpha
81424	SUMO1	SMT3 suppressor of mif two 3 homolog 1 (yeast)	313.72	89.00	0.034	338.47
81848	RAD21	RAD21 homolog (S. pombe)	368.76	164.73	0.103	102.70
81964	SEC24C	SEC24 related gene family, member C (S. cerevisiae)	186.43	96.07	0.241	56.08
82201	CSNK2A2	Casein kinase 2, alpha prime polypeptide	123.76	72.38	0.310	77.63
82327	GSS	Glutathione synthetase	184.39	77.08	0.138	47.74
82719	YIPF6	Yip1 domain family, member 6	123.85	72.31	0.379	40.25
82793	PSMB3	Proteasome (prosome. macropain) subunit, beta type, 3	158.41	64.83	0.138	168.49
82887	PPP1R11	Protein phosphatase 1, regulatory (inhibitor) subunit 11	190.42	75.63	0.241	36.52
82890	DAD1	Defender against cell death 1	202.51	132.00	0.310	176.07
82916	CCT6A	Chaperonin containing TCP1, subunit 6A (zeta 1)	407.59	75.69	0.034	155.89
82927	AMPD2	Adenosine monophosphate deaminase 2 (isoform L)	148.16	149.07	0.345	62.69
83190	FASN	Fatty acid synthase	562.35	101.57	0.241	249.20
83347	AAMP	Angio-associated, migratory cell protein	224.46	80.95	0.138	75.73
83383	PRDX4	Peroxiredoxin 4	152.24	74.89	0.379	62.85
83734	STX4	Syntaxin 4	117.13	61.41	0.276	65.02
83753	SNRPB	Small nuclear ribonucleoprotein polypeptides B and B1	874.09	87.85	0.138	206.87
83765	DHFR	Dihydrofolate reductase	111.62	78.02	0.310	60.49
83916	NDUFA5	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13	455.28	149.11	0.207	146.78
84359	GABARAP	GABA(A) receptor-associated protein	190.65	77.34	0.138	153.83
84753	NT5DC2	5′-nucleotidase domain containing 2	158.64	96.33	0.310	142.25
85155	ZFP36L1	Zinc finger protein 36, C3H type-like 1	196.81	98.76	0.207	254.51
85769	DNTTIP2	Deoxynucleotidyltransferase, terminal. interacting protein 2	105.55	51.70	0.379	54.58
85962	CTF8	Chromosome transmission fidelity factor 8 homolog (S. cerevisiae)	170.29	139.62	0.276	49.58
86131	FADD	Fas (TNFRSF6)-associated via death domain	158.82	101.13	0.172	69.23
87752	MSN	Moesin	275.46	95.27	0.103	181.99
89545	PSMB4	Proteasome (prosome, macropain) subunit, beta type. 4	463.81	87.69	0.034	224.28
89643	TKT	Transketolase (Wernicke-Korsakoff syndrome)	588.97	97.80	0.103	201.22
89649	EPHX1	Epoxide hydrolase 1, microsomal (xenobiotic)	238.26	88.30	0.345	128.11
89781	UBTF	Upstream binding transcription factor. RNA polymerase I	121.71	54.79	0.241	117.56
89864	SKIV2L	Superkiller viralicidic activity 2-like (S. cerevisiae)	132.50	66.99	0.379	46.22
90061	PGRMC1	Progesterone receptor membrane component 1	194.16	93.36	0.172	99.80
90093	HSPA4	Heat shock 70 kDa protein 4	149.59	74.25	0.172	62.89
90107	ADRM1	Adhesion regulating molecule 1	246.89	81.18	0.172	107.95
90443	NDUFS8	NADH dehydrogenase (ubiquinone) Fe—S protein 8, 23 kDa	153.66	106.13	0.207	151.21
		(NADH-coenzyme Q reductase)
91142	KHSRP	KH-type splicing regulatory protein (FUSE binding protein 2)	237.57	80.25	0.241	191.59
91531	MLLT6	Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog,	163.44	99.71	0.207	48.01
		Drosophila); translocated to, 6
93659	PDIA4	Protein disulfide isomerase family A. member 4	221.64	92.23	0.207	119.28
93832	TMCO1	Transmembrane and coiled-coil domains 1	215.75	94.44	0.138	138.95
95577	CDK4	Cyclin-dependent kinase 4	512.67	181.54	0.103	70.34
96530	COX11	COX11 homolog, cytochrome c oxidase assembly protein (yeast)	133.50	61.61	0.241	44.09
96852	EDC3	Enhancer of mRNA decapping 3 homolog (S. cerevisiae)	315.49	327.98	0.345	49.12
96996	HNRPA0	Heterogeneous nuclear ribonucleoprotein A0	203.93	87.67	0.172	175.06
97616	SH3GL1	SH3-domain GRB2-like 1	271.66	106.70	0.069	109.70
97887	RCN1	Reticulocalbin 1, EF-hand calcium binding domain	176.05	78.51	0.207	128.29
98751	FUBP3	Far upstream element (FUSE) binding protein 3	115.91	57.99	0.276	79.69
98791	ACTR1B	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	154.61	74.84	0.276	46.33
102696	MCTS1	Malignant T cell amplified sequence 1	182.20	108.79	0.379	89.54
102798	PSMA1	Proteasome (prosome, macropain) subunit, alpha type. 1	222.80	73.98	0.069	117.56
103561	ARL6IP4	ADP-ribosylation-like factor 6 interacting protein 4	177.34	82.48	0.172	125.24
103834	TMEM106C	Transmembrane protein 106C	164.57	88.83	0.138	88.84
104839	TIMP2	TIMP metallopeptidase inhibitor 2	266.07	83.65	0.172	326.45
105547	NPDC1	Neural proliferation, differentiation and control, 1	184.55	89.27	0.345	240.66
106185	RALGDS	Ral guanine nucleotide dissociation stimulator	113.28	56.31	0.379	94.40
106876	ATP6V0D1	ATPase. H+ transporting. lysosomal 38 kDa. V0 subunit d isoform	157.31	76.54	0.207	90.28
		1
106909	ANAPC13	Anaphase promoting complex subunit 13	409.28	124.92	0.310	82.82
107003	CCNB1IP1	Cyclin B1 interacting protein 1	198.64	135.06	0.207	2470.25
107101	C1orf86	Chromosome 1 open reading frame 86	132.02	90.12	0.310	102.36
107387	C7orf20	Chromosome 7 open reading frame 20	158.14	146.65	0.379	85.47
107393	CLDND1	Claudin domain containing 1	182.62	98.17	0.276	55.41
108029	SH3BGRL	SH3 domain binding glutamic acid-rich protein like	217.90	129.37	0.138	173.06
108080	CSRP1	Cysteine and glycine-rich protein 1	226.87	81.65	0.172	326.55
108371	E2F4	E2F transcription factor 4. p107/p130-binding	124.23	53.45	0.207	64.69
108408	APH1A	Anterior pharynx defective 1 homolog A (C. elegans)	214.52	73.54	0.276	115.29
108957	RPS27L	Ribosomal protein S27-like	214.43	105.97	0.345	197.20
108969	C19orf56	Chromosome 19 open reading frame 56	165.48	98.67	0.207	145.21
109051	SH3BGRL3	SH3 domain binding glutamic acid-rich protein like 3	190.53	95.77	0.207	158.45
109052	C14orf2	Chromosome 14 open reading frame 2	254.93	147.67	0.310	191.48
109672	ST6GALNAC6	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-	113.89	58.27	0.379	67.37
		acetylgalactosaminide alpha-2,6-sialyltransferase 6
109798	C6orf48	Chromosome 6 open reading frame 48	221.40	98.21	0.207	94.17
110695	SF3B5	Splicing factor 3b, subunit 5, 10 kDa	161.11	93.81	0.310	280.95
110849	ESRRA	Estrogen-related receptor alpha	243.72	107.89	0.310	78.88
111286	MRPS11	Mitochondrial ribosomal protein S11	118.62	52.84	0.207	53.04
111577	ITM2C	Integral membrane protein 2C	293.83	115.98	0.138	172.80
111801	ARS2	ARS2 protein	213.16	99.08	0.276	50.72
112058	SIVA1	SIVA1, apoptosis-inducing factor	161.23	58.99	0.345	75.36
112318	TOMM7	Translocase of outer mitochondrial membrane 7 homolog (yeast)	406.79	253.67	0.276	376.30
112955	NUDT5	Nudix (nucleoside diphosphate linked moiety X)-type motif 5	197.68	94.29	0.276	63.30
114033	SSR1	Signal sequence receptor, alpha (translocon-associated protein	161.00	68.79	0.207	55.66
		alpha)
114286	CD9	CD9 antigen (p24)	239.20	130.06	0.172	227.35
114412	TXNL1	Thioredoxin-like 1	117.31	93.59	0.207	120.38
115474	RFC3	Replication factor C (activator 1) 3, 38 kDa	175.70	158.89	0.345	40.56
115792	EXOSC7	Exosome component 7	134.25	74.20	0.207	51.01
116448	GLS	Glutaminase	192.13	67.06	0.379	38.83
117176	PABPN1	Poly(A) binding protein, nuclear 1	124.05	80.27	0.276	277.14
117715	ST5	Suppression of tumorigenicity 5	101.33	55.39	0.379	68.40
118110	BST2	Bone marrow stromal cell antigen 2	216.68	84.28	0.241	177.54
118400	FSCN1	Fascin homolog 1, actin-bundling protein (Strongylocentrotus	684.83	91.57	0.241	277.47
		purpuratus)
118463	PNPLA2	Patatin-like phospholipase domain containing 2	162.21	88.10	0.345	139.17
118638	NME1	Non-metastatic cells 1, protein (NM23A) expressed in	290.12	103.60	0.172	202.48
118722	FUT8	Fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	118.38	149.55	0.379	65.86
118964	GATAD2A	GATA zinc finger domain containing 2A	124.22	85.19	0.310	40.82
118983	GSDMDC1	Gasdermin domain containing 1	184.87	95.75	0.379	147.97
119177	ARF3	ADP-ribosylation factor 3	239.68	76.49	0.138	139.61
119192	H2AFZ	H2A histone family, member Z	453.31	159.40	0.103	221.14
119251	UQCRC1	Ubiquinol-cytochrome c reductase core protein I	442.99	74.48	0.103	152.44
119591	AP2S1	Adaptor-related protein complex 2. sigma 1 subunit	177.74	82.21	0.241	121.28
119598	RPL3	Ribosomal protein L3	3807.92	79.61	0.000	1976.38
120323	LOC26010	Viral DNA polymerase-transactivated protein 6	128.35	69.74	0.310	119.93
121088	NUP153	Nucleoporin 153 kDa	123.13	79.84	0.310	76.28
121549	CDIPT	CDP-diacylglycerol-inositol 3-phosphatidyltransferase	177.98	81.88	0.241	115.81
		(phosphatidylinositol synthase)
122363	WIPI2	WD repeat domain, phosphoinositide interacting 2	186.76	89.61	0.138	78.30
122523	SND1	Staphylococcal nuclease domain containing 1	355.50	74.36	0.034	106.76
124126	ARPC1A	Actin related protein 2/3 complex. subunit 1 A. 41 kDa	206.46	81.13	0.103	122.85
124147	FBXL11	PRO1880 protein	144.07	78.43	0.207	52.87
124246	C10orf119	Chromosome 10 open reading frame 119	144.50	66.52	0.172	76.17
124366	BBX	Bobby sox homolog (Drosophila)	147.83	66.94	0.345	56.68
125113	CCT8	Chaperonin containing TCP1, subunit 8 (theta)	187.53	84.03	0.034	136.62
125867	EVL	Enah/Vasp-like	170.08	84.54	0.276	196.70
125898	GNAS	GNAS complex locus	669.01	93.40	0.069	471.82
126497	AEBP2	AE binding protein 2	102.85	77.77	0.379	126.95
126774	DTL	Denticleless homolog (Drosophila)	160.79	71.32	0.379	58.18
126938	NAPA	N-ethylmaleimide-sensitive factor attachment protein, alpha	196.92	84.26	0.069	106.30
127092	DHX38	DEAH (Asp-Glu-Ala-His) box polypeptide 38	168.85	103.87	0.379	51.60
127249	SNF8	SNF8, ESCRT-II complex subunit. homolog (S. cerevisiae)	134.67	80.08	0.310	125.84
127386	MAMDC2	MAM domain containing 2	147.47	78.47	0.241	343.27
127764	RAB5C	RAB5C, member RAS oncogene family	242.33	112.45	0.276	245.24
128065	CTSC	Cathepsin C	238.81	102.05	0.207	76.06
128199	SEPT11	Septin 11	159.83	63.97	0.241	90.00
128548	WDR1	WD repeat domain 1	267.90	69.81	0.069	103.72
129634	CINP	Cyclin-dependent kinase 2-interacting protein	104.53	70.89	0.345	34.81
129673	EIF4A1	Eukaryotic translation initiation factor 4A. isoform 1	1492.15	82.19	0.000	380.49
130031	TRIO	Triple functional domain (PTPRF interacting)	142.59	75.94	0.310	334.92
130098	DDX23	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	188.55	94.45	0.172	50.98
130293	CROP	Cisplatin resistance-associated overexpressed protein	152.55	84.06	0.207	191.28
130413	TM9SF2	Transmembrane 9 superfamily member 2	210.83	99.09	0.103	49.93
131226	BNIP3L	BCL2/adenovirus E1B 19 kDa interacting protein 3-like	192.67	70.38	0.241	50.95
132497	PRNPIP	Prion protein interacting protein	168.32	67.74	0.310	103.21
132513	HSD17B12	Hydroxysteroid (17-beta) dehydrogenase 12	137.10	95.65	0.207	48.15
133892	TPM1	Tropomyosin 1 (alpha)	606.98	169.48	0.207	189.30
134074	SLC35E1	Solute carrier family 35, member E1	110.83	70.67	0.345	72.41
134688	PSMD13	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	304.05	104.85	0.207	57.48
135406	CEBPZ	CCAAT/enhancer binding protein zeta	126.72	64.41	0.207	51.10
136905	HUWE1	HECT, UBA and WWE domain containing 1	196.13	66.09	0.138	75.28
136947	RALY	RNA binding protein. autoantigenic (hnRNP-associated with lethal	339.69	92.28	0.069	169.57
		yellow homolog (mouse))
137510	NCOR2	Nuclear receptor co-repressor 2	243.82	126.40	0.207	47.10
138860	ARHGAP1	Rho GTPase activating protein 1	106.56	50.87	0.310	92.98
139896	MAEA	Macrophage erythroblast attacher	203.45	84.45	0.276	56.94
140452	M6PRBP1	Mannose-6-phosphate receptor binding protein 1	381.09	119.04	0.138	119.07
142442	HP1BP3	Heterochromatin protein 1. binding protein 3	161.28	66.57	0.207	72.01
143187	DDX49	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	144.35	67.10	0.241	59.63
143766	ATN1	Atrophin 1	184.56	86.85	0.207	76.29
143873	S100A10	S100 calcium binding protein A10 (annexin II ligand, calpactin I,	255.56	111.88	0.172	675.77
		light polypeptide (p11))
144058	NAT9	N-acetyltransferase 9	99.56	67.02	0.345	45.72
144468	CHID1	Chitinase domain containing 1	179.03	105.35	0.241	103.94
144835	EEF1G	Eukaryotic translation elongation factor 1 gamma	4056.39	76.55	0.000	1929.11
144868	VTI1B	Vesicle transport through interaction with t-SNAREs homolog 1B	103.57	54.85	0.310	47.28
		(yeast)
144941	LRRC41	Leucine rich repeat containing 41	152.40	71.74	0.172	45.67
144949	ZNF313	Zinc finger protein 313	145.79	62.78	0.138	63.37
144980	SCAMP4	Secretory carrier membrane protein 4	127.39	96.37	0.345	60.46
145049	PLEKHM2	Pleckstrin homology domain containing. family M (with RUN	205.68	86.88	0.138	45.61
		domain) member 2
145442	MAP2K1	Mitogen-activated protein kinase kinase 1	101.59	55.16	0.241	57.21
145575	UBL3	Ubiquitin-like 3	157.68	79.65	0.345	90.10
146070	TPM3	Tropomyosin 3	695.80	102.33	0.000	175.65
146393	HERPUD1	Homocysteine-inducible, endoplasmic reticulum stress-inducible.	226.44	86.29	0.172	101.04
		ubiquitin-like domain member 1
146602	UQCRQ	Ubiquinol-cytochrome c reductase. complex III subunit VII. 9.5 kDa	193.38	169.43	0.276	312.78
146804	SPIN1	Spindlin 1	127.00	68.69	0.345	46.25
146806	CUL1	Cullin 1	120.27	57.50	0.207	69.33
147433	PCNA	Proliferating cell nuclear antigen	258.31	133.96	0.172	92.79
148078	UBR4	Ubiquitin protein ligase E3 component n-recognin 4	144.18	73.44	0.138	81.01
148272	CCM2	Cerebral cavernous malformation 2	199.79	94.01	0.207	76.34
148330	ARF4	ADP-ribosylation factor 4	385.93	105.50	0.138	153.40
148340	PTPRG	Protein tyrosine phosphatase, receptor type, G	1592.61	150.52	0.069	252.27
148670	RHOBTB1	Rho-related BTB domain containing 1	116.95	99.14	0.345	47.31
149004	FBXO31	F-box protein 31	141.63	81.88	0.379	71.24
149957	RPS6KA1	Ribosomal protein S6 kinase, 90 kDa, polypeptide 1	146.89	140.85	0.310	62.80
149983	PEX14	Peroxisomal biogenesis factor 14	132.69	140.50	0.241	43.40
150107	BIRC6	Baculoviral IAP repeat-containing 6 (apollon)	149.90	66.77	0.345	78.67
150540	TMEM112B	Transmembrane protein 112B	180.63	177.93	0.379	53.76
150580	EIF1	Eukaryotic translation initiation factor 1	458.80	84.42	0.034	865.15
150837	TXNDC5	Thioredoxin domain containing 5	483.23	126.33	0.034	99.46
151134	OXA1L	Oxidase (cytochrome c) assembly 1-like	238.54	70.29	0.103	62.00
151220	PALLD	Palladin, cytoskeletal associated protein	198.94	75.04	0.345	113.44
151413	GMFB	Glia maturation factor beta	190.53	95.31	0.379	113.32
151787	EFTUD2	Elongation factor Tu GTP binding domain containing 2	326.78	81.27	0.069	105.28
152536	PSMD6	Proteasome (prosome, macropain) 26S subunit, non-ATPase. 6	134.14	63.78	0.241	75.62
153177	RPS28	Ribosomal protein S28	437.53	297.35	0.241	1095.00
154023	TXNDC4	Thioredoxin domain containing 4 (endoplasmic reticulum)	133.74	72.55	0.345	51.92
154073	SLC35B1	Solute carrier family 35. member B1	99.61	61.75	0.379	52.53
155165	ZFPL1	Zinc finger protein-like 1	156.23	92.72	0.310	64.84
155218	HNRPUL1	Heterogeneous nuclear ribonucleoprotein U-like 1	474.38	82.52	0.000	175.01
155396	NFE2L2	Nuclear factor (erythroid-derived 2)-like 2	182.54	63.38	0.172	76.81
155829	TBC1D9B	TBC1 domain family, member 9B (with GRAM domain)	189.13	67.14	0.241	61.75
156171	PSMC6	Proteasome (prosome, macropain) 26S subunit, ATPase. 6	202.42	86.99	0.172	72.51
156367	RPS29	Ribosomal protein S29	735.43	357.07	0.241	2469.70
156667	CALCOCO	Calcium binding and coiled-coil domain 1	150.95	83.49	0.276	48.15
157160	MRPS34	Mitochondrial ribosomal protein S34	163.79	79.67	0.276	94.71
157351	GTPBP9	GTP-binding protein 9 (putative)	256.77	85.59	0.207	86.88
157379	H2AFV	H2A histone family. member V	212.94	72.40	0.138	196.03
157394	HAGH	Hydroxyacylglutathione hydrolase	110.09	79.63	0.345	58.25
159014	PRPF4B	PRP4 pre-mRNA processing factor 4 homolog B (yeast)	101.54	63.09	0.379	87.15
159118	AMD1	Adenosylmethionine decarboxylase 1	179.16	87.63	0.241	87.60
159130	RAF1	V-raf-1 murine leukemia viral oncogene homolog 1	148.50	123.34	0.138	75.30
159161	ARHGDIA	Rho GDP dissociation inhibitor (GDI) alpha	781.87	98.28	0.138	124.37
159699	FBXO21	F-box protein 21	112.15	59.46	0.345	78.43
159799	THRAP2	Thyroid hormone receptor associated protein 2	135.37	68.96	0.345	57.41
160958	CDC37	CDC37 cell division cycle 37 homolog (S. cerevisiae)	297.55	114.77	0.069	93.25
161357	PDHB	Pyruvate dehydrogenase (lipoamide) beta	188.51	80.70	0.172	57.45
162032	HBP1	HMG-box transcription factor 1	119.42	40.70	0.345	76.14
162233	CHD4	Chromodomain helicase DNA binding protein 4	294.77	95.15	0.207	209.93
162877	PACSIN2	Protein kinase C and casein kinase substrate in neurons 2	181.10	101.47	0.207	88.79
163645	MOCS2	Molybdenum cofactor synthesis 2	123.58	91.10	0.276	59.81
163776	UBE2J1	Ubiquitin-conjugating enzyme E2. J1 (UBC6 homolog. yeast)	229.95	250.60	0.310	47.01
163893	PICALM	Phosphatidylinositol binding clathrin assembly protein	153.29	84.25	0.310	98.35
165195	VAPA	VAMP (vesicle-associated membrane protein)-associated protein	170.73	76.58	0.069	115.35
		A. 33 kDa
166011	CTNND1	Catenin (cadherin-associated protein), delta 1	181.39	76.07	0.138	75.94
166204	PHF1	PHD finger protein 1	128.96	77.28	0.345	43.53
166463	HNRPU	Heterogeneous nuclear ribonucleoprotein U (scaffold attachment	279.34	89.13	0.034	185.87
		factor A)
166924	SEC13	SEC13 homolog (S. cerevisiae)	164.56	70.57	0.207	99.75
166975	SFRS5	Splicing factor, arginine/serine-rich 5	241.85	95.20	0.138	153.47
167535	SRP54	Signal recognition particle 54 kDa	132.08	105.35	0.241	43.01
168073	TRPC4AP	Transient receptor potential cation channel, subfamily C, member	174.32	67.74	0.241	95.49
		4 associated protein
168799	METTL3	Methyltransferase like 3	133.88	65.22	0.172	71.62
169611	DIABLO	Diablo homolog (Drosophila)	167.55	69.66	0.276	41.81
169718	CNN2	Calponin 2	263.90	111.61	0.138	133.00
170107	UQCRFS1	Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide	112.20	75.09	0.241	76.06
170131	NFIC	Nuclear factor I/C (CCAAT-binding transcription factor)	128.62	75.64	0.379	73.22
170553	CNOT7	CCR4-NOT transcription complex, subunit 7	119.98	77.62	0.276	62.09
170622	CFL1	Cofilin 1 (non-muscle)	1372.26	96.41	0.034	1717.53
171626	SKP1A	S-phase kinase-associated protein 1A (p19A)	457.12	128.78	0.138	403.46
172550	PTBP1	Polypyrimidine tract binding protein 1	554.08	85.76	0.103	138.65
172755	BRP44L	Brain protein 44-like	150.10	97.09	0.379	90.49
172928	COL1A1	Collagen, type I, alpha 1	657.85	170.49	0.276	1790.49
173024	NUB1	Negative regulator of ubiquitin-like proteins 1	102.38	55.09	0.276	49.89
173162	COX4NB	COX4 neighbor	259.86	100.34	0.310	48.81
173381	DPYSL2	Dihydropyrimidinase-like 2	213.62	76.62	0.310	337.96
173464	FKBP8	FK506 binding protein 8, 38 kDa	446.43	105.38	0.103	241.30
173611	NDUFS2	NADH dehydrogenase (ubiquinone) Fe—S protein 2, 49 kDa	308.98	100.60	0.069	103.79
		(NADH-coenzyme Q reductase)
173705	LOC40115	HCV F-transactivated protein 1	155.92	91.92	0.207	105.45
173724	CKB	Creatine kinase, brain	395.40	117.54	0.310	500.02
174050	EDF1	Endothelial differentiation-related factor 1	163.11	77.20	0.345	295.84
174195	IFITM2	Interferon induced transmembrane protein 2 (1-8D)	439.92	224.90	0.276	123.33
175473	AK1	Adenylate kinase 1	115.05	96.67	0.345	154.31
175955	YTHDC1	YTH domain containing 1	114.99	56.92	0.310	51.24
177530	ATP5E	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilo	343.57	172.81	0.207	738.25
		subunit
177766	PARP1	Poly (ADP-ribose) polymerase family, member 1	260.77	114.80	0.103	88.33
178551	RPL8	Ribosomal protein L8	1600.62	93.63	0.034	951.00
178728	MBD3	Methyl-CpG binding domain protein 3	226.33	93.86	0.241	150.69
179986	FLOT1	Flotillin 1	239.64	133.66	0.241	173.68
180141	CFL2	Cofilin 2 (muscle)	236.22	198.55	0.345	58.91
180312	MRPS16	Mitochondrial ribosomal protein S16	148.32	71.61	0.276	43.03
180414	HSPA8	Heat shock 70 kDa protein 8	1204.20	99.10	0.000	543.94
180877	H3F3B	H3 histone, family 3B (H3.3B)	701.35	71.33	0.000	322.18
180903	NCAPH2	Non-SMC condensin II complex, subunit H2	273.31	91.43	0.310	66.01
180909	PRDX1	Peroxiredoxin 1	973.56	146.34	0.138	346.95
180933	CXXC1	CXXC finger 1 (PHD domain)	127.97	58.18	0.345	51.48
181046	DUSP3	Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-	168.09	115.04	0.207	74.49
		related)
181112	MED4	Mediator of RNA polymerase II transcription, subunit 4 homolog	208.67	152.66	0.276	52.19
		(yeast)
181163	HMGN2	High-mobility group nucleosomal binding domain 2	798.73	84.12	0.000	504.02
181244	HLA-A	Major histocompatibility complex, class I. A	874.95	96.35	0.138	945.29
181368	PRPF8	PRP8 pre-mRNA processing factor 8 homolog (yeast)	308.98	76.46	0.138	57.52
181444	TMEM9	Transmembrane protein 9	210.70	80.44	0.172	99.45
182255	NHP2L1	NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)	236.95	69.85	0.069	216.97
182626	C22orf5	Chromosome 22 open reading frame 5	189.45	87.32	0.310	85.24
182885	SLC35B2	Solute carrier family 35, member B2	197.27	131.49	0.241	71.21
183684	EIF4G2	Eukaryotic translation initiation factor 4 gamma, 2	571.05	99.96	0.069	244.19
183706	ADD1	Adducin 1 (alpha)	210.75	70.37	0.138	124.62
183800	RANGAP1	Ran GTPase activating protein 1	330.34	92.47	0.172	82.36
183850	DCTD	DCMP deaminase	140.58	59.00	0.345	50.00
183994	PPP1CA	Protein phosphatase 1, catalytic subunit, alpha isoform	374.52	71.55	0.103	122.79
184062	C20orf24	Chromosome 20 open reading frame 24	161.95	77.22	0.310	106.44
184211	PMPCB	Peptidase (mitochondrial processing) beta	177.15	64.50	0.138	44.05
184233	HSPA9	Heat shock 70 kDa protein 9 (mortalin)	311.24	80.92	0.034	155.04
184492	ELAVL1	ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu	130.66	66.07	0.207	61.10
		antigen R)
185172	GNB2	Guanine nucleotide binding protein (G protein), beta polypeptide 2	420.89	178.43	0.172	146.97
185597	SPG7	Spastic paraplegia 7. paraplegin (pure and complicated autosomal	167.10	102.17	0.207	85.24
		recessive)
187199	MALAT1	Metastasis associated lung adenocarcinoma transcript 1 (non-	3984.95	243.42	0.241	982.17
		coding RNA)
187635	RPS15A	Chromosome 20 open reading frame 19	705.06	435.58	0.138	584.60
187763	BRD4	Bromodomain containing 4	226.90	138.89	0.241	92.81
187866	NPTN	Neuroplastin	120.12	53.64	0.379	127.00
187946	SLC20A1	Solute carrier family 20 (phosphate transporter). member 1	141.36	96.84	0.207	79.95
188501	PAFAH1B2	Platelet-activating factor acetylhydrolase. isoform Ib. beta subunit	149.54	78.69	0.138	75.71
		30 kDa
188614	PLEKHA5	Pleckstrin homology domain containing. family A member 5	115.79	66.94	0.379	53.09
188879	RBM6	RNA binding motif protein 6	100.43	54.89	0.379	79.10
188882	NUDT3	Nudix (nucleoside diphosphate linked moiety X)-type motif 3	129.54	63.13	0.276	41.12
189075	TWF1	Twinfilin. actin-binding protein. homolog 1 (Drosophila)	164.98	70.22	0.310	103.18
189119	CXXC5	CXXC finger 5	97.63	45.99	0.345	191.46
189329	SMURF1	SMAD specific E3 ubiquitin protein ligase 1	126.19	77.52	0.379	46.81
189716	NDUFAB1	NADH dehydrogenase (ubiquinone) 1. alpha/beta subcomplex, 1.	224.85	87.06	0.276	59.73
		8 kDa
189772	CCT2	Chaperonin containing TCP1, subunit 2 (beta)	269.61	95.66	0.069	124.53
190028	GSTO1	Glutathione S-transferase omega 1	178.51	92.79	0.241	87.26
190086	MRCL3	Myosin regulatory light chain MRCL3	469.83	322.83	0.172	204.74
190334	RAP1A	RAP1A, member of RAS oncogene family	130.79	76.47	0.310	49.76
190384	COPS4	COP9 constitutive photomorphogenic homolog subunit 4	163.76	100.38	0.138	59.12
		(Arabidopsis)
190722	C19orf62	Chromosome 19 open reading frame 62	218.33	85.79	0.207	75.54
190904	STRN4	Striatin. calmodulin binding protein 4	183.13	100.67	0.241	74.69
191186	TTC17	Tetratricopeptide repeat domain 17	125.42	63.68	0.310	43.91
191346	SEPT7	Septin 7	318.59	80.82	0.103	196.34
191518	DHX9	DEAH (Asp-Glu-Ala-His) box polypeptide 9	239.90	67.53	0.241	61.56
191987	UBE2J2	Ubiquitin-conjugating enzyme E2. J2 (UBC6 homolog. yeast)	125.95	71.90	0.207	35.20
192316	CDC2L1	Cell division cycle 2-like 1 (PITSLRE proteins)	102.48	85.83	0.379	83.41
192374	HSP90B1	Heat shock protein 90 kDa beta (Grp94), member 1	388.12	88.21	0.034	487.07
192425	EIF3S8	Eukaryotic translation initiation factor 3, subunit 8, 110 kDa	1001.22	91.36	0.103	382.10
193118	ZMIZ1	Zinc finger. MIZ-type containing 1	125.42	71.59	0.345	103.91
193163	BIN1	Bridging integrator 1	216.65	88.45	0.241	86.88
193491	TUBB6	Tubulin. beta 6	255.15	94.70	0.241	85.60
194329	TCEAL4	Transcription elongation factor A (SII)-like 4	110.76	60.41	0.207	98.50
194718	ZRANB2	Zinc finger. RAN-binding domain containing 2	170.63	70.34	0.207	60.86
195464	FLNA	Filamin A, alpha (actin binding protein 280)	554.90	92.75	0.172	45.29
195642	RNF213	Ring finger protein 213	146.02	74.10	0.379	49.42
196983	SSFA2	Sperm specific antigen 2	238.74	197.56	0.241	41.49
198281	PKM2	Pyruvate kinase, muscle	3044.33	101.80	0.000	562.77
199561	RANBP2	RAN binding protein 2	134.09	59.13	0.379	78.36
199625	HAX1	HCLS1 associated protein X-1	243.58	94.74	0.138	231.23
200063	HDAC7A	Histone deacetylase 7A	252.27	159.81	0.241	66.57
200600	SCAMP3	Secretory carrier membrane protein 3	165.58	75.71	0.207	82.26
200804	SDCBP	Syndecan binding protein (syntenin)	355.16	73.99	0.172	100.60
201253	CKAP5	Cytoskeleton associated protein 5	157.71	77.53	0.069	51.67
201390	WDR45L	WDR45-like	115.15	53.09	0.138	66.73
201712	GLG1	Golgi apparatus protein 1	128.23	88.99	0.310	62.32
202011	CCDC47	Coiled-coil domain containing 47	108.62	67.48	0.172	152.06
202085	VDAC1	Voltage-dependent anion channel 1	179.22	70.07	0.276	154.71
202166	HNRPH1	Heterogeneous nuclear ribonucleoprotein H1 (H)	199.33	74.31	0.069	183.12
202179	SMN2	Survival of motor neuron 1. telomeric	103.17	55.27	0.379	77.19
203099	WAPAL	Wings apart-like homolog (Drosophila)	162.13	143.02	0.345	56.63
203910	SGTA	Small glutamine-rich tetratricopeptide repeat (TPR)-containing.	213.58	79.65	0.138	124.15
		alpha
204041	AHSA1	AHA1. activator of heat shock 90 kDa protein ATPase homolog 1	263.29	112.20	0.207	131.33
		(yeast)
204773	WDR77	WD repeat domain 77	185.81	74.28	0.172	65.95
205163	MRPL3	Mitochondrial ribosomal protein L3	176.93	58.08	0.069	129.59
206500	CTTN	Cortactin	148.63	96.70	0.310	85.71
206824	MGC71993	Similar to DNA segment, Chr 11, Brigham & Womens	143.54	88.77	0.345	218.52
		Genetics 0434 expressed
208597	CTBP1	Hypothetical protein LOC285463	136.74	48.53	0.138	213.99
209983	STMN1	Stathmin 1/oncoprotein 18	619.09	139.81	0.034	198.15
210469	ELMO2	Engulfment and cell motility 2 (ced-12 homolog. C. elegans)	96.39	71.43	0.379	57.31
210532	KIAA0141	KIAA0141	138.36	72.99	0.241	62.91
211463	DNM2	Dynamin 2	195.67	87.32	0.241	81.50
211594	PSMC4	Proteasome (prosome, macropain) 26S subunit, ATPase. 4	469.59	192.26	0.138	67.56
211914	NDUFS7	NADH dehydrogenase (ubiquinone) Fe—S protein 7, 20 kDa	159.44	73.80	0.379	86.83
		(NADH-coenzyme Q reductase)
212102	PDIA6	Protein disulfide isomerase family A. member 6	274.17	97.91	0.103	160.42
212395	CIZ1	CDKN1A interacting zinc finger protein 1	272.61	88.59	0.138	50.78
213061	NUCKS1	Nuclear casein kinase and cyclin-dependent kinase substrate 1	304.71	64.96	0.138	231.69
213470	PSMB7	Proteasome (prosome, macropain) subunit. beta type. 7	247.81	65.94	0.034	222.67
213541	LOC55288	Hypothetical LOC552889	136.06	60.14	0.345	67.95
213666	K1AA0460	KIAA0460	96.71	78.04	0.241	68.88
213724	SUPT16H	Suppressor of Ty 16 homolog (S. cerevisiae)	149.27	79.71	0.207	52.16
216653	FBXO9	F-box protein 9	92.77	49.72	0.310	50.09
220950	FOXO3	Forkhead box O3	196.88	112.74	0.276	91.70
221847	SLC38A2	Solute carrier family 38, member 2	204.23	78.33	0.207	281.04
222510	DAZAP1	DAZ associated protein 1	126.05	97.18	0.276	67.85
223141	DDX21	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21	255.54	70.08	0.069	103.03
224607	SDC1	Syndecan 1	241.65	87.87	0.276	119.67
226007	RDH11	Retinol dehydrogenase 11 (all-trans and 9-cis)	340.36	135.94	0.172	92.30
226117	H1F0	H1 histone family, member 0	326.85	160.18	0.310	127.49
226755	YWHAH	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	199.21	161.02	0.207	191.85
		activation protein. eta polypeptide
227067	ATAD3A	ATPase family, AAA domain containing 3A	254.68	105.30	0.172	57.56
227253	TOMM70A	Translocase of outer mitochondrial membrane 70 homolog A	130.67	67.31	0.172	87.82
		(yeast)
227777	PTP4A1	Protein tyrosine phosphatase type IVA, member 1	219.08	115.20	0.138	131.83
229641	SUB1	SUB1 homolog (S. cerevisiae)	300.51	103.71	0.138	147.72
231295	PITPNC1	Phosphatidylinositol transfer protein, cytoplasmic 1	171.09	127.31	0.345	63.03
231616	C19orf53	Chromosome 19 open reading frame 53	162.05	104.55	0.345	102.58
232194	KIAA0174	KIAA0174	204.24	73.78	0.138	84.98
232543	PDCD4	Programmed cell death 4 (neoplastic transformation inhibitor)	126.25	61.41	0.310	189.22
233458	NFYC	Nuclear transcription factor Y, gamma	92.20	51.11	0.345	89.24
233552	CDC2L5	Cell division cycle 2-like 5 (cholinesterase-related cell division	139.27	109.94	0.379	29.61
		controller)
233952	PSMA7	Proteasome (prosome, macropain) subunit, alpha type, 7	358.81	133.21	0.069	431.24
234521	MAPKAPK3	Mitogen-activated protein kinase-activated protein kinase 3	185.75	77.03	0.379	59.41
236030	SMARCC2	SWI/SNF related, matrix associated, actin dependent regulator of	198.07	83.50	0.207	34.66
		chromatin. subfamily c. member 2
237536	NT5C3L	5′-nucleotidase, cytosolic III-like	160.67	84.27	0.276	95.40
237971	XTP3TPA	XTP3-transactivated protein A	122.34	67.16	0.276	58.94
238839	SCYL1	SCY1-like 1 (S. cerevisiae)	173.16	113.72	0.310	144.41
240170	OBFC2B	Oligonucleotide/oligosaccharide-binding fold containing 2B	136.42	69.86	0.345	96.25
241336	ATPIF1	ATPase inhibitory factor 1	227.40	125.29	0.172	224.03
241543	POLDIP2	Polymerase (DNA-directed), delta interacting protein 2	217.98	81.62	0.138	66.91
241558	ARIH2	Ariadne homolog 2 (Drosophila)	178.45	77.54	0.172	65.16
241575	GNPTG	N-acetylglucosamine-1-phosphate transferase, gamma subunit	117.17	100.69	0.345	73.29
241576	DERL1	Der1-like domain family. member 1	111.58	87.37	0.310	72.57
241579	SERPINH1	Serpin peptidase inhibitor. clade H (heat shock protein 47),	380.44	115.76	0.172	198.12
		member 1. (collagen binding protein 1)
242458	SPG21	Spastic paraplegia 21 (autosomal recessive, Mast syndrome)	120.35	59.44	0.310	76.41
242947	DGKI	Diacylglycerol kinase, iota	131.75	120.70	0.379	4086.25
246112	ASCC3L1	Activating signal cointegrator 1 complex subunit 3-like 1	278.46	81.24	0.172	160.68
246310	ATP5J	ATP synthase, H+ transporting, mitochondrial F0 complex. subuni	220.45	113.90	0.276	232.33
		F6
246413	CPNE1	RNA binding motif protein 12	392.42	88.16	0.069	93.63
246781	FBXO11	F-box protein 11	141.20	92.55	0.379	48.14
247077	RHOA	Ras homolog gene family, member A	553.79	77.72	0.034	545.41
247186	FBRS	Fibrosin	145.20	107.50	0.379	70.03
247975	HSPD1	Pro-melanin-concentrating hormone-like 1	241.69	85.58	0.207	238.18
248267	MPST	Mercaptopyruvate sulfurtransferase	167.67	112.86	0.276	80.10
248941	TAF9	TAF9 RNA polymerase II. TATA box binding protein (TBP)-	148.14	65.92	0.276	54.96
		associated factor, 32 kDa
249600	DLGAP4	Discs, large (Drosophila) homolog-associated protein 4	233.49	169.10	0.276	98.90
250009	ARL8B	ADP-ribosylation factor-like 8B	132.27	55.79	0.379	134.21
250429	SUPT6H	Suppressor of Ty 6 homolog (S. cerevisiae)	162.25	82.76	0.379	44.11
250758	PSMC3	Proteasome (prosome, macropain) 26S subunit, ATPase, 3	391.11	115.64	0.138	111.57
250899	HSBP1	Heat shock factor binding protein 1	214.94	105.83	0.069	141.99
250905	TMEM85	Transmembrane protein 85	156.08	143.74	0.241	77.54
251531	PSMA4	Proteasome (prosome, macropain) subunit, alpha type, 4	739.81	217.34	0.138	172.42
252457	MVD	Mevalonate (diphospho) decarboxylase	170.93	117.34	0.379	65.93
252713	TTC15	Tetratricopeptide repeat domain 15	105.62	56.20	0.345	75.68
252967	C1orf144	Chromosome 1 open reading frame 144	240.90	109.65	0.207	105.98
253726	PAPOLA	Poly(A) polymerase alpha	216.15	65.36	0.172	118.24
253903	STOM	Stomatin	199.17	100.65	0.276	100.22
254042	BAT1	HLA-B associated transcript 1	351.44	89.43	0.069	144.69
255015	VPS24	Vacuolar protein sorting 24 (yeast)	126.82	67.80	0.069	79.90
255093	PFKL	Phosphofructokinase, liver	342.69	81.83	0.207	167.85
255932	XRN2	5′-3′ exoribonuclease 2	166.16	57.70	0.069	53.31
255935	BTG1	B-cell translocation gene 1. anti-proliferative	272.14	115.44	0.138	264.18
255973	EID1	EP300 interacting inhibitor of differentiation 1	227.90	86.79	0.138	174.44
256301	C19orf48	Chromosome 19 open reading frame 48	337.67	84.54	0.207	158.37
256549	NUBP2	Nucleotide binding protein 2 (MinD homolog. E. coli)	200.75	98.94	0.241	76.00
257008	PLD3	Phospholipase D family, member 3	349.21	100.00	0.276	203.69
257341	SAV1	Salvador homolog 1 (Drosophila)	91.57	65.55	0.276	34.40
257761	SH3BP5	SH3-domain binding protein 5 (BTK-associated)	170.93	92.54	0.345	70.17
258551	DNPEP	Aspartyl aminopeptidase	168.16	84.05	0.138	38.05
258563	FEZ2	Fasciculation and elongation protein zeta 2 (zygin II)	190.19	204.72	0.345	67.33
258798	NSMCE4A	Non-SMC element 4 homolog A (S. cerevisiae)	79.52	52.34	0.345	366.69
259461	PALM2-	PALM2-AKAP2 protein	171.91	79.41	0.310	128.63
	AKAP2
260603	PIP5K2B	Phosphatidylinositol-4-phosphate 5-kinase. type II, beta	132.75	67.00	0.276	94.30
262823	IARS2	Isoleucyl-tRNA synthetase 2, mitochondrial	139.24	59.53	0.345	118.15
265829	ITGA3	Integrin. alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3	404.31	148.83	0.379	109.76
		receptor)
268488	LRRC47	Leucine rich repeat containing 47	115.89	116.32	0.379	54.76
268530	GPS1	Radical fringe homolog (Drosophila)	263.51	64.58	0.138	107.13
268742	POMP	Proteasome maturation protein	213.22	98.49	0.276	212.21
268849	GLO1	Glyoxalase I	293.88	85.24	0.138	179.31
268939	MATR3	Matrin 3	292.73	68.23	0.034	241.08
269528	NAT13	N-acetyltransferase 13	237.37	198.20	0.172	110.90
269577	PTPRA	Protein tyrosine phosphatase, receptor type, A	183.68	82.75	0.207	168.07
269782	GNAQ	Guanine nucleotide binding protein (G protein). q polypeptide	174.12	105.06	0.241	52.13
269944	MTCH2	Mitochondrial carrier homolog 2 (C. elegans)	158.42	74.35	0.103	70.20
270291	ACTN4	Actinin, alpha 4	341.13	108.40	0.172	419.64
270428	SUCLG1	Succinate-CoA ligase, GDP-forming, alpha subunit	242.34	241.99	0.241	106.33
270525	LASS5	LAG1 longevity assurance homolog 5 (S. cerevisiae)	111.31	73.14	0.379	57.78
270869	ZNF410	Zinc finger protein 410	135.77	84.28	0.172	53.74
271135	ATP5C1	ATP synthase, H+ transporting, mitochondrial F1 complex, gamm	448.47	176.19	0.172	135.97
		polypeptide 1
271695	NOB1	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	111.46	73.07	0.310	47.43
272062	PTPRF	Protein tyrosine phosphatase. receptor type. F	269.10	88.46	0.310	119.22
272168	SERINC3	Serine incorporator 3	121.11	72.44	0.138	39.75
272630	ATP6V1D	ATPase, H+ transporting, lysosomal 34 kDa, V1 subunit D	149.33	85.72	0.207	78.13
272927	SEC23A	Sec23 homolog A (S. cerevisiae)	128.24	74.07	0.379	52.45
273077	TMEM14B	Transmembrane protein 14B	128.20	70.29	0.345	63.88
274184	TFE3	Transcription factor binding to IGHM enhancer 3	111.31	57.20	0.276	57.28
274772	C15orf15	Chromosome 15 open reading frame 15	1163.64	205.16	0.172	82.77
274873	CARS	Cysteinyl-tRNA synthetase	176.72	76.48	0.207	82.54
275243	S100A6	S100 calcium binding protein A6 (calcyclin)	361.59	101.08	0.103	591.93
275775	SEPP1	Selenoprotein P, plasma, 1	543.33	189.21	0.379	121.63
275865	PCNP	PEST-containing nuclear protein	315.34	88.79	0.069	83.52
276878	NUP93	Nucleoporin 93 kDa	101.32	60.26	0.241	65.66
277035	MGLL	Monoglyceride lipase	399.51	211.97	0.379	116.15
277517	C11orf2	Chromosome 11 open reading frame 2	193.83	84.84	0.241	127.65
278186	ARHGEF1	Rho guanine nucleotide exchange factor (GEF) 1	194.28	91.63	0.345	73.95
278362	MEA1	Male-enhanced antigen 1	152.60	83.00	0.276	98.75
278426	PDAP1	PDGFA associated protein 1	184.93	86.49	0.172	106.94
278429	C9orf78	Chromosome 9 open reading frame 78	109.74	79.17	0.276	63.78
278500	GNPDA1	Glucosamine-6-phosphate deaminase 1	174.64	74.75	0.241	80.44
278569	SNX17	Sorting nexin 17	297.66	66.25	0.069	132.92
278573	CD59	CD59 antigen p18-20 (antigen identified by monoclonal antibodies	336.75	91.21	0.138	154.72
		16.3A5, EJ16, EJ30, EL32 and G344)
278721	SLC39A7	Solute carrier family 39 (zinc transporter), member 7	147.65	72.58	0.379	71.42
279061	GLOD4	Glyoxalase domain containing 4	148.90	76.66	0.172	65.97
279245	TACC1	Transforming. acidic coiled-coil containing protein 1	186.16	79.86	0.241	103.52
279257	PCMT1	Protein-L-isoaspartate (D-aspartate) O-methyltransferase	172.73	62.20	0.103	102.09
279413	POLDI	Polymerase (DNA directed). delta 1. catalytic subunit 125 kDa	164.91	99.93	0.276	75.52
279529	PRELID1	PRELI domain containing 1	224.95	77.28	0.172	102.94
279583	METTL9	Methyltransferase like 9	183.44	155.70	0.241	146.63
279623	SEPX1	Selenoprotein X, 1	117.70	54.66	0.345	47.48
279640	TPR	Translocated promoter region (to activated MET oncogene)	94.90	66.61	0.310	69.84
279652	MRPL4	Mitochondrial ribosomal protein L4	173.40	73.00	0.276	110.73
279669	TUBG1	Tubulin, gamma 1	169.58	65.01	0.310	72.06
279696	SUMF2	Sulfatase modifying factor 2	149.85	83.02	0.345	127.55
279806	DDX5	RNA-binding protein 45 (RBP45). putative	457.60	87.95	0.103	856.99
279836	COMMD9	COMM domain containing 9	104.98	49.94	0.379	60.58
279920	YWHAB	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	288.39	87.94	0.034	251.99
		activation protein. beta polypeptide
279929	TMED9	Transmembrane emp24 protein transport domain containing 9	291.55	91.04	0.069	202.03
280202	SBF1	SET binding factor 1	382.01	317.21	0.310	36.29
280342	PRKAR1A	Protein kinase, cAMP-dependent, regulatory, type I. alpha (tissue	266.02	111.27	0.103	209.46
		specific extinguisher 1)
280378	SNRPB2	Small nuclear ribonucleoprotein polypeptide B″	243.47	100.43	0.310	68.06
282410	CALM1	Calmodulin 1 (phosphorylase kinase, delta)	246.78	67.76	0.103	513.80
282700	SPCS2	Signal peptidase complex subunit 2 homolog (S. cerevisiae)	232.99	84.36	0.207	59.54
282901	RBM39	RNA binding motif protein 39	166.92	85.70	0.138	181.79
282998	RBM9	RNA binding motif protein 9	477.00	221.29	0.103	145.15
283111	C140rf124	Chromosome 14 open reading frame 124	168.06	139.52	0.207	73.74
283454	BNIP2	BCL2/adenovirus E1B 19 kDa interacting protein 2	130.03	68.79	0.310	47.89
283521	RHEB	Ras homolog enriched in brain	193.25	113.28	0.310	92.73
283610	ATG4B	ATG4 autophagy related 4 homolog B (S. cerevisiae)	180.36	88.44	0.172	49.24
283652	IDI1	Isopentenyl-diphosphate delta isomerase 1	233.34	102.32	0.241	58.55
283739	UBQLN4	Ubiquitin 4	165.35	84.58	0.207	62.49
284208	ANKRD25	Ankyrin repeat domain 25	124.68	85.84	0.379	46.63
284279	HMOX2	Heme oxygenase (decycling) 2	151.53	85.91	0.310	50.68
