Data processing, analysis method of gene expression data to identify endogenous reference genes

Abstract

Disclosed are data processing and analysis methods for gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in amplifying the identified endogenous reference genes. Introduced with the concepts of “Zero's proportion” and CV, the method allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2,087 genes are first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes is determined by analyzing their expression stability. Of the 2,087 genes, 13 genes show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTS, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

Description

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 24, 2013, is named 84346-CON-301519_ST25.txt and is 8,058 bytes in size.

TECHNICAL FIELD

The present invention relates to a data processing and analysis method of gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes. More particularly, the present invention relates to a data processing and analysis method for identifying novel endogenous reference genes using gene expression data from EST, SAGE and microarray datasets with zero's proportion and coefficient of variation, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

BACKGROUND ART

As many as 50,000-100,000 genes can be found in each human cell, but are selectively used in each cell. Of them, a significant number of genes are involved in basic functions and routine cellular metabolic processes required for the sustenance of the cell. Such genes are called housekeeping genes (hereinafter referred to as “HKG”). In various gene expression analysis methods utilizing the quantification of messenger RNA (hereinafter referred to as “mRNA”) to determine expression levels of specific or multiple genes with the aim of identifying the functions of specific genes, searching for genes directed to specific functions, profiling the gene expression of organisms under specific conditions, and describing other biological purposes, endogenous reference genes mean housekeeping genes useful in the normalization of the mRNA level for the relative quantification of genes of interest.

Endogenous reference genes are most widely used to normalize mRNA level for accurate comparison of gene expression between different samples (Vandesompele J et al., Genome Biol 3(7), p. RESEARCH0034, 2002). Endogenous reference genes are usually used in gene expression analysis techniques ranging from conventional reverse transcriptase polymerase chain reaction (hereinafter referred to as “RT-PCR”) to recently developed quantitative real time PCR (hereinafter referred to as “qRT-PCT”), serial analysis of gene expression (hereinafter referred to as “SAGE”) and microarray. Traditional reference genes such as glyceraldehyde-3-phosphate dehydrogenase (hereinafter referred to as “GAPDH”) and β-actin (hereinafter referred to as “ACTB”) have been used without proper validation, assuming that they are expressed at constant levels across different samples, irrespectively cell or tissue type and are not regulated by experimental treatment.

However, it is well known that the expression of traditional reference genes may vary among different tissues and cell types and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states (Bereta J and Bereta M, Biochem Biophys Res Commun 217(1)363-369, 1995; Tricarico C et al., Anal Biochem 309(2):293-300, 2002; Thellin O et al., J Biotechnol 75(2-3):291-295, 1999; Rubie C et al., Mol Cell Probes 19(2):101-109, 2005; Schmittgen T D and Zakrajsek B A, J Biochem Biophys Methods 46(1-2):69-81, 2000; Zhong H and JSimons W, Biochem Biophys Res Commun 259(3):523-526, 1999; Selvey S et al., Mol Cell Probes 15(5):307-311, 2001; Wu Y Y and LRees J, Acta Derm Venereol 80(1):2-3, 2000; Lee P D et al., Genome Res 12(2):292-297, 2002; Hamalainen H K et al., Anal Biochem 299(1):63-70, 2001). The use of inappropriate reference genes in the relative quantification of gene expression may result in biased expression profiles. This concern has already been raised by many researchers (Tricarico C et al., Anal Biochem 309(2):293-300 2002; Dheda K et al., Anal Biochem 344(1):141-143, 2005; de Kok J B et al., Lab Invest 85(1):154-159, 2005; Brunner A M et al., BMC Plant Biol 4:14, 2004). Particularly, the selection of proper endogenous reference genes is essential for accurate measurement in qRT-PCR, which is a reliable method for detecting gene expression with high sensitivity and accuracy though accurate normalization, and may not be required in qualitative analysis such as northern blot or conventional RT-PCR (Huggett J et al., Genes Immun 6(4):279-284, 2005).

With the acknowledgement of the importance of the proper validation of traditional reference genes and the identification of more suitable reference genes, a number of studies have been undertaken to select the most suitable genes among commonly used reference genes in specific experimental conditions, or to identify novel genes, which are superior to the traditional genes that are universally used for mRNA quantification. However, most of the previous studies have been focused on the selection (validation) of the most stable genes among commonly used reference genes in specific experimental systems or a given set of limited tissue samples (Goidin D et al., Anal Biochem 295(1):17-21, 2001; Haller F et al., Anal Biochem 335(1):1-9, 2004; Ohl F et al., J Mol Med 83(12):1014-1024, 2005; Radonic A et al., Biochem Biophys Res Commun 313(4):856-862, 2004). Some programs are now available for identifying the most appropriate genes among multiple reference genes using qRT-PCR results (Vandesompele J et al., Genome Biol 3(7), p. RESEARCH0034, 2002; Pfaffl M W et al., Biotechnol Lett 26(6):509-15, 2004; Andersen C L et al., Cancer Res 64(15):5245-5250, 2004).

In addition, novel endogenous reference genes have been found mostly on the basis of microarray data (Hamalainen H K et al., Anal Biochem 299(1):63-70, 2001; Hoerndli F J et al., Anal Biochem 335(1):30-41, 2004; Czechowski T et al., Plant Physiol 139(1):5-17, 2005; Jin P et al., BMC Genomics, 5(1):55, 2004; Kobayashi M S et al., J. Neurosci Res 76(4):512-518, 2004; Shulzhenko N et al., Biochem Biophys Res Commun 337(1):306-12, 2005). As is well-known, the microarray technique has some problems and limitations (errors) due to the potential for inaccurate cross hybridization between probes and unintended transcripts, the potential for differences in hybridization efficiency between probe sets, and the potential for the incorrect annotation of transcripts (Haverty P M et al., Bioinformatics 20(18):3431-3441, 2004; van Ruissen F et al., BMC Genomics 6:91, 2005). The microarray technique also allows the detection of expression of genes only on the chip, in contrast to expressed sequence tag (hereinafter referred to as “EST”) and SAGE, in which the expression profiles of whole transcripts in samples (cDNA libraries) can be measured (van Ruissen F et al., BMC Genomics 6:91, 2005). The use of gene expression data from different platforms together is expected to complement the limitation of individual platforms. For example, SAGE is far more sensitive than EST for detecting low-abundance transcripts (Sun M et al., BMC Genomics 5(1):1-4, 2004).

Even if an ideal endogenous reference gene does not exist, it is possible to find a more ideal endogenous reference gene applicable to most experimental conditions than traditional reference genes through various, large gene expression data.

Leading to the present invention, intensive and thorough research on accurate comparison of gene expression among different samples, conducted by the present inventors, resulted in the finding that gene expression datasets constructed from microarray data, in addition to EST and SAGE data, are useful in searching for endogenous reference genes, and that novel reference genes identified using the datasets are superior to previously used genes and show more stable expression across a wide range of samples, thus being universally useful for the normalization of gene expression, rather than being limited for use on specific tissue samples or in specific studies.

DISCLOSURE

Technical Problem

Therefore, it is an object of the present invention to provide a method of processing and analyzing gene expression data, with a statistical concept introduced thereinto, to identify endogenous reference genes which are superior to traditional reference genes in terms of expression stability across a wide range of samples, thus being universally useful for the normalization of gene expression, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

Technical Solution

In order to accomplish the above objects, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising: 1) computing expression levels of genes from EST, SAGE and microarray datasets; and 2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero (0)'s proportions thereof.

Also, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

Also, there is provided a method for quantifying an expression level of a gene of interest, comprising: 1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the a candidate endogenous reference gene with the composition; and 2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

Furthermore, there is provided a method for selecting guide genes, comprising: measuring the candidate endogenous reference genes selected using the method for coefficient of variation (CV); and ranking the endogenous reference genes in an ascending order of CV.

Also, the present invention provides a composition for detecting at least one guide reference gene identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

There is provided a method for quantifying an expression level of a target gene, comprising: 1) synthesizing cDNA from RNA of a subject; 2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and 3) normalizing an expression level of the target gene to that of the candidate endogenous reference gene of step 2).

Moreover, there is provided a method for identifying the amplification of a target gene in genomic DNA, comprising: 1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a subject serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and 2) normalizing an expression level of the target gene to that of the candidate endogenous reference gene.

Advantageous Effects

Introduced with the concepts of ‘Zero's proportion’ and CV, the method of the present invention allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2,087 genes were first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes was determined by analyzing their expression stability. Out of the 2,087 genes, 13 genes were found to show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTB, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic view showing a process of identifying endogenous reference genes (ERGs).

FIG. 2 is a graph showing a functional distribution of candidate ERGs classified according to FunCat (Functional Classification Catalogue):

Numeral: numbers of genes

A: protein fate (folding, modification, destination); B: cellular transport, transport facilitation and transport route; C: transcription; D: cellular communication/signal transduction mechanism; E: cell cycle and DNA processing; F: protein synthesis; G: metabolism; H: energy; I: cell fate; J: interaction with cellular environment; K: interaction with environment (systemic); L: organ differentiation; M: development (systemic); N: protein activity regulation; 0: tissue differentiation; P: Biogenesis of cellular components; Q: cell rescue, defense and virulence; and R: cell type differentiation.

FIG. 3 shows correlations of gene expression of 2,087 candidates ERG among four datasets [EST (expressed sequence tag), ShortSAGE, LongSAGE and microarray datasets].

FIG. 4 shows correlations of CV (coefficient of variation %) of 2,087 candidates ERGs among four datasets (EST, ShortSAGE, LongSAGE and microarray datasets).

FIG. 5 is a graph showing the comparison of gene expression between the candidate ERGs, selected according to the present invention, and non-candidate ERGs among each dataset:

Box and Whisker plots: expression distribution expressed as natural log value (1n);

Bottom surface of box: corresponding to 25% of the total expression levels in ascending order; and

Top surface of box: corresponding to 75% of the total expression levels in ascending order.

FIG. 6 shows the comparison of gene expression between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 7 shows the comparison of CV (%) between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 8 is a graph showing mRNA level distributions of the novel and traditional ERGs, determined by real-time PCR, in 48 samples including frozen human tissues and cancer cell lines.

FIG. 9 shows mRNA level distributions, expressed as Cp values determined using real-time PCR, of the novel and traditional ERGs in 48 samples (including frozen human tissues and cancer cell lines) and 60 FFPE (formalin-fixed paraffin-embedded) tissues. In the boxes, the middle lines represent median values of Cp, and the bottom and the top surfaces correspond to 25% and 75% of the total Cp values in ascending order, respectively.

BEST MODE

The terms used herein are defined before embodiments of the present invention are described in detail.

The term “candidate reference gene”, as used herein, is intended to refer to a gene, selected using the method of the present invention, which shows a housekeeping gene (HKG)'s properties of being constitutively expressed across a wide range of tissues.

The term “guide gene”, as used herein, is intended to refer to a gene, selected from among candidate reference genes, which shows as low an expression level and variation in expression level as most transcripts within cells, which is also expressed as “reference gene” or “endogenous reference gene”.

In accordance with an aspect thereof, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising:

1) computing expression levels of genes from EST, SAGE and microarray datasets; and

2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero (0)'s proportions thereof.

Endogenous reference genes (ERG) are most widely used to normalize mRNA levels for an accurate comparison of gene expression between different samples. ERG is usually applied to gene expression analysis, such as RT-PCR (reverse transcriptase polymerase chain reaction), qRT-PCR (quantitative real time PCR), SAGE (serial analysis of gene expression) and microarray. Traditional reference genes, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB), have been used without proper validation, assuming that they are expressed at constant levels across different samples irrespectively the various origins thereof, and are not regulated according to experimental conditions. However, it is well known that the expression of traditional reference genes may differ from one tissue or cell type to another and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states.

In order to search for candidate housekeeping genes (HKG) whose expression is maintained on similar levels in most tissues, first, datasets were constructed using EST and SAGE human gene expression data collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/) and microarray gene expression data obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set. Although the above-mentioned databases were combined to construct new datasets, it should be noted that availability is not limited to the databases. Using the expression data from the datasets, the expression level of a given gene is determined according to the following Mathematical Formulas 1 and 2. The EST (expressed sequence tag) expression levels and the SAGE expression levels of a gene in a given library can be calculated according to Mathematical Formulas 1 and 2, respectively

$\begin{array}{cc}\mathrm{ETS}\mathrm{gene}\mathrm{expression}=\frac{\begin{array}{c}\mathrm{No}\mathrm{of}\mathrm{EST}\mathrm{of}a\mathrm{Given}\\ \mathrm{Gene}\mathrm{in}\mathrm{Library}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{ESTs}\mathrm{in}\mathrm{Library}}\times 1\text{,}000\text{,}000& <\mathrm{Mathematical}\mathrm{Formula}1>\\ \mathrm{Sage}\mathrm{gene}\mathrm{expression}=\frac{\begin{array}{c}\mathrm{No}\mathrm{of}\mathrm{Tags}\mathrm{of}a\mathrm{Given}\\ \mathrm{Gene}\mathrm{in}\mathrm{Library}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tags}\mathrm{in}\mathrm{Library}}\times 1\text{,}000\text{,}000& <\mathrm{Mathematical}\mathrm{Formula}2>\end{array}$

In accordance with the present invention, data from the different databases were analyzed to determine their integrity and to identify commonality therebetween. In this regard, the concept of zero (0)'s proportion is introduced to determine the possibility that a given gene might be a housekeeping gene (HKG), which is ubiquitously expressed across most tissues.

$\begin{array}{cc}0\text{'}s\mathrm{Proportion}=\frac{\begin{array}{c}\mathrm{No}.\mathrm{of}\mathrm{Tissues}\mathrm{with}\mathrm{No}\\ \mathrm{Expression}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tissues}}& <\mathrm{Mathematical}\mathrm{Formula}3>\end{array}$

As expressed by Mathematical Formula 3, zero (0)'s proportion is defined as the ratio of the number of the tissues with no expression of a given gene to the total number of tissues. The lower the 0's proportion is, the higher is the possibility that the given gene might be an HKG. Utilizing the concept of 0's proportion, genes which have low 0's proportions in EST, ShortSAGE, and LongSAGE datasets were sorted. 2,087 genes common to the 3 datasets were selected and categorized as “candidate reference genes” or “candidate ERGs”. The genes which have low 0's proportions refer to genes with 0's proportions less than 0.4 for EST, 0.1 for ShortSAGE, and 0.3 for LongSAGE. The mean gene expression values and CV (%) of the 2,087 candidate reference genes were calculated using another dataset, Affymetrix HG-U133, as well as in EST and SAGE datasets. The expression data of 1,990 UniGene clusters (gene expression data for 5,238 different probe sets, 5317 fragments) corresponding to 2,087 ERGs were obtained.

As a result, a significant correlation of the mean expression values is observed among all of the four datasets (EST (expressed sequence tag), ShortSAGE, LongSAGE and microarray dataset)) (see FIG. 3). Correlation analysis on CV showed lower agreement between datasets than on the mean gene expression levels, although a significant correlation was detected (see FIG. 4).

In addition, the candidate ERGs were compared with non-ERGs with regard to gene expression in each dataset. As we expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-ERGs in all of the four datasets (p<0.0001) (see FIG. 5).

In accordance with another aspect thereof, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