284286	MRPS24	Mitochondrial ribosomal protein S24	136.83	77.51	0.345	71.40
284491	PDXK	Pyridoxal (pyridoxine, vitamin B6) kinase	235.50	93.74	0.138	787.92
285354	MAX	MYC associated factor X	109.16	60.60	0.345	64.26
285976	LASS2	LAG1 longevity assurance homolog 2 (S. cerevisiae)	203.17	82.28	0.172	132.14
286221	ARF1	ADP-ribosylation factor 1	704.87	66.67	0.069	199.12
286226	MYO1C	Myosin IC	253.69	114.87	0.310	90.05
288193	KPNA4	Karyopherin alpha 4 (importin alpha 3)	144.60	134.58	0.379	59.34
288856	PFDN5	Prefoldin 5	226.65	96.63	0.103	320.21
288969	NMRAL1	NmrA-like family domain containing 1	126.04	77.91	0.379	34.41
289008	NUS1	Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S.	157.63	95.67	0.310	68.14
		cerevisiae)
289092	COTL1	Coactosin-like 1 (Dictyostelium)	315.93	109.13	0.172	167.69
289123	DCTN2	Dynactin 2 (p50)	261.39	105.34	0.069	89.02
289271	CYC1	Cytochrome c-1	345.69	78.79	0.172	242.81
290243	GBF1	Golgi-specific brefeldin A resistance factor 1	241.54	85.11	0.310	632.98
290404	SLC25A3	Solute carrier family 25 (mitochondrial carrier; phosphate carrier),	1579.85	87.93	0.034	45.05
		member 3
290758	DDB1	Damage-specific DNA binding protein 1, 127 kDa	452.78	82.29	0.138	190.14
291587	ARID1B	AT rich interactive domain 1B (SWI1-like)	135.97	82.06	0.310	73.22
292026	EIF4E2	Eukaryotic translation initiation factor 4E member 2	186.78	88.38	0.138	46.59
292063	EIF4B	Hypothetical protein PRO1843	439.43	110.97	0.103	148.75
292078	LARP1	La ribonucleoprotein domain family. member 1	246.82	65.22	0.069	105.37
292265	ZMYND11	Zinc finger, MYND domain containing 11	133.13	109.13	0.207	56.47
292457	SNHG5	Small nucleolar RNA host gene (non-protein coding) 5	400.14	267.50	0.276	289.85
292493	XRCC6	X-ray repair complementing defective repair in Chinese hamster	691.10	100.07	0.034	318.36
		cells 6 (Ku autoantigen, 70 kDa)
292524	CCNH	Cyclin H	158.48	96.80	0.276	32.70
292579	PTDSS1	Phosphatidylserine synthase 1	195.76	80.55	0.276	67.07
293563	C1orf108	Chromosome 1 open reading frame 108	144.99	87.81	0.172	65.61
295917	ATP6V1B2	ATPase, H+ transporting. lysosomal 56/58 kDa, VI subunit B,	151.09	76.58	0.207	62.97
		isoform 2
297324	TIMP3	TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy.	505.19	227.34	0.310	200.02
		pseudoinflammatory)
298198	CMTM3	CKLF-like MARVEL transmembrane domain containing 3	127.34	71.77	0.310	95.15
298280	ATP5A1	ATP synthase, H+ transporting, mitochondrial F1 complex. alpha	1791.25	357.36	0.000	473.59
		subunit. isoform 1. cardiac muscle
298654	DUSP6	Dual specificity phosphatase 6	208.26	87.60	0.310	98.88
299002	FBL	Fibrillarin	591.46	179.47	0.138	162.19
299055	GDI2	GDP dissociation inhibitor 2	323.73	77.59	0.069	72.16
300141	RPL39	Ribosomal protein L39	775.36	419.08	0.172	791.80
300684	RCP9	Calcitonin gene-related peptide-receptor component protein	79.62	45.89	0.241	39.78
300772	TPM2	Tropomyosin 2 (beta)	861.72	370.12	0.345	294.55
300816	RAB1B	RAB1B. member RAS oncogene family	228.92	96.00	0.172	175.17
300834	GALNT2	UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-	155.76	89.15	0.241	76.65
		acetylgaladosaminyltransferase 2 (GalNAc-T2)
301404	RBM3	RNA binding motif (RNP1, RRM) protein 3	325.81	102.69	0.172	117.20
301412	UFC1	Ubiquitin-fold modifier conjugating enzyme 1	142.19	76.03	0.276	155.60
302742	MRPS6	Mitochondrial ribosomal protein S6	184.15	77.33	0.276	99.50
302903	UBE2I	Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	178.40	82.89	0.172	95.85
303676	G3BP2	Ras-GTPase activating protein SH3 domain-binding protein 2	149.92	66.30	0.241	98.85
304192	DSTN	Destrin (actin depolymerizing factor)	223.11	77.62	0.207	79.90
304682	CST3	Cystatin C (amyloid angiopathy and cerebral hemorrhage)	266.47	126.42	0.172	802.25
306123	MAGEF1	Melanoma antigen family F, 1	183.67	83.29	0.379	64.12
306242	RANBP9	RAN binding protein 9	116.92	67.43	0.310	66.12
306329	ZFAND6	Zinc finger, AN1-type domain 6	247.28	99.07	0.276	111.07
306425	IBTK	Inhibitor of Bruton agammaglobulinemia tyrosine kinase	104.18	51.87	0.379	71.02
308122	ITPK1	Inositol 1,3,4-triphosphate 5/6 kinase	254.52	81.30	0.276	53.88
308340	NUP188	Nucleoporin 188 kDa	329.72	144.04	0.241	50.55
308709	PDIA3	Protein disulfide isomerase family A, member 3	204.27	87.48	0.069	175.08
309090	SFRS7	Splicing factor, arginine/serine-rich 7, 35 kDa	189.69	89.49	0.172	104.22
309231	C6orf153	Chromosome 6 open reading frame 153	157.44	80.31	0.310	66.08
309641	RNF11	Ring finger protein 11	162.82	68.82	0.172	187.15
309753	STARD3NL	STARD3 N-terminal like	119.30	74.99	0.310	95.69
309849	C14orf159	Chromosome 14 open reading frame 159	122.74	74.53	0.379	43.93
310542	TOMM40	Translocase of outer mitochondrial membrane 40 homolog (yeast)	267.48	79.87	0.138	50.95
310645	RAB1A	RAB1A. member RAS oncogene family	252.99	84.41	0.241	104.46
311072	MRPS35	Mitochondrial ribosomal protein S35	138.81	64.82	0.345	40.18
311346	CMAS	Cytidine monophosphate N-acetylneuraminic acid synthetase	109.31	97.45	0.345	48.58
311609	DDX39	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39	260.02	110.28	0.138	102.82
311640	RPS27A	Ribosomal protein S27a	524.64	119.16	0.034	830.70
312098	ADAM15	ADAM metallopeptidase domain 15 (metargidin)	200.26	132.76	0.345	77.56
313847	TXNDC11	Thioredoxin domain containing 11	106.99	71.40	0.345	35.55
314263	BAZ2A	Bromodomain adjacent to zinc finger domain, 2A	164.92	91.68	0.241	70.15
314359	EIF3S12	Eukaryotic translation initiation factor 3, subunit 12	248.91	116.13	0.103	350.37
315177	IFRD2	Interferon-related developmental regulator 2	180.25	60.11	0.276	58.92
315230	EIF1B	Eukaryotic translation initiation factor 1B	166.77	108.63	0.207	160.77
319334	NASP	Nuclear autoantigenic sperm protein (histone-binding)	320.92	87.44	0.103	131.55
321391	ELOF1	Elongation factor 1 homolog (S. cerevisiae)	119.51	68.26	0.345	60.37
321541	RAB11A	RAB11A, member RAS oncogene family	193.82	99.65	0.172	123.34
323363	ATG9A	ATG9 autophagy related 9 homolog A (S. cerevisiae)	159.62	88.11	0.276	47.64
323489	PTCD3	Pentatricopeptide repeat domain 3	153.29	80.62	0.172	49.53
324250	NDUFB2	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8 kDa	245.74	182.66	0.379	183.95
324844	VKORC1	Vitamin K epoxide reductase complex. subunit 1	151.74	66.24	0.276	138.96
325650	EHD2	EH-domain containing 2	160.03	99.53	0.379	116.94
326387	MORF4L2	Mortality factor 4 like 2	313.02	109.69	0.103	189.57
330384	CORO1C	Coronin. actin binding protein. 1C	171.53	69.53	0.103	118.15
331431	SCC-112	SCC-112 protein	242.38	75.28	0.069	64.31
333388	EEF1D	Eukaryotic translation elongation factor 1 delta (guanine nucleotid	899.57	105.63	0.000	404.01
		exchange protein)
333579	HSPC152	Hypothetical protein HSPC152	209.20	133.84	0.172	163.96
333786	PSMA2	Proteasome (prosome. macropain) subunit, alpha type. 2	207.24	97.57	0.138	197.41
333823	MRPL13	Mitochondrial ribosomal protein L13	113.33	69.75	0.345	44.81
334017	TUBA1B	Tubulin. alpha 1b	1834.27	95.82	0.000	1202.13
334479	TRAF7	TNF receptor-associated factor 7	242.13	130.36	0.138	56.99
334534	GNS	Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID)	129.18	72.76	0.276	73.76
334587	RBPMS	RNA binding protein with multiple splicing	136.68	59.93	0.345	76.18
334713	UBL7	Ubiquitin-like 7 (bone marrow stromal cell-derived)	192.75	67.45	0.207	71.93
334851	LASP1	LIM and SH3 protein 1	297.69	80.06	0.034	98.51
334868	PPP2R5E	Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform	111.74	78.51	0.345	40.49
335003	ANKRD11	Ankyrin repeat domain 11	152.63	135.85	0.276	85.85
335057	SEPT2	Septin 2	321.01	90.60	0.069	203.38
335163	LIMCH1	LIM and calponin homology domains 1	217.46	84.47	0.379	58.83
335918	FDPS	Farnesyl diphosphate synthase (farnesyl pyrophosphate	635.55	104.20	0.034	75.25
		synthetase. dimethylallyltranstransferase, geranyltranstransferase
337295	STIP1	Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing	326.55	78.19	0.172	108.95
337766	TXNRD1	Thioredoxin reductase 1	641.30	103.44	0.034	227.03
339278	COPB1	Coatomer protein complex. subunit beta 1	144.35	59.14	0.241	121.58
339639	COX7A2L	Cytochrome c oxidase subunit VIIa polypeptide 2 like	222.21	84.81	0.241	200.80
339697	GRINA	Glutamate receptor, ionotropic, N-methyl D-asparate-associated	287.06	90.28	0.103	251.13
		protein 1 (glutamate binding)
343911	EI24	Etoposide induced 2.4 mRNA	172.38	72.77	0.103	162.16
345694	KCMF1	Potassium channel modulatory factor 1	114.01	57.72	0.345	54.57
346868	EBNA1BP2	EBNA1 binding protein 2	190.81	79.22	0.276	75.67
348418	DR1	Down-regulator of transcription 1. TBP-binding (negative cofactor	109.41	77.62	0.207	45.01
349656	SCARB2	Scavenger receptor class B, member 2	147.31	89.03	0.241	210.49
350194	ZMAT2	Zinc finger. matrin type 2	115.49	53.42	0.207	37.72
350229	CASC3	Cancer susceptibility candidate 3	124.19	53.21	0.241	114.41
350268	IRF2BP2	Interferon regulatory factor 2 binding protein 2	153.03	81.62	0.276	118.60
350364	FAM120AOS	Family with sequence similarity 120A opposite strand	107.30	65.11	0.379	41.56
350927	SLC25A6	Solute carrier family 25 (mitochondrial carrier: adenine nucleotide	952.99	85.55	0.000	444.35
		translocator). member 6
351099	FLJ10241	Hypothetical protein FLJ10241	126.93	65.83	0.276	39.55
351296	LOC51035	SAPK substrate protein 1	210.44	71.71	0.172	87.27
351316	TM4SF1	Transmembrane 4 L six family member 1	422.43	110.13	0.276	449.98
351474	PAQR4	Progestin and adipoQ receptor family member IV	212.87	153.70	0.345	84.43
351680		CDNA clone IMAGE: 5302006	133.19	88.88	0.276	120.23
351875	COX6C	Cytochrome c oxidase subunit VIc	304.69	180.70	0.310	559.91
352341	STCH	Stress 70 protein chaperone, microsome-associated. 60 kDa	121.74	86.32	0.379	58.92
352656	GHITM	Growth hormone inducible transmembrane protein	363.92	99.19	0.103	63.14
352768	PSMB1	Proteasome (prosome, macropain) subunit, beta type, 1	292.02	82.24	0.103	177.54
354056	POR	P450 (cytochrome) oxidoreductase	227.09	82.79	0.379	74.23
355141	TNIP1	TNFAIP3 interacting protein 1	269.81	97.79	0.241	102.36
355606	TMEM167	Transmembrane protein 167	211.08	149.60	0.276	80.22
355643	RNPS1	RNA binding protein S1, serine-rich domain	423.42	65.75	0.103	105.94
355708	TMEM127	Transmembrane protein 127	77.31	49.24	0.379	45.95
355750	JOSD3	Josephin domain containing 3	117.50	61.17	0.379	147.10
355753	AGPAT6	1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic	150.13	73.56	0.345	47.02
		acid acyltransferase. zeta)
355867	MARS	Methionine-tRNA synthetase	323.10	233.26	0.069	59.52
355927	VDAC2	Voltage-dependent anion channel 2	242.40	82.56	0.103	141.28
355934	SFPQ	Splicing factor proline/glutamine-rich (polypyrimidine tract binding	269.46	133.96	0.138	128.50
		protein associated)
355983	BZW1	Basic leucine zipper and W2 domains 1	338.32	108.39	0.103	181.32
356061	MAP1LC3B	Microtubule-associated protein 1 light chain 3 beta	126.69	74.25	0.207	166.48
356096	MAP7D1	MAP7 domain containing 1	191.33	92.49	0.207	152.55
356190	UBB	Ubiquitin B	742.69	74.99	0.000	716.73
356270	SDHD	Succinate dehydrogenase complex, subunit D, integral membrane	977.72	187.08	0.207	47.58
		protein
356285	HMGN1	High-mobility group nucleosome binding domain 1	279.36	80.39	0.138	330.79
356331	PPIA	Peptidylprolyl isomerase A (cyclophilin A)	1225.70	78.02	0.034	1646.83
356366	RPS2	Ribosomal protein S2	5031.59	91.00	0.000	1894.42
356371	RPL28	Ribosomal protein L28	622.10	176.27	0.034	2001.52
356377	RNF187	Ring finger protein 187	188.84	96.73	0.207	92.73
356467	C19orf42	Chromosome 19 open reading frame 42	148.32	80.69	0.034	76.36
356501	PHF6	PHD finger protein 6	145.65	87.04	0.310	160.28
356502	RPLP1	Ribosomal protein, large, P1	881.03	208.46	0.000	2388.08
356549	SNRPD3	Small nuclear ribonucleoprotein D3 polypeptide 18 kDa	153.63	84.17	0.276	81.89
356630	NUTF2	Nuclear transport factor 2	144.29	83.13	0.103	186.27
356647	SNX6	Sorting nexin 6	134.10	84.57	0.310	94.88
356654	PSMC1	Proteasome (prosome, macropain) 26S subunit, ATPase, 1	154.97	82.94	0.172	80.59
356766	C20orf199	Chromosome 20 open reading frame 199	227.51	154.61	0.310	203.56
356769	MAN2B1	Mannosidase, alpha, class 2B. member 1	166.87	97.57	0.310	102.94
356799	RPL41	Ribosomal protein L41	336.21	165.15	0.345	350.34
357901	SOX4	SRY (sex determining region Y)-box 4	163.64	90.74	0.345	273.44
362728	SEP15	15 kDa selenoprotein	302.87	139.54	0.138	110.63
365116	U2AF1	U2(RNU2) small nuclear RNA auxiliary factor 1	152.30	63.70	0.241	103.78
368084	LRPPRC	Leucine-rich PPR-motif containing	180.31	95.65	0.241	70.90
368149	CCT7	Chaperonin containing TCP1. subunit 7 (eta)	968.98	94.04	0.069	253.53
368157	PYGB	Phosphorylase. glycogen; brain	289.40	94.26	0.241	262.01
368240	DYRK1A	Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	132.39	93.19	0.379	80.76
368264	PPP2R5C	Protein phosphatase 2. regulatory subunit B (B56), gamma	235.30	135.72	0.103	78.57
368376	SRPR	Signal recognition particle receptor (‘docking protein’)	170.10	91.17	0.138	64.69
368402	C8orf55	Chromosome 8 open reading frame 55	129.24	75.63	0.379	50.69
368404	EXT2	Exostoses (multiple) 2	144.25	80.41	0.345	64.81
368525	PDLIM1	PDZ and LIM domain 1 (elfin)	285.39	113.52	0.241	94.01
368598	ZC3H15	Zinc finger CCCH-type containing 15	153.03	73.26	0.172	63.93
368934	C17orf45	Chromosome 17 open reading frame 45	538.27	122.37	0.103	510.24
368985	TRIP12	Thyroid hormone receptor interactor 12	160.59	66.50	0.345	74.13
369017	RAB2A	RAB2A, member RAS oncogene family	185.09	87.27	0.172	120.37
369052	SELT	Selenoprotein T	368.37	150.53	0.172	114.17
369068	DYNC1LI2	Dynein, cytoplasmic 1, light intermediate chain 2	158.56	97.53	0.138	167.20
369125	PSMD14	Proteasome (prosome, macropain) 26S subunit, non-ATPase. 14	166.50	83.15	0.103	74.34
369285	INTS7	Integrator complex subunit 7	112.06	98.19	0.379	266.65
369356	MLL5	Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog,	156.73	73.07	0.276	76.27
		Drosophila)
369606	CPSF6	Cleavage and polyadenylation specific factor 6, 68 kDa	132.90	65.76	0.207	63.91
369607	GAK	Cyclin G associated kinase	139.66	91.16	0.379	72.66
369614	COPS2	COP9 constitutive photomorphogenic homolog subunit 2	138.58	64.46	0.241	36.98
		(Arabidopsis)
369615	SLC25A38	Solute carrier family 25. member 38	148.69	73.93	0.345	43.41
369761	DAZAP2	DAZ associated protein 2	432.10	77.51	0.069	187.75
369785	C19orf50	Chromosome 19 open reading frame 50	176.53	91.76	0.207	85.83
369920	RAP1B	RAP1B. member of RAS oncogene family	160.45	86.70	0.138	172.27
370024	SEC31A	SEC31 homolog A (S. cerevisiae)	162.54	73.78	0.138	159.51
370247	APLP2	Amyloid beta (A4) precursor-like protein 2	331.96	98.29	0.207	295.17
370292	BCCIP	BRCA2 and CDKN1A interacting protein	116.14	69.62	0.172	54.66
370312	FNTA	Farnesyltransferase, CAAX box, alpha	113.75	73.97	0.172	56.14
370408	COMT	Catechol-O-methyltransferase	269.48	182.45	0.138	81.80
370581	CAP1	CAP. adenylate cyclase-associated protein 1 (yeast)	429.82	79.15	0.069	202.38
370770	XPO1	Exportin 1 (CRM1 homolog, yeast)	218.71	75.18	0.172	86.09
370771	CDKN1A	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)	406.91	129.23	0.207	221.01
370895	RPN2	Ribophorin II	431.77	115.24	0.069	151.28
370927	LRRC59	Leucine rich repeat containing 59	338.69	149.06	0.138	68.76
370937	TAPBP	TAP binding protein (tapasin)	159.24	70.81	0.310	115.35
371001	EIF3S9	Eukaryotic translation initiation factor 3, subunit 9 eta, 116 kDa	343.76	63.64	0.103	193.59
371416	CARM1	Coactivator-associated arginine methyltransferase 1	186.54	108.72	0.276	44.92
371563	RAB14	RAB14. member RAS oncogene family	154.08	65.54	0.310	90.16
371788	C1orf77	Chromosome 1 open reading frame 77	121.36	60.36	0.207	40.80
371889	ATP1A1	Hypothetical protein MGC16179	910.43	156.53	0.069	245.88
372003	FAM120A	Family with sequence similarity 120A	211.67	121.79	0.241	130.10
372050	YIPF5	Yip1 domain family, member 5	117.56	66.39	0.276	58.15
372286	CUL3	Cullin 3	131.34	66.77	0.207	55.91
372331	SPTAN1	Spectrin, alpha. non-erythrocytic 1 (alpha-fodrin)	187.03	76.74	0.207	141.12
372541	KBTBD2	Kelch repeat and BTB (POZ) domain containing 2	100.18	63.32	0.310	72.26
372616	ARL1	ADP-ribosylation factor-like 1	107.60	50.60	0.345	53.90
372914	NDRG1	N-myc downstream regulated gene 1	214.33	101.47	0.241	84.08
373550	TGIF1	TGFB-induced factor homeobox 1	109.97	67.30	0.379	133.12
373741	HM13	Histocompatibility (minor) 13	280.09	120.85	0.069	144.47
373763	HNRPR	Heterogeneous nuclear ribonucleoprotein R	210.83	74.59	0.103	190.45
373952	CAMTA2	Calmodulin binding transcription activator 2	181.38	88.37	0.345	50.38
373959	VGLL4	Vestigial like 4 (Drosophila)	141.11	70.42	0.310	71.58
374043	ASXL1	Additional sex combs like 1 (Drosophila)	130.97	88.31	0.241	116.01
374257	LOC28616	Hypothetical protein LOC286167	151.79	112.19	0.276	73.50
374378	CKS1B	CDC28 protein kinase regulatory subunit 1B	179.04	67.28	0.172	113.85
374477	EWSR1	Ewing sarcoma breakpoint region 1	423.33	116.42	0.069	133.82
374503	MORF4L1	Mortality factor 4 like 1	292.45	60.67	0.069	303.22
374588	RPL17	Ribosomal protein L17	907.22	138.52	0.034	1232.67
374596	TPT1	Tumor protein. translationally-controlled 1	987.59	77.14	0.034	3569.27
374650	IFITM3	Interferon induced transmembrane protein 3 (1-8U)	366.99	97.80	0.276	406.62
374973	PRPF4	PRP4 pre-mRNA processing factor 4 homolog (yeast)	103.66	65.33	0.207	44.01
375001	TLN1	Talin 1	392.09	120.61	0.138	109.38
375108	CD24	CD24 antigen (small cell lung carcinoma cluster 4 antigen)	239.14	95.21	0.310	518.62
375217	RNF31	Ring finger protein 31	104.06	73.05	0.379	50.53
376046	BTN3A2	Butyrophilin, subfamily 3. member A2	149.93	123.05	0.310	52.79
376933	GUK1	Guanylate kinase 1	401.68	92.59	0.276	308.91
377155	MTDH	Metadherin	214.89	91.52	0.138	132.35
378103	RPS5	Ribosomal protein S5	1006.11	134.01	0.069	568.97
378532	HBS1L	HBS1-like (S. cerevisiae)	131.17	80.02	0.241	36.24
378808	EIF2A	Eukaryotic translation initiation factor 2A. 65 kDa	197.55	75.77	0.138	71.81
380403	BMI1	BMI1 polycomb ring finger oncogene	103.02	59.56	0.276	49.37
380774	DDX3X	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked	183.86	64.56	0.241	292.30
380953	RPL38	Ribosomal protein L38	472.88	260.03	0.138	1234.08
380973	SUMO2	SMT3 suppressor of mif two 3 homolog 2 (yeast)	634.74	241.40	0.103	516.19
381008	HLA-E	Major histocompatibility complex, class I. E	476.57	108.00	0.103	189.44
381058	KIAA0146	KIAA0146 protein	136.13	82.82	0.276	58.75
381072	PPIF	Peptidylprolyl isomerase F (cyclophilin F)	236.14	96.10	0.034	101.71
381123	RPL21	Ribosomal protein L21	1087.11	152.34	0.069	2223.30
381126	RPS14	Ribosomal protein S14	312.13	120.35	0.172	890.77
381189	CBX3	Chromobox homolog 3 (HP1 gamma homolog. Drosophila)	352.70	90.90	0.138	202.41
381219	RPL15	Ribosomal protein L15	454.76	118.60	0.034	690.41
381256	GLTP	Glycolipid transfer protein	107.14	53.95	0.379	107.25
382044	MRPS2	Mitochondrial ribosomal protein S2	171.06	80.19	0.207	63.91
382168	NCOA3	Nuclear receptor coactivator 3	166.37	135.20	0.345	47.57
385913	ANP32E	Acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	183.06	71.26	0.345	98.67
385986	UBE2B	Ubiquitin-conjugating enzyme E2B (RAD6 homolog)	135.72	71.52	0.345	133.50
386434	ANXA7	Annexin A7	173.87	70.85	0.138	79.18
386465	CHERP	Calcium homeostasis endoplasmic reticulum protein	177.08	80.21	0.345	43.91
386939	USP7	Ubiquitin specific peptidase 7 (herpes virus-associated)	181.20	217.36	0.207	49.17
387208	FAU	Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV)	336.62	163.47	0.103	653.75
		ubiquitously expressed (fox derived); ribosomal protein S30
387804	PABPC1	Poly(A) binding protein, cytoplasmic 1	625.68	87.04	0.000	382.83
388034	RXRB	Retinoid X receptor. beta	142.87	89.88	0.310	38.31
388654	ATP6V1G1	ATPase, H+ transporting, lysosomal 13 kDa, V1 subunit G isofor	234.65	112.64	0.172	97.60
		1
388664	RPL11	Ribosomal protein L11	672.13	137.34	0.034	1553.26
388739	XRCC5	X-ray repair complementing defective repair in Chinese hamster	346.39	73.79	0.034	162.11
		cells 5 (double-strand-break rejoining; Ku autoantigen, 80 kDa)
388927	YY1	YY1 transcription factor	136.53	65.73	0.103	127.70
388956	C19orf22	Chromosome 19 open reading frame 22	133.57	84.00	0.345	55.36
389037	MCM3APAS	MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)	152.46	115.81	0.207	70.85
		associated protein
389107	ATP6V0C	ATPase, H+ transporting. lysosomal 16 kDa, V0 subunit c	237.34	79.84	0.172	238.25
389171	PINK1	PTEN induced putative kinase 1	126.44	98.97	0.207	74.04
389649	EIF4A3	Eukaryotic translation initiation factor 4A. isoform 3	193.85	75.13	0.138	88.57
389734	TCEAL8	Transcription elongation factor A (SII)-like 8	155.08	72.63	0.345	43.98
389996	CHCHD2	Coiled-coil-helix-coiled-coil-helix domain containing 2	373.11	68.47	0.034	337.24
390667	GSTK1	Glutathione S-transferase kappa 1	168.35	104.34	0.241	152.19
393201	ACTR2	ARP2 actin-related protein 2 homolog (yeast)	328.49	139.01	0.172	119.86
395482	PTK2	PTK2 protein tyrosine kinase 2	177.88	103.98	0.207	42.01
396644	PAIP2	Poly(A) binding protein interacting protein 2	198.13	69.25	0.103	96.51
396740	NIP30	NEFA-interacting nuclear protein NIP30	96.64	53.08	0.241	47.28
396783	SLC9A3R1	Solute carrier family 9 (sodium/hydrogen exchanger). member 3	165.70	98.11	0.276	107.54
		regulator 1
397609	RPS16	Ribosomal protein S16	1470.38	224.21	0.069	1068.13
399800	AKAP8L	A kinase (PRKA) anchor protein 8-like	166.62	90.19	0.310	63.09
400295	RPL30	Ribosomal protein L30	473.07	139.61	0.103	2027.75
401509	RBM10	RNA binding motif protein 10	170.05	75.56	0.172	69.36
401903	COX5A	Cytochrome c oxidase subunit Va	149.97	93.76	0.379	296.35
401929	RPL10	Ribosomal protein L10	1521.64	147.31	0.000	2240.90
403917	STK24	Serine/threonine kinase 24 (STE20 homolog. yeast)	150.48	84.52	0.276	83.03
404056	EIF3S1	Eukaryotic translation initiation factor 3. subunit 1 alpha. 35 kDa	140.93	90.80	0.310	62.42
404321	GARS	Glycyl-tRNA synthetase	247.29	80.31	0.034	166.21
405144	SFRS3	Splicing factor, arginine/serine-rich 3	526.80	137.87	0.034	293.88
405410	OGT	O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-	153.55	55.45	0.379	87.05
		acetylglucosamine: polypeptide-N-acetylglucosaminyl transferase)
405514	KIAA1267	KIAA1267	114.08	65.11	0.345	72.89
405590	EIF3S6	Eukaryotic translation initiation factor 3. subunit 6 48 kDa	654.44	113.72	0.069	174.41
405880	MRPS21	Mitochondrial ribosomal protein S21	141.88	82.93	0.276	145.69
405942	CCDC137	Coiled-coil domain containing 137	133.03	86.11	0.241	77.12
406062	NDUFA11	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11. 14.7	173.17	93.80	0.345	194.39
		kDa
406068	UBE2M	Ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)	132.46	80.88	0.345	94.66
406096	ZFAND5	Zinc finger. AN1-type domain 5	192.43	93.38	0.345	318.23
406277	SF3A1	Splicing factor 3a, subunit 1, 120 kDa	296.74	89.39	0.276	83.36
406300	RPL23	Ribosomal protein L23	696.30	308.79	0.069	1844.46
406423	SF3B2	Splicing factor 3b, subunit 2, 145 kDa	355.96	73.17	0.069	58.42
406510	ATP5B	ATP synthase, H+ transporting, mitochondrial F1 complex, beta	1002.07	88.90	0.034	206.51
		polypeptide
406520	LOC38954	Similar to CG14977-PA	124.27	87.28	0.276	188.85
406534	HMG20B	High-mobility group 20B	281.92	155.98	0.103	66.80
406590	MRFAP1	Mof4 family associated protein 1	256.02	73.95	0.207	195.87
406620	RPS10	Ribosomal protein S10	1185.80	153.87	0.034	437.99
406683	RPS15	Ribosomal protein S15	521.25	123.23	0.069	137.98
406799	RAB18	RAB18. member RAS oncogene family	127.87	57.58	0.310	50.22
406840	SLC35A4	Solute carrier family 35. member A4	186.45	71.30	0.103	42.86
407368	LSM14A	LSM14A, SCD6 homolog A (S. cerevisiae)	151.28	68.77	0.207	296.81
407580	PKP4	Plakophilin 4	130.61	101.53	0.207	111.02
407995	MIF	Macrophage migration inhibitory factor (glycosylation-inhibiting	520.62	161.06	0.241	820.62
		factor)
408018	RPL36	Ribosomal protein L36	426.58	200.20	0.276	1665.77
408073	RPS6	Ribosomal protein S6	1753.93	92.01	0.034	1215.89
408236	TXNL5	Thioredoxin-like 5	137.51	78.57	0.276	189.91
408257	NDUFS6	NADH dehydrogenase (ubiquinone) Fe—S protein 6, 13 kDa	167.98	115.41	0.379	166.96
		(NADH-coenzyme Q reductase)
408293	CEP170	Centrosomal protein 170 kDa	95.55	57.63	0.379	56.47
408324	FLJ10769	Hypothetical protein FLJ10769	179.63	110.86	0.345	54.49
408428	FOXN3	Forkhead box N3	171.98	93.85	0.379	87.86
408581	SVIL	Supervillin	150.79	78.33	0.276	98.78
408909	GOLPH3	Golgi phosphoprotein 3 (coat-protein)	149.55	90.99	0.207	103.46
409140	ATP5O	ATP synthase, H+ transporting, mitochondrial F1 complex, O	238.76	77.50	0.138	187.51
		subunit (oligomycin sensitivity conferring protein)
409223	SSR4	Signal sequence receptor, delta (translocon-associated protein	187.19	88.00	0.138	154.53
		delta)
409230	AGPAT1	1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic	188.83	78.43	0.207	71.39
		acid acyltransferase, alpha)
409834	PHPT1	Phosphohistidine phosphatase 1	129.72	80.15	0.379	132.98
410197	IDH3G	Isocitrate dehydrogenase 3 (NAD+) gamma	142.89	74.63	0.276	43.88
410596	WDR68	WD repeat domain 68	190.39	78.19	0.069	37.03
410817	RPL13	Ribosomal protein L13	1259.59	96.20	0.034	2237.07
411480	AUP1	Ancient ubiquitous protein 1	197.34	72.07	0.103	130.09
411641	EIF4EBP1	Eukaryotic translation initiation factor 4E binding protein 1	185.54	87.93	0.310	96.89
411847	MAPK6	Mitogen-activated protein kinase 6	143.89	100.65	0.207	67.09
412103	EFHA1	EF-hand domain family. member A1	130.69	68.19	0.276	74.51
412117	ANXA6	Annexin A6	173.96	90.66	0.172	81.81
412196	IFT57	Intraflagellar transport 57 homolog (Chlamydomonas)	109.98	56.91	0.379	49.42
412433	AIP	Aryl hydrocarbon receptor interacting protein	157.20	76.87	0.207	95.68
412468	KLHDC3	Kelch domain containing 3	366.49	77.49	0.172	60.90
412842	CDC123	Cell division cycle 123 homolog (S. cerevisiae)	155.00	62.20	0.207	68.47
413036	WBSCR22	Williams Beuren syndrome chromosome region 22	181.29	60.06	0.103	73.81
413482	C21orf33	Chromosome 21 open reading frame 33	220.73	103.88	0.172	72.11
414579	SCOTIN	Scotin	344.80	79.60	0.138	89.15
415342	TCF25	Transcription factor 25 (basic helix-loop-helix)	132.99	67.57	0.172	122.55
416049	TNPO2	Transportin 2 (importin 3, karyopherin beta 2b)	121.80	74.72	0.345	77.32
416436	TRIM50	Tripartite motif-containing 50	253.97	118.36	0.138	85.38
417004	S100A11	S100 calcium binding protein A11 (calgizzarin)	282.02	146.47	0.138	317.66
417029	C17orf81	Chromosome 17 open reading frame 81	116.93	60.21	0.379	84.10
418123	CTSLL3	Cathepsin L-like 3	196.99	151.69	0.345	94.78
418175	VPS28	Vacuolar protein sorting 28 (yeast)	137.80	101.08	0.345	126.20
418233	MRPL24	Mitochondrial ribosomal protein L24	111.66	117.93	0.345	91.94
418450	MRPL11	Mitochondrial ribosomal protein L11	169.41	63.02	0.310	53.11
418533	BUB3	BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)	180.32	113.91	0.172	73.29
418668	ATP5D	ATP synthase, H+ transporting. mitochondrial F1 complex. delta	142.90	94.88	0.276	249.44
		subunit
419640	PARK7	Parkinson disease (autosomal recessive, early onset) 7	255.09	75.95	0.172	80.33
420269	COL6A2	Collagen. type VI. alpha 2	425.15	132.41	0.379	327.11
420272	H2AFY	H2A histone family. member Y	236.54	78.85	0.069	156.87
421257	RPL7	Ribosomal protein L7	148.01	111.08	0.138	773.71
421509	CCT4	Chaperonin containing TCP1, subunit 4 (delta)	245.54	69.17	0.138	100.96
422113	ZNF511	Zinc finger protein 511	92.03	40.84	0.379	56.61
423935	RDBP	RD RNA binding protein	114.07	56.49	0.241	90.04
423968	FIS1	Fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)	140.14	94.84	0.379	184.40
424126	SERF2	Small EDRK-rich factor 2	421.90	169.35	0.103	442.70
424908	LSM5	LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)	118.18	94.48	0.310	84.59
425777	UBE2L6	Ubiquitin-conjugating enzyme E2L 6	176.08	83.76	0.345	95.06
426296	C10orf104	Chromosome 10 open reading frame 104	193.46	94.72	0.207	104.09
426359	PRR13	proline rich 13	204.04	77.90	0.345	127.55
429052	ITGB1	Integrin. beta 1 (fibronectin receptor. beta polypeptide. antigen	343.25	71.08	0.207	216.47
		CD29 includes MDF2. MSK12)
429353	SEPN1	Selenoprotein N, 1	163.54	91.46	0.241	102.88
429581	RTN4	Reticulon 4	587.74	263.68	0.069	320.92
429819	PITPNA	Phosphatidylinositol transfer protein, alpha	132.54	66.33	0.241	119.10
429839	BTF3L4	Basic transcription factor 3-like 4	128.62	88.13	0.379	63.92
430425	GNB1	Guanine nucleotide binding protein (G protein). beta polypeptide 1	348.68	72.19	0.069	129.12
430551	IQGAP1	IQ motif containing GTPase activating protein 1	168.69	68.30	0.241	88.02
430606	CS	Citrate synthase	377.31	109.46	0.034	147.21
430657	ARF5	ADP-ribosylation factor 5	184.36	99.34	0.310	83.08
430733	CLNS1A	Chloride channel. nucleotide-sensitive. 1A	147.58	71.03	0.207	62.07
431101	GNG12	Guanine nucleotide binding protein (G protein). gamma 12	197.95	72.99	0.310	108.86
431367	VTA1	Vps20-associated 1 homolog (S. cerevisiae)	154.26	81.47	0.172	43.97
431498	FOXP1	Forkhead box P1	158.95	84.08	0.345	98.20
431550	MAP4K4	Mitogen-activated protein kinase kinase kinase kinase 4	150.49	75.85	0.241	138.08
431668	COX6B1	Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)	249.30	171.30	0.207	425.55
431850	MAPK1	Mitogen-activated protein kinase 1	147.43	68.90	0.241	66.06
431861	PPP5C	Protein phosphatase 5, catalytic subunit	203.35	97.62	0.138	99.20
431926	NFKB1	Nuclear factor of kappa light polypeptide gene enhancer in B-cells	118.70	65.79	0.310	59.70
		1 (p105)
432121	PRDX2	Peroxiredoxin 2	328.05	98.46	0.069	287.03
432438	EML4	Echinoderm microtubule associated protein like 4	127.17	67.00	0.345	67.18
432491	ESD	Esterase D/formylglutathione hydrolase	181.49	81.57	0.103	68.19
432690	SLC39A9	Solute carrier family 39 (zinc transporter), member 9	123.27	74.29	0.207	62.18
432760	CAPZB	Capping protein (actin filament) muscle Z-line. beta	189.76	70.34	0.069	950.43
432898	RPL4	Mitogen-activated protein kinase kinase kinase 13	2173.97	96.68	0.000	1111.01
432976	NR1H2	Nuclear receptor subfamily 1, group H. member 2	190.02	112.04	0.241	79.20
433154	PLSCR3	Phospholipid scramblase 3	118.46	78.13	0.345	42.73
433201	CDK2AP1	CDK2-associated protein 1	137.33	80.77	0.241	153.26
433222	NPC2	Niemann-Pick disease, type C2	218.82	98.64	0.069	149.92
433291	ARD1A	ARD1 homolog A, N-acetyltransferase (S. cerevisiae)	119.07	75.05	0.207	64.82
433307	BCKDHA	Branched chain keto acid dehydrogenase E1, alpha polypeptide	166.35	84.74	0.379	89.54
		(maple syrup urine disease)
433343	SRRM2	Serine/arginine repetitive matrix 2	179.81	99.94	0.103	178.03
433345		Full-length cDNA clone CL0BB014ZH04 of Neuroblastoma of	131.69	72.43	0.241	109.07
		Homo sapiens (human)
433419	COX4I1	Cytochrome c oxidase subunit IV isoform 1	291.96	97.81	0.103	402.93
433512	ACTR3	ARP3 actin-related protein 3 homolog (yeast)	202.84	72.82	0.103	95.46
433529	RPS11	Ribosomal protein S11	659.56	130.65	0.069	457.96
433540	DNAJC8	DnaJ (Hsp40) homolog, subfamily C. member 8	164.57	66.59	0.172	102.38
433573	C11orf68	Chromosome 11 open reading frame 68	109.74	74.58	0.379	76.09
433615	TUBB2C	Tubulin. beta 2C	1313.99	109.59	0.034	501.20
433701	RPL37A	Ribosomal protein L37a	941.22	280.38	0.034	2360.84
433722	KIAA1967	KIAA1967	137.26	57.51	0.345	37.39
433732	CLK1	CDC-like kinase 1	179.68	71.24	0.379	66.75
433750	EIF4G1	Eukaryotic translation initiation factor 4 gamma. 1	509.92	79.20	0.138	129.41
433759	BANF1	Barrier to autointegration factor 1	185.36	115.51	0.103	199.75
433795	SHC1	SHC (Src homology 2 domain containing) transforming protein 1	307.01	110.48	0.103	93.40
433863	PEBP1	Phosphatidylethanolamine binding protein 1	349.44	89.20	0.034	565.16
433901	COX8A	Cytochrome c oxidase subunit 8A (ubiquitous)	335.34	202.06	0.207	527.55
433951	GPX4	Glutathione peroxidase 4 (phospholipid hydroperoxidase)	265.60	84.94	0.207	646.53
434102	HMGB1	High-mobility group box 1	638.86	104.01	0.000	439.56
434207	HARS2	Histidyl-tRNA synthetase 2	146.76	94.43	0.276	50.79
434219	ANKHD1	Ankyrin repeat and KH domain containing 1	190.31	76.42	0.103	265.78
434401	ZNF638	Zinc finger protein 638	127.61	80.05	0.276	97.81
434937	PPIB	Peptidylprolyl isomerase B (cyclophilin B)	258.12	78.54	0.069	426.54
434953	HMGB2	High-mobility group box 2	275.63	95.40	0.138	90.55
434980	APP	Amyloid beta (A4) precursor protein (peptidase nexin-II. Alzheime	228.56	92.10	0.172	645.54
		disease)
435044	TBC1D22A	TBC1 domain family, member 22A	160.02	137.97	0.310	159.88
435064	DENND1A	DENN/MADD domain containing 1A	99.58	55.26	0.379	37.16
435120	KIF1C	Kinesin family member 1C	210.09	68.46	0.241	114.26
435136	TXN	Thioredoxin	346.61	189.66	0.276	221.38
435166	LBR	Lamin B receptor	188.22	185.85	0.310	68.73
435231	ZFR	Zinc finger RNA binding protein	158.35	73.83	0.172	48.65
435255	UBXD1	UBX domain containing 1	173.66	118.04	0.241	59.99
435326	ACTL6A	Actin-like 6A	152.42	64.63	0.172	41.79
435512	PPP3CA	Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha	156.63	85.19	0.345	114.98
		isoform (calcineurin A alpha)
435535	ZNF395	Zinc finger protein 395	126.06	79.86	0.310	50.14
435610	WAC	WW domain containing adaptor with coiled-coil	197.21	111.45	0.172	100.47
435741	GCSH	IQ motif and WD repeats 1	165.11	72.41	0.138	121.99
435759	THAP4	THAP domain containing 4	133.58	83.98	0.379	45.48
435771	API5	Apoptosis inhibitor 5	191.29	106.97	0.276	59.57
435841	TNRC15	Trinucleotide repeat containing 15	115.02	60.28	0.310	37.44
435850	LYPLA1	Lysophospholipase I	278.94	98.93	0.138	132.98
435933	PHF10	Chromosome 6 open reading frame 120	160.27	71.75	0.276	72.80
435948	ATAD1	ATPase family, AAA domain containing 1	119.77	79.07	0.310	46.76
435952	CDK5RAP1	CDK5 regulatory subunit associated protein 1	122.11	83.77	0.310	40.84
435974	MTHFD1	Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1,	193.28	103.81	0.172	55.52
		methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate
		synthetase
436035	TUBA1C	Tubulin, alpha 1c	3419.68	98.12	0.000	275.68
436093	BAT2	HLA-B associated transcript 2	414.35	96.65	0.172	98.56
436204	ZNF289	Zinc finger protein 289, ID1 regulated	187.48	70.10	0.138	33.87
436298	EMP1	Epithelial membrane protein 1	139.81	90.61	0.310	164.61
436405	IDH3B	Isocitrate dehydrogenase 3 (NAD+) beta	233.17	64.64	0.172	72.68
436437	ALDH2	Aldehyde dehydrogenase 2 family (mitochondrial)	213.99	91.66	0.207	112.73
436446	ARMET	Arginine-rich, mutated in early stage tumors	238.76	107.79	0.379	112.15
436500	DBNL	Drebrin-like	322.18	106.61	0.241	68.08
436568	CD74	CD74 antigen (invariant polypeptide of major histocompatibility	3672.46	211.82	0.345	1315.63
		complex, class II antigen-associated)
436578	POLR2F	Polymerase (RNA) II (DNA directed) polypeptide F	106.90	73.50	0.345	88.14
436657	CLU	Clusterin (complement lysis inhibitor. SP-40, 40, sulfated	586.91	158.76	0.241	1709.53
		glycoprotein 2, testosterone-repressed prostate message 2,
		apolipoprotein J)
436687	SET	SET translocation (myeloid leukemia-associated)	285.02	84.84	0.034	483.49
436803	VBP1	Von Hippel-Lindau binding protein 1	182.84	93.52	0.207	77.53
437056	SUPT5H	Suppressor of Ty 5 homolog (S. cerevisiae)	216.64	117.71	0.207	47.97
437060	CYCS	Cytochrome c, somatic	1874.90	252.41	0.207	102.41
437110	ANXA2	Annexin A2	2060.10	130.61	0.034	483.00
437178	ACADVL	Acyl-Coenzyme A dehydrogenase, very long chain	288.37	92.69	0.069	176.48
437256	GRINL1A	Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A	151.07	83.14	0.345	42.69
437277	MGAT4B	Mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-	1083.50	147.46	0.103	98.94
		acetylglucosaminyltransferase, isoenzyme B
437367	GBAS	Glioblastoma amplified sequence	143.22	113.71	0.276	128.35
437388	PIGT	Phosphatidylinositol glycan, class T	227.91	106.45	0.103	55.36
437403	PPA1	Pyrophosphatase (inorganic) 1	159.06	72.02	0.138	83.72
437594	RPLP2	Ribosomal protein, large, P2	498.18	148.73	0.034	2903.18
437638	XBP1	X-box binding protein 1	319.21	100.78	0.069	381.08
437779	C11orf10	Chromosome 11 open reading frame 10	241.39	149.44	0.345	178.08
437831	C14orf32	Chromosome 14 open reading frame 32	175.37	74.13	0.241	47.62
438072	UNC84A	Unc-84 homolog A (C. elegans)	146.52	82.20	0.345	53.45
438219	GPS2	G protein pathway suppressor 2	172.78	109.64	0.172	71.49
438429	RPS19	Ribosomal protein S19	721.53	169.75	0.103	3026.84
438678	TALDO1	Transaldolase 1	280.29	75.06	0.138	109.07
438720	MCM7	MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)	548.49	107.89	0.138	192.09
438970	TBL1XR1	Transducin (beta)-like 1X-linked receptor 1	185.70	86.87	0.241	73.49
438974	CUTL1	Cut-like 1. CCAAT displacement protein (Drosophila)	159.65	95.91	0.310	59.88
439480	RBM5	RNA binding motif protein 5	145.24	117.34	0.379	56.89
439481	SUPT4H1	Suppressor of Ty 4 homolog 1 (S. cerevisiae)	139.55	62.12	0.207	121.04
439548	FAM96A	Family with sequence similarity 96. member A	155.35	85.81	0.241	32.78
439552	MAP2K3	Mitogen-activated protein kinase kinase 3	2617.77	147.47	0.000	97.32
439815	HBXIP	Hepatitis B virus x interacting protein	127.08	97.39	0.310	188.94
440382	TRIM27	Tripartite motif-containing 27	155.33	68.54	0.172	80.66
440544	CLIC4	Chloride intracellular channel 4	337.71	121.54	0.103	116.71
440599	DDX1	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	433.83	283.30	0.103	194.20
440604	PSMD7	Proteasome (prosome. macropain) 26S subunit, non-ATPase, 7	156.07	77.17	0.138	99.15
		(Mov34 homolog)
440899	TTYH3	Tweety homolog 3 (Drosophila)	229.54	97.64	0.172	81.97
440932	SEPT9	Septin 9	361.78	96.86	0.034	158.17
440960	RAD23A	RAD23 homolog A (S. cerevisiae)	214.38	69.61	0.207	56.98
440961	CAST	Calpastatin	194.31	90.01	0.207	86.43
441072	POLR2L	Polymerase (RNA) II (DNA directed) polypeptide L, 7.6 kDa	225.44	138.68	0.379	278.78
441550	ABHD12	Abhydrolase domain containing 12	215.47	106.70	0.241	69.22
442344	IRS2	Insulin receptor substrate 2	134.97	79.52	0.379	117.65
442798	RNF10	Ring finger protein 10	210.73	75.43	0.103	80.34
443134	GBA2	Glucosidase. beta (bile acid) 2	132.85	60.27	0.379	64.55
443379	PSMD11	Proteasome (prosome, macropain) 26S subunit. non-ATPase. 11	180.98	64.45	0.172	49.98
443837	NPEPPS	Aminopeptidase puromycin sensitive	173.54	73.65	0.172	51.38
443914	SOD1	Superoxide dismutase 1. soluble (amyotrophic lateral sclerosis 1	341.06	88.95	0.103	267.67
		(adult))
444279	GPBP1	GC-rich promoter binding protein 1	132.98	56.92	0.241	63.11
444356	GRB2	Growth factor receptor-bound protein 2	167.92	61.94	0.172	146.51
444468	CTDSP1	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A	187.59	76.37	0.241	92.85
		small phosphatase 1
444472	SDHC	Succinate dehydrogenase complex. subunit C. integral membrane	175.42	71.22	0.207	45.51
		protein, 15 kDa
444569	TMEM49	Transmembrane protein 49	212.58	83.31	0.241	197.09
444673	CLPTM1L	CLPTM1-like	229.08	106.76	0.207	91.56
444724	AZI2	5-azacytidine induced 2	132.28	73.71	0.345	44.74
444818	CGGBP1	CGG triplet repeat binding protein 1	177.53	83.72	0.241	66.90
444931	CRSP6	Cofactor required for Sp1 transcriptional activation, subunit 6, 77	88.71	48.78	0.379	43.14
		kDa
444969	MEMO1	Mediator of cell motility 1	96.52	59.19	0.276	59.89
444986	METAP2	Methionyl aminopeptidase 2	169.09	73.08	0.172	54.25
445081	OAF	OAF homolog (Drosophila)	113.21	58.71	0.345	57.76
445351	LGALS1	Lectin. galactoside-binding. soluble, 1 (galectin 1)	564.16	197.93	0.241	1304.52
445394	VPS29	Vacuolar protein sorting 29 (yeast)	276.97	108.32	0.138	82.01
445498	SNW1	SNW domain containing 1	143.71	69.55	0.138	43.68
445511	RIOK3	RIO kinase 3 (yeast)	110.92	105.70	0.379	54.46
445570	CD63	CD63 antigen (melanoma 1 antigen)	489.45	199.49	0.034	182.09
445803	DC2	DC2 protein	658.16	215.09	0.138	77.15
445893	KHDRBS1	KH domain containing, RNA binding. signal transduction	227.64	88.75	0.138	189.36
		associated 1
445977	GTF3A	General transcription factor IIIA	160.66	73.81	0.172	82.05
446017	WSB1	WD repeat and SOCS box-containing 1	239.91	93.71	0.276	231.33
446091	WTAP	Wilms tumor 1 associated protein	119.70	95.46	0.379	83.46
446123	CAPZA2	Capping protein (actin filament) muscle Z-line, alpha 2	370.83	95.48	0.138	88.07
446149	LDHB	Lactate dehydrogenase B	1544.78	120.53	0.000	250.91
446260	PSMA6	Proteasome (prosome, macropain) subunit, alpha type. 6	224.07	106.72	0.172	227.02
446336	PXN	Paxillin	259.56	97.96	0.138	155.02
446345	FTH1	Ferritin, heavy polypeptide 1	2359.77	133.58	0.034	3636.50
446414	CD47	CD47 antigen (Rh-related antigen. integrin-associated signal	165.59	95.67	0.310	83.15
		transducer)
446427	OAZ1	Ornithine decarboxylase antizyme 1	673.68	62.71	0.069	576.39
446445	YIF1A	Yip1 interacting factor homolog A (S. cerevisiae)	151.87	80.99	0.276	76.17
446450	ITM2B	Integral membrane protein 2B	511.62	115.21	0.138	528.00
446574	TMSB10	Thymosin. beta 10	524.43	177.08	0.103	1381.46
446588	RPS13	Ribosomal protein S13	183.34	95.13	0.345	603.82
446623	HNRPL	Heterogeneous nuclear ribonucleoprotein L	113.61	53.54	0.276	351.95
446628	RPS4X	Ribosomal protein S4, X-linked	1285.06	89.84	0.000	2026.83
446641	ARAF	V-raf murine sarcoma 3611 viral oncogene homolog	176.49	69.57	0.241	54.08
446852	EIF3S6IP	Eukaryotic translation initiation factor 3. subunit 6 interacting	925.97	188.87	0.034	160.77
		protein
447477	ST13	Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70	272.29	141.17	0.103	139.88
		interacting protein)
447492	PGAM1	Phosphoglycerate mutase 1 (brain)	781.46	84.70	0.034	498.68
447547	VPS35	Hypothetical protein MGC34800	195.14	67.15	0.103	121.44
448226	RPLP0	Ribosomal protein, large, P0	3809.20	75.92	0.000	1108.65
448588	NGFRAP1	Nerve growth factor receptor (TNFRSF16) associated protein 1	218.09	83.14	0.310	364.70
448646	RPL27A	Ribosomal protein L27a	766.60	139.37	0.276	3106.03
448879	LOC38834	similar to ribosomal protein L13	471.24	99.11	0.069	126.52
449114	HNRPC	Heterogeneous nuclear ribonucleoprotein C (C1/C2)	803.24	90.38	0.034	241.77
449171	HNRPK	Heterogeneous nuclear ribonucleoprotein K	403.79	69.90	0.034	266.35
454534	USF2	Upstream transcription factor 2, c-fos interacting	111.98	76.53	0.310	62.62
454699	IL6ST	Interleukin 6 signal transducer (gp130. oncostatin M receptor)	266.74	139.73	0.103	48.68
456507	KIAA0319L	KIAA0319-like	131.45	85.77	0.241	73.31
456557	C1orf164	chromosome 1 open reading frame 164	143.89	71.60	0.276	116.20
458320	C3orf37	chromosome 3 open reading frame 37	170.49	148.07	0.310	35.84
458358	TSPYL1	Squamous cell carcinoma antigen recognized by T cells 2	101.91	73.81	0.345	127.17
458414	IFITM1	Interferon induced transmembrane protein 1 (9-27)	278.31	223.88	0.345	119.42
458458	FAM108A1	Family with sequence similarity 108. member A1	149.77	96.59	0.276	93.53
458747	ANP32A	Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	197.57	100.71	0.172	46.30
459106	AZIN1	Antizyme inhibitor 1	209.63	95.22	0.207	49.61
459149	BTBD1	BTB (POZ) domain containing 1	136.20	84.67	0.310	54.21
459174	FAM91A1	Family with sequence similarity 91, member A1	133.90	80.72	0.379	82.35
459211	AKAP13	A kinase (PRKA) anchor protein 13	217.52	97.30	0.310	70.77
459596	MPG	N-methylpurine-DNA glycosylase	110.09	94.77	0.241	78.83
459649	CLCN7	Chloride channel 7	161.09	107.31	0.207	57.89
459927	PTMA	Prothymosin. alpha (gene sequence 28)	1066.55	86.69	0.000	1205.32
459940	LITAF	Lipopolysaccharide-induced TNF factor	184.70	98.75	0.069	118.47
460238	SH3GLB2	SH3-domain GRB2-like endophilin B2	146.60	86.41	0.207	54.58
460317	SETX	Senataxin	132.56	111.94	0.310	59.22
460336	GGA2	Golgi associated. gamma adaptin ear containing. ARF binding	253.27	171.03	0.241	51.31
		protein 2
460468	XPO6	Exportin 6	212.84	80.39	0.172	58.36
460499	ATXN2L	Ataxin 2-like	228.25	84.67	0.310	66.95
460574	LOC12444	Hypothetical protein BC017488	125.84	87.37	0.379	74.28
460923	CNOT1	CCR4-NOT transcription complex. subunit 1	173.85	65.75	0.207	67.45
460929	GOT2	Glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate	397.62	79.42	0.103	126.69
		aminotransferase 2)
460978	APPBP1	Amyloid beta precursor protein binding protein 1	133.67	64.71	0.241	46.47
461047	G6PD	Glucose-6-phosphate dehydrogenase	274.16	130.32	0.207	81.94
461131	CYB5B	Cytochrome b5 type B (outer mitochondrial membrane)	192.30	75.56	0.138	76.12
461361	CFDP1	Craniofacial development protein 1	111.79	67.73	0.310	79.79
461379	GABARAPL2	GABA(A) receptor-associated protein-like 2	122.55	63.48	0.345	184.34
461722	TRAPPC2L	Trafficking protein particle complex 2-like	97.91	62.09	0.379	78.84
461777	CHMP1A	Chromatin modifying protein 1A	171.31	77.92	0.207	77.23
461896	CRK	V-crk sarcoma virus CT10 oncogene homolog (avian)	158.10	68.61	0.276	68.65
461925	RPA1	Replication protein A1. 70 kDa	160.13	72.42	0.103	83.76
462035	UBE2G1	Ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast)	149.46	102.82	0.207	72.02
462086	RPAIN	RPA interacting protein	129.54	77.35	0.379	70.39
462306	UBE2S	Ubiquitin-conjugating enzyme E2S	216.54	74.27	0.310	226.76
462316	TTC19	Hypothetical protein LOC125150	116.49	89.17	0.241	83.84
462492	USP22	Ubiquitin specific peptidase 22	379.95	165.78	0.138	95.69
462550	PIGS	Phosphatidylinositol glycan. class S	164.57	97.00	0.345	61.36
462956	PPARBP	PPAR binding protein	106.51	76.59	0.379	65.65
462998	IGFBP4	Insulin-like growth factor binding protein 4	345.88	87.71	0.207	238.31
463010	SMARCE1	SWI/SNF related, matrix associated, actin dependent regulator of	173.85	56.13	0.069	51.34
		chromatin. subfamily e. member 1
463035	FKBP10	FK506 binding protein 10. 65 kDa	164.51	91.24	0.310	88.10
463041	RERE	Arginine-glutamic acid dipeptide (RE) repeats	200.18	92.99	0.276	112.05
463059	STAT3	Signal transducer and activator of transcription 3 (acute-phase	205.74	114.93	0.207	286.52
		response factor)
463295	CDC27	Cell division cycle 27	115.34	79.50	0.310	47.81
463506	AKAP1	A kinase (PRKA) anchor protein 1	124.11	52.64	0.345	401.26
463702	BCAS3	Breast carcinoma amplified sequence 3	98.88	74.57	0.379	44.08
463797	MRTO4	mRNA turnover 4 homolog (S. cerevisiae)	142.20	59.85	0.276	48.55
464071	PGD	Phosphogluconate dehydrogenase	338.78	85.70	0.138	159.65
464137	ACOX1	Acyl-Coenzyme A oxidase 1, palmitoyl	103.04	66.74	0.241	64.57
464210	SYNGR2	Synaptogyrin 2	348.69	97.83	0.276	159.36
464336	P4HB	Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-	859.74	89.54	0.069	354.48
		hydroxylase). beta polypeptide (protein disulfide isomerase-
		associated 1)
464438	AGTRAP	Angiotensin II receptor-associated protein	117.55	68.62	0.379	100.58
464472	MRLC2	Myosin regulatory light chain MRLC2	233.35	102.50	0.034	303.55
464595	PPP4R1	Protein phosphatase 4. regulatory subunit 1	181.18	80.16	0.241	61.71
464652	TNFSF5IP1	Tumor necrosis factor superfamily, member 5-induced protein 1	145.59	119.46	0.345	59.73
464912	P15RS	Hypothetical protein FLJ10656	142.03	83.19	0.276	65.87
465224	NARS	Asparaginyl-tRNA synthetase	220.96	70.84	0.103	91.32
465374	EFHD2	EF-hand domain family. member D2	265.91	113.85	0.241	121.77
465498	TXNL4A	Thioredoxin-like 4A	121.61	80.29	0.276	118.06
465529	MIDN	Midnolin	139.65	96.07	0.345	77.19
465543	BTBD2	BTB (POZ) domain containing 2	204.49	98.92	0.207	90.71
465627	MAP2K2	Mitogen-activated protein kinase kinase 2	154.59	85.81	0.310	176.08
465645	C19orf10	Chromosome 19 open reading frame 10	204.93	79.48	0.276	122.81
465808	HNRPM	Heterogeneous nuclear ribonucleoprotein M	258.95	99.76	0.103	126.89
465849	PIN1	Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1	121.36	61.35	0.310	157.79
465924	SDHB	Succinate dehydrogenase complex. subunit B. iron sulfur (Ip)	161.79	65.94	0.241	76.80
466044	PKN1	Protein kinase N1	252.31	87.50	0.276	62.96
466088	TPM4	Tropomyosin 4	139.00	71.29	0.345	150.55
466148	NR2F6	Nuclear receptor subfamily 2, group F, member 6	179.12	94.04	0.379	157.14
466471	GPI	Glucose phosphate isomerase	502.15	94.80	0.069	172.27
466693	SIRT2	Sirtuin (silent mating type information regulation 2 homolog) 2 (S.	214.11	113.63	0.379	122.41
		cerevisiae)
466766	LTBP4	Latent transforming growth factor beta binding protein 4	174.46	77.33	0.379	68.26
466775	SNRPA	Small nuclear ribonucleoprotein polypeptide A	196.94	63.74	0.138	58.13
467084	EIF4G3	Eukaryotic translation initiation factor 4 gamma. 3	102.77	64.71	0.310	58.39
467097	SNRP70	Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen)	294.48	80.04	0.103	100.15
467192	PPP2R1A	Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65)	475.55	80.67	0.069	102.67
		alpha isoform
467279	LENG4	Leukocyte receptor cluster (LRC) member 4	315.24	116.72	0.310	169.43
467284	RPS9	Ribosomal protein S9	986.04	73.58	0.069	638.08
467408	TRIM28	Tripartite motif-containing 28	715.33	79.78	0.138	235.85
467637	CDC42	Cell division cycle 42 (GTP binding protein. 25 kDa)	158.07	97.05	0.138	282.31
467696	HPCAL1	Hippocalcin-like 1	172.64	83.71	0.379	94.69
467701	ODC1	Ornithine decarboxylase 1	351.16	77.30	0.103	112.30
467807	LAPTM4A	Lysosomal-associated protein transmembrane 4 alpha	482.50	88.89	0.069	380.71
467824	PUM2	Pumilio homolog 2 (Drosophila)	153.26	86.50	0.207	60.01
467960	RAB10	RAB10. member RAS oncogene family	162.79	57.31	0.103	100.37
468018	PPP1CB	Protein phosphatase 1, catalytic subunit. beta isoform	203.84	64.65	0.207	243.47
468415	PIGF	Phosphatidylinositol glycan, class F	150.01	71.46	0.241	85.62
468442	CALM2	Calmodulin 2 (phosphorylase kinase. delta)	1841.31	235.41	0.000	448.88
468760	AFTPH	Aftiphilin	93.25	61.52	0.310	56.19
469022	DGUOK	Deoxyguanosine kinase	116.26	75.71	0.241	55.33
469171	C1orf160	Chromosome 1 open reading frame 160	116.05	66.17	0.172	59.47
469331	STARD7	START domain containing 7	312.84	91.19	0.138	3007.75
469820	RALB	V-ral simian leukemia viral oncogene homolog B (ras related: GTF	125.95	59.65	0.379	51.68
		binding protein)
469863	YWHAZ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	385.89	74.53	0.034	262.56
		activation protein. zeta polypeptide
469925	FAM128B	Family with sequence similarity 128, member B	157.81	62.74	0.345	481.47
469970	SFRS4	Splicing factor, arginine/serine-rich 4	134.13	54.16	0.310	62.81
470091	YWHAE	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	330.87	97.70	0.069	590.76
		activation protein. epsilon polypeptide
470233	ARL5A	ADP-ribosylation factor-like 5A	137.43	81.25	0.345	39.57
470417	PEF1	Penta-EF-hand domain containing 1	144.07	63.57	0.241	62.85
470477	PTP4A2	Protein tyrosine phosphatase type IVA. member 2	163.45	69.99	0.103	138.21
470577	EIF2S2	Eukaryotic translation initiation factor 2. subunit 2 beta. 38 kDa	175.54	98.23	0.379	164.48
470588	KPNA6	Karyopherin alpha 6 (importin alpha 7)	105.07	66.63	0.207	91.23
470943	STAT1	Signal transducer and activator of transcription 1. 91 kDa	204.00	91.39	0.207	99.04
471011	SF3B1	Splicing factor 3b, subunit 1, 155 kDa	171.22	65.74	0.276	54.27
471104	NOP5/NOP58	Nucleolar protein NOP5/NOP58	119.95	77.84	0.207	107.80
471207	NDUFS1	NADH dehydrogenase (ubiquinone) Fe—S protein 1, 75 kDa	152.75	64.26	0.207	53.27
		(NADH-coenzyme Q reductase)
471441	PSMB2	Proteasome (prosome. macropain) subunit, beta type, 2	160.02	84.75	0.207	132.08
471461	ACSL3	Acyl-CoA synthetase long-chain family member 3	143.25	48.15	0.207	55.56
471593	CAB39	Calcium binding protein 39	125.47	90.94	0.276	71.62
471768	STK40	Serine/threonine kinase 40	150.57	81.43	0.310	76.01
471818	CAPRIN1	Cell cycle associated protein 1	233.39	93.24	0.069	48.75
471851	HDLBP	High density lipoprotein binding protein (vigilin)	770.41	90.63	0.034	284.45
471873	DTYMK	Deoxythymidylate kinase (thymidylate kinase)	151.55	81.98	0.276	61.06
471933	FKBP1A	FK506 binding protein 1A. 12 kDa	264.05	83.21	0.138	166.80
471975	C20orf116	Chromosome 20 open reading frame 116	168.09	95.60	0.379	46.80
472010	PRNP	Prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-	151.22	82.78	0.276	217.32
		Strausler-Scheinker syndrome, fatal familial insomnia)
472024	C20orf30	Chromosome 20 open reading frame 30	180.50	82.62	0.138	87.82
472031	UBE2D3	Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)	305.38	72.17	0.069	161.41
472038	UTP11L	UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)	116.49	107.41	0.379	46.16
472056	SYNCRIP	Synaptotagmin binding, cytoplasmic RNA interacting protein	198.01	71.24	0.103	97.30
472119	MKKS	McKusick-Kaufman syndrome	110.70	82.99	0.276	43.01
472185	NDUFS5	NADH dehydrogenase (ubiquinone) Fe—S protein 5, 15 kDa	317.85	115.06	0.172	175.84
		(NADH-coenzyme Q reductase)
472213	RRBP1	Ribosome binding protein 1 homolog 180 kDa (dog)	194.55	81.99	0.276	81.63
472330	C20orf3	Chromosome 20 open reading frame 3	210.62	71.28	0.345	111.23
472475	MACF1	Glycine-rich protein (GRP3S)	170.84	81.77	0.310	117.24
472535	AURKAIP1	Aurora kinase A interacting protein 1	236.28	92.32	0.345	87.41
472558	ERGIC3	ERGIC and golgi 3	273.22	82.09	0.138	150.94
472651	BLCAP	Bladder cancer associated protein	174.08	74.85	0.241	69.65
472737	TOP1	Topoisomerase (DNA) I	145.07	71.88	0.310	79.62
473296	TPD52L2	Tumor protein D52-like 2	198.42	74.39	0.172	87.51
473583	YBX1	Y box binding protein 1	706.53	98.38	0.034	340.36
473648	GART	Phosphoribosylglycinamide formyltransferase,	159.98	70.49	0.138	51.98
		phosphoribosylglycinamide synthetase,
		phosphoribosylaminoimidazole synthetase
473721	SLC2A1	Solute carrier family 2 (facilitated glucose transporter), member 1	496.75	142.19	0.345	157.66
473761	RTN3	Reticulon 3	222.45	76.58	0.103	160.89
473788	OTUB1	OTU domain, ubiquitin aldehyde binding 1	235.08	75.48	0.207	93.09
474005	SUMO3	SMT3 suppressor of mif two 3 homolog 3 (yeast)	224.13	104.97	0.138	71.57
474010	PTTG1IP	Pituitary tumor-transforming 1 interacting protein	472.39	85.43	0.138	111.37
474053	COL6A1	Collagen, type VI, alpha 1	240.21	60.68	0.345	421.26
474083	B4GALT2	UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptid	118.57	65.47	0.345	74.49
		2
474213	UFD1L	Ubiquitin fusion degradation 1 like (yeast)	117.12	72.56	0.276	42.38
474584	AKR1A1	Aldo-keto reductase family 1. member A1 (aldehyde reductase)	216.03	70.29	0.138	94.42
474643	C22orf28	Chromosome 22 open reading frame 28	331.66	109.80	0.138	100.93
474751	MYH9	Myosin. heavy polypeptide 9, non-muscle	426.57	109.52	0.069	127.27
474833	CSNK1E	Casein kinase 1, epsilon	193.49	86.78	0.138	68.93
474914	RUTBC3	RUN and TBC1 domain containing 3	190.23	157.68	0.345	74.06
474938	SLC25A17	Solute carrier family 25 (mitochondrial carrier; peroxisomal	113.70	81.93	0.345	33.74
		membrane protein, 34 kDa). member 17
474949	RBX1	Ring-box 1	145.55	82.29	0.241	69.67
474982	ACO2	Aconitase 2, mitochondrial	307.04	91.01	0.034	105.23
475125	ATXN10	Ataxin 10	198.54	95.44	0.172	118.31
475319	LRRFIP2	Leucine rich repeat (in FLII) interacting protein 2	104.35	72.12	0.310	69.04
475382	MTMR14	Myotubularin related protein 14	149.47	83.39	0.172	114.62
475392	TMEM111	Transmembrane protein 111	136.12	88.37	0.379	46.89
475663	RAB5A	RAB5A, member RAS oncogene family	119.70	91.27	0.241	74.69
475733	TOP2B	Topoisomerase (DNA) II beta 180 kDa	180.06	113.03	0.172	121.72
475812	STT3B	STT3, subunit of the oligosaccharyltransferase complex. homolog	108.24	76.02	0.310	55.56
		B (S. cerevisiae)
476018	CTNNB1	Catenin (cadherin-associated protein), beta 1, 88 kDa	138.21	58.20	0.310	215.94
476033	TXNDC12	Thioredoxin domain containing 12 (endoplasmic reticulum)	146.57	70.89	0.172	52.90
476179	SMARCC1	SWI/SNF related, matrix associated, actin dependent regulator of	171.16	127.75	0.138	91.06
		chromatin, subfamily c, member 1
476221	IHPK2	Inositol hexaphosphate kinase 2	145.26	55.31	0.241	77.62
476231	IMPDH2	IMP (inosine monophosphate) dehydrogenase 2	1006.91	110.38	0.034	120.62
476308	ALAS1	Aminolevulinate, delta-, synthase 1	132.82	82.50	0.345	50.43
476365	SCP2	Sterol carrier protein 2	690.56	180.11	0.276	125.14
476448	FLNB	Filamin B, beta (actin binding protein 278)	189.01	103.49	0.310	56.29
476706	MRPL37	Mitochondrial ribosomal protein L37	249.66	66.27	0.172	97.03
476930	CHMP2B	Chromatin modifying protein 2B	143.22	100.41	0.310	73.54
477157	DULLARD	Dullard homolog (Xenopus laevis)	158.37	96.36	0.103	97.30
477789	ATP1B3	ATPase. Na+/K+ transporting. beta 3 polypeptide	167.45	84.60	0.138	135.93
477892	GYG1	Glycogenin 1	151.92	63.62	0.345	54.22
478000	MBNL1	Muscleblind-like (Drosophila)	304.13	90.08	0.241	61.18
478044	PA2G4	Proliferation-associated 2G4, 38 kDa	460.10	87.56	0.103	157.68
478553	EIF4A2	Eukaryotic translation initiation factor 4A, isoform 2	403.21	91.85	0.069	357.47
479208	FBXL5	F-box and leucine-rich repeat protein 5	140.68	84.67	0.276	55.97
479264	LAP3	Leucine aminopeptidase 3	140.16	84.68	0.241	106.91
479634	SLC30A9	Solute carrier family 30 (zinc transporter), member 9	123.90	63.55	0.379	75.32
479693	SFRS11	Splicing factor, arginine/serine-rich 11	189.39	69.99	0.172	199.97
479728	GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	7330.72	80.18	0.000	3167.05
479747	BCAR1	Breast cancer anti-estrogen resistance 1	183.08	85.45	0.310	58.32
479814	POLR2B	Polymerase (RNA) II (DNA directed) polypeptide B, 140 kDa	170.30	62.57	0.310	102.92
480073	HNRPD	Heterogeneous nuclear ribonucleoprotein D (AU-rich element RN	229.02	68.01	0.103	241.33
		binding protein 1, 37 kDa)
480311	PDLIM5	PDZ and LIM domain 5	273.24	235.65	0.241	95.21
480465	SCYE1	Small inducible cytokine subfamily E. member 1 (endothelial	107.39	55.27	0.276	55.39
		monocyte-activating)
480653	ANXA5	Annexin A5	303.60	104.16	0.069	169.77
481571	UQCRH	Similar to Ubiquinol-cytochrome C reductase complex 11 kDa	229.54	102.84	0.138	431.88
		protein. mitochondrial precursor (Mitochondrial hinge protein)
		(Cytochrome C1, nonheme 11 kDa protein) (Complex III subunit
		VIII)
481720	MYO10	Myosin X	140.50	130.53	0.310	91.75
481898	CCBL2	Cysteine conjugate-beta lyase 2	134.41	54.32	0.310	48.63
482144	RPL26	Similar to 60S ribosomal protein L26	447.43	95.30	0.034	699.37
482363	SLC30A5	Solute carrier family 30 (zinc transporter), member 5	78.30	56.98	0.379	57.46
482526	TINP1	TGF beta-inducible nuclear protein 1	121.52	61.06	0.241	173.99
482868	KIAA0372	KIAA0372	126.07	60.99	0.241	71.13
483036	PJA2	Praja 2, RING-H2 motif containing	158.62	65.91	0.276	72.48
483067	C5orf13	Chromosome 5 open reading frame 13	318.12	190.12	0.379	195.11
483305	HINT1	Histidine triad nucleotide binding protein 1	236.40	118.42	0.207	113.38
483408	PPP2CA	Protein phosphatase 2 (formerly 2A). catalytic subunit, alpha	230.50	94.12	0.138	105.32
		isoform
483454	CNN3	Calponin 3, acidic	211.93	89.89	0.207	399.33
483486	JMJD1B	Jumonji domain containing 1B	107.12	52.95	0.310	64.58
484138	FBXW11	F-box and WD-40 domain protein 11	117.64	68.50	0.379	109.27
484188	ATP6V0E1	ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1	159.10	68.32	0.138	71.54
484242	UBXD8	UBX domain containing 8	125.98	75.93	0.207	66.51
484288	DDX41	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	214.13	74.98	0.138	47.70
484363	RNF130	Ring finger protein 130	97.65	67.32	0.138	111.91
484551	CPM	Carboxypeptidase M	186.28	78.16	0.310	71.14
484813	DEK	DEK oncogene (DNA binding)	260.77	83.22	0.172	114.27
485155	RPL35	Ribosomal protein L35	281.04	111.39	0.172	1995.97
485195	SORT1	Sortilin 1	150.82	80.52	0.345	91.72
485246	PSMA5	Proteasome (prosome, macropain) subunit, alpha type. 5	164.31	83.49	0.207	72.99
485262	MTCH1	Mitochondrial carrier homolog 1 (C. elegans)	364.72	91.85	0.103	222.02
485365	AHCYL1	S-adenosylhomocysteine hydrolase-like 1	182.57	61.85	0.207	87.98
485616	DST	Dystonin	144.43	74.83	0.276	159.14
486542	BCLAF1	BCL2-associated transcription factor 1	184.76	58.42	0.207	57.11
487027	VIL2	Villin 2 (ezrin)	228.59	71.02	0.138	203.46
487054	TCP1	T-complex 1	209.76	78.62	0.138	162.70
487635	BZW2	Basic leucine zipper and W2 domains 2	250.31	146.18	0.172	96.11
487774	HNRPA2B1	Heterogeneous nuclear ribonucleoprotein A2/B1	218.53	87.55	0.103	476.18
488171	NUDCD3	NudC domain containing 3	607.73	183.50	0.034	2935.95
488181	OGDH	Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	245.90	110.90	0.207	93.55
488307	ECOP	EGFR-coamplified and overexpressed protein	151.47	75.46	0.345	105.70
488478	C7orf42	Chromosome 7 open reading frame 42	151.66	70.90	0.207	70.53
488671	BAZ1B	Bromodomain adjacent to zinc finger domain. 1B	114.54	65.20	0.207	97.87
489207	ASNS	Asparagine synthetase	262.06	124.38	0.172	159.98
489284	ARPC1B	Actin related protein 2/3 complex. subunit 1B. 41 kDa	555.08	109.32	0.103	249.26
489287	CPSF4	Cleavage and polyadenylation specific factor 4, 30 kDa	171.76	69.89	0.172	88.36
489336	SYAP1	Synapse associated protein 1. SAP47 homolog (Drosophila)	126.10	45.09	0.310	51.70
489615	PBEF1	Pre-B-cell colony enhancing factor 1	211.67	111.85	0.276	110.09
490203	CALD1	Caldesmon 1	242.44	103.25	0.207	84.05
490394	SSBP1	Single-stranded DNA binding protein 1	444.28	309.52	0.241	86.70
490415	ZYX	Zyxin	259.67	90.01	0.138	278.36
490745	DNAJB6	DnaJ (Hsp40) homolog. subfamily B. member 6	182.26	74.39	0.103	170.33
490795	FAM62B	Family with sequence similarity 62 (C2 domain containing)	256.81	139.32	0.276	67.48
		member B
490874	MTX1	Metaxin 1	139.52	83.02	0.310	62.57
491336	ELP3	Elongation protein 3 homolog (S. cerevisiae)	98.38	59.66	0.379	43.04
491359	LMNA	Lamin A/C	797.11	108.53	0.138	415.19
491440	PPP2CB	Protein phosphatase 2 (formerly 2A). catalytic subunit. beta	146.90	77.42	0.276	218.31
		isoform
491494	CCT3	Chaperonin containing TCP1, subunit 3 (gamma)	1152.31	109.73	0.034	207.97
491597	VDAC3	Voltage-dependent anion channel 3	189.10	60.03	0.207	82.40
491695	UBE2V2	Ubiquitin-conjugating enzyme E2 variant 2	1324.03	205.58	0.276	58.78
491745	TCEA1	Transcription elongation factor A (SII). 1	180.17	63.49	0.241	69.36
491988	TRAM1	Translocation associated membrane protein 1	151.74	62.44	0.172	147.67
492236	WDR42A	WD repeat domain 42A	135.63	62.96	0.310	61.94
492314	LAPTM4B	Lysosomal associated protein transmembrane 4 beta	315.85	98.92	0.138	124.30
492445	UBR5	Ubiquitin protein ligase E3 component n-recognin 5	133.59	70.25	0.345	51.32
492599	EIF3S3	Eukaryotic translation initiation factor 3, subunit 3 gamma, 40 kDa	457.44	91.86	0.069	165.21
492805	NMD3	NMD3 homolog (S. cerevisiae)	154.69	68.25	0.276	64.99
493362	AK3L1	Adenylate kinase 3	138.22	63.01	0.241	49.75
493750	WDR40A	WD repeat domain 40A	158.95	64.13	0.345	28.58
494173	ANXA1	Annexin A1	663.71	206.40	0.138	439.06
494419	LAMP1	Lysosomal-associated membrane protein 1	278.30	123.84	0.276	112.59
494457	NINJ1	Ninjurin 1	146.99	120.17	0.379	192.87
494604	ANP32B	Acidic (leucine-rich) nuclear phosphoprotein 32 family. member B	297.30	74.71	0.069	142.74
494614	BAT2D1	BAT2 domain containing 1	103.03	72.44	0.310	133.29
494691	PFN1	Profilin 1	582.68	96.95	0.069	1198.54
494700	SLC44A1	Solute carrier family 44, member 1	156.34	79.78	0.379	88.15
494985	FBXW2	F-box and WD-40 domain protein 2	97.45	68.65	0.379	40.27
495039	NDUFA8	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex. 8, 19	100.91	70.67	0.345	82.23
495349	KIAA0515	KIAA0515	213.73	62.92	0.069	129.84
495471	PMPCA	Peptidase (mitochondrial processing) alpha	174.09	84.07	0.172	85.88
495605	CD99	CD99 antigen	171.31	62.16	0.138	198.26
495851	APOO	Apolipoprotein O	144.33	80.53	0.345	129.92
495960	ATP6AP2	ATPase. H+ transporting. lysosomal accessory protein 2	177.66	91.25	0.276	67.87
496068	PCTK1	PCTAIRE protein kinase 1	177.60	80.15	0.207	56.40
496098	OTUD5	OTU domain containing 5	171.08	119.61	0.207	43.34
496271	?	Full-length cDNA clone CS0DJ002YF04 of T cells (Jurkat cell line	552.58	198.74	0.172	70.79
		Cot 10-normalized of Homo sapiens (human)
496487	ATF4	Activating transcription factor 4 (tax-responsive enhancer element	644.83	92.22	0.069	179.34
		B67)
496646	IL13RA1	Interleukin 13 receptor. alpha 1	117.23	77.35	0.310	54.24
496684	LAMP2	Lysosomal-associated membrane protein 2	175.62	85.98	0.241	127.56
497183	IVNS1ABP	Influenza virus NS1A binding protein	156.30	56.55	0.241	76.25
497599	WARS	Tryptophanyl-tRNA synthetase	328.30	141.43	0.103	158.85
497692	NSL1	NSL1, MIND kinetochore complex component. homolog (S.	142.41	132.49	0.379	45.74
		cerevisiae)
497893	ENAH	Enabled homolog (Drosophila)	133.62	90.22	0.276	73.14
498239	FH	Fumarate hydratase	304.63	108.28	0.276	51.25
498313	ADSS	Adenylosuccinate synthase	138.41	96.89	0.276	66.59
498317	C1orf121	Chromosome 1 open reading frame 121	139.90	108.25	0.379	67.33
498455	LARP5	La ribonucleoprotein domain family, member 5	142.32	72.97	0.241	56.84
498548	RBM17	RNA binding motif protein 17	119.60	106.34	0.207	84.57
498727	DHCR24	24-dehydrocholesterol reductase	380.21	178.18	0.207	125.92
499145	YME1L1	YME1-like 1 (S. cerevisiae)	218.20	87.96	0.241	85.44
499158	GGA1	Golgi associated. gamma adaptin ear containing. ARF binding	149.92	94.46	0.276	59.38
		protein 1
499594	TIMM23	Translocase of inner mitochondrial membrane 23 homolog (yeast)	116.05	77.66	0.241	46.30
499833	REEP3	Receptor accessory protein 3	97.26	86.49	0.345	48.48
499891	HNRPH3	Heterogeneous nuclear ribonucleoprotein H3 (2H9)	152.75	70.91	0.103	103.56
499925	VPS26A	Vacuolar protein sorting 26 homolog A (S. pombe)	129.39	63.83	0.172	66.21
499960	SAR1A	SAR1 gene homolog A (S. cerevisiae)	122.18	69.10	0.172	87.25
500067	PPP3CB	Protein phosphatase 3 (formerly 2B). catalytic subunit. beta	120.27	66.72	0.241	124.28
		isoform (calcineurin A beta)
500101	VCL	Vinculin	197.78	102.19	0.207	122.06
500375	ENTPD6	Ectonucleoside triphosphate diphosphohydrolase 6 (putative	163.42	84.78	0.276	93.92
		function)
500409	GLUD1	Glutamate dehydrogenase 1	161.37	95.54	0.138	228.78
500546	IDE	Insulin-degrading enzyme	112.83	68.82	0.310	46.45
500674	TM9SF3	Transmembrane 9 superfamily member 3	215.50	58.43	0.207	132.96
500775	ZNF207	Zinc finger protein 207	233.29	62.27	0.034	165.68
500842	MGEA5	Meningioma expressed antigen 5 (hyaluronidase)	179.67	93.93	0.310	194.92
500874	CUEDC2	CUE domain containing 2	129.96	52.06	0.310	136.22
501012	ADD3	Adducin 3 (gamma)	223.70	119.75	0.310	80.79
501023	MXI1	MAX interactor 1	94.44	62.74	0.345	62.06
501203	TIAL1	TIA1 cytotoxic granule-associated RNA binding protein-like 1	146.01	73.16	0.276	75.46
501293	BSG	Basigin (OK blood group)	737.88	112.29	0.103	664.58
501309	CIRBP	Cold inducible RNA binding protein	265.44	117.90	0.034	203.81
501353	PLEKHJ1	Pleckstrin homology domain containing, family J member 1	100.87	56.61	0.379	75.27
501376	UROS	Uroporphyrinogen III synthase (congenital erythropoietic porphyria)	130.07	71.33	0.241	54.58
501420	NCLN	Nicalin homolog (zebrafish)	177.01	86.48	0.241	51.28
501629	IER2	Immediate early response 2	140.79	60.99	0.241	197.55
501684	NAP1L4	Nucleosome assembly protein 1-like 4	166.93	111.13	0.138	77.93
501735	STIM1	Stromal interaction molecule 1	117.62	71.87	0.276	85.58
501853	TMEM9B	TMEM9 domain family, member B	110.79	91.41	0.379	55.61
501924	USP47	Ubiquitin specific peptidase 47	132.14	118.32	0.345	43.63
501991	MLSTD2	Male sterility domain containing 2	96.74	62.95	0.379	51.17
502302	CAT	Catalase	158.19	107.96	0.345	78.26
502328	CD44	CD44 antigen (homing function and Indian blood group system)	366.11	100.63	0.172	183.18
502461	DGKZ	Diacylglycerol kinase. zeta 104 kDa	109.99	96.64	0.310	78.41
502528	NDUFS3	NADH dehydrogenase (ubiquinone) Fe—S protein 3. 30 kDa	119.28	75.88	0.207	151.30
		(NADH-coenzyme Q reductase)
502630	C11orf31	Chromosome 11 open reading frame 31	170.27	98.83	0.276	149.13
502659	RHOC	Ras homolog gene family, member C	253.62	101.47	0.138	234.42
502705	PRPF19	PRP19/PSO4 pre-mRNA processing factor 19 homolog (S.	198.31	100.04	0.276	84.60
		cerevisiae)
502745	FADS2	Fatty acid desaturase 2	266.18	116.45	0.276	221.93
502769	SLC3A2	Solute carrier family 3 (activators of dibasic and neutral amino aci	276.24	84.47	0.138	123.67
		transport). member 2
502773	ADI1	Acireductone dioxygenase 1	159.84	55.74	0.103	57.70
502823	PRDX5	Peroxiredoxin 5	183.65	76.11	0.241	216.88
502829	SF1	Splicing factor 1	263.86	66.20	0.069	141.67
502836	ARL2	ADP-ribosylation factor-like 2	134.06	114.72	0.310	119.31
502842	CAPN1	Calpain 1. (mu/l) large subunit	287.11	101.89	0.207	88.58
502872	MAP3K11	Mitogen-activated protein kinase kinase kinase 11	128.70	82.13	0.276	72.97
502876	RHOB	Ras homolog gene family, member B	165.00	92.57	0.310	283.76
503093	ZFP36L2	Zinc finger protein 36, C3H type-like 2	150.79	67.83	0.207	280.17
503222	RAB6A	RAB6A, member RAS oncogene family	152.69	73.96	0.241	119.21
503251	PPME1	Protein phosphatase methylesterase 1	123.71	52.56	0.207	59.51
503597	HSPC148	Hypothetical protein HSPC148	107.89	76.02	0.276	58.03
503709	TMEM123	Transmembrane protein 123	339.10	161.64	0.172	79.34
503716	DCUN1D5	DCN1, defective in cullin neddylation 1. domain containing 5 (S.	167.32	87.13	0.138	54.63
		cerevisiae)
503787	DARS	Aspartyl-tRNA synthetase	147.34	55.17	0.138	100.30
504237	STT3A	STT3, subunit of the oligosaccharyltransferase complex. homolog	117.19	108.95	0.345	77.26
		A (S. cerevisiae)
504517	RPS27	Tetraspanin 9	176.40	121.62	0.379	2547.00
504613	PTMS	Parathymosin	175.13	81.37	0.345	308.10
504620	PHB2	Prohibitin 2	506.51	79.86	0.069	136.79
504687	MYL9	Elongation factor Tu family protein	343.66	100.94	0.379	340.49
504828	DDX47	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	130.63	59.08	0.379	43.21
504895	STRAP	Serine/threonine kinase receptor associated protein	221.43	95.09	0.138	122.68
505033	KRAS	v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	115.82	83.04	0.310	57.38
505059	PSMD4	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	259.00	62.63	0.103	180.27
505625	C12orf10	Chromosome 12 open reading frame 10	105.33	77.88	0.345	80.93
505652	COPZ1	Coatomer protein complex, subunit zeta 1	204.89	87.20	0.000	217.03
505676	CIP29	Cytokine induced protein 29 kDa	184.81	88.39	0.241	118.62
505705	MYL6	Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle	438.52	109.87	0.069	1121.48
505806	PBXIP1	Pre-B-cell leukemia transcription factor interacting protein 1	115.75	83.63	0.310	72.04
505824	SAMM50	Sorting and assembly machinery component 50 homolog (S.	242.60	117.59	0.172	59.28
		cerevisiae)
506215	RARS	Arginyl-tRNA synthetase	192.15	85.96	0.172	103.05
506325	NUDT4	Nudix (nucleoside diphosphate linked moiety X)-type motif 4	121.40	87.04	0.379	161.89
		pseudogene 2
506759	ATP2A2	ATPase. Ca++ transporting. cardiac muscle. slow twitch 2	375.19	241.76	0.241	195.37
506861	DDX54	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	199.70	104.77	0.241	74.73
507074	KIAA0152	KIAA0152	244.90	89.86	0.069	77.13
507162	VPS37B	Vacuolar protein sorting 37 homolog B (S. cerevisiae)	142.45	79.66	0.276	143.42
507584	POLR1D	Polymerase (RNA) I polypeptide D. 16 kDa	121.94	73.07	0.241	107.77
507680	PFAAP5	Phosphonoformate immuno-associated protein 5	143.30	68.40	0.345	63.32
507910	PGRMC2	Progesterone receptor membrane component 2	131.09	75.85	0.207	124.83
507916	TSC22D1	TSC22 domain family. member 1	344.52	102.84	0.172	243.46
508010	FNDC3A	Fibronectin type III domain containing 3A	264.21	157.30	0.241	110.98
508644	FLJ10154	Hypothetical protein FLJ10154	183.99	75.88	0.310	65.60
509163	ERGIC1	Endoplasmic reticulum-golgi intermediate compartment (ERGIC)	1147.54	71.85	0.103	94.35
509226	FKBP3	FK506 binding protein 3, 25 kDa	146.28	97.77	0.241	140.21
509264	KLHDC2	Kelch domain containing 2	117.21	72.23	0.207	121.90
509414	KTN1	Kinectin 1 (kinesin receptor)	196.92	103.65	0.207	88.75
509622	RGL2	Ral guanine nucleotide dissociation stimulator-like 2	136.36	70.20	0.345	93.28
509736	HSP90AB1	Heat shock protein 90 kDa alpha (cytosolic), class B member 1	2045.82	87.83	0.000	550.72
509791	ERH	Enhancer of rudimentary homolog (Drosophila)	148.95	80.20	0.207	256.46
509909	NUMB	Numb homolog (Drosophila)	115.97	62.99	0.241	58.22
510087	ENSA	Endosulfine alpha	196.15	70.81	0.034	159.53
510328	DDX24	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	446.38	126.73	0.103	75.63
510402	CD46	CD46 molecule, complement regulatory protein	255.43	87.89	0.276	81.27
511067	FAM82C	Family with sequence similarity 82. member C	193.94	125.16	0.345	39.66
511138	TMEM87A	Transmembrane protein 87A	153.90	71.25	0.241	82.26
511149	SNAP23	Synaptosomal-associated protein, 23 kDa	159.76	70.15	0.276	51.21
511425	SRP9	Signal recognition particle 9 kDa	1439.84	206.14	0.069	454.09
511504	TCF12	Transcription factor 12 (HTF4. helix-loop-helix transcription factor	175.22	83.75	0.276	69.32
		4)
511862		Similar to 60S acidic ribosomal protein P1	182.40	88.27	0.379	84.86
511952	CBX6	Chromobox homolog 6	153.88	81.20	0.276	64.59
512005	ARPC3	Actin related protein 2/3 complex. subunit 3, 21 kDa	175.09	73.61	0.241	119.68
512465	SURF4	Surfeit 4	272.49	79.31	0.069	106.55
512525	RPS17	Ribosomal protein S17	1561.21	128.47	0.069	599.75
512607	MIR16	Membrane interacting protein of RGS16	243.63	112.71	0.207	98.46
512640	PRKCSH	Protein kinase C substrate 80K-H	369.95	87.75	0.172	131.74
512661	ISY1	ISY1 splicing factor homolog (S. cerevisiae)	247.17	110.21	0.241	115.05
512676	RPS25	Ribosomal protein S25	200.49	132.68	0.241	286.69
512693	METT11D1	Methyltransferase 11 domain containing 1	119.37	86.98	0.345	29.73
512756	THAP7	THAP domain containing 7	139.40	88.58	0.345	51.73
512815	AP3D1	Adaptor-related protein complex 3, delta 1 subunit	260.40	98.20	0.034	107.57
512857	CD151	CD151 antigen	289.17	93.65	0.207	378.94
512867	CASC4	Cancer susceptibility candidate 4	130.94	70.38	0.207	100.14
512908	ARPP-19	Cyclic AMP phosphoprotein. 19 kD	226.51	76.75	0.207	146.97
513043	IMP3	IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)	135.64	58.16	0.310	47.55
513055	WDR61	WD repeat domain 61	114.60	53.12	0.345	70.68
513057	RANBP5	RAN binding protein 5	280.02	118.69	0.172	101.08
513058	TMED3	Transmembrane emp24 protein transport domain containing 3	180.01	81.33	0.138	114.71
513071	MESDC1	Mesoderm development candidate 1	153.38	113.49	0.276	50.82
513083	RPL9	Ribosomal protein L9	1564.85	164.78	0.034	740.57
513141	IDH2	Isocitrate dehydrogenase 2 (NADP+). mitochondrial	276.13	73.73	0.103	172.64
513145	NGRN	Neugrin. neurite outgrowth associated	292.66	85.21	0.034	91.71
513153	FURIN	Furin (paired basic amino acid cleaving enzyme)	171.95	95.68	0.379	67.56
513230	MRPL28	Mitochondrial ribosomal protein L28	206.58	141.00	0.241	67.94
513242	RHOT2	Ras homolog gene family. member T2	146.56	66.79	0.345	59.56
513261	HN1L	Hematological and neurological expressed 1-like	169.07	73.84	0.138	62.28
513266	NDUFB10	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22	141.77	93.82	0.345	42.16
513470	NFATC2IP	Nuclear factor of activated T-cells, cytoplasmic. calcineurin-	123.18	55.34	0.310	30.57
		dependent 2 interacting protein
513488	MVP	Major vault protein	276.00	95.97	0.276	79.08
513490	ALDOA	Aldolase A. fructose-bisphosphate	1575.38	81.23	0.034	916.32
513520	BCKDK	Branched chain ketoacid dehydrogenase kinase	181.01	99.21	0.276	51.25
513522	FUS	Fusion (involved in t(12; 16) in malignant liposarcoma)	402.21	88.89	0.034	172.34
513631	ARL2BP	ADP-ribosylation factor-like 2 binding protein	133.32	76.06	0.379	60.80
513856	DPH1	DPH1 homolog (S. cerevisiae)	153.80	77.15	0.172	162.16
513984	FLIl	Flightless l homolog (Drosophila)	218.66	80.64	0.103	61.58
514012	MAP2K3	Mitogen-activated protein kinase kinase 3	206.91	198.73	0.379	68.18
514036	SDF2	Stromal cell-derived factor 2	139.48	83.16	0.379	49.32
514038	FLOT2	Flotillin 2	205.94	75.37	0.241	103.22
514174	JUP	Junction plakoglobin	311.95	175.04	0.310	204.87
514196	RPL27	Ribosomal protein L27	445.53	163.18	0.103	927.28
514211	TMEM101	Transmembrane protein 101	207.70	66.43	0.345	109.02
514216	SLC25A39	Solute carrier family 25. member 39	372.09	78.71	0.103	162.85
514220	GRN	Granulin	569.94	118.75	0.103	216.06
514297	UBE2Z	Ubiquitin-conjugating enzyme E2Z (putative)	149.22	70.83	0.172	84.41
514303	PHB	Prohibitin	337.86	78.21	0.103	142.93
514435	SF3B3	Splicing factor 3b, subunit 3. 130 kDa	245.52	67.98	0.138	44.20
514489	WBP2	WW domain binding protein 2	367.18	97.07	0.138	147.04
514535	LGALS3BP	Lectin. galactoside-binding. soluble. 3 binding protein	714.12	134.59	0.172	117.40
514581	ACTG1	Actin, gamma 1	6790.08	96.54	0.000	1374.42
514590	HGS	Hepatocyte growth factor-regulated tyrosine kinase substrate	234.48	89.80	0.241	88.17
514819	AP2B1	Adaptor-related protein complex 2, beta 1 subunit	184.47	53.67	0.207	92.79
514870	ATP5F1	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	441.56	130.47	0.034	84.88
		b, isoform 1
514920	CALCOCO	Calcium binding and coiled-coil domain 2	151.26	76.62	0.241	46.59
514934	CAPZA1	Capping protein (actin filament) muscle Z-line, alpha 1	232.49	84.07	0.276	101.72
515003	C19orf6	Chromosome 19 open reading frame 6	218.92	96.61	0.172	96.49
515005	STK11	Serine/threonine kinase 11 (Peutz-Jeghers syndrome)	127.27	85.12	0.379	66.15
515018	GNA13	Guanine nucleotide binding protein (G protein). alpha 13	162.22	105.65	0.345	72.69