The candidate endogenous reference gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 120(PRDX6), Accession No. Hs 142(SULT1A1), Accession No. Hs 202(BZRP), Accession No. Hs 429(ATP5G3), Accession No. Hs 695(CSTB), Accession No. Hs 808(HNRPF), Accession No. Hs 861(MAPK3), Accession No. Hs 1063(SNRPC), Accession No. Hs 1103(TGFB1), Accession No. Hs 2430(TCFL1), Accession No. Hs 2533(ALDH9A1), Accession No. Hs 2795(LDHA), Accession No. Hs 2853(PCBP1), Accession No. Hs 3100(KARS), Accession No. Hs 3254(MRPL23), Accession No. Hs 3353(G3BP), Accession No. Hs 3416(ADFP), Accession No. Hs 439(STOML2), Accession No. Hs 3530(FUSIP1), Accession No. Hs 3989(PLXNB2), Accession No. Hs 4055(KLF6), Accession No. Hs 4742(GPAA1), Accession No. Hs 4747(DKC1), Accession No. Hs 4766(FAM32A), Accession No. Hs 4859(CCNL1), Accession No. Hs 4997(RBM23), Accession No. Hs 4998(TMOD3), Accession No. Hs 5062(TM4SF8), Accession No. Hs 5086(MGC10433), Accession No. Hs 5120(DNCL1), Accession No. Hs 5158(ILK), Accession No. Hs 5245(FLJ20643), Accession No. Hs 5258(MAGED1), Accession No. Hs 5268(ZDHHC4), Accession No. Hs 5298(ADIPOR1), Accession No. Hs 5308(UBA52), Accession No. Hs 5324(C2orf25), Accession No. Hs 5345(RNPEPL1), Accession No. Hs 5662(GNB2L1), Accession No. Hs 5710(CREG1), Accession No. Hs 5719(CNAP1), Accession No. Hs 5912(FBXO7), Accession No. Hs 5947(RAB8A), Accession No. Hs 6396(JTB), Accession No. Hs 6454(RGS19IP1), Accession No. Hs 6459(GPR172A), Accession No. Hs 6551(ATP6AP1), Accession No. Hs 6891(SFRS6), Accession No. Hs 7101(ANAPC5), Accession No. Hs 7236(NOSIP), Accession No. Hs 7476(ATP6V0B), Accession No. Hs 7527(DKFZP566E144), Accession No. Hs 7744(NDUFV1), Accession No. Hs 7753(CALU), Accession No. Hs 7768(FIBP), Accession No. Hs 7862(PNRC2), Accession No. Hs 7910(RYBP), Accession No. Hs 7917(HIG1), Accession No. Hs 8102(RPS20), Accession No. Hs 8372(UQCR), Accession No. Hs 8737(WDR6), Accession No. Hs 8752(TMEM4), Accession No. Hs 8765(DDX42), Accession No. Hs 8859(CANT1), Accession No. Hs 8867(CYR61), Accession No. Hs 9003(FLJ13868), Accession No. Hs 9015(MGC52000), Accession No. Hs 9043(C14orf120), Accession No. Hs 9234(NIFIE14), Accession No. Hs 9235(NME4), Accession No. Hs 9527(C2orf28), Accession No. Hs 9534(SEC11L1), Accession No. Hs 9573(ABCF1), Accession No. Hs 9589(UBQLN1), Accession No. Hs 9788(NDFIP1), Accession No. Hs 9825(CGI-128), Accession No. Hs 9857(DCXR), Accession No. Hs 10326(COPE), Accession No. Hs 10842(RAN), Accession No. Hs 10848(BMS1L), Accession No. Hs 11125(SPCS1), Accession No. Hs 11184(UBE2R2), Accession No. Hs 11223(IDH1), Accession No. Hs 11355(TMPO), Accession No. Hs 11463(UMP-CMPK), Accession No. Hs 12013(ABCE1), Accession No. Hs 12084(TUFM), Accession No. Hs 12102(SNX3), Accession No. Hs 12107(BC-2), Accession No. Hs 12109(WDR39), Accession No. Hs 12144(KIAA1033), Accession No. Hs 12152(SRPRB), Accession No. Hs 12272(BECN1), Accession No. Hs 12341(ADAR), Accession No. Hs 12457(NUP133), Accession No. Hs 12865(NSFL1C), Accession No. Hs 13662(MGC5508), Accession No. Hs 14317(NOLA3), Accession No. Hs 14333(FLJ10349), Accession No. Hs 14745(C10orf9), Accession No. Hs 14839(POLR2G), Accession No. Hs 14846(SLC7A1), Accession No. Hs 14894(TGOLN2), Accession No. Hs 15277(C16orf33), Accession No. Hs 15591(COPS6), Accession No. Hs 15738(RAB7), Accession No. Hs 16059(HSPC009), Accession No. Hs 16130(E2-230K), Accession No. Hs 16349(KIAA0431), Accession No. Hs 17118(FLJ11730), Accession No. Hs 17250(MGC4767), Accession No. Hs 17680(FUCA2), Accession No. Hs 17731(FLJ12892), Accession No. Hs 17883(PPM1G), Accession No. Hs 18069(LGMN), Accession No. Hs 18128(C20orf44), Accession No. Hs 18349(MRPL15), Accession No. Hs 19673(MAF1), Accession No. Hs 20013(P29), Accession No. Hs 20107(KNS2), Accession No. Hs 20157(CDK5RAP3), Accession No. Hs 20521(HRMT1L2), Accession No. Hs 20529(LOC127262), Accession No. Hs 20573(IGF1R), Accession No. Hs 20716(TIMM17A), Accession No. Hs 22393(DENR), Accession No. Hs 22543(UBE3A), Accession No. Hs 22546(CYBASC3), Accession No. Hs 22616(KIAA0664), Accession No. Hs 23033(LOC92912), Accession No. Hs 23111(FARSLA), Accession No. Hs 23978(SAFB), Accession No. Hs 24301(POLR2E), Accession No. Hs 24379(TRAPPC1), Accession No. Hs 24601(FBLN1), Accession No. Hs 24950(RGSS), Accession No. Hs 25155(NET1), Accession No. Hs 25450(SLC29A1), Accession No. Hs 25723(MTVR1), Accession No. Hs 26010(PFKP), Accession No. Hs 26023(FOXJ3), Accession No. Hs 26136(MGC14156), Accession No. Hs 26232(MAN2C1), Accession No. Hs 26403(GSTZ1), Accession No. Hs 26518(TM4SF7), Accession No. Hs 27222(NOLA2), Accession No. Hs 28491(SAT), Accession No. Hs 28914(APRT), Accession No. Hs 29203(GBL), Accession No. Hs 29665(CLSTN1), Accession No. Hs 30011(MGC2963), Accession No. Hs 30026(HSPC182), Accession No. Hs 30345(TRAP1), Accession No. Hs 30954(PMVK), Accession No. Hs 31053(CKAP1), Accession No. Hs 31334(C20orf14), Accession No. Hs 31387(DKFZP564J0123), Accession No. Hs 34045(CDCA4), Accession No. Hs 34576(TAX1BP1), Accession No. Hs 34906(BLOC1S2), Accession No. Hs 35052(TEGT), Accession No. Hs 35828(MARK3), Accession No. Hs 36587(PPP1R7), Accession No. Hs 36927(HSPH1), Accession No. Hs 37616(STRA13), Accession No. Hs 37916(DPP7), Accession No. Hs 42806(Cab45), Accession No. Hs 43297(MTPN), Accession No. Hs 47062(POLR2I), Accession No. Hs 50098(NDUFA4), Accession No. Hs 50308(HIP2), Accession No. Hs 50425(TEBP), Accession No. Hs 53066(HSPBP1), Accession No. Hs 54277(FAM50A), Accession No. Hs 54457(CD81), Accession No. Hs 54642(MAT2B), Accession No. Hs 54649(RY1), Accession No. Hs 55682(EIF3S7), Accession No. Hs 55847(MRPL51), Accession No. Hs 58488(CTNNAL1), Accession No. Hs 58992(SMC4L1), Accession No. Hs 59486(HSDL2), Accession No. Hs 61812(PTPN12), Accession No. Hs 65234(DDX27), Accession No. Hs 65238(RNF40), Accession No. Hs 66048(BPY2IP1), Accession No. Hs 66915(C22orf16), Accession No. Hs 68714(SFRS1), Accession No. Hs 9293(HEXB), Accession No. Hs 69554(RNF126), Accession No. Hs 69855(UNR), Accession No. Hs 71465(SQLE), Accession No. Hs 71787(MRPS7), Accession No. Hs 73527(CSNK2B), Accession No. Hs 73722(APEX1), Accession No. Hs 73799(GNAI3), Accession No. Hs 73965(SFRS2), Accession No. Hs 74047(ETFB), Accession No. Hs 74050(FVT1), Accession No. Hs 74137(TMP21), Accession No. Hs 74375(DVL1), Accession No. Hs 74405(YWHAQ), Accession No. Hs 74471(GJA1), Accession No. Hs 74563(OAZ2), Accession No. Hs 74564(SSR2), Accession No. Hs 74576(GDI1), Accession No. Hs 75056(TIMM13), Accession No. Hs 75061(MARCKSL1), Accession No. Hs 75066(TSN), Accession No. Hs 75087(FASTK), Accession No. Hs 75117(ILF2), Accession No. Hs 75133(TFAM), Accession No. Hs 75139(ARFIP2), Accession No. Hs 75189(DAP), Accession No. Hs 75227(NDUFA9), Accession No. Hs 75243(BRD2), Accession No. Hs 75249(ARL6IP), Accession No. Hs 75254(IRF3), Accession No. Hs 75318(TUBA1), Accession No. Hs 75348(PSME1), Accession No. Hs 75438(QDPR), Accession No. Hs 75527(ADSL), Accession No. Hs 75724(COPB2), Accession No. Hs 75798(C20orf111), Accession No. Hs 75841(C12orf8), Accession No. Hs 75890(MBTPS1), Accession No. Hs 75914(RNP24), Accession No. Hs 76111(DAG1), Accession No. Hs 76394(ECHS1), Accession No. Hs 76480(UBL4), Accession No. Hs 76662(ZDHHC16), Accession No. Hs 76686(GPX1), Accession No. Hs 76847(GANAB), Accession No. Hs 77060(PSMB6), Accession No. Hs 77269(GNAI2), Accession No. Hs 77313(CDK10), Accession No. Hs 77422(PLP2), Accession No. Hs 77558(HMGN3), Accession No. Hs 77578(USP9X), Accession No. Hs 77793(CSK), Accession No. Hs 77897(SF3A3), Accession No. Hs 77961(HLA-B), Accession No. Hs 77978(DKFZp761I2123), Accession No. Hs 78466(PSMD8), Accession No. Hs 78601(UROD), Accession No. Hs 78771(PGK1), Accession No. Hs 78880(ILVBL), Accession No. Hs 78888(DBI), Accession No. Hs 78989(ADHS), Accession No. Hs 79064(DHPS), Accession No. Hs 79081(PPP1CC), Accession No. Hs 79088(RCN2), Accession No. Hs 79101(CCNG1), Accession No. Hs 79110(NCL), Accession No. Hs 79322(QARS), Accession No. Hs 79335(SMARCD1), Accession No. Hs 79387(PSMC5), Accession No. Hs 79402(POLR2C), Accession No. Hs 79411(RPA2), Accession No. Hs 79625(C20orf149), Accession No. Hs 80545(RPL37), Accession No. Hs 80919(SYPL), Accession No. Hs 80986(ATP5G1), Accession No. Hs 81328(NFKBIA), Accession No. Hs 81424(SUMO1), Accession No. Hs 81848(RAD21), Accession No. Hs 81964(SEC24C), Accession No. Hs 82201(CSNK2A2), Accession No. Hs 82327(GSS), Accession No. Hs 82719(MGC21416), Accession No. Hs 82793(PSMB3), Accession No. Hs 82887(PPP1R11), Accession No. Hs 82890(DAD1), Accession No. Hs 82916(CCT6A), Accession No. Hs 82927(AMPD2), Accession No. Hs 83190(FASN), Accession No. Hs 83347(AAMP), Accession No. Hs 83383(PRDX4), Accession No. Hs 83734(STX4A), Accession No. Hs 83753(SNRPB), Accession No. Hs 83765(DHFR), Accession No. Hs 83916(NDUFA5), Accession No. Hs 84359(GABARAP), Accession No. Hs 84753(FLJ12442), Accession No. Hs 85155(ZFP36L1), Accession No. Hs 85769(ERBP), Accession No. Hs 85962(DERPC), Accession No. Hs 86131(FADD), Accession No. Hs 87752(MSN), Accession No. Hs 89545(PSMB4), Accession No. Hs 89643(TKT), Accession No. Hs 89649(EPHX1), Accession No. Hs 89781(UBTF), Accession No. Hs 89864(SKIV2L), Accession No. Hs 90061(PGRMC1), Accession No. Hs 90093(HSPA4), Accession No. Hs 90107(ADRM1), Accession No. Hs 90443(NDUFS8), Accession No. Hs 91142(KHSRP), Accession No. Hs 91531(MLLT6), Accession No. Hs 93659(ERP70), Accession No. Hs 93832(L0054499), Accession No. Hs 95577(CDK4), Accession No. Hs 96530(COX11), Accession No. Hs 96852(FLJ121128), Accession No. Hs 96996(HNRPA0), Accession No. Hs 97616(SH3GL1), Accession No. Hs 97887(RCN1), Accession No. Hs 98751(FUBP3), Accession No. Hs 98791(ACTR1B), Accession No. Hs 102696(MCTS1), Accession No. Hs 102798(PSMA1), Accession No. Hs 103561(ARL6IP4), Accession No. Hs 103834(MGC5576), Accession No. Hs 104839(TIMP2), Accession No. Hs 105547(NPDC1), Accession No. Hs 106185(RALGDS), Accession No. Hs 106876(ATP6VOD1), Accession No. Hs 106909(ANAPC13), Accession No. Hs 107003(CCNBlIP1), Accession No. Hs 107101(FLJ131031), Accession No. Hs 107387(C7orf20), Accession No. Hs 107393(C3orf4), Accession No. Hs 108029(SH3BGRL), Accession No. Hs 108080(CSRP1), Accession No. Hs 108371(E2F4), Accession No. Hs 108408(APH-1A), Accession No. Hs 108957(RPS27L), Accession No. Hs 108969(PTD008), Accession No. Hs 109051(SH3BGRL3), Accession No. Hs 109052(C14orf2), Accession No. Hs 109672(SIAT7F), Accession No. Hs 109798(C6orf48), Accession No. Hs 110695(SF3B5), Accession No. Hs 110849(ESRRA), Accession No. Hs 111286(MRPS11), Accession No. Hs 111577(ITM2C), Accession No. Hs 111801(ARS2), Accession No. Hs 112058(SIVA), Accession No. Hs 112318(TOMM7), Accession No. Hs 112955(NUDT5), Accession No. Hs 114033(SSR1), Accession No. Hs 114286(CD9), Accession No. Hs 114412(TXNL1), Accession No. Hs 115474(RFC3), Accession No. Hs 115792(EXOSC7), Accession No. Hs 116448(GLS), Accession No. Hs 117176(PABPN1), Accession No. Hs 117715(ST5), Accession No. Hs 118110(BST2), Accession No. Hs 118400(FSCN1), Accession No. Hs 118463(PNPLA2), Accession No. Hs 118638(NME1), Accession No. Hs 118722(FUT8), Accession No. Hs 118964(p66a1pha), Accession No. Hs 118983(GSDMDC1), Accession No. Hs 19177(ARF3), Accession No. Hs 119192(H2AFZ), Accession No. Hs 119251(UQCRC1), Accession No. Hs 119591(AP2S1), Accession No. Hs 119598(RPL3), Accession No. Hs 120323(DNAPTP6), Accession No. Hs 121088(NUP153), Accession No. Hs 121549(CDIPT), Accession No. Hs 122363(WIPI-2), Accession No. Hs 122523(SND1), Accession No. Hs 124126(ARPC1A), Accession No. Hs 124147(FBXL11), Accession No. Hs 124246(C10orf119), Accession No. Hs 124366(BBX), Accession No. Hs 125113(CCT8), Accession No. Hs 125867(EVL), Accession No. Hs 125898(GNAS), Accession No. Hs 126497(AEBP2), Accession No. Hs 126774(RAMP), Accession No. Hs 126938(NAPA), Accession No. Hs 127092(DHX38), Accession No. Hs 127249(EAP30), Accession No. Hs 127386(MAMDC2), Accession No. Hs 127764(RABSC), Accession No. Hs 128065(CTSC), Accession No. Hs 128199(SEPT11), Accession No. Hs 128548(WDR1), Accession No. Hs 129634(CINP), Accession No. Hs 129673(EIF4A1), Accession No. Hs 130031(TRIO), Accession No. Hs 130098(DDX23), Accession No. Hs 130293(CROP), Accession No. Hs 130413(TM9SF2), Accession No. Hs 131226(BNIP3L), Accession No. Hs 132497(PRNPIP), Accession No. Hs 132513 HSD17B12), Accession No. Hs 133892(TPM1), Accession No. Hs 134074(SLC35E1), Accession No. Hs 134688(PSMD13), Accession No. Hs 135406(CEBPZ), Accession No. Hs 136905(UREB1), Accession No. Hs 136947(RALY), Accession No. Hs 137510(NCOR2), Accession No. Hs 138860(ARHGAP1), Accession No. Hs 139896(MAEA), Accession No. Hs 140452(M6PRBP1), Accession No. Hs 142442(HP1-BP74), Accession No. Hs 143187(DDX49), Accession No. Hs 143766(DRPLA), Accession No. Hs 143873(S100A10), Accession No. Hs 144058(EBSP), Accession No. Hs 144468(MGC3234), Accession No. Hs 144835(EEF1G), Accession No. Hs 144868(VTI1B), Accession No. Hs 144941(MUF1), Accession No. Hs 144949(ZNF313), Accession No. Hs 144980(SCAMP4), Accession No. Hs 145049(PLEKHM2), Accession No. Hs 145442(MAP2K1), Accession No. Hs 145575(UBL3), Accession No. Hs 146070(TPM3), Accession No. Hs 146393(HERPUD1), Accession No. Hs 146602(QP-C), Accession No. Hs 146804(SPIN), Accession No. Hs 146806(CUL1), Accession No. Hs 147433(PCNA), Accession No. Hs 148078(RBAF600), Accession No. Hs 148272(CCM2), Accession No. Hs 148330(ARF4), Accession No. Hs 148340(PTPRG), Accession No. Hs 148670(RHOBTB1), Accession No. Hs 149004(FBXO31), Accession No. Hs 149957(RPS6KA1), Accession No. Hs 149983(PEX14), Accession No. Hs 150107(BIRC6), Accession No. Hs 150540(BC002942), Accession No. Hs 150580(SUI1), Accession No. Hs 150837(TXNDC5), Accession No. Hs 151134(OXA1L), Accession No. Hs 151220(KIAA0992), Accession No. Hs 151413(GMFB), Accession No. Hs 151787(U5-116KD), Accession No. Hs 152536(p44S10), Accession No. Hs 153177(RPS28), Accession No. Hs 154023(TXNDC4), Accession No. Hs 154073(SLC35B1), Accession No. Hs 155165(ZFPL1), Accession No. Hs 155218(HNRPUL1), Accession No. Hs 155396(NFE2L2), Accession No. Hs 155829(KIAA0676), Accession No. Hs 156171(PSMC6), Accession No. Hs 156367(RPS29), Accession No. Hs 156667(KIAA1536), Accession No. Hs 157160(MRPS34), Accession No. Hs 157351(PTD004), Accession No. Hs 157379(H2AFV), Accession No. Hs 157394(HAGH), Accession No. Hs 159014(PRPF4B), Accession No. Hs 159118(AMD1), Accession No. Hs 159130(RAF1), Accession No. Hs 159161(ARHGDIA), Accession No. Hs 159699(FBXO21), Accession No. Hs 159799(THRAP2), Accession No. Hs 160958(CDC37), Accession No. Hs 161357(PDHB), Accession No. Hs 162032(HBP1), Accession No. Hs 162233(CHD4), Accession No. Hs 162877(PACSIN2), Accession No. Hs 163645(MOCS2), Accession No. Hs 163776(UBE2J1), Accession No. Hs 163893(PICALM), Accession No. Hs 165195(VAPA), Accession No. Hs 166011(CTNND1), Accession No. Hs 166204(PHF1), Accession No. Hs 166463(HNRPU), Accession No. Hs 166924(SEC13L1), Accession No. Hs 166975(SFRS5), Accession No. Hs 167535(SRP54), Accession No. Hs 168073(TRPC4AP), Accession No. Hs 168799(METTL3), Accession No. Hs 169611(DIABLO), Accession No. Hs 169718(CNN2), Accession No. Hs 170107(UQCRFS1), Accession No. Hs 170131(NFIC), Accession No. Hs 170553(CNOT7), Accession No. Hs 170622(CFL1), Accession No. Hs 171626(SKP1A), Accession No. Hs 172550(PTBP1), Accession No. Hs 172755(BRP44L), Accession No. Hs 172928(COL1A1), Accession No. Hs 173024(NYREN18), Accession No. Hs 173162(NOC4), Accession No. Hs 173381(DPYSL2), Accession No. Hs 173464(FKBP8), Accession No. Hs 173611(NDUFS2), Accession No. Hs 173705(LOC401152), Accession No. Hs 173724(CKB), Accession No. Hs 174050(EDF1), Accession No. Hs 174195(IFITM2), Accession No. Hs 175473(AK1), Accession No. Hs 175955(YT521), Accession No. Hs 177530(ATPSE), Accession No. Hs 177766(PARP1), Accession No. Hs 178551(RPL8), Accession No. Hs 178728(MBD3), Accession No. Hs 179986(FLOT1), Accession No. Hs 180141(CFL2), Accession No. Hs 180312(MRPS16), Accession No. Hs 180414(HSPA8), Accession No. Hs 180877(H3F3B), Accession No. Hs 180903(384D8-2), Accession No. Hs 180909(PRDX1), Accession No. Hs 180933(CXXC1), Accession No. Hs 181046(DUSP3), Accession No. Hs 181112(MED4), Accession No. Hs 181163(HMGN2), Accession No. Hs 181244(HLA-A), Accession No. Hs 181368(PRPF8), Accession No. Hs 181444(TMEM9), Accession No. Hs 182255(NHP2L1), Accession No. Hs 182626(C22orf5), Accession No. Hs 182885(SLC35B2), Accession No. Hs 183684(EIF4G2), Accession No. Hs 183706(ADD1), Accession No. Hs 183800(RANGAP1), Accession No. Hs 183850(DCTD), Accession No. Hs 183994(PPP1CA), Accession No. Hs 184062(C20orf24), Accession No. Hs 184211(PMPCB), Accession No. Hs 184233(HSPA9B), Accession No. Hs 184492(ELAVL1), Accession No. Hs 185172(GNB2), Accession No. Hs 185597(SPG7), Accession No. Hs 187199(MALAT1), Accession No. Hs 187635(RPS15A), Accession No. Hs 187763(BRD4), Accession No. Hs 187866(SDFR1), Accession No. Hs 187946(SLC20A1), Accession No. Hs 188501(PAFAH1B2), Accession No. Hs 188614(PLEKHA5), Accession No. Hs 188879(RBM6), Accession No. Hs 188882(NUDT3), Accession No. Hs 189075(PTK9), Accession No. Hs 189119(CXXC5), Accession No. Hs 189329(SMURF1), Accession No. Hs 189716(NDUFAB1), Accession No. Hs 189772(CCT2), Accession No. Hs 190028(GSTO1), Accession No. Hs 190086(MRCL3), Accession No. Hs 190334(RAP1A), Accession No. Hs 190384(COPS4), Accession No. Hs 190722(HSPC142), Accession No. Hs 190904(STRN4), Accession No. Hs 191186(TTC17), Accession No. Hs 191346(SEPT7), Accession No. Hs 191518(DHX9), Accession No. Hs 191987(UBE2J2), Accession No. Hs 192316(CDC2L1), Accession No. Hs 192374(TRA1), Accession No. Hs 192425(EIF3S8), Accession No. Hs 193118(RAI17), Accession No. Hs 193163(BIN1), Accession No. Hs 193491(TUBB6), Accession No. Hs 194329(TCEAL4), Accession No. Hs 194718(ZNF265), Accession No. Hs 195464(FLNA), Accession No. Hs 195642(C17orf27), Accession No. Hs 196983(SSFA2), Accession No. Hs 198281(PKM2), Accession No. Hs 199561(RANBP2), Accession No. Hs 199625(HAX1), Accession No. Hs 200063(HDAC7A), Accession No. Hs 200600(SCAMP3), Accession No. Hs 200804(SDCBP), Accession No. Hs 201253(ch-TOG), Accession No. Hs 201390(WDR45L), Accession No. Hs 201712(GLG1), Accession No. Hs 202011(GK001), Accession No. Hs 202085(VDAC1), Accession No. Hs 202166(HNRPH1), Accession No. Hs 202179(SMN2), Accession No. Hs 203099(KIAA0261), Accession No. Hs 203910(SGTA), Accession No. Hs 204041(AHSA1), Accession No. Hs 204773(MEP50), Accession No. Hs 205163(MRPL3), Accession No. Hs 206500(CTTN), Accession No. Hs 206824(MGC71993), Accession No. Hs 208597(CTBP1), Accession No. Hs 209983(STMN1), Accession No. Hs 210469(ELMO2), Accession No. Hs 210532(KIAA0141), Accession No. Hs 211463(DNM2), Accession No. Hs 211594(PSMC4), Accession No. Hs 211914(NDUFS7), Accession No. Hs 212102(TXNDC7), Accession No. Hs 212395(CIZ1), Accession No. Hs 213061(NUCKS), Accession No. Hs 213470(PSMB7), Accession No. Hs 213541, Accession No. Hs 213666(KIAA0460), Accession No. Hs 213724(SUPT16H), Accession No. Hs 216653(FBXO9), Accession No. Hs 220950(FOXO3A), Accession No. Hs 221847(SLC38A2), Accession No. Hs 222510(DAZAP1), Accession No. Hs 223141(DDX21), Accession No. Hs 224607(SDC1), Accession No. Hs 226007(RDH11), Accession No. Hs 226117(H1F0), Accession No. Hs 226755(YWHAH), Accession No. Hs 227067(ATAD3A), Accession No. Hs 227253(TOMM70A), Accession No. Hs 227777(PTP4A1), Accession No. Hs 229641(PC4), Accession No. Hs 231295(PITPNC1), Accession No. Hs 231616(HSPCO23), Accession No. Hs 232194(KIAA0174), Accession No. Hs 232543(PDCD4), Accession No. Hs 233458(NFYC), Accession No. Hs 233552(CDC2L5), Accession No. Hs 233952(PSMA7), Accession No. Hs 234521(MAPKAPK3), Accession No. Hs 236030(SMARCC2), Accession No. Hs 237536(MGC20781), Accession No. Hs 237971(XTP3TPA), Accession No. Hs 238839(SCYL1), Accession No. Hs 240170(MGC2731), Accession No. Hs 241336(ATPIF1), Accession No. Hs 241543(POLDIP2), Accession No. Hs 241558(ARIH2), Accession No. Hs 241575(GNPTG), Accession No. Hs 241576(DERL1), Accession No. Hs 241579(SERPINH1), Accession No. Hs 242458(SPG21), Accession No. Hs 242947(DGKI), Accession No. Hs 246112(ASCC3L1), Accession No. Hs 246310(ATP5J), Accession No. Hs 246413(CPNE1), Accession No. Hs 246781(FBXO11), Accession No. Hs 247077(RHOA), Accession No. Hs 247186(FBS1), Accession No. Hs 247975(HSPD1), Accession No. Hs 248267(MPST), Accession No. Hs 248941(TAF9), Accession No. Hs 49600(DLGAP4), Accession No. Hs 250009(ARL10C), Accession No. Hs 250429(SUPT6H), Accession No. Hs 250758(PSMC3), Accession No. Hs 250899(HSBP1), Accession No. Hs 250905(L0051234), Accession No. Hs 251531(PSMA4), Accession No. Hs 252457(MVD), Accession No. Hs 252713(TTC15), Accession No. Hs 252967 DKFZp566C0424), Accession No. Hs 253726(PAPOLA), Accession No. Hs 253903(STOM), Accession No. Hs 254042(BAT1), Accession No. Hs 255015(VPS24), Accession No. Hs 255093(PFKL), Accession No. Hs 255932(XRN2), Accession No. Hs 255935(BTG1), Accession No. Hs 255973(CRI1), Accession No. Hs 256301(MGC13170), Accession No. Hs 256549(NUBP2), Accession No. Hs 257008(PLD3), Accession No. Hs 257341(SAV1), Accession No. Hs 57761(SH3BP5), Accession No. Hs 258551(DNPEP), Accession No. Hs 258563(FEZ2), Accession No. Hs 258798 C10orf86), Accession No. Hs 259461(PALM2-AKAP2), Accession No. Hs 260603(PIP5K2B), Accession No. Hs 262823(FLJ10326), Accession No. Hs 265829(ITGA3), Accession No. Hs 268488(KIAA1185), Accession No. Hs 268530(GPS1), Accession No. Hs 268742(C13orf12), Accession No. Hs 268849(GLO1), Accession No. Hs 268939(MATR3), Accession No. Hs 269528(MAK3), Accession No. Hs 269577(PTPRA), Accession No. Hs 269782(GNAQ), Accession No. Hs 269944(MTCH2), Accession No. Hs 270291(ACTN4), Accession No. Hs 270428(SUCLG1), Accession No. Hs 270525(LASS5), Accession No. Hs 270869(ZNF410), Accession No. Hs 271135(ATP5C1), Accession No. Hs 271695(NOB1P), Accession No. Hs 272062(PTPRF), Accession No. Hs 272168(TDE1), Accession No. Hs 272630(ATP6V1D), Accession No. Hs 272927(SEC23A), Accession No. Hs 273077(TMEM14B), Accession No. Hs 274184(TFE3), Accession No. Hs 274772(C15orf15), Accession No. Hs 274873(CARS), Accession No. Hs 275243(S100A6), Accession No. Hs 275775(SEPP1), Accession No. Hs 275865(PCNP), Accession No. Hs 276878(NUP93), Accession No. Hs 277035(MGLL), Accession No. Hs 277517(C11orf2), Accession No. Hs 278186(ARHGEF1), Accession No. Hs 278362(MEA), Accession No. Hs 278426(PDAP1), Accession No. Hs 278429(C9orf78), Accession No. Hs 278500(GNPDA1), Accession No. Hs 278569(SNX17), Accession No. Hs 278573(CD59), Accession No. Hs 278721(SLC39A7), Accession No. Hs 279061(C17orf25), Accession No. Hs 279245(TACC1), Accession No. Hs 279257(PCMT1), Accession No. Hs 279413(POLD1), Accession No. Hs 279529(PX19), Accession No. Hs 279583(DREV1), Accession No. Hs 279623(SEPX1), Accession No. Hs 279640(TPR), Accession No. Hs 279652(MRPL4), Accession No. Hs 279669(TUBG1), Accession No. Hs 279696(SUMF2), Accession No. Hs 279806(DDX5), Accession No. Hs 79836(COMMD9), Accession No. Hs 279920(YWHAB), Accession No. Hs 279929(TMED9), Accession No. Hs 80202(SBF1), Accession No. Hs 280342(PRKAR1A), Accession No. Hs 280378(SNRPB2), Accession No. Hs 282410(CALM1), Accession No. Hs 282700(SPCS2), Accession No. Hs 282901(RNPC2), Accession No. Hs 282998(RBM9), Accession No. Hs 283111(C14orf124), Accession No. Hs 283454(BNIP2), Accession No. Hs 283521(RHEB), Accession No. Hs 283610(APG4B), Accession No. Hs 283652(IDI1), Accession No. Hs 283739(UBQLN4), Accession No. Hs 284208(ANKRD25), Accession No. Hs 284279(HMOX2), Accession No. Hs 284286(MRPS24), Accession No. Hs 284491(PDXK), Accession No. Hs 285354(MAX), Accession No. Hs 285976(LASS2), Accession No. Hs 286221(ARF1), Accession No. Hs 286226(MYO1C), Accession No. Hs 288193(KPNA4), Accession No. Hs 288856(PFDN5), Accession No. Hs 288969(HSCARG), Accession No. Hs 289008(C6orf68), Accession No. Hs 289092(COTL1), Accession No. Hs 289123(DCTN2), Accession No. Hs 289271(CYC1), Accession No. Hs 290243(GBF1), Accession No. Hs 290404(SLC25A3), Accession No. Hs 290758(DDB1), Accession No. Hs 291587(ARID1B), Accession No. Hs 292026(EIF4E2), Accession No. Hs 292063(EIF4B), Accession No. Hs 292078(LARP), Accession No. Hs 292265(ZMYND11), Accession No. Hs 292457, Accession No. Hs 292493(G22P1), Accession No. Hs 292524(CCNH), Accession No. Hs 292579(PTDSS1), Accession No. Hs 293563(FLJ12666), Accession No. Hs 295917(ATP6V1B2), Accession No. Hs 297324(TIMP3), Accession No. Hs 298198(CKLFSF3), Accession No. Hs 298280(ATP5A1), Accession No. Hs 298654(DUSP6), Accession No. Hs 299002(FBL), Accession No. Hs 299055(GDI2), Accession No. Hs 300141(RPL39), Accession No. Hs 300684(RCP9), Accession No. Hs 300772(TPM2), Accession No. Hs 300816 RAB1B), Accession No. Hs 300834(GALNT2), Accession No. Hs 301404(RBM3), Accession No. Hs 301412(Ufc1), Accession No. Hs 302742(MRPS6), Accession No. Hs 302903(UBE2I), Accession No. Hs 303676(G3BP2), Accession No. Hs 304192(DSTN), Accession No. Hs 304682(CST3), Accession No. Hs 306123(MAGEF1), Accession No. Hs 306242(RANBP9), Accession No. Hs 306329(ZA20D3), Accession No. Hs 306425(IBTK), Accession No. Hs 308122(ITPK1), Accession No. Hs 308340(NUP188), Accession No. Hs 308709(GRP58), Accession No. Hs 309090(SFRS7), Accession No. Hs 309231(C6orf153), Accession No. Hs 309641(RNFLJ1), Accession No. Hs 309753(STARD3NL), Accession No. Hs 309849(C14orf159), Accession No. Hs 310542(TOMM40), Accession No. Hs 310645(RAB1A), Accession No. Hs 311072(MRPS35), Accession No. Hs 311346(CMAS), Accession No. Hs 311609(DDX39), Accession No. Hs 311640(RPS27A), Accession No. Hs 312098(ADAM15), Accession No. Hs 313847(TXNDC11), Accession No. Hs 314263(BAZ2A), Accession No. Hs 314359(EIF3S12), Accession No. Hs 315177(IFRD2), Accession No. Hs 315230(GC20), Accession No. Hs 319334(NASP), Accession No. Hs 321391(MGC4549), Accession No. Hs 321541(RAB11A), Accession No. Hs 323363(APG9L1), Accession No. Hs 323489(FLJ120758), Accession No. Hs 324250(NDUFB2), Accession No. Hs 324844(VKORC1), Accession No. Hs 325650(EHD2), Accession No. Hs 326387(MORF4L2), Accession No. Hs 330384(CORO1C), Accession No. Hs 331431(SCC-112), Accession No. Hs 333388(EEF1D), Accession No. Hs 333579(HSPC152), Accession No. Hs 333786(PSMA2), Accession No. Hs 333823(MRPL13), Accession No. Hs 334017(K-ALPHA-1), Accession No. Hs 334479(TRAF7), Accession No. Hs 334534(GNS), Accession No. Hs 334587(RBPMS), Accession No. Hs 334713(BMSC-UbP), Accession No. Hs 334851(LASP1), Accession No. Hs 334868(PPP2R5E), Accession No. Hs 335003(ANKRD11), Accession No. Hs 335057(SEPT2), Accession No. Hs 335163(KIAA1102), Accession No. Hs 335918(FDPS), Accession No. Hs 337295(STIP1), Accession No. Hs 337766(TXNRD1), Accession No. Hs 339278(COPB), Accession No. Hs 339639(COX7A2L), Accession No. Hs 339697(GRINA), Accession No. Hs 343911(E124), Accession No. Hs 345694(KCMF1), Accession No. Hs 346868(EBNA1BP2), Accession No. Hs 348418(DR1), Accession No. Hs 349656(SCARB2), Accession No. Hs 350194(ZMAT2), Accession No. Hs 350229(CASC3), Accession No. Hs 350268(IRF2BP2), Accession No. Hs 350364(C9orf10OS), Accession No. Hs 350927(SLC25A6), Accession No. Hs 351099(FLJ10241), Accession No. Hs 351296(L0051035), Accession No. Hs 351316(TM4SF1), Accession No. Hs 351474(PAQR4), Accession No. Hs 351680, Accession No. Hs 351875(COX6C), Accession No. Hs 352341(STCH), Accession No. Hs 352656(GHITM), Accession No. Hs 352768(PSMB1), Accession No. Hs 354056(POR), Accession No. Hs 355141(TNIP1), Accession No. Hs 355606(MGC23909), Accession No. Hs 355643(RNPS1), Accession No. Hs 355708(FLJ120507), Accession No. Hs 355750(MGC5306), Accession No. Hs 355753(DKFZp586M1819), Accession No. Hs 355867(MARS), Accession No. Hs 355927(VDAC2), Accession No. Hs 355934(SFPQ), Accession No. Hs 355983(BZW1), Accession No. Hs 356061(MAP1LC3B), Accession No. Hs 356096(FLJ10350), Accession No. Hs 356190(UBB), Accession No. Hs 356270(SDHD), Accession No. Hs 356285(HMGN1), Accession No. Hs 356331(PPIA), Accession No. Hs 356366(RPS2), Accession No. Hs 356371(RPL28), Accession No. Hs 356377(LOC149603), Accession No. Hs 356467(MGC2747), Accession No. Hs 356501(PHF6), Accession No. Hs 356502(RPLP1), Accession No. Hs 356549(SNRPD3), Accession No. Hs 356630(NUTF2), Accession No. Hs 356647(SNX6), Accession No. Hs 356654(PSMC1), Accession No. Hs 567660, Accession No. Hs 356769(MAN2B1), Accession No. Hs 356799, Accession No. Hs 357901(SOX4), Accession No. Hs 362728(SEP15), Accession No. Hs 365116(U2AF1), Accession No. Hs 368084(LRPPRC), Accession No. Hs 368149(CCT7), Accession No. Hs 368157(PYGB), Accession No. Hs 368240(DYRK1A), Accession No. Hs 68264(PPP2R5C), Accession No. Hs 368376(SRPR), Accession No. Hs 368402(L0051337), Accession No. Hs 368404(EXT2), Accession No. Hs 368525(PDLIM1), Accession No. Hs 368598(LEREPO4), Accession No. Hs 368934(MGC40157), Accession No. Hs 368985(TRIP12), Accession No. Hs 369017(RAB2), Accession No. Hs 369052(SELT), Accession No. Hs 369068(DNCLI2), Accession No. Hs 369125(PSMD14), Accession No. Hs 369285(DKFZP434B168), Accession No. Hs 369356(MLL5), Accession No. Hs 369606(CPSF6), Accession No. Hs 369607(GAK), Accession No. Hs 369614(COPS2), Accession No. Hs 369615(FLJ120551), Accession No. Hs 369761(DAZAP2), Accession No. Hs 369785(MGC2749), Accession No. Hs 369920(RAP1B), Accession No. Hs 370024(SEC31L1), Accession No. Hs 370247(APLP2), Accession No. Hs 370292(BCCIP), Accession No. Hs 370312(FNTA), Accession No. Hs 370408(COMT), Accession No. Hs 370581(CAP1), Accession No. Hs 370770(XPO1), Accession No. Hs 370771(CDKN1A), Accession No. Hs 370895(RPN2), Accession No. Hs 370927(PRO1855), Accession No. Hs 370937(TAPBP), Accession No. Hs 371001(EIF3S9), Accession No. Hs 371416(CARM1), Accession No. Hs 371563(RAB14), Accession No. Hs 371788(DKFZP547E1010), Accession No. Hs 371889(ATP1A1), Accession No. Hs 372003(C9orf10), Accession No. Hs 372050(SMAP-5), Accession No. Hs 372286(CUL3), Accession No. Hs 372331(SPTAN1), Accession No. Hs 372541(KBTBD2), Accession No. Hs 372616(ARL1), Accession No. Hs 372914(NDRG1), Accession No. Hs 373550(TGIF), Accession No. Hs 373741(HM13), Accession No. Hs 373763(HNRPR), Accession No. Hs 373952(CAMTA2), Accession No. Hs 373959(VGLL4), Accession No. Hs 374043(ASXL1), Accession No. Hs 374257(SIAT4A), Accession No. Hs 374378(CKS1B), Accession No. Hs 374477(EWSR1), Accession No. Hs 374503(MORF4L1), Accession No. Hs 374588(RPL17), Accession No. Hs 374596(TPT1), Accession No. Hs 374650(IFITM3), Accession No. Hs 374973(PRPF4), Accession No. Hs 375001(TLN1), Accession No. Hs 375108(CD24), Accession No. Hs 375217(RNF31), Accession No. Hs 376046(BTN3A2), Accession No. Hs 376933(GUK1), Accession No. Hs 377155(LYRIC), Accession No. Hs 378103(RPS5), Accession No. Hs 378532(HBS1L), Accession No. Hs 378808(eIF2A), Accession No. Hs 380403(PCGF4), Accession No. Hs 380774(DDX3X), Accession No. Hs 380953(RPL38), Accession No. Hs 380973(SUMO2), Accession No. Hs 381008(HLA-E), Accession No. Hs 381058(KIAA0146), Accession No. Hs 381072(PPIF), Accession No. Hs 381123(RPL21), Accession No. Hs 381126(RPS14), Accession No. Hs 381189(CBX3), Accession No. Hs 381219, Accession No. Hs 381256(GLTP), Accession No. Hs 382044(MRPS2), Accession No. Hs 382168(NCOA3), Accession No. Hs 385913(ANP32E), Accession No. Hs 385986(UBE2B), Accession No. Hs 386434(ANXA7), Accession No. Hs 386465(CHERP), Accession No. Hs 386939(USP7), Accession No. Hs 387208(FAU), Accession No. Hs 387804(PABPC1), Accession No. Hs 388034(RXRB), Accession No. Hs 388654(ATP6V1G1), Accession No. Hs 388664(RPL11), Accession No. Hs 388739(XRCCS), Accession No. Hs 388927(YY1), Accession No. Hs 388956(C19orf22), Accession No. Hs 389037(MCM3APAS), Accession No. Hs 389107(ATP6VOC), Accession No. Hs 389171(PINK1), Accession No. Hs 389649(DDX48), Accession No. Hs 389734(TCEAL8), Accession No. Hs 389996(CHCHD2), Accession No. Hs 390667(GSTK1), Accession No. Hs 393201(ACTR2), Accession No. Hs 395482(PTK2), Accession No. Hs 396644(PAIP2), Accession No. Hs 396740(NIP30), Accession No. Hs 396783(SLC9A3R1), Accession No. Hs 397609(RPS16), Accession No. Hs 399800(AKAP8L), Accession No. Hs 400295(RPL30), Accession No. Hs 401509(RBM10), Accession No. Hs 401903(COX5A), Accession No. Hs 401929(RPL10), Accession No. Hs 403917(STK24), Accession No. Hs 404056(EIF3S1), Accession No. Hs 404321(GARS), Accession No. Hs 405144(SFRS3), Accession No. Hs 405410(OGT), Accession No. Hs 405514(LOC284058), Accession No. Hs 405590(EIF3S6), Accession No. Hs 405880(MRPS21), Accession No. Hs 405942(LOC339229), Accession No. Hs 406062(NDUFA11), Accession No. Hs 406068(UBE2M), Accession No. Hs 406096(ZA20D2), Accession No. Hs 406277(SF3A1), Accession No. Hs 406300(RPL23), Accession No. Hs 406423(SF3B2), Accession No. Hs 406510(ATP5B), Accession No. Hs 406520(LOC389541), Accession No. Hs 406534(HMG20B), Accession No. Hs 406590(PGR1), Accession No. Hs 406620(RPS10), Accession No. Hs 406683(RPS15), Accession No. Hs 406799(RAB18), Accession No. Hs 406840(SLC35A4), Accession No. Hs 407368(C19orf13), Accession No. Hs 407580(PKP4), Accession No. Hs 407995(MIF), Accession No. Hs 408018(RPL36), Accession No. Hs 408073(RPS6), Accession No. Hs 408236(TXNL5), Accession No. Hs 408257(NDUFS6), Accession No. Hs 408293(KAB), Accession No. Hs 408324(FLJ10769), Accession No. Hs 408428(CHES1), Accession No. Hs 408581(SVIL), Accession No. Hs 408909(GOLPH3), Accession No. Hs 409140(ATP5O), Accession No. Hs 409223(SSR4), Accession No. Hs 409230(AGPAT1), Accession No. Hs 409834(PHPT1), Accession No. Hs 410197(IDH3G), Accession No. Hs 410596(HAN11), Accession No. Hs 410817(RPL13), Accession No. Hs 411480(AUP1), Accession No. Hs 411641(EIF4EBP1), Accession No. Hs 411847(MAPK6), Accession No. Hs 412103(EFHA1), Accession No. Hs 412117(ANXA6), Accession No. Hs 412196(ESRRBL1), Accession No. Hs 412433(AIP), Accession No. Hs 412468(KLHDC3), Accession No. Hs 