515053	AES	Amino-terminal enhancer of split	314.90	95.73	0.138	258.48
515070	EEF2	Eukaryotic translation elongation factor 2	403.41	101.00	0.034	2097.60
515092	CLPP	ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit	173.03	103.29	0.241	50.27
		homolog (E. coli)
515155	C19orf43	Chromosome 19 open reading frame 43	161.94	77.42	0.138	117.34
515162	CALR	Calreticulin	575.58	88.03	0.034	110.24
515164	GADD45GIP1	Growth arrest and DNA-damage-inducible, gamma interacting	191.12	69.42	0.276	107.72
		protein 1
515210	DNAJB1	DnaJ (Hsp40) homolog, subfamily B. member 1	233.68	80.33	0.207	330.45
515255	LSM4	LSM4 homolog. U6 small nuclear RNA associated (S. cerevisiae)	266.66	105.98	0.276	139.77
515266	UPF1	UPF1 regulator of nonsense transcripts homolog (yeast)	163.88	99.99	0.276	60.23
515271	SFRS14	Splicing factor, arginine/serine-rich 14	124.30	81.86	0.310	47.59
515329	RPL22	Ribosomal protein L22	191.43	75.49	0.138	455.30
515371	CAPNS1	Calpain. small subunit 1	404.46	95.10	0.069	519.15
515406	AKT2	V-akt murine thymoma viral oncogene homolog 2	139.00	124.72	0.345	101.41
515417	EGLN2	Egl nine homolog 2 (C. elegans)	257.04	138.23	0.379	141.94
515432	DEDD2	Death effector domain containing 2	94.65	52.25	0.379	52.49
515472	SNRPD2	Small nuclear ribonucleoprotein D2 polypeptide 16.5 kDa	292.31	154.43	0.207	250.23
515475	SYMPK	Symplekin	133.18	53.29	0.241	43.73
515487	CALM3	Calmodulin 3 (phosphorylase kinase. delta)	439.26	95.22	0.069	170.52
515494	SLC1A5	Solute carrier family 1 (neutral amino acid transporter), member 5	448.32	106.79	0.138	90.90
515500	SAE1	SUMO-1 activating enzyme subunit 1	380.21	79.67	0.034	84.41
515515	KDELR1	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention	261.62	81.81	0.138	278.16
		receptor 1
515517	RPL18	Ribosomal protein L18	743.38	74.48	0.103	361.65
515524	NUCB1	Nucleobindin 1	350.34	117.21	0.103	177.67
515540	PTOV1	Prostate tumor overexpressed gene 1	175.30	98.47	0.172	165.98
515550	LOC284361	Hematopoietic signal peptide-containing	135.48	82.61	0.310	234.71
515598	PRPF31	PRP31 pre-mRNA processing factor 31 homolog (yeast)	368.40	151.24	0.276	57.93
515607	PPP1R12C	Protein phosphatase 1, regulatory (inhibitor) subunit 12C	165.22	97.14	0.379	50.41
515642	GPSN2	Glycoprotein, synaptic 2	171.37	74.21	0.345	122.06
515785	BLVRB	Biliverdin reductase B (flavin reductase (NADPH))	143.92	94.30	0.310	182.67
515846	RUVBL2	RuvB-like 2 (E. coli)	354.78	98.40	0.138	97.93
515848	HADHB	Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme	213.42	90.90	0.103	98.50
		thiolase/enoyl-Coenzyme A hydratase (trifunctional protein). beta
		subunit
515890	YPEL5	Yippee-like 5 (Drosophila)	181.92	82.16	0.276	123.75
516075	TIA1	TIA1 cytotoxic granule-associated RNA binding protein	183.23	80.58	0.310	93.19
516077	FLJ14668	Hypothetical protein FLJ14668	112.96	75.82	0.276	61.98
516087	TEX261	Testis expressed sequence 261	146.81	110.15	0.241	33.17
516111	DCTN1	Dynactin 1 (p150. glued homolog. Drosophila)	261.96	94.41	0.103	64.73
516114	WBP1	WW domain binding protein 1	114.03	56.61	0.310	42.16
516157	MAT2A	Methionine adenosyltransferase II. alpha	195.52	68.87	0.172	242.05
516450	SMPD4	Sphingomyelin phosphodiesterase 4, neutral membrane (neutral	248.30	97.54	0.172	118.46
		sphingomyelinase-3)
516522	INTS3	Integrator complex subunit 3	142.16	102.91	0.379	59.15
516539	HNRPA3	Heterogeneous nuclear ribonucleoprotein A3	223.52	72.69	0.138	168.69
516587	UBE2Q1	Ubiquitin-conjugating enzyme E2Q (putative) 1	131.58	55.37	0.345	69.25
516633	NCKAP1	NCK-associated protein 1	198.42	62.97	0.241	153.54
516711	CHPF	Chondroitin polymerizing factor	213.73	142.81	0.379	128.03
516790	ARHGEF2	Rho/rac guanine nucleotide exchange factor (GEF) 2	133.62	84.47	0.379	59.83
516807	STK25	Serine/threonine kinase 25 (STE20 homolog, yeast)	455.41	109.35	0.138	64.72
516826	TRIB3	Tribbles homolog 3 (Drosophila)	228.24	99.31	0.241	50.84
516855	CENPB	Centromere protein B. 80 kDa	202.67	80.52	0.276	82.21
517080	SLC35C2	Solute carrier family 35, member C2	163.93	94.82	0.207	60.57
517106	CEBPB	CCAAT/enhancer binding protein (C/EBP), beta	178.82	93.37	0.345	155.23
517134	C20orf43	Chromosome 20 open reading frame 43	247.39	69.92	0.069	79.36
517145	ENO1	Enolase 1, (alpha)	3401.32	102.15	0.000	166.84
517168	TAGLN2	Transgelin 2	626.02	75.92	0.069	595.39
517216	PEA15	Phosphoprotein enriched in astrocytes 15	283.17	82.20	0.172	201.83
517232	PEX19	Peroxisomal biogenesis factor 19	151.27	57.99	0.207	78.36
517240	IFNGR2	Interferon gamma receptor 2 (interferon gamma transducer 1)	158.55	79.26	0.172	79.49
517262	SON	SON DNA binding protein	197.08	79.92	0.138	111.91
517293	F11R	F11 receptor	215.86	109.54	0.276	1045.83
517338	ATP6V1E1	ATPase. H+ transporting. lysosomal 31 kDa. V1 subunit E isoform	197.20	81.17	0.069	122.60
		1
517342	DEDD	Death effector domain containing	136.31	62.93	0.276	55.11
517356	COL18A1	Collagen, type XVIII, alpha 1	388.40	175.92	0.345	169.44
517357	DGCR2	DiGeorge syndrome critical region gene 2	214.17	92.03	0.241	88.38
517421	PCQAP	PC2 (positive cofactor 2. multiprotein complex) glutamine/Q-rich-	205.74	178.98	0.241	70.11
		associated protein
517438	ASCC2	Activating signal cointegrator 1 complex subunit 2	138.59	89.52	0.138	46.79
517517	EP300	E1A binding protein p300	124.61	92.25	0.379	70.50
517543	PES1	Pescadillo homolog 1, containing BRCT domain (zebrafish)	242.64	124.33	0.276	66.78
517582	MCM5	MCM5 minichromosome maintenance deficient 5, cell division	424.00	105.24	0.172	49.05
		cycle 46 (S. cerevisiae)
517622	UNC84B	Unc-84 homolog B (C. elegans)	131.34	80.16	0.310	86.59
517641	L3MBTL2	L(3)mbt-like 2 (Drosophila)	116.46	67.43	0.345	35.18
517666	CYB5R3	Cytochrome b5 reductase 3	314.58	161.98	0.138	125.03
517731	TRABD	TraB domain containing	180.88	102.41	0.276	83.26
517768	BRP44	Brain protein 44	127.10	104.51	0.345	90.63
517792	C3orf10	Chromosome 3 open reading frame 10	175.04	80.24	0.069	101.16
517817	TMEM43	Transmembrane protein 43	136.66	75.36	0.310	40.01
517821		CDNA clone IMAGE: 5278517	120.53	66.29	0.310	154.05
517888	CRTAP	Cartilage associated protein	208.15	77.38	0.207	87.57
517948	DHX30	DEAH (Asp-Glu-Ala-His) box polypeptide 30	209.13	121.04	0.207	70.11
517949	MAP4	Microtubule-associated protein 4	306.69	79.18	0.103	204.68
517969	APEH	N-acylaminoacyl-peptide hydrolase	330.37	60.97	0.207	65.68
517981	TUSC2	Tumor suppressor candidate 2	129.92	69.61	0.310	47.18
518060	ARL6IP5	ADP-ribosylation-like factor 6 interacting protein 5	303.59	116.09	0.207	144.14
518123	TFG	TRK-fused gene	189.81	59.70	0.138	95.89
518236	SEC61A1	Sec61 alpha 1 subunit (S. cerevisiae)	272.42	82.37	0.138	130.33
518244	RPN1	Ribophorin I	232.54	86.03	0.172	155.16
518249	CNBP	CCHC-type zinc finger. nucleic acid binding protein	307.66	69.72	0.034	229.80
518250	COPG	Coatomer protein complex, subunit gamma	205.51	104.21	0.276	130.03
518265	CDV3	CDV3 homolog (mouse)	192.56	91.81	0.138	187.87
518326	SERP1	Stress-associated endoplasmic reticulum protein 1	233.71	64.27	0.069	106.11
518346	SSR3	Signal sequence receptor, gamma (translocon-associated protein	133.69	62.65	0.241	92.36
		gamma)
518374	QSOX1	Quiescin Q6 sulfhydryl oxidase 1	151.71	84.80	0.310	145.16
518424	NDUFB5	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16 kDa	625.19	180.45	0.276	63.18
518460	AP2M1	Adaptor-related protein complex 2, mu 1 subunit	584.10	76.35	0.069	110.88
518464	PSMD2	Proteasome (prosome, macropain) 26S subunit, non-ATPase. 2	538.23	93.02	0.103	173.46
518525	GLUL	Glutamate-ammonia ligase (glutamine synthetase)	326.37	86.68	0.138	580.48
518551	RPL31	Ribosomal protein L31	883.50	204.46	0.103	1315.12
518608	MRFAP1L1	Morf4 family associated protein 1-like 1	107.24	53.27	0.172	87.02
518609	ARPC5	Actin related protein 2/3 complex, subunit 5, 16 kDa	226.65	65.59	0.172	86.13
518750	OCIAD1	OCIA domain containing 1	121.73	78.62	0.172	557.63
518805	HMGA1	High mobility group AT-hook 1	1583.57	131.69	0.172	519.78
518827	CCNI	Cyclin I	495.99	157.57	0.034	378.10
519276	MAPKAPK2	Mitogen-activated protein kinase-activated protein kinase 2	172.89	87.16	0.172	110.38
519304	PELO	Pelota homolog (Drosophila)	204.10	151.63	0.310	91.66
519346	ERBB2IP	Erbb2 interacting protein	171.05	83.90	0.241	52.83
519347	SFRS12	Splicing factor. arginine/serine-rich 12	99.98	49.97	0.310	53.48
519520	RPS25	Ribosomal protein S25	717.45	181.09	0.034	1253.26
519523	SERPINB6	Serpin peptidase inhibitor, clade B (ovalbumin). member 6	180.64	74.06	0.172	97.35
519557	TMEM14C	Transmembrane protein 14C	139.62	70.39	0.276	71.79
519718	TTC1	Tetratricopeptide repeat domain 1	119.41	63.74	0.276	51.02
519756	STK10	Serine/threonine kinase 10	131.85	89.36	0.379	33.36
519818	MGAT1	Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-	179.60	85.97	0.138	124.43
		acetylglucosaminyltransferase
519909	MARCKS	Myristoylated alanine-rich protein kinase C substrate	360.12	219.46	0.310	315.50
519930	C6orf62	Chromosome 6 open reading frame 62	131.39	63.83	0.138	140.39
520026	VARS2	Valyl-tRNA synthetase	317.40	77.78	0.241	122.24
520028	HSPA1A	Heat shock 70 kDa protein 1A	267.63	174.20	0.241	697.50
520037	NEU1	Sialidase 1 (lysosomal sialidase)	229.35	119.62	0.310	108.45
520070	CUTA	CutA divalent cation tolerance homolog (E. coli)	154.48	68.26	0.207	234.43
520140	SRF	Serum response factor (c-fos serum response element-binding	130.75	59.73	0.379	78.21
		transcription factor)
520189	ELOVL5	ELOVL family member 5. elongation of long chain fatty acids	137.81	70.07	0.276	92.84
		(FEN1/Elo2, SUR4/Elo3-like, yeast)
520205	EIF2AK1	Eukaryotic translation initiation factor 2-alpha kinase 1	238.20	66.39	0.138	137.26
520210	KDELR2	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention	225.97	94.83	0.138	163.28
		receptor 2
520287	C6orf111	Chromosome 6 open reading frame 111	170.77	69.67	0.207	51.33
520313	CD164	CD164 antigen. sialomucin	387.43	78.65	0.172	179.75
520383	STX7	Syntaxin 7	200.61	198.70	0.379	62.05
520421	PERP	PERP. TP53 apoptosis effector	278.10	105.31	0.379	142.93
520459	GTF2I	General transcription factor II. i	179.36	111.40	0.345	291.72
520623	C7orf27	Chromosome 7 open reading frame 27	107.46	71.73	0.345	33.85
520640	ACTB	Actin, beta	4381.34	95.98	0.034	1348.49
520740	SCRN1	Secernin 1	162.41	76.80	0.276	116.36
520794	YKT6	SNARE protein Ykt6	322.61	99.65	0.276	50.36
520898	CTSB	Cathepsin B	555.78	100.98	0.034	454.52
520943	EIF4H	Eukaryotic translation initiation factor 4H	520.03	71.02	0.069	219.24
520967	MDH2	Malate dehydrogenase 2, NAD (mitochondrial)	368.83	66.26	0.069	186.05
520973	HSPB1	Heat shock 27 kDa protein 1	608.95	126.99	0.138	466.81
520974	YWHAG	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	171.99	87.92	0.310	260.44
		activation protein, gamma polypeptide
521064	ZNF655	Zinc finger protein 655	100.31	68.90	0.379	78.88
521151	ZNF672	Zinc finger protein 672	185.36	113.36	0.310	46.43
521289	REPIN1	Replication initiator 1	220.03	101.31	0.172	86.72
521487	TMEM66	Transmembrane protein 66	276.62	74.21	0.138	363.27
521640	RAD23B	RAD23 homolog B (S. cerevisiae)	334.78	294.31	0.241	1470.83
521809	RP13-	Cofactor of BRCA1	180.78	84.61	0.172	78.57
	122B23.3
521903	LY6E	Lymphocyte antigen 6 complex, locus E	425.61	138.70	0.172	224.92
521924	SIAHBP1	Fuse-binding protein-interacting repressor	381.93	82.10	0.103	89.56
521969	NDUFB11	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11. 17.3	144.58	114.75	0.379	136.30
		kDa
521973	WDR13	WD repeat domain 13	177.47	106.14	0.172	49.95
522074	TSC22D3	TSC22 domain family, member 3	194.81	93.94	0.207	98.72
522110	CREB3	CAMP responsive element binding protein 3	153.05	94.31	0.241	42.72
522114	CLTA	Clathrin, light polypeptide (Lca)	317.85	88.44	0.103	155.26
522310	NANS	N-acetylneuraminic acid synthase (sialic acid synthase)	114.60	62.52	0.310	91.19
522373	GSN	Gelsolin (amyloidosis. Finnish type)	434.41	204.85	0.138	323.96
522394	HSPA5	Heat shock 70 kDa protein 5 (glucose-regulated protein. 78 kDa)	367.53	102.24	0.172	784.29
522463	EEF1A1	Eukaryotic translation elongation factor 1 alpha 1	9324.87	148.86	0.000	3936.86
522507	FBXW5	F-box and WD-40 domain protein 5	199.15	90.48	0.276	108.16
522584	TMSB4X	Thymosin, beta 4, X-linked	1362.45	161.68	0.172	1985.02
522590	EIF1AX	Eukaryotic translation initiation factor 1A. X-linked	136.35	67.99	0.207	125.35
522632	TIMP1	TIMP metallopeptidase inhibitor 1	386.91	180.87	0.241	193.45
522665	MAGED2	Melanoma antigen family D, 2	430.71	110.49	0.138	74.89
522675	LAS1L	LAS1-like (S. cerevisiae)	201.59	69.13	0.241	56.35
522752	PSMD10	Proteasome (prosome. macropain) 26S subunit, non-ATPase, 10	122.91	60.90	0.276	74.90
522817	BCAP31	B-cell receptor-associated protein 31	290.93	84.50	0.172	110.80
522819	IRAK1	Interleukin-1 receptor-associated kinase 1	382.94	97.80	0.138	147.41
522823	EMD	Emerin (Emery-Dreifuss muscular dystrophy)	171.35	87.58	0.379	89.83
522932	NCOA4	Nuclear receptor coactivator 4	209.19	70.05	0.138	63.66
522995	EIF4EBP2	Eukaryotic translation initiation factor 4E binding protein 2	176.81	73.83	0.103	72.69
523004	PSAP	Prosaposin (variant Gaucher disease and variant metachromatic	1098.27	123.65	0.034	854.93
		leukodystrophy)
523012	DDIT4	DNA-damage-inducible transcript 4	415.15	125.10	0.276	174.92
523054	TMEM50A	Transmembrane protein 50A	139.64	109.41	0.276	109.08
523131	TRAPPC3	Trafficking protein particle complex 3	139.68	66.61	0.310	61.64
523145	DDOST	Dolichyl-diphosphooligosaccharide-protein glycosyltransferase	338.02	90.17	0.103	119.03
523215	NDUFB8	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8. 19 kDa	199.51	106.37	0.172	132.65
523238	NOLC1	Nucleolar and coiled-body phosphoprotein 1	176.02	83.34	0.138	97.37
523262	TMEM59	Transmembrane protein 59	262.49	95.63	0.069	168.88
523299	EIF3S10	Eukaryotic translation initiation factor 3, subunit 10 theta. 150/170	180.25	76.56	0.172	112.29
		kDa
523302	PRDX3	Peroxiredoxin 3	948.84	182.31	0.138	83.94
523560	HSP90AA2	Heat shock protein 90 kDa alpha (cytosolic), class A member 2	971.87	81.16	0.000	822.83
523680	SSRP1	Structure specific recognition protein 1	259.94	67.23	0.138	128.11
523789	TncRNA	Trophoblast-derived noncoding RNA	290.76	109.38	0.310	400.45
523829	POLD4	Polymerase (DNA-directed), delta 4	192.79	92.64	0.310	73.03
523836	GSTP1	Glutathione S-transferase pi	363.83	79.45	0.103	390.11
523852	CCND1	Cyclin D1	257.94	79.21	0.310	315.81
523875	INPPL1	Inositol polyphosphate phosphatase-like 1	198.48	82.78	0.310	52.62
524009	AASDHPPT	Aminoadipate-semialdehyde dehydrogenase-phosphopantetheiny	139.83	74.10	0.345	73.36
		transferase
524081	DPAGT1	Dolichyl-phosphate (UDP-N-acetylglucosamine) N-	125.85	78.99	0.345	43.70
		acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase
524084	RNF26	Ring finger protein 26	170.50	95.60	0.310	45.76
524161	RSU1	Ras suppressor protein 1	173.91	80.13	0.276	81.94
524171	RAD52	RAD52 homolog (S. cerevisiae)	128.36	73.88	0.345	57.90
524183	FKBP4	FK506 binding protein 4, 59 kDa	345.04	165.12	0.138	195.27
524195	ARHGAP2	Rho GTPase activating protein 21	118.87	87.10	0.379	102.62
524214	MLF2	Myeloid leukemia factor 2	271.91	68.75	0.138	109.61
524219	TPI1	Triosephosphate isomerase 1	1085.58	88.77	0.069	928.11
524271	PHC2	Polyhomeotic-like 2 (Drosophila)	333.79	105.07	0.138	59.03
524367	CBARA1	Calcium binding atopy-related autoantigen 1	133.75	65.29	0.207	95.25
524395	TUBA1A	Tubulin, alpha 1a	423.08	127.26	0.241	779.97
524464	ATP5G2	ATP synthase, H+ transporting. mitochondrial F0 complex, subuni	300.01	124.98	0.172	295.35
		c (subunit 9), isoform 2
524502	RNF41	Ring finger protein 41	110.38	68.59	0.241	55.12
524530	CTDSP2	CTD (carboxy-terminal domain, RNA polymerase II. polypeptide A	286.91	136.97	0.103	54.40
		small phosphatase 2
524590	RAB21	RAB21, member RAS oncogene family	112.13	48.40	0.379	39.33
524599	NAP1L1	60S ribosomal protein L6 (RPL6A)	559.97	99.14	0.034	179.39
524690	PPIE	Peptidylprolyl isomerase E (cyclophilin E)	224.33	109.34	0.207	60.86
524788	RAB35	RAB35, member RAS oncogene family	97.18	65.96	0.379	47.40
524809	CLIP1	CAP-GLY domain containing linker protein 1	121.91	90.76	0.345	71.42
524899	SAP18	Sin3-associated polypeptide, 18 kDa	129.03	72.41	0.172	89.47
524920	ZFP91	Zinc finger protein 91 homolog (mouse)	126.10	83.51	0.207	99.40
524969	UFM1	Ubiquitin-fold modifier 1	172.41	84.47	0.310	85.23
525134	POMGNT1	Protein O-linked mannose beta1,2-N-	161.82	102.74	0.345	77.25
		acetylglucosaminyltransferase
525163	ANKRD10	Ankyrin repeat domain 10	156.22	79.59	0.207	92.10
525232	LRP10	Low density lipoprotein receptor-related protein 10	201.98	129.16	0.138	71.88
525238	C14orf119	Chromosome 14 open reading frame 119	141.96	104.26	0.276	130.29
525330	ARF6	ADP-ribosylation factor 6	191.66	134.63	0.103	129.69
525391	C1orf123	Chromosome 1 open reading frame 123	98.24	87.20	0.310	44.15
525527	RER1	RER1 retention in endoplasmic reticulum 1 homolog (S.	137.56	72.32	0.310	57.33
		cerevisiae)
525626	PACS2	Phosphofurin acidic cluster sorting protein 2	126.74	98.42	0.345	36.14
525899	C6orf49	Chromosome 6 open reading frame 49	144.67	83.87	0.172	114.56
526464	PML	Promyelocytic leukemia	129.51	84.95	0.345	75.33
526521	MDH1	Malate dehydrogenase 1, NAD (soluble)	414.98	150.61	0.103	302.75
527105	HNRPDL	Heterogeneous nuclear ribonucleoprotein D-like	215.39	95.16	0.207	425.77
527193	RPS23	Ribosomal protein S23	178.23	128.51	0.207	1153.32
527348	AKAP9	A kinase (PRKA) anchor protein (Yotiao) 9	103.64	60.76	0.310	39.34
527412	ASAH1	N-acylsphingosine amidohydrolase (acid ceramidase) 1	216.47	95.28	0.241	124.23
527861	OS9	Amplified in osteosarcoma	317.55	151.86	0.138	157.27
527862	PKD1	Hypothetical protein LOC339047	142.25	87.72	0.345	135.27
527980	DUT	DUTP pyrophosphatase	150.77	79.02	0.207	96.02
528050	HARS	HistidyI-tRNA synthetase	171.62	84.32	0.138	39.25
528222	NDUFS4	NADH dehydrogenase (ubiquinone) Fe—S protein 4. 18 kDa	112.10	94.04	0.276	72.79
		(NADH-coenzyme Q reductase)
528300	PITRM1	Pitrilysin metallopeptidase 1	122.00	61.07	0.276	46.35
528305	DDX17	DEAD (Asp-Glu-Ala-Asp) box polypeptide 17	298.20	91.95	0.138	235.95
528572	SORBS3	Sorbin and SH3 domain containing 3	187.70	104.57	0.345	62.31
528668	RPL6	Ribosomal protein L6	1037.68	85.03	0.034	572.62
528780	GSPT1	G1 to S phase transition 1	170.88	56.71	0.138	73.97
528803	UQCRC2	Ubiquinol-cytochrome c reductase core protein II	272.39	84.82	0.103	118.93
529059	EIF3S4	Eukaryotic translation initiation factor 3, subunit 4 delta. 44 kDa	311.33	92.44	0.172	112.54
529132	SEPW1	Selenoprotein W. 1	231.08	110.89	0.276	115.82
529244	NCK2	NCK adaptor protein 2	236.70	169.13	0.345	42.17
529280	ANAPC7	Anaphase promoting complex subunit 7	94.04	52.31	0.379	51.63
529303	ARPC2	Actin related protein 2/3 complex, subunit 2. 34 kDa	329.77	127.35	0.034	204.04
529369	AFAP1	Actin filament associated protein 1	101.03	56.96	0.379	54.85
529400	IFNAR1	Interferon (alpha, beta and omega) receptor 1	108.71	56.53	0.310	76.16
529420	UBE2G2	Ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)	160.64	100.65	0.103	928.90
529591	TLOC1	Translocation protein 1	141.82	65.80	0.172	80.62
529618	TFRC	Transferrin receptor (p90, CD71)	212.76	85.52	0.241	89.51
529631	RPL35A	Ribosomal protein L35a	453.58	173.13	0.103	891.99
529782	VCP	Valosin-containing protein	532.58	85.03	0.034	173.75
529798	BTF3	Basic transcription factor 3	400.11	94.96	0.069	270.43
529862	CSNK1A1	Casein kinase 1. alpha 1	210.72	69.09	0.103	102.92
529890	CANX	Calnexin	399.31	129.28	0.069	448.92
529892	SQSTM1	Sequestosome 1	789.12	108.86	0.034	194.96
529957	SEC63	SEC63-like (S. cerevisiae)	120.12	80.80	0.276	70.58
530096	EIF3S2	Eukaryotic translation initiation factor 3. subunit 2 beta. 36 kDa	451.94	86.61	0.034	284.86
530118	LUC7L2	LUC7-like 2 (S. cerevisiae)	132.76	59.55	0.172	74.65
530291	ANXA11	Annexin A11	279.25	86.71	0.069	75.64
530314	SSNA1	Sjogren's syndrome nuclear autoantigen 1	122.20	58.54	0.379	75.26
530331	PDHA1	Pyruvate dehydrogenase (lipoamide) alpha 1	179.99	79.37	0.207	104.89
530381	PIM3	Pim-3 oncogene	114.61	72.86	0.345	42.02
530412	SERBP1	SERPINE1 mRNA binding protein 1	289.56	66.47	0.069	569.26
530436	STXBP3	Syntaxin binding protein 3	113.84	77.40	0.276	71.84
530479	PMF1	Polyamine-modulated factor 1	128.35	73.53	0.241	60.22
530687	RNH1	Ribonuclease/angiogenin inhibitor 1	342.47	102.27	0.172	126.29
530734	MRPL16	Mitochondrial ribosomal protein L16	106.22	67.89	0.345	48.51
530753	C11orf59	Chromosome 11 open reading frame 59	153.75	63.46	0.276	132.79
530823	COPS7A	COP9 constitutive photomorphogenic homolog subunit 7A	202.70	132.83	0.138	52.43
		(Arabidopsis)
530862	PRKAG1	Protein kinase. AMP-activated. gamma 1 non-catalytic subunit	136.75	73.16	0.241	38.26
531081	LGALS3	Lectin. galactoside-binding. soluble. 3 (galectin 3)	318.01	134.08	0.241	403.19
531089	PSMA3	Proteasome (prosome. macropain) subunit. alpha type. 3	218.40	93.16	0.276	54.35
531176	SARS	Seryl-tRNA synthetase	297.55	88.08	0.138	137.35
531330	CBWD1	COBW domain containing 2	123.09	79.22	0.310	125.23
531614	BTBD14B	BTB (POZ) domain containing 14B	123.09	63.39	0.310	79.33
531752	RANBP3	RAN binding protein 3	122.49	64.65	0.310	44.32
531856	GAS5	Growth arrest-specific 5	227.80	134.55	0.241	609.96
531876	DYNLRB1	Dynein, light chain, roadblock-type 1	167.51	104.22	0.241	122.79
531879	RAD1	RAD1 homolog (S. pombe)	115.15	74.02	0.379	58.80
532359	RPL5	Ribosomal protein L5	747.39	72.96	0.000	682.59
532399	ZC3H11A	Zinc finger CCCH-type containing 11A	139.50	74.48	0.241	64.34
532755	C16orf80	Chromosome 16 open reading frame 80	95.17	63.38	0.207	37.29
532790	NMT1	N-myristoyltransferase 1	165.97	105.96	0.172	94.43
532793	KPNB1	Karyopherin (importin) beta 1	568.94	129.62	0.000	88.10
532803	HN1	Hematological and neurological expressed 1	225.82	90.89	0.103	218.39
532826	MCL1	Myeloid cell leukemia sequence 1 (BCL2-related)	252.48	83.80	0.207	221.93
532853	NDUFB7	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18 kDa	145.80	84.03	0.345	150.66
533030	TRIOBP	TRIO and F-actin binding protein	339.95	148.19	0.207	108.55
533059	TUBB	Tubulin, beta polypeptide	2476.41	87.07	0.000	423.10
533122	SFRS10	Splicing factor, arginine/serine-rich 10 (transformer 2 homolog,	182.52	60.97	0.034	111.10
		Drosophila)
533136	LRPAP1	Low density lipoprotein receptor-related protein associated protein	234.76	108.38	0.207	119.75
		1
533192	TOMM20	Translocase of outer mitochondrial membrane 20 homolog (yeast)	208.87	77.43	0.138	133.51
533222	DIMT1L	DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)	129.17	69.14	0.379	42.41
533245	DDX46	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	118.53	50.97	0.345	51.51
533282	NONO	Non-POU domain containing. octamer-binding	842.92	104.94	0.034	184.07
533308	PPP2R5D	Protein phosphatase 2. regulatory subunit B (B56). delta isoform	223.23	100.62	0.138	47.46
533317	VIM	Vimentin	1800.81	137.19	0.069	658.72
533437	TCEB1	Transcription elongation factor B (SIII). polypeptide 1 (15 kDa.	121.08	94.03	0.276	103.33
		elongin C)
533440	WWP1	WW domain containing E3 ubiquitin protein ligase 1	146.51	87.93	0.345	60.09
533474	PPP1R8	Protein phosphatase 1, regulatory (inhibitor) subunit 8	95.08	118.26	0.379	50.60
533479	LYPLA2	Lysophospholipase II	223.79	59.26	0.276	107.17
533526	ATRX	Alpha thalassemia/mental retardation syndrome X-linked (RAD54	149.83	61.38	0.276	73.22
		homolog, S. cerevisiae)
533624	H3F3A	H3 histone. family 3A	322.44	81.23	0.103	986.85
533712	RBM4	RNA binding motif protein 4	169.22	66.18	0.138	54.47
533732	SRP14	Signal recognition particle 14 kDa (homologous Alu RNA binding	223.87	85.87	0.172	350.32
		protein)
533771	STUB1	STIP1 homology and U-box containing protein 1	238.45	84.03	0.241	74.01
533782	KRT8	Keratin 8	1307.25	94.61	0.379	1096.00
533977	TXNIP	Thioredoxin interacting protein	429.73	92.27	0.034	105.46
533985	EXOC7	Exocyst complex component 7	168.92	93.23	0.276	83.81
533986	ZMYM6	Zinc finger, MYM-type 6	99.16	62.99	0.310	42.97
534125	HLA-C	Major histocompatibility complex. class I. C	610.10	155.80	0.034	477.32
534168	NDUFA1	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex. 1, 7.5	261.51	202.07	0.310	304.79
		kDa
534212	SEC22B	SEC22 vesicle trafficking protein homolog B (S. cerevisiae)	107.96	68.79	0.379	57.75
534255	B2M	Beta-2-microglobulin	1303.98	172.16	0.000	2594.12
534307	CCND3	Cyclin D3	471.76	356.89	0.207	49.64
534314	EIF5A	Eukaryotic translation initiation factor 5A	438.38	88.29	0.207	745.09
534326	ITGB4BP	Integrin beta 4 binding protein	360.06	78.91	0.103	132.91
534338	PPP4C	Protein phosphatase 4 (formerly X). catalytic subunit	191.52	75.42	0.138	85.04
534346	RPS7	Ribosomal protein S7	572.81	120.27	0.000	458.06
534350	SMARCB1	SWI/SNF related, matrix associated, actin dependent regulator of	210.96	162.57	0.172	56.06
		chromatin. subfamily b. member 1
534453	NDUFA13	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex. 13	194.91	119.87	0.138	355.30
534456	ANAPC11	APC11 anaphase promoting complex subunit 11 homolog (yeast)	164.01	99.17	0.172	159.17
534457	C14orf166	Chromosome 14 open reading frame 166	171.37	66.04	0.138	73.01
534473	TOMM22	Translocase of outer mitochondrial membrane 22 homolog (yeast)	144.72	100.10	0.207	64.20
534483	PHF23	PHD finger protein 23	123.34	63.04	0.276	43.74
536275	PACS1	Phosphofurin acidic cluster sorting protein 1	217.82	86.00	0.345	46.64
541269	NDUFB9	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9. 22 kDa	269.72	132.31	0.172	420.59
546248	CTSD	Cathepsin D (lysosomal aspartyl peptidase)	660.73	119.52	0.103	104.98
546250	DYNC1I2	Dynein. cytoplasmic 1, intermediate chain 2	154.54	71.13	0.172	166.85
546253	FDFT1	Farnesyl-diphosphate farnesyltransferase 1	249.53	81.90	0.034	124.83
546261	HNRPA1	Heterogeneous nuclear ribonucleoprotein A1	649.46	94.55	0.000	470.61
546269	RPL10A	Ribosomal protein L10a	706.14	175.46	0.103	1748.03
546271	PCBP2	Poly(rC) binding protein 2	293.34	87.15	0.103	451.52
546286	RPS3	Ribosomal protein S3	2290.87	95.60	0.000	1021.82
546289	RPS12	Ribosomal protein S12	527.74	281.85	0.103	1459.28
546290	RPS18	Ribosomal protein S18	939.29	233.81	0.069	1853.80
546291	RPS27	Ribosomal protein S27 (metallopanstimulin 1)	725.59	382.56	0.172	55.70
546339	C11orf58	Chromosome 11 open reading frame 58	580.69	190.75	0.138	99.65
546356	RPL13A	Ribosomal protein L13a	1352.43	84.32	0.000	3663.74
546394	CCDC72	Coiled-coil domain containing 72	244.28	200.01	0.241	175.77
547759	SSBP3	Single stranded DNA binding protein 3	124.35	57.76	0.310	76.79
549178	C9orf86	Chromosome 9 open reading frame 86	219.13	114.79	0.138	106.75
552590	HTF9C	Hpall tiny fragments locus 9C	107.24	77.34	0.276	37.92
553496	PGM3	Phosphoglucomutase 3	103.08	61.39	0.379	48.42
553512	MBOAT5	Membrane bound O-acyltransferase domain containing 5	124.81	75.10	0.310	81.43
554767	NUP88	Nucleoporin 88 kDa	120.01	86.75	0.345	41.31
554776	SREBF1	Sterol regulatory element binding transcription factor 1	171.91	88.02	0.276	65.79
554894	WDR54	WD repeat domain 54	114.62	72.99	0.345	48.56
554896	C7orf50	Chromosome 7 open reading frame 50	193.18	101.69	0.207	156.46
555194	FAM36A	Family with sequence similarity 36, member A	120.40	52.67	0.276	115.74
555866	C1QBP	Complement component 1. q subcomponent binding protein	312.33	77.95	0.138	179.94
555873	HNRPAB	Heterogeneous nuclear ribonucleoprotein A/B	316.21	89.74	0.034	87.52
555875	IDH3A	Isocitrate dehydrogenase 3 (NAD+) alpha	143.01	87.51	0.345	43.03
555889	PSMC2	Proteasome (prosome, macropain) 26S subunit. ATPase, 2	219.37	69.24	0.172	67.04
555890	RBBP4	Retinoblastoma binding protein 4	204.72	80.47	0.172	148.13
555911	RBM8A	RNA binding motif protein 8A	125.26	75.03	0.172	110.86
555969	RIC8A	Resistance to inhibitors of cholinesterase 8 homolog A (C.	261.31	93.56	0.172	42.50
		elegans)
555971	TMBIM1	Transmembrane BAX inhibitor motif containing	219.28	114.17	0.207	100.55
555973	MRPS25	Mitochondrial ribosomal protein S25	152.15	62.00	0.207	47.22
555994	LONP2	Ion peptidase 2. peroxisomal	135.95	87.69	0.379	37.87
556267	FBXL10	F-box and leucine-rich repeat protein 10	81.84	65.86	0.379	39.65
556461	NDUFV2	NADH dehydrogenase (ubiquinone) flavoprotein 2. 24 kDa	146.86	108.59	0.207	99.23
556795	PAICS	Phosphoribosylaminoimidazole carboxylase.	253.76	89.34	0.138	122.76
		phosphoribosylaminoimidazole succinocarboxamide synthetase
557550	NPM1	Nucleophosmin (nucleolar phosphoprotein B23, numatrin)	1675.95	168.64	0.000	707.78
558296	ACP1	Acid phosphatase 1, soluble	123.31	58.79	0.172	76.31
558313	COX6A1	Cytochrome c oxidase subunit VIa polypeptide 1	170.58	93.53	0.241	268.12
558322	EEF1B2	Eukaryotic translation elongation factor 1 beta 2	450.71	94.79	0.034	725.93
558325	EIF5	Eukaryotic translation initiation factor 5	232.38	85.09	0.172	121.20
558328	FKBP5	FK506 binding protein 5	117.84	59.52	0.310	88.77
558330	FTL	Ferritin, light polypeptide	2521.41	158.72	0.069	1268.35
558338	HSPE1	Heat shock 10 kDa protein 1 (chaperonin 10)	270.37	133.18	0.207	259.73
558345	IK	IK cytokine, down-regulator of HLA II	252.13	99.25	0.138	52.12
558354	RPSA	Ribosomal protein SA	1322.76	86.38	0.034	2215.71
558360	NDUFB4	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15 kDa	211.99	145.77	0.345	213.80
558361	NME2	Non-metastatic cells 2, protein (NM23B) expressed in	300.76	113.65	0.276	377.22
558362	NUMA1	Nuclear mitotic apparatus protein 1	186.63	72.04	0.207	70.26
558376	RAC1	Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP	310.27	151.23	0.000	423.24
		binding protein Rac1)
558381	SNORA65	Small nucleolar RNA, H/ACA box 65	182.13	140.06	0.172	167.44
558382	RPL15	Ribosomal protein L15	675.76	128.40	0.000	247.73
558383	RPL18A	Ribosomal protein L18a	705.56	175.27	0.034	1510.30
558384	RPL19	Ribosomal protein L19	526.89	137.15	0.034	913.52
558385	RPL23A	Ribosomal protein L23a	699.13	138.42	0.069	591.06
558386	RPL34	Ribosomal protein L34	697.35	378.17	0.069	994.94
558388	RPS3A	Ribosomal protein S3A	2474.40	122.86	0.034	1599.66
558389	RPS8	Ribosomal protein S8	962.64	129.92	0.000	1884.53
558390	RPS24	Ribosomal protein S24	612.43	101.36	0.034	1096.04
558391	RPS26	Ribosomal protein S26	165.48	119.11	0.276	1253.30
558396	SCD	Stearoyl-CoA desaturase (delta-9-desaturase)	914.63	104.45	0.069	153.06
558424	CSDA	Cold shock domain protein A	226.19	107.82	0.103	153.84
558426	EIF3S5	Eukaryotic translation initiation factor 3. subunit 5 epsilon, 47 kDa	303.80	92.52	0.172	111.38
558429	BUD31	BUD31 homolog (S. cerevisiae)	144.18	63.32	0.172	74.41
558431	RPL14	Ribosomal protein L14	572.84	76.90	0.069	374.90
558442	PDCD6IP	Programmed cell death 6 interacting protein	197.37	92.14	0.241	62.39
558448	TXNL2	Thioredoxin-like 2	190.19	99.31	0.276	111.05
558453	ATP5L	ATP synthase. H+ transporting, mitochondrial F0 complex, subuni	303.51	169.99	0.172	614.08
		g
558454	NUDC	Nuclear distribution gene C homolog (A. nidulans)	366.87	118.17	0.207	97.57
558458	COPS8	COP9 constitutive photomorphogenic homolog subunit 8	143.44	86.61	0.207	41.97
		(Arabidopsis)
558473	C18orf10	Chromosome 18 open reading frame 10	143.75	80.47	0.172	66.89
558499	CD320	CD320 molecule	188.81	75.95	0.379	45.84
558511	PARL	Presenilin associated, rhomboid-like	126.27	91.30	0.276	60.47
558521	C2orf33	Chromosome 2 open reading frame 33	133.19	79.12	0.241	84.37
558591	ORMDL1	ORM1-like 1 (S. cerevisiae)	156.16	85.13	0.345	92.26
558825	PDE4DIP	Phosphodiesterase 4D interacting protein (myomegalin)	192.79	111.41	0.241	95.41
558995	C1orf151	Chromosome 1 open reading frame 151	718.64	244.03	0.103	115.01
567260	CD2BP2	CD2 antigen (cytoplasmic tail) binding protein 2	161.65	79.42	0.207	55.10
567263	C1orf43	Chromosome 1 open reading frame 43	337.41	80.70	0.172	106.63
567267	ATP2C1	ATPase. Ca++ transporting. type 2C. member 1	95.02	60.83	0.345	74.61
567279	SAP30BP	SAP30 binding protein	178.67	103.35	0.207	55.83
		SHORT			Genomic Variants on Human
	UniGene	SAGE	LONG SAGE	Affymetrix	Genome Assembly Build 36
	cluster	CV	0's P	Mean	CV	0's P	Mean	CV	Variation	Cytogen	Locus ID
	120	77.57	0.000	182.28	77.83	0.000	536.31	44.78	CopyNumber	1q25.1	177
	142	78.94	0.036	83.00	75.28	0.000			CopyNumber	16p11.2	2900
	202	113.47	0.000	199.28	96.07	0.111	419.21	51.49
	429	82.18	0.000	551.21	81.48	0.000	865.18	43.60
	695	90.92	0.000	118.87	85.62	0.111	1052.98	100.96	CopyNumber	21q22.3	3455
	808	66.96	0.000	135.76	77.44	0.222	210.67	38.17
	861	107.22	0.000	36.11	50.87	0.222	127.15	87.08	CopyNumber	16p11.2	2903
	1063	67.18	0.036	100.31	75.40	0.222	194.60	33.14
	1103	111.80	0.036	125.52	97.41	0.111	106.24	57.23
	2430	80.01	0.071	47.30	88.89	0.222	218.15	32.90
	2533	77.46	0.071	74.01	77.57	0.111	354.31	47.43
	2795	95.03	0.000	259.59	82.14	0.111	2250.38	43.77
	2853	63.43	0.036	186.93	60.34	0.111	926.32	22.95
	3100	76.40	0.000	61.24	67.08	0.222	517.42	29.81
	3254	78.32	0.036	113.88	73.94	0.111	211.49	31.45	Inversion	11p15.5	2202
	3353	56.37	0.071	216.42	70.65	0.000	881.36	27.96
	3416	131.08	0.036	68.67	112.87	0.222	360.44	151.18	CopyNumber	9p22.1	1912
	3439	80.75	0.036	89.54	93.24	0.111	191.34	38.33
	3530	72.15	0.036	108.31	56.32	0.000	136.00	30.88
	3989	108.38	0.036	134.74	83.01	0.111	427.22	43.37
	4055	135.83	0.000	441.94	118.93	0.111	64.49	38.32
	4742	119.15	0.036	39.71	65.93	0.222	275.64	44.77	CopyNumber	8q24.3	1879
	4747	73.50	0.071	71.07	73.04	0.111	307.46	47.47
	4766	86.86	0.036	72.60	84.36	0.222	262.05	27.51
	4859	103.29	0.071	110.40	111.52	0.000	299.38	40.44
	4997	62.12	0.000	50.72	94.59	0.111	264.44	22.10
	4998	63.22	0.036	28.78	51.61	0.222	229.36	56.84
	5062	101.42	0.000	111.82	81.88	0.111	800.47	52.13	CopyNumber	15q24.3	2811
	5086	72.25	0.036	53.42	73.36	0.222	135.70	28.77
	5120	71.64	0.000	204.68	69.54	0.111	1158.59	29.63
	5158	67.54	0.000	138.55	60.73	0.111	383.95	36.39
	5245	74.90	0.000	80.69	73.69	0.000	219.54	21.60
	5258	84.40	0.071	133.74	77.92	0.111	589.76	55.05
	5268	78.70	0.000	46.25	73.83	0.111	113.40	37.54
	5298	59.08	0.000	58.54	49.70	0.111	296.11	31.82
	5308	83.81	0.000	479.50	73.38	0.000	2422.20	38.02
	5324	64.23	0.000	62.22	66.74	0.111	694.81	25.69
	5345	86.81	0.071	61.41	84.79	0.111	73.49	30.51	CopyNumber	2q37.3	515
	5662	87.26	0.000	651.22	57.10	0.000	2861.36	36.28
	5710	67.53	0.071	34.13	80.74	0.111	452.86	45.78
	5719	94.26	0.000	65.99	56.36	0.000	55.53	45.18	CopyNumber	12p13.31	2368
	5912	65.61	0.000	30.20	60.87	0.111	430.78	30.03
	5947	68.42	0.036	34.91	59.37	0.222	368.59	33.28
	6396	72.90	0.036	94.01	39.56	0.222	869.88	31.02
	6454	77.38	0.000	290.31	91.04	0.000	504.85	40.25	CopyNumber	19p13.12	3223
	6459	121.97	0.036	88.34	85.38	0.111	157.79	41.08	CopyNumber	8q24.3	1880
	6551	102.10	0.000	99.28	83.28	0.000	515.56	45.37
	6891	68.55	0.000	79.36	95.32	0.000	437.26	34.58
	7101	85.77	0.071	81.04	84.26	0.000	183.19	27.20
	7236	91.55	0.000	89.02	123.50	0.111	150.63	53.39	CopyNumber	19q13.33	3277
	7476	85.55	0.000	91.48	67.53	0.000	1250.83	39.30
	7527	92.63	0.036	52.36	54.01	0.222	97.43	36.93
	7744	85.28	0.000	77.42	71.13	0.000	415.46	37.27	CopyNumber	11q13.1-	2278
										11q13.2
	7753	136.12	0.000	138.00	85.95	0.111	100.65	48.84	CopyNumber	7q32.1	1639
	7768	65.21	0.000	63.80	65.95	0.111	269.17	27.39	CopyNumber	11q13.1	2276
	7862	74.15	0.036	84.67	63.85	0.111
	7910	72.05	0.036	78.63	65.90	0.111	153.70	42.23
	7917	78.00	0.000	135.78	112.82	0.111	661.73	52.63	CopyNumber	3p22.1	572
	8102	83.01	0.000	1410.01	75.01	0.000	4250.06	30.72
	8372	108.88	0.000	146.74	79.82	0.111	788.19	32.34
	8737	68.38	0.036	88.71	85.75	0.111	253.06	44.11
	8752	57.76	0.071	52.10	62.17	0.222	102.13	32.76	CopyNumber	12q13.2	2429
	8765	64.21	0.000	53.71	59.12	0.000	228.43	30.56
	8859	111.07	0.036	53.33	94.17	0.222	234.96	73.37
	8867	137.92	0.000	273.81	95.23	0.111	547.98	79.93
	9003	69.05	0.000	66.15	65.61	0.000	148.11	36.69
	9015	65.95	0.000	180.11	68.32	0.000
	9043	67.83	0.000	38.48	97.33	0.111	162.00	25.78
	9234	79.49	0.071	68.18	62.80	0.111	434.76	37.42
	9235	92.25	0.000	67.77	88.26	0.222	256.46	58.39
	9527	84.48	0.036	51.11	48.09	0.222	538.70	28.49
	9534	72.74	0.000	86.28	73.16	0.222	626.14	29.63
	9573	92.63	0.036	31.79	54.71	0.222	778.41	33.32
	9589	61.30	0.036	71.77	49.75	0.111	919.32	26.81
	9788	88.77	0.071	127.59	72.78	0.000	377.13	38.24
	9825	66.79	0.000	56.23	48.85	0.111	365.07	28.07
	9857	122.60	0.000	232.82	151.99	0.000	463.40	157.98
	10326	73.58	0.000	197.00	75.36	0.000	369.97	68.55
	10842	94.54	0.000	239.28	115.19	0.222	718.72	44.58
	10848	67.53	0.071	31.76	66.74	0.111	104.71	37.33	CopyNumber	10q11.21	2093
	11125	68.78	0.071	93.47	59.46	0.000	817.21	27.49
	11184	59.84	0.036	115.93	46.13	0.000	292.68	27.77	CopyNumber	9p13.3	1937
	11223	88.67	0.071	78.63	87.24	0.222	57.89	55.15
	11355	104.32	0.036	66.99	75.00	0.222	62.56	35.20
	11463	61.89	0.036	113.19	84.50	0.111	429.95	40.75
	12013	64.76	0.036	45.75	69.36	0.222	99.02	32.35
	12084	81.01	0.000	364.40	89.06	0.000	623.07	39.39	CopyNumber	16p11.2	2900
	12102	67.05	0.071	114.17	52.22	0.111	518.73	22.82	CopyNumber	6q21	1407
	12107	72.91	0.036	50.80	59.67	0.111	329.36	29.47
	12109	61.69	0.036	46.73	59.25	0.111	118.79	29.00	CopyNumber	2q11.2	378
	12144	73.94	0.071	41.87	82.28	0.222	162.21	31.04
	12152	79.55	0.036	58.29	64.64	0.222	30.47	58.95
	12272	64.89	0.071	48.28	64.28	0.111	236.82	29.21
	12341	71.85	0.000	80.90	63.60	0.222	646.53	35.91
	12457	60.75	0.036	41.32	44.32	0.222	141.28	35.86
	12865	77.51	0.036	56.10	68.14	0.111	161.87	24.52
	13662	73.45	0.071	42.54	82.56	0.111	286.77	29.53
	14317	85.06	0.000	210.81	76.29	0.111	707.56	30.56	CopyNumber	15q14	2760
	14333	93.92	0.000	49.69	65.95	0.222	52.91	32.36	CopyNumber	1p36.11	49
	14745	67.71	0.036	34.86	68.85	0.222	344.17	44.46
	14839	60.79	0.036	72.24	59.97	0.000	425.45	27.99	CopyNumber	11q12.3	2269
	14846	71.11	0.036	35.42	56.40	0.111	290.22	58.28
	14894	82.05	0.000	60.76	70.36	0.111	126.08	28.41
	15277	127.86	0.000	94.06	82.10	0.111	147.72	37.89	CopyNumber	16p13.3	2866
	15591	67.01	0.000	41.12	58.74	0.111	131.70	28.53	CopyNumber	7q22.1	1598
	15738	72.04	0.000	129.69	48.46	0.111	417.14	23.56
	16059	66.35	0.000	71.91	74.39	0.111	679.76	46.08
	16130	62.56	0.036	43.34	61.70	0.222	18.64	94.29	CopyNumber	17q25.1	3075
	16349	59.57	0.071	31.68	64.66	0.222	148.04	24.93	CopyNumber	16q23.2	2956
	17118	62.14	0.071	46.03	69.29	0.111	213.73	40.31	CopyNumber	1p34.3	58