412842(C10orf7), Accession No. Hs 413036(WBSCR22), Accession No. Hs 413482(C21orf33), Accession No. Hs 414579(SCOTIN), Accession No. Hs 415342(KIAA1049), Accession No. Hs 416049(TNPO2), Accession No. Hs 416436(TRIM50A), Accession No. Hs 417004(S100A11), Accession No. Hs 417029(DERP6), Accession No. Hs 418123(CTSL), Accession No. Hs 418175(VPS28), Accession No. Hs 418233(MRPL24), Accession No. Hs 418450(MRPL11), Accession No. Hs 418533(BUB3), Accession No. Hs 418668(ATPSD), Accession No. Hs 419640(PARK7), Accession No. Hs 420269(COL6A2), Accession No. Hs 420272(H2AFY), Accession No. Hs 421257(RPL7), Accession No. Hs 421509(CCT4), Accession No. Hs 422113(ZNF511), Accession No. Hs 423935(RDBP), Accession No. Hs 423968(TTC11), Accession No. Hs 424126(SERF2), Accession No. Hs 424908(LSM5), Accession No. Hs 425777(UBE2L6), Accession No. Hs 426296(C10orf104), Accession No. Hs 426359(DKFZp564J157), Accession No. Hs 429052(ITGB1), Accession No. Hs 429353(SEPN1), Accession No. Hs 429581(RTN4), Accession No. Hs 429819(PITPNA), Accession No. Hs 429839(MGC23908), Accession No. Hs 430425(GNB1), Accession No. Hs 430551(IQGAP1), Accession No. Hs 430606(CS), Accession No. Hs 430657(ARF5), Accession No. Hs 430733(CLNS1A), Accession No. Hs 431101(GNG12), Accession No. Hs 431367(C6orf55), Accession No. Hs 431498(FOXP1), Accession No. Hs 431550(MAP4K4), Accession No. Hs 431668(COX6B1), Accession No. Hs 431850(MAPK1), Accession No. Hs 431861(PPP5C), Accession No. Hs 431926 NFKB1), Accession No. Hs 432121(PRDX2), Accession No. Hs 432438(EML4), Accession No. Hs 432491(ESD), Accession No. Hs 432690(SLC39A9), Accession No. Hs 432760(CAPZB), Accession No. Hs 432898(RPL4), Accession No. Hs 432976(NR1H2), Accession No. Hs 433154(PLSCR3), Accession No. Hs 433201(CDK2AP1), Accession No. Hs 433222(NPC2), Accession No. Hs 433291(ARD1), Accession No. Hs 433307(BCKDHA), Accession No. Hs 433343(SRRM2), Accession No. Hs 433345, Accession No. Hs 433419(COX4I1), Accession No. Hs 433512(ACTR3), Accession No. Hs 433529(RPS11), Accession No. Hs 433540(DNAJC8), Accession No. Hs 433573(Bles03), Accession No. Hs 433615(TUBB2), Accession No. Hs 433701(RPL37A), Accession No. Hs 433722(KIAA1967), Accession No. Hs 33732(CLK1), Accession No. Hs 433750(EIF4G1), Accession No. Hs 433759(BANF1), Accession No. Hs 433795(SHC1), Accession No. Hs 433863(PBP), Accession No. Hs 433901(COX8A), Accession No. Hs 433951(GPX4), Accession No. Hs 434102(HMGB1), Accession No. Hs 434207(HARS2), Accession No. Hs 434219(ANKHD1), Accession No. Hs 434401(ZNF638), Accession No. Hs 434937(PPIB), Accession No. Hs 434953(HMGB2), Accession No. Hs 434980(APP), Accession No. Hs 435044(TBC1D22A), Accession No. Hs 435064(KIAA1608), Accession No. Hs 435120(KIF1C), Accession No. Hs 435136(TXN), Accession No. Hs 435166(LBR), Accession No. Hs 435231(ZFR), Accession No. Hs 435255(UBXD1), Accession No. Hs 435326(ACTL6A), Accession No. Hs 435512(PPP3CA), Accession No. Hs 435535(ZNF395), Accession No. Hs 435610(WAC), Accession No. Hs 435741(GCSH), Accession No. Hs 435759(THAP4), Accession No. Hs 435771(APIS), Accession No. Hs 435841(TNRC15), Accession No. Hs 435850(LYPLA1), Accession No. Hs 435933(PHF10), Accession No. Hs 435948(ATAD1), Accession No. Hs 435952(CDK5RAP1), Accession No. Hs 435974(MTHFD1), Accession No. Hs 436035(TUBA6), Accession No. Hs 436093(BAT2), Accession No. Hs 436204(ZNF289), Accession No. Hs 436298(EMP1), Accession No. Hs 436405(IDH3B), Accession No. Hs 436437(ALDH2), Accession No. Hs 436446(ARMET), Accession No. Hs 436500(DBNL), Accession No. Hs 436568(CD74), Accession No. Hs 436578(POLR2F), Accession No. Hs 436657(CLU), Accession No. Hs 436687(SET), Accession No. Hs 436803(VBP1), Accession No. Hs 437056(SUPT5H), Accession No. Hs 437060(CYC5), Accession No. Hs 437110(ANXA2), Accession No. Hs 437178(ACADVL), Accession No. Hs 437256(GRINL1A), Accession No. Hs 437277(MGAT4B), Accession No. Hs 437367(GBAS), Accession No. Hs 437388(PIGT), Accession No. Hs 437403(PP), Accession No. Hs 437594(RPLP2), Accession No. Hs 437638(XBP1), Accession No. Hs 437779(C11orf10), Accession No. Hs 437831(C14orf32), Accession No. Hs 438072(UNC84A), Accession No. Hs 438219(GPS2), Accession No. Hs 438429(RPS19), Accession No. Hs 438678(TALDO1), Accession No. Hs 438720(MCM7), Accession No. Hs 438970(TBL1XR1), Accession No. Hs 438974(CUTL1), Accession No. Hs 439480(RBM5), Accession No. Hs 439481(SUPT4H1), Accession No. Hs 439548(FLJ122875), Accession No. Hs 439552, Accession No. Hs 439815(HBXIP), Accession No. Hs 440382(RFP), Accession No. Hs 440544(CLIC4), Accession No. Hs 440599(DDX1), Accession No. Hs 440604(PSMD7), Accession No. Hs 440899(TTYH3), Accession No. Hs 440932(SEPT9), Accession No. Hs 440960(RAD23A), Accession No. Hs 440961(CAST), Accession No. Hs 441072(POLR2L), Accession No. Hs 441550(C20orf22), Accession No. Hs 442344(IRS2), Accession No. Hs 442798(RNF10), Accession No. Hs 443134(GBA2), Accession No. Hs 443379(PSMD11), Accession No. Hs 443837(NPEPPS), Accession No. Hs 443914(SOD1), Accession No. Hs 444279(DKFZp761C169), Accession No. Hs 444356(GRB2), Accession No. Hs 444468(CTDSP1), Accession No. Hs 444472(SDHC), Accession No. Hs 444569(VMP1), Accession No. Hs 444673(CRR9), Accession No. Hs 444724(AZI2), Accession No. Hs 444818(CGGBP1), Accession No. Hs 444931(CRSP6), Accession No. Hs 444969(C2orf4), Accession No. Hs 444986(METAP2), Accession No. Hs 445081(NS5ATP13TP2), Accession No. Hs 445351(LGALS1), Accession No. Hs 445394(VPS29), Accession No. Hs 445498(SKIIP), Accession No. Hs 445511(RIOK3), Accession No. Hs 445570(CD63), Accession No. Hs 445803(DC2), Accession No. Hs 445893(KHDRBS1), Accession No. Hs 445977(GTF3A), Accession No. Hs 446017(WSB1), Accession No. Hs 446091(WTAP), Accession No. Hs 446123(CAPZA2), Accession No. Hs 446149(LDHB), Accession No. Hs 446260(PSMA6), Accession No. Hs 446336(PXN), Accession No. Hs 446345(FTH1), Accession No. Hs 446414(CD47), Accession No. Hs 446427(OAZ1), Accession No. Hs 446445(YIF1), Accession No. Hs 446450(ITM2B), Accession No. Hs 446574(TMSB10), Accession No. Hs 446588(RPS13), Accession No. Hs 446623(HNRPL), Accession No. Hs 446628(RPS4X), Accession No. Hs 446641(ARAF), Accession No. Hs 446852(EIF3S6IP), Accession No. Hs 447477(ST13), Accession No. Hs 447492(PGAM1), Accession No. Hs 447547(VPS35), Accession No. Hs 48226(RPLP0), Accession No. Hs 448588(NGFRAP1), Accession No. Hs 448646(RPL27A), Accession No. Hs 448879, Accession No. Hs 449114(HNRPC), Accession No. Hs 449171(HNRPK), Accession No. Hs 454534(USF2), Accession No. Hs 454699(IL6ST), Accession No. Hs 456507(PKD1-like), Accession No. Hs 456557(FLJ10597), Accession No. Hs 458320(DC12), Accession No. Hs 458358(TSPYL1), Accession No. Hs 458414(IFITM1), Accession No. Hs 458458(C19orf27), Accession No. Hs 458747(ANP32A), Accession No. Hs 459106(OAZIN), Accession No. Hs 459149(BTBD1), Accession No. Hs 459174(FLJ123790), Accession No. Hs 459211(AKAP13), Accession No. Hs 459596(MPG), Accession No. Hs 459649(CLCN7), Accession No. Hs 459927(PTMA), Accession No. Hs 459940(LITAF), Accession No. Hs 460238(SH3GLB2), Accession No. Hs 460317(ALS4), Accession No. Hs 460336(GGA2), Accession No. Hs 460468(XPO6), Accession No. Hs 460499(ATXN2L), Accession No. Hs 460574(LOC124446), Accession No. Hs 460923(CNOT1), Accession No. Hs 460929(GOT2), Accession No. Hs 460978(APPBP1), Accession No. Hs 461047(G6PD), Accession No. Hs 461131(CYBS-M), Accession No. Hs 461361(CFDP1), Accession No. Hs 461379(GABARAPL2), Accession No. Hs 461722(HSPC176), Accession No. Hs 461777(PCOLN3), Accession No. Hs 461896(CRK), Accession No. Hs 461925(RPA1), Accession No. Hs 462035(UBE2G1), Accession No. Hs 462086(RIP), Accession No. Hs 462306(UBE2S), Accession No. Hs 462316(TTC19), Accession No. Hs 462492(USP22), Accession No. Hs 462550(PIGS), Accession No. Hs 462956(PPARBP), Accession No. Hs 462998(IGFBP4), Accession No. Hs 463010(SMARCE1), Accession No. Hs 463035(FKBP10), Accession No. Hs 463041(RERE), Accession No. Hs 463059(STAT3), Accession No. Hs 463295(CDC27), Accession No. Hs 463506(AKAP1), Accession No. Hs 463702(BCAS3), Accession No. Hs 463797(C1orf33), Accession No. Hs 464071(PGD), Accession No. Hs 464137(ACOX1), Accession No. Hs 464210(SYNGR2), Accession No. Hs 464336(P4HB), Accession No. Hs 464438(AGTRAP), Accession No. Hs 464472(MRLC2), Accession No. Hs 464595(PPP4R1), Accession No. Hs 464652(TNFSF5IP1), Accession No. Hs 464912(P15RS), Accession No. Hs 465224(NARS), Accession No. Hs 465374(EFHD2), Accession No. Hs 465498(TXNL4A), Accession No. Hs 465529(MIDN), Accession No. Hs 465543(BTBD2), Accession No. Hs 465627(MAP2K2), Accession No. Hs 465645(C19orf10), Accession No. Hs 465808(HNRPM), Accession No. Hs 465849(PIN1), Accession No. Hs 465924(SDHB), Accession No. Hs 466044(PKN1), Accession No. Hs 466088(TPM4), Accession No. Hs 466148(NR2F6), Accession No. Hs 466471(GPI), Accession No. Hs 466693(SIRT2), Accession No. Hs 466766(LTBP4), Accession No. Hs 466775(SNRPA), Accession No. Hs 467084(EIF4G3), Accession No. Hs 467097(SNRP70), Accession No. Hs 467192(PPP2R1A), Accession No. Hs 467279(LENG4), Accession No. Hs 467284(RPS9), Accession No. Hs 467408(TRIM28), Accession No. Hs 467637(CDC42), Accession No. Hs 467696(HPCAL1), Accession No. Hs 467701(ODC1), Accession No. Hs 467807(LAPTM4A), Accession No. Hs 467824(PUM2), Accession No. Hs 467960(RAB10), Accession No. Hs 468018(PPP1CB), Accession No. Hs 468415(PIGF), Accession No. Hs 468442(CALM2), Accession No. Hs 468760(AFTIPHILIN), Accession No. Hs 469022(DGUOK), Accession No. Hs 469171(DKFZP564D0478), Accession No. Hs 469331(STARD7), Accession No. Hs 469820(RALB), Accession No. Hs 469863(YWHAZ), Accession No. Hs 469925(FLJ14346), Accession No. Hs 469970(SFRS4), Accession No. Hs 470091(YWHAE), Accession No. Hs 470233(ARL5), Accession No. Hs 470417, Accession No. Hs 470477(PTP4A2), Accession No. Hs 470577(EIF2S2), Accession No. Hs 470588(KPNA6), Accession No. Hs 470943(STAT1), Accession No. Hs 471011(SF3B1), Accession No. Hs 471104(NOP5/NOP58), Accession No. Hs 471207(NDUFS1), Accession No. s 471441(PSMB2), Accession No. Hs 471461(ACSL3), Accession No. Hs 471593(CAB39), Accession No. Hs 471768(MGC4796), Accession No. Hs 471818(M11S1), Accession No. Hs 471851(HDLBP), Accession No. Hs 471873(DTYMK), Accession No. Hs 471933(FKBP1A), Accession No. Hs 471975(C20orf116), Accession No. Hs 472010(PRNP), Accession No. Hs 472024(C20orf30), Accession No. Hs 472031(UBE2D3), Accession No. Hs 472038(CGI-94), Accession No. Hs 472056(SYNCRIP), Accession No. Hs 472119(MKKS), Accession No. Hs 472185(NDUFS5), Accession No. Hs 472213(RRBP1), Accession No. Hs 472330(C20orf3), Accession No. Hs 472475(MACF1), Accession No. Hs 472535(AKIP), Accession No. Hs 472558(SDBCAG84), Accession No. Hs 472651(BLCAP), Accession No. Hs 472737(TOP1), Accession No. Hs 473296(TPD52L2), Accession No. Hs 473583(NSEP1), Accession No. Hs 473648(GART), Accession No. Hs 473721(SLC2A1), Accession No. Hs 473761(RTN3), Accession No. Hs 473788(OTUB1), Accession No. Hs 474005(SUMO3), Accession No. Hs 474010(PTTG1IP), Accession No. Hs 474053(COL6A1), Accession No. Hs 474083(B4GALT2), Accession No. Hs 474213(UFD1L), Accession No. Hs 474584(AKR1A1), Accession No. Hs 474643(HSPC117), Accession No. Hs 474751(MYH9), Accession No. Hs 474833(CSNK1E), Accession No. Hs 474914(RUTBC3), Accession No. Hs 474938(SLC25A17), Accession No. Hs 474949(RBX1), Accession No. Hs 474982(ACO2), Accession No. Hs 475125(ATXN10), Accession No. Hs 475319(LRRFIP2), Accession No. Hs 475382(FLJ122405), Accession No. Hs 475392(L0055831), Accession No. Hs 475663(RAB5A), Accession No. Hs 475733(TOP2B), Accession No. Hs 475812(SIMP), Accession No. Hs 476018(CTNNB1), Accession No. Hs 476033(TLP19), Accession No. Hs 476179(SMARCC1), Accession No. Hs 476221(IHPK2), Accession No. Hs 76231(IMPDH2), Accession No. Hs 476308(ALAS1), Accession No. Hs 476365(SCP2), Accession No. Hs 476448(FLNB), Accession No. Hs 476706(MRPL37), Accession No. Hs 476930(DKFZP564O123), Accession No. Hs 477157(DULLARD), Accession No. Hs 477789(ATP1B3), Accession No. Hs 477892(GYG), Accession No. Hs 478000(MBNL1), Accession No. Hs 478044(PA2G4), Accession No. Hs 478553(EIF4A2), Accession No. Hs 479208(FBXL5), Accession No. Hs 479264(LAP3), Accession No. Hs 479634(SLC30A9), Accession No. Hs 479693(SFRS11), Accession No. Hs 479728(GAPD), Accession No. Hs 479747(BCAR1), Accession No. Hs 479814(POLR2B), Accession No. Hs 480073(HNRPD), Accession No. Hs 480311(PDLIM5), Accession No. Hs 480465(SCYE1), Accession No. Hs 80653(ANXA5), Accession No. Hs 481571(UQCRH), Accession No. Hs 481720(MYO10), Accession No. Hs 481898(KAT3), Accession No. Hs 482144(RPL26), Accession No. Hs 482363(SLC30A5), Accession No. Hs 482526(TINP1), Accession No. Hs 482868(KIAA0372), Accession No. Hs 483036(PJA2), Accession No. Hs 483067(C5orf13), Accession No. Hs 483305(HINT1), Accession No. Hs 483408(PPP2CA), Accession No. Hs 483454(CNN3), Accession No. Hs 483486(JMJD1B), Accession No. Hs 484138(FBXW11), Accession No. Hs 484188(ATP6V0E), Accession No. 484242(ETEA), Accession No. Hs 484288(DDX41), Accession No. Hs 484363(RNF130), Accession No. Hs 484551(CPM), Accession No. Hs 484813(DEK), Accession No. Hs 485155(RPL35), Accession No. Hs 485195(SORT1), Accession No. Hs 485246(PSMA5), Accession No. Hs 485262(MTCH1), Accession No. Hs 485365(AHCYL1), Accession No. Hs 485616(DST), Accession No. Hs 486542(BCLAF1), Accession No. Hs 487027(VIL2), Accession No. Hs 487054(TCP1), Accession No. Hs 487635(BZW2), Accession No. Hs 487774(HNRPA2B1), Accession No. Hs 488171(KIAA1068), Accession No. Hs 488181(OGDH), Accession No. Hs 488307(DKFZP564K0822), Accession No. Hs 488478(FLJ10099), Accession No. Hs 488671(BAZ1B), Accession No. Hs 489207(ASNS), Accession No. Hs 489284(ARPC1B), Accession No. Hs 489287(CPSF4), Accession No. Hs 489336(SYAP1), Accession No. Hs 489615(PBEF1), Accession No. Hs 490203(CALD1), Accession No. Hs 490394(SSBP1), Accession No. Hs 490415(ZYX), Accession No. Hs 490745(DNAJB6), Accession No. Hs 490795(CHR2SYT), Accession No. Hs 490874(MTX1), Accession No. Hs 491336(ELP3), Accession No. Hs 491359(LMNA), Accession No. Hs 491440(PPP2CB), Accession No. Hs 491494(CCT3), Accession No. Hs 491597(VDAC3), Accession No. Hs 491695(UBE2V2), Accession No. Hs 491745(TCEA1), Accession No. Hs 491988(TRAM1), Accession No. Hs 492236(WDR42A), Accession No. Hs 492314(LAPTM4B), Accession No. Hs 492445(EDD), Accession No. Hs 492599(EIF3S3), Accession No. Hs 492805(CGI-07), Accession No. Hs 493362(AK3L1), Accession No. Hs 493750(WDR40A), Accession No. Hs 494173(ANXA1), Accession No. Hs 494419(LAMP1), Accession No. Hs 494457(NINJ1), Accession No. Hs 494604(ANP32B), Accession No. Hs 494614(XTP2), Accession No. Hs 494691(PFN1), Accession No. Hs 494700(CDW92), Accession No. Hs 494985(FBXW2), Accession No. Hs 495039(NDUFA8), Accession No. Hs 495349(KIAA0515), Accession No. Hs 495471(PMPCA), Accession No. Hs 495605(CD99), Accession No. Hs 495851(MGC4825), Accession No. Hs 495960(ATP6AP2), Accession No. Hs 496068(PCTK1), Accession No. Hs 496098(DKFZp761A052), Accession No. Hs 496271, Accession No. Hs 496487(ATF4), Accession No. Hs 496646(IL13RA1), Accession No. Hs 496684(LAMP2), Accession No. Hs 497183(IVNS1ABP), Accession No. Hs 497599(WARS), Accession No. Hs 497692(C1orf48), Accession No. Hs 497893(ENAH), Accession No. Hs 498239(FH), Accession No. Hs 498313(ADSS), Accession No. Hs 498317(PNAS-4), Accession No. Hs 498455(KIAA0217), Accession No. Hs 498548(RBM17), Accession No. Hs 498727(DHCR24), Accession No. Hs 499145(YME1L1), Accession No. Hs 499158(GGA1), Accession No. Hs 499594(TIMM23), Accession No. Hs 499833(C10orf74), Accession No. Hs 499891(HNRPH3), Accession No. Hs 499925(VPS26), Accession No. Hs 499960(SARA1), Accession No. Hs 500067(PPP3CB), Accession No. Hs 500101(VCL), Accession No. Hs 500375(ENTPD6), Accession No. Hs 500409(GLUD1), Accession No. Hs 500546(IDE), Accession No. Hs 500674(SMBP), Accession No. Hs 500775(ZNF207), Accession No. Hs 500842(MGEAS), Accession No. Hs 500874(CUEDC2), Accession No. Hs 501012(ADD3), Accession No. Hs 501023(MXI1), Accession No. Hs 501203(TIAL1), Accession No. Hs 501293(BSG), Accession No. Hs 501309(CIRBP), Accession No. Hs 501353(PLEKHJ1), Accession No. Hs 501376(UROS), Accession No. Hs 501420(NCLN), Accession No. Hs 501629(IER2), Accession No. Hs 501684(NAP1L4), Accession No. Hs 501735(STIM1), Accession No. Hs 501853(C11orf15), Accession No. Hs 501924(USP47), Accession No. Hs 501991(MLSTD2), Accession No. Hs 502302(CAT), Accession No. Hs 502328(CD44), Accession No. Hs 502461(DGKZ), Accession No. Hs 502528(NDUFS3), Accession No. Hs 502630(C11orf31), Accession No. Hs 502659(RHOC), Accession No. Hs 502705(PRP19), Accession No. Hs 502745(FADS2), Accession No. Hs 502769(SLC3A2), Accession No. Hs 502773(MTCBP-1), Accession No. Hs 502823(PRDX5), Accession No. Hs 502829(SF1), Accession No. Hs 502836(ARL2), Accession No. Hs 502842(CAPN1), Accession No. Hs 502872(MAP3K11), Accession No. Hs 502876(RHOB), Accession No. Hs 503093(ZFP36L2), Accession No. Hs 503222(RAB6A), Accession No. Hs 503251(PME-1), Accession No. Hs 503597(HSPC148), Accession No. Hs 503709(PORIMIN), Accession No. Hs 503716(MGC2714), Accession No. Hs 503787(DARS), Accession No. Hs 504237(ITM1), Accession No. Hs 504517(RPS27), Accession No. Hs 504613(PTMS), Accession No. Hs 504620(REA), Accession No. Hs 504687(MYL9), Accession No. Hs 504828(DDX47), Accession No. Hs 504895(STRAP), Accession No. Hs 505033(KRAS2), Accession No. Hs 505059(PSMD4), Accession No. Hs 505625(C12orf10), Accession No. Hs 505652(COPZ1), Accession No. Hs 505676(CIP29), Accession No. Hs 505705(MYL6), Accession No. Hs 505806(PBXIP1), Accession No. Hs 505824(CGI-51), Accession No. Hs 506215(RARS), Accession No. Hs 506325(NUDT4), Accession No. Hs 06759(ATP2A2), Accession No. Hs 506861(DDX54), Accession No. Hs 507074(KIAA0152), Accession No. Hs 507162(FLJ12750), Accession No. Hs 507584(MGC9850), Accession No. Hs 507680(PFAAP5), Accession No. Hs 507910(PGRMC2), Accession No. Hs 507916(TGFB114), Accession No. Hs 508010(FNDC3A), Accession No. Hs 508644(FLJ10154), Accession No. Hs 509163(KIAA1181), Accession No. Hs 509226(FKBP3), Accession No. Hs 509264(KLHDC2), Accession No. Hs 509414(KTN1), Accession No. Hs 509622(RGL2), Accession No. Hs 509736(HSPCB), Accession No. Hs 509791(ERH), Accession No. Hs 509909(NUMB), Accession No. Hs 510087(ENSA), Accession No. Hs 510328(DDX24), Accession No. Hs 510402(MCP), Accession No. Hs 511067(FLJ10579), Accession No. Hs 511138(DKFZP564G2022), Accession No. Hs 511149(SNAP23), Accession No. Hs 511425(SRP9), Accession No. Hs 511504(TCF12), Accession No. Hs 511862, Accession No. Hs 511952(CBX6), Accession No. Hs 512005(ARPC3), Accession No. Hs 512465(SURF4), Accession No. Hs 512525(RPS17), Accession No. Hs 512607(MIR16), Accession No. Hs 512640(PRKCSH), Accession No. Hs 512661(KIAA1160), Accession No. Hs 512676, Accession No. Hs 512693(FLJ120859), Accession No. Hs 512756(THAP7), Accession No. Hs 512815(AP3D1), Accession No. Hs 512857(CD151), Accession No. Hs 512867(H63), Accession No. Hs 512908(ARPP-19), Accession No. Hs 513043(C15orf12), Accession No. Hs 513055(REC14), Accession No. Hs 513057(RANBP5), Accession No. Hs 513058(TMED3), Accession No. Hs 513071(MESDC1), Accession No. Hs 513083(RPL9), Accession No. Hs 513141(IDH2), Accession No. Hs 513145(NEUGRIN), Accession No. Hs 513153(FURIN), Accession No. Hs 513230(MRPL28), Accession No. Hs 513242(RHOT2), Accession No. Hs 513261(C16orf34), Accession No. Hs 513266(NDUFB10), Accession No. Hs 513470(NFATC2IP), Accession No. Hs 513488(MVP), Accession No. Hs 513490(ALDOA), Accession No. Hs 513520(BCKDK), Accession No. Hs 513522(FUS), Accession No. Hs 513631(ARL2BP), Accession No. Hs 513856(DPH2L1), Accession No. Hs 513984(FLII), Accession No. Hs 514012(MAP2K3), Accession No. Hs 514036(SDF2), Accession No. Hs 514038(FLOT2), Accession No. Hs 514174(JUP), Accession No. Hs 514196(RPL27), Accession No. Hs 514211(MGC4251), Accession No. Hs 514216(CGI-69), Accession No. Hs 514220(GRN), Accession No. Hs 514297(FLJ13855), Accession No. Hs 514303(PHB), Accession No. Hs 514435(SF3B3), Accession No. Hs 514489(WBP2), Accession No. Hs 514535(LGALS3BP), Accession No. Hs 514581(ACTG1), Accession No. Hs 514590(HGS), Accession No. Hs 514819(AP2B1), Accession No. Hs 514870(ATP5F1), Accession No. Hs 514920(NDP52), Accession No. Hs 514934(CAPZA1), Accession No. Hs 515003(C19orf6), Accession No. Hs 515005(STK11), Accession No. Hs 515018(GNA13), Accession No. Hs 515053(AES), Accession No. Hs 515070(EEF2), Accession No. Hs 515092(CLPP), Accession No. Hs 515155(MGC2803), Accession No. Hs 515162(CALR), Accession No. Hs 515164(GADD45GIP1), Accession No. Hs 515210(DNAJB1), Accession No. Hs 515255(LSM4), Accession No. Hs 515266(RENT1), Accession No. Hs 515271(SFRS14), Accession No. Hs 515329(RPL22), Accession No. Hs 515371(CAPNS1), Accession No. Hs 515406(AKT2), Accession No. Hs 515417(EGLN2), Accession No. Hs 515432(DEDD2), Accession No. Hs 515472(SNRPD2), Accession No. Hs 515475(SYMPK), Accession No. Hs 515487(CALM3), Accession No. Hs 515494(SLC1A5), Accession No. Hs 515500(SAE1), Accession No. Hs 515515(KDELR1), Accession No. Hs 515517(RPL18), Accession No. Hs 515524(NUCB1), Accession No. Hs 515540(PTOV1), Accession No. Hs 515550(LOC284361), Accession No. Hs 515598(PRPF31), Accession No. Hs 515607(PPP1R12C), Accession No. Hs 515642(GPSN2), Accession No. Hs 515785(BLVRB), Accession No. Hs 515846(RUVBL2), Accession No. Hs 515848(HADHB), Accession No. Hs 515890(YPEL5), Accession No. Hs 516075(TIA1), Accession No. Hs 516077(FLJ14668), Accession No. Hs 516087(TEX261), Accession No. Hs 516111(DCTN1), Accession No. Hs 516114(WBP1), Accession No. Hs 516157(MAT2A), Accession No. Hs 516450(FLJ120297), Accession No. Hs 516522(FLJ121919), Accession No. Hs 516539(HNRPA3), Accession No. Hs 516587(UBE2Q), Accession No. Hs 516633(NCKAP1), Accession No. Hs 516711(CHPF), Accession No. Hs 516790(ARHGEF2), Accession No. Hs 516807(STK25), Accession No. Hs 516826(TRIB3), Accession No. Hs 516855(CENPB), Accession No. Hs 517080(SLC35C2), Accession No. Hs 517106(CEBPB), Accession No. Hs 517134(C20orf43), Accession No. Hs 517145(ENO1), Accession No. Hs 517168(TAGLN2), Accession No. Hs 517216(PEA15), Accession No. Hs 517232(PEX19), Accession No. Hs 517240(IFNGR2), Accession No. Hs 517262(SON), Accession No. Hs 517293(FLJ1R), Accession No. Hs 517338(ATP6V1E1), Accession No. Hs 17342(DEDD), Accession No. Hs 517356(COL18A1), Accession No. Hs 517357(DGCR2), Accession No. Hs 517421(PCQAP), Accession No. Hs 517438(ASCC2), Accession No. Hs 517517(EP300), Accession No. Hs 517543(PES1), Accession No. Hs 517582(MCM5), Accession No. Hs 517622(UNC84B), Accession No. Hs 517641(L3MBTL2), Accession No. Hs 517666(DIA1), Accession No. Hs 517731(PP2447), Accession No. Hs 517768(DKFZP564B167), Accession No. Hs 517792(C3orf10), Accession No. Hs 517817(MGC3222), Accession No. Hs 517821, Accession No. Hs 517888(CRTAP), Accession No. Hs 517948(DHX30), Accession No. Hs 517949(MAP4), Accession No. Hs 517969(APEH), Accession No. Hs 517981(TUSC2), Accession No. Hs 518060(ARL6IP5), Accession No. Hs 518123(TFG), Accession No. Hs 518236(SEC61A1), Accession No. Hs 518244(RPN1), Accession No. Hs 518249(ZNF9), Accession No. Hs 518250(COPG), Accession No. Hs 518265(H41), Accession No. Hs 518326(SERP1), Accession No. Hs 518346(SSR3), Accession No. Hs 518374(QSCN6), Accession No. Hs 518424(NDUFB5), Accession No. Hs 518460(AP2M1), Accession No. Hs 518464(PSMD2), Accession No. Hs 518525(GLUL), Accession No. Hs 518551(RPL31), Accession No. Hs 518608(PP784), Accession No. Hs 518609(ARPC5), Accession No. Hs 518750(OCIAD1), Accession No. Hs 18805(HMGA1), Accession No. Hs 518827(CCNI), Accession No. Hs 519276(MAPKAPK2), Accession No. Hs 519304(PELO), Accession No. Hs 519346(ERBB2IP), Accession No. Hs 519347(SFRS12), Accession No. Hs 519520(RPS25), Accession No. Hs 519523(SERPINB6), Accession No. Hs 519557(TMEM14C), Accession No. Hs 519718(TTC1), Accession No. Hs 519756(STK10), Accession No. Hs 519818(MGAT1), Accession No. Hs 519909(MARCKS), Accession No. Hs 519930(C6orf62), Accession No. Hs 520026(VARS2), Accession No. Hs 520028(HSPA1A), Accession No. Hs 520037(NEU1), Accession No. Hs 520070(C6orf82), Accession No. Hs 520140(SRF), Accession No. Hs 520189(ELOVL5), Accession No. Hs 520205(EIF2AK1), Accession No. Hs 520210(KDELR2), Accession No. Hs 520287(C6orf111), Accession No. Hs 520313(CD164), Accession No. Hs 520383(STX7), Accession No. Hs 520421(PERP), Accession No. Hs 520459(GTF2I), Accession No. Hs 520623(C7orf27), Accession No. Hs 520640(ACTB), Accession No. Hs 520740(SCRN1), Accession No. Hs 520794(YKT6), Accession No. Hs 520898(CTSB), Accession No. Hs 520943(WBSCR1), Accession No. Hs 520967(MDH2), Accession No. Hs 520973(HSPB1), Accession No. Hs 520974(YWHAG), Accession No. Hs 521064(ZNF655), Accession No. Hs 521151(FLJ122301), Accession No. Hs 521289(REPIN1), Accession No. Hs 521487(MGC8721), Accession No. Hs 521640(RAD23B), Accession No. Hs 521809(COBRA1), Accession No. Hs 521903(LY6E), Accession No. Hs 521924(SIAHBP1), Accession No. Hs 521969(NDUFB11), Accession No. Hs 521973(WDR13), Accession No. Hs 522074(DSIPI), Accession No. Hs 522110(CREB3), Accession No. Hs 522114(CLTA), Accession No. Hs 522310(NANS), Accession No. Hs 522373(GSN), Accession No. Hs 522394(HSPA5), Accession No. Hs 522463(EEF1A1), Accession No. Hs 522507(FBXW5), Accession No. Hs 522584(TMSB4X), Accession No. Hs 522590(EIF1AX), Accession No. Hs 522632(TIMP1), Accession No. Hs 522665(MAGED2), Accession No. Hs 522675(FLJ12525), Accession No. Hs 522752(PSMD10), Accession No. Hs 522817(BCAP31), Accession No. Hs 522819(IRAK1), Accession No. Hs 522823(EMD), Accession No. Hs 522932(NCOA4), Accession No. Hs 522995(EIF4EBP2), Accession No. Hs 523004(PSAP), Accession No. Hs 523012(DDIT4), Accession No. Hs 523054(SMP1), Accession No. Hs 523131(TRAPPC3), Accession No. Hs 523145(DDOST), Accession No. Hs 523215(NDUFB8), Accession No. Hs 523238(NOLC1), Accession No. Hs 523262(C1orf8), Accession No. Hs 523299(EIF3S10), Accession No. Hs 523302(PRDX3), Accession No. Hs 523560(HSPCA), Accession No. Hs 523680(SSRP1), Accession No. Hs 523789(TncRNA), Accession No. Hs 523829(POLD4), Accession No. Hs 523836(GSTP1), Accession No. Hs 523852(CCND1), Accession No. Hs 523875(INPPL1), Accession No. Hs 524009(AASDHPPT), Accession No. Hs 524081(DPAGT1), Accession No. Hs 524084(RNF26), Accession No. Hs 524161(RSU1), Accession No. Hs 524171(RAD52), Accession No. Hs 524183(FKBP4), Accession No. Hs 524195(ARHGAP21), Accession No. Hs 524214(MLF2), Accession No. Hs 524219(TPI1), Accession No. Hs 524271(PHC2), Accession No. Hs 524367(CBARA1), Accession No. Hs 524395(TUBA3), Accession No. Hs 524464(ATP5G2), Accession No. Hs 524502(RNF41), Accession No. Hs 524530(CTDSP2), Accession No. Hs 524590(RAB21), Accession No. Hs 524599(NAP1L1), Accession No. Hs 524690(PPIE), Accession No. Hs 524788(RAB35), Accession No. Hs 524809(RSN), Accession No. Hs 524899(SAP18), Accession No. Hs 524920(ZFP91), Accession No. Hs 524969(Ufm1), Accession No. Hs 525134(FLJ120277), Accession No. Hs 525163(ANKRD10), Accession No. Hs 525232(LRP10), Accession No. Hs 525238(C14orf119), Accession No. Hs 525330(ARF6), Accession No. Hs 525391(FLJ120580), Accession No. Hs 525527(RER1), Accession No. Hs 525626(PACS1L), Accession No. Hs 525899(C6orf49), Accession No. Hs 526464(PML), Accession No. Hs 526521(MDH1), Accession No. Hs 527105(HNRPDL), Accession No. Hs 527193(RPS23), Accession No. Hs 527348(AKAP9), Accession No. Hs 527412(ASAH1), Accession No. Hs 527861(OS-9), Accession No. Hs 527862(PKD1), Accession No. Hs 527980(DUT), Accession No. Hs 528050(HARS), Accession No. Hs 528222(NDUFS4), Accession No. Hs 528300(PITRM1), Accession No. Hs 528305(DDX17), Accession No. Hs 528572(SCAM-1), Accession No. Hs 528668(RPL6), Accession No. Hs 528780(GSPT1), Accession No. Hs 528803(UQCRC2), Accession No. Hs 529059(EIF3S4), Accession No. Hs 529132(SEPW1), Accession No. Hs 529244(NCK2), Accession No. Hs 529280(ANAPC7), Accession No. Hs 529303(ARPC2), Accession No. Hs 529369(AFAP), Accession No. Hs 529400(IFNAR1), Accession No. Hs 529420(UBE2G2), Accession No. Hs 529591(TLOC1), Accession No. Hs 529618(TFRC), Accession No. Hs 529631(RPL35A), Accession No. Hs 529782(VCP), Accession No. Hs 529798(BTF3), Accession No. Hs 529862(CSNK1A1), Accession No. Hs 529890(CANX), Accession No. Hs 529892(SQSTM1), Accession No. Hs 529957(SEC63), Accession No. Hs 530096(EIF3S2), Accession No. Hs 530118(LUC7L2), Accession No. Hs 530291(ANXA11), Accession No. Hs 530314(SSNA1), Accession No. Hs 530331(PDHA1), Accession No. Hs 530381(PIM3), Accession No. Hs 530412(PAI-RBP1), Accession No. Hs 530436(STXBP3), Accession No. Hs 530479(PMF1), Accession No. Hs 530687(RNH), Accession No. Hs 530734(MRPL16), Accession No. Hs 530753(FLJ120625), Accession No. Hs 530823(COPS7A), Accession No. Hs 530862(PRKAG1), Accession No. Hs 531081(LGALS3), Accession No. Hs 531089(PSMA3), Accession No. Hs 531176(SARS), Accession No. Hs 531330(CBWD1), Accession No. Hs 531614(BTBD14B), Accession No. Hs 531752(RANBP3), Accession No. Hs 531856(GAS5), Accession No. Hs 531876(DNCL2A), Accession No. Hs 531879(RAD1), Accession No. Hs 532359(RPL5), Accession No. Hs 532399(KIAA0663), Accession No. Hs 532755(GTL3), Accession No. Hs 532790(NMT1), Accession No. Hs 532793(KPNB1), Accession No. Hs 532803(HN1), Accession No. Hs 532826(MCL1), Accession No. Hs 532853(NDUFB7), Accession No. Hs 533030(HRIHFB2122), Accession No. Hs 533059(TUBB), Accession No. Hs 533122(SFRS10), Accession No. Hs 533136(LRPAP1), Accession No. Hs 533192(TOMM20), Accession No. Hs 533222(HSA9761), Accession No. Hs 533245(DDX46), Accession No. Hs 533282(NONO), Accession No. Hs 533308(PPP2R5D), Accession No. Hs 533317(VIM), Accession No. Hs 533437(TCEB1), Accession No. Hs 533440(WWP1), Accession No. Hs 533474(PPP1R8), Accession No. Hs 533479(LYPLA2), Accession No. Hs 533526(ATRX), Accession No. Hs 533624(H3F3A), Accession No. Hs 533712(RBM4), Accession No. Hs 533732(SRP14), Accession No. Hs 533771(STUB1), Accession No. Hs 533782(KRT8), Accession No. Hs 533977(TXNIP), Accession No. Hs 533985(EXOC7), Accession No. Hs 533986(ZNF258), Accession No. Hs 534125(HLA-C), Accession No. Hs 534168(NDUFA1), Accession No. Hs 534212(SEC22L1), Accession No. Hs 534255(B2M), Accession No. Hs 534307(CCND3), Accession No. Hs 534314(EIF5A), Accession No. Hs 534326(ITGB4BP), Accession No. Hs 534338(PPP4C), Accession No. Hs 534346(RPS7), Accession No. Hs 534350(SMARCB1), Accession No. Hs 534453(GRIM19), Accession No. Hs 534456(ANAPC11), Accession No. Hs 534457(C14orf166), Accession No. Hs 534473(TOMM22), Accession No. Hs 534483(MGC2941), Accession No. Hs 536275(PACS1), Accession No. Hs 541269(NDUFB9), Accession No. Hs 546248(CTSD), Accession No. Hs 546250(DNCI2), Accession No. Hs 546253(FDFT1), Accession No. Hs 546261(HNRPA1), Accession No. Hs 546269(RPL10A), Accession No. Hs 546271(PCBP2), Accession No. Hs 546286(RPS3), Accession No. Hs 546289(RPS12), Accession No. Hs 546290(RPS18), Accession No. Hs 546291(NET-5), Accession No. Hs 546339(SMAP), Accession No. Hs 546356(RPL13A), Accession No. Hs 546394(HSPC016), Accession No. Hs 547759(SSBP3), Accession No. Hs 549178(C9orf86), Accession No. Hs 552590(HTF9C), Accession No. Hs 553496(PGM3), Accession No. Hs 553512(C3F), Accession No. Hs 554767(NUP88), Accession No. Hs 554776(SREBF1), Accession No. Hs 554894(FLJ12953), Accession No. Hs 554896(MGC11257), Accession No. Hs 555194(FAM36A), Accession No. Hs 555866(C1QBP), Accession No. Hs 555873(HNRPAB), Accession No. Hs 555875(IDH3A), Accession No. Hs 555889(PSMC2), Accession No. Hs 555890(RBBP4), Accession No. Hs 555911(RBM8A), Accession No. Hs 555969(RIC8), Accession No. Hs 555971(PP1201), Accession No. Hs 555973(MRPS25), Accession No. Hs 555994(LONP), Accession No. Hs 556267(FBXL10), Accession No. Hs 556461(NDUFV2), Accession No. Hs 556795(PAIC5), Accession No. Hs 557550(NPM1), Accession No. Hs 558296(ACP1), Accession No. Hs 558313(COX6A1), Accession No. Hs 558322(EEF1B2), Accession No. Hs 558325(EIF5), Accession No. Hs 558328(FKBP5), Accession No. Hs 558330(FTL), Accession No. Hs 558338(HSPE1), Accession No. Hs 558345(1K), Accession No. Hs 558354(LAMR1), Accession No. Hs 558360(NDUFB4), Accession No. Hs 558361(NME2), Accession No. Hs 558362(NUMA1), Accession No. Hs 558376(RAC1), Accession No. Hs 558381(RNU65), Accession No. Hs 558382(RPL15), Accession No. Hs 558383(RPL18A), Accession No. Hs 558384(RPL19), Accession No. Hs 558385(RPL23A), Accession No. Hs 558386(RPL34), Accession No. Hs 558388(RPS3A), Accession No. Hs 558389(RPS8), Accession No. Hs 558390(RPS24), Accession No. Hs 558391(RPS26), Accession No. Hs 558396(SCD), Accession No. Hs 558424(CSDA), Accession No. Hs 558426(EIF3S5), Accession No. Hs 558429(G10), Accession No. Hs 558431(RPL14), Accession No. Hs 558442(PDCD6IP), Accession No. Hs 558448(TXNL2), Accession No. Hs 558453(ATP5L), Accession No. Hs 558454(NUDC), Accession No. Hs 558458(COPS8), Accession No. Hs 558473(C18orf10), Accession No. Hs 558499(8D6A), Accession No. Hs 558511(PSARL), Accession No. Hs 558521(C2orf33), Accession No. Hs 558591(ORMDL1), Accession No. Hs 558825(PDE4DIP), Accession No. Hs 558995, Accession No. Hs 567260(CD2BP2), Accession No. Hs 567263(C1orf43), Accession No. Hs 567267(ATP2C1) and Accession No. Hs 567279(HCNGP). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the candidate reference gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 bp, corresponding to a sense or antisense sequence of the selected candidate reference gene, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 bp in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, the primers used in the present invention can be any length. The primers may be designed using a well-known primer design program. Additionally, the primers are not limited as to their position on the gene, as long as they can be used in the amplification of the gene.