	17250	79.64	0.071	117.82	78.92	0.111	294.70	33.94
	17680	73.53	0.071	48.01	54.77	0.111	516.93	33.95	CopyNumber	6q24.2	1437
	17731	70.13	0.000	29.51	60.36	0.111	520.71	54.10
	17883	65.60	0.000	135.33	70.28	0.000	114.89	33.02
	18069	90.49	0.036	63.83	85.91	0.111	211.65	49.02
	18128	74.70	0.036	28.66	43.42	0.222	141.00	37.06	CopyNumber	20q11.22	3366
	18349	74.07	0.036	49.61	83.49	0.222	300.87	45.97
	19673	80.92	0.071	95.67	73.57	0.222	562.71	37.51	CopyNumber	8q24.3	1879
	20013	65.84	0.000	62.25	52.78	0.000	173.94	35.93	CopyNumber	1p36.11	48
	20107	96.88	0.036	39.46	139.41	0.222	175.52	41.33	CopyNumber	14q32.33	2746
	20157	77.35	0.036	59.44	87.93	0.222	376.62	32.83
	20521	94.01	0.000	152.96	89.93	0.111	383.24	40.81	CopyNumber	19q13.33	3277
	20529	69.78	0.071	39.76	53.17	0.222	749.10	34.18	CopyNumber	1p36.32	11
	20573	67.85	0.000	81.56	153.79	0.111	23.55	41.49
	20716	71.00	0.036	66.00	55.65	0.222	276.11	36.03	CopyNumber	1q32.1	209
	22393	64.62	0.036	63.67	82.21	0.222	228.15	33.72
	22543	56.69	0.036	63.96	65.55	0.222	34.14	49.75
	22546	71.92	0.036	42.45	98.37	0.222	651.22	63.93	CopyNumber	11q12.2	2266
	22616	75.10	0.071	35.69	58.10	0.222	144.92	52.15	CopyNumber	17p13.3	2978
	23033	58.71	0.071	39.15	53.57	0.222	341.82	43.42
	23111	77.82	0.071	52.47	83.58	0.222	105.11	33.54	CopyNumber	19p13.13	3220
	23978	66.48	0.036	58.25	63.84	0.222	128.24	28.55
	24301	143.33	0.036	116.94	59.98	0.111	286.08	26.26	CopyNumber	19p13.3	3198
	24379	89.22	0.000	90.75	71.03	0.000	479.98	29.85
	24601	136.75	0.000	195.56	129.74	0.222	34.60	49.50	CopyNumber	22q13.31	3508
	24950	186.79	0.071	189.81	135.70	0.222	307.39	104.91
	25155	120.45	0.071	52.76	77.03	0.222	204.80	58.51
	25450	206.58	0.036	103.43	106.19	0.222	124.80	61.30
	25723	98.01	0.036	74.46	92.32	0.111	204.78	31.78
	26010	107.96	0.036	71.92	87.71	0.111	127.90	44.05	CopyNumber	10p15.2-	2038
										10p15.3
	26023	71.18	0.036	27.14	63.42	0.222	32.41	34.48
	26136	64.61	0.000	126.52	71.60	0.000	1187.97	29.30
	26232	90.53	0.071	26.46	93.62	0.222	122.41	30.42
	26403	79.12	0.036	49.19	87.28	0.222	49.29	121.55
	26518	108.83	0.036	82.68	57.69	0.111	145.35	56.07	CopyNumber	11p15.5	2200
	27222	70.07	0.036	92.82	77.94	0.111	408.36	36.92
	28491	110.80	0.000	366.05	99.16	0.000	1987.13	39.05
	28914	124.19	0.036	75.99	55.29	0.111	172.22	38.11	CopyNumber	16q24.3	2971
	29203	106.14	0.000	45.04	65.31	0.111	60.43	48.50	CopyNumber	16p13.3	2866
	29665	99.16	0.036	72.28	88.66	0.111	350.56	37.72
	30011	81.69	0.071	81.96	82.93	0.222	133.44	28.49	CopyNumber	17p13.3-	2981
										17p13.2
	30026	86.33	0.000	93.91	62.29	0.111	123.60	30.35	CopyNumber	1p36.33	0003
	30345	88.62	0.000	124.96	92.01	0.222	262.70	34.03
	30954	68.95	0.000	33.38	69.19	0.222	151.11	40.16
	31053	81.65	0.000	122.44	66.60	0.111	341.88	36.28	CopyNumber	19q13.12	3250
	31334	61.03	0.036	78.51	49.15	0.111	134.99	47.91	CopyNumber	20q13.33	3420
	31387	84.87	0.000	46.14	75.32	0.222	173.71	43.22
	34045	74.24	0.071	45.53	64.82	0.111	117.61	48.58
	34576	64.28	0.036	73.10	58.20	0.000	402.96	28.27	CopyNumber	7p15.2	1525
	34906	68.64	0.071	61.99	53.16	0.111	625.46	46.98
	35052	57.78	0.000	362.25	60.57	0.000	855.32	36.18
	35828	62.01	0.000	45.72	60.60	0.222	108.48	23.16	CopyNumber	14q32.33	2744
	36587	71.83	0.000	30.96	65.30	0.222	179.98	30.62
	36927	121.45	0.000	211.50	111.53	0.222	291.25	56.92
	37616	95.13	0.036	111.55	102.44	0.000	164.13	70.51
	37916	76.45	0.036	73.92	86.57	0.000	160.38	37.39	CopyNumber	9q34.3	2030
	42806	98.22	0.071	67.92	66.52	0.222	113.20	27.89	CopyNumber	1p36.33	0002
	43297	62.31	0.036	167.46	70.07	0.000
	47062	81.09	0.000	51.75	59.62	0.111	279.70	38.81	CopyNumber	19q13.12	3250
	50098	97.25	0.000	197.41	66.02	0.111	889.01	34.95
	50308	69.01	0.071	64.21	68.46	0.111	590.61	33.23	CopyNumber	4p14	824
	50425	59.02	0.000	452.95	56.90	0.000	981.84	28.48
	53066	89.79	0.036	84.91	123.45	0.222	86.87	42.17
	54277	70.86	0.036	96.39	65.47	0.222	198.46	29.56
	54457	101.21	0.000	70.72	79.45	0.111	1276.93	35.83
	54642	66.57	0.036	50.30	60.80	0.222	504.88	34.60
	54649	62.12	0.000	39.30	61.93	0.222	114.82	27.65
	55682	77.92	0.000	55.77	52.38	0.111	1742.75	35.36	CopyNumber	22q12.3	3492
	55847	133.75	0.000	127.47	77.36	0.222	1589.77	32.09	CopyNumber	12p13.31	2368
	58488	91.55	0.000	55.35	57.10	0.222	204.60	74.27
	58992	99.33	0.036	54.95	72.92	0.000	19.90	46.40	CopyNumber	19q13.2	3258
	59486	80.61	0.000	36.11	94.51	0.222	125.78	61.69
	61812	62.20	0.036	81.03	52.93	0.222	163.53	35.91
	65234	85.90	0.000	45.56	51.74	0.111	230.78	28.28
	65238	74.65	0.036	76.11	68.06	0.111	138.90	30.03	CopyNumber	16p11.2	2904
	66048	75.95	0.000	37.75	57.98	0.111	62.79	37.57	CopyNumber	19p13.11	3229
	66915	138.86	0.071	97.34	71.78	0.222	1098.67	81.32
	68714	72.45	0.000	52.63	57.22	0.222	320.40	27.38
	69293	98.44	0.071	85.35	81.08	0.000	585.49	38.47
	69554	69.56	0.036	55.49	73.57	0.111	83.68	28.75
	69855	188.78	0.000	305.44	48.54	0.000	727.35	25.99
	71465	105.85	0.071	66.00	78.37	0.222	243.96	77.49
	71787	77.93	0.071	83.49	81.21	0.222	200.16	37.18
	73527	70.51	0.071	124.08	51.87	0.111	583.61	28.44
	73722	85.72	0.000	261.97	71.05	0.000	463.11	27.57
	73799	65.89	0.071	58.08	66.99	0.000	377.98	28.45
	73965	70.12	0.000	283.48	68.03	0.000	235.15	31.88
	74047	87.12	0.071	30.09	43.70	0.222	43.44	43.38
	74050	65.00	0.000	50.61	69.46	0.222	85.49	33.47
	74137	67.80	0.036	162.33	96.54	0.000	765.38	31.85
	74375	80.65	0.000	94.05	93.83	0.222	79.06	34.15	CopyNumber	1p36.33	2
	74405	70.95	0.000	376.04	102.24	0.000	1073.13	29.89	CopyNumber	2p25.1	280
	74471	146.61	0.000	820.91	82.84	0.222	309.99	88.83
	74563	91.47	0.000	161.30	79.91	0.000	220.82	27.96
	74564	86.90	0.071	98.67	73.67	0.222	853.95	35.62
	74576	103.63	0.036	206.54	105.86	0.111	372.42	51.84
	75056	95.92	0.036	196.13	70.63	0.000	175.01	40.98
	75061	134.90	0.036	139.52	106.48	0.222	694.54	68.77
	75066	57.57	0.071	59.08	75.04	0.222	49.39	28.04
	75087	78.42	0.000	102.46	73.16	0.111	222.76	28.01	CopyNumber	7q36.1	1667
	75117	68.05	0.000	108.92	67.92	0.222	298.96	40.82
	75133	90.78	0.036	33.87	52.50	0.222
	75139	77.20	0.071	32.14	56.90	0.111	265.49	32.96
	75189	71.71	0.036	88.49	96.81	0.111	273.22	47.07
	75227	98.77	0.000	103.41	83.59	0.111	330.85	41.09
	75243	86.87	0.000	163.16	69.12	0.000	306.90	30.86	CopyNumber	6p21.32	1316
	75249	79.25	0.036	72.48	58.84	0.111	451.23	40.81	CopyNumber	16p12.3	2889
	75254	85.88	0.036	35.63	92.11	0.222	167.60	35.94	CopyNumber	19q13.33	3277
	75318	107.17	0.071	47.29	77.96	0.222	245.52	63.96
	75348	83.65	0.000	90.61	53.97	0.000	742.51	27.52
	75438	135.05	0.071	104.15	222.79	0.111	241.61	96.64
	75527	75.11	0.036	50.93	81.60	0.222	188.80	30.23
	75724	72.09	0.000	117.37	63.92	0.000	284.42	34.05
	75798	66.34	0.000	46.25	98.54	0.111	132.09	26.63
	75841	67.70	0.036	111.03	66.56	0.222	697.12	38.13
	75890	63.35	0.071	55.70	53.32	0.222	192.57	34.39
	75914	75.69	0.000	149.78	60.21	0.111	998.68	31.35	CopyNumber	12q24.31	2518
	76111	74.32	0.036	91.80	91.74	0.222	349.38	32.91
	76394	97.13	0.071	85.81	54.54	0.111	723.48	75.27	CopyNumber	10q26.3	2199
	76480	72.15	0.071	42.20	50.89	0.222	107.11	31.94
	76662	75.63	0.071	39.52	102.23	0.222	371.15	30.57
	76686	89.86	0.000	260.60	79.93	0.111	786.14	45.48
	76847	66.20	0.000	156.31	84.21	0.111	534.34	30.42	CopyNumber	11q12.3	2268
	77060	84.28	0.000	108.25	74.95	0.111	304.90	32.72	CopyNumber	17p13.2	2984
	77269	77.93	0.000	395.01	92.11	0.000	212.81	53.48	CopyNumber	3p21.31	586
	77313	109.12	0.036	102.72	140.65	0.000	74.75	36.55	CopyNumber	16q24.3	2973
	77422	91.72	0.000	60.73	89.20	0.111	377.17	61.65	Inversion	Xp11.23	3552
	77558	84.61	0.000	101.75	71.51	0.111	662.90	46.96
	77578	77.49	0.000	102.87	121.76	0.222	171.09	31.33
	77793	72.60	0.000	34.98	96.71	0.222	170.28	52.53
	77897	69.16	0.071	111.11	71.27	0.000	112.01	24.87
	77961	169.44	0.000	823.99	124.02	0.000	4899.68	43.03	CopyNumber	6p21.33	1313
	77978	75.97	0.000	91.06	68.25	0.111	264.14	34.17
	78466	105.76	0.000	115.24	59.35	0.111	296.95	45.96
	78601	74.95	0.036	60.03	61.28	0.000	209.16	29.30
	78771	85.53	0.000	445.96	90.90	0.000	1179.63	41.05	CopyNumber	Xq21.1	3567
	78880	89.08	0.036	41.08	84.35	0.222	167.42	38.32	CopyNumber	19p13.12	3225
	78888	111.41	0.036	130.51	70.31	0.000	1459.58	43.93
	78989	75.96	0.000	94.26	93.28	0.000	363.83	37.58
	79064	65.62	0.071	37.14	60.46	0.222	93.49	36.45
	79081	93.36	0.036	167.72	99.22	0.111	499.05	34.22
	79088	81.96	0.000	99.08	109.91	0.222	156.03	53.20	CopyNumber	15q24.3	2811
	79101	141.29	0.071	153.49	137.97	0.111	444.07	49.53
	79110	86.13	0.036	372.48	77.25	0.000	913.17	31.25
	79322	74.35	0.036	132.17	60.84	0.000	691.01	34.62
	79335	73.95	0.036	64.11	77.17	0.222	67.72	31.29
	79387	62.64	0.000	149.41	65.96	0.111	377.33	28.18
	79402	69.22	0.036	42.24	54.66	0.111	237.05	27.80
	79411	67.91	0.000	66.14	69.85	0.222	231.21	28.82
	79625	136.24	0.000	189.30	141.24	0.222	1792.59	46.21	CopyNumber	20q13.33	3419
	80545	88.80	0.000	3675.93	53.49	0.000	8897.81	33.60
	80919	76.35	0.036	67.97	78.25	0.111	313.08	32.42
	80986	120.32	0.000	219.34	96.44	0.000	231.11	44.42	CopyNumber	17q21.32	3034
	81328	217.63	0.036	729.78	176.26	0.000	845.91	66.53
	81424	60.84	0.000	178.67	63.11	0.222	343.25	25.72
	81848	71.54	0.071	108.12	78.45	0.222	261.11	47.46
	81964	75.88	0.071	37.25	88.70	0.222	173.27	38.81
	82201	64.48	0.071	52.80	63.18	0.222	227.05	31.28
	82327	80.48	0.000	34.79	79.12	0.222	199.40	38.88	CopyNumber	20q11.22	3365
	82719	66.25	0.071	23.77	44.79	0.111	85.74	30.33
	82793	128.02	0.036	83.47	68.72	0.222	611.12	45.54
	82887	77.92	0.071	29.21	62.08	0.222	470.22	22.27
	82890	66.89	0.000	89.92	89.16	0.111	541.67	28.47
	82916	94.85	0.000	244.03	94.29	0.000	218.30	42.67
	82927	105.59	0.036	43.00	75.49	0.222	123.23	36.72
	83190	182.78	0.036	211.86	121.95	0.222	263.79	128.00
	83347	69.02	0.036	71.54	56.24	0.000	154.79	25.38
	83383	84.31	0.036	68.79	80.95	0.111	617.70	83.89
	83734	69.26	0.071	53.32	60.39	0.000	140.82	29.73	CopyNumber	16p11.2	2905
	83753	88.26	0.000	302.30	80.76	0.111	314.59	48.19	CopyNumber	20p13	3302
	83765	85.58	0.071	65.48	111.40	0.222	99.10	47.99	CopyNumber	5q14.1	1155
	83916	87.67	0.000	53.16	106.27	0.222	192.48	51.98
	84359	91.88	0.000	190.01	97.99	0.111	1358.12	25.26
	84753	105.87	0.036	215.33	92.76	0.222	92.58	76.88
	85155	135.45	0.000	398.59	101.28	0.111	463.10	46.79
	85769	68.76	0.036	46.70	56.56	0.111	203.84	26.22
	85962	84.29	0.071	75.97	60.72	0.222	14.60	66.14
	86131	79.74	0.036	38.81	70.54	0.222	91.70	50.98
	87752	96.06	0.000	186.51	80.13	0.111	86.54	36.98
	89545	67.58	0.000	183.77	60.61	0.111	631.69	33.52	CopyNumber	1q21.2-	152
	89643	142.36	0.000	365.70	117.06	0.111	120.47	36.69
	89649	104.25	0.000	82.36	107.95	0.111	606.74	180.62
	89781	68.82	0.000	113.28	69.11	0.111	494.30	21.89	CopyNumber	17q21.31	3026
	89864	114.71	0.071	29.48	76.43	0.222	163.77	23.54	CopyNumber	6p21.32	1314
	90061	83.92	0.036	91.42	74.05	0.222	651.40	42.91
	90093	92.05	0.036	105.16	101.89	0.222	155.51	38.77
	90107	77.30	0.000	83.77	71.73	0.111	271.86	37.65	CopyNumber	20q13.33	3417
	90443	101.63	0.000	70.31	56.02	0.222	263.10	39.12	CopyNumber	11q13.2	2278
	91142	77.58	0.000	202.64	43.73	0.000	163.39	35.82
	91531	96.12	0.071	80.15	95.45	0.111	637.99	34.78
	93659	83.46	0.000	155.28	76.20	0.111	167.42	46.25
	93832	74.43	0.000	74.64	79.56	0.222	186.80	32.78
	95577	87.03	0.071	71.04	85.81	0.222	371.35	99.75
	96530	62.70	0.000	32.79	68.25	0.222	65.51	38.27	CopyNumber	17q22	3042
	96852	64.09	0.071	35.77	59.97	0.111	461.69	19.35
	96996	71.81	0.000	189.55	52.96	0.000	218.21	29.32
	97616	65.77	0.036	108.39	65.74	0.222	102.19	51.76	CopyNumber	19p13.3	3206
	97887	68.13	0.000	92.61	67.37	0.222	239.81	49.52	CopyNumber	11p13	2237
	98751	70.96	0.036	59.19	66.83	0.222	66.72	38.38
	98791	67.83	0.036	28.93	101.87	0.222	224.90	22.28	CopyNumber	2q11.2	379
	102696	79.18	0.000	92.68	80.38	0.111	211.23	39.36
	102798	87.39	0.000	110.04	53.06	0.111	793.97	25.38
	103561	85.04	0.036	55.08	51.00	0.111	262.35	26.56	CopyNumber	12q24.31	2517
	103834	80.57	0.036	64.54	76.68	0.222	293.02	59.69
	104839	100.99	0.000	225.26	136.95	0.222	87.68	65.32
	105547	81.74	0.000	160.68	82.23	0.111	143.20	86.05	CopyNumber	9q34.3	2030
	106185	89.36	0.036	64.50	91.88	0.000	183.56	43.28
	106876	63.88	0.000	56.12	75.64	0.222	138.98	35.36
	106909	79.27	0.036	39.60	58.15	0.222	516.81	27.82
	107003	124.40	0.000	813.78	84.52	0.000	197.77	54.64
	107101	89.68	0.000	175.98	78.98	0.111	268.93	27.15	CopyNumber	1p36.33	4
	107387	70.31	0.000	76.67	74.85	0.000	253.94	39.88
	107393	83.93	0.036	59.30	71.63	0.222	267.59	45.01
	108029	93.33	0.000	169.75	68.54	0.000	579.34	50.79
	108080	130.54	0.000	212.70	124.15	0.111	825.21	73.65
	108371	71.05	0.036	43.89	82.98	0.222	479.16	32.37
	108408	68.23	0.036	119.79	74.72	0.111	307.87	34.75
	108957	105.42	0.000	125.72	97.21	0.000	1244.98	34.19
	108969	69.16	0.000	54.94	59.23	0.111	484.04	31.51
	109051	126.66	0.036	115.04	127.27	0.222	405.39	56.02
	109052	93.26	0.000	149.09	47.63	0.111	1050.08	33.47	CopyNumber	14q32.33	2746
	109672	98.84	0.036	29.04	57.79	0.111	108.91	98.07
	109798	88.57	0.036	97.36	91.62	0.111	559.23	64.63
	110695	89.57	0.000	421.58	103.23	0.000	476.37	28.95
	110849	75.22	0.000	67.73	71.02	0.000	181.15	45.21
	111286	105.86	0.071	18.21	107.86	0.222	110.28	32.60
	111577	146.37	0.071	118.94	80.20	0.111	415.46	141.25
	111801	62.24	0.036	45.24	48.41	0.111	283.10	26.11	CopyNumber	7q22.1	1600
	112058	86.73	0.000	80.73	66.67	0.111	82.86	34.43
	112318	59.33	0.036	328.41	54.43	0.000			CopyNumber	7p15.3	1519
	112955	83.18	0.000	68.65	74.54	0.222	175.05	32.35
	114033	66.61	0.071	46.31	51.12	0.111	208.35	29.63
	114286	105.50	0.000	160.45	104.16	0.111	138.02	46.31
	114412	69.57	0.000	89.73	60.94	0.000	565.48	23.70
	115474	68.64	0.000	26.75	40.02	0.222	38.04	51.64
	115792	86.72	0.000	64.83	84.38	0.111	84.30	30.92	CopyNumber	3p21.31	574
	116448	76.33	0.071	42.71	91.17	0.111	92.28	52.71
	117176	57.12	0.000	213.98	51.77	0.000	546.64	24.11
	117715	73.13	0.036	39.78	89.12	0.222	139.79	48.24	CopyNumber	11p15.4	2212
	118110	135.94	0.000	197.86	123.23	0.111	289.38	139.96
	118400	143.18	0.036	396.12	82.68	0.222	45.89	81.52	CopyNumber	7p22.1	1487
	118463	114.64	0.036	277.75	88.48	0.000	489.97	35.21	CopyNumber	11p15.5	2200
	118638	91.73	0.000	150.66	112.93	0.111	502.98	55.85
	118722	70.58	0.071	36.51	53.51	0.222	115.71	60.62
	118964	81.48	0.071	54.63	51.42	0.111	180.13	35.29
	118983	116.33	0.000	216.74	115.85	0.000	112.11	59.33
	119177	54.58	0.000	89.84	57.06	0.222	287.10	32.29	CopyNumber	12q13.12	2421
	119192	136.52	0.071	366.01	79.98	0.111	746.04	45.80
	119251	77.27	0.000	105.57	82.18	0.000	510.26	60.79
	119591	132.87	0.000	85.25	60.89	0.111	277.18	26.93	CopyNumber	19q13.32	3268
	119598	65.34	0.000	1828.88	55.92	0.000	5605.82	37.33
	120323	72.42	0.000	82.14	75.76	0.222	139.72	33.20
	121088	71.71	0.036	49.78	72.44	0.111	167.42	38.93	CopyNumber	6p22.3	1297
	121549	59.29	0.036	72.38	43.55	0.111	348.76	34.62
	122363	70.90	0.071	47.10	52.74	0.222	69.77	30.93
	122523	74.89	0.000	118.63	57.28	0.000	262.80	35.66
	124126	115.07	0.000	66.49	67.09	0.111	404.01	47.98	CopyNumber	7q22.1	1597
	124147	80.00	0.036	49.60	67.28	0.111	88.88	40.69
	124246	73.44	0.000	67.23	50.90	0.222	78.00	25.49
	124366	64.80	0.036	31.83	72.36	0.222	296.88	27.96	CopyNumber	3q13.12	644
	125113	208.71	0.000	207.39	70.50	0.000	130.39	26.17
	125867	149.28	0.071	249.31	163.63	0.000	127.51	42.41
	125898	68.47	0.000	463.77	95.22	0.000	3114.95	38.76
	126497	92.86	0.071	174.55	58.17	0.000	240.18	42.08
	126774	85.40	0.071	39.13	64.55	0.222	142.39	51.09
	126938	74.59	0.036	93.26	77.82	0.111	106.86	32.06	CopyNumber	19q13.32	3269
	127092	112.32	0.071	30.80	75.39	0.222	57.16	37.84	CopyNumber	16q22.3	2939
	127249	54.54	0.000	80.21	58.63	0.111	216.47	28.77	CopyNumber	17q21.32	3034
	127386	80.59	0.000	307.40	63.02	0.111
	127764	63.23	0.036	156.09	58.22	0.000
	128065	98.69	0.071	111.69	94.46	0.222	59.95	51.61
	128199	77.43	0.000	73.49	95.92	0.222	302.61	35.57
	128548	78.55	0.000	160.67	43.75	0.111	510.95	31.27	CopyNumber	4p16.1	773
	129634	74.38	0.071	38.63	51.13	0.222	58.68	27.28
	129673	76.37	0.000	374.81	65.02	0.111	2050.10	29.97
	130031	141.77	0.036	61.66	100.82	0.111	124.88	40.58
	130098	68.07	0.036	21.50	58.55	0.222	72.44	30.73
	130293	74.37	0.036	143.21	63.05	0.111	394.94	46.49
	130413	62.69	0.036	35.34	73.66	0.111	763.95	36.55
	131226	77.45	0.036	40.35	61.36	0.222	211.50	44.83
	132497	62.00	0.000	89.82	78.68	0.000	67.63	44.78	CopyNumber	1p34.1	66
	132513	64.29	0.036	33.27	58.33	0.222	474.25	37.94	CopyNumber	11p11.2	2252
	133892	129.65	0.000	246.87	96.64	0.111	1107.22	68.63
	134074	100.43	0.071	26.96	119.73	0.222	90.07	25.91
	134688	70.25	0.071	68.24	53.74	0.000	72.44	28.26
	135406	65.02	0.071	70.87	53.64	0.111	258.58	31.26
	136905	88.95	0.071	63.87	56.85	0.111	420.31	25.48
	136947	61.39	0.000	83.24	64.45	0.111	164.27	33.47
	137510	78.32	0.071	33.03	97.57	0.222	338.93	38.22	CopyNumber	12q24.31	2520
	138860	75.60	0.000	63.39	84.41	0.222	104.45	29.18
	139896	65.18	0.000	67.60	55.36	0.111	240.43	26.38
	140452	115.93	0.000	61.69	109.34	0.222	149.10	37.19
	142442	65.85	0.000	96.04	76.63	0.222	900.30	25.31
	143187	74.48	0.000	61.96	104.03	0.111	114.98	39.16
	143766	70.65	0.036	56.38	78.56	0.222	131.85	31.29
	143873	123.17	0.000	265.13	64.14	0.111	1812.20	70.31
	144058	67.40	0.071	30.59	57.17	0.222	91.15	33.46
	144468	77.62	0.000	72.08	68.21	0.000	369.59	42.51	CopyNumber	11p15.5	2200
	144835	59.90	0.000	1239.80	47.18	0.000	4424.16	35.78	CopyNumber	11q12.3	2268
	144868	61.94	0.036	46.48	65.44	0.222
	144941	99.27	0.036	30.70	62.58	0.222	27.70	47.48
	144949	89.85	0.036	51.55	71.38	0.111	139.69	32.40
	144980	66.37	0.036	31.70	83.79	0.111	78.74	45.38
	145049	79.64	0.036	44.08	75.91	0.222
	145442	67.35	0.071	65.14	62.03	0.111	227.44	39.23
	145575	224.58	0.036	45.18	76.11	0.222	202.49	59.73
	146070	128.18	0.000	178.96	54.77	0.000	93.05	36.84
	146393	72.80	0.000	88.78	95.83	0.111	667.21	52.63
	146602	102.89	0.000	281.39	83.54	0.000	1415.55	49.65
	146804	74.69	0.036	67.23	67.16	0.222	54.96	64.90
	146806	65.76	0.036	76.43	55.00	0.111	156.47	27.78
	147433	173.87	0.036	100.81	101.76	0.111	185.23	55.89
	148078	68.19	0.000	44.30	49.13	0.222	259.39	36.71
	148272	78.08	0.000	40.88	58.49	0.222	282.89	43.22
	148330	68.24	0.000	195.74	61.44	0.111	882.12	30.42
	148340	57.95	0.000	129.05	74.68	0.111	97.73	64.77	CopyNumber	3p14.2	601
	148670	89.45	0.036	35.45	93.34	0.222	56.01	87.59
	149004	102.91	0.036	30.71	66.15	0.222			CopyNumber	16q24.2	2967
	149957	81.12	0.071	47.00	76.13	0.222	125.85	48.66
	149983	68.84	0.071	42.84	78.77	0.222	75.44	36.59	CopyNumber	1p36.22	27
	150107	116.09	0.071	20.91	61.58	0.222	573.50	21.98	CopyNumber	2p22.3	302
	150540	90.93	0.036	48.36	86.76	0.000	183.75	29.74
	150580	80.15	0.000	1108.77	70.34	0.000	3122.23	30.91	CopyNumber	17q21.2	3022
	150837	124.23	0.036	86.20	120.91	0.222	778.59	48.51
	151134	57.73	0.071	45.75	78.70	0.222	289.38	30.06
	151220	73.17	0.036	66.67	96.14	0.222	744.16	63.01	CopyNumber	4q32.3	1031
	151413	80.50	0.000	79.73	76.85	0.000	300.73	30.47
	151787	65.45	0.036	107.49	74.56	0.111	592.77	39.14
	152536	151.78	0.036	64.94	62.87	0.111	437.32	51.09
	153177	82.65	0.000	1290.76	62.05	0.000
	154023	69.11	0.071	35.70	66.65	0.111	83.15	28.46	CopyNumber	9q31.1	1976
	154073	75.96	0.036	33.22	53.61	0.222	218.58	39.39
	155165	68.65	0.036	52.72	66.13	0.111	79.58	31.11
	155218	57.46	0.000	200.28	53.39	0.000	216.50	35.53
	155396	76.82	0.071	67.48	97.34	0.222	405.26	42.07
	155829	66.32	0.000	59.97	79.36	0.000	238.12	23.08
	156171	68.16	0.000	68.13	52.36	0.222	147.78	34.78
	156367	87.67	0.000	1712.42	68.63	0.000	4735.69	38.82
	156667	92.93	0.036	26.62	69.37	0.222	239.39	35.65
	157160	92.71	0.071	89.61	69.92	0.000	100.13	36.59	CopyNumber	16p13.3	2866
	157351	66.51	0.036	91.00	77.95	0.000	484.52	37.70
	157379	88.98	0.000	245.35	78.54	0.000
	157394	115.85	0.036	40.70	64.13	0.111	128.63	71.71	CopyNumber	16p13.3	2866
	159014	63.78	0.036	89.22	60.16	0.111	163.73	32.17
	159118	93.76	0.000	80.22	75.94	0.222	173.36	116.76
	159130	70.14	0.036	83.65	78.95	0.000	257.93	22.84
	159161	97.10	0.000	133.32	61.43	0.000	599.74	28.29	CopyNumber	17q25.3	3087
	159699	69.52	0.000	37.41	64.94	0.111	210.99	69.05	CopyNumber	12q24.22	2509
	159799	64.26	0.036	34.74	59.78	0.111	91.07	36.21	CopyNumber	12q24.21	2506
	160958	79.14	0.000	114.90	52.77	0.222	127.25	40.40
	161357	64.76	0.000	46.29	76.91	0.000	147.60	39.89
	162032	67.26	0.036	70.53	79.73	0.000	255.04	27.58
	162233	74.14	0.000	90.72	65.27	0.000	179.64	29.18
	162877	69.59	0.036	50.56	52.07	0.000	521.49	49.22
	163645	76.60	0.071	24.93	67.74	0.111	84.40	61.57
	163776	71.14	0.071	37.56	78.72	0.111	528.53	41.20
	163893	57.76	0.000	58.05	59.53	0.000	271.42	33.87
	165195	65.00	0.036	108.29	54.09	0.222	943.91	27.36
	166011	93.62	0.000	49.61	56.41	0.222	312.99	31.66
	166204	68.68	0.071	31.97	87.75	0.000	320.35	36.72
	166463	56.02	0.000	192.95	59.71	0.000	787.81	25.31
	166924	72.91	0.036	55.96	77.29	0.111	350.25	27.79
	166975	84.13	0.000	175.23	59.39	0.111	567.33	40.53
	167535	67.25	0.071	31.16	78.48	0.222	189.62	34.78	CopyNumber	14q13.2	2665
	168073	57.46	0.000	79.97	43.40	0.000	97.12	34.22	CopyNumber	20q11.22	3365
	168799	72.15	0.000	85.51	85.35	0.111	127.53	38.40	CopyNumber	14q11.2	2643
	169611	69.54	0.071	37.43	50.49	0.222	285.98	24.97
	169718	96.71	0.000	139.45	63.02	0.222	232.68	35.86	CopyNumber	19p13.3	3198
	170107	87.41	0.071	47.18	78.34	0.222	1036.03	59.06
	170131	67.79	0.036	50.82	86.27	0.111	99.84	47.80	CopyNumber	19p13.3	3203
	170553	58.81	0.071	60.80	61.32	0.222	725.07	33.82
	170622	78.58	0.000	2283.14	56.69	0.000	9908.08	42.82	CopyNumber	11q13.1	2276
	171626	63.32	0.000	241.54	57.86	0.000	1649.53	25.79
	172550	105.11	0.000	212.10	66.20	0.111	549.43	25.49
	172755	131.11	0.036	69.54	193.88	0.111	31.12	77.04
	172928	223.12	0.000	3277.02	184.20	0.222	23.83	59.75
	173024	72.45	0.000	18.77	58.78	0.222	607.15	31.58
	173162	77.43	0.071	64.12	75.11	0.111	116.53	36.61
	173381	129.69	0.036	196.90	150.06	0.222	416.10	84.50
	173464	130.72	0.000	144.94	86.56	0.000	106.78	43.86
	173611	74.38	0.036	72.63	73.41	0.222	450.20	37.71
	173705	71.42	0.036	77.12	54.80	0.111	1003.69	44.66
	173724	129.37	0.000	480.96	98.37	0.111	328.75	117.68
	174050	81.34	0.000	161.44	58.99	0.111	435.08	32.67	CopyNumber	9q34.3	2030
	174195	121.69	0.000	59.79	61.62	0.222	1541.94	54.35
	175473	178.89	0.000	74.84	74.19	0.111	39.59	55.77
	175955	78.53	0.071	82.37	63.20	0.000	407.41	30.39	CopyNumber	4q13.2	868
										4q13.3-
										4q13.2
	177530	105.78	0.000	370.63	61.86	0.000	1399.62	34.95
	177766	110.71	0.036	85.86	98.28	0.222	258.95	47.27
	178551	80.06	0.000	709.53	80.15	0.000	4043.69	42.24
	178728	82.99	0.000	68.39	77.86	0.222	178.39	24.90
	179986	66.32	0.000	162.17	96.06	0.000	650.73	31.17	CopyNumber	6p21.33	1312
	180141	117.29	0.036	32.50	84.00	0.222	371.27	77.91
	180312	89.37	0.036	55.94	83.19	0.222	153.55	46.39
	180414	84.33	0.000	849.88	48.98	0.000	1613.00	26.72
	180877	77.30	0.000	324.36	71.18	0.000	1202.80	34.96
	180903	87.91	0.000	76.16	118.67	0.111	44.42	26.29	CopyNumber	22q13.33	3520
	180909	80.07	0.000	371.75	106.26	0.000	1474.92	40.32
	180933	80.42	0.071	73.33	92.53	0.111	346.11	27.13
	181046	71.47	0.000	52.77	69.61	0.111	76.22	39.96
	181112	67.48	0.000	56.45	51.99	0.111	58.24	39.41	CopyNumber	13q14.2	2567
	181163	101.97	0.036	209.51	59.97	0.000	1671.22	28.67
	181244	84.91	0.000	615.31	92.95	0.000			CopyNumber	6p21.33	1311
	181368	73.25	0.036	72.19	59.47	0.222	877.69	37.35
	181444	77.92	0.000	93.53	65.83	0.111	428.12	41.92
	182255	70.26	0.000	258.19	78.53	0.000	575.25	28.65
	182626	59.53	0.036	77.65	60.50	0.111	114.59	33.95
	182885	72.14	0.071	79.54	72.22	0.111	658.87	31.09
	183684	66.42	0.000	167.12	47.95	0.000	1226.24	19.58
	183706	87.65	0.000	71.68	63.07	0.111	129.53	32.44
	183800	73.34	0.000	88.07	68.82	0.111	79.80	39.64	CopyNumber	22q13.2	3503
	183850	63.02	0.071	42.45	54.66	0.222	201.07	30.38
	183994	111.25	0.036	107.82	63.33	0.222	314.08	45.04
	184062	80.16	0.000	108.22	79.79	0.111	885.45	50.28
	184211	68.32	0.071	35.11	53.79	0.222	316.88	34.51
	184233	67.24	0.000	149.88	69.13	0.111	465.50	38.54
	184492	63.40	0.071	46.02	72.84	0.222	397.55	26.36	CopyNumber	19p13.2	3210
	185172	91.53	0.000	246.66	86.19	0.000	344.82	34.87	CopyNumber	7q22.1	1600
	185597	59.04	0.000	83.15	71.88	0.111	139.56	35.15	CopyNumber	16q24.3	2972
	187199	115.54	0.000	303.70	76.68	0.000
	187635	101.59	0.000	380.46	78.22	0.000	28.66	51.48	CopyNumber	16p12.3	2889
	187763	66.27	0.000	76.79	54.16	0.222	500.24	26.46
	187866	73.60	0.000	111.79	64.50	0.111	680.00	34.53
	187946	84.06	0.000	104.34	48.89	0.222	200.66	75.07
	188501	67.55	0.000	55.47	53.26	0.222	45.76	34.94
	188614	65.47	0.071	44.10	82.41	0.222	84.46	53.64	CopyNumber	12p12.3	2387
	188879	68.81	0.071	103.91	56.06	0.111	141.32	40.35
	188882	62.39	0.036	30.53	64.74	0.222	163.76	30.89
	189075	84.72	0.000	48.42	71.25	0.222	232.97	38.78
	189119	95.87	0.000	83.56	64.37	0.222	64.39	50.46
	189329	60.19	0.071	28.86	71.76	0.222	86.40	35.87
	189716	84.20	0.000	79.20	72.95	0.111	798.87	31.92
	189772	112.18	0.071	233.62	107.40	0.222	546.84	44.02
	190028	96.99	0.036	64.26	55.28	0.222	715.65	50.89
	190086	108.77	0.000	238.35	55.47	0.111	312.07	29.80
	190334	64.40	0.000	45.95	69.08	0.222	275.10	42.89
	190384	61.06	0.036	49.81	60.07	0.111	232.13	26.89
	190722	69.16	0.000	105.73	67.89	0.000	144.16	53.90
	190904	86.92	0.036	32.05	61.63	0.222	95.24	30.61	CopyNumber	19q13.32	3268
	191186	70.71	0.071	39.12	55.01	0.222	614.82	24.31
	191346	80.55	0.000	98.52	86.95	0.111	757.36	36.32	CopyNumber	7p14.2	1530
	191518	87.09	0.071	92.92	81.35	0.222	176.63	30.67
	191987	71.55	0.071	50.78	45.94	0.222	307.98	24.32	CopyNumber	1p36.33	2
	192316	65.32	0.036	43.60	69.01	0.222	176.27	33.07	CopyNumber	1p36.33	3
	192374	78.84	0.000	407.58	81.92	0.000	1068.05	35.28
	192425	76.85	0.000	311.90	64.60	0.000			InversionBreakpoint	16p11.2	2900
									InversionBreakpoint
									CopyNumber
	193118	62.88	0.036	41.98	71.16	0.000	331.29	46.59	CopyNumber	10q22.3	2141
	193163	145.45	0.000	64.92	125.23	0.222	62.71	48.89	CopyNumber	2q14.3	408
	193491	92.35	0.000	115.38	71.01	0.111	286.47	58.62	CopyNumber	18p11.21	3105
	194329	73.07	0.000	93.43	82.64	0.000	315.47	84.07
	194718	66.93	0.071	50.97	67.72	0.111	497.18	30.12
	195464	98.64	0.036	248.43	76.79	0.000	442.92	71.56	Inversion	Xq28	3630
	195642	78.70	0.071	39.60	101.58	0.222	88.25	56.73
	196983	83.49	0.071	33.94	63.95	0.222	186.36	59.61
	198281	108.54	0.000	400.81	102.64	0.111	57.29	51.53
	199561	68.25	0.036	72.08	76.53	0.000	89.48	31.20
	199625	89.82	0.000	222.28	87.19	0.111	383.94	32.48
	200063	131.93	0.071	68.93	74.04	0.111	65.10	51.46
	200600	81.79	0.036	59.63	66.67	0.222	239.47	30.41	CopyNumber	1q22	160
	200804	109.85	0.000	135.85	90.16	0.000	879.77	36.77	CopyNumber	8q12.1	1762
	201253	75.54	0.071	53.03	72.88	0.111	150.04	34.96
	201390	61.96	0.036	64.00	58.40	0.111	410.22	35.22
	201712	78.85	0.036	29.07	57.59	0.222	96.84	37.35	CopyNumber	16q22.3	2941
	202011	64.61	0.000	88.75	53.56	0.111	189.04	35.21
	202085	70.60	0.000	180.75	62.87	0.000
	202166	57.15	0.000	166.73	45.76	0.111	1023.72	33.49	Inversion	5q35.3	1270
									CopyNumber
	202179	59.85	0.000	59.18	64.11	0.222	53.16	43.92	CopyNumber	5q13.2	1143
	203099	55.11	0.036	50.48	63.52	0.222	113.15	27.96
	203910	83.11	0.000	151.92	125.87	0.000	46.20	51.50
	204041	74.62	0.036	106.38	86.68	0.111	254.62	59.64
	204773	71.71	0.000	60.94	64.50	0.000	135.31	39.98
	205163	62.46	0.000	151.99	70.71	0.000	517.07	39.92	CopyNumber	3q22.1	670
	206500	81.07	0.036	62.30	49.78	0.222
	206824	89.50	0.000	195.81	83.44	0.111	2218.86	36.90
	208597	62.01	0.000	112.96	50.60	0.000	481.51	24.72
	209983	132.48	0.071	257.96	130.11	0.222	101.23	38.96
	210469	70.29	0.036	21.05	72.93	0.222	64.90	43.40
	210532	74.09	0.071	82.09	84.33	0.111	61.52	28.17
	211463	73.34	0.000	101.29	69.16	0.222	98.91	38.82	CopyNumber	19p13.2	3217
	211594	102.99	0.071	73.05	66.89	0.111	104.24	46.28	CopyNumber	19q13.2	3258
	211914	107.07	0.036	59.20	53.55	0.111	128.87	42.11	CopyNumber	19p13.3	3198
	212102	78.06	0.000	138.13	60.95	0.111	393.98	37.87
	212395	62.26	0.071	31.35	67.76	0.222	59.26	42.89
	213061	98.05	0.000	327.00	72.73	0.000	1227.71	41.68
	213470	67.83	0.000	192.87	68.35	0.111	410.41	31.28
	213541	84.63	0.036	85.44	89.94	0.000	429.86	31.21
	213666	61.77	0.036	27.18	63.86	0.222	107.77	28.26
	213724	81.67	0.071	54.83	74.71	0.111	278.03	30.19
	216653	74.68	0.071	33.21	71.69	0.222	343.12	32.18
	220950	71.10	0.071	83.15	93.30	0.000	1027.22	35.80
	221847	107.96	0.000	214.24	135.53	0.111	687.16	51.69
	222510	93.05	0.071	88.95	63.95	0.222	113.62	30.43	CopyNumber	19p13.3	3198
	223141	99.93	0.036	131.95	62.74	0.111	1035.61	39.53
	224607	152.50	0.036	87.86	158.09	0.222	137.21	45.23
	226007	164.81	0.071	47.81	52.32	0.222	40.09	36.30
	226117	83.46	0.000	65.79	116.54	0.111	371.84	56.86	CopyNumber	22q13.1	3496
	226755	93.25	0.000	194.51	65.63	0.111	278.34	38.95
	227067	67.54	0.071	33.57	86.75	0.222	231.33	33.85	CopyNumber	1p36.33	3
	227253	81.31	0.036	55.73	71.93	0.111	101.17	28.59
	227777	72.56	0.000	81.21	76.44	0.111	415.86	66.71
	229641	64.35	0.000	118.72	79.68	0.000	809.47	34.84	CopyNumber	5p13.3	1105
	231295	68.62	0.071	21.81	62.84	0.222	87.17	37.84	CopyNumber	17q24.2	3061
	231616	83.55	0.036	105.55	56.13	0.000	385.33	37.02	CopyNumber	19p13.13-	3221
										19p13.12
	232194	64.71	0.000	51.79	57.10	0.111	405.35	23.20
	232543	132.95	0.036	98.19	105.59	0.222	74.17	72.02
	233458	89.76	0.000	44.01	49.80	0.000	127.26	26.28
	233552	59.88	0.071	23.54	97.43	0.222	130.13	32.17	CopyNumber	7p14.1	1535
	233952	90.17	0.000	319.55	67.24	0.000	101.92	36.48
	234521	91.19	0.071	81.43	91.57	0.222	69.82	35.53
	236030	71.56	0.036	23.36	61.13	0.222	83.17	36.95	CopyNumber	12q13.2	2429
	237536	90.09	0.036	49.15	76.51	0.111	483.90	44.44
	237971	91.89	0.036	78.94	95.20	0.222	246.47	64.85
	238839	67.07	0.000	145.01	65.51	0.000	190.91	36.76
	240170	87.00	0.000	118.73	122.83	0.222	37.21	46.26	CopyNumber	12q13.2	2429
	241336	61.07	0.000	155.72	77.04	0.111	721.67	34.47
	241543	76.34	0.000	45.73	60.57	0.222	203.39	33.10
	241558	64.15	0.000	47.89	63.03	0.222	122.71	28.63
	241575	70.86	0.000	45.40	74.01	0.222	432.03	30.80	CopyNumber	16p13.3	2866
	241576	71.75	0.000	35.61	63.06	0.222	626.29	37.40
	241579	107.31	0.000	207.46	85.28	0.222
	242458	57.83	0.036	73.30	49.12	0.000	415.64	29.35
	242947	58.36	0.000	3864.18	41.07	0.000	13.84	72.12
	246112	67.73	0.000	136.82	57.97	0.111	1178.68	27.77	CopyNumber	2q11.2	378
	246310	76.17	0.000	145.70	64.99	0.111	618.59	39.03
	246413	81.25	0.036	112.38	61.72	0.111	183.60	54.30
	246781	62.94	0.071	41.90	55.75	0.222	10.39	88.93
	247077	67.52	0.000	567.58	47.87	0.000	1471.14	26.19	CopyNumber	3p21.31	583
	247186	64.96	0.000	37.62	80.54	0.222	77.06	31.82	CopyNumber	16p11.2	2904
	247975	105.68	0.000	438.14	91.84	0.000	104.18	46.50
	248267	96.06	0.036	85.59	77.62	0.000	267.18	59.58
	248941	61.08	0.036	51.35	63.24	0.222	221.26	33.54	CopyNumber	5q13.2	1143
	249600	70.96	0.071	67.36	81.11	0.222	73.53	34.15
	250009	61.55	0.000	59.19	55.14	0.111	418.28	26.81
	250429	69.07	0.071	30.41	44.58	0.222	130.29	29.98
	250758	61.91	0.000	91.07	70.47	0.222	135.51	35.81
	250899	79.57	0.000	193.37	90.68	0.000	526.51	34.77
	250905	66.32	0.000	77.23	58.42	0.111	1248.73	26.47
	251531	101.66	0.000	119.04	61.83	0.222	359.88	30.37
	252457	76.40	0.000	54.99	74.23	0.000	13.56	94.81	CopyNumber	16q24.2-	2970
										16q24.3
	252713	72.27	0.071	50.47	59.99	0.111	74.87	50.43
	252967	64.23	0.000	74.53	57.70	0.111	168.08	23.83
	253726	58.02	0.000	89.50	50.88	0.000	451.23	27.68
	253903	101.02	0.071	152.14	104.18	0.222	591.87	57.57
	254042	67.31	0.000	162.34	45.49	0.000	920.76	27.97	CopyNumber	6p21.33	1313
	255015	52.53	0.036	52.05	70.92	0.111	607.92	28.15
	255093	61.27	0.000	87.62	65.22	0.111	184.42	34.31
	255932	75.20	0.071	63.07	84.50	0.111	246.82	28.40
	255935	97.23	0.000	310.78	117.34	0.111	10.29	49.34
	255973	77.67	0.000	121.74	58.40	0.111	88.24	45.36
	256301	143.00	0.036	131.52	125.09	0.111	193.25	117.05
	256549	73.37	0.071	66.78	109.62	0.111	72.47	43.74	CopyNumber	16p13.3	2866
	257008	94.53	0.000	239.54	60.00	0.000	206.91	69.09
	257341	80.14	0.071	32.10	94.24	0.222
	257761	74.40	0.071	57.97	89.39	0.222	90.97	44.23
	258551	113.91	0.036	31.42	52.51	0.111	212.75	23.35	CopyNumber	2q35	496
	258563	74.13	0.000	51.06	53.28	0.222	270.95	35.45
	258798	192.40	0.000	100.67	52.60	0.222	109.62	31.17
	259461	79.93	0.036	118.37	49.94	0.000	119.14	28.75
	260603	112.19	0.036	28.87	96.98	0.111	114.76	44.19
	262823	101.47	0.036	35.90	64.77	0.222	268.43	30.93
	265829	134.13	0.036	60.09	147.84	0.222	88.23	82.34
	268488	75.37	0.000	22.47	50.04	0.222	260.69	26.22	CopyNumber	1p36.32	12
	268530	81.96	0.036	168.88	85.78	0.000	106.18	37.76
	268742	79.56	0.000	96.43	68.28	0.111	881.42	37.73
	268849	62.43	0.000	127.97	70.40	0.222	666.34	58.26	CopyNumber	6p21.2	1325
	268939	88.77	0.000	69.60	63.46	0.111	993.14	26.39
	269528	65.55	0.000	77.77	59.98	0.111	321.03	37.48
	269577	52.27	0.036	116.39	58.52	0.000	163.78	33.49	CopyNumber	20p13	3304
	269782	67.13	0.071	73.22	67.37	0.111	139.08	34.10
	269944	60.66	0.000	46.86	64.04	0.222	297.40	32.90	CopyNumber	11p11.2	2254
	270291	83.84	0.000	288.23	52.39	0.000	489.18	51.55
	270428	69.26	0.036	56.42	53.38	0.000	575.82	78.18
	270525	70.97	0.071	49.58	95.80	0.222	482.93	25.81
	270869	61.79	0.036	41.81	83.43	0.222	159.67	24.39
	271135	68.23	0.036	96.12	59.45	0.000	1364.03	36.20
	271695	74.54	0.071	51.23	58.22	0.222	431.22	39.81
	272062	90.33	0.071	134.84	67.71	0.222	403.60	48.89
	272168	70.53	0.071	24.14	85.55	0.222	235.12	31.23
	272630	60.27	0.000	49.35	72.52	0.111	70.37	33.27
	272927	66.36	0.000	55.23	67.21	0.111	132.83	49.23
	273077	75.82	0.071	65.81	74.94	0.111	284.35	38.35
	274184	70.70	0.071	73.81	63.57	0.111	79.41	33.16
	274772	65.96	0.000	78.91	69.49	0.000	341.50	37.35
	274873	81.69	0.000	64.18	62.49	0.111	401.63	28.94
	275243	132.16	0.000	386.53	100.02	0.222	2365.31	75.71
	275775	134.20	0.071	141.95	138.41	0.222	1379.68	60.08
	275865	62.60	0.071	77.19	60.06	0.111	390.18	35.84
	276878	85.73	0.071	75.29	88.57	0.222	41.28	79.67
	277035	117.16	0.000	49.43	96.96	0.111	820.49	57.32	CopyNumber	3q21.3	667
	277517	74.29	0.000	43.19	64.65	0.222	340.59	48.75
	278186	85.24	0.071	64.92	117.05	0.111	125.86	38.10
	278362	66.62	0.000	67.90	71.94	0.000	328.98	38.55
	278426	62.04	0.000	92.55	57.10	0.111	156.41	42.46	CopyNumber	7q22.1	1597
	278429	64.98	0.036	103.18	62.08	0.111	94.29	29.86
	278500	68.19	0.036	75.86	73.54	0.222	106.63	48.00
	278569	82.25	0.000	200.20	102.95	0.222	107.25	51.38
	278573	101.10	0.000	114.44	148.80	0.111	650.32	46.92
	278721	83.27	0.036	71.10	71.24	0.222	72.60	42.44
	279061	67.08	0.036	44.30	63.18	0.222	197.52	31.29	CopyNumber	17p13.3	2975
	279245	76.47	0.000	75.15	85.55	0.111	91.87	45.55
	279257	66.80	0.036	93.74	71.44	0.111	194.76	31.27
	279413	129.76	0.036	110.16	104.82	0.111	47.09	59.50
	279529	81.69	0.036	104.37	66.22	0.222	1363.23	45.45	CopyNumber	5q35.3	1268
	279583	71.86	0.036	199.42	57.52	0.000	103.71	39.63	Inversion	16p12.2-	2894
									CopyNumber	16p12.1
	279623	77.55	0.071	41.14	84.94	0.111	251.43	82.76	CopyNumber	16p13.3	2866
	279640	65.23	0.036	40.21	83.36	0.222	301.86	23.97
	279652	91.16	0.000	56.36	73.29	0.222	122.30	52.34
	279669	82.14	0.071	83.17	76.56	0.222	90.40	49.23
	279696	83.17	0.036	102.39	93.03	0.000	431.21	44.69
	279806	69.81	0.000	647.74	79.09	0.111	1392.91	24.99
	279836	58.12	0.000	42.38	77.37	0.222	109.90	38.28	CopyNumber	11p13-	2245
										11p12
	279920	78.76	0.000	209.25	54.55	0.111	1143.94	32.04
	279929	81.28	0.000	119.27	50.43	0.111	615.57	32.57
	280202	67.43	0.036	34.06	68.28	0.111
	280342	64.79	0.000	190.05	68.21	0.111	507.64	35.59
	280378	78.00	0.036	59.08	52.49	0.111	324.22	34.79
	282410	75.08	0.000	346.66	83.21	0.000	863.13	37.39
	282700	59.59	0.071	89.12	64.76	0.111	474.36	29.57
	282901	61.28	0.000	161.17	55.92	0.111	586.28	30.27
	282998	87.12	0.000	109.61	89.33	0.000	203.95	38.00
	283111	77.12	0.000	54.33	58.77	0.111	148.42	37.10
	283454	55.19	0.071	33.55	62.22	0.111	72.33	42.83
	283521	77.37	0.000	76.39	64.83	0.222	21.40	67.57
	283610	59.73	0.071	45.77	73.57	0.111	113.35	30.58
	283652	77.33	0.036	55.65	73.75	0.222	173.00	38.91
	283739	146.71	0.071	51.69	109.60	0.222	360.93	32.32
	284208	78.08	0.071	29.66	65.71	0.111	301.23	63.92
	284279	69.22	0.000	39.54	69.82	0.222	123.20	36.70
	284286	81.75	0.036	67.66	95.49	0.222	1531.44	35.52	CopyNumber	7p13	1537
	284491	136.63	0.000	305.06	99.27	0.000	226.73	38.91	CopyNumber	21q22.3	3455
	285354	59.95	0.071	60.82	74.39	0.222	168.00	27.87
	285976	94.65	0.000	98.07	53.23	0.111	573.85	77.02
	286221	75.65	0.000	248.30	58.65	0.000	3463.94	35.74
	286226	101.42	0.036	32.24	72.06	0.222	207.01	28.47
	288193	61.78	0.000	45.54	63.87	0.111	349.23	36.00
	288856	87.34	0.071	197.77	57.17	0.000	1020.14	40.67
	288969	73.68	0.071	31.39	60.73	0.222	278.99	36.61
	289008	59.92	0.036	63.72	61.38	0.222	271.56	30.69
	289092	116.11	0.036	289.77	159.61	0.111	458.68	76.94	CopyNumber	16q24.1	2960
	289123	66.03	0.000	78.85	81.68	0.000	272.21	82.53	CopyNumber	12q13.3	2432
	289271	87.86	0.000	314.40	88.75	0.000	394.29	60.90	CopyNumber	8q24.3	1879
	290243	125.85	0.000	761.77	103.49	0.000	101.29	27.98
	290404	75.80	0.071	40.20	86.49	0.111	1710.99	28.57
	290758	67.69	0.000	91.13	56.76	0.222	361.48	36.00	CopyNumber	11q12.2	2266
	291587	59.78	0.000	43.57	53.60	0.111	178.10	32.56
	292026	69.01	0.036	40.56	58.47	0.222	211.07	26.51
	292063	62.83	0.000	145.61	55.21	0.000	49.54	46.81
	292078	78.84	0.036	77.92	77.84	0.111	475.13	31.13
	292265	64.89	0.071	34.72	84.99	0.222	384.26	31.49	CopyNumber	10p15.3	2033
	292457	160.14	0.000	215.82	73.61	0.111	63.85	61.00
	292493	70.67	0.000	424.46	81.44	0.000	831.58	26.17
	292524	67.18	0.071	25.82	53.79	0.222	195.08	27.33
	292579	75.20	0.036	75.85	66.75	0.111	420.33	36.15
	293563	104.96	0.036	137.26	82.64	0.111	165.89	47.95
	295917	77.96	0.036	56.00	89.69	0.222	319.57	47.66
	297324	107.68	0.000	190.59	111.57	0.222	155.47	67.70
	298198	79.37	0.000	97.17	92.03	0.111	293.20	59.13