In contrast to previously reported traditional HKGs, in which genes encoding metabolism and ribosome proteins are contained in high proportions (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsiao L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found at a high proportion within the candidate ERGs when they are classified by FunCat (Functional Classification Catalogue, Version 2.0, Ruepp A et al., Nucleic Acids Res 32:5539-45, 2004) (see FIG. 2). Further, analysis on the 2,087 genes shows a high frequency of CpG islands, which is in line with the results of previous reports (Larsen F et al., Genomics 13:1095-107, 1992; Ponger L et al., Genome Res 11:1854-60, 2001) (see TABLE 1).

Moreover, the genes can be detected using microarray, SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR). Out of the genes, the most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (see Table 2).

In addition, the reference genes selected and identified according to the present invention are adopted as candidate reference genes which may be useful in the analysis of the genes of interest through the validation of expression stability.

In accordance with a further aspect thereof, the present invention provides a method for quantifying an expression level of a gene of interest, comprising:

1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

In accordance with still a further aspect thereof, the present invention provides a method for selecting guide genes, comprising measuring the selected candidate endogenous reference genes for coefficient of variation (CV) and ranking the endogenous reference genes in an ascending order of CV.

In an embodiment, the guide genes are expressed in most human body tissues. The guide genes can be used to normalize expression levels for relative quantification of gene expression between different samples. The higher the coefficient of variation (CV) is, the more greatly the gene expression varies from one tissue to another.

CVs of the candidate reference genes, selected using the selection method of the present invention, were calculated for each UniGene cluster in the datasets including EST, ShortSAGE, LongSAGE and microarray, and the genes were arranged in ascending order of CV. From the candidate ERG were selected the reference genes which were found to be stably expressed across a wide range of tissues. Out of the 400 genes (corresponding to about 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs common to all four datasets were selected (see FIG. 1 and Table 3). The 13 reference genes are identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

In other words, the reference genes are genes that show lower expression variations than do the other genes among the 2,087 genes expressed in most tissues. The reference genes identified according to the present invention are expressed in a manner similar to that in which the majority of the intracellular transcripts are expressed at low abundance.

In an aspect of gene expression level and CV, the 13 reference genes identified according to the present invention were compared with 13 traditional reference genes (see Table 4). In all datasets, six of the 13 traditional reference genes showed relatively high mean expression levels, while the other traditional reference genes indicated expression levels similar to or lower than those of the reference genes of the present invention. In terms of both expression level and CV, the traditional reference genes are generally greater than the endogenous reference genes of the present invention (see FIGS. 6 and 7).

In order to validate the suitability of the 13 genes for reference genes, they were examined for gene copy number variation with reference to the Database of Genomic Variants(//projects.tcag.ca/variation/)(see Table 5). As a result, only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found on chromosome regions known for gene copy variation, whereas many (ACTB, GAPDH, PGK1, B2M, TBP, TFRC, ALAS1) of the traditional reference genes were located in such chromosome regions.

Furthermore, the quantitative real-time RT-PCR (qRT-PCR) analysis (see Table 7) of ERG on human tissue samples and cancer cell lines (see Table 6) indicated that the 13 novel ERGs were expressed in all 48 samples, including frozen human tissues and cancer cell lines (see FIG. 8). The novel 13 ERGs ranged from 19 to 29 in Cp (Crossing Point, the cycle number at which fluorescence crosses the background signal upon qRT-PCR) (see FIG. 9). In addition, using geNorm v3.4 software (Vandesompele J et al., Genome Biol 3:RESEARCH0034, 2002) and NormFinder software (Andersen C L et al., Cancer Res 64:5245-50, 2004), ERGs were analyzed for expression stability according to the following Mathematical Formula 4 in consideration of the efficiency of the PCR performed above (see Table 8). All of the 13 novel ERGs according to the present invention were found to show higher expression stability than were the traditional ERGs as calculated by the geNorm and NormFinder programs (see Table 9). In Table 9, lower expression stability values (M by geNorm, S by NormFinder) mean more stable expression.Relative Expression=(1+E)^ΔCp  <Mathematical Formula 4>

• • ΔCp=Minimum Cp−Sample Cp;
  • Minimum Cp=lowest Cp value; and
  • E=PCR Efficiency

There was no significant correlation between the M values, which were calculated with geNorm (M) and CV in microarray and LongSAGE datasets, but significance was found in EST and ShortSAGE datasets. Likewise, as for the stability values(S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed highest agreement with CV in ShortSAGE (see Table 10).

These results indicate that the reference genes identified according to the present invention are more stably expressed than are the traditional reference genes.

In consideration of the fact that the majority of intracellular transcripts are expressed in low abundance (Warrington J A et al., Physiol Genomics 2(3):143-147, 2000), traditional reference genes, having high expression levels, may not be suitable for use in normalization. A reference gene with an expression level similar to that of a target gene is recommended, so that the measurement can be done on the same linear scale (Szabo A et al., Genome Biol 5(8):R59, 2004; RocheAppliedScience Technical Note No. LC 15/2005). Therefore, the endogenous reference genes identified according to the present invention are believed to be more suitable and widely used because they show relatively lower expression and lower variability than do the traditional reference genes (Czechowski T et al., Plant Physiol 139(1):5-17, 2005).

In accordance with still another aspect thereof, the present invention provides a composition for detecting at least one of the guide genes identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

In an embodiment of this aspect, the guide genes feature low expression levels, like most low-abundance intracellular transcripts. The guide gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the guide gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 bp corresponding to sense or antisense sequence of the identified guide genes, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 bp in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, any length of primers can be used in the present invention. The primers may be designed using a well-known primer design program. Additionally, the primers are not limited by the position on the gene as long as they can be used in the amplification of the gene.

In addition, the detection method is preferably conducted using microarray, SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR).

In accordance with yet a further aspect thereof, the present invention provides a method for quantifying an expression level of a target gene, comprising:

1) synthesizing cDNA from RNA of a subject;

2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

In accordance with yet another aspect thereof, the present invention provides a method for identifying the amplification of a target gene in genomic DNA, comprising:

1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a subject serving as a template and than performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

[Mode For Invention]

A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed as the limit of the present invention.

EXAMPLE 1

Gene Expression Dataset Construction

EST (expressed sequence tag) and SAGE (serial analysis of gene expression) human gene expression data were collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/). Microarray gene expression data were obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set.

Out of a total of 8,633 libraries in Hs_LibData.dat (31/Oct/05) file, 77 libraries meeting the requirements: 1) non-normalized and 2)>10,000 sequences, were included in the EST dataset constructed from the CGAP site. EST frequency in each library was obtained from Hs_ExprData.dat (31/Oct/05) file. 29 different tissues, including normal and tumor samples, and 26,117 UniGene clusters were included in these libraries.

SAGE short data for all 280 libraries (Hs_short.frequencies.gz, 05/Dec/06), representing 38,290 UniGene clusters, and SAGE long data (Hs_long.frequencies.gz, 05/Dec/06) for 46 libraries, representing 21,868 UniGene clusters, were used in creating the dataset for SAGE short (ShortSAGE) and long (LongSAGE), respectively. Also, SAGE tags were mapped to UniGene clusters using the files Hs_short.best_gene.gz (05/Dec/06) and Hs_long.best_gene.gz (05/Dec/06). ShortSAGE and LongSAGE contained information on SAGE expression in 28 and 9 different tissues, including normal and tumor samples, respectively.

Affymetrix GeneChips gene expression data from 567 different samples representing 13 different tissues including the brain, the breast, the colon, the esophagus, the kidney, the liver, the lung, the lymph node, the ovary, the pancreas, the prostate, the rectum and the stomach were also analyzed (Table 11). Affymetrix (CA) HG-U133 and 44,760 different probe sets (total 44,928 probe sets) were included in the microarray dataset.

EXAMPLE 2

Selection of Candidate ERG

Using the datasets constructed in Example 1, expression level was calculated for UniGene clusters so as to search for housekeeping genes which are constitutively expressed in most human tissues.

Gene expression levels of EST dataset for each gene were calculated as the number of ESTs of a gene in a given library, divided by the total number of ESTs in all genes in a given library and then multiplied by 1,000,000, as expressed by Mathematical Formula 1.

Likewise, Gene expression levels of SAGE dataset for each gene were calculated as the number of tags (sum of tag frequency) of a gene in a given library, divided by the total number of tags and then multiplied by 1,000,000, as expressed by Mathematical Formula 2.

$\begin{array}{cc}\mathrm{ETS}\mathrm{gene}\mathrm{expression}=\frac{\begin{array}{c}\mathrm{No}\mathrm{of}\mathrm{EST}\mathrm{of}a\mathrm{Given}\\ \mathrm{Gene}\mathrm{in}\mathrm{Library}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{ESTs}\mathrm{in}\mathrm{Library}}\times 1\text{,}000\text{,}000& <\mathrm{Mathematical}\mathrm{Formula}1>\\ \mathrm{SAGE}\mathrm{gene}\mathrm{expression}=\frac{\begin{array}{c}\mathrm{No}\mathrm{of}\mathrm{Tags}\mathrm{of}a\mathrm{Given}\\ \mathrm{Gene}\mathrm{in}\mathrm{Library}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tags}\mathrm{in}\mathrm{Library}}\times 1\text{,}000\text{,}000& <\mathrm{Mathematical}\mathrm{Formula}2>\end{array}$

Expression levels in Microarray dataset were represented by the signal intensity calculated for each transcript by the analysis algorithm of Affymetrix Microarray Suite 5.0. Mean gene expression was defined as the average of gene expression level of a given gene in all libraries.

HKGs for use in identifying endogenous reference genes, which are expressed in most human tissues, were investigated using EST and SAGE datasets. In order to examine whether a given gene might be an HKG which is constitutively expressed across a wide range of tissues, the proportion of the tissues not expressing the given gene to the total tissues of the EST and SAGE datasets was calculated. If gene expression frequency is found in any one library of multiple libraries corresponding to one tissue, that gene was considered to be expressed in that tissue. For this, the 0's proportion, which is defined as the ratio of the number of the tissues in which a given gene was not expressed to the total number of tissues, was introduced. In the 0's proportion, “0” indicates that the gene is expressed in all tissues, and conversely, “1” means that the gene is not expressed in any tissue.

$\begin{array}{cc}0\text{'}s\mathrm{Proportion}=\frac{\begin{array}{c}\mathrm{No}.\mathrm{of}\mathrm{Tissues}\mathrm{with}\mathrm{No}\\ \mathrm{Expression}\mathrm{of}a\mathrm{Given}\mathrm{Gene}\end{array}}{\mathrm{Total}\mathrm{No}.\mathrm{of}\mathrm{Tissues}}& <\mathrm{Mathematical}\mathrm{Formula}3>\end{array}$

In a study of 101 samples obtained from 47 different human tissues and cell lines, cutoff values for the 0's proportion were determined in each of EST and SAGE datasets so as to include most of the 575 housekeeping genes identified from previous microarray data using the Affymetrix U95A chip (CA), containing 2,600 probes (Eisenberg E and Levanon E Y, Trends Genet, 19(7), 362-365, 2003). Genes with 0's proportion<0.4 for EST (EST, 4,027 UniGene clusters), 0.1 for ShortSAGE (4,758 UniGene clusters) and 0.3 for LongSAGE (4,569 UniGene clusters) were sorted. 2,087 genes common to the three datasets were selected

Out of the 575 genes obtained by U95A, 451(78.43%) in EST, 432(75.13%) in ShortSAGE, and 446(77.57%) in LongSAGE were included in the selected housekeeping genes, respectively. A majority of the 575 HKGs was found to have low 0's proportion in the constructed datasets, EST, ShortSAGE and LongSAGE even though some genes showed the 0's proportion greater than 0.5 unexpectedly. Traditional reference genes like RPLP0, ACTB, PPIA, GAPDH, PGK1, B2M and were TFRC also found in the 2,087 genes.

The mean gene expression value and CV (%) of the housekeeping genes selected from the EST and SAGE datasets were calculated in the microarray dataset (Affymetrix HG-U133, CA). The microarray expression data of 5,238 different probe sets (gene expression data for 5,317 fragments, 1,990 UniGene clusters) corresponding to the selected HKGs were obtained.

UniGene clusters were used to allow respective gene probes to correspond thereto in the datasets. On the chip set HG-U133 were found cases where multiple probe sets, which show various expression intensities, correspond to one gene or UniGene cluster. In such cases, one probe set for one UniGene cluster, showing the lowest CV among several probe sets, was selected.

The 2,087 HKGs obtained above were categorized as “candidate ERGs” or “candidate reference genes” in accordance with the present invention.

EXPERIMENTAL EXAMPLE 1

Analysis of Candidate ERG

<1-1> Functional Classification of Candidate ERG

Using FunCat (Functional Classification Catalogue, Version 2.0, Ruepp, A., et al. Nucleic Acids Res, 32, 5539-45, 2004), the 2,087 genes obtained above were classified.

Out of the 2,087 candidate ERGs, 1,689 UniGene clusters were associated with GO terms allocated to MIPS (Munich Information Center for Protein Sequences) FunCat (Functional Catalogue). Among the 1,689 UniGene clusters, 1,318 UniGene clusters were functionally classified to be associated with GO terms corresponding to biological processes. These 1,318 genes were identified to be involved in various basic cellular functions. While a high proportion of the previously reported traditional HKGs encode metabolism and ribosome proteins (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsiao L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found in large amounts in the candidate ERGs (FIG. 2).

<1-2> Analysis of Candidate ERGs for CpG Island

Sequences upstream of the annotated transcription start site of the ERGs according to the present invention were obtained from the UCSC site (//hgdownload.cse.ucsc.edu/goldenPath/hg18/bigZips/). CpG islands located 1,000, 2,000 and 5,000 bp upstream of the transcription start points on the basis of a DNA sequence longer than 500 bp, and having a G+C content of 55% and a CpG observed/expected ratio of 0.65 (Takai D & Jones P A Proc Natl Acad Sci USA, 99, 3740-5, 2002), were searched for using CpGIE software (Wang, Y & Leung, F C Bioinformatics, 20, 1170-7, 2004).

The Z-test (R program, //www.R-project.org) was applied to assess whether there was a statistical significance of differences in the frequency of genes with CpG island between the candidate ERGs and non-candidate ERGs. P<0.05 was considered to be significant.

In line with the previous reports (Larsen, F., et al., Genomics, 13, 1095-107. 1992; Ponger, L., et al., Genome Res, 11, 1854-60. 42, 2001), most candidate ERGs were found to show high frequencies of CpG islands in upstream sequences (1000 bp; 70%, 2000 bp; 73%, 5000 bp; 76%). In contrast, CpG islands were found at low frequencies in the upstream sequences of non-candidate ERGs (p<0.001, Table 1).

TABLE 1
Comparison of the Proportion of Genes with CpG Islands
in Upstream Sequences of the transcription start
site in Candidate ERG and Non-Candidate ERG
	Candidate ERG	Non-Candidate ERG
	(No. = 2002)	(No. = 14848)
		Ratios of		Ratios of
Upstream	No. of	Genes with	No. of	Genes with
Bp	Genes	CpG Islands	Genes	CpG Islands	p-values
5000	1516	76%	8036	54%	<0.001
2000	1456	73%	7410	50%	<0.001
1000	1410	70%	7048	47%	<0.001

EXPERIMENTAL EXAMPLE 2

Correlation Analysis

Correlation analysis was performed using a correlation coefficient, which indicates linear association between two groups, with a significance level of p<0.05. All calculations and scatter plots were produced with the statistical analysis program R-Package (//www.r-project.org).

First, Pearson and Spearman's rank correlation analysis were performed to compare the candidate ERGs selected from the four datasets in terms of gene expression and CV. FIG. 3 is a scatter plot of gene expression for the four datasets of the candidate ERGs. It was observed that there was a significant correlation of expression values between all four datasets. ShortSAGE versus LongSAGE showed the highest Spearman correlation coefficient of 0.853 (p<0.0001) and the lowest Spearman correlation of 0.339 between EST and Microarray (p<0.0001).

Next, the coefficient of variation (CV, %) was computed to investigate the consistency of the expression level of the candidate ERGs across various libraries in each dataset. Pearson and Spearman's rank correlation analyses were performed on the CV thus obtained, indicating that the CV was less similar between datasets (Spearman correlation coefficient<0.5) than was the gene expression level although a significant correlation was still found (p≤0.001)(FIG. 4).

These results may be attributed to the difference in the kind and number of samples between datasets because expression levels may vary depending on the kind and number of the samples.

EXPERIMENTAL EXAMPLE 3

Comparison Between Candidate ERG and Non-Candidate ERG

A t-test was conducted to examine whether there was a significant difference in mean gene expression between candidate ERG and non-candidate ERG. FIG. 5 shows the distribution of the gene expressions of candidate ERG and non-candidate ERG for each dataset. As was expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-candidate ERGs in all four datasets (p<0.0001). These results are in line with previous reports (Eisenberg E and Levanon E Y, Trends Genet, 19(7), 362-365, 2003).

Gene expression levels were found to range from 73.83 to 9324.87 in EST, from 28.58 to 4086.25 in ShortSAGE, from 17.47 to 4621.60 in LongSAGE, and from 1.47 to 18598.26 in HG-U133 microarray. A significant number of genes encoding ribosomal proteins showed the highest expression levels in all four datasets. The most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (Table 2)