	298280	86.67	0.000	235.59	89.33	0.111	1546.16	35.33
	298654	101.00	0.071	136.05	94.16	0.111	181.32	68.18
	299002	118.98	0.036	211.61	81.78	0.000	590.01	51.94	CopyNumber	19q13.2	3258
	299055	67.41	0.071	60.49	51.37	0.000	1136.65	27.04
	300141	82.66	0.000	880.44	79.56	0.000
	300684	86.52	0.036	19.56	66.08	0.222	55.18	33.61
	300772	407.50	0.000	144.07	60.22	0.111	11.36	80.27
	300816	68.45	0.000	144.04	91.05	0.222	258.49	31.17
	300834	53.83	0.000	46.55	59.38	0.111
	301404	84.83	0.036	127.77	69.34	0.000	48.88	37.40
	301412	70.03	0.000	161.71	51.02	0.000	573.46	31.44
	302742	97.96	0.036	99.87	126.82	0.222	620.43	57.69	CopyNumber	21q22.11	3448
	302903	73.32	0.036	155.07	64.76	0.111	503.88	36.57	CopyNumber	16p13.3	2866
	303676	78.57	0.036	106.32	83.93	0.222	263.04	37.05
	304192	89.25	0.071	87.57	78.41	0.111	1681.62	40.81
	304682	146.41	0.000	586.08	115.24	0.000	1233.74	48.30
	306123	69.15	0.071	59.10	53.26	0.222	125.75	44.20
	306242	71.12	0.000	48.63	99.39	0.222	136.24	37.00
	306329	62.26	0.000	60.88	78.67	0.222	316.67	32.67
	306425	73.63	0.000	34.17	79.05	0.000	84.65	38.45	CopyNumber	6q14.1	1383
	308122	77.12	0.036	78.26	58.86	0.111	226.98	30.91	CopyNumber	14q32.12	2733
	308340	93.90	0.071	39.81	69.75	0.222	83.71	47.24
	308709	105.53	0.000	111.91	66.83	0.000	310.05	37.58	CopyNumber	15q15.3	2771
	309090	85.59	0.071	177.79	69.74	0.111	45.16	35.63
	309231	80.54	0.036	63.95	73.06	0.111	580.07	23.13
	309641	75.27	0.000	99.07	83.98	0.000	264.53	42.66
	309753	69.18	0.000	71.16	72.16	0.111	742.22	44.20	CopyNumber	7p14.1	1534
	309849	73.60	0.071	28.98	68.38	0.222	94.62	48.92
	310542	92.37	0.071	77.69	87.64	0.222	156.90	38.84
	310645	69.28	0.036	100.90	54.85	0.000	1125.09	21.18
	311072	86.83	0.036	27.73	57.37	0.222	367.02	38.90
	311346	67.53	0.036	44.51	86.22	0.111	53.25	44.95	CopyNumber	12p12.1	2391
	311609	70.74	0.000	104.20	81.30	0.000	237.18	48.06	CopyNumber	19p13.12	3223
	311640	106.83	0.000	510.33	73.34	0.000	93.77	42.99
	312098	97.67	0.071	80.93	101.94	0.111	35.13	77.49
	313847	55.80	0.036	26.60	71.34	0.222	299.35	40.72
	314263	68.60	0.071	103.11	55.03	0.000	89.94	34.68	CopyNumber	12q13.3	2430
	314359	69.38	0.000	355.31	42.03	0.000	154.82	30.01
	315177	90.19	0.000	79.21	90.27	0.000	225.39	34.43	CopyNumber	3p21.31	586
	315230	75.35	0.000	128.92	93.04	0.222	276.19	37.74
	319334	88.71	0.036	167.66	92.28	0.000	64.37	38.27
	321391	64.74	0.000	42.64	64.44	0.111	435.65	30.96
	321541	59.35	0.036	127.00	41.41	0.111	662.88	41.93	CopyNumber	15q22.31	2793
	323363	64.47	0.000	29.43	51.70	0.222
	323489	81.42	0.036	73.56	84.83	0.222	152.22	30.03
	324250	79.24	0.000	158.34	82.02	0.000	324.22	27.86
	324844	83.37	0.000	138.52	92.47	0.111	368.21	49.14
	325650	136.52	0.000	82.13	109.38	0.222	108.42	62.31
	326387	61.74	0.000	159.12	60.70	0.111	1355.73	29.26
	330384	69.44	0.000	68.69	88.89	0.222	263.52	45.28
	331431	64.62	0.036	34.89	61.05	0.222	164.96	25.51	CopyNumber	4p14	825
	333388	90.31	0.000	248.00	49.98	0.000	56.06	41.65	CopyNumber	8q24.3	1878
	333579	73.99	0.000	207.00	86.45	0.000	578.55	32.43
	333786	82.77	0.000	297.78	97.96	0.000	88.80	27.84
	333823	89.78	0.036	42.96	56.87	0.222	126.65	54.02
	334017	82.51	0.000	1496.72	84.82	0.111
	334479	72.52	0.036	61.34	57.88	0.222	224.68	33.05	CopyNumber	16p13.3	2866
	334534	94.59	0.000	64.42	72.27	0.222	230.52	56.05
	334587	98.49	0.036	127.44	77.96	0.222	56.82	48.84
	334713	72.87	0.071	69.27	86.41	0.222	158.37	38.36
	334851	102.17	0.000	101.40	41.98	0.111	553.93	45.99
	334868	56.26	0.071	23.15	52.67	0.222	170.24	29.57
	335003	52.84	0.000	53.68	52.65	0.111	280.86	27.96	CopyNumber	16q24.3	2972
	335057	68.54	0.000	137.12	58.17	0.000	682.36	27.44
	335163	75.40	0.071	45.38	129.15	0.222	69.59	99.48
	335918	98.06	0.071	79.89	54.30	0.222	222.21	54.25	CopyNumber	1q22	160
	337295	84.21	0.036	137.57	72.92	0.111	116.16	50.84	CopyNumber	11q13.1	2272
	337766	68.01	0.000	202.91	74.78	0.000	3513.66	53.34	CopyNumber	12q23.3	2494
	339278	66.75	0.000	93.08	54.14	0.111	612.93	27.37
	339639	71.56	0.000	59.94	63.25	0.222	530.98	32.89
	339697	73.00	0.000	206.27	69.44	0.111	207.55	60.06
	343911	79.02	0.000	73.68	85.85	0.111	126.75	36.12
	345694	57.05	0.000	44.59	53.30	0.000	118.43	29.68
	346868	85.04	0.071	86.46	71.11	0.222	78.76	41.86
	348418	65.21	0.036	41.25	56.56	0.111	133.63	28.30
	349656	69.11	0.000	122.42	91.03	0.111	65.67	33.86
	350194	67.50	0.071	57.18	56.35	0.222	974.29	21.31
	350229	97.88	0.000	64.62	89.22	0.111	182.02	57.82
	350268	84.85	0.071	121.48	94.64	0.111	854.94	33.25
	350364	62.80	0.071	32.70	56.87	0.222	489.36	49.85
	350927	60.49	0.000	549.42	42.63	0.000	1242.87	45.82
	351099	73.49	0.071	48.32	58.61	0.111	151.95	26.94
	351296	70.85	0.000	100.35	47.00	0.111	210.84	29.83	CopyNumber	11q12.3	2268
	351316	231.65	0.000	962.00	171.72	0.222	602.84	78.49
	351474	98.35	0.000	56.04	104.42	0.111	65.42	73.26
	351680	134.97	0.036	51.32	81.83	0.222	1028.80	33.00
	351875	195.85	0.000	285.77	81.89	0.000	1982.14	49.61
	352341	75.79	0.071	26.39	65.54	0.222	37.24	43.85
	352656	71.84	0.036	58.63	44.06	0.111	875.31	43.75
	352768	72.88	0.036	106.19	71.31	0.111	881.32	24.35	CopyNumber	6q27	1479
	354056	76.13	0.071	56.50	78.63	0.111	126.70	123.02	CopyNumber	7q11.23	1572
	355141	91.77	0.000	101.53	69.50	0.111	220.79	44.58
	355606	60.91	0.071	76.85	66.68	0.000	574.94	34.63
	355643	77.96	0.036	108.17	72.63	0.111	1201.76	27.22	CopyNumber	16p13.3	2866
	355708	63.12	0.036	37.30	87.81	0.222	262.34	29.20	CopyNumber	2q11.2	378
	355750	71.27	0.000	106.84	50.91	0.000	80.87	40.21
	355753	84.23	0.036	38.89	56.95	0.111	336.82	37.01
	355867	93.77	0.071	48.09	62.22	0.222	280.34	54.64	CopyNumber	12q13.3	2432
	355927	64.41	0.000	147.13	64.66	0.111	941.32	36.63
	355934	69.80	0.036	156.14	50.78	0.000	161.58	25.13
	355983	66.37	0.000	154.52	67.35	0.222	404.14	34.07
	356061	67.49	0.000	116.51	74.14	0.111	218.65	28.55	CopyNumber	16q24.2	2967
	356096	70.29	0.000	168.35	68.41	0.111	168.20	43.07
	356190	88.54	0.000	478.54	95.96	0.000	3961.19	25.93
	356270	65.90	0.036	46.04	72.70	0.222	257.48	42.37
	356285	79.82	0.000	329.64	78.06	0.000	799.76	33.14
	356331	59.53	0.000	1683.27	56.79	0.000	5223.43	28.46
	356366	92.12	0.000	1928.74	63.68	0.000			CopyNumber	16p13.3	2866
	356371	75.13	0.000	2350.46	66.23	0.000	112.06	33.10
	356377	82.23	0.000	62.50	63.16	0.222	320.21	50.05
	356467	66.21	0.000	55.00	59.52	0.000	527.54	28.10
	356501	153.63	0.000	51.63	63.33	0.000	250.13	58.63
	356502	73.27	0.000	2501.03	44.31	0.000	4303.08	32.44	CopyNumber	15q23	2800
	356549	65.60	0.000	84.68	67.51	0.222	294.91	45.11
	356630	59.68	0.000	135.65	56.95	0.111	256.98	31.53
	356647	75.20	0.000	113.95	64.30	0.000	982.39	31.67	Inversion	14q13.1-	2663
										14q13.2
	356654	68.00	0.036	50.52	58.00	0.111	529.64	18.33
	356766	85.27	0.036	207.71	52.85	0.111	3532.27	54.09
	356769	148.76	0.071	82.19	77.74	0.111	211.91	50.28
	356799	127.42	0.000	82.88	66.53	0.000
	357901	181.23	0.036	350.43	80.27	0.111	407.08	74.43
	362728	62.46	0.000	117.00	40.93	0.222	292.65	31.92
	365116	68.53	0.036	126.74	72.33	0.222	109.68	38.27
	368084	67.93	0.036	82.52	74.16	0.111	330.85	36.03
	368149	84.73	0.000	319.23	99.32	0.000	306.87	38.36
	368157	132.67	0.000	60.76	64.42	0.222	96.04	37.48
	368240	63.21	0.036	41.47	63.19	0.222	282.82	29.11
	368264	104.35	0.036	82.07	152.01	0.000	93.79	33.59
	368376	63.69	0.000	60.30	75.16	0.111	475.42	40.92
	368402	86.05	0.036	31.92	91.55	0.111	104.92	68.11	CopyNumber	8q24.3	1876
	368404	74.03	0.036	46.42	53.59	0.000	79.74	27.69
	368525	121.26	0.000	89.35	75.68	0.222	699.89	47.37
	368598	79.84	0.036	50.09	69.21	0.222	212.95	33.37	CopyNumber	2q32.1	464
	368934	97.54	0.000	420.24	80.76	0.000	2026.16	62.15
	368985	64.59	0.000	54.64	54.70	0.222	245.08	30.39
	369017	64.56	0.000	69.11	41.17	0.222	181.79	39.53
	369052	64.31	0.000	70.30	47.70	0.000	455.50	36.14
	369068	62.84	0.000	90.19	99.10	0.111	210.93	35.73
	369125	86.12	0.036	66.79	75.85	0.222			CopyNumber	2q24.2	437
	369285	183.68	0.000	62.35	137.25	0.222	34.54	60.02
	369356	80.32	0.071	113.07	56.67	0.111	217.18	43.38
	369606	78.57	0.071	63.17	66.71	0.111	145.32	32.96
	369607	63.47	0.036	49.42	69.10	0.111	289.22	36.24	CopyNumber	4p16.3	758
	369614	68.46	0.071	43.68	55.15	0.222	348.84	31.68
	369615	89.80	0.071	29.44	70.80	0.222	118.05	30.52
	369761	72.58	0.036	199.77	81.21	0.000	1028.59	25.79
	369785	70.47	0.000	99.64	68.29	0.000	519.82	35.06
	369920	77.09	0.000	168.51	77.20	0.111	505.36	31.36
	370024	81.89	0.000	128.78	60.25	0.000	422.20	27.11
	370247	75.77	0.000	233.67	70.23	0.000	40.96	41.82	CopyNumber	11q24.3	2355
	370292	77.26	0.036	36.54	69.28	0.000	327.17	36.76	CopyNumber	10q26.2	2190
	370312	65.22	0.036	69.14	59.74	0.222	173.14	30.85
	370408	81.05	0.000	47.84	69.75	0.000	458.21	44.61	CopyNumber	22q11.21	3466
	370581	86.13	0.000	191.83	64.65	0.111	579.49	33.71	CopyNumber	1p34.2	60
	370770	84.48	0.036	95.64	93.45	0.111	452.54	31.23	CopyNumber	2p15	345
	370771	118.09	0.036	242.66	151.31	0.222	251.27	55.14
	370895	82.56	0.000	100.06	76.14	0.111	881.82	34.34
	370927	121.90	0.036	52.90	64.05	0.222	432.84	47.49
	370937	87.18	0.071	124.70	85.67	0.111	561.13	45.91
	371001	69.51	0.000	170.33	68.79	0.111	454.07	35.94
	371416	78.55	0.036	36.50	64.63	0.111	96.75	35.90	CopyNumber	19p13.2	3217
	371563	63.43	0.036	59.64	75.25	0.111	202.76	25.54
	371788	59.70	0.000	54.31	56.93	0.222	206.21	29.90
	371889	68.61	0.000	325.06	67.81	0.000	936.64	56.60
	372003	61.79	0.000	80.84	79.74	0.111	89.46	30.69
	372050	66.34	0.071	46.09	73.62	0.222	82.63	32.40
	372286	64.63	0.036	30.00	59.49	0.222	354.14	23.10
	372331	89.80	0.036	81.60	144.08	0.222	232.33	49.08
	372541	65.94	0.071	66.46	82.62	0.111	186.66	25.95
	372616	72.02	0.036	35.25	60.41	0.222	143.19	33.51
	372914	126.22	0.000	100.73	126.29	0.111	231.60	56.38
	373550	88.97	0.036	184.03	68.60	0.222	209.76	48.79
	373741	79.81	0.000	77.80	98.88	0.000	412.67	38.36
	373763	63.54	0.036	195.53	52.32	0.111
	373952	94.13	0.036	30.34	82.86	0.111	96.20	32.08	CopyNumber	17p13.2	2984
	373959	63.44	0.000	33.58	71.55	0.000	183.05	41.76
	374043	66.27	0.036	34.15	82.28	0.222	106.28	22.55
	374257	90.84	0.071	57.56	72.95	0.222	65.71	68.99
	374378	119.35	0.036	125.53	97.64	0.111	225.89	60.82
	374477	56.99	0.000	105.78	48.32	0.000	246.92	24.70
	374503	59.32	0.000	271.15	58.47	0.000	2139.38	28.45
	374588	75.34	0.000	683.86	58.24	0.000	413.28	42.63
	374596	85.39	0.000	2551.73	61.31	0.000	5206.59	33.30
	374650	126.18	0.036	88.32	93.01	0.222	2238.80	53.03
	374973	72.70	0.071	33.02	75.69	0.222	110.84	45.58
	375001	70.26	0.000	87.30	74.38	0.222	100.50	40.21
	375108	143.73	0.071	764.58	129.71	0.222	128.99	45.16
	375217	66.70	0.000	45.51	78.12	0.222	38.58	33.48
	376046	131.46	0.071	67.73	85.63	0.222	324.83	59.30
	376933	85.54	0.000	188.71	94.17	0.111	932.24	43.14
	377155	84.44	0.000	52.03	67.04	0.000	165.50	32.72
	378103	84.12	0.036	640.07	72.81	0.000	2299.39	45.40	CopyNumber	19q13.43	3293
	378532	74.21	0.071	19.77	57.36	0.222	143.45	34.11
	378808	80.58	0.071	42.68	76.86	0.222	1023.41	32.72
	380403	77.18	0.071	39.70	97.70	0.111	152.35	50.89
	380774	69.78	0.036	367.07	72.51	0.000	704.94	28.60
	380953	120.40	0.000	1164.30	50.87	0.000	4148.67	36.69	CopyNumber	17q25.1	3072
	380973	66.60	0.000	541.31	51.30	0.000	636.85	33.23
	381008	113.07	0.000	775.01	80.40	0.000	541.08	39.56
	381058	58.41	0.036	40.33	63.46	0.222	25.40	47.69
	381072	76.95	0.000	77.98	75.38	0.111	163.52	63.87
	381123	73.37	0.000	1876.45	45.25	0.000	8803.79	35.35
	381126	143.53	0.000	523.32	77.49	0.000	40.73	27.35	CopyNumber	5q33.1	1236
	381189	74.68	0.036	232.19	94.40	0.000	495.84	37.72
	381219	98.54	0.000	704.33	65.39	0.000	1933.04	37.91
	381256	99.47	0.036	83.41	96.68	0.111	46.96	62.16
	382044	92.25	0.036	85.09	76.07	0.111	98.39	41.13
	382168	85.81	0.071	40.65	65.81	0.222	47.88	50.87	CopyNumber	20q13.12-	3395
										20q13.13
	385913	75.07	0.071	85.26	93.35	0.222	200.81	51.44
	385986	67.61	0.036	72.40	68.58	0.000	238.36	27.33
	386434	72.97	0.036	52.83	73.51	0.111	344.41	26.93
	386465	67.39	0.071	32.55	77.62	0.111	144.09	43.35
	386939	79.30	0.036	38.64	50.55	0.111	171.14	24.98
	387208	63.45	0.000	727.99	60.47	0.000	2811.53	37.85
	387804	85.40	0.036	481.25	60.76	0.000	2686.84	38.70
	388034	67.46	0.071	46.51	81.22	0.222	140.62	25.58
	388654	81.47	0.000	93.30	67.09	0.111	637.15	55.44	CopyNumber	9q32	1992
	388664	53.99	0.000	1460.59	41.29	0.000	6835.36	34.82
	388739	68.80	0.036	122.75	82.72	0.111	520.74	24.62
	388927	71.40	0.071	139.68	66.05	0.111	356.99	30.26
	388956	85.77	0.036	71.01	94.85	0.111
	389037	84.61	0.036	47.66	65.23	0.222	91.25	34.83
	389107	94.66	0.036	263.90	108.16	0.000	892.91	48.86	CopyNumber	16p13.3	2866
	389171	82.45	0.036	44.74	103.84	0.111	192.72	33.61
	389649	125.20	0.036	163.93	82.73	0.000	425.65	32.06	CopyNumber	17q25.3	3084
	389734	78.85	0.071	38.68	121.32	0.111	289.67	51.68
	389996	180.39	0.000	327.19	82.08	0.000	1922.00	29.42
	390667	74.42	0.000	105.64	80.72	0.111	468.47	48.33
	393201	67.22	0.071	96.98	68.05	0.111	509.48	35.05
	395482	65.92	0.036	44.74	59.27	0.111	102.70	40.91	CopyNumber	8q24.3	1874
	396644	69.48	0.036	133.73	60.82	0.111	1142.75	35.09
	396740	68.39	0.036	43.05	64.23	0.111	445.56	26.13
	396783	118.29	0.036	110.63	82.09	0.111	261.57	76.08
	397609	254.69	0.000	633.23	56.50	0.000	13138.69	29.06
	399800	66.18	0.036	44.45	64.79	0.111	75.35	36.85
	400295	72.44	0.000	2244.41	48.14	0.000	13951.77	33.35
	401509	85.63	0.036	115.39	64.94	0.000	118.05	44.04
	401903	90.23	0.000	453.74	70.31	0.000	114.88	45.33
	401929	68.45	0.000	2446.06	47.57	0.000	4419.77	40.15	Inversion	Xq28	3631
	403917	63.27	0.071	80.15	43.62	0.222	142.49	52.88
	404056	68.09	0.036	52.37	46.66	0.000	187.40	29.97
	404321	116.89	0.000	104.40	74.14	0.111	419.99	34.26
	405144	69.11	0.000	415.47	73.52	0.000	396.95	31.07
	405410	76.64	0.071	78.70	71.34	0.000	433.35	42.84
	405514	69.02	0.071	38.09	82.50	0.111	418.51	26.82	CopyNumber	17q21.32-	3030
										17 1 31
	405590	81.80	0.036	169.04	77.14	0.000	245.79	24.62
	405880	78.38	0.000	92.99	92.66	0.000	940.03	50.82
	405942	83.39	0.071	57.96	72.26	0.000	158.43	35.77
	406062	84.43	0.000	131.48	52.80	0.222	1502.27	27.41
	406068	75.82	0.036	114.88	92.45	0.111	127.41	44.39
	406096	82.28	0.036	155.28	110.89	0.222	111.15	33.70
	406277	63.86	0.036	80.15	58.28	0.111	262.74	27.77
	406300	110.40	0.000	1789.62	51.80	0.000	3379.42	39.25
	406423	82.14	0.036	108.09	55.19	0.222	227.08	30.58
	406510	99.80	0.000	362.39	97.60	0.000	1484.49	47.35
	406520	68.92	0.000	79.16	46.52	0.000	552.71	43.50	CopyNumber	7q22.1	1598
	406534	76.53	0.036	84.44	74.61	0.111	81.66	48.02	CopyNumber	19p13.3	3204
	406590	80.43	0.000	116.59	54.77	0.111	3669.45	26.79
	406620	105.57	0.000	937.84	74.78	0.000			CopyNumber	6p21.31	1319
	406683	397.62	0.036	101.26	87.65	0.111	4567.96	36.31	CopyNumber	19p13.3	3198
	406799	62.82	0.036	34.19	47.08	0.222	624.11	32.91
	406840	63.67	0.071	35.33	63.00	0.222	417.25	27.92
	407368	85.75	0.000	208.80	51.34	0.000	189.03	26.77
	407580	55.41	0.071	40.52	91.55	0.111	136.75	49.37
	407995	102.74	0.000	792.47	129.50	0.000	1327.53	53.18
	408018	73.73	0.000	1638.52	53.51	0.000	1595.26	49.48
	408073	101.78	0.000	1040.65	78.37	0.000	5022.25	35.22
	408236	178.08	0.036	191.09	140.73	0.111	166.92	28.73
	408257	73.75	0.000	176.37	73.95	0.000	346.00	33.39
	408293	79.96	0.071	55.21	76.68	0.222
	408324	79.03	0.000	70.97	91.67	0.222	261.14	38.52
	408428	57.10	0.000	54.54	56.13	0.111
	408581	168.89	0.000	47.66	93.70	0.111	22.32	70.59	CopyNumber	10p11.23	2079
	408909	55.91	0.000	107.48	55.68	0.000	462.90	38.03	CopyNumber	5p13.3	1105
	409140	68.36	0.000	146.00	65.13	0.111	1015.79	34.02
	409223	88.98	0.000	109.75	63.00	0.111	1498.41	63.96
	409230	77.08	0.000	45.77	60.03	0.222	358.93	29.50	CopyNumber	6p21.32	1314
	409834	82.56	0.000	145.39	69.35	0.000	1395.23	31.06	CopyNumber	9q34.3	2030
	410197	63.50	0.071	28.39	50.29	0.111	193.36	31.09
	410596	66.47	0.071	34.69	51.96	0.111	972.56	29.87
	410817	89.11	0.000	967.12	38.98	0.000	4919.57	40.81	CopyNumber	16q24.3	2972
	411480	73.79	0.000	66.40	53.89	0.222	180.20	28.59	CopyNumber	2p13.1	356
	411641	133.02	0.000	73.09	72.11	0.111	141.55	88.01
	411847	71.19	0.036	79.52	59.04	0.000	277.48	39.90
	412103	67.52	0.036	35.32	74.96	0.111	239.50	42.79	CopyNumber	13q12.11	2541
	412117	79.30	0.036	72.03	73.91	0.111	106.69	32.88
	412196	75.22	0.071	30.98	71.64	0.222	199.00	43.49
	412433	63.22	0.036	78.22	90.02	0.111	272.65	29.98	CopyNumber	11q13.1-	2278
										11q13.2
	412468	119.89	0.036	65.27	91.38	0.111	141.12	32.72
	412842	70.86	0.071	69.10	79.95	0.111	232.58	28.04
	413036	70.20	0.071	69.74	59.75	0.111	243.79	34.29
	413482	80.49	0.036	49.57	57.15	0.111	337.81	43.89
	414579	80.14	0.071	71.27	55.92	0.222
	415342	79.01	0.000	111.61	77.60	0.222	459.69	25.69
	416049	68.55	0.036	43.93	72.18	0.222	197.48	40.51
	416436	70.64	0.000	58.84	53.49	0.000	108.37	40.38	InversionBreakpoint	7q11.23-	1569
									CopyNumber	7q11.22
									CopyNumber
	417004	136.17	0.000	201.17	72.90	0.222	521.74	63.64
	417029	74.72	0.036	99.27	71.29	0.000	200.46	37.83
	418123	202.05	0.036	138.03	241.75	0.222	319.38	64.64	CopyNumber	9q21.33-	1960
										9q22.1
	418175	85.40	0.000	67.13	69.58	0.111	354.32	39.90	CopyNumber	8q24.3	1880
	418233	101.45	0.000	117.46	123.53	0.000	280.39	36.32
	418450	105.88	0.000	56.80	81.39	0.222	159.74	29.02
	418533	61.17	0.036	73.40	66.43	0.222	340.85	38.60
	418668	90.41	0.000	162.79	95.51	0.111	100.95	36.86	CopyNumber	19p13.3	3198
	419640	82.10	0.071	72.52	61.17	0.111	1390.88	23.87
	420269	205.21	0.036	412.78	162.70	0.222	70.62	57.13
	420272	65.09	0.000	101.26	85.37	0.000	239.55	31.21
	421257	83.68	0.000	1327.95	45.08	0.000	5761.57	31.60
	421509	88.01	0.036	110.18	89.29	0.000	938.99	34.34
	422113	70.57	0.036	55.85	49.24	0.111	252.93	58.42	CopyNumber	10q26.3	2199
	423935	65.96	0.000	87.90	52.75	0.222	148.10	43.63	CopyNumber	6p21.32	1314
	423968	79.75	0.000	113.92	73.70	0.111	461.34	31.00	CopyNumber	7q22.1	1600
	424126	98.54	0.000	300.03	49.27	0.000	154.40	28.34	CopyNumber	15q15.3	2771
	424908	81.21	0.000	64.53	78.90	0.111	265.87	44.69
	425777	80.47	0.036	77.84	85.16	0.111	366.93	47.98	CopyNumber	11q12.1	2261
	426296	64.88	0.071	75.24	62.36	0.111	1457.22	32.65
	426359	87.85	0.000	111.22	63.93	0.222	458.50	41.77
	429052	92.93	0.000	242.82	57.76	0.222	1214.90	32.34
	429353	79.94	0.036	65.42	71.89	0.111	343.74	43.42
	429581	114.95	0.000	135.56	64.30	0.222	1000.39	35.21
	429819	89.35	0.000	44.35	56.24	0.111	112.40	29.86
	429839	70.25	0.036	59.72	96.19	0.000	526.01	27.93	CopyNumber	1p32.3	71
	430425	77.22	0.000	63.83	73.92	0.000	645.48	26.65	CopyNumber	1p36.33	3
	430551	76.02	0.000	71.02	65.06	0.000	221.97	39.09
	430606	54.49	0.000	144.68	41.23	0.111	503.23	31.70
	430657	80.31	0.071	49.61	85.30	0.222	278.49	29.31
	430733	68.85	0.036	62.86	88.39	0.111	19.58	102.83
	431101	80.78	0.036	82.46	93.00	0.111	302.22	42.11
	431367	68.42	0.071	40.76	57.01	0.222	317.45	23.88
	431498	58.31	0.000	50.68	71.27	0.111	215.07	31.63
	431550	68.11	0.000	104.26	94.29	0.222	36.35	49.04	CopyNumber	2q11.2	384
	431668	67.73	0.000	220.78	53.03	0.111	783.69	38.20
	431850	72.50	0.036	34.04	80.31	0.111	12.95	42.74	CopyNumber	22q11.22-	3472
										22q11.21
	431861	75.28	0.036	122.14	101.94	0.222	73.76	32.92
	431926	135.79	0.071	84.76	110.75	0.222	190.15	30.68
	432121	83.85	0.000	184.40	74.24	0.111	42.79	41.58	CopyNumber	19p13.13	3220
	432438	80.60	0.071	52.75	89.48	0.111	211.51	33.45
	432491	76.58	0.036	40.08	63.63	0.222	127.64	31.44
	432690	65.69	0.000	31.94	67.02	0.222	611.10	28.10
	432760	97.72	0.000	118.99	66.08	0.111	276.03	25.41
	432898	79.34	0.000	1010.53	58.63	0.000	4901.72	34.25
	432976	72.23	0.000	73.94	60.54	0.222	75.50	28.05
	433154	96.48	0.071	34.89	56.17	0.222	376.16	26.85
	433201	91.66	0.036	152.71	94.95	0.111	576.21	55.18
	433222	103.15	0.036	189.47	72.45	0.000	1186.75	51.60
	433291	85.16	0.071	76.18	72.63	0.111	114.48	38.12
	433307	77.86	0.071	96.78	92.13	0.000	114.79	35.45
	433343	65.49	0.000	184.42	53.88	0.000	291.09	38.55	CopyNumber	16p13.3	2866
	433345	120.01	0.000	213.51	71.24	0.000	862.00	56.26
	433419	60.89	0.000	500.10	50.66	0.000	1779.46	34.78
	433512	84.34	0.071	85.96	81.88	0.222	1236.34	38.08
	433529	170.20	0.036	2199.40	54.31	0.000	14172.61	40.90	CopyNumber	19q13.33	3277
	433540	69.15	0.000	64.51	73.27	0.000	211.95	23.86
	433573	63.03	0.000	57.01	59.43	0.111	123.88	31.69	CopyNumber	11q13.1	2276
	433615	92.22	0.000	388.92	80.94	0.111	1034.66	46.90	CopyNumber	9q34.3	2030
	433701	71.70	0.000	2139.00	50.10	0.000	7744.18	32.81
	433722	74.06	0.036	27.81	59.03	0.222	141.76	60.11	CopyNumber	8p21.3	1710
	433732	90.12	0.071	85.09	83.28	0.111	103.47	51.61
	433750	73.70	0.000	60.65	76.09	0.222	80.25	36.40	CopyNumber	3q27.1	733
	433759	58.35	0.000	139.75	61.48	0.111	411.26	35.14
	433795	85.23	0.036	87.81	51.85	0.111	404.06	43.69
	433863	66.30	0.000	430.25	65.24	0.000	1139.88	60.50
	433901	72.42	0.000	618.72	88.72	0.000	1212.52	34.44
	433951	77.15	0.000	631.83	67.81	0.111	627.74	38.31	CopyNumber	19p13.3	3198
	434102	72.84	0.000	538.05	84.61	0.000	2487.38	32.06
	434207	74.97	0.071	49.39	68.58	0.222	97.26	42.61	CopyNumber	20p11.23	3342
	434219	137.02	0.036	51.48	60.93	0.222	80.88	28.08
	434401	76.58	0.000	58.22	90.45	0.222	245.63	25.67
	434937	79.45	0.000	143.66	68.38	0.111	736.59	35.97
	434953	126.26	0.000	167.82	113.49	0.111	50.78	49.08
	434980	73.22	0.000	373.57	81.91	0.111	63.94	46.60
	435044	119.14	0.036	65.58	58.30	0.222	171.64	27.03	CopyNumber	22q13.31	3512
	435064	53.57	0.071	27.55	70.25	0.222	213.71	32.00
	435120	91.12	0.036	52.68	89.10	0.222	111.38	57.81
	435136	83.96	0.000	172.33	62.24	0.000	53.09	51.23
	435166	68.02	0.071	73.27	65.77	0.111	310.78	56.86
	435231	128.11	0.071	40.03	61.55	0.000	85.70	26.38	CopyNumber	5p13.3	1105
	435255	62.36	0.071	56.26	62.36	0.222	90.51	30.90
	435326	74.42	0.071	49.09	59.90	0.222	78.17	52.63	CopyNumber	3q26.33	731
	435512	77.87	0.000	34.15	50.88	0.222	190.85	63.23
	435535	73.62	0.071	34.83	91.49	0.000	260.08	66.53
	435610	69.17	0.000	86.37	78.22	0.111	404.43	20.92
	435741	64.08	0.000	87.01	63.94	0.000	98.47	35.51	CopyNumber	16q23.2	2956
	435759	74.67	0.071	52.90	67.87	0.222	332.76	29.01	CopyNumber	2q37.3	516
	435771	67.86	0.036	56.30	74.26	0.111	90.36	28.25
	435841	72.67	0.071	23.60	100.76	0.222	161.24	24.64
	435850	84.40	0.036	105.96	99.27	0.111	267.53	47.21	CopyNumber	8q11.23	1756
	435933	58.96	0.036	57.82	69.98	0.111	211.82	30.44
	435948	62.53	0.036	29.62	71.91	0.222	149.70	30.57
	435952	57.02	0.036	28.36	84.91	0.111	104.05	37.95
	435974	78.61	0.071	68.25	91.00	0.222	218.66	65.62
	436035	91.16	0.000	187.52	75.63	0.000	3174.68	46.99
	436093	78.08	0.000	76.39	64.46	0.111	136.65	33.53
	436204	64.95	0.036	29.22	78.13	0.222	250.23	22.99
	436298	167.91	0.036	265.70	177.92	0.222	42.37	74.64
	436405	77.90	0.036	27.67	56.95	0.222	313.71	26.76
	436437	94.20	0.036	77.60	93.12	0.222	918.38	80.58
	436446	66.68	0.000	99.63	53.06	0.111	309.25	35.80
	436500	72.80	0.036	60.68	75.22	0.222	472.17	25.55	CopyNumber	7p13	1537
	436568	131.69	0.000	1219.01	117.62	0.111	50.53	68.91
	436578	90.18	0.000	113.73	79.39	0.000	140.58	43.95
	436657	178.41	0.000	500.52	138.23	0.111	15.83	89.67
	436687	75.22	0.000	611.23	84.03	0.000	638.97	31.31
	436803	73.05	0.000	85.70	97.89	0.111	316.09	35.27
	437056	103.58	0.036	43.41	77.96	0.222	163.82	26.89
	437060	74.69	0.000	167.53	67.12	0.000	1114.79	54.47
	437110	118.34	0.000	457.69	74.53	0.111
	437178	108.35	0.000	118.41	93.36	0.000	491.49	49.15
	437256	85.27	0.071	27.23	74.49	0.222	133.85	34.04
	437277	113.92	0.036	112.16	68.25	0.222	562.98	51.58	CopyNumber	5q35.3	1271
	437367	80.84	0.036	76.15	76.20	0.111	240.02	54.01
	437388	92.45	0.071	42.31	57.64	0.222	238.37	40.11
	437403	73.99	0.036	83.00	65.86	0.000	913.95	48.77
	437594	63.31	0.000	2995.32	44.60	0.000	3402.65	43.18	CopyNumber	11p15.5	2200
	437638	230.82	0.000	332.76	161.65	0.000	726.60	84.34
	437779	79.94	0.000	162.25	59.57	0.000	1026.73	29.41
	437831	69.32	0.071	42.55	70.99	0.222	349.70	25.46
	438072	75.82	0.071	37.78	63.33	0.111	226.25	39.89
	438219	66.65	0.071	41.29	63.30	0.222	161.95	25.67
	438429	82.19	0.000	2234.04	58.24	0.000	4443.85	41.78
	438678	95.46	0.000	66.45	74.83	0.111	417.69	43.11	CopyNumber	11p15.5	2200
	438720	110.88	0.036	245.01	102.14	0.000	150.74	57.91	CopyNumber	7q22.1	1598
	438970	65.73	0.036	35.85	46.43	0.111	1820.04	33.55
	438974	65.29	0.036	44.97	79.81	0.111			CopyNumber	7q22.1	1603
	439480	63.35	0.036	57.48	70.79	0.111	236.05	33.28
	439481	387.86	0.000	88.09	67.88	0.222	169.24	40.86	CopyNumber	17q22	3047
	439548	61.68	0.071	37.93	64.75	0.222	1054.07	45.16
	439552	95.86	0.071	229.49	79.88	0.111	6558.96	35.24
	439815	64.93	0.036	157.75	73.89	0.000	568.16	45.34
	440382	63.06	0.000	67.84	45.41	0.111	163.60	26.30
	440544	76.58	0.000	183.45	74.43	0.111	120.48	60.51	CopyNumber	1p36.11	46
	440599	545.85	0.000	639.75	338.15	0.000	377.40	37.66
	440604	69.40	0.000	120.21	77.49	0.222	219.86	29.08	CopyNumber	16q22.3	2941
	440899	108.09	0.036	90.62	83.07	0.111	375.62	48.63
	440932	67.69	0.000	103.15	59.03	0.111	1062.06	42.62	CopyNumber	17q25.2	3077
	440960	72.81	0.071	47.81	52.64	0.111	258.65	30.69	CopyNumber	19p13.13	3220
	440961	70.30	0.000	77.69	104.24	0.000	450.65	39.28
	441072	127.50	0.000	185.74	85.71	0.000	731.13	33.84	CopyNumber	11p15.5	2200
	441550	76.06	0.036	56.52	72.10	0.222	236.69	37.99
	442344	88.49	0.071	72.66	94.29	0.000	207.03	63.14	CopyNumber	13q33.3-	2880
										13q34
	442798	54.05	0.036	54.26	57.73	0.222	231.34	26.39
	443134	85.46	0.036	64.44	87.35	0.222	198.90	27.17
	443379	72.92	0.071	67.86	68.96	0.111	224.78	38.54
	443837	77.55	0.071	46.32	62.18	0.222	174.43	34.43	CopyNumber	17q21.32	3031
	443914	58.76	0.000	247.64	46.39	0.000	1457.78	49.68
	444279	61.65	0.000	80.72	51.79	0.111	746.56	26.60
	444356	57.17	0.036	92.25	70.76	0.222	182.95	39.12	CopyNumber	17q25.1	3073
	444468	78.70	0.000	67.26	84.13	0.111	310.40	27.53
	444472	73.19	0.071	54.83	62.43	0.111	195.91	35.50
	444569	110.59	0.000	189.12	138.53	0.000	519.72	46.05
	444673	71.14	0.036	92.42	75.43	0.111	67.52	34.65
	444724	59.51	0.036	21.27	56.05	0.222	81.02	40.08
	444818	72.48	0.071	40.54	62.78	0.111	209.04	23.65
	444931	61.84	0.071	30.56	69.88	0.222	113.86	30.06
	444969	72.90	0.071	59.68	83.21	0.000	136.35	35.35
	444986	81.88	0.071	31.66	59.27	0.222	182.02	33.14
	445081	108.71	0.036	70.28	132.55	0.222	544.37	97.39
	445351	153.11	0.000	1533.86	144.30	0.111	39.15	60.06	CopyNumber	22q13.1	3496
	445394	61.72	0.000	60.05	68.24	0.000	1169.19	31.54
	445498	69.47	0.071	37.53	51.18	0.111	126.46	22.30	CopyNumber	14q24.3	2709
	445511	100.89	0.071	43.28	70.81	0.222	220.12	43.86
	445570	85.23	0.000	287.35	53.42	0.000	2381.68	28.41
	445803	90.03	0.000	123.83	68.80	0.111	1202.42	33.85
	445893	61.34	0.036	158.23	69.47	0.000	147.47	27.99
	445977	66.19	0.036	69.10	64.20	0.111	644.29	43.60
	446017	76.51	0.036	155.50	54.07	0.000	397.35	48.34
	446091	71.17	0.036	85.02	65.59	0.111	941.23	28.02	CopyNumber	6q25.3	1460
	446123	64.84	0.000	57.10	56.16	0.222	166.18	39.16
	446149	93.31	0.000	369.45	112.87	0.000	1387.86	59.45	CopyNumber	12p12.1	2390
	446260	71.29	0.000	126.46	62.05	0.111	720.78	37.72
	446336	118.95	0.000	56.90	54.31	0.111	182.90	31.05
	446345	75.64	0.000	2881.93	51.03	0.000
	446414	79.62	0.036	56.65	96.50	0.111	83.57	42.55	Inversion	3q13.12	646
	446427	55.94	0.000	444.92	41.01	0.000	1860.94	22.07	CopyNumber	19p13.3	3199
	446445	117.64	0.000	85.11	64.37	0.111	220.61	30.91
	446450	91.72	0.000	785.60	75.69	0.000	1838.91	35.62
	446574	101.45	0.000	1048.70	47.73	0.111	4295.62	48.23
	446588	74.06	0.000	514.97	50.47	0.000	10114.50	28.56
	446623	59.32	0.000	440.12	53.84	0.000	280.15	39.09
	446628	69.18	0.000	1715.03	60.31	0.000	4069.97	36.87
	446641	74.66	0.000	70.78	78.14	0.000	226.36	28.05
	446852	65.91	0.036	169.80	67.64	0.000	1472.64	39.26	CopyNumber	22q13.1	3486
	447477	59.67	0.036	112.12	53.27	0.222
	447492	70.38	0.000	576.32	85.45	0.111	128.97	28.68
	447547	68.05	0.036	63.65	59.13	0.222
	448226	91.01	0.000	1605.76	74.12	0.000	1888.46	41.47
	448588	89.27	0.000	289.59	98.53	0.222	1421.10	61.15
	448646	106.73	0.000	2172.80	57.81	0.000
	448879	104.70	0.071	169.47	88.62	0.000
	449114	62.43	0.000	277.65	67.95	0.111	25.47	56.84
	449171	78.63	0.000	672.77	37.65	0.000			CopyNumber	9q21.32	1957
	454534	72.76	0.036	51.63	64.52	0.222	87.97	34.37	CopyNumber	19q13.12	3247
	454699	69.32	0.071	522.93	101.80	0.000
	456507	68.08	0.036	50.47	65.93	0.222	358.16	38.22
	456557	65.44	0.036	88.99	75.61	0.222	120.23	30.51	CopyNumber	1p34.1	66
	458320	67.14	0.071	31.00	50.77	0.222	136.02	27.81
	458358	94.79	0.071	58.21	86.21	0.222	256.39	41.07
	458414	135.42	0.036	193.99	95.48	0.222	1264.21	74.29
	458458	96.04	0.000	151.41	91.30	0.000
	458747	58.82	0.036	95.42	71.07	0.222	98.53	30.78
	459106	67.41	0.036	30.94	43.03	0.222	350.68	35.89
	459149	77.24	0.071	63.96	81.98	0.222	208.67	32.53
	459174	64.84	0.071	65.88	81.46	0.111	430.22	38.61
	459211	74.24	0.071	63.93	96.88	0.111	121.40	39.40	CopyNumber	15q25.3	2828
	459596	97.43	0.036	59.17	70.19	0.111	97.92	30.16	CopyNumber	16p13.3	2866
	459649	98.22	0.071	74.77	93.41	0.111	141.86	39.47	CopyNumber	16p13.3	2866
	459927	87.23	0.000	2248.86	63.06	0.000	1030.19	45.59	CopyNumber	2q37.1	507
	459940	87.15	0.000	129.67	70.79	0.222	677.27	59.84
	460238	100.06	0.000	31.15	69.28	0.000	250.78	29.94
	460317	72.75	0.036	35.75	55.10	0.222	115.06	30.41
	460336	67.69	0.071	40.70	46.75	0.000	45.79	44.88
	460468	64.03	0.036	56.42	63.75	0.111	230.88	23.36	CopyNumber	16p11.2	2900
	460499	92.61	0.071	48.97	54.21	0.000	37.47	53.32	CopyNumber	16p11.2	2900
	460574	83.01	0.071	78.45	91.21	0.111	746.92	27.83
	460923	71.51	0.036	28.17	61.28	0.222	152.22	22.68	CopyNumber	16q21	2926
	460929	96.28	0.071	141.87	83.05	0.111	370.86	56.55	CopyNumber	16q21	2926
	460978	73.44	0.036	49.25	81.01	0.222	250.20	31.68
	461047	103.47	0.071	67.54	106.04	0.111	70.12	87.63
	461131	122.98	0.036	127.62	157.34	0.222	76.67	41.61
	461361	78.50	0.036	30.76	40.03	0.222	174.78	41.86	CopyNumber	16q23.1	2944
	461379	83.32	0.000	96.52	91.91	0.111	641.27	33.25
	461722	71.51	0.000	48.48	53.92	0.111	186.99	29.54	CopyNumber	16q24.3	2971
	461777	79.87	0.000	81.52	105.93	0.111
	461896	75.47	0.000	126.02	74.34	0.000	134.80	28.05
	461925	71.77	0.000	103.12	73.82	0.222	147.49	38.95
	462035	62.46	0.000	66.85	67.94	0.111	216.51	26.40	CopyNumber	17p13.2	2983
	462086	56.55	0.036	58.35	72.87	0.111	140.21	27.82	Inversion	17p11.2	2999
	462306	151.24	0.036	384.89	136.76	0.111	93.89	42.37
	462316	52.50	0.036	45.98	51.91	0.000	305.99	31.78
	462492	75.74	0.000	101.26	70.86	0.222	889.15	34.30
	462550	77.59	0.036	37.84	47.17	0.111	481.28	40.17
	462956	121.13	0.071	41.50	83.60	0.111	272.89	75.13
	462998	165.03	0.000	412.00	132.76	0.222	318.32	32.43
	463010	74.65	0.036	48.26	79.91	0.000	297.90	46.77	CopyNumber	17q21.2	3021
	463035	84.60	0.036	88.96	78.41	0.222	29.55	123.40
	463041	60.04	0.000	61.76	105.33	0.111	85.41	37.40	CopyNumber	1p36.23	24
	463059	99.58	0.000	97.24	64.76	0.000	708.36	33.04
	463295	128.90	0.000	22.01	67.66	0.222	89.26	24.02	CopyNumber	17q21.32-	3030
										17q21.31
	463506	144.88	0.036	69.53	99.95	0.000	311.25	41.57	CopyNumber	17q22	3044
	463702	182.82	0.071	17.71	63.68	0.222	71.51	32.11
	463797	86.43	0.071	35.50	77.38	0.222	60.88	56.60
	464071	87.71	0.000	221.39	89.76	0.000	219.07	81.15	CopyNumber	1p36.22	27
	464137	80.94	0.036	49.33	90.69	0.000	60.37	44.17
	464210	106.68	0.000	141.21	95.75	0.111	537.14	49.17
	464336	99.04	0.000	283.74	88.39	0.000	2084.95	55.71	CopyNumber	17q25.3	3087
	464438	107.95	0.036	166.40	112.66	0.000	98.95	38.69
	464472	95.86	0.000	207.88	42.93	0.000	1126.38	32.54
	464595	58.98	0.000	59.05	58.88	0.111	215.87	47.07	CopyNumber	18p11.22	3100
	464652	61.77	0.036	54.95	54.53	0.222	517.28	24.42
	464912	70.39	0.000	76.41	70.71	0.111	213.12	37.13
	465224	72.99	0.036	75.36	57.77	0.222	700.57	30.47
	465374	103.77	0.071	157.39	115.14	0.000	330.15	48.22
	465498	68.69	0.000	88.16	71.12	0.111	400.88	28.38
	465529	122.89	0.036	107.98	78.16	0.111	288.27	45.92	CopyNumber	19p13.3	3198
	465543	63.89	0.071	84.61	58.95	0.111	64.19	57.71
	465627	70.89	0.000	133.95	67.91	0.000	301.85	37.18	CopyNumber	19p13.3	3205
	465645	77.44	0.000	75.74	54.65	0.000	386.74	35.78
	465808	66.58	0.000	143.70	66.22	0.111	434.39	30.19
	465849	69.39	0.000	91.55	80.10	0.111	44.47	66.21
	465924	84.07	0.036	50.18	61.81	0.222	165.00	42.35	CopyNumber	1p36.13	35
	466044	72.79	0.036	84.23	68.24	0.111	73.78	52.32	CopyNumber	19p13.12	3223
	466088	111.92	0.000	181.29	71.15	0.111	179.65	56.72
	466148	84.06	0.000	97.34	76.06	0.111	203.63	72.98
	466471	105.82	0.000	168.18	142.62	0.000	626.83	50.67
	466693	102.86	0.000	67.60	126.08	0.222	176.70	34.39
	466766	118.35	0.036	34.50	83.74	0.222	45.08	45.77
	466775	79.83	0.036	68.63	60.69	0.222	244.72	28.23	CopyNumber	19q13.2	3260
	467084	54.54	0.036	34.59	66.69	0.222	99.92	38.09	CopyNumber	1p36.12	37
	467097	76.10	0.036	128.68	86.64	0.111	397.83	35.85	CopyNumber	19q13.33	3276
	467192	73.99	0.000	138.33	71.24	0.111	315.89	28.78
	467279	53.14	0.000	77.66	63.14	0.111	125.33	61.82	CopyNumber	19q13.42	3287
	467284	110.65	0.036	1280.99	75.58	0.000			CopyNumber	19q13.42	3287
	467408	63.16	0.000	325.76	90.96	0.111	393.32	76.72
	467637	49.68	0.000	192.26	43.69	0.111	218.92	31.71	CopyNumber	1p36.12	39
	467696	92.22	0.000	54.70	92.68	0.111	81.56	46.18
	467701	84.27	0.036	80.50	96.79	0.222	611.36	76.96
	467807	67.35	0.000	271.07	62.85	0.000	1249.38	26.16
	467824	65.40	0.036	37.46	47.95	0.222	425.41	25.22
	467960	55.30	0.071	78.25	53.53	0.222	1591.91	35.68
	468018	78.99	0.000	181.90	57.84	0.111	221.20	50.86
	468415	66.24	0.071	77.48	62.56	0.111	149.98	25.30	CopyNumber	2p21	325
	468442	60.35	0.000	431.37	47.50	0.000	3361.97	24.79
	468760	79.05	0.036	31.54	72.64	0.111	405.11	28.06
	469022	70.82	0.071	71.82	59.11	0.111	223.87	28.02
	469171	71.16	0.071	32.92	79.80	0.222	196.57	24.11
	469331	87.59	0.000	191.43	51.78	0.111	1314.48	35.64	CopyNumber	2q11.2	378
	469820	71.71	0.000	38.70	85.72	0.222	246.69	30.95	CopyNumber	2q14.2	402
	469863	57.98	0.000	457.07	59.63	0.000
	469925	77.87	0.000	361.73	80.70	0.000	456.73	35.81	CopyNumber	2q14.3-	410
	469970	76.12	0.000	60.03	58.11	0.000	250.41	21.69		2q21.1
	470091	62.78	0.000	636.64	72.45	0.000
	470233	104.74	0.071	31.04	74.54	0.111	227.42	28.85
	470417	65.73	0.000	36.16	73.00	0.222	240.63	29.90	CopyNumber	1p35.2-	53
										1p35.1
	470477	78.56	0.000	176.13	76.36	0.000	704.61	35.82	CopyNumber	1p35.2-	53
										1p35.1
	470577	112.63	0.000	64.25	63.02	0.000
	470588	62.13	0.000	49.83	47.08	0.222	38.39	32.85
	470943	79.99	0.036	73.35	126.49	0.222	655.85	58.91
	471011	67.05	0.071	67.25	53.93	0.222	121.32	42.55
	471104	89.45	0.000	149.19	59.04	0.111	602.32	48.56
	471207	63.61	0.071	49.29	54.88	0.222	136.91	52.19
	471441	78.02	0.000	176.65	89.29	0.111	498.87	39.72
	471461	73.53	0.071	32.43	58.01	0.222	196.76	59.72
	471593	53.91	0.071	36.64	49.61	0.222	288.93	31.86
	471768	90.76	0.071	70.68	83.24	0.111	111.27	42.60	CopyNumber	1p34.3	57
	471818	63.33	0.071	35.69	55.32	0.111	1268.99	34.78
	471851	70.38	0.000	115.85	67.87	0.111	499.38	30.04
	471873	109.74	0.071	97.75	113.82	0.111	48.62	53.92
	471933	63.18	0.000	202.14	53.09	0.000	624.43	29.36
	471975	70.45	0.071	36.48	73.24	0.222	242.80	24.13	CopyNumber	20p13	3306
	472010	105.00	0.000	67.84	111.58	0.222	155.71	45.29
	472024	64.21	0.036	69.70	48.63	0.111	1913.94	28.06
	472031	59.04	0.000	211.67	50.43	0.111			CopyNumber	4q24	915
	472038	67.26	0.071	32.17	50.19	0.111	123.01	32.36
	472056	68.89	0.036	112.97	60.49	0.111
	472119	66.76	0.071	31.86	112.28	0.222	139.92	34.83
	472185	78.25	0.000	242.12	90.19	0.000	1069.96	32.56
	472213	95.80	0.071	41.74	48.04	0.111	48.90	42.31
	472330	96.95	0.036	69.76	90.01	0.111	465.49	45.06
	472475	69.13	0.000	78.28	70.30	0.000	139.49	37.18
	472535	99.64	0.071	77.90	44.78	0.222	199.94	32.50	CopyNumber	1p36.33	2
	472558	74.34	0.000	132.04	58.70	0.000	639.31	31.64
	472651	79.84	0.000	36.65	74.11	0.222	314.39	34.69
	472737	61.99	0.071	43.99	48.64	0.222	363.10	33.74	CopyNumber	20q12	3378
	473296	84.70	0.000	63.19	58.70	0.222	168.83	41.41	CopyNumber	20q13.33	3420
	473583	60.46	0.000	514.27	77.95	0.000	1676.15	36.77
	473648	73.17	0.036	64.60	71.35	0.222	102.03	32.42
	473721	128.82	0.000	134.23	123.75	0.111	33.23	53.19
	473761	72.57	0.000	132.69	52.87	0.111	657.85	38.65
	473788	64.69	0.000	111.64	71.83	0.222	157.28	26.24
	474005	61.86	0.000	75.34	61.40	0.111	478.66	79.39
	474010	78.81	0.000	59.76	58.87	0.222	891.19	36.45
	474053	147.51	0.000	499.17	168.59	0.222	29.70	60.90
	474083	72.19	0.036	75.46	78.10	0.111	114.78	33.60
	474213	79.94	0.000	36.27	50.63	0.222	196.39	29.08
	474584	80.62	0.071	112.70	73.66	0.000	162.31	31.89
	474643	74.60	0.000	58.12	75.67	0.222	795.97	39.57	CopyNumber	22q12.3	3485
	474751	97.07	0.000	78.94	84.91	0.222	372.66	35.97	CopyNumber	22q12.3	3492
	474833	89.25	0.036	58.59	72.73	0.111	237.54	48.09
	474914	69.41	0.036	62.09	108.62	0.111	72.32	40.96
	474938	60.89	0.036	23.46	63.42	0.222	59.35	36.45
	474949	73.51	0.036	92.75	72.43	0.111	309.31	39.95
	474982	85.98	0.000	78.19	80.45	0.111	320.54	79.01	CopyNumber	22q13.2	3503
	475125	207.12	0.000	64.68	86.52	0.222	119.70	27.01
	475319	67.49	0.036	43.01	77.46	0.222	62.08	33.32
	475382	139.32	0.036	33.09	54.60	0.222	133.66	23.64
	475392	65.47	0.036	34.18	68.93	0.222	258.78	29.27
	475663	63.62	0.000	53.92	65.40	0.111	432.72	25.21
	475733	81.21	0.036	146.31	89.30	0.222	173.94	39.02
	475812	68.94	0.071	52.89	70.48	0.222	1013.17	36.02
	476018	69.79	0.000	149.54	73.93	0.000	200.35	60.22
	476033	64.70	0.000	34.53	60.01	0.111	864.12	31.66	CopyNumber	1p32.3	71
	476179	79.60	0.000	59.30	85.57	0.111	194.12	38.59	CopyNumber	3p21.31	580
	476221	67.55	0.000	66.80	51.17	0.222	603.05	35.35
	476231	80.66	0.000	113.22	65.22	0.111	228.30	24.27
	476308	72.23	0.000	22.50	50.59	0.222	178.95	107.93	CopyNumber	3p21.1	590
	476365	67.35	0.036	87.65	77.78	0.111	406.18	49.02	CopyNumber	1p32.3	73
	476448	82.54	0.036	26.09	48.03	0.111	273.21	70.63
	476706	89.82	0.000	112.58	110.62	0.222	81.22	37.20
	476930	58.53	0.000	66.80	47.34	0.111	174.86	28.52
	477157	67.07	0.000	152.23	52.84	0.111
	477789	79.84	0.000	117.57	72.54	0.222	721.27	53.90