TABLE 2
A list of 2087 candidate endogenous reference genes
UniGene		EST
cluster	Symbol	Gene Names	Mean	CV	0's P
120	PRDX6	Peroxiredoxin 6	458.61	113.71	0.034
142	SULT1A1	Sulfotransferase family, cytosolic, 1A, phenol-preferring, member	1248.16	105.30	0.241
202	TSPO	translocator protein	198.55	80.83	0.207
429	ATP5G3	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	211.73	76.87	0.103
		c (subunit 9) isoform 3
695	CSTB	Cystatin B (stefin B)	138.20	109.45	0.345
808	HNRPF	Heterogeneous nuclear ribonucleoprotein F	340.14	74.87	0.034
861	MAPK3	Mitogen-activated protein kinase 3	145.68	106.68	0.241
1063	SNRPC	Small nuclear ribonucleoprotein polypepticte C	171.26	77.26	0.276
1103	TGFB1	Transforming growth factor, beta 1 (Camurati-Engelmann disease)	197.32	110.45	0.345
2430	VPS72	Vacuolar protein sorting 72 homolog (S. cerevisiae)	117.28	76.90	0.241
2533	ALDH9A1	Aldehyde dehydrogenase 9 family, member A1	119.81	68.68	0.207
2795	LDHA	Lactate dehydrogenase A	723.58	109.92	0.034
2853	PCBP1	Poly(rC) binding protein 1	203.55	81.02	0.103
3100	KARS	Lysyl-tRNA synthetase	242.90	76.66	0.138
3254	MRPL23	Mitochondrial ribosomal protein L23	105.59	58.85	0.379
3353	G3BP1	GTPase activating protein (SH3 domain) binding protein 1	221.63	105.29	0.138
3416	ADFP	Adipose differentiation-related protein	250.88	167.90	0.241
3439	STOML2	Stomatin (EPB72)-like 2	303.44	78.37	0.069
3530	FUSIP1	FUS interacting protein (serine/arginine-rich) 1	188.96	77.05	0.138
3989	PLXNB2	Plexin B2	365.44	108.04	0.138
4055	KLF6	Kruppel-like factor 6	258.77	121.39	0.276
4742	GPAA1	GPAA1P anchor attachment protein 1 homolog (yeast)	334.17	107.33	0.207
4747	DKC1	Dyskeratosis congenita 1, dyskerin	232.08	109.39	0.138
4766	FAM32A	Family with sequence similarity 32, member A	182.68	72.56	0.138
4859	CCNL1	Cyclin L1	117.20	67.94	0.379
4997	RBM23	RHA binding motif protein 23	151.36	66.00	0.345
4998	TMOD3	Tropomodulin 3 (ubiquitous)	117.77	105.21	0.345
5062	TSPAN3	Tetraspanin 3	230.30	90.95	0.069
5086	RBM42	RNA binding motif protein 42	232.32	80.47	0.172
5120	DYNLL1	Dynein, light chain, LC8-type 1	202.21	103.08	0.103
5158	ILK	Integrin-linked kinase-2	154.41	64.84	0.138
5245	PIH1D1	PIH1 domain containing 1	300.56	124.75	0.207
5258	MAGED1	Melanoma antigen family D, 1	605.46	103.33	0.138
5268	ZDHHC4	Zinc finger, DHHC-type containing 4	105.02	62.27	0.345
5298	ADIPOR1	Adiponectin receptor 1	175.47	95.76	0.138
5308	UBA52	Ubiquitin A-52 residue ribosomal protein fusion product 1	482.46	229.44	0.103
5324	C2orf25	Chromosome 2 open reading frame 25	665.12	222.84	0.138
5345	RNPEPL1	Arginyl aminopeptidase (aminopeptidase B)-like 1	174.04	85.31	0.310
5662	GNB2L1	Guanine nucleotide binding protein (G protein), beta polypeptide 2	2888.02	78.73	0.000
		like 1
5710	CREG1	Cellular repressor of E1A-stimulated genes 1	186.09	125.07	0.241
5719	NCAPD2	Non-SMC condensin I complex, subunit D2	285.44	132.20	0.241
5912	FBXO7	F-box protein 7	203.36	91.84	0.207
5947	RAB8A	RAB8A, member RAS oncogene family	195.76	70.42	0.138
6396	JTB	Jumping translocation breakpoint	264.77	96.40	0.172
6454	GIPC1	GIPC PDZ domain containing family, member 1	283.16	100.25	0.069
6459	GPR172A	G protein-coupled receptor 172A	180.95	83.98	0.276
6551	ATP6AP1	ATPase, H+ transporting, lysosomal accessory protein 1	238.13	103.93	0.207
6891	SFRS6	Splicing factor, arginine/serine-rich 6	131.50	89.49	0.241
7101	ANAPC5	Anaphase promoting complex subunit 5	248.20	68.36	0.103
7236	NOSIP	Nitric oxide synthase interacting protein	160.80	86.71	0.310
7476	ATP6V0B	ATPase, H+ transporting, lysosomal 21 kDa, V0 subunit c″	179.43	84.77	0.241
7527	REXO2	REX2, RNA exonuclease 2 homolog (S. cerevisiae)	137.24	85.72	0.379
7744	NDUFV1	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51 kDa	373.45	70.69	0.069
7753	CALU	Calumenin	251.14	83.95	0.069
7768	FIBP	Fibroblast growth factor (acidic) intracellular binding protein	149.44	71.07	0.138
7862	PNRC2	Proline-rich nuclear receptor coactivator 2	165.82	66.37	0.241
7910	RYBP	RING1 and YY1 binding protein	148.78	147.82	0.310
7917	HIGD1A	HIG1 domain family, member 1A	1039.59	201.55	0.103
8102	RPS20	Ribosomal protein S20	808.74	200.51	0.000
8372	UQCR	Ubiquinol-cytochrome c reductase, 6.4 kDa subunit	171.69	131.04	0.172
8737	WDR6	WD repeat domain 6	214.98	113.65	0.172
8752	TMEM4	Transmembrane protein 4	133.39	83.23	0.345
8765	DDX42	DEAD (Asp-Glu-Ala-Asp) box polypeptide 42	139.51	72.23	0.310
8859	CANT1	Calcium activated nucleotidase 1	195.72	80.27	0.310
8867	CYR61	Cysteine-rich, angiogenic inducer, 61	267.57	79.91	0.379
9003	C16orf58	Chromosome 16 open reading frame 58	148.64	68.89	0.207
9015	LOC57255	Hypothetical locus LOC572558	130.09	98.43	0.276
9043	NGDN	Neuroguidin, EIF4E binding protein	117.81	54.04	0.379
9234	TMEM147	Transmembrane protein 147	129.58	83.82	0.207
9235	NME4	Protein expressed in non-metastatic cells 4	148.59	103.05	0.379
9527	C2orf28	Chromosome 2 open reading frame 28	184.04	88.83	0.207
9534	SEC11A	SEC11 homolog A (S. cerevisiae)	146.99	82.65	0.069
9573	ABCF1	ATP-binding cassette, sub-family F (GCN20), member 1	173.73	124.13	0.276
9589	UBQLN1	Ubiquilin 1	111.34	60.19	0.310
9788	NDFIP1	Nedd4 family interacting protein 1	167.04	73.62	0.172
9825	FAM96B	Family with sequence similarity 96, member B	139.95	94.16	0.345
9857	DCXR	Dicarbonyl/L-xylulose reductase	170.77	74.16	0.379
10326	COPE	Coatomer protein complex, subunit epsilon	383.31	95.38	0.103
10842	RAN	RAN, member RAS oncogene family	825.56	82.38	0.000
10848	BMS1	BMS1 homolog, ribosome assembly protein (yeast)	121.69	60.27	0.345
11125	SPCS1	Signal peptidase complex subunit 1 homolog (S. cerevisiae)	151.97	92.91	0.276
11184	UBE2R2	Ubiquitin-conjugating enzyme E2R 2	379.09	474.01	0.172
11223	IDH1	Isocitrate dehydrogenase 1 (NADP+), soluble	199.04	77.27	0.103
11355	TMPO	Thymopoietin	213.98	130.12	0.172
11463	CMPK	Cytidylate kinase	180.54	86.53	0.172
12013	ABCE1	ATP-binding cassette, sub-family E (OABP), member 1	179.59	72.05	0.241
12084	TUFM	Tu translation elongation factor, mitochondrial	518.02	95.08	0.207
12102	SNX3	Sorting nexin 3	280.04	91.18	0.207
12107	CHMP2A	Chromatin modifying protein 2A	108.77	44.44	0.207
12109	CIAO1	Cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)	127.53	69.27	0.207
12144	KIAA1033	KIAA1033	109.38	59.10	0.345
12152	SRPRB	Signal recognition particle receptor, B subunit	197.29	199.04	0.310
12272	BECN1	Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein)	135.99	56.22	0.310
12341	ADAR	Adenosine deaminase, RNA-specific	272.66	83.29	0.103
12457	NUP133	Nucleoporin 133 kDa	134.39	100.25	0.310
12865	NSFL1C	NSFL1 (p97) cofactor (p47)	137.86	79.36	0.276
13662	TMEM109	Transmembrane protein 109	180.15	110.32	0.276
14317	NOLA3	Nucleolar protein family A, member 3 (H/ACA small nucleolar	205.32	119.91	0.310
		RNPs)
14333	ATPBD1B	ATP binding domain 1 family, member B	159.24	82.57	0.379
14745	CCNY	Cyclin Y	133.37	75.66	0.276
14839	POLR2G	Polymerase (RNA) II (DNA directed) polypeptide G	141.30	66.30	0.207
14846	SLC7A1	Solute carrier family 7 (cationic amino acid transporter, y+ system	139.07	71.59	0.310
		member 1
14894	TGOLN2	Trans-golgi network protein 2	157.54	69.37	0.241
15277	C16orf33	Chromosome 16 open reading frame 33	120.09	75.30	0.310
15591	COPS6	COP9 constitutive photomorphogenic homolog subunit 6	217.83	90.78	0.172
		(Arabidopsis)
15738	RAB7A	RAB7A, member RAS oncogene family	400.18	95.67	0.069
16059	CCDC56	Coiled-coil domain containing 56	143.39	86.29	0.345
16130	UBE2O	Ubiquitin-conjugating enzyme E2O	157.52	114.59	0.241
16349	ASCIZ	ATM/ATR-Substrate Chk2-Interacting Zn2+-finger protein	122.72	69.67	0.310
17118	C1orf149	Chromosome 1 open reading frame 149	139.92	85.35	0.310
17250	COQ5	Coenzyme Q5 homolog, methyltransferase (S. cerevisiae)	91.88	50.52	0.345
17680	FUCA2	Fucosidase, alpha-L-2, plasma	157.91	93.28	0.276
17731	CCDC14	Coiled-coil domain containing 14	84.79	48.78	0.379
17883	PPM1G	Protein phosphatase 1G (formerly 2C), magnesium-dependent,	381.13	94.17	0.103
		gamma isoform
18069	LGMN	Legumain	189.38	150.90	0.310
18128	C20orf44	Chromosome 20 open reading frame 44	120.34	63.49	0.276
18349	MRPL15	Mitochondrial ribosomal protein L15	126.02	62.29	0.310
19673	MAF1	MAF1 homolog (S. cerevisiae)	208.66	72.97	0.069
20013	SYF2	SYF2 homolog, RNA splicing factor (S. cerevisiae)	109.39	47.58	0.310
20107	KLC1	Kinesin light chain 1	158.65	81.31	0.241
20157	CDK5RAP3	CDK5 regulatory subunit associated protein 3	186.17	71.88	0.276
20521	PRMT1	Protein arginine methyltransferase 1	270.96	72.70	0.103
20529	FAM79A	Family with sequence similarity 79, member A	101.33	68.50	0.379
20573	IGF1R	Insulin-like growth factor 1 receptor	133.12	72.84	0.379
20716	TIMM17A	Translocase of inner mitochondrial membrane 17 homolog A	378.20	138.09	0.241
		(yeast)
22393	DENR	Density-regulated protein	147.59	60.97	0.138
22543	UBE3A	Ubiquitin protein ligase E3A (human papilloma virus E6-associated	180.41	98.42	0.276
		protein, Angelman syndrome)
22546	CYBASC3	Cytochrome b, ascorbate dependent 3	271.22	114.11	0.276
22616	KIAA0664	KIAA0664 protein	126.85	69.83	0.276
23033	UBE2Q2	Ubiquitin-conjugating enzyme E2Q (putative) 2	127.34	80.73	0.379
23111	FARSA	Phenylalanyl-tRNA synthetase, alpha subunit	239.95	79.63	0.241
23978	SAFB	Scaffold attachment factor B	195.91	87.35	0.207
24301	POLR2E	Polymerase (RNA) II (DNA directed) polypeptide E, 25 kDa	345.43	77.04	0.207
24379	TRAPPC1	Trafficking protein particle complex 1	155.30	123.38	0.172
24601	FBLN1	Fibulin 1	492.05	242.68	0.345
24950	RGS5	Regulator of G-protein signalling 5	561.58	225.25	0.345
25155	NET1	Neuroepithelial cell transforming gene 1	114.28	95.82	0.207
25450	SLC29A1	Solute carrier family 29 (nucleoside transporters), member 1	201.64	68.32	0.379
25723	FAM89B	Family with sequence similarity 89, member B	140.19	148.04	0.345
26010	PFKP	Phosphofructokinase, platelet	268.83	113.15	0.103
26023	FOXJ3	Forkhead box J3	73.83	44.60	0.379
26136	PIGY	Phosphatidylinositol glycan anchor biosynthesis, class Y	150.82	96.10	0.345
26232	MAN2C1	Mannosidase, alpha, class 2C, member 1	117.43	87.14	0.379
26403	GSTZ1	Glutathione transferase zeta 1 (maleylacetoacetate isomerase)	139.46	92.67	0.345
26518	TSPAN4	Tetraspanin 4	164.19	75.89	0.310
27222	NOLA2	Nucleolar protein family A, member 2 (H/ACA small nucleolar	172.83	107.54	0.276
		RNPs)
28491	SAT1	Spermidine/spermine N1-acetyltransferase 1	578.08	192.92	0.276
28914	APRT	Adenine phosphoribosyltransferase	160.48	119.31	0.345
29203	GBL	G protein beta subunit-like	172.86	96.17	0.310
29665	CLSTN1	Calsyntenin 1	223.34	109.23	0.103
30011	TMEM93	Transmembrane protein 93	122.56	80.02	0.379
30026	SSU72	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	122.96	77.31	0.138
30345	TRAP1	TNF receptor-associated protein 1	433.73	106.66	0.103
30954	PMVK	Phosphomevalonate kinase	168.78	141.42	0.379
31053	TBCB	Tubulin folding cofactor B	267.45	128.93	0.276
31334	PRPF6	PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)	278.00	95.93	0.103
31387	C3orf60	Chromosome 3 open reading frame 60	194.85	96.83	0.276
34045	CDCA4	Cell division cycle associated 4	142.01	95.48	0.379
34576	TAX1BP1	Tax1 (human T-cell leukemia virus type I) binding protein 1	166.29	86.39	0.138
34906	BLOC1S2	Biogenesis of lysosome-related organelles complex-1, subunit 2	110.24	106.36	0.345
35052	TEGT	Testis enhanced gene transcript (BAX inhibitor 1)	601.46	76.56	0.000
35828	MARK3	MAP/microtubule affinity-regulating kinase 3	181.74	68.97	0.207
36587	PPP1R7	Protein phosphatase 1, regulatory subunit 7	147.34	89.65	0.207
36927	HSPH1	Heat shock 105 kDa/110 kDa protein 1	142.61	62.36	0.241
37616	STRA13	Stimulated by retinoic acid 13 homolog (mouse)	132.28	87.28	0.310
37916	DPP7	Dipeptidylpeptidase 7	189.05	126.98	0.207
42806	SDF4	Stromal cell derived factor 4	395.61	110.02	0.138
43297	MTPN	Myotrophin	224.31	82.09	0.172
47062	POLR2I	Polymerase (RNA) II (DNA directed) polypeptide I, 14.5 kDa	136.77	76.60	0.310
50098	NDUFA4	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9 kDa	444.09	142.87	0.310
50308	HIP2	Huntingtin interacting protein 2	145.77	68.04	0.207
50425	PTGES3	Prostaglandin E synthase 3 (cytosolic)	411.83	77.96	0.103
53066	HSPBP1	Hsp70-interacting protein	202.07	92.49	0.138
54277	FAM50A	Family with sequence similarity 50, member A	145.83	129.34	0.345
54457	CD81	CD81 antigen (target of antiproliferative antibody 1)	303.19	99.16	0.069
54642	MAT2B	Methionine adenosyltransferase II, beta	133.55	71.29	0.207
54649	RY1	Putative nucleic acid binding protein RY-1	203.85	97.67	0.241
55682	EIF3S7	Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67 kDa	455.77	153.84	0.034
55847	MRPL51	Mitochondrial ribosomal protein L51	122.64	99.22	0.241
58488	CTNNAL1	Catenin (cadherin-associated protein), alpha-like 1	126.66	70.42	0.379
58992	SMC4	Structural maintenance of chromosomes 4	228.66	99.66	0.207
59486	HSDL2	Hydroxysteroid dehydrogenase like 2	129.48	73.68	0.345
61812	PTPN12	Protein tyrosine phosphatase, non-receptor type 12	108.62	74.97	0.345
65234	DDX27	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	199.19	91.01	0.241
65238	RNF40	Ring finger protein 40	193.26	81.38	0.172
66048	MAP1S	Microtubule-associated protein 1S	131.74	79.04	0.276
66915	C22orf16	Chromosome 22 open reading frame 16	135.11	102.77	0.379
68714	SFRS1	Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate	249.07	79.18	0.103
		splicing factor)
69293	HEXB	Hexosaminidase B (beta polypeptide)	198.57	153.59	0.276
69554	RNF126	Ring finger protein 126	161.03	83.35	0.241
69855	UNR	Cold shock domain containing E1, RNA-binding	657.29	110.51	0.103
71465	SQLE	Squalene epoxidase	105.27	62.62	0.276
71787	MRPS7	Mitochondrial ribosomal protein S7	159.90	59.92	0.310
73527	CSNK2B	Casein kinase 2, beta polypeptide	202.65	73.01	0.207
73722	APEX1	APEX nuclease (multifunctional DNA repair enzyme) 1	339.50	85.30	0.103
73799	GNAI3	Guanine nucleotide binding protein (G protein), alpha inhibiting	150.46	62.95	0.207
		activity polypeptide 3
73965	SFRS2	Hypothetical protein ET	280.26	73.78	0.000
74047	ETFB	Electron-transfer-flavoprotein, beta polypeptide	168.06	80.53	0.138
74050	FVT1	Follicular lymphoma variant translocation 1	98.29	70.32	0.379
74137	TMED10	Transmembrane emp24-like trafficking protein 10 (yeast)	237.09	91.81	0.138
74375	DVL1	Dishevelled, dsh homolog 1 (Drosophila)	133.54	77.04	0.276
74405	YWHAQ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	413.13	88.00	0.034
		activation protein, theta polypeptide
74471	GJA1	Gap junction protein, alpha 1, 43 kDa (connexin 43)	183.35	62.77	0.379
74563	OAZ2	Ornithine decarboxylase antizyme 2	193.33	73.23	0.103
74564	SSR2	Signal sequence receptor, beta (translocon-associated protein	312.91	86.38	0.034
		beta)
74576	GDI1	GDP dissociation inhibitor 1	230.50	117.59	0.138
75056	TIMM13	Translocase of inner mitochondrial membrane 13 homolog (yeast)	225.25	76.11	0.345
75061	MARCKSL	MARCKS-like 1	449.23	89.23	0.103
75066	TSN	Translin	128.46	75.98	0.345
75087	FASTK	Fas-activated serine/threonine kinase	179.08	68.42	0.345
75117	ILF2	Interleukin enhancer binding factor 2, 45 kDa	349.26	76.78	0.034
75133	TFAM	Transcription factor A, mitochondrial	111.21	68.59	0.310
75139	ARFIP2	ADP-ribosylation factor interacting protein 2 (arfaptin 2)	178.80	116.43	0.345
75189	DAP	Death-associated protein	217.73	94.24	0.103
75227	NDUFA9	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39	290.29	122.15	0.138
75243	BRD2	Bromodomain containing 2	301.76	102.55	0.069
75249	ARL6IP1	ADP-ribosylation factor-like 6 interacting protein 1	269.13	69.42	0.172
75254	IRF3	Interferon regulatory factor 3	131.45	93.03	0.345
75318	TUBA4A	Tubulin, alpha 4a	346.93	95.88	0.276
75348	PSME1	Proteasome (prosome, macropain) activator subunit 1 (PA28	196.67	85.95	0.138
		alpha)
75438	QDPR	Quinoid dihydropteridine reductase	239.93	101.27	0.345
75527	ADSL	Adenylosuccinate lyase	187.36	79.69	0.000
75724	COPB2	Coatomer protein complex, subunit beta 2 (beta prime)	169.19	70.94	0.172
75798	C20orf111	Chromosome 20 open reading frame 111	138.12	60.97	0.379
75841	ERP29	Endoplasmic reticulum protein 29	170.38	80.11	0.276
75890	MBTPS1	Membrane-bound transcription factor peptidase, site 1	143.96	76.79	0.241
75914	TMED2	Transmembrane emp24 domain trafficking protein 2	257.34	78.55	0.103
76111	DAG1	Dystroglycan 1 (dystrophin-associated glycoprotein 1)	185.89	66.32	0.310
76394	ECHS1	Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial	296.18	99.29	0.207
76480	UBL4A	Ubiquitin-like 4A	177.47	73.71	0.379
76662	ZDHHC16	Zinc finger, DHHC-type containing 16	138.92	90.05	0.276
76686	GPX1	Glutathione peroxidase 1	154.93	84.27	0.276
76847	GANAB	Glucosidase, alpha; neutral AB	371.62	103.22	0.138
77060	PSMB6	Proteasome (prosome, macropain) subunit, beta type, 6	258.61	103.69	0.172
77269	GNAI2	Guanine nucleotide binding protein (G protein), alpha inhibiting	454.86	93.08	0.103
		activity polypeptide 2
77313	CDK10	Cyclin-dependent kinase (CDC2-like) 10	98.89	72.87	0.345
77422	PLP2	Proteolipid protein 2 (colonic epithelium-enriched)	189.36	121.71	0.310
77558	HMGN3	High mobility group nucleosomal binding domain 3	161.44	94.74	0.207
77578	USP9X	Ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)	143.39	67.26	0.310
77793	CSK	C-src tyrosine kinase	222.19	95.17	0.310
77897	SF3A3	Splicing factor 3a, subunit 3, 60 kDa	169.65	127.16	0.276
77961	HLA-B	Major histocompatibility complex, class I, B	851.44	157.10	0.103
77978		Hypothetical protein DKFZp761I2123	115.47	65.78	0.345
78466	PSMD8	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	274.96	128.74	0.241
78601	UROD	Uroporphyrinogen decarboxylase	187.65	84.63	0.103
78771	PGK1	Phosphoglycerate kinase 1	681.19	86.72	0.034
78880	ILVBL	IlvB (bacterial acetolactate synthase)-like	185.37	153.08	0.379
78888	DBI	Diazepam binding inhibitor (GABA receptor modulator, acyl-	220.96	127.35	0.241
		Coenzyme A binding protein)
78989	ADH5	Alcohol dehydrogenase 5 (class III), chi polypeptide	179.39	72.64	0.034
79064	DHPS	Deoxyhypusine synthase	164.95	100.52	0.241
79081	PPP1CC	Protein phosphatase 1, catalytic subunit, gamma isoform	318.25	84.70	0.103
79088	RCN2	Reticulocalbin 2, EF-hand calcium binding domain	150.90	75.39	0.207
79101	CCNG1	Cyclin G1	240.04	67.65	0.069
79110	NCL	Nucleolin	293.04	63.35	0.034
79322	QARS	Glutaminyl-tRNA synthetase	402.46	67.92	0.138
79335	SMARCD1	SWI/SNF related, matrix associated, actin dependent regulator of	146.36	68.95	0.241
		chromatin, subfamily d, member 1
79387	PSMC5	Proteasome (prosome, macropain) 26S subunit, ATPase, 5	243.74	74.96	0.138
79402	POLR2C	Polymerase (RNA) II (DNA directed) polypeptide C, 33 kDa	146.42	65.99	0.241
79411	RPA2	Replication protein A2, 32 kDa	179.33	111.72	0.345
79625	C20orf149	Chromosome 20 open reading frame 149	361.43	94.87	0.310
80545	RPL37	Ribosomal protein L37	755.77	355.66	0.103
80919	SYPL1	Synaptophysin-like 1	215.72	101.08	0.207
80986	ATP5G1	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	209.65	91.99	0.276
		c (subunit 9), isoform 1
81328	NFKBIA	Nuclear factor of kappa light polypeptide gene enhancer in B-cells	186.76	120.33	0.345
		inhibitor, alpha
81424	SUMO1	SMT3 suppressor of mif two 3 homolog 1 (yeast)	313.72	89.00	0.034
81848	RAD21	RAD21 homolog (S. pombe)	368.76	164.73	0.103
81964	SEC24C	SEC24 related gene family, member C (S. cerevisiae)	186.43	96.07	0.241
82201	CSNK2A2	Casein kinase 2, alpha prime polypeptide	123.76	72.38	0.310
82327	GSS	Glutathione synthetase	184.39	77.08	0.138
82719	YIPF6	Yip1 domain family, member 6	123.85	72.31	0.379
82793	PSMB3	Proteasome (prosome, macropain) subunit, beta type, 3	158.41	64.83	0.138
82887	PPP1R11	Protein phosphatase 1, regulatory (inhibitor) subunit 11	190.42	75.63	0.241
82890	DAD1	Defender against cell death 1	202.51	132.00	0.310
82916	CCT6A	Chaperonin containing TCP1, subunit 6A (zeta 1)	407.59	75.69	0.034
82927	AMPD2	Adenosine monophosphate deaminase 2 (isoform L)	148.16	149.07	0.345
83190	FASN	Fatty acid synthase	562.35	101.57	0.241
83347	AAMP	Angio-associated, migratory cell protein	224.46	80.95	0.138
83383	PRDX4	Peroxiredoxin 4	152.24	74.89	0.379
83734	STX4	Syntaxin 4	117.13	61.41	0.276
83753	SNRPB	Small nuclear ribonucleoprotein polypeptides B and B1	874.09	87.85	0.138
83765	DHFR	Dihydrofolate reductase	111.62	78.02	0.310
83916	NDUFA5	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13	455.28	149.11	0.207
84359	GABARAP	GABA(A) receptor-associated protein	190.65	77.34	0.138
84753	NT5DC2	5′-nucleotidase domain containing 2	158.64	96.33	0.310
85155	ZFP36L1	Zinc finger protein 36, C3H type-like 1	196.81	98.76	0.207
85769	DNTTIP2	Deoxynucleotidyltransferase, terminal, interacting protein 2	105.55	51.70	0.379
85962	CTF8	Chromosome transmission fidelity factor 8 homolog (S. cerevisiae)	170.29	139.62	0.276
86131	FADD	Fas (TNFRSF6)-associated via death domain	158.82	101.13	0.172
87752	MSN	Moesin	275.46	95.27	0.103
89545	PSMB4	Proteasome (prosome, macropain) subunit, beta type, 4	463.81	87.69	0.034
89643	TKT	Transketolase (Wernicke-Korsakoff syndrome)	588.97	97.80	0.103
89649	EPHX1	Epoxide hydrolase 1, microsomal (xenobiotic)	238.26	88.30	0.345
89781	UBTF	Upstream binding transcription factor, RNA polymerase I	121.71	54.79	0.241
89864	SKIV2L	Superkiller viralicidic activity 2-like (S. cerevisiae)	132.50	66.99	0.379
90061	PGRMC1	Progesterone receptor membrane component 1	194.16	93.36	0.172
90093	HSPA4	Heat shock 70 kDa protein 4	149.59	74.25	0.172
90107	ADRM1	Adhesion regulating molecule 1	246.89	81.18	0.172
90443	NDUFS8	NADH dehydrogenase (ubiquinone) Fe—S protein 8, 23 kDa	153.66	106.13	0.207
		(NADH-coenzyme Q reductase)
91142	KHSRP	KH-type splicing regulatory protein (FUSE binding protein 2)	237.57	80.25	0.241
91531	MLLT6	Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog,	163.44	99.71	0.207
		Drosophila); translocated to, 6
93659	PDIA4	Protein disulfide isomerase family A, member 4	221.64	92.23	0.207
93832	TMCO1	Transmembrane and coiled-coil domains 1	215.75	94.44	0.138
95577	CDK4	Cyclin-dependent kinase 4	512.67	181.54	0.103
96530	COX11	COX11 homolog, cytochrome c oxidase assembly protein (yeast)	133.50	61.61	0.241
96852	EDC3	Enhancer of mRNA decapping 3 homolog (S. cerevisiae)	315.49	327.98	0.345
96996	HNRPA0	Heterogeneous nuclear ribonucleoprotein A0	203.93	87.67	0.172
97616	SH3GL1	SH3-domain GRB2-like 1	271.66	106.70	0.069
97887	RCN1	Reticulocalbin 1, EF-hand calcium binding domain	176.05	78.51	0.207
98751	FUBP3	Far upstream element (FUSE) binding protein 3	115.91	57.99	0.276
98791	ACTR1B	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	154.61	74.84	0.276
102696	MCTS1	Malignant T cell amplified sequence 1	182.20	108.79	0.379
102798	PSMA1	Proteasome (prosome, macropain) subunit, alpha type, 1	222.80	73.98	0.069
103561	ARL6IP4	ADP-ribosylation-like factor 6 interacting protein 4	177.34	82.48	0.172
103834	TMEM106C	Transmembrane protein 106C	164.57	88.83	0.138
104839	TIMP2	TIMP metallopeptidase inhibitor 2	266.07	83.65	0.172
105547	NPDC1	Neural proliferation, differentiation and control, 1	184.55	89.27	0.345
106185	RALGDS	Ral guanine nucleotide dissociation stimulator	113.28	56.31	0.379
106876	ATP6V0D1	ATPase, H+ transporting, lysosomal 38 kDa, V0 subunit d isoform 1	157.31	76.54	0.207
106909	ANAPC13	Anaphase promoting complex subunit 13	409.28	124.92	0.310
107003	CCNB1IP1	Cyclin B1 interacting protein 1	198.64	135.06	0.207
107101	C1orf86	Chromosome 1 open reading frame 86	132.02	90.12	0.310
107387	C7orf20	Chromosome 7 open reading frame 20	158.14	146.65	0.379
107393	CLDND1	Claudin domain containing 1	182.62	98.17	0.276
108029	SH3BGRL	SH3 domain binding glutamic acid-rich protein like	217.90	129.37	0.138
108080	CSRP1	Cysteine and glycine-rich protein 1	226.87	81.65	0.172
108371	E2F4	E2F transcription factor 4, p107/p130-binding	124.23	53.45	0.207
108408	APH1A	Anterior pharynx defective 1 homolog A (C. elegans)	214.52	73.54	0.276
108957	RPS27L	Ribosomal protein S27-like	214.43	105.97	0.345
108969	C19orf56	Chromosome 19 open reading frame 56	165.48	98.67	0.207
109051	SH3BGRL3	SH3 domain binding glutamic acid-rich protein like 3	190.53	95.77	0.207
109052	C14orf2	Chromosome 14 open reading frame 2	254.93	147.67	0.310
109672	ST6GALNAC6	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-	113.89	58.27	0.379
		acetylgalactosaminide alpha-2,6-sialyltransferase 6
109798	C6orf48	Chromosome 6 open reading frame 48	221.40	98.21	0.207
110695	SF3B5	Splicing factor 3b, subunit 5, 10 kDa	161.11	93.81	0.310
110849	ESRRA	Estrogen-related receptor alpha	243.72	107.89	0.310
111286	MRPS11	Mitochondrial ribosomal protein S11	118.62	52.84	0.207
111577	ITM2C	Integral membrane protein 2C	293.83	115.98	0.138
111801	ARS2	ARS2 protein	213.16	99.08	0.276
112058	SIVA1	SIVA1, apoptosis-inducing factor	161.23	58.99	0.345
112318	TOMM7	Translocase of outer mitochondrial membrane 7 homolog (yeast)	406.79	253.67	0.276
112955	NUDT5	Nudix (nucleoside diphosphate linked moiety X)-type motif 5	197.68	94.29	0.276
114033	SSR1	Signal sequence receptor, alpha (translocon-associated protein	161.00	68.79	0.207
		alpha)
114286	CD9	CD9 antigen (p24)	239.20	130.06	0.172
114412	TXNL1	Thioredoxin-like 1	117.31	93.59	0.207
115474	RFC3	Replication factor C (activator 1) 3, 38 kDa	175.70	158.89	0.345
115792	EXOSC7	Exosome component 7	134.25	74.20	0.207
116448	GLS	Glutaminase	192.13	67.06	0.379
117176	PABPN1	Poly(A) binding protein, nuclear 1	124.05	80.27	0.276
117715	ST5	Suppression of tumorigenicity 5	101.33	55.39	0.379
118110	BST2	Bone marrow stromal cell antigen 2	216.68	84.28	0.241
118400	FSCN1	Fascin homolog 1, actin-bundling protein (Strongylocentrotus	684.83	91.57	0.241
		purpuratus)
118463	PNPLA2	Patatin-like phospholipase domain containing 2	162.21	88.10	0.345
118638	NME1	Non-metastatic cells 1, protein (NM23A) expressed in	290.12	103.60	0.172
118722	FUT8	Fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	118.38	149.55	0.379
118964	GATAD2A	GATA zinc finger domain containing 2A	124.22	85.19	0.310
118983	GSDMDC1	Gasdermin domain containing 1	184.87	95.75	0.379
119177	ARF3	ADP-ribosylation factor 3	239.68	76.49	0.138
119192	H2AFZ	H2A histone family, member Z	453.31	159.40	0.103
119251	UQCRC1	Ubiquinol-cytochrome c reductase core protein 1	442.99	74.48	0.103
119591	AP2S1	Adaptor-related protein complex 2, sigma 1 subunit	177.74	82.21	0.241
119598	RPL3	Ribosomal protein L3	3807.92	79.61	0.000
120323	LOC26010	Viral DNA polymerase-transactivated protein 6	128.35	69.74	0.310
121088	NUP153	Nucleoporin 153 kDa	123.13	79.84	0.310
121549	CDIPT	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	177.98	81.88	0.241
		(phosphatidylinositol synthase)
122363	WIPI2	WD repeat domain, phosphoinositide interacting 2	186.76	89.61	0.138
122523	SND1	Staphylococcal nuclease domain containing 1	355.50	74.36	0.034
124126	ARPC1A	Actin related protein 2/3 complex, subunit 1A, 41 kDa	206.46	81.13	0.103
124147	FBXL11	PRO1880 protein	144.07	78.43	0.207
124246	C10orf119	Chromosome 10 open reading frame 119	144.50	66.52	0.172
124366	BBX	Bobby sox homolog (Drosophila)	147.83	66.94	0.345
125113	CCT8	Chaperonin containing TCP1, subunit 8 (theta)	187.53	84.03	0.034
125867	EVL	Enah/Vasp-like	170.08	84.54	0.276
125898	GNAS	GNAS complex locus	669.01	93.40	0.069
126497	AEBP2	AE binding protein 2	102.85	77.77	0.379
126774	DTL	Denticleless homolog (Drosophila)	160.79	71.32	0.379
126938	NAPA	N-ethylmaleimide-sensitive factor attachment protein, alpha	196.92	84.26	0.069
127092	DHX38	DEAH (Asp-Glu-Ala-His) box polypeptide 38	168.85	103.87	0.379
127249	SNF8	SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)	134.67	80.08	0.310
127386	MAMDC2	MAM domain containing 2	147.47	78.47	0.241
127764	RAB5C	RAB5C, member RAS oncogene family	242.33	112.45	0.276
128065	CTSC	Cathepsin C	238.81	102.05	0.207
128199	SEPT11	Septin 11	159.83	63.97	0.241
128548	WDR1	WD repeat domain 1	267.90	69.81	0.069
129634	CINP	Cyclin-dependent kinase 2-interacting protein	104.53	70.89	0.345
129673	EIF4A1	Eukaryotic translation initiation factor 4A, isoform 1	1492.15	82.19	0.000
130031	TRIO	Triple functional domain (PTPRF interacting)	142.59	75.94	0.310
130098	DDX23	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	188.55	94.45	0.172
130293	CROP	Cisplatin resistance-associated overexpressed protein	152.55	84.06	0.207
130413	TM9SF2	Transmembrane 9 superfamily member 2	210.83	99.09	0.103
131226	BNIP3L	BCL2/adenovirus E1B 19 kDa interacting protein 3-like	192.67	70.38	0.241
132497	PRNPIP	Prion protein interacting protein	168.32	67.74	0.310
132513	HSD17B12	Hydroxysteroid (17-beta) dehydrogenase 12	137.10	95.65	0.207
133892	TPM1	Tropomyosin 1 (alpha)	606.98	169.48	0.207
134074	SLC35E1	Solute carrier family 35, member E1	110.83	70.67	0.345
134688	PSMD13	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	304.05	104.85	0.207
135406	CEBPZ	CCAAT/enhancer binding protein zeta	126.72	64.41	0.207
136905	HUWE1	HECT, UBA and WWE domain containing 1	196.13	66.09	0.138
136947	RALY	RNA binding protein, autoantigenic (hnRNP-associated with lethal	339.69	92.28	0.069
		yellow homolog (mouse))
137510	NCOR2	Nuclear receptor co-repressor 2	243.82	126.40	0.207
138860	ARHGAP1	Rho GTPase activating protein 1	106.56	50.87	0.310
139896	MAEA	Macrophage erythroblast attacher	203.45	84.45	0.276
140452	M6PRBP1	Mannose-6-phosphate receptor binding protein 1	381.09	119.04	0.138
142442	HP1BP3	Heterochromatin protein 1, binding protein 3	161.28	66.57	0.207
143187	DDX49	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	144.35	67.10	0.241
143766	ATN1	Atrophin 1	184.56	86.85	0.207
143873	S100A10	S100 calcium binding protein A10 (annexin II ligand, calpactin I,	255.56	111.88	0.172
		light polypeptide (p11))
144058	NAT9	N-acetyltransferase 9	99.56	67.02	0.345
144468	CHID1	Chitinase domain containing 1	179.03	105.35	0.241
144835	EEF1G	Eukaryotic translation elongation factor 1 gamma	4056.39	76.55	0.000
144868	VTI1B	Vesicle transport through interaction with t-SNAREs homolog 1B	103.57	54.85	0.310
		(yeast)
144941	LRRC41	Leucine rich repeat containing 41	152.40	71.74	0.172
144949	ZNF313	Zinc finger protein 313	145.79	62.78	0.138
144980	SCAMP4	Secretory carrier membrane protein 4	127.39	96.37	0.345
145049	PLEKHM2	Pleckstrin homology domain containing, family M (with RUN	205.68	86.88	0.138
		domain) member 2
145442	MAP2K1	Mitogen-activated protein kinase kinase 1	101.59	55.16	0.241
145575	UBL3	Ubiquitin-like 3	157.68	79.65	0.345
146070	TPM3	Tropomyosin 3	695.80	102.33	0.000
146393	HERPUD1	Homocysteine-inducible, endoplasmic reticulum stress-inducible,	226.44	86.29	0.172
		ubiquitin-like domain member 1
146602	UQCRQ	Ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5 kDa	193.38	169.43	0.276
146804	SPIN1	Spindlin 1	127.00	68.69	0.345
146806	CUL1	Cullin 1	120.27	57.50	0.207
147433	PCNA	Proliferating cell nuclear antigen	258.31	133.96	0.172
148078	UBR4	Ubiquitin protein ligase E3 component n-recognin 4	144.18	73.44	0.138
148272	CCM2	Cerebral cavernous malformation 2	199.79	94.01	0.207
148330	ARF4	ADP-ribosylation factor 4	385.93	105.50	0.138
148340	PTPRG	Protein tyrosine phosphatase, receptor type, G	1592.61	150.52	0.069
148670	RHOBTB1	Rho-related BTB domain containing 1	116.95	99.14	0.345
149004	FBXO31	F-box protein 31	141.63	81.88	0.379
149957	RPS6KA1	Ribosomal protein S6 kinase, 90 kDa, polypeptide 1	146.89	140.85	0.310
149983	PEX14	Peroxisomal biogenesis factor 14	132.69	140.50	0.241
150107	BIRC6	Baculoviral IAP repeat-containing 6 (apollon)	149.90	66.77	0.345
150540	TMEM112B	Transmembrane protein 112B	180.63	177.93	0.379
150580	EIF1	Eukaryotic translation initiation factor 1	458.80	84.42	0.034
150837	TXNDC5	Thioredoxin domain containing 5	483.23	126.33	0.034
151134	OXA1L	Oxidase (cytochrome c) assembly 1-like	238.54	70.29	0.103
151220	PALLD	Palladin, cytoskeletal associated protein	198.94	75.04	0.345
151413	GMFB	Glia maturation factor beta	190.53	95.31	0.379
151787	EFTUD2	Elongation factor Tu GTP binding domain containing 2	326.78	81.27	0.069
152536	PSMD6	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	134.14	63.78	0.241
153177	RPS28	Ribosomal protein S28	437.53	297.35	0.241
154023	TXNDC4	Thioredoxin domain containing 4 (endoplasmic reticulum)	133.74	72.55	0.345
154073	SLC35B1	Solute carrier family 35, member B1	99.61	61.75	0.379
155165	ZFPL1	Zinc finger protein-like 1	156.23	92.72	0.310
155218	HNRPUL1	Heterogeneous nuclear ribonucleoprotein U-like 1	474.38	82.52	0.000
155396	NFE2L2	Nuclear factor (erythroid-derived 2)-like 2	182.54	63.38	0.172
155829	TBC1D9B	TBC1 domain family, member 9B (with GRAM domain)	189.13	67.14	0.241
156171	PSMC6	Proteasome (prosome, macropain) 26S subunit, ATPase, 6	202.42	86.99	0.172
156367	RPS29	Ribosomal protein S29	735.43	357.07	0.241
156667	CALCOCO	Calcium binding and coiled-coil domain 1	150.95	83.49	0.276
157160	MRPS34	Mitochondrial ribosomal protein S34	163.79	79.67	0.276
157351	GTPBP9	GTP-binding protein 9 (putative)	256.77	85.59	0.207
157379	H2AFV	H2A histone family, member V	212.94	72.40	0.138
157394	HAGH	Hydroxyacylglutathione hydrolase	110.09	79.63	0.345
159014	PRPF4B	PRP4 pre-mRNA processing factor 4 homolog B (yeast)	101.54	63.09	0.379
159118	AMD1	Adenosylmethionine decarboxylase 1	179.16	87.63	0.241
159130	RAF1	V-raf-1 murine leukemia viral oncogene homolog 1	148.50	123.34	0.138
159161	ARHGDIA	Rho GDP dissociation inhibitor (GDI) alpha	781.87	98.28	0.138
159699	FBXO21	F-box protein 21	112.15	59.46	0.345
159799	THRAP2	Thyroid hormone receptor associated protein 2	135.37	68.96	0.345
160958	CDC37	CDC37 cell division cycle 37 homolog (S. cerevisiae)	297.55	114.77	0.069
161357	PDHB	Pyruvate dehydrogenase (lipoamide) beta	188.51	80.70	0.172
162032	HBP1	HMG-box transcription factor 1	119.42	40.70	0.345
162233	CHD4	Chromodomain helicase DNA binding protein 4	294.77	95.15	0.207
162877	PACSIN2	Protein kinase C and casein kinase substrate in neurons 2	181.10	101.47	0.207
163645	MOCS2	Molybdenum cofactor synthesis 2	123.58	91.10	0.276
163776	UBE2J1	Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)	229.95	250.60	0.310
163893	PICALM	Phosphatidylinositol binding clathrin assembly protein	153.29	84.25	0.310
165195	VAPA	VAMP (vesicle-associated membrane protein)-associated protein	170.73	76.58	0.069
		A, 33 kDa
166011	CTNND1	Catenin (cadherin-associated protein), delta 1	181.39	76.07	0.138
166204	PHF1	PHD finger protein 1	128.96	77.28	0.345
166463	HNRPU	Heterogeneous nuclear ribonucleoprotein U (scaffold attachment	279.34	89.13	0.034
		factor A)
166924	SEC13	SEC13 homolog (S. cerevisiae)	164.56	70.57	0.207
166975	SFRS5	Splicing factor, arginine/serine-rich 5	241.85	95.20	0.138
167535	SRP54	Signal recognition particle 54 kDa	132.08	105.35	0.241
168073	TRPC4AP	Transient receptor potential cation channel, subfamily C, member	174.32	67.74	0.241
		4 associated protein
168799	METTL3	Methyltransferase like 3	133.88	65.22	0.172
169611	DIABLO	Diablo homolog (Drosophila)	167.55	69.66	0.276
169718	CNN2	Calponin 2	263.90	111.61	0.138
170107	UQCRFS1	Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide	112.20	75.09	0.241
170131	NFIC	Nuclear factor I/C (CCAAT-binding transcription factor)	128.62	75.64	0.379
170553	CNOT7	CCR4-NOT transcription complex, subunit 7	119.98	77.62	0.276
170622	CFL1	Cofilin 1 (non-muscle)	1372.26	96.41	0.034
171626	SKP1A	S-phase kinase-associated protein 1A (p19A)	457.12	128.78	0.138
172550	PTBP1	Polypyrimidine tract binding protein 1	554.08	85.76	0.103
172755	BRP44L	Brain protein 44-like	150.10	97.09	0.379
172928	COL1A1	Collagen, type I, alpha 1	657.85	170.49	0.276
173024	NUB1	Negative regulator of ubiquitin-like proteins 1	102.38	55.09	0.276
173162	COX4NB	COX4 neighbor	259.86	100.34	0.310
173381	DPYSL2	Dihydropyrimidinase-like 2	213.62	76.62	0.310
173464	FKBP8	FK506 binding protein 8, 38 kDa	446.43	105.38	0.103
173611	NDUFS2	NADH dehydrogenase (ubiquinone) Fe—S protein 2, 49 kDa	308.98	100.60	0.069
		(NADH-coenzyme Q reductase)
173705	LOC40115	HCV F-transactivated protein 1	155.92	91.92	0.207
173724	CKB	Creatine kinase, brain	395.40	117.54	0.310
174050	EDF1	Endothelial differentiation-related factor 1	163.11	77.20	0.345
174195	IFITM2	Interferon induced transmembrane protein 2 (1-8D)	439.92	224.90	0.276
175473	AK1	Adenylate kinase 1	115.05	96.67	0.345
175955	YTHDC1	YTH domain containing 1	114.99	56.92	0.310
177530	ATP5E	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon	343.57	172.81	0.207
		subunit
177766	PARP1	Poly (ADP-ribose) polymerase family, member 1	260.77	114.80	0.103
178551	RPL8	Ribosomal protein L8	1600.62	93.63	0.034
178728	MBD3	Methyl-CpG binding domain protein 3	226.33	93.86	0.241
179986	FLOT1	Flotillin 1	239.64	133.66	0.241
180141	CFL2	Cofilin 2 (muscle)	236.22	198.55	0.345
180312	MRPS16	Mitochondrial ribosomal protein S16	148.32	71.61	0.276
180414	HSPA8	Heat shock 70 kDa protein 8	1204.20	99.10	0.000
180877	H3F3B	H3 histone, family 3B (H3.3B)	701.35	71.33	0.000
180903	NCAPH2	Non-SMC condensin II complex, subunit H2	273.31	91.43	0.310
180909	PRDX1	Peroxiredoxin 1	973.56	146.34	0.138
180933	CXXC1	CXXC finger 1 (PHD domain)	127.97	58.18	0.345
181046	DUSP3	Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-	168.09	115.04	0.207
		related)
181112	MED4	Mediator of RNA polymerase II transcription, subunit 4 homolog	208.67	152.66	0.276
		(yeast)
181163	HMGN2	High-mobility group nucleosomal binding domain 2	798.73	84.12	0.000
181244	HLA-A	Major histocompatibility complex, class I, A	874.95	96.35	0.138
181368	PRPF8	PRP8 pre-mRNA processing factor 8 homolog (yeast)	308.98	76.46	0.138
181444	TMEM9	Transmembrane protein 9	210.70	80.44	0.172
182255	NHP2L1	NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)	236.95	69.85	0.069
182626	C22orf5	Chromosome 22 open reading frame 5	189.45	87.32	0.310
182885	SLC35B2	Solute carrier family 35, member B2	197.27	131.49	0.241
183684	EIF4G2	Eukaryotic translation initiation factor 4 gamma, 2	571.05	99.96	0.069
183706	ADD1	Adducin 1 (alpha)	210.75	70.37	0.138
183800	RANGAP1	Ran GTPase activating protein 1	330.34	92.47	0.172
183850	DCTD	DCMP deaminase	140.58	59.00	0.345
183994	PPP1CA	Protein phosphatase 1, catalytic subunit, alpha isoform	374.52	71.55	0.103
184062	C20orf24	Chromosome 20 open reading frame 24	161.95	77.22	0.310
184211	PMPCB	Peptidase (mitochondrial processing) beta	177.15	64.50	0.138
184233	HSPA9	Heat shock 70 kDa protein 9 (mortalin)	311.24	80.92	0.034
184492	ELAVL1	ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu	130.66	66.07	0.207
		antigen R)
185172	GNB2	Guanine nucleotide binding protein (G protein), beta polypeptide 2	420.89	178.43	0.172
185597	SPG7	Spastic paraplegia 7, paraplegin (pure and complicated autosomal	167.10	102.17	0.207
		recessive)
187199	MALAT1	Metastasis associated lung adenocarcinoma transcript 1 (non-	3984.95	243.42	0.241
		coding RNA)
187635	RPS15A	Chromosome 20 open reading frame 19	705.06	435.58	0.138
187763	BRD4	Bromodomain containing 4	226.90	138.89	0.241
187866	NPTN	Neuroplastin	120.12	53.64	0.379
187946	SLC20A1	Solute carrier family 20 (phosphate transporter), member 1	141.36	96.84	0.207
188501	PAFAH1B2	Platelet-activating factor acetylhydrolase, isoform Ib, beta subunit	149.54	78.69	0.138
		30 kDa
188614	PLEKHA5	Pleckstrin homology domain containing, family A member 5	115.79	66.94	0.379
188879	RBM6	RNA binding motif protein 6	100.43	54.89	0.379
188882	NUDT3	Nudix (nucleoside diphosphate linked moiety X)-type motif 3	129.54	63.13	0.276
189075	TWF1	Twinfilin, actin-binding protein, homolog 1 (Drosophila)	164.98	70.22	0.310
189119	CXXC5	CXXC finger 5	97.63	45.99	0.345
189329	SMURF1	SMAD specific E3 ubiquitin protein ligase 1	126.19	77.52	0.379
189716	NDUFAB1	NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1,	224.85	87.06	0.276
		8 kDa
189772	CCT2	Chaperonin containing TCP1, subunit 2 (beta)	269.61	95.66	0.069
190028	GSTO1	Glutathione S-transferase omega 1	178.51	92.79	0.241
190086	MRCL3	Myosin regulatory light chain MRCL3	469.83	322.83	0.172
190334	RAP1A	RAP1A, member of RAS oncogene family	130.79	76.47	0.310
190384	COPS4	COP9 constitutive photomorphogenic homolog subunit 4	163.76	100.38	0.138
		(Arabidopsis)
190722	C19orf62	Chromosome 19 open reading frame 62	218.33	85.79	0.207
190904	STRN4	Striatin, calmodulin binding protein 4	183.13	100.67	0.241
191186	TTC17	Tetratricopeptide repeat domain 17	125.42	63.68	0.310
191346	SEPT7	Septin 7	318.59	80.82	0.103
191518	DHX9	DEAH (Asp-Glu-Ala-His) box polypeptide 9	239.90	67.53	0.241
191987	UBE2J2	Ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)	125.95	71.90	0.207
192316	CDC2L1	Cell division cycle 2-like 1 (PITSLRE proteins)	102.48	85.83	0.379
192374	HSP90B1	Heat shock protein 90 kDa beta (Grp94), member 1	388.12	88.21	0.034
192425	EIF3S8	Eukaryotic translation initiation factor 3, subunit 8, 110 kDa	1001.22	91.36	0.103
193118	ZMIZ1	Zinc finger, MIZ-type containing 1	125.42	71.59	0.345
193163	BIN1	Bridging integrator 1	216.65	88.45	0.241
193491	TUBB6	Tubulin, beta 6	255.15	94.70	0.241
194329	TCEAL4	Transcription elongation factor A (SII)-like 4	110.76	60.41	0.207
194718	ZRANB2	Zinc finger, RAN-binding domain containing 2	170.63	70.34	0.207
195464	FLNA	Filamin A, alpha (actin binding protein 280)	554.90	92.75	0.172
195642	RNF213	Ring finger protein 213	146.02	74.10	0.379
196983	SSFA2	Sperm specific antigen 2	238.74	197.56	0.241
198281	PKM2	Pyruvate kinase, muscle	3044.33	101.80	0.000
199561	RANBP2	RAN binding protein 2	134.09	59.13	0.379
199625	HAX1	HCLS1 associated protein X-1	243.58	94.74	0.138
200063	HDAC7A	Histone deacetylase 7A	252.27	159.81	0.241
200600	SCAMP3	Secretory carrier membrane protein 3	165.58	75.71	0.207
200804	SDCBP	Syndecan binding protein (syntenin)	355.16	73.99	0.172
201253	CKAP5	Cytoskeleton associated protein 5	157.71	77.53	0.069
201390	WDR45L	WDR45-like	115.15	53.09	0.138
201712	GLG1	Golgi apparatus protein 1	128.23	88.99	0.310
202011	CCDC47	Coiled-coil domain containing 47	108.62	67.48	0.172
202085	VDAC1	Voltage-dependent anion channel 1	179.22	70.07	0.276
202166	HNRPH1	Heterogeneous nuclear ribonucleoprotein H1 (H)	199.33	74.31	0.069
202179	SMN2	Survival of motor neuron 1, telomeric	103.17	55.27	0.379
203099	WAPAL	Wings apart-like homolog (Drosophila)	162.13	143.02	0.345
203910	SGTA	Small glutamine-rich tetratricopeptide repeat (TPR)-containing,	213.58	79.65	0.138
		alpha
204041	AHSA1	AHA1, activator of heat shock 90 kDa protein ATPase homolog 1	263.29	112.20	0.207
		(yeast)
204773	WDR77	WD repeat domain 77	185.81	74.28	0.172
205163	MRPL3	Mitochondrial ribosomal protein L3	176.93	58.08	0.069
206500	CTTN	Cortactin	148.63	96.70	0.310
206824	MGC71993	Similar to DNA segment, Chr 11, Brigham & Womens	143.54	88.77	0.345
		Genetics 0434 expressed
208597	CTBP1	Hypothetical protein LOC285463	136.74	48.53	0.138
209983	STMN1	Stathmin 1/oncoprotein 18	619.09	139.81	0.034
210469	ELMO2	Engulfment and cell motility 2 (ced-12 homolog, C. elegans)	96.39	71.43	0.379
210532	KIAA0141	KIAA0141	138.36	72.99	0.241
211463	DNM2	Dynamin 2	195.67	87.32	0.241
211594	PSMC4	Proteasome (prosome, macropain) 26S subunit, ATPase, 4	469.59	192.26	0.138
211914	NDUFS7	NADH dehydrogenase (ubiquinone) Fe—S protein 7, 20 kDa	159.44	73.80	0.379
		(NADH-coenzyme Q reductase)
212102	PDIA6	Protein disulfide isomerase family A, member 6	274.17	97.91	0.103
212395	CIZ1	CDKN1A interacting zinc finger protein 1	272.61	88.59	0.138
213061	NUCKS1	Nuclear casein kinase and cyclin-dependent kinase substrate 1	304.71	64.96	0.138
213470	PSMB7	Proteasome (prosome, macropain) subunit, beta type, 7	247.81	65.94	0.034
213541	LOC55288	Hypothetical LOC552889	136.06	60.14	0.345
213666	KIAA0460	KIAA0460	96.71	78.04	0.241
213724	SUPT16H	Suppressor of Ty 16 homolog (S. cerevisiae)	149.27	79.71	0.207
216653	FBXO9	F-box protein 9	92.27	49.72	0.310
220950	FOXO3	Forkhead box O3	196.88	112.74	0.276
221847	SLC38A2	Solute carrier family 38, member 2	204.23	78.33	0.207
222510	DAZAP1	DAZ associated protein 1	126.05	97.18	0.276
223141	DDX21	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21	255.54	70.08	0.069
224607	SDC1	Syndecan 1	241.65	87.87	0.276
226007	RDH11	Retinol dehydrogenase 11 (all-trans and 9-cis)	340.36	135.94	0.172
226117	H1F0	H1 histone family, member 0	326.85	160.18	0.310
226755	YWHAH	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	199.21	161.02	0.207
		activation protein, eta polypeptide
227067	ATAD3A	ATPase family, AAA domain containing 3A	254.68	105.30	0.172
227253	TOMM70A	Translocase of outer mitochondrial membrane 70 homolog A	130.67	67.31	0.172
		(yeast)
227777	PTP4A1	Protein tyrosine phosphatase type IVA, member 1	219.08	115.20	0.138
229641	SUB1	SUB1 homolog (S. cerevisiae)	300.51	103.71	0.138
231295	PITPNC1	Phosphatidylinositol transfer protein, cytoplasmic 1	171.09	127.31	0.345
231616	C19orf53	Chromosome 19 open reading frame 53	162.05	104.55	0.345
232194	KIAA0174	KIAA0174	204.24	73.78	0.138
232543	PDCD4	Programmed cell death 4 (neoplastic transformation inhibitor)	126.25	61.41	0.310
233458	NFYC	Nuclear transcription factor Y, gamma	92.20	51.11	0.345
233552	CDC2L5	Cell division cycle 2-like 5 (cholinesterase-related cell division	139.27	109.94	0.379
		controller)
233952	PSMA7	Proteasome (prosome, macropain) subunit, alpha type, 7	358.81	133.21	0.069
234521	MAPKAPK3	Mitogen-activated protein kinase-activated protein kinase 3	185.75	77.03	0.379
236030	SMARCC2	SWI/SNF related, matrix associated, actin dependent regulator of	198.07	83.50	0.207
		chromatin, subfamily c, member 2
237536	NT5C3L	5′-nucleotidase, cytosolic III-like	160.67	84.27	0.276
237971	XTP3TPA	XTP3-transactivated protein A	122.34	67.16	0.276
238839	SCYL1	SCY1-like 1 (S. cerevisiae)	173.16	113.72	0.310
240170	OBFC2B	Oligonucleotide/oligosaccharide-binding fold containing 2B	136.42	69.86	0.345
241336	ATPIF1	ATPase inhibitory factor 1	227.40	125.29	0.172
241543	POLDIP2	Polymerase (DNA-directed), delta interacting protein 2	217.98	81.62	0.138
241558	ARIH2	Ariadne homolog 2 (Drosophila)	178.45	77.54	0.172
241575	GNPTG	N-acetylglucosamine-1-phosphate transferase, gamma subunit	117.17	100.69	0.345
241576	DERL1	Der1-like domain family, member 1	111.58	87.37	0.310
241579	SERPINH1	Serpin peptidase inhibitor, clade H (heat shock protein 47),	380.44	115.76	0.172
		member 1, (collagen binding protein 1)
242458	SPG21	Spastic paraplegia 21 (autosomal recessive, Mast syndrome)	120.35	59.44	0.310
242947	DGKI	Diacylglycerol kinase, iota	131.75	120.70	0.379
246112	ASCC3L1	Activating signal cointegrator 1 complex subunit 3-like 1	278.46	81.24	0.172
246310	ATP5J	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	220.45	113.90	0.276
		F6
246413	CPNE1	RNA binding motif protein 12	392.42	88.16	0.069
246781	FBXO11	F-box protein 11	141.20	92.55	0.379
247077	RHOA	Ras homolog gene family, member A	553.79	77.72	0.034
247186	FBRS	Fibrosin	145.20	107.50	0.379
247975	HSPD1	Pro-melanin-concentrating hormone-like 1	241.69	85.58	0.207
248267	MPST	Mercaptopyruvate sulfurtransferase	167.67	112.86	0.276
248941	TAF9	TAF9 RNA polymerase II, TATA box binding protein (TBP)-	148.14	65.92	0.276
		associated factor, 32 kDa
249600	DLGAP4	Discs, large (Drosophila) homolog-associated protein 4	233.49	169.10	0.276
250009	ARL8B	ADP-ribosylation factor-like 8B	132.27	55.79	0.379
250429	SUPT6H	Suppressor of Ty 6 homolog (S. cerevisiae)	162.25	82.76	0.379
250758	PSMC3	Proteasome (prosome, macropain) 26S subunit, ATPase, 3	391.11	115.64	0.138
250899	HSBP1	Heat shock factor binding protein 1	214.94	105.83	0.069
250905	TMEM85	Transmembrane protein 85	156.08	143.74	0.241
251531	PSMA4	Proteasome (prosome, macropain) subunit, alpha type, 4	739.81	217.34	0.138
252457	MVD	Mevalonate (diphospho) decarboxylase	170.93	117.34	0.379
252713	TTC15	Tetratricopeptide repeat domain 15	105.62	56.20	0.345
252967	C1orf144	Chromosome 1 open reading frame 144	240.90	109.65	0.207
253726	PAPOLA	Poly(A) polymerase alpha	216.15	65.36	0.172
253903	STOM	Stomatin	199.17	100.65	0.276
254042	BAT1	HLA-B associated transcript 1	351.44	89.43	0.069
255015	VPS24	Vacuolar protein sorting 24 (yeast)	126.82	67.80	0.069
255093	PFKL	Phosphofructokinase, liver	342.69	81.83	0.207
255932	XRN2	5′-3′ exoribonuclease 2	166.16	57.70	0.069
255935	BTG1	B-cell translocation gene 1, anti-proliferative	272.14	115.44	0.138
255973	EID1	EP300 interacting inhibitor of differentiation 1	227.90	86.79	0.138
256301	C19orf48	Chromosome 19 open reading frame 48	337.67	84.54	0.207
256549	NUBP2	Nucleotide binding protein 2 (MinD homolog, E. coli)	200.75	98.94	0.241
257008	PLD3	Phospholipase D family, member 3	349.21	100.00	0.276
257341	SAV1	Salvador homolog 1 (Drosophila)	91.57	65.55	0.276
257761	SH3BP5	SH3-domain binding protein 5 (BTK-associated)	170.93	92.54	0.345
258551	DNPEP	Aspartyl aminopeptidase	168.16	84.05	0.138
258563	FEZ2	Fasciculation and elongation protein zeta 2 (zygin II)	190.19	204.72	0.345
258798	NSMCE4A	Non-SMC element 4 homolog A (S. cerevisiae)	79.52	52.34	0.345
259461	PALM2-	PALM2-AKAP2 protein	171.91	79.41	0.310
	AKAP2
260603	PIP5K2B	Phosphatidylinositol-4-phosphate 5-kinase, type II, beta	132.75	67.00	0.276
262823	IARS2	Isoleucyl-tRNA synthetase 2, mitochondrial	139.24	59.53	0.345
265829	ITGA3	Integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3	404.31	148.83	0.379
		receptor)
268488	LRRC47	Leucine rich repeat containing 47	115.89	116.32	0.379
268530	GPS1	Radical fringe homolog (Drosophila)	263.51	64.58	0.138
268742	POMP	Proteasome maturation protein	213.22	98.49	0.276
268849	GLO1	Glyoxalase I	293.88	85.24	0.138
268939	MATR3	Matrin 3	292.73	68.23	0.034
269528	NAT13	N-acetyltransferase 13	237.37	198.20	0.172
269577	PTPRA	Protein tyrosine phosphatase, receptor type, A	183.68	82.75	0.207
269782	GNAQ	Guanine nucleotide binding protein (G protein), q polypeptide	174.12	105.06	0.241
269944	MTCH2	Mitochondrial carrier homolog 2 (C. elegans)	158.42	74.35	0.103
270291	ACTN4	Actinin, alpha 4	341.13	108.40	0.172
270428	SUCLG1	Succinate-CoA ligase, GDP-forming, alpha subunit	242.34	241.99	0.241
270525	LASS5	LAG1 longevity assurance homolog 5 (S. cerevisiae)	111.31	73.14	0.379
270869	ZNF410	Zinc finger protein 410	135.77	84.28	0.172
271135	ATP5C1	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma	448.47	176.19	0.172
		polypeptide 1
271695	NOB1	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	111.46	73.07	0.310
272062	PTPRF	Protein tyrosine phosphatase, receptor type, F	269.10	88.46	0.310
272168	SERINC3	Serine incorporator 3	121.11	72.44	0.138
272630	ATP6V1D	ATPase, H+ transporting, lysosomal 34 kDa, V1 subunit D	149.33	85.72	0.207
272927	SEC23A	Sec23 homolog A (S. cerevisiae)	128.24	74.07	0.379
273077	TMEM14B	Transmembrane protein 14B	128.20	70.29	0.345
274184	TFE3	Transcription factor binding to IGHM enhancer 3	111.31	57.20	0.276
274772	C15orf15	Chromosome 15 open reading frame 15	1163.64	205.16	0.172
274873	CARS	Cysteinyl-tRNA synthetase	176.72	76.48	0.207
275243	S100A6	S100 calcium binding protein A6 (calcyclin)	361.59	101.08	0.103
275775	SEPP1	Selenoprotein P, plasma, 1	543.33	189.21	0.379
275865	PCNP	PEST-containing nuclear protein	315.34	88.79	0.069
276878	NUP93	Nucleoporin 93 kDa	101.32	60.26	0.241
277035	MGLL	Monoglyceride lipase	399.51	211.97	0.379
277517	C11orf2	Chromosome 11 open reading frame 2	193.83	84.84	0.241
278186	ARHGEF1	Rho guanine nucleotide exchange factor (GEF) 1	194.28	91.63	0.345
278362	MEA1	Male-enhanced antigen 1	152.60	83.00	0.276
278426	PDAP1	PDGFA associated protein 1	184.93	86.49	0.172
278429	C9orf78	Chromosome 9 open reading frame 78	109.74	79.17	0.276
278500	GNPDA1	Glucosamine-6-phosphate deaminase 1	174.64	74.75	0.241
278569	SNX17	Sorting nexin 17	297.66	66.25	0.069
278573	CD59	CD59 antigen p18-20 (antigen identified by monoclonal antibodies	336.75	91.21	0.138
		16.3A5, EJ16, EJ30, EL32 and G344)
278721	SLC39A7	Solute carrier family 39 (zinc transporter), member 7	147.65	72.58	0.379
279061	GLOD4	Glyoxalase domain containing 4	148.90	76.66	0.172
279245	TACC1	Transforming, acidic coiled-coil containing protein 1	186.16	79.86	0.241
279257	PCMT1	Protein-L-isoaspartate (D-aspartate) O-methyltransferase	172.73	62.20	0.103
279413	POLD1	Polymerase (DNA directed), delta 1, catalytic subunit 125 kDa	164.91	99.93	0.276
279529	PRELID1	PRELI domain containing 1	224.95	77.28	0.172
279583	METTL9	Methyltransferase like 9	183.44	155.70	0.241
279623	SEPX1	Selenoprotein X, 1	117.70	54.66	0.345
279640	TPR	Translocated promoter region (to activated MET oncogene)	94.90	66.61	0.310
279652	MRPL4	Mitochondrial ribosomal protein L4	173.40	73.00	0.276
279669	TUBG1	Tubulin, gamma 1	169.58	65.01	0.310
279696	SUMF2	Sulfatase modifying factor 2	149.85	83.02	0.345
279806	DDX5	RNA-binding protein 45 (RBP45), putative	457.60	87.95	0.103
279836	COMMD9	COMM domain containing 9	104.98	49.94	0.379
279920	YWHAB	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	288.39	87.94	0.034
		activation protein, beta polypeptide
279929	TMED9	Transmembrane emp24 protein transport domain containing 9	291.55	91.04	0.069
280202	SBF1	SET binding factor 1	382.01	317.21	0.310
280342	PRKAR1A	Protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue	266.02	111.27	0.103
		specific extinguisher 1)
280378	SNRPB2	Small nuclear ribonucleoprotein polypeptide B″	243.47	100.43	0.310
282410	CALM1	Calmodulin 1 (phosphorylase kinase, delta)	246.78	67.76	0.103
282700	SPCS2	Signal peptidase complex subunit 2 homolog (S. cerevisiae)	232.99	84.36	0.207
282901	RBM39	RNA binding motif protein 39	166.92	85.70	0.138
282998	RBM9	RNA binding motif protein 9	477.00	221.29	0.103
283111	C14orf124	Chromosome 14 open reading frame 124	168.06	139.52	0.207
283454	BNIP2	BCL2/adenovirus E1B 19 kDa interacting protein 2	130.03	68.79	0.310
283521	RHEB	Ras homolog enriched in brain	193.25	113.28	0.310
283610	ATG4B	ATG4 autophagy related 4 homolog B (S. cerevisiae)	180.36	88.44	0.172
283652	IDI1	Isopentenyl-diphosphate delta isomerase 1	233.34	102.32	0.241
283739	UBQLN4	Ubiquilin 4	165.35	84.58	0.207
284208	ANKRD25	Ankyrin repeat domain 25	124.68	85.84	0.379
284279	HMOX2	Heme oxygenase (decycling) 2	151.53	85.91	0.310
284286	MRPS24	Mitochondrial ribosomal protein S24	136.83	77.51	0.345
284491	PDXK	Pyridoxal (pyridoxine, vitamin B6) kinase	235.50	93.74	0.138
285354	MAX	MYC associated factor X	109.16	60.60	0.345
285976	LASS2	LAG1 longevity assurance homolog 2 (S. cerevisiae)	203.17	82.28	0.172
286221	ARF1	ADP-ribosylation factor 1	704.87	66.67	0.069
286226	MYO1C	Myosin IC	253.69	114.87	0.310
288193	KPNA4	Karyopherin alpha 4 (importin alpha 3)	144.60	134.58	0.379
288856	PFDN5	Prefoldin 5	226.65	96.63	0.103
288969	NMRAL1	NmrA-like family domain containing 1	126.04	77.91	0.379
289008	NUS1	Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	157.63	95.67	0.310