	477892	78.36	0.036	57.25	57.97	0.222	310.08	37.49
	478000	64.58	0.071	50.48	78.17	0.111	341.67	50.94	CopyNumber	3q25.2	695
	478044	91.75	0.000	243.91	67.91	0.000
	478553	71.73	0.000	280.28	57.47	0.000	1815.88	27.23	CopyNumber	3q27.3	735
	479208	70.67	0.036	49.83	85.49	0.222	273.64	45.06	CopyNumber	4p15.33-	780
										4p15.32
	479264	90.31	0.036	53.68	100.71	0.222	408.08	53.78	CopyNumber	4p15.32	782
	479634	68.03	0.036	41.66	53.90	0.000	172.97	40.28	CopyNumber	4p13	831
	479693	56.38	0.000	130.06	53.34	0.111	284.38	38.70
	479728	83.62	0.000	3178.15	102.50	0.000	4934.56	42.86	CopyNumber	12p13.31	2368
	479747	70.99	0.036	64.38	45.15	0.222	7.50	52.67	Inversion	16q23.1	2943
									CopyNumber
	479814	68.90	0.071	58.18	86.26	0.111	282.68	26.04
	480073	71.32	0.036	300.48	64.32	0.000	630.71	24.05
	480311	89.15	0.036	59.40	90.37	0.222	67.76	39.38
	480465	68.49	0.036	34.96	55.94	0.111	256.72	29.28
	480653	90.52	0.000	190.63	63.63	0.222	682.67	41.50
	481571	70.58	0.000	535.04	63.11	0.000	1077.46	44.16
	481720	79.80	0.036	93.11	81.12	0.222	200.72	60.41
	481898	73.18	0.000	50.50	72.53	0.111	147.39	32.08	CopyNumber	1p22.2	109
	482144	85.86	0.000	471.96	66.50	0.000
	482363	60.86	0.000	36.22	51.54	0.222	233.09	31.51
	482526	63.94	0.000	168.03	60.84	0.000	627.83	38.92
	482868	62.26	0.000	47.36	57.55	0.111	85.83	30.54
	483036	86.03	0.071	34.06	72.88	0.222	186.72	49.93
	483067	195.81	0.000	113.05	119.75	0.222	107.96	48.75
	483305	77.80	0.000	53.80	57.74	0.222	1552.44	38.45	CopyNumber	5q31.1	1221
	483408	59.58	0.000	101.17	58.25	0.222	332.91	23.51
	483454	95.38	0.000	276.29	56.43	0.222	240.02	66.66
	483486	70.29	0.071	53.21	62.00	0.111	273.51	21.50
	484138	135.13	0.071	55.94	56.87	0.222	135.74	33.03	CopyNumber	5q35.1	1257
	484188	89.14	0.071	98.14	90.97	0.111	1025.85	27.84	CopyNumber	5q35.2	1260
	484242	68.78	0.000	36.97	64.48	0.222	152.49	26.36
	484288	72.10	0.000	44.27	51.35	0.222	205.62	31.99
	484363	74.19	0.000	128.94	71.40	0.000	135.92	30.55
	484551	83.81	0.071	35.00	75.65	0.111
	484813	92.28	0.071	140.15	85.01	0.222	357.48	42.75
	485155	104.91	0.000	1053.71	62.95	0.000	233.33	38.86
	485195	72.46	0.036	32.33	115.62	0.222	98.61	44.74
	485246	89.00	0.036	63.99	82.34	0.222	305.16	41.61
	485262	65.94	0.000	121.08	68.51	0.111	1132.47	23.10
	485365	89.21	0.036	50.62	83.69	0.222	24.30	39.23
	485616	118.44	0.036	54.62	126.87	0.222	202.89	41.15
	486542	66.70	0.036	40.95	55.22	0.111	532.52	25.97
	487027	102.66	0.036	172.51	92.92	0.000	456.54	51.77
	487054	83.58	0.000	196.99	81.02	0.111	96.63	33.00	CopyNumber	6q25.3	1460
	487635	90.09	0.036	87.13	86.36	0.111	418.48	59.45
	487774	69.59	0.000	441.11	76.24	0.000	858.14	28.90
	488171	78.74	0.000	1889.50	43.31	0.000	205.88	23.98
	488181	66.18	0.000	72.82	72.57	0.111	150.84	51.09
	488307	118.69	0.000	40.98	83.43	0.222	116.63	31.66
	488478	63.31	0.000	60.31	56.88	0.222	531.39	27.89	CopyNumber	7q11.21-	1563
										7q11.22
	488671	63.52	0.000	66.99	86.38	0.222	146.22	35.88	CopyNumber	7q11.23-	1569
										7q11.22
	489207	229.58	0.036	95.96	93.07	0.000	100.25	84.19	CopyNumber	7q21.3	1596
	489284	174.12	0.000	270.09	108.06	0.111	502.47	67.41	CopyNumber	7q22.1	1597
	489287	72.56	0.000	89.22	87.25	0.111	137.90	40.47	CopyNumber	7q22.1	1597
	489336	73.40	0.036	29.14	50.97	0.222	434.70	40.35
	489615	157.53	0.000	87.65	120.96	0.111	238.13	62.54
	490203	94.98	0.000	149.77	111.35	0.222	71.14	35.48
	490394	80.08	0.036	124.86	65.68	0.000	343.69	34.12
	490415	84.59	0.000	165.38	70.44	0.111	321.85	40.17
	490745	67.85	0.000	174.03	73.05	0.111	107.47	33.33
	490795	84.72	0.036	61.57	91.56	0.222	366.95	44.62
	490874	71.64	0.071	51.50	59.92	0.222	199.27	40.49	CopyNumber	1q22	160
	491336	79.86	0.071	26.67	61.36	0.222	59.45	31.69
	491359	117.62	0.000	444.58	141.63	0.000	144.60	37.95
	491440	84.00	0.000	127.99	68.91	0.111	584.73	41.60
	491494	76.88	0.000	179.06	70.15	0.111	578.57	38.69
	491597	68.90	0.071	78.66	71.01	0.111	47.73	29.91
	491695	61.10	0.036	47.66	66.95	0.111	115.13	36.13	CopyNumber	8q11.21	1744
	491745	79.23	0.036	91.43	97.21	0.222	517.81	34.02	CopyNumber	8q11.23	1756
	491988	80.07	0.036	148.34	53.25	0.000	761.27	37.05
	492236	58.47	0.071	53.23	50.26	0.111	378.81	31.38
	492314	134.13	0.000	280.47	119.64	0.111	867.01	82.56
	492445	79.94	0.071	34.07	68.47	0.222	235.18	33.32
	492599	63.87	0.000	104.23	64.07	0.222	1025.28	42.75
	492805	98.49	0.071	45.41	54.06	0.222	714.35	33.62
	493362	78.53	0.036	36.00	66.40	0.111	1207.36	49.22
	493750	62.06	0.036	19.06	55.52	0.222	369.95	32.38
	494173	148.42	0.000	295.60	110.96	0.111	876.15	113.53
	494419	79.67	0.000	84.24	54.97	0.222	1836.27	27.61
	494457	75.88	0.000	131.41	71.03	0.111	140.35	49.81
	494604	77.33	0.000	102.64	45.34	0.000	1093.70	32.75
	494614	67.07	0.071	131.49	59.76	0.111	271.73	34.09
	494691	100.32	0.000	1473.17	85.74	0.000	1356.61	41.82	CopyNumber	17p13.2	2984
	494700	111.44	0.036	45.03	71.95	0.222	142.65	50.45	CopyNumber	9q31.1	1982
	494985	58.47	0.000	23.54	51.61	0.111	69.32	28.36
	495039	77.88	0.000	53.22	87.48	0.111	241.85	32.88
	495349	51.38	0.000	73.03	68.57	0.000	128.78	41.86
	495471	132.48	0.000	61.04	104.84	0.222	111.31	28.11	CopyNumber	9q34.3	2030
	495605	103.21	0.000	259.83	98.52	0.000	1069.64	37.36	CopyNumber	Xp22.33	3522
	495851	103.41	0.036	155.32	96.68	0.000	133.50	48.69
	495960	75.83	0.071	89.70	72.01	0.222	23.52	45.21
	496068	80.35	0.036	68.03	85.57	0.222	133.18	34.99
	496098	67.73	0.036	47.15	59.31	0.222	174.56	31.62
	496271	89.89	0.071	67.91	73.61	0.222
	496487	88.77	0.000	227.53	59.84	0.111	1039.79	27.70
	496646	74.01	0.071	51.96	94.43	0.222	242.03	33.02
	496684	91.16	0.000	90.84	89.82	0.111	116.47	51.77	CopyNumber	Xq24	3603
	497183	76.76	0.036	93.97	66.65	0.111	259.92	53.23
	497599	111.15	0.036	134.22	94.08	0.111	192.73	115.77
	497692	81.57	0.036	38.61	69.57	0.222	88.50	26.06	CopyNumber	1q32.3	223
	497893	70.25	0.036	80.49	54.75	0.222	85.47	38.00	CopyNumber	1q42.12	234
	498239	85.83	0.071	42.11	68.85	0.222	313.30	70.17
	498313	73.37	0.071	61.83	57.22	0.222	166.23	33.54
	498317	97.53	0.036	34.96	52.65	0.222	241.17	32.40
	498455	60.99	0.071	41.69	52.75	0.222	159.22	29.80
	498548	65.53	0.036	83.74	56.09	0.111	544.75	28.88
	498727	212.50	0.000	375.51	152.25	0.111	393.92	82.64
	499145	63.76	0.036	90.25	49.65	0.000	362.61	30.38	CopyNumber	10p12.1	2075
	499158	77.10	0.036	36.41	89.25	0.111	487.66	24.83	CopyNumber	22q13.1	3496
	499594	68.79	0.000	38.30	61.11	0.111	43.26	67.66	CopyNumber	10q11.23	2097
	499833	65.54	0.036	31.78	67.31	0.111	65.25	48.78
	499891	64.27	0.036	90.85	48.08	0.000	119.21	32.55
	499925	99.08	0.071	47.23	93.94	0.111	425.42	26.54
	499960	53.38	0.036	75.36	58.96	0.111	230.51	30.46
	500067	91.39	0.000	42.67	83.69	0.222	85.13	38.67
	500101	91.91	0.000	122.55	71.82	0.222	523.98	46.28
	500375	72.57	0.000	42.54	60.50	0.111	173.31	57.99
	500409	90.31	0.000	97.98	79.16	0.222	111.85	38.24	CopyNumber	10q23.2	2151
	500546	80.29	0.071	32.37	73.60	0.222	114.50	26.14
	500674	61.65	0.036	100.83	54.64	0.111	101.84	40.78
	500775	56.77	0.000	154.32	52.88	0.111	358.69	18.38
	500842	76.32	0.000	109.14	53.92	0.000	70.07	32.85
	500874	92.56	0.000	190.37	116.30	0.000	302.13	30.53
	501012	80.92	0.036	59.53	67.35	0.222	56.69	51.38
	501023	76.62	0.036	34.17	71.76	0.222	359.89	46.05
	501203	60.32	0.036.	58.65	70.61	0.000	203.01	29.78
	501293	159.72	0.000	331.94	61.09	0.111	257.95	64.96
	501309	91.32	0.000	179.56	76.44	0.000	74.58	38.37	CopyNumber	19p13.3	3198
	501353	76.11	0.000	85.50	67.94	0.111	165.38	38.49	CopyNumber	19p13.3	3199
	501376	74.39	0.000	46.23	52.90	0.222	117.83	30.84	CopyNumber	10q26.2	2190
	501420	72.23	0.071	51.43	76.62	0.222	8.49	69.55
	501629	193.96	0.071	304.65	100.03	0.000	1073.10	56.96
	501684	67.20	0.071	72.15	58.11	0.111	182.45	25.59	CopyNumber	11p15.4	2203
	501735	80.80	0.036	48.77	90.13	0.222	66.88	36.29	CopyNumber	11p15.4	2205
	501853	66.72	0.036	45.46	83.18	0.111	258.40	27.75	CopyNumber	11p15.4	2212
	501924	70.20	0.036	22.66	58.29	0.111			CopyNumber	11p15.3	2216
	501991	74.39	0.071	51.32	69.18	0.222	239.62	40.48
	502302	104.67	0.036	65.09	114.45	0.111	58.12	61.81
	502328	105.65	0.036	192.87	102.65	0.000	277.01	57.86	CopyNumber	11p13	2243
	502461	88.29	0.000	63.08	66.07	0.222	92.47	41.06
	502528	68.66	0.000	135.26	95.87	0.111	414.87	34.37	CopyNumber	11p11.2	2254
	502630	86.54	0.000	188.95	62.55	0.111	974.26	31.28
	502659	83.71	0.000	137.92	78.61	0.000	418.65	40.34	CopyNumber	1p13.2-	141
										1p13.1
	502705	75.99	0.000	63.68	62.88	0.222	200.89	34.78
	502745	116.28	0.000	165.50	152.75	0.111	33.94	90.81
	502769	70.29	0.000	127.45	65.13	0.000	146.88	43.18	CopyNumber	11q12.3	2269
	502773	85.33	0.000	36.02	52.79	0.222	382.36	89.13
	502823	89.25	0.000	97.58	72.37	0.000	1483.75	48.37
	502829	49.99	0.000	140.90	56.82	0.000	377.34	29.68	CopyNumber	11q13.1	2274
	502836	80.42	0.000	108.10	81.32	0.222	186.99	39.86
	502842	98.83	0.071	91.38	63.44	0.111	262.91	27.81
	502872	160.73	0.000	168.69	130.10	0.111	162.72	27.57
	502876	121.94	0.036	240.25	126.64	0.111	1110.19	63.79
	503093	105.81	0.000	272.03	101.56	0.000	1003.83	41.56
	503222	70.44	0.000	78.57	60.15	0.111	436.02	32.33
	503251	75.49	0.036	52.37	80.76	0.000	269.32	30.88	CopyNumber	11q13.4	2286
	503597	72.02	0.036	44.54	65.19	0.222	993.22	28.63
	503709	80.48	0.036	56.09	56.61	0.000	359.18	41.09
	503716	74.54	0.036	67.10	57.41	0.111	401.83	39.72	CopyNumber	11q22.3	2327
	503787	62.10	0.036	88.32	64.96	0.222	94.48	36.57
	504237	84.57	0.071	67.58	73.38	0.111	96.18	41.40
	504517	74.64	0.000	2607.18	71.46	0.000
	504613	89.25	0.000	223.84	85.33	0.111	62.36	60.07
	504620	86.81	0.000	160.25	104.00	0.111	1302.64	32.11
	504687	187.11	0.000	417.49	95.88	0.222	784.44	114.26
	504828	60.20	0.036	35.05	61.58	0.222	272.03	32.15
	504895	88.83	0.000	185.08	83.41	0.000	509.46	28.54
	505033	85.57	0.071	37.32	52.34	0.000	231.87	47.13
	505059	69.53	0.000	146.67	85.08	0.000	401.54	42.58
	505625	85.89	0.036	105.74	98.40	0.111	141.17	35.31
	505652	54.99	0.000	128.09	56.80	0.000	337.62	27.67
	505676	67.86	0.036	90.76	76.70	0.222	152.86	29.88
	505705	81.22	0.000	811.93	36.92	0.000	2225.97	26.97	CopyNumber	12q13.2	2429
	505806	90.69	0.036	62.89	118.65	0.222	193.34	42.44
	505824	125.62	0.071	46.25	72.86	0.111	171.87	30.26	CopyNumber	22q13.31	3505
	506215	79.99	0.000	94.43	66.41	0.000	157.71	28.13
	506325	83.72	0.071	84.67	58.55	0.111	347.25	61.58
	506759	118.14	0.036	94.62	70.61	0.111	37.81	36.31
	506861	78.06	0.000	95.81	90.86	0.000	79.06	33.92
	507074	74.70	0.000	83.96	62.86	0.222	432.06	61.29
	507162	98.40	0.000	29.80	68.25	0.111	92.08	59.64
	507584	68.17	0.000	150.24	63.80	0.000	369.22	38.69
	507680	54.78	0.036	49.68	77.53	0.222	203.53	42.58
	507910	69.11	0.000	69.36	64.58	0.111	88.32	41.59
	507916	97.27	0.036	192.99	102.63	0.000	52.82	43.91
	508010	93.45	0.036	32.99	90.85	0.222	166.37	35.28
	508644	68.43	0.036	49.21	55.85	0.222	110.99	40.54
	509163	93.24	0.036	35.34	54.15	0.222	375.23	41.32
	509226	88.83	0.000	236.57	70.64	0.000	179.58	33.62
	509264	71.38	0.000	82.07	77.38	0.000	427.67	35.66
	509414	89.01	0.036	72.77	69.54	0.000	512.55	27.88
	509622	105.94	0.036	112.54	148.47	0.000	237.96	45.40
	509736	72.67	0.000	720.87	60.73	0.111	4674.01	38.38
	509791	66.04	0.036	289.40	66.68	0.000	2482.97	38.50
	509909	66.97	0.036	31.58	63.60	0.222	102.28	29.40
	510087	96.58	0.036	144.88	56.65	0.000
	510328	60.49	0.000	87.51	60.32	0.111	344.12	27.98
	510402	70.87	0.071	74.30	67.71	0.222	332.17	39.17
	511067	63.37	0.071	30.52	92.27	0.222	178.77	26.75
	511138	72.01	0.071	51.32	77.97	0.111	386.10	50.09	CopyNumber	15q15.1	2768
	511149	73.09	0.071	47.43	61.92	0.222	219.59	40.88
	511425	66.07	0.000	306.59	64.17	0.000	766.85	32.72
	511504	156.60	0.036	118.98	198.75	0.222	93.53	41.90
	511862	113.15	0.036	78.27	91.67	0.111
	511952	83.56	0.036	45.39	80.23	0.222	280.77	42.92
	512005	86.15	0.000	177.05	97.71	0.000
	512465	60.22	0.000	101.69	51.11	0.000	1328.32	37.34
	512525	140.21	0.000	564.24	59.56	0.111			CopyNumber	15q25.2	2822
	512607	74.76	0.000	66.75	86.55	0.111	188.34	40.78
	512640	95.97	0.036	87.26	49.87	0.000	353.07	25.39
	512661	114.56	0.036	78.95	73.16	0.111	225.56	27.09
	512676	89.69	0.036	472.46	56.90	0.000	3826.23	33.98
	512693	65.72	0.071	32.21	61.74	0.222	243.81	32.66	CopyNumber	14q11.2	2641
	512756	68.12	0.071	36.00	87.05	0.222	82.76	24.22	CopyNumber	22q11.21	3469
	512815	57.32	0.000	72.82	58.05	0.222	349.78	23.00	CopyNumber	19p13.3	3199
	512857	98.39	0.000	389.64	108.93	0.000	236.30	44.67	CopyNumber	11p15.5	2200
	512867	145.32	0.000	57.53	59.42	0.111	756.60	42.54
	512908	81.46	0.000	139.12	83.26	0.000	529.32	26.51
	513043	79.47	0.036	65.23	53.50	0.222	200.34	26.92
	513055	71.45	0.036	46.53	69.38	0.111	428.66	34.03
	513057	72.89	0.000	108.87	84.74	0.000	172.47	40.79
	513058	89.89	0.000	89.17	120.69	0.111	251.55	55.04
	513071	80.98	0.036	61.02	85.52	0.111	416.01	37.15
	513083	90.78	0.000	747.03	87.03	0.000	13273.59	32.07
	513141	104.92	0.000	106.35	102.92	0.222	68.76	57.99	CopyNumber	15q26.1	2836
	513145	72.65	0.000	82.48	62.05	0.111	690.46	36.42	CopyNumber	15q26.1	2836
	513153	127.64	0.036	57.82	56.98	0.000	112.68	79.81
	513230	68.82	0.036	88.04	62.79	0.111	102.18	30.45	CopyNumber	16p13.3	2866
	513242	76.58	0.036	70.14	78.60	0.000	134.47	29.60	CopyNumber	16p13.3	2866
	513261	83.40	0.036	100.06	63.05	0.000	66.99	49.34	CopyNumber	16p13.3	2866
	513266	88.47	0.000	43.44	51.74	0.222	420.41	37.37	CopyNumber	16p13.3	2866
	513470	74.31	0.071	23.98	100.87	0.222	126.44	34.12	CopyNumber	16p11.2	2900
	513488	126.33	0.071	80.83	109.04	0.111	135.41	35.18
	513490	141.10	0.000	600.22	108.89	0.000	1936.06	50.21	CopyNumber	16p11.2	2903
	513520	74.53	0.036	51.84	63.38	0.222	107.26	38.88
	513522	86.72	0.000	262.60	56.68	0.000	109.64	38.78
	513631	66.09	0.036	43.26	73.49	0.222	231.71	24.36
	513856	69.11	0.000	58.26	78.43	0.111	50.56	33.92
	513984	103.20	0.036	56.92	80.13	0.111	110.00	28.54	Inversion	17p11.2	2999
	514012	104.20	0.000	68.14	88.15	0.222	111.02	33.44
	514036	78.04	0.071	40.32	72.95	0.111	150.39	21.29
	514038	71.06	0.071	98.33	73.54	0.222	282.81	33.39
	514174	127.42	0.036	218.64	117.36	0.111	423.86	101.58
	514196	72.49	0.000	707.66	61.15	0.000	8554.76	27.60	CopyNumber	17q21.31	3024
	514211	139.51	0.036	50.70	81.92	0.222	182.87	97.71
	514216	73.83	0.000	115.83	85.67	0.111	792.84	46.18
	514220	104.37	0.000	175.85	118.04	0.222	722.34	44.39
	514297	72.66	0.036	77.55	75.65	0.222	353.72	26.50	CopyNumber	17q21.32	3034
	514303	86.25	0.000	174.64	95.39	0.222	134.97	51.53	CopyNumber	17q21.33	3035
	514435	68.14	0.036	40.72	84.74	0.222	147.89	37.81	CopyNumber	16q22.1	2937
	514489	80.99	0.071	44.98	74.04	0.000	217.12	36.85
	514535	115.82	0.036	81.79	89.33	0.222	806.22	54.38
	514581	87.86	0.000	2385.84	64.09	0.000	12015.94	27.98	CopyNumber	17q25.3	3086
	514590	79.57	0.000	82.16	60.88	0.111	270.30	30.55
	514819	63.43	0.000	91.91	57.33	0.111	146.77	39.49	CopyNumber	17q12	3015
	514870	75.67	0.036	116.52	66.41	0.111	1076.27	31.74
	514920	70.87	0.036	42.93	92.05	0.222	305.87	26.30	CopyNumber	17q21.32	3034
	514934	64.83	0.000	93.36	57.74	0.222	489.19	36.29	CopyNumber	1p13.2-	141
										1p13.1
	515003	90.52	0.000	73.12	71.02	0.111	244.41	34.43	CopyNumber	19p13.3	3198
	515005	84.23	0.036	84.14	115.67	0.111	111.71	28.21	CopyNumber	19p13.3	3198
	515018	81.16	0.036	38.38	92.19	0.222	975.69	36.28	CopyNumber	17q24.1	3057
	515053	79.56	0.036	327.53	82.45	0.000	130.71	37.38	CopyNumber	19p13.3	3201
	515070	61.50	0.000	1309.96	51.55	0.000	2287.41	36.04
	515092	92.89	0.071	63.55	123.14	0.222	142.44	34.66
	515155	77.95	0.000	107.39	48.32	0.222	1314.81	29.66
	515162	99.70	0.000	174.56	65.50	0.111	738.50	33.21	CopyNumber	19p13.13	3220
	515164	83.59	0.000	81.45	86.75	0.222	111.33	38.03
	515210	159.79	0.000	500.13	127.33	0.111	405.99	51.27
	515255	77.20	0.000	150.61	99.16	0.000	275.62	55.00
	515266	74.02	0.036	54.18	59.54	0.222	129.69	29.52
	515271	69.78	0.071	36.74	77.34	0.111	130.40	32.76
	515329	66.72	0.000	534.24	65.17	0.000	3426.69	32.80	CopyNumber	1p36.31	17
	515371	70.79	0.000	343.10	48.33	0.111	1005.23	29.71
	515406	149.32	0.000	65.79	61.04	0.222	287.02	37.67	CopyNumber	19q13.2	3259
	515417	66.12	0.000	107.98	54.42	0.000	153.02	44.34	CopyNumber	19q13.2	3260
	515432	97.88	0.036	44.58	59.07	0.111	404.46	33.77
	515472	85.54	0.000	277.80	71.92	0.000	1110.26	42.17
	515475	68.85	0.071	36.35	61.24	0.222	28.67	48.11
	515487	274.74	0.000	142.33	104.31	0.111	173.36	32.28
	515494	119.52	0.071	146.78	92.71	0.111	112.41	47.69	CopyNumber	19q13.32	3268
	515500	76.81	0.000	102.79	91.08	0.222
	515515	49.82	0.000	182.19	48.37	0.000	152.89	38.45	CopyNumber	19q13.32	3273
	515517	88.12	0.000	299.84	58.12	0.000	7157.08	36.30
	515524	71.77	0.000	80.95	66.53	0.111	391.51	35.24	CopyNumber	19q13.33	3275
	515540	75.18	0.000	189.06	82.37	0.111	165.22	50.26	CopyNumber	19q13.33	3278
	515550	69.11	0.000	172.43	76.53	0.111	561.99	34.69
	515598	74.86	0.071	38.40	66.79	0.111	138.35	27.47
	515607	65.02	0.036	55.58	56.62	0.111	158.32	52.15	CopyNumber	19q13.42	3288
	515642	65.18	0.000	99.65	61.65	0.000	197.53	45.80
	515785	105.76	0.036	219.93	101.68	0.000	214.35	62.17
	515846	76.72	0.036	69.80	136.41	0.222	151.33	51.40	CopyNumber	19q13.33	3276
	515848	79.47	0.000	50.31	62.08	0.111	672.95	55.07
	515890	80.81	0.036	100.90	82.45	0.111	935.79	30.21	CopyNumber	2p23.2-	300
										2p23.1
	516075	80.99	0.036	54.66	76.57	0.222	157.18	35.84
	516077	82.82	0.071	56.97	75.78	0.000	146.37	36.19
	516087	72.96	0.071	33.52	80.94	0.222	302.28	19.82
	516111	89.42	0.000	51.66	89.35	0.222	183.74	28.09	CopyNumber	2p13.1	356
	516114	76.16	0.071	48.69	52.22	0.111	215.69	73.89	CopyNumber	2p13.1	356
	516157	71.75	0.000	187.71	78.16	0.000	146.38	36.40
	516450	82.86	0.000	54.05	65.03	0.222	129.56	29.36	CopyNumber	2q14.3-	410
										2q21.1
	516522	78.65	0.000	43.56	73.85	0.222	158.20	39.84
	516539	64.18	0.000	157.83	64.03	0.111	335.66	28.98
	516587	75.09	0.036	89.91	71.91	0.111	266.02	25.33
	516633	70.34	0.036	119.71	62.46	0.111	38.49	36.65	CopyNumber	2q32.1	456
	516711	87.42	0.000	50.69	95.23	0.222	148.16	36.16
	516790	76.19	0.071	46.62	74.67	0.222	107.23	36.95
	516807	71.31	0.000	60.83	83.48	0.222	86.90	29.56	CopyNumber	2q37.3	516
	516826	108.19	0.071	35.66	84.03	0.111	151.54	92.04
	516855	76.73	0.000	81.22	90.29	0.111	67.23	34.92
	517080	76.28	0.071	23.53	51.42	0.222	79.83	30.97
	517106	158.42	0.036	155.61	98.37	0.222	1027.69	57.60
	517134	72.40	0.000	77.76	62.28	0.111	210.01	25.80
	517145	114.98	0.036	448.32	88.56	0.000	135.06	29.88
	517168	83.39	0.000	616.48	87.90	0.000	607.75	49.57
	517216	119.03	0.000	135.47	130.41	0.222	76.10	46.15
	517232	73.76	0.071	32.93	49.49	0.111	125.67	43.67
	517240	62.59	0.036	68.91	63.03	0.111	546.02	33.01
	517262	56.95	0.036	106.71	47.20	0.000	453.65	25.51
	517293	86.33	0.000	196.11	66.38	0.111	1344.41	51.31
	517338	80.24	0.000	77.61	75.20	0.111	340.46	41.14
	517342	163.80	0.071	33.97	52.74	0.222	152.42	25.59
	517356	140.28	0.000	114.91	84.11	0.222	170.23	74.30
	517357	55.86	0.000	28.35	52.86	0.111	107.26	33.50	CopyNumber	22q11.21	3463
	517421	80.19	0.000	44.23	77.66	0.222	119.57	29.20	CopyNumber	22q11.21	3467
	517438	78.06	0.036	26.64	70.20	0.222	67.48	48.02
	517517	71.96	0.036	47.98	48.58	0.222	59.52	37.67
	517543	68.12	0.036	74.51	88.10	0.111	83.91	46.35
	517582	97.38	0.071	65.71	77.50	0.222	104.81	77.46
	517622	74.85	0.000	74.01	87.22	0.222	166.60	36.65
	517641	62.07	0.036	22.98	61.04	0.222	296.00	30.89
	517666	82.83	0.036	80.25	64.44	0.222	667.96	39.27	CopyNumber	22q13.2	3504
	517731	91.26	0.000	65.22	73.35	0.000	220.84	43.41
	517768	117.43	0.036	25.76	80.17	0.222	508.84	63.13
	517792	64.90	0.000	96.83	54.04	0.000	859.89	24.77
	517817	69.75	0.071	33.30	51.38	0.111	305.79	29.77
	517821	70.35	0.000	131.04	69.12	0.000	671.35	29.32
	517888	77.52	0.036	95.09	58.38	0.222	103.41	36.07
	517948	68.83	0.036	63.83	84.82	0.222	141.09	23.16	CopyNumber	3p21.31	580
	517949	71.07	0.036	123.55	64.91	0.222	203.81	34.54
	517969	81.54	0.036	84.63	88.21	0.222	142.60	39.43
	517981	78.80	0.000	22.98	50.79	0.222	103.97	29.66	CopyNumber	3p21.31	586
	518060	65.51	0.036	134.03	74.66	0.000	392.29	40.39
	518123	62.29	0.036	95.99	66.38	0.111	474.82	27.22
	518236	84.23	0.036	80.10	61.00	0.000	319.95	36.04
	518244	55.08	0.000	111.32	61.11	0.000	314.23	33.48	CopyNumber	3q21.3	668
	518249	60.78	0.000	175.57	66.17	0.111	786.47	28.84
	518250	62.86	0.036	67.52	62.70	0.111	145.96	34.99
	518265	54.39	0.000	141.98	43.28	0.000	341.22	32.71
	518326	63.93	0.036	210.14	56.18	0.000	903.16	40.84
	518346	76.42	0.000	96.28	40.13	0.111	1384.11	39.61	CopyNumber	3q25.31	703
	518374	194.16	0.000	83.91	105.38	0.111	228.30	73.20	CopyNumber	1q25.2-	186
										1q25.3
	518424	65.39	0.000	65.91	71.07	0.111	472.78	36.48
	518460	86.56	0.000	144.56	61.00	0.111	474.56	36.78	CopyNumber	3q27.1	733
	518464	78.82	0.000	131.96	60.97	0.222	341.49	43.16	CopyNumber	3q27.1	733
	518525	108.66	0.000	559.19	97.79	0.000	1176.03	58.17
	518551	87.47	0.000	989.61	83.61	0.000
	518608	66.98	0.036	53.34	50.94	0.222	233.50	33.35
	518609	135.38	0.000	166.56	130.43	0.111	588.35	32.89
	518750	94.60	0.000	288.21	79.65	0.000	1360.79	25.92
	518805	142.88	0.000	1068.25	127.25	0.000	249.62	81.08
	518827	57.74	0.000	355.52	56.22	0.111	84.24	38.17
	519276	93.94	0.000	113.47	81.01	0.000	230.33	36.58	CopyNumber	1q32.1	213
	519304	60.54	0.036	36.33	87.42	0.222	114.84	33.78
	519346	66.16	0.071	34.53	74.90	0.222	314.36	37.07	CopyNumber	5q12.3	1140
	519347	68.95	0.071	34.71	73.49	0.222	207.52	27.55
	519520	70.03	0.000	741.35	73.96	0.000
	519523	81.66	0.000	55.73	84.24	0.222	3.52	261.11
	519557	79.60	0.000	93.24	91.88	0.111	2662.06	27.88
	519718	67.90	0.036	45.99	67.49	0.000	115.89	35.44
	519756	92.45	0.071	40.69	113.09	0.222	132.53	29.71	CopyNumber	5q35.1	1258
	519818	97.23	0.000	59.90	67.91	0.111	188.05	33.00	CopyNumber	5q35.3	1273
	519909	101.05	0.000	244.91	76.44	0.222	117.68	50.36
	519930	69.33	0.036	121.92	56.23	0.111	110.92	29.41
	520026	87.98	0.000	108.58	87.98	0.222	62.19	41.41
	520028	222.76	0.000	1404.48	164.02	0.000	1040.72	63.83
	520037	63.50	0.071	45.72	74.52	0.222	158.73	56.07
	520070	64.71	0.000	185.65	53.29	0.111	672.92	34.49
	520140	84.60	0.036	75.11	85.11	0.111	74.72	42.98
	520189	97.80	0.036	77.42	57.29	0.222	38.86	41.39
	520205	70.26	0.000	81.96	68.26	0.222	596.12	27.17
	520210	74.37	0.000	122.94	70.34	0.222	538.81	39.96
	520287	65.65	0.071	131.99	67.30	0.111	252.76	37.55
	520313	83.70	0.036	103.31	73.66	0.000	842.14	32.44
	520383	69.15	0.036	54.79	74.80	0.222	51.28	37.61
	520421	121.20	0.071	155.06	87.58	0.111	2195.13	80.88
	520459	84.53	0.000	159.85	66.78	0.111	399.69	40.23	InversionBreakpoint	7q11.23	1572
									CopyNumber
	520623	81.68	0.036	27.31	61.61	0.222	248.55	33.13
	520640	91.02	0.000	1961.29	60.59	0.111	5036.63	31.42	CopyNumber	7p22.1	1487
	520740	85.41	0.000	97.72	112.58	0.111	187.18	70.60
	520794	70.80	0.036	49.78	44.95	0.111	40.24	56.59	CopyNumber	7p13	1537
	520898	110.99	0.000	400.82	102.01	0.000	21.23	57.80
	520943	59.21	0.000	305.60	62.29	0.000	662.42	26.48
	520967	70.34	0.000	252.42	65.79	0.000	120.89	29.85	CopyNumber	7q11.23	1572
	520973	130.49	0.000	298.97	145.41	0.111	1152.33	82.08	CopyNumber	7q11.23	1572
	520974	80.79	0.036	179.20	74.93	0.111	1930.00	33.13	CopyNumber	7q11.23	1572
	521064	70.08	0.071	60.61	80.98	0.111	558.65	43.97
	521151	85.62	0.036	47.47	134.19	0.222	127.30	30.14
	521289	65.97	0.036	64.57	62.31	0.222	236.18	49.64
	521487	69.54	0.000	276.67	67.15	0.000	538.96	41.02
	521640	133.20	0.000	85.15	63.55	0.111	298.27	31.34
	521809	69.55	0.000	72.24	94.32	0.000	125.31	30.12	CopyNumber	9q34.3	2030
	521903	143.71	0.000	176.08	67.76	0.000	27.38	72.01
	521924	82.37	0.036	59.55	73.11	0.111	401.23	45.90
	521969	86.81	0.000	55.63	96.01	0.000	400.95	33.05
	521973	80.96	0.036	39.93	90.53	0.111	142.18	54.69
	522074	162.66	0.071	183.70	145.60	0.000	75.36	43.60
	522110	63.85	0.071	29.44	57.72	0.222	152.37	38.21
	522114	58.16	0.000	93.47	54.91	0.000	909.36	30.72
	522310	102.19	0.036	111.23	114.70	0.111	227.49	72.44
	522373	177.96	0.000	134.50	163.88	0.111	1015.67	83.01
	522394	84.47	0.000	695.64	96.96	0.000	892.36	34.63
	522463	71.14	0.000	4621.60	78.17	0.000
	522507	66.02	0.036	114.54	64.14	0.000	369.13	29.46	CopyNumber	9q34.3	2030
	522584	80.07	0.000	1864.38	65.53	0.000	2817.95	42.35
	522590	65.85	0.000	87.04	74.78	0.111	155.78	39.35
	522632	157.61	0.000	149.26	117.91	0.111	1399.30	82.97
	522665	99.28	0.071	78.39	77.48	0.111	169.43	65.16
	522675	68.02	0.071	35.39	56.96	0.222	89.16	49.55
	522752	63.85	0.036	65.13	87.37	0.111	226.13	30.00
	522817	92.87	0.000	243.72	76.57	0.000	446.45	43.91
	522819	75.66	0.000	128.02	77.03	0.000	442.54	53.56
	522823	65.96	0.000	55.52	55.51	0.111	80.40	39.08	Inversion	Xq28	3631
	522932	74.41	0.071	62.12	87.31	0.222	932.94	35.74	CopyNumber	10q11.23	2097
	522995	72.57	0.000	92.76	85.46	0.222	155.41	29.78
	523004	91.74	0.000	1093.46	104.71	0.000	1020.96	39.57
	523012	151.59	0.036	108.27	101.71	0.111	460.74	105.86
	523054	58.03	0.000	85.81	56.99	0.111	215.84	28.86	CopyNumber	1p36.11	48
	523131	64.37	0.036	54.95	87.13	0.000	176.91	27.06
	523145	77.65	0.000	77.46	74.44	0.000	713.08	34.57
	523215	72.87	0.000	87.19	71.68	0.111	515.77	29.73	CopyNumber	10q24.31	2164
	523238	72.68	0.000	120.04	66.25	0.222	77.37	32.28
	523262	70.08	0.036	131.35	69.97	0.000	1073.88	31.10
	523299	84.00	0.071	94.08	72.86	0.222	94.93	27.98
	523302	73.40	0.036	52.80	58.41	0.111	39.16	33.68
	523560	81.28	0.000	971.82	62.39	0.000
	523680	83.52	0.000	107.04	96.51	0.111	160.42	34.93
	523789	160.56	0.000	399.15	138.88	0.000	126.46	81.17
	523829	93.80	0.036	62.35	75.95	0.111	128.33	63.45
	523836	118.62	0.000	551.15	91.25	0.000	692.25	64.89	CopyNumber	11q13.1-	2278
										11q13.2
	523852	122.32	0.000	140.78	82.29	0.222	223.69	123.19	CopyNumber	11q13.2-	2280
										11q13.3
	523875	85.23	0.036	67.45	82.01	0.222	138.28	32.54
	524009	72.05	0.071	48.51	71.53	0.222	181.41	38.91
	524081	79.74	0.036	25.40	66.56	0.222	131.07	30.87
	524084	71.59	0.000	52.46	63.40	0.222	310.09	30.43
	524161	56.55	0.071	58.04	46.88	0.000	158.34	33.48	CopyNumber	10p13	2062
	524171	65.02	0.036	39.20	45.15	0.222
	524183	99.77	0.036	250.38	82.32	0.111	259.10	66.52	CopyNumber	12p13.33	2363
	524195	77.48	0.036	45.90	110.88	0.222	329.67	54.17
	524214	65.06	0.000	93.97	80.62	0.111	429.42	38.04
	524219	102.77	0.000	1283.75	138.72	0.000	1413.03	41.62
	524271	101.04	0.000	72.07	117.41	0.111	303.87	28.52
	524367	97.52	0.000	23.68	69.12	0.222	212.52	34.89
	524395	160.71	0.071	629.43	152.46	0.111	691.04	113.98
	524464	63.84	0.000	249.77	51.93	0.111	800.60	36.87
	524502	63.30	0.036	38.16	53.21	0.222	35.02	67.39	CopyNumber	12q13.2	2429
	524530	62.04	0.071	58.64	69.36	0.222	119.54	33.29
	524590	62.24	0.071	32.90	59.64	0.222	168.27	24.98	CopyNumber	12q21.1	2454
	524599	101.39	0.036	171.63	88.17	0.111	877.45	45.68
	524690	157.16	0.071	37.45	91.05	0.222	129.11	25.70	CopyNumber	1p34.2	60
	524788	66.86	0.071	46.71	77.38	0.222	152.65	26.13
	524809	81.00	0.071	32.60	68.39	0.222	71.44	35.75
	524899	64.26	0.000	95.67	74.61	0.222	638.70	30.17
	524920	66.48	0.000	61.67	67.69	0.111	789.95	26.29
	524969	65.49	0.000	50.51	61.47	0.222	159.56	35.37
	525134	62.67	0.036	52.40	77.61	0.222	157.75	32.67
	525163	68.79	0.036	118.15	66.40	0.000	209.09	38.04
	525232	89.47	0.036	78.60	84.11	0.000	536.96	31.58
	525238	93.87	0.000	59.16	67.35	0.111	602.44	37.66
	525330	77.23	0.000	183.06	61.77	0.000	381.49	40.05
	525391	59.57	0.036	42.13	65.68	0.222	156.20	32.83	CopyNumber	1p32.3	74
	525527	71.43	0.071	100.14	58.46	0.111	184.06	29.23	CopyNumber	1p36.33-	4
										1p36.32
	525626	70.54	0.036	28.27	80.56	0.222	93.85	33.60	CopyNumber	14q32.33	2747
	525899	90.18	0.000	114.54	61.10	0.222	197.83	28.39
	526464	68.99	0.036	26.13	58.80	0.222	142.58	30.88	CopyNumber	15q24.1	2808
	526521	96.01	0.000	250.88	101.74	0.000	147.15	33.86
	527105	68.10	0.000	371.42	53.26	0.000	445.41	26.61
	527193	66.74	0.000	1409.75	60.87	0.000	54.69	37.93
	527348	68.02	0.071	31.17	107.14	0.111	156.88	41.93
	527412	112.08	0.036	111.78	104.84	0.222	954.00	37.46
	527861	75.05	0.000	174.55	93.72	0.000	778.13	44.76
	527862	77.71	0.000	121.83	69.64	0.222			CopyNumber	16p13.3	2866
	527980	93.19	0.000	140.08	80.91	0.111	72.21	28.28	CopyNumber	15q21.1	2774
	528050	86.07	0.071	39.50	93.86	0.222	153.01	24.84
	528222	71.25	0.000	56.92	67.43	0.222	297.99	38.18
	528300	70.72	0.071	37.21	64.60	0.111	143.10	32.16	CopyNumber	10p15.2-	2038
										10p15.3
	528305	69.32	0.000	323.87	54.84	0.000	1767.97	27.06
	528572	107.18	0.036	40.58	69.71	0.222	121.35	39.94	CopyNumber	8p21.3	1710
	528668	82.67	0.000	640.96	72.93	0.000
	528780	78.91	0.036	95.64	74.72	0.111	545.27	28.60
	528803	63.96	0.000	69.19	61.88	0.222	637.49	39.09	Inversion	16p12.2-	2894
										16p12.1
	529059	86.70	0.000	155.84	79.33	0.000	436.61	43.10	CopyNumber	19p13.2	3216
	529132	101.86	0.000	206.58	89.23	0.000	607.67	37.45
	529244	79.26	0.036	48.81	59.97	0.222	299.18	31.69	CopyNumber	2q12.2	387
	529280	59.84	0.036	42.59	87.27	0.222	122.27	29.28
	529303	118.67	0.000	324.14	115.14	0.111	857.43	38.03
	529369	89.29	0.000	25.26	76.50	0.111	9.01	69.95
	529400	76.13	0.000	40.63	114.07	0.111	32.05	45.08
	529420	107.73	0.000	106.80	48.77	0.000	56.41	37.58
	529591	68.74	0.000	78.81	61.99	0.111	467.29	39.56
	529618	87.09	0.036	82.62	91.59	0.111	36.01	56.84	CopyNumber	3q29	753
									Inversion
									CopyNumber
	529631	74.72	0.000	620.31	56.60	0.000	176.79	30.79	CopyNumber	3q29	755
	529782	58.53	0.000	130.67	66.49	0.000	146.41	27.77
	529798	75.07	0.000	328.92	49.58	0.000	1755.52	30.60
	529862	62.81	0.000	117.16	56.20	0.222
	529890	63.76	0.000	331.32	41.79	0.000	3988.58	27.20	CopyNumber	5q35.3	1270
	529892	108.94	0.036	139.13	107.43	0.222			CopyNumber	5q35.3	1271
	529957	57.49	0.036	71.45	52.24	0.000	242.41	35.55
	530096	68.28	0.000	137.92	57.16	0.111	422.18	29.43
	530118	65.41	0.000	57.21	50.39	0.111	386.79	22.90
	530291	94.65	0.000	62.14	78.23	0.000	77.23	37.30
	530314	113.91	0.000	72.35	69.84	0.111	135.51	32.51	CopyNumber	9q34.3	2030
	530331	79.95	0.071	96.65	72.31	0.111	393.16	48.43
	530381	84.23	0.000	44.92	94.49	0.111	740.81	47.85
	530412	108.42	0.000	884.31	121.35	0.000	755.69	25.73
	530436	68.51	0.036	39.15	65.12	0.000	89.36	36.15
	530479	68.09	0.071	50.16	67.87	0.222	130.74	30.76
	530687	76.35	0.000	123.16	101.20	0.111	388.74	29.72	CopyNumber	11p15.5	2200
	530734	78.25	0.036	43.82	67.00	0.222	203.80	36.73
	530753	64.89	0.000	122.19	58.43	0.111	1049.37	27.21
	530823	71.41	0.036	34.72	46.24	0.111	219.78	24.63
	530862	76.97	0.071	24.06	57.79	0.111	216.03	27.91	CopyNumber	12q13.12	2421
	531081	144.33	0.000	188.82	111.97	0.111	1778.83	73.47
	531089	64.92	0.000	58.25	72.81	0.222	240.62	40.78
	531176	69.91	0.036	192.02	57.22	0.111	407.01	25.65
	531330	73.90	0.000	113.07	68.46	0.111	834.17	46.89	CopyNumber	9p24.3	1883
	531614	75.55	0.071	84.93	89.38	0.111	260.94	66.65
	531752	65.88	0.071	46.35	66.00	0.000	53.66	35.52
	531856	113.19	0.000	567.60	102.77	0.000	10.32	101.76
	531876	75.41	0.036	87.48	59.71	0.222	539.73	29.29
	531879	73.81	0.071	33.40	53.04	0.111	88.51	36.03
	532359	71.75	0.000	899.39	67.01	0.000	3112.89	40.25
	532399	60.44	0.071	53.30	56.19	0.111	556.41	25.27
	532755	59.70	0.071	35.53	57.88	0.222	174.78	35.47
	532790	82.55	0.000	83.21	52.24	0.222	153.66	31.53
	532793	105.70	0.036	160.69	81.87	0.111	299.76	37.08	CopyNumber	17q21.32	3031
	532803	110.79	0.000	194.85	85.55	0.111	251.26	89.23
	532826	124.52	0.036	436.04	83.52	0.000	55.92	39.14
	532853	75.00	0.000	86.71	66.43	0.111	104.95	47.87
	533030	90.84	0.036	91.99	90.93	0.111	235.53	30.97	CopyNumber	22q13.1	3496
	533059	100.23	0.000	432.63	104.06	0.111	952.40	34.46	CopyNumber	6p21.33	1312
	533122	60.64	0.071	124.04	67.72	0.000	610.09	26.23
	533136	71.52	0.000	67.48	58.25	0.111	202.24	47.72	CopyNumber	4p16.2	761
	533192	67.13	0.036	119.13	68.06	0.000	390.25	37.80
	533222	60.55	0.071	36.87	44.13	0.111	164.72	28.30	CopyNumber	5q12.1	1137
	533245	65.70	0.036	46.71	63.31	0.111	179.53	24.31	CopyNumber	5q31.1	1222
	533282	56.67	0.000	183.69	77.18	0.000	1100.81	25.29
	533308	68.45	0.036	48.77	64.22	0.222	202.26	24.39
	533317	143.97	0.000	745.87	104.93	0.111	2393.96	70.88
	533437	71.07	0.036	132.40	64.32	0.222
	533440	143.68	0.036	45.51	61.68	0.222	235.54	58.67
	533474	59.55	0.036	53.89	75.77	0.111	128.82	31.21
	533479	69.59	0.036	96.22	76.98	0.111	86.44	31.09
	533526	71.06	0.000	49.86	57.89	0.111	218.93	31.26
	533624	70.85	0.000	959.57	58.54	0.000	1867.45	27.19
	533712	65.23	0.036	55.59	73.88		259.05
	533732	65.50	0.000	204.31	50.13	0.000	1297.83	21.87
	533771	93.54	0.000	50.24	77.32	0.222	1094.17	25.43	CopyNumber	16p13.3	2866
	533782	221.65	0.036	544.77	104.33	0.222	29.71	50.29
	533977	109.58	0.071	160.18	105.13	0.111	1758.85	51.28	CopyNumber	1q21.1	147
	533985	197.67	0.036	55.92	64.84	0.111	188.23	31.85
	533986	68.64	0.036	24.58	130.07	0.222	179.95	28.58
	534125	142.62	0.000	832.59	105.81	0.111	4813.26	38.31	CopyNumber	6p21.33	1313
	534168	75.97	0.036	323.99	55.72	0.000	1011.41	45.93	CopyNumber	Xq24	3602
	534212	77.33	0.000	43.32	66.35	0.222	99.62	33.06	CopyNumber	1q21.1	147
	534255	96.87	0.000	2910.69	103.61	0.000	4736.90	32.54	CopyNumber	15q21.1	2773
	534307	90.48	0.036	47.43	99.71
	534314	85.64	0.000	902.22	82.80	0.000	123.06	45.02
	534326	91.25	0.000	113.47	96.69	0.111	398.89	46.54
	534338	66.09	0.036	78.26	71.00	0.222	158.13	58.47	CopyNumber	16p11.2	2903
	534346	77.56	0.000	650.12	74.11	0.000
	534350	71.06	0.071	29.73	56.39	0.222	141.64	41.82
	534453	90.65	0.000	296.51	95.48	0.000	624.74	38.70
	534456	130.28	0.000	192.47	72.01	0.000	88.66	32.89	CopyNumber	17q25.3	3087
	534457	62.64	0.071	61.53	74.61	0.000	730.32	25.54
	534473	63.86	0.071	93.62	63.87	0.222	453.91	46.23
	534483	56.84	0.071	41.04	62.68	0.222	271.95	33.02
	536275	69.43	0.071	36.99	76.62	0.222	305.46	30.60
	541269	79.15	0.000	244.71	86.94	0.000
	546248	137.05	0.036	819.47	122.30	0.000	277.158	66.77
	546250	75.46	0.000	135.33	72.35	0.000	457.00	31.62
	546253	79.22	0.036	154.37	88.05	0.222	80.29	33.55
	546261	89.83	0.036	496.55	65.24	0.000	6040.82	27.54
	546269	75.45	0.000	1517.81	42.29	0.000	14429.75	31.95
	546271	65.78	0.000	386.41	50.39	0.000	1283.29	34.90
	546286	89.05	0.000	1172.72	54.31	0.000	4362.29	39.28
	546289	108.77	0.000	1051.06	67.54	0.000	4831.90	38.49
	546290	94.06	0.000	2012.36	62.38	0.000	6697.93	38.63
	546291	84.07	0.000	142.03	61.95	0.000	5073.35	34.62	CopyNumber	12p13.33-	2364
										12p13.32
	546339	64.42	0.000	67.76	55.24	0.111	535.27	24.30
	546356	59.11	0.000	4388.69	51.21	0.000	6301.04	40.02	CopyNumber	19q13.33	3277
	546394	111.80	0.000	185.13	58.61	0.000
	547759	63.46	0.071	48.56	84.67	0.000
	549178	82.90	0.000	82.93	55.18	0.111			CopyNumber	9q34.3	2030
	552590	70.08	0.036	25.28	65.81	0.222			CopyNumber	22q11.21	3466
	553496	72.62	0.071	41.08	79.89	0.222	43.50	72.79
	553512	113.45	0.000	44.13	95.01	0.111
	554767	64.47	0.071	35.90	65.85	0.222
	554776	84.70	0.071	46.58	100.28	0.222			Inversion	17p11.2	2999
	554894	87.26	0.071	45.88	73.07	0.222			CopyNumber	2p13.1	356
	554896	89.43	0.000	112.49	60.07	0.000	291.19	31.70	CopyNumber	7p22.3	1481
	555194	75.14	0.036	108.54	77.43	0.222
	555866	100.49	0.000	206.53	89.92	0.000	185.01	47.68
	555873	116.51	0.000	174.85	100.43	0.111
	555875	78.46	0.036	17.73	91.10	0.222
	555889	61.77	0.036	59.41	70.56	0.222
	555890	64.41	0.000	151.98	72.68	0.111			CopyNumber	1p35.1	54
	555911	83.61	0.000	120.74	64.55	0.000	182.74	32.39	CopyNumber	1q21.1	147
	555969	85.57	0.036	27.90	60.28	0.222	187.95	28.62
	555971	102.99	0.071	43.43	70.29	0.000
	555973	61.02	0.071	25.39	54.32	0.222	365.86	37.66	CopyNumber	3p24.3	538
	555994	67.15	0.071	17.47	70.28	0.222	113.88	43.85	CopyNumber	16q12.1	2912
	556267	68.11	0.036	37.29	76.22	0.222
	556461	109.80	0.000	89.26	94.15	0.111
	556795	113.17	0.071	222.20	105.92	0.111
	557550	90.20	0.000	781.42	91.24	0.000	2030.99	30.63
	558296	65.84	0.000	71.76	64.47	0.222	293.40	20.63	CopyNumber	2p25.3	261
	558313	83.46	0.000	103.84	61.28	0.111
	558322	81.02	0.000	781.10	60.08	0.000
	558325	58.04	0.071	105.00	59.17	0.000
	558328	175.31	0.071	41.72	74.68	0.222	724.52	77.69	CopyNumber	6p21.31	1321
	558330	119.70	0.000	1306.25	81.82	0.000			CopyNumber	19q13.33	3275
	558338	94.69	0.000	392.75	84.14	0.111
	558345	68.96	0.036	47.70	48.55	0.222
	558354	85.28	0.000	3392.33	80.75	0.000
	558360	85.52	0.000	198.33	51.08	0.111
	558361	86.68	0.000	276.67	71.79	0.111
	558362	74.08	0.036	45.59	64.87	0.222	229.35	49.45
	558376	55.75	0.000	528.10	45.88	0.000
	558381	127.10	0.000	52.20	90.63	0.000
	558382	62.95	0.036	245.75	66.13	0.111
	558383	92.57	0.000	850.60	69.48	0.111
	558384	70.50	0.000	972.23	66.45	0.000			CopyNumber	17q12	3020
	558385	76.67	0.000	522.14	55.82	0.111
	558386	70.79	0.000	1008.37	63.71	0.000
	558388	76.32	0.000	1561.96	59.50	0.000
	558389	86.31	0.000	2526.25	46.00	0.000
	558390	76.07	0.000	653.91	60.77	0.000
	558391	71.38	0.000	1018.49	62.26	0.000
	558396	101.60	0.071	177.30	89.88	0.222	187.47	100.01
	558424	92.40	0.000	144.32	74.76	0.000
	558426	67.09	0.036	90.90	62.22	0.111
	558429	78.14	0.036	73.01	72.78	0.111			CopyNumber	7q22.1	1597
	558431	100.68	0.000	155.33	60.37	0.000
	558442	63.18	0.000	51.45	69.20	0.000
	558448	67.59	0.000	46.04	58.56	0.111
	558453	82.84	0.000	530.26	57.92	0.000
	558454	75.98	0.000	112.20	87.34	0.111			CopyNumber	1p36.11	49
	558458	67.67	0.071	35.79	63.61	0.111
	558473	70.64	0.000	40.37	55.42	0.222	104.21	36.46	CopyNumber	18q12.2	3132
	558499	78.66	0.071	43.18	52.43	0.222	69.81	63.34	CopyNumber	19p13.2	3210
	558511	54.61	0.000	46.40	50.18	0.222
	558521	78.28	0.000	61.92	65.33	0.111
	558591	68.02	0.071	85.80	56.76	0.111	687.61	32.03
	558825	107.55	0.000	42.12	72.58	0.000			CopyNumber	1q21.1	147
	558995	53.36	0.000	186.71	64.24	0.111
	567260	63.25	0.036	44.20	70.83	0.222	14.03	385.13	CopyNumber	16p11.2	2903
	567263	62.05	0.000	93.74	61.88	0.222	27.38	49.92
	567267	57.55	0.036	44.12	65.62	0.000	26.18	56.35
	567279	65.02	0.036	43.97	59.48	0.111			CopyNumber	17q25.1	3074
	Mean: mean gene expression level,
	CV: coefficient of variation,
	0's P: 0's proportion
	indicates data missing or illegible when filed