289092	COTL1	Coactosin-like 1 (Dictyostelium)	315.93	109.13	0.172
289123	DCTN2	Dynactin 2 (p50)	261.39	105.34	0.069
289271	CYC1	Cytochrome c-1	345.69	78.79	0.172
290243	GBF1	Golgi-specific brefeldin A resistance factor 1	241.54	85.11	0.310
290404	SLC25A3	Solute carrier family 25 (mitochondrial carrier; phosphate carrier),	1579.85	87.93	0.034
		member 3
290758	DDB1	Damage-specific DNA binding protein 1, 127 kDa	452.78	82.29	0.138
291587	ARID1B	AT rich interactive domain 1B (SWI1-like)	135.97	82.06	0.310
292026	EIF4E2	Eukaryotic translation initiation factor 4E member 2	186.78	88.38	0.138
292063	EIF4B	Hypothetical protein PRO1843	439.43	110.97	0.103
292078	LARP1	La ribonucleoprotein domain family, member 1	246.82	65.22	0.069
292265	ZMYND11	Zinc finger, MYND domain containing 11	133.13	109.13	0.207
292457	SNHG5	Small nucleolar RNA host gene (non-protein coding) 5	400.14	267.50	0.276
292493	XRCC6	X-ray repair complementing defective repair in Chinese hamster	691.10	100.07	0.034
		cells 6 (Ku autoantigen, 70 kDa)
292524	CCNH	Cyclin H	158.48	96.80	0.276
292579	PTDSS1	Phosphatidylserine synthase 1	195.76	80.55	0.276
293563	C1orf108	Chromosome 1 open reading frame 108	144.99	87.81	0.172
295917	ATP6V1B2	ATPase, H+ transporting, lysosomal 56/58 kDa, V1 subunit B,	151.09	76.58	0.207
		isoform 2
297324	TIMP3	TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy,	505.19	227.34	0.310
		pseudoinflammatory)
298198	CMTM3	CKLF-like MARVEL transmembrane domain containing 3	127.34	71.77	0.310
298280	ATP5A1	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha	1791.25	357.36	0.000
		subunit, isoform 1, cardiac muscle
298654	DUSP6	Dual specificity phosphatase 6	208.26	87.60	0.310
299002	FBL	Fibrillarin	591.46	179.47	0.138
299055	GDI2	GDP dissociation inhibitor 2	323.73	77.59	0.069
300141	RPL39	Ribosomal protein L39	775.36	419.08	0.172
300684	RCP9	Calcitonin gene-related peptide-receptor component protein	79.62	45.89	0.241
300772	TPM2	Tropomyosin 2 (beta)	881.72	370.12	0.345
300816	RAB1B	RAB1B, member RAS oncogene family	228.92	96.00	0.172
300834	GALNT2	UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-	155.76	89.15	0.241
		acetylgalactosaminyltransferase 2 (GalNAc-T2)
301404	RBM3	RNA binding motif (RNP1, RRM) protein 3	325.81	102.69	0.172
301412	UFC1	Ubiquitin-fold modifier conjugating enzyme 1	142.19	76.03	0.276
302742	MRPS6	Mitochondrial ribosomal protein S6	184.15	77.33	0.276
302903	UBE2I	Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	178.40	82.89	0.172
303676	G3BP2	Ras-GTPase activating protein SH3 domain-binding protein 2	149.92	66.30	0.241
304192	DSTN	Destrin (actin depolymerizing factor)	223.11	77.62	0.207
304682	CST3	Cystatin C (amyloid angiopathy and cerebral hemorrhage)	266.47	126.42	0.172
306123	MAGEF1	Melanoma antigen family F, 1	183.67	83.29	0.379
306242	RANBP9	RAN binding protein 9	116.92	67.43	0.310
306329	ZFAND6	Zinc finger, AN1-type domain 6	247.28	99.07	0.276
306425	IBTK	Inhibitor of Bruton agammaglobulinemia tyrosine kinase	104.18	51.87	0.379
308122	ITPK1	Inositol 1,3,4-triphosphate 5/6 kinase	254.52	81.30	0.276
308340	NUP188	Nucleoporin 188 kDa	329.72	144.04	0.241
308709	PDIA3	Protein disulfide isomerase family A, member 3	204.27	87.48	0.069
309090	SFRS7	Splicing factor, arginine/serine-rich 7, 35 kDa	189.69	89.49	0.172
309231	C6orf153	Chromosome 6 open reading frame 153	157.44	80.31	0.310
309641	RNF11	Ring finger protein 11	162.82	68.82	0.172
309753	STARD3NL	STARD3 N-terminal like	119.30	74.99	0.310
309849	C14orf159	Chromosome 14 open reading frame 159	122.74	74.53	0.379
310542	TOMM40	Translocase of outer mitochondrial membrane 40 homolog (yeast)	267.48	79.87	0.138
310645	RAB1A	RAB1A, member RAS oncogene family	252.99	84.41	0.241
311072	MRPS35	Mitochondrial ribosomal protein S35	138.81	64.82	0.345
311346	CMAS	Cytidine monophosphate N-acetylneuraminic acid synthetase	109.31	97.45	0.345
311609	DDX39	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39	260.02	110.28	0.138
311640	RPS27A	Ribosomal protein S27a	524.64	119.16	0.034
312098	ADAM15	ADAM metallopeptidase domain 15 (metargidin)	200.26	132.76	0.345
313847	TXNDC11	Thioredoxin domain containing 11	106.99	71.40	0.345
314263	BAZ2A	Bromodomain adjacent to zinc finger domain, 2A	164.92	91.68	0.241
314359	EIF3S12	Eukaryotic translation initiation factor 3, subunit 12	248.91	116.13	0.103
315177	IFRD2	Interferon-related developmental regulator 2	180.25	60.11	0.276
315230	EIF1B	Eukaryotic translation initiation factor 1B	166.77	108.63	0.207
319334	NASP	Nuclear autoantigenic sperm protein (histone-binding)	320.92	87.44	0.103
321391	ELOF1	Elongation factor 1 homolog (S. cerevisiae)	119.51	68.26	0.345
321541	RAB11A	RAB11A, member RAS oncogene family	193.82	99.65	0.172
323363	ATG9A	ATG9 autophagy related 9 homolog A (S. cerevisiae)	159.62	88.11	0.276
323489	PTCD3	Pentatricopeptide repeat domain 3	153.29	80.62	0.172
324250	NDUFB2	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8 kDa	245.74	182.66	0.379
324844	VKORC1	Vitamin K epoxide reductase complex, subunit 1	151.74	66.24	0.276
325650	EHD2	EH-domain containing 2	160.03	99.53	0.379
326387	MORF4L2	Mortality factor 4 like 2	313.02	109.69	0.103
330384	CORO1C	Coronin, actin binding protein, 1C	171.53	69.53	0.103
331431	SCC-112	SCC-112 protein	242.38	75.28	0.069
333388	EEF1D	Eukaryotic translation elongation factor 1 delta (guanine nucleotide	899.57	105.63	0.000
		exchange protein)
333579	HSPC152	Hypothetical protein HSPC152	209.20	133.84	0.172
333786	PSMA2	Proteasome (prosome, macropain) subunit, alpha type, 2	207.24	97.57	0.138
333823	MRPL13	Mitochondrial ribosomal protein L13	113.33	69.75	0.345
334017	TUBA1B	Tubulin, alpha 1b	1834.27	95.82	0.000
334479	TRAF7	TNF receptor-associated factor 7	242.13	130.36	0.138
334534	GNS	Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID)	129.18	72.76	0.276
334587	RBPMS	RNA binding protein with multiple splicing	136.68	59.93	0.345
334713	UBL7	Ubiquitin-like 7 (bone marrow stromal cell-derived)	192.75	67.45	0.207
334851	LASP1	LIM and SH3 protein 1	297.69	80.06	0.034
334868	PPP2R5E	Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform	111.74	78.51	0.345
335003	ANKRD11	Ankyrin repeat domain 11	152.63	135.85	0.276
335057	SEPT2	Septin 2	321.01	90.60	0.069
335163	LIMCH1	LIM and calponin homology domains 1	217.46	84.47	0.379
335918	FDPS	Farnesyl diphosphate synthase (farnesyl pyrophosphate	635.55	104.20	0.034
		synthetase, dimethylallyltranstransferase, geranyltranstransferase
337295	STIP1	Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing	326.55	78.19	0.172
337766	TXNRD1	Thioredoxin reductase 1	641.30	103.44	0.034
339278	COPB1	Coatomer protein complex, subunit beta 1	144.35	59.14	0.241
339639	COX7A2L	Cytochrome c oxidase subunit VIIa polypeptide 2 like	222.21	84.81	0.241
339697	GRINA	Glutamate receptor, ionotropic, N-methyl D-asparate-associated	287.06	90.28	0.103
		protein 1 (glutamate binding)
343911	EI24	Etoposide induced 2.4 mRNA	172.38	72.77	0.103
345694	KCMF1	Potassium channel modulatory factor 1	114.01	57.72	0.345
346868	EBNA1BP2	EBNA1 binding protein 2	190.81	79.22	0.276
348418	DR1	Down-regulator of transcription 1, TBP-binding (nagative cofactor	109.41	77.62	0.207
349656	SCARB2	Scavenger receptor class B, member 2	147.31	89.03	0.241
350194	ZMAT2	Zinc finger, matrin type 2	115.49	53.42	0.207
350229	CASC3	Cancer susceptibility candidate 3	124.19	53.21	0.241
350268	IRF2BP2	Interferon regulatory factor 2 binding protein 2	153.03	81.62	0.276
350364	FAM120AOS	Family with sequence similarity 120A opposite strand	107.30	65.11	0.379
350927	SLC25A6	Solute carrier family 25 (mitochondrial carrier; adenine nucleotide	952.99	85.55	0.000
		translocator), member 6
351099	FLJ10241	Hypothetical protein FLJ10241	126.93	65.83	0.276
351296	LOC51035	SAPK substrate protein 1	210.44	71.71	0.172
351316	TM4SF1	Transmembrane 4 L six family member 1	422.43	110.13	0.276
351474	PAQR4	Progestin and adipoQ receptor family member IV	212.87	153.70	0.345
351680		CDNA clone IMAGE: 5302006	133.19	88.88	0.276
351875	COX6C	Cytochrome c oxidase subunit VIc	304.69	180.70	0.310
352341	STCH	Stress 70 protein chaperone, microsome-associated, 60 kDa	121.74	86.32	0.379
352656	GHITM	Growth hormone inducible transmembrane protein	363.92	99.19	0.103
352768	PSMB1	Proteasome (prosome, macropain) subunit, beta type, 1	292.02	82.24	0.103
354056	POR	P450 (cytochrome) oxidoreductase	227.09	82.79	0.379
355141	TNIP1	TNFAIP3 interacting protein 1	269.81	97.79	0.241
355606	TMEM167	Transmembrane protein 167	211.08	149.60	0.276
355643	RNPS1	RNA binding protein S1, serine-rich domain	423.42	65.75	0.103
355708	TMEM127	Transmembrane protein 127	77.31	49.24	0.379
355750	JOSD3	Josephin domain containing 3	117.50	61.17	0.379
355753	AGPAT6	1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic	150.13	73.56	0.345
		acid acyltransferase, zeta)
355867	MARS	Methionine-tRNA synthetase	323.10	233.26	0.069
355927	VDAC2	Voltage-dependent anion channel 2	242.40	82.56	0.103
355934	SFPQ	Splicing factor proline/glutamine-rich (polypyrimidine tract binding	269.46	133.96	0.138
		protein associated)
355983	BZW1	Basic leucine zipper and W2 domains 1	338.32	108.39	0.103
356061	MAP1LC3B	Microtubule-associated protein 1 light chain 3 beta	126.69	74.25	0.207
356096	MAP7D1	MAP7 domain containing 1	191.33	92.49	0.207
356190	UBB	Ubiquitin B	742.69	74.99	0.000
356270	SDHD	Succinate dehydrogenase complex, subunit D, integral membrane	977.72	187.08	0.207
		protein
356285	HMGN1	High-mobility group nucleosome binding domain 1	279.36	80.39	0.138
356331	PPIA	Peptidylprolyl isomerase A (cyclophilin A)	1225.70	78.02	0.034
356368	RPS2	Ribosomal protein S2	5031.59	91.00	0.000
356371	RPL28	Ribosomal protein L28	622.10	176.27	0.034
356377	RNF187	Ring finger protein 187	188.84	96.73	0.207
356487	C19orf42	Chromosome 19 open reading frame 42	148.32	80.69	0.034
356501	PHF6	PHD finger protein 6	145.65	87.04	0.310
356502	RPLP1	Ribosomal protein, large, P1	881.03	208.46	0.000
356549	SNRPD3	Small nuclear ribonucleoprotein D3 polypeptide 18 kDa	153.63	84.17	0.276
356630	NUTF2	Nuclear transport factor 2	144.29	83.13	0.103
356647	SNX6	Sorting nexin 6	134.10	84.57	0.310
356654	PSMC1	Proteasome (prosome, macropain) 26S subunit, ATPase, 1	154.97	82.94	0.172
356766	C20orf199	Chromosome 20 open reading frame 199	227.51	154.61	0.310
356769	MAN2B1	Mannosidase, alpha, class 2B, member 1	166.87	97.57	0.310
356799	RPL41	Ribosomal protein L41	336.21	165.15	0.345
357901	SOX4	SRY (sex determining region Y)-box 4	163.64	90.74	0.345
362728	SEP15	15 kDa selenoprotein	302.87	139.54	0.138
365116	U2AF1	U2(RNU2) small nuclear RNA auxiliary factor 1	152.30	63.70	0.241
368084	LRPPRC	Leucine-rich PPR-motif containing	180.31	95.65	0.241
368149	CCT7	Chaperonin containing TCP1, subunit 7 (eta)	968.98	94.04	0.069
368157	PYGB	Phosphorylase, glycogen; brain	289.40	94.26	0.241
368240	DYRK1A	Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	132.39	93.19	0.379
368264	PPP2R5C	Protein phosphatase 2, regulatory subunit B (B56), gamma	235.30	135.72	0.103
368376	SRPR	Signal recognition particle receptor (‘docking protein’)	170.10	91.17	0.138
368402	C8orf55	Chromosome 8 open reading frame 55	129.24	75.63	0.379
368404	EXT2	Exostoses (multiple) 2	144.25	80.41	0.345
368525	PDLIM1	PDZ and LIM domain 1 (elfin)	285.39	113.52	0.241
368598	ZC3H15	Zinc finger CCCH-type containing 15	153.03	73.26	0.172
368934	C17orf45	Chromosome 17 open reading frame 45	538.27	122.37	0.103
368985	TRIP12	Thyroid hormone receptor interactor 12	160.59	66.50	0.345
369017	RAB2A	RAB2A, member RAS oncogene family	165.09	87.27	0.172
369052	SELT	Selenoprotein T	368.37	150.53	0.172
369068	DYNC1LI2	Dynein, cytoplasmic 1, light intermediate chain 2	158.58	97.53	0.138
369125	PSMD14	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	166.50	83.15	0.103
369285	INTS7	Integrator complex subunit 7	112.06	98.19	0.379
369356	MLL5	Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog,	156.73	73.07	0.276
		Drosophila)
369606	CPSF6	Cleavage and polyadenylation specific factor 6, 68 kDa	132.90	65.76	0.207
369607	GAK	Cyclin G associated kinase	139.66	91.16	0.379
369614	COPS2	COP9 constitutive photomorphogenic homolog subunit 2	138.58	64.46	0.241
		(Arabidopsis)
369615	SLC25A38	Solute carrier family 25, member 38	148.69	73.93	0.345
369761	DAZAP2	DAZ associated protein 2	432.10	77.51	0.069
369785	C19orf50	Chromosome 19 open reading frame 50	176.53	91.76	0.207
369920	RAP1B	RAP1B, member of RAS oncogene family	160.45	86.70	0.138
370024	SEC31A	SEC31 homolog A (S. cerevisiae)	162.54	73.78	0.138
370247	APLP2	Amyloid beta (A4) precursor-like protein 2	331.96	98.29	0.207
370292	BCCIP	BRCA2 and CDKN1A interacting protein	116.14	69.62	0.172
370312	FNTA	Farnesyltransferase, CAAX box, alpha	113.75	73.97	0.172
370408	COMT	Catechol-O-methyltransferase	269.48	182.45	0.138
370581	CAP1	CAP, adenylate cyclase-associated protein 1 (yeast)	429.82	79.15	0.069
370770	XPO1	Exportin 1 (CRM1 homolog, yeast)	218.71	75.18	0.172
370771	CDKN1A	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)	406.91	129.23	0.207
370895	RPN2	Ribophorin II	431.77	115.24	0.069
370927	LRRC59	Leucine rich repeat containing 59	338.69	149.06	0.138
370937	TAPBP	TAP binding protein (tapasin)	159.24	70.81	0.310
371001	EIF3S9	Eukaryotic translation initiation factor 3, subunit 9 eta, 116 kDa	343.76	63.64	0.103
371416	CARM1	Coactivator-associated arginine methyltransferase 1	168.54	108.72	0.276
371563	RAB14	RAB14, member RAS oncogene family	154.08	65.54	0.310
371783	C1orf77	Chromosome 1 open reading frame 77	121.36	60.36	0.207
371889	ATP1A1	Hypothetical protein MGC16179	910.43	156.53	0.069
372003	FAM120A	Family with sequence similarity 120A	211.67	121.79	0.241
372050	YIPF5	Yip1 domain family, member 5	117.56	66.39	0.276
372286	CUL3	Cullin 3	131.34	66.77	0.207
372331	SPTAN1	Spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	187.03	76.74	0.207
372541	KBTBD2	Kelch repeat and BTB (POZ) domain containing 2	100.18	63.32	0.310
372616	ARL1	ADP-ribosylation factor-like 1	107.60	50.60	0.345
372914	NDRG1	N-myc downstream regulated gene 1	214.33	101.47	0.241
373550	TGIF1	TGFB-induced factor homeobox 1	109.97	67.30	0.379
373741	HM13	Histocompatibility (minor) 13	280.09	120.85	0.069
373763	HNRPR	Heterogeneous nuclear ribonucleoprotein R	210.83	74.59	0.103
373952	CAMTA2	Calmodulin binding transcription activator 2	181.38	88.37	0.345
373959	VGLL4	Vestigial like 4 (Drosophila)	141.11	70.42	0.310
374043	ASXL1	Additional sex combs like 1 (Drosophila)	130.97	88.31	0.241
374257	LOC28616	Hypothetical protein LOC286167	151.79	112.19	0.276
374378	CKS1B	CDC28 protein kinase regulatory subunit 1B	179.04	67.28	0.172
374477	EWSR1	Ewing sarcoma breakpoint region 1	423.33	116.42	0.069
374503	MORF4L1	Mortality factor 4 like 1	292.45	60.67	0.069
374588	RPL17	Ribosomal protein L17	907.22	138.52	0.034
374596	TPT1	Tumor protein, translationally-controlled 1	987.59	77.14	0.034
374650	IFITM3	Interferon induced transmembrane protein 3 (1-8U)	366.99	97.80	0.276
374973	PRPF4	PRP4 pre-mRNA processing factor 4 homolog (yeast)	103.66	65.33	0.207
375001	TLN1	Talin 1	392.09	120.61	0.138
375108	CD24	CD24 antigen (small cell lung carcinoma cluster 4 antigen)	239.14	95.21	0.310
375217	RNF31	Ring finger protein 31	104.06	73.05	0.379
376046	BTN3A2	Butyrophilin, subfamily 3, member A2	149.93	123.05	0.310
376933	GUK1	Guanylate kinase 1	401.68	92.59	0.276
377155	MTDH	Metadherin	214.89	91.52	0.138
378103	RPS5	Ribosomal protein S5	1006.11	134.01	0.069
378532	HBS1L	HBS1-like (S. cerevisiae)	131.17	80.02	0.241
378808	EIF2A	Eukaryotic translation initiation factor 2A, 65 kDa	197.55	75.77	0.138
380403	BMI1	BMI1 polycomb ring finger oncogene	103.02	59.56	0.276
380774	DDX3X	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked	183.86	64.56	0.241
380953	RPL38	Ribosomal protein L38	472.88	260.03	0.138
380973	SUMO2	SMT3 suppressor of mif two 3 homolog 2 (yeast)	634.74	241.40	0.103
381008	HLA-E	Major histocompatibility complex, class I, E	476.57	108.00	0.103
381058	KIAA0146	KIAA0146 protein	136.13	82.82	0.276
381072	PPIF	Peptidylprolyl isomerase F (cyclophilin F)	236.14	96.10	0.034
381123	RPL21	Ribosomal protein L21	1087.11	152.34	0.069
381126	RPS14	Ribosomal protein S14	312.13	120.35	0.172
381189	CBX3	Chromobox homolog 3 (HP1 gamma homolog Drosophila)	352.70	90.90	0.138
381219	RPL15	Ribosomal protein L15	454.76	118.60	0.034
381256	GLTP	Glycolipid transfer protein	107.14	53.95	0.379
382044	MRPS2	Mitochondrial ribosomal protein S2	171.06	80.19	0.207
382168	NCOA3	Nuclear receptor coactivator 3	166.37	135.20	0.345
385913	ANP32E	Acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	183.06	71.26	0.345
385986	UBE2B	Ubiquitin-conjugating enzyme E2B (RAD6 homolog)	135.72	71.52	0.345
386434	ANXA7	Annexin A7	173.87	70.85	0.138
386465	CHERP	Calcium homeostasis endoplasmic reticulum protein	177.08	80.21	0.345
386939	USP7	Ubiquitin specific peptidase 7 (herpes virus-associated)	181.20	217.36	0.207
387208	FAU	Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV)	338.62	163.47	0.103
		ubiquitously expressed (fox derived); ribosomal protein S30
387804	PABPC1	Poly(A) binding protein, cytoplasmic 1	625.68	87.04	0.000
388034	RXRB	Retinoid X receptor, beta	142.87	89.88	0.310
388654	ATP6V1G1	ATPase, H+ transporting, lysosomal 13 kDa, V1 subunit G isoform 1	234.65	112.64	0.172
388664	RPL11	Ribosomal protein L11	672.13	137.34	0.034
388739	XRCC5	X-ray repair complementing defective repair in Chinese hamster	346.39	73.79	0.034
		cells 5 (double-strand-break rejoining; Ku autoantigan, 80 kDa)
388927	YY1	YY1 transcription factor	136.53	65.73	0.103
388956	C19orf22	Chromosome 19 open reading frame 22	133.57	84.00	0.345
389037	MCM3APAS	MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)	152.46	115.81	0.207
		associated protein
389107	ATP6V0C	ATPase, H+ transporting, lysosomal 16 kDa, V0 subunit c	237.34	79.84	0.172
389171	PINK1	PTEN induced putative kinase 1	126.44	98.97	0.207
389649	EIF4A3	Eukaryotic translation initiation factor 4A, isoform 3	193.85	75.13	0.138
389734	TCEAL8	Transcription elongation factor A (SII)-like 8	155.08	72.63	0.345
389996	CHCHD2	Colied-coli-helix-coiled-coil-helix domain containing 2	373.11	68.47	0.034
390667	GSTK1	Glutathione S-transferase kappa 1	168.35	104.34	0.241
393201	ACTR2	ARP2 actin-related protein 2 homolog (yeast)	328.49	139.01	0.172
395482	PTK2	PTK2 protein tyrosine kinase 2	177.88	103.98	0.207
396644	PAIP2	Poly(A) binding protein interacting protein 2	198.13	69.25	0.103
396740	NIP30	NEFA-interacting nuclear protein NIP30	96.64	53.08	0.241
396783	SLC9A3R1	Solute carrier family 9 (sodium/hydrogen exchanger), member 3	165.70	98.11	0.276
		regulator 1
397609	RPS16	Ribosomal protein S16	1470.38	224.21	0.069
399800	AKAP8L	A kinase (PRKA) anchor protein 8-like	166.62	90.19	0.310
400295	RPL30	Ribosomal protein L30	473.07	139.61	0.103
401509	RBM10	RNA binding motif protein 10	170.05	75.56	0.172
401903	COX5A	Cytochrome c oxidase subunit Va	149.97	93.76	0.379
401929	RPL10	Ribosomal protein L10	1521.64	147.31	0.000
403917	STK24	Serine/threonine kinase 24 (STE20 homolog, yeast)	150.48	64.52	0.276
404056	EIF3S1	Eukaryotic translation initiation factor 3, subunit 1 alpha, 35 kDa	140.93	90.80	0.310
404321	GARS	Glycyl-tRNA synthetase	247.29	80.31	0.034
405144	SFRS3	Splicing factor, arginine/serine-rich 3	526.80	137.87	0.034
405410	OGT	O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-	153.55	55.45	0.379
		acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
405514	KIAA1267	KIAA1267	114.08	65.11	0.345
405590	EIF3S6	Eukaryotic translation initiation factor 3, subunit 6 48 kDa	654.44	113.72	0.069
405880	MRPS21	Mitochondrial ribosomal protein S21	141.88	82.93	0.276
405942	CCDC137	Coiled-coil domain containing 137	133.03	86.11	0.241
406062	NDUFA11	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7 kDa	173.17	93.80	0.345
406068	UBE2M	Ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)	132.46	80.88	0.345
406096	ZFAND5	Zinc finger, AN1-type domain 5	192.43	93.38	0.345
406277	SF3A1	Splicing factor 3a, subunit 1, 120 kDa	296.74	89.39	0.276
406300	RPL23	Ribosomal protein L23	696.30	308.79	0.069
406423	SF3B2	Splicing factor 3b, subunit 2, 145 kDa	355.96	73.17	0.069
406510	ATP5B	ATP synthase, H+ transporting, mitochondrial F1 complex, beta	1002.07	88.90	0.034
		polypeptide
406520	LOC38954	Similar to CG14977-PA	124.27	87.28	0.276
406534	HMG20B	High-mobility group 20B	281.92	155.98	0.103
406590	MRFAP1	Mof4 family associated protein 1	256.02	73.95	0.207
406620	RPS10	Ribosomal protein S10	1185.80	153.87	0.034
406683	RPS15	Ribosomal protein S15	521.25	123.23	0.069
406799	RAB18	RAB18, member RAS oncogene family	127.87	57.58	0.310
406840	SLC35A4	Solute carrier family 35, member A4	186.45	71.30	0.103
407368	LSM14A	LSM14A, SCD6 homolog A (S. cerevisiae)	151.28	68.77	0.207
407580	PKP4	Plakophilin 4	130.61	101.53	0.207
407995	MIF	Macrophage migration inhibitory factor (glycosylation-inhibiting	520.62	161.06	0.241
		factor)
408018	RPL36	Ribosomal protein L36	426.58	200.20	0.276
408073	RPS6	Ribosomal protein S6	1753.93	92.01	0.034
408236	TXNL5	Thioredoxin-like 5	137.51	78.57	0.276
408257	NDUFS6	NADH dehydrogenase (ubiquinone) Fe—S protein 6, 13 kDa	167.98	115.41	0.379
		(NADH-coenzyme Q reductase)
408293	CEP170	Centrosomal protein 170 kDa	95.55	57.63	0.379
408324	FLJ10769	Hypothetical protein FLJ10769	179.63	110.86	0.345
408428	FOXN3	Forkhead box N3	171.98	93.85	0.379
408581	SVIL	Supervillin	150.79	78.33	0.276
408909	GOLPH3	Golgi phosphoprotein 3 (coat-protein)	149.55	90.99	0.207
409140	ATP5O	ATP synthase, H+ transporting, mitochondrial F1 complex, O	238.76	77.50	0.138
		subunit (oligomycin sensitivity conferring protein)
409223	SSR4	Signal sequence receptor, delta (translocon-associated protein	187.19	88.00	0.138
		delta)
409230	AGPAT1	1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic	188.83	78.43	0.207
		acid acyltransferase, alpha)
409834	PHPT1	Phosphohistidine phosphatase 1	129.72	80.15	0.379
410197	IDH3G	Isocitrate dehydrogenase 3 (NAD+) gamma	142.89	74.63	0.276
410596	WDR68	WD repeat domain 68	190.39	78.19	0.069
410817	RPL13	Ribosomal protein L13	1259.59	96.20	0.034
411480	AUP1	Ancient ubiquitous protein 1	197.34	72.07	0.103
411641	EIF4EBP1	Eukaryotic translation initiation factor 4E binding protein 1	185.54	87.93	0.310
411847	MAPK6	Mitogen-activated protein kinase 6	143.89	100.65	0.207
412103	EFHA1	EF-hand domain family, member A1	130.69	68.19	0.276
412117	ANXA6	Annexin A6	173.96	90.66	0.172
412196	IFT57	Intraflagellar transport 57 homolog (Chlamydomonas)	109.98	56.91	0.379
412433	AIP	Aryl hydrocarbon receptor interacting protein	157.20	76.87	0.207
412468	KLHDC3	Kelch domain containing 3	366.49	77.49	0.172
412842	CDC123	Cell division cycle 123 homolog (S. cerevisiae)	155.00	62.20	0.207
413036	WBSCR22	Williams Beuren syndrome chromosome region 22	181.29	80.06	0.103
413482	C21orf33	Chromosome 21 open reading frame 33	220.73	103.88	0.172
414579	SCOTIN	Scotin	344.80	79.60	0.138
415342	TCF25	Transcription factor 25 (basic helix-loop-helix)	132.99	67.57	0.172
416049	TNPO2	Transportin 2 (importin 3, karyopherin beta 2b)	121.80	74.72	0.345
416436	TRIM50	Tripartite motif-containing 50	253.97	118.36	0.138
417004	S100A11	S100 calcium binding protein A11 (calgizzarin)	282.02	146.47	0.138
417029	C17orf81	Chromosome 17 open reading frame 81	116.93	60.21	0.379
418123	CTSLL3	Cathepsin L-like 3	196.99	151.69	0.345
418175	VPS28	Vacuolar protein sorting 28 (yeast)	137.80	101.08	0.345
418233	MRPL24	Mitochondrial ribosomal protein L24	111.66	117.93	0.345
418450	MRPL11	Mitochondrial ribosomal protein L11	169.41	63.02	0.310
418533	BUB3	BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)	180.32	113.91	0.172
418668	ATP5D	ATP synthase, H+ transporting, mitochondrial F1 complex, delta	142.90	94.88	0.276
		subunit
419640	PARK7	Parkinson disease (autosomal recessive, early onset) 7	255.09	75.95	0.172
420269	COL6A2	Collagen, type VI, alpha 2	425.15	132.41	0.379
420272	H2AFY	H2A histone family, member Y	238.54	78.85	0.069
421257	RPL7	Ribosomal protein L7	148.01	111.08	0.138
421509	CCT4	Chaperonin containing TCP1, subunit 4 (delta)	245.54	69.17	0.138
422113	ZNF511	Zinc finger protein 511	92.03	40.84	0.379
423935	RDBP	RD RNA binding protein	114.07	56.49	0.241
423968	FIS1	Fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)	140.14	94.84	0.379
424126	SERF2	Small EDRK-rich factor 2	421.90	169.35	0.103
424908	LSM5	LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)	118.18	94.48	0.310
425777	UBE2L6	Ubiquitin-conjugating enzyme E2L 6	176.08	83.76	0.345
426296	C10orf104	Chromosome 10 open reading frame 104	193.46	94.72	0.207
426359	PRR13	proline rich 13	204.04	77.90	0.345
429052	ITGB1	Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen	343.25	71.08	0.207
		CD29 includes MDF2, MSK12)
429353	SEPN1	Selenoprotein N, 1	163.54	91.46	0.241
429581	RTN4	Reticulon 4	587.74	263.68	0.069
429819	PITPNA	Phosphatidylinositol transfer protein, alpha	132.54	66.33	0.241
429839	BTF3L4	Basic transcription factor 3-like 4	128.62	88.13	0.379
430425	GNB1	Guanine nucleotide binding protein (G protein), beta polypeptide 1	348.68	72.19	0.069
430551	IQGAP1	IQ motif containing GTPase activating protein 1	168.69	68.30	0.241
430606	CS	Citrate synthase	377.31	109.46	0.034
430657	ARF5	ADP-ribosylation factor 5	184.36	99.34	0.310
430733	CLNS1A	Chloride channel, nucleotide-sensitive, 1A	147.58	71.03	0.207
431101	GNG12	Guanine nucleotide binding protein (G protein), gamma 12	197.95	72.99	0.310
431367	VTA1	Vps20-associated 1 homolog (S. cerevisiae)	154.26	81.47	0.172
431498	FOXP1	Forkhead box P1	158.95	84.08	0.345
431550	MAP4K4	Mitogen-activated protein kinase kinase kinase kinase 4	150.49	75.85	0.241
431668	COX6B1	Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)	249.30	171.30	0.207
431850	MAPK1	Mitogen-activated protein kinase 1	147.43	68.90	0.241
431861	PPP5C	Protein phosphatase 5, catalytic subunit	203.35	97.62	0.138
431926	NFKB1	Nuclear factor of kappa light polypeptide gene enhancer in B-cells	118.70	65.79	0.310
		1 (p105)
432121	PRDX2	Peroxiredoxin 2	328.05	98.46	0.069
432438	EML4	Echinoderm microtubule associated protein like 4	127.17	67.00	0.345
432491	ESD	Esterase D/formylglutathione hydrolase	181.49	81.57	0.103
432690	SLC39A9	Solute carrier family 39 (zinc transporter), member 9	123.27	74.29	0.207
432760	CAPZB	Capping protein (actin filament) muscle Z-line, beta	189.76	70.34	0.069
432898	RPL4	Mitogen-activated protein kinase kinase kinase 13	2173.97	96.68	0.000
432976	NR1H2	Nuclear receptor subfamily 1, group H, member 2	190.02	112.04	0.241
433154	PLSCR3	Phospholipid scramblase 3	118.46	78.13	0.345
433201	CDK2AP1	CDK2-associated protein 1	137.33	80.77	0.241
433222	NPC2	Niemann-Pick disease, type C2	218.82	98.64	0.069
433291	ARD1A	ARD1 homolog A, N-acetyltransferase (S. cerevisiae)	119.07	75.05	0.207
433307	BCKDHA	Branched chain keto acid dehydrogenase E1, alpha polypeptide	166.35	84.74	0.379
		(maple syrup urine disease)
433343	SRRM2	Serine/arginine repetitive matrix 2	179.81	99.94	0.103
433345		Full-length cDNA clone CL0BB014ZH04 of Neuroblastoma of	131.69	72.43	0.241
		Homo sapiens (human)
433419	COX4I1	Cytochrome c oxidase subunit IV isoform 1	291.96	97.81	0.103
433512	ACTR