Example 3: Identification of ERG

Among the candidate ERGs, reference genes were further identified according to the following process.

First. CVs were calculated for each UniGene cluster in the datasets including EST, ShortSAGE, LongSAGE and microarray (Affymetrix HG-U133, CA), and genes were preferentially ranked in ascending order of CV. Out of the 400 genes (approx. 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs were found to be common to all four datasets (Table 3). The 13 ERGs were identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

The gene ontology thereof was determined from a Gene Ontology site (http://www.geneontology.org).

Most of the identified genes (ZNF207. OAZ1. CTBP1. PAPOLA, and FBXW2) were involved in basic cellular physiological processes, particularly in cellular metabolic processes. TRIM27 and CUL1 are genes responsible for cell proliferation. OAZ1 showed the lowest CV in both ShortSAGE and LongSAGE. CTBP1 and ZNF207 were the most stable genes in CGAP and Microarray, respectively. OAZ1, which is involved in polyamine biosynthesis, showed the highest expression across all four datasets, with relatively low CV in all datasets except for the EST dataset.

Experimental Example 4: Correlation Analysis of Reference Gene Between Dataset

Pearson and Spearman's rank correlation analyses were performed on the ERGs identified according to the present invention in a manner similar to that of Experimental Example 2 to compare the four datasets in terms of gene expression and CV.

Significant correlations between expression values were observed within some of the datasets, whereas no significant correlations of CV between any of the datasets were observed.

Although the Superman correlation between EST-microarray (0.374, P=0.206) and ShortSAGE-Microarray (0.511, P=0.076) was not significant, the gene expression of the 13 ERGs showed a significant Pearson correlation (p<0.01). No significant correlation in CV was found between the datasets (P>0.05). With the respective transcripts thereof found in all tissues in both ShortSAGE and LongSAGE, CDC42 and MYL6 were most stably expressed among the ERGs. HBP1 and PSMC1 showed the lowest CV in EST and Microarray.

Experimental Example 5: Comparison Between Novel Reference Gene and Traditional Reference Gene in Gene Expression Datasets

The 13 endogenous reference genes identified according to the present invention were compared with 13 traditional reference genes (Table 4) in terms of gene expression level and CV.

As a result, the six traditional endogenous reference genes. RPLP0, ACTB. PPIA. GAPD. PGK1 and B2M, showed high expression levels, while the other genes, GUSB, HPRT1, TBP, TFRC, ALAS1, H6PD and HMBS, exhibited relatively low expression levels, in all four datasets (FIG. 6). These results are in line with those of the previous repot, in which potential endogenous expression genes were analyzed for mRNA level using qRT-PCR (Radonic A et al., Biochem Biophys Res Commun. 313(4), 856-862, 2004). The expression levels of the endogenous reference genes identified according to the present invention were similar to or slightly higher than those of the low-abundance group of the traditional endogenous reference gems.

In addition, all of the endogenous reference genes identified according to the present invention, except for a few, showed lower CV values than traditional reference genes (FIG. 7). In other words, the endogenous reference genes of the present invention are generally low in expression variation across a wide range of tissues, indicating that the identified reference genes according to the present invention m more stably expressed than traditional endogenous reference genes.

TABLE 3
ERGs identified from four datasets
UniGene	EST	SHORT SAGE	LONG SAGE
cluster	Symbol	Gene Title	Mean	CV	0's P	Mean	CV	0's P	Mean	CV	0's P
Hs446427	GAZ1	decarboxylate	673.62	62.31	0.069	376.38	53.94	0	444.92	41.91	0
		antizyme 1
Hs95	UBQINI	1	111.34	60.19	0.31	25.93	61.3	0.035	71.27	44.75	0.111
Hs444279	GPBP1	GC-rich	132.95	56.92	0.241	63.11	61.65	0	60.72	51.79	0.111
		binding protein 1
Hs202597	CTEF1	C-terminal binding	236.74	48.53	0.338	213.99	82.01	0	112.96	50.6	0
		protein 1
Hs251726	PAPOLA	Poly(A) polymerase	216.13	65.36	0.171	110.14	32.02	0	29.5	30.83	0
		alpha
Hs230909	ARL2B	ADP  factor	132.27	35.79	0.379	124.21	61.55	0	59.49	55.14	0.111
		like 2B
Hs241455	SPG11	Spastic   21	120.33	39.44	0.31	36.41	57.83	0.636	73.3	49.12	0
		(autosomal receive
		Meat syndrome)
Hs530214	LUC7L2	LUC7-like 2 (S. cerevisiae)	131.76	39.55	0.172	74.65	65.41	0	57.21	59.39	0.111
Hs560773	ZNF267	Zinc finger protein 201	233.29	62.27	0.034	165.65	56.72	0	154.32	52.88	0.111
Hs333222	DB	DNA dimethyl	129.17	69.34	0.379	42.11	60.55	0.071	36.87	44.13	0.111
		(transferase 1-like S. cerevisiae)
Hs440322	TRI427	Tripartile	155.231	68.54	0.172	59.65	63.06	0	67.84	45.41	0.111
		containing 27
Hs146866	CEL1	Culin1	126.27	37.3	0.205	69.33	65.76	0.036	76.43	55	0.111
Hs494985		and WD-40	97.45	62.65	0.379	46.27	56.47	0	23.34	53.61	0.111
		domain protein 1
	UniGene	Affymetrix	Gene Ontology
	cluster	Mean	CV	Biological Process	Molecular Function
	Hs446427	1360.0	22.07	Poly	decarboxylase
					initiator activity
	Hs95	919.32	26.21
	Hs444279	746.56	26.6
	Hs202597	481.81	24.72	Negative regulation of cell	Protein C4
				proliferation Protein	binding Transcription
				phosphorylation	factor binding
				replication
	Hs251726	431.23	27.65	mRNA poly	RNA binding
	Hs230909	416.24	26.51		α-tubulin binding
					β-tubulin binding GDP
					binding GTP binding
					GTPase activity
	Hs241455	415.04	29.35	Antigen receptor-	CD  binding
				signalling pathway
	Hs530214	326.79	22.9
	Hs560773	358.69	18.38	Regulation of transcription	Transcription factor
				DNA-dependent	activity zinc ion binding
	Hs333222	161.22	28.3
	Hs440322	163.6	26.3	Cell proliferation	Metal ion binding
					Transmembrane receptor
					protein tyrosine kinase
					activity
	Hs146866	156.47	27.78	Cell cycle	Domain binding
				cell
				cycle Induction of
				apo  intracellular
				Negative
				regulation of cell
				proliferation
	Hs494985	69.32	28.36		Protein binding ubiquintin
					con  enzyme
					activity, ubiquitin protein
					lipase activity
	Mean: Mean gene expression level,
	CV: Coefficient of variation,
	0's P: 0's proportion
	indicates data missing or illegible when filed

TABLE 4
Traditional ERGs used in present invention
UniGene	EST	SHORT SAGE
cluster	Symbol	Gene Title	Mean	CV	0's P	Mean	CV	0's P
Hs.448226	RPIP0	Riboclinical protein, large,	3,809.2	75.92	0	1,108.65	91.01	0
		P0
Hs.520640	ACTB	β-actin	4,381.34	95.98	0.034	1,348.49	91.02	0
Hs.356331	PPIA	Peptidylprolyl-isomerase	1,225.7	78.02	0.034	1,646.83	59.53	0
		A (cyclophilin A)
Hs.479728	GAPDH	Glyceraldehyde-3-	7,330.22	80.18	0	3,167.05	83.62	0
		phosphate dehydrogenase
Hs.78771	PGK1	Phosphoglycerate kinase 1	681.19	86.72	0.034	423.67	85.52	0
Hs.534255	B2M	β-2-nucroglobulin	1,303.98	172.16	0	2,594.12	96.87	0
Hs.255230	GUSB	β-Glucurcoidase	116.77	89.37	0.414	40.98	67.81	0.407
Hs.412707	HPRT1	Hypoxanthine	103.48	63.18	0.345	32.51	63.51	0.407
		phosphoriborytransferase 1
Hs.1100	TBP	TATA box binding	71.45	47.75	0.448	31.94	62.8	0.286
		protein
Hs.529618	TFRC	Transferrin recepter	212.76	85.52	0.341	89.51	87.09	0.036
		(p90, CD71)
Hs.82609	HMB8	Hydroxymethylbilane	176.26	105.68	0.172	32.51	76.51	0.214
		synthase
Hs.463511	H6PD	Hexose-6-phosphate	101.9	86.9	0.483	44.65	70.8	0.071
		dehydrogenase (glucose-
		1-dehydrogenase)
Hs.476308	ALAS1	δ-Aminolevulinate	132.82	82.5	0.345	50.43	72.23	0
		synthase 1
	UniGene	LONG SAGE	Affymetrix
	cluster	Mean	CV	0's P	Mean	CV
	Hs.448226	1,605,76	74.12	0	1,888.46	41.47
	Hs.520640	1,961.29	60.59	0.111	5,036.63	31.42
	Hs.356331	1,683.27	56.79	0	5,223.43	28.46
	Hs.479728	3,178.15	102.5	0	4,934.56	42.86
	Hs.78771	445.96	90.9	0	1,179.63	41.05
	Hs.534255	2,910.69	103.61	0	4,736.9	32.54
	Hs.255230	11.42	89.36	0.556	360.37	49.14
	Hs.412707	33.29	49.07	0.222	233.36	40.85
	Hs.1100	17.58	69.22	0.444	25.44	73.23
	Hs.529618	82.62	91.59	0.111	36.01	56.84
	Hs.82609	28.04	43.5	0.444	119.08	33.63
	Hs.463511	25.33	101.45	0.222	25.04	28.85
	Hs.476308	22.6	50.59	0.202	178.95	107.93
	Mean: Mean gene expression level,
	CV: Coefficient of variation,
	0's P: 0's proportion

Experimental Example 6: Gene Copy Number Variations of ERGs

The 13 ERGs identified according to the present invention were examined for gene copy number variation with reference to the Database of Genomic Variants (http//projects.tcag.ca/variation/). Only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found in chromosome regions known to exhibit gene copy number variation (Table 5). In contrast, many (ACTB, GAPDH, PGK1, B2M. TBP. TFRC, ALAS1) of the traditional reference genes were located at such genomic loci (Table 5). These results suggest that almost all of the identified reference genes of the present invention, except for the two genes, can be used as guide genes for the measurement of gene amplification because they might be highly unlikely to show variation in gene copy number.

Experimental Example 7: Validation of Referee Gene

<7-1> Validation of Expression Level of ERG by Quantitative RT-PCR (qRT-PCR)

For use in validating the expression stability of the ERGs identified from the datasets, a total of 108 human samples, including 26 frozen human tissues, 60 formalin-fixed, paraffin embedded (FFPE) human tissues, and 22 human cancer cell lines were obtained (Table 6). The 60 FFPE tissues were composed of 10 breast cancer tissues, 8 normal stomach tissues, 9 stomach cancer tissues, 10 normal ovary tissues, 4 ovarian dropsy tissues, 9 borderline ovarian tumors, and 10 ovarian cancer tissues. Total RNA was isolated from these tissues and cell lines. For frozen human tissues and human cancer cell line samples. RNA which met the requirements of A26/280≥1.80 and rRNA (28S/18S)≥1.0 was used in qRT-PCR. cDNA was synthesized from the RNA using a standard technique and then diluted in distilled water (1:3 cDNA:DW) before qRT-PCR. PCR primers are summarized, together with the Universal Probe Library (UPL) thereof, in Table 7, below.

For use in this qRT-PCR, traditional ERGs were selected on the basis of the use frequency in previous repots and commercially available kits and the CV calculated from the database of the present invention. The 8 ERGs (B2M. ACTB. GAPDH, HMBS. PPIA. HPRT1, TBP and H6PD) that are most widely used can be found in commercially available kits such as Taqman human endogenous control plate (Applied Biosystems) and HKG selection kit (Roche Applied Science. Ohl F et, al., Mal Med 83:1014-24, 2005; Roche Applied Science Technical Note No. LC 15/2005; Applied Biosystems, 2001). Each gene was measured at 530 nm using an PAM-conjugate UPL probe (Roche Applied Science) or a custom-made specific probe (TIB MOLBIOL GmbH, Germany). All PCR was performed in a Lightcycler 2.0 (Roche Applied Science. USA) using standard protocols.

PCR efficiency for each gene was measured using a cDNA serial dilution (Pfaffl M W et al., Nucleic Acids Res 29: e45, 2001) of the stomach cancer cell line MKN74 and calculated with Lightcycler software 4.0 (Roche Applied Science, USA). It was found to fall within a range from 90 to 100% (Table 8).

Also, PCR efficiency for each probe in tissue samples was estimated using a LinRegPCR program (Ramakers C et al., Neurosci Lett 339:62-6, 2003). A Cp value is an average of three measurements for each gene. The same genes from different tissue samples were measured under the same PCR conditions so as to minimize experimental variation. Because it was not measured in any of 4 samples, normal lung, liver, breast and kidney tissues, the Cp value of H6PD was omitted from subsequent calculations. For each experiment that was conducted in triplicate, the Cp values were found to have a CV less than 5%.

Expression levels of 20 genes, except for H6PD, across 48 samples, including frozen human tissues and cancer cell lines, are depicted in FIG. 8. The 13 novel ERGs of the present invention were expressed in all 48 samples, 7 traditional ERGs showed a wide expression range (Cp: 13.52˜29.39) whereas H6PD was not found in some tissues. The 13 ERGs ranged in Cp from 18.90 to 28.79 (FIG. 9). Traditional ERGs can be classified into a high-expression group (median <20 cycles) and a low-expression group (median >23 cycles). B2M. PPIA. GAPDH and ACTB are included in the high-expression group and HPRT1, TBP, and HMBS are found in the low-expression group. All of the novel ERGs of the present invention, except for OAZ1, show expression levels between those of the high-expression group and the low-expression group of the traditional ERGs. ZNF2007 had the highest expression level among the ERGs, followed by UBQLN1 and CUL1. OAZ1 had the lowest expression level.

TABLE 5
Gene copy number variations of traditional ERG and novel ERG
Novel candidate ERGs	Traditional ERGs
Gene	Genomic	Genomic Variation**	Gene	Genomic	Genomic Variation**
Symbol	location*	Variation type	Locus ID	References	symbol	location*	Variation type	Locus ID	References
ZNF207	17q11.2				RPLP0	12q24.23
OAZ1	19p13.3	Copy number	3199	Wong et al (2007)	ACTB	7p22.1	Copy number	1487	Wong et al (2007)
LUC7L2	7q34				PP1A	7p13
CTBP1	4p16.3				GAPDH	12p13.31	Copy number	2368	Redon et al (2006)
TRIM27	6p22.1				PGK1	Xq21.1	Copy number	3567	Iafrate et al (2004)
GPBP1	5q11.2				B2M	15q21.1	Copy number	2773	Redon et al (2006)
UBQLN1	9q21.33				GUSB	7q11.21
ARL8B	3p26.1				HPRT1	Xq26.2
PAPOLA	14q32.2				TBP	6q27	Copy number	1479	Redon et al (2006)
CUL1	7q36.1				TFRC	3q29	Copy number	753	Iafrate et al (2004)
DIMTIL	5q12.1	Copy number	1137	Redon et al (2006)			Copy number		Redon et al (2006)
FBXW2	9q33.2				HMBS	11q23.3
SPG21	15q22.31				H6PD	1p36.22
					ALAS1	3p21.2	Copy number	590	Wong et al (2007)
*Genomic location was searched from Ensembl (http://www.ensembl.org/index:html)
**Genomic variations were searched in the Database of Genomic Variants (http://projects. /variation/Human Genomic Assembly Build 36 (hg18))
indicates data missing or illegible when filed

<7-2 Validation of ERG Using Expression Stability Based on qRT-PCR Data

Gene expression stability was analyzed using geNorm v3.4 software (Vandesompele J et al., Genome Biol 3:RESEARCH034, 2002) and NormFinder software (Andersen C L et al., Cancer Res 64:5245-50, 2004). For geNorm and NormFinder analysis. Cp values were converted into relative expression levels in consideration of the PCR efficiencies of genes shown in Table 8 (GeNorm software manual, update on Sep. 6, 2004. //medgen.ugnet.be/˜jvdesomp/genorm/). Relative expression was calculated according to the following Mathematical Formula 4.

Relative Expression=(1+E)^ΔCp  <Mathematical Formula 4>

• • ΔCp=Minimum Cp−Sample Cp;
  • Minimum Cp=lowest Cp value; and
  • E=PCR Efficiency

Correlation between the gone expression stability calculated with the geNorm or NormFinder program (M by geNorm, S by NormFinder) and the CV calculated in each dataset was analyzed with R analysis software (//www.R-project.org).

All of the genes were found to have M values (<0.9) lower than the default limit, 1.5, of geNorm, with high expression stability, as analyzed using the geNorm program (Table 9). Lower M values for mean expression stability mean more stable expression. GPBP1 and CUL1 were observed to show the most stable expression. Among the genes analyzed, B2M is the lowest stable expression gene, with the highest M value of 0.888, followed by ACTB (M=0.843). HMBS (M=0.815) and GAPDH (M=0.793) in descending order of expression instability.

When using the NormFinder program. TBP and PAPOLA were ranked as the top two in terms of expression stability (Table 9). Consistent with the geNorm result, B2M. ACTB, GAPDH. HMBS and HPRT1 were found to be less stable in expression level than the novel ERGs of the present invention. Both programs demonstrated that most of the novel ERGs identified according to the present invention show more stable expression levels than do traditional ERGs. Further, when analyzed for gene expression stability using a LinRegPCR program on the basis of the relative expression calculated with PCR efficiency, most novel ERGs were found to maintain higher expression stability than traditional ERGs.

There is no significant correlation between the M values calculated with geNorm and the CV values in Microarray and LongSAGE (p>0.05), whereas significance was found in correlation between M values and CV values in EST (Pearson correlation coefficient: 0.676, p=0.001) and ShortSAGE (Pearson correlation coefficient 0.659, p=0.002). Likewise, as for the Stability values (S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed higher agreement with CV in EST and ShortSAGE than in Affymetrix (Table 10).

Furthermore, the 13 novel ERGs were analyzed for expression in 60 FFPE samples using qRT-PCR in order to examine the possibility of applying them to the tissues in which high RNA degradation occurs. All of the genes, except for DIMT1L, were found to be expressed in all 60 samples. Cp was observed to range from 18.85 to 33.02 for traditional ERGs and from 23.33 to 31.38 for the novel ERGs (FIG. 9). Because of the lack of amplification in 5 samples. DIMT1L was omitted from subsequent stability analyses. Despite difference in the type of samples used in the experiments, almost all genes, except for several genes, were observed to be expressed in a pattern similar to that observed in the previous 48 samples. These results indicate that the novel ERGs of the present invention can be applied to gene expression in FFPE samples, geNorm and NormFinder analyses demonstrate that most of the novel ERGs are more stably expressed with lower Cp values in FFPE samples, as well as in the 48 samples, than are traditional ERGs (Table

TABLE 6
Human tissues and cancer cell lines used in Real time-PCR
			Normal
	Tissue or		(N)/
			Tumor
No.	cell lines	Type	(T)	Diagnosis	Remarks
1	Adrenal	frozen	N	Normal
	gland	tissue
2	Brain	frozen	N	Normal
		tissue
3	Breast	frozen	N	Normal
		tissue
4	Colon	frozen	N	Normal	Normal tissue
		tissue			adjacent to
					signet ring cell
					carcinoma,
					ascending colon
5	Esophagus	frozen	N	Normal
		tissue
6	Kidney	frozen	N	Normal
		tissue
7	Liver	frozen	N	Normal
		tissue
8	Lung	frozen	N	Normal
		tissue
9	Omentum	frozen	N	Normal
		tissue
10	Ovary	frozen	N	Normal
		tissue
11	Placenta	frozen	N	Normal
		tissue
12	Placenta	frozen	N	Normal	Immature
		tissue			placenta with
					focal
					intervillous
					calcification,
					normal two
					umbilical
					arteries
					and one vein,
					and no-evidence
					of
					chorioamnionitis
13	Rectum	frozen	N	Normal
		tissue
14	Salivary	frozen	N	Normal
	gland	tissue
15	Thyroid	frozen	N	Normal
	gland	tissue
16	Tonsil	frozen	N	Normal
		tissue
17	Uterus	frozen	N	Normal
		tissue
18	Vein	frozen	N	Normal
		tissue
19	Vulva	frozen	N	Normal
		tissue
20	Brain	frozen	T	Glioblastoma
		tissue		multiforme
21	Breast	frozen	T	Invasive ductal
		tissue		carcinoma,
				uppe rcentral
22	Transverse	frozen	T	Ulcerofungating
	colon	tissue		carcinoma
				transverse colon,
				Mucinous
				adenocarcinoma
23	Lung	frozen	T	Pleomorphic
		tissue		carcinoma
24	Ovary	frozen	T	Transitional cell
		tissue		carcinoma,
				bilateral ovaries
25	Rectum	frozen	T	Adenocarcinoma,
		tissue		moderately
				differentiated
				with mucin
				production
26	Stomach	frozen	T	Advanced gastric
		tissue		carcinoma,
				Tubular
				adenocarcinoma,
				M/D
27	HL-60	cell lines	T	Leukemia	Blood
28	MDA-	cell lines	T	Breast cancer	Breast
	MB-231
29	C33A	cell lines	T	Cervical cancer	Cervix
30	HeLa	cell lines	T	Cervical cancer	Lung
31	HCC-44	cell lines	T	Lung cancer
32	A549	cell lines	T	Lung cancer
33	Caov3	cell lines	T	Ovarian cancer	Ovary
34	OV-90	cell lines	T	Ovarian cancer
35	OVCAR3	cell lines	T	Ovarian cancer
36	SK-OV3	cell lines	T	Ovarian cancer
37	SNU119	cell lines	T	Ovarian cancer
38	LSW626	cell lines	T	Ovarian cancer
39	AGS	cell lines	T	Gastric cancer	Stomach
40	Kato III	cell lines	T	Gastric cancer
41	MKN1	cell lines	T	Gastric cancer
42	MKN74	cell lines	T	Gastric cancer
43	NCI-N87	cell lines	T	Gastric cancer
44	SNU5	cell lines	T	Gastric cancer
45	SNU16	cell lines	T	Gastric cancer
46	SNU484	cell lines	T	Gastric cancer
47	SNU601	cell lines	T	Gastric cancer
48	SNU638	cell lines	T	Gastric cancer
*: Normal tissue adjacent to signet ring cell carcinoma, ascending colon; and
**: immature placenta with focal intervillous calcifications, normal two umbilical arteries and one vein, and no evidence of chorioamnionitis.

TABLE 7
Primers and Taqman Probes for Real-Time PCR
Gene	UPL	Primers	Product
Names	No.	Sense Primers	Anti-Sense Primers	(bp)
GAPDH	60	SEQ ID NO. 1:	SEQ ID NO. 2:	66
		agccacatgctcagaca	gccaatacgaccaaatcc
ACTB	64	SEQ ID NO. 3:	SEQ ID NO. 4:	97
		ccaaccgcgagaagatga	ccagaggcgtacagggatag
B2M	42	SEQ ID NO. 5:	SEQ ID NO. 6:	86
		ttctggcctggaggctatc	tcaggaaatttgactttccattc
PPIA	#	SEQ ID NO. 7:	SEQ ID NO. 8:	326
		catctgcactgccaagactgag	tgcaatccagctaggcatg
HPRT1	73	SEQ ID NO. 9:	SEQ ID NO. 10:	102
		tgaccttgatttattttgcatacc	cgagcaagacgttcagtcct
HBMS	26	SEQ ID NO. 11:	SEQ ID NO. 12:	92
		tgtggtgggaaccagctc	tgttgaggtttccccgaat
TBP	3	SEQ ID NO. 13:	SEQ ID NO. 14:	60
		gctggcccatagtgatcttt	cttcacacgccaagaaacagt
H6PD	89	SEQ ID NO. 15:	SEQ ID NO. 16:	74
		tggagatcatcatgaaagagacc	gcgaatgacaccgtactcct
ZNF207	27	SEQ ID NO. 17:	SEQ ID NO. 18:	65
		ctgtttcctagcacagcacaa	ggtttgaaatctgtaccaacagg
OAZ1	74	SEQ ID NO. 19:	SEQ ID NO. 20:	67
		caccatgccgctcctaag	gagggagaccctggaactct
LUC7L2	85	SEQ ID NO. 21:	SEQ ID NO. 22:	60
		cgatcacacagcaagaatcc	agatcgatgtctgcgatgc
CTBP1	77	SEQ ID NO. 23:	SEQ ID NO. 24:	86
		actgcgtgaccctgcact	gccccttgtctcatctgc
TRIM27	7	SEQ ID NO. 25:	SEQ ID NO. 26:	71
		caggcacgagctgaactct	agctgctcaaactcccaaac
GPBP1	4	SEQ ID NO. 27:	SEQ ID NO. 28:	75
		tcacttgaggcagaacacaga	agcacatgtttcatcattttcac
UBQLN1	73	SEQ ID NO. 29:	SEQ ID NO. 30:	92
		gaatcctgaccttgctgcac	ttgggagctgttgtctcattt
ARL8B	82	SEQ ID NO. 31:	SEQ ID NO. 32:	66
		aagcatgtgggagcggtat	cgatctgcagcatctatcatgt
PAPOLA	78	SEQ ID NO. 33:	SEQ ID NO. 34:	91
		gctacgaagaccagtccattg	tgttggtcacagatgctgct
CUL1	65	SEQ ID NO. 35:	SEQ ID NO. 36:	86
		gcgaggtcctcactcagc	ttctttctcaattagaatgtcaatgc
DIMT1L	77	SEQ ID NO. 37:	SEQ ID NO. 38:	75
		tccagtgttgtaaggatagaacctaag	Ccttactagaccatcccattcct
FBXW2	3	SEQ ID NO. 39:	SEQ ID NO. 40:	111
		cggctctgcagacttcact	ttgcacttctgcaaaactacct
SPG21	21	SEQ ID NO. 41:	SEQ ID NO. 42:	88
		gatgtctttttccggcagat	cgagatggtcccaataaactg

TABLE 8
PCR Efficiency of Genes
	UPL Probe	PCR Efficiency	PCR Efficiency
Gene Name	Nos.	(Diluted)*	(LinRegPCR)**
GAPDH	60	1.899	1.735 ± 0.048(137)
ACTB	64	2.038	1.491 ± 0.034(137)
B2M	42	1.868	1.717 ± 0.068(140)
PPIA	#	1.877	1.773 ± 0.058(142)
HPRT1	73	1.800	1.771 ± 0.024(143)
HMBS	26	1.954	1.431 ± 0.031(143)
TBP	3	1.826	1.447 ± 0.038(142)
H6PD	89	1.874	1.832 ± 0.026(64)
ZNF207	27	1.869	1.648 ± 0.018(142)
OAZ1	74	2.068	1.498 ± 0.059(142)
LUC7L2	85	1.829	1.709 ± 0.047(143)
CTBP1	77	2.064	1.651 ± 0.055(141)
TRIM27	7	1.908	1.693 ± 0.034(143)
GPBP1	4	1.844	1.715 ± 0.031(141)
UBQLN1	73	1.864	1.723 ± 0.027(143)
ARL8B	82	1.838	1.499 ± 0.074(139)
PAPOLA	78	1.830	1.509 ± 0.032(141)
CUL1	65	1.810	1.695 ± 0.027(139)
DIMT1L	77	1.906	1.655 ± 0.037(141)
FBXW2	3	1.891	1.638 ± 0.02(142)
SPG21	21	1.826	1.636 ± 0.021(142)
*PCR Efficiency; calculated with Roche Lightcycler software 4.0 using serial diluted cDNA of MKN 74 stomach cancer cell line;
**PCR Efficiency; calculated with LinRegPCR(Ramakers et. al., Neurosci Lett 339(1):62-66, 2003); and,
#: F-ttcttgctggtcttgccatTcctgga-p;
T: TAMRA-labeled;
F: FAM-labeled;
P: phosphate.

TABLE 9
Expression Stability of Novel and Traditional ERGs Calculated
by geNorm and NormFinder based on Real-Time PCR Data
48 Samples	60 FFPE Samples*
GeNorm	NormFinder	GeNorm	NormFinder
Genes	M	Genes	S	Genes	M	Genes	S
GPBP1	0.496	TBP	0.276	GPBP1	0.409	ARL8B	0.233
CUL1		PAPOLA	0.280	PAPOLA		LUC7L2	0.235
PAPOLA	0.536	CUL1	0.287	ARL8B	0.437	OAZ1	0.247
TBP	0.548	LUC7L2	0.290	CTBP1	0.454	CTBP1	0.251
LUC7L2	0.565	CTBP1	0.312	LUC7L2	0.483	UBQLN1	0.273
TRIM27	0.585	GPBP1	0.317	SPG21	0.509	SPG21	0.280
FBXW2	0.597	TRIM27	0.317	FBXW2	0.528	FBXW2	0.286
CTBP1	0.608	FBXW2	0.329	OAZ1	0.545	PAPOLA	0.290
UBQLN1	0.623	DIMT1L	0.364	UBQLN1	0.555	TRIM27	0.327
DIMT1L	0.637	PPIA	0.383	TRIM27	0.567	GPBP1	0.345
PPIA	0.661	UBQLN	10.398	TBP	0.580	HPRT1	0.368
OAZ1	0.682	OAZ1	0.438	CUL1	0.593	CUL1	0.383
ZNF207	0.709	ARL8B	0.494	HPRT1	0.609	TBP	0.402
ARL8B	0.731	SPG21	0.502	ZNF207	0.625	HMBS	0.407
SPG21	0.749	ZNF207	0.502	HMBS	0.641	ZNF207	0.440
HPRT1	0.770	HPRT1	0.516	GAPDH	0.668	PPIA	0.461
GAPDH	0.793	HMBS	0.587	PPIA	0.692	GAPDH	0.527
HMBS	0.815	GAPDH	0.591	B2M	0.715	B2M	0.530
ACTB	0.843	ACTB	0.618	ACTB	0.737	ACTB	0.541
B2M	0.888	B2M	0.815
*DIMT1L was excluded from the analysis.
M: mean expression stability calculated with geNorm program;
S: Stability calculated with NormFinder program.

TABLE 10
Correlation between CV in each dataset and expression stability calculated with geNorm and NormFinder
	EST-M	EST-S	Short SAGE-M	Short SAGE-S	Long SAGE-M	Long SAGE-S	Affy-M	Affy-S	M-S
Pearson	0.676	0.792	0.659	0.75	0.427	0.561	0.039	0.017	0.953
P value	0.001	<0.001	0.002	<0.001	0.061	0.01	0.869	0.944	<0.001
Spearman	0.589	0.605	0.277	0.268	0.092	0.105	0.424	0.357	0.955
P value	0.006	0.005	0.237	0.254	0.701	0.661	0.063	0.123	<0.001
Pearson	0.623	0.626	0.656	0.737	0.481	0.672	0.243	0.335	0.852
P value	0.004	0.004	0.002	<0.001	0.037	0.002	0.317	0.161	<0.001
Spearman	0.653	0.596	0.515	0.502	0.374	0.567	0.521	0.583	0.841
P value	0.002	0.008	0.024	0.03	0.115	0.013	0.022	0.009	<0.001
M: Mean expression stability calculated with geNorm;
S: Stability calculated with NormFinder

TABLE 11
List of 567 Samples Including 13 Tissues in HG-U133 Array
			Nos. of
Tissues	Categories	Morphology	Samples
Brain	Benign	Meningioma	7	23
	Malignant	Glioblastoma Multiforme	7
		Oligodendroglioma	6
		Medulloblastoma	3
Breast	Normal	Normal Tissue	18	74
	Malignant	Infiltrating Duct Carcionma	36
		Infiltrating Duct and Lobular Carcinoma	7
		Infiltrating Lobular Carcinoma	13
Colon	Normal	Normal Tissue	22	62
	Malignant	Adenocarcinoma	33
		Mucinous Adenocarcinoma	7
Esophagus	Normal	Normal Tissue	11	17
	Malignant	Adenocarcinoma	6
Kidney	Normal	Normal Tissue	26	51
	Benign	Oncocytoma	5
	Malignant	Clear Cell Adenocarcinoma	6
		Renal Cell Carcinoma	14
Liver	Normal	Normal Tissue	10	29
	Malignant	Hepatocellular Carcinoma	19
Lung	Normal	Normal Tissue	26	58
	Malignant	Adenocarcinoma	15
		Squamous Cell Carcinoma	17
Lymph	Normal	Normal Tissue	4	23
Node	Malignant	Hodgkin's Disease	4
		Malignant Lymphoma	15
Ovary	Normal	Normal Tissue	10	50
	Malignant	Adenocarcinoma	5
		Clear Cell Adenocarcinoma	6
		Mucinous Cystadenocarcinoma	5
		Serous Cystadenocarcinoma	6
		Papillary Serous Adenocarcinoma	18
Pancreas	Normal	Normal Tissue	13	41
	Malignant	Adenocarcinoma	28
Prostate	Normal	Normal Tissue	14	41
	Malignant	Adenocarcinoma	27
Rectum	Normal	Normal Tissue	17	38
	Malignant	Adenocarcinoma	21
Stomach	Normal	Normal Tissue	17	60
	Malignant	Adenocarcinoma	37
		Signet Ring Cell Carcinoma	6
Total			567

Claims

1.-2. (canceled)

3. A method for selecting endogenous reference gene OAZ1 expressed in a formaline-fixed paraffin embedded (FFPE) tissue sample of human breast cancer tissues comprising: 1) selecting candidate endogenous reference gene by a method comprising (a) computing expression levels of genes from expressed sequence tag (EST), serial analysis of gene expression (SAGE) and microarray datasets, and (b) identifying constitutively expressed genes from more than one tissue type based on the computed gene expression level of step (a) and zero(0)'s proportions thereof;2) determining the coefficient of variation (CV) for the candidate endogenous reference gene of step 1); and3) ranking the candidate endogenous gene in an ascending order of CV of step 2.

4. The method according to the claim 3, wherein the endogenous reference gene OAZ1 can be used to normalize expression levels for relative quantification of gene expression between different samples.

5. The method according to the claim 3, wherein the coefficient of variation (CV) becomes larger as the gene expression increasingly varies from one tissue to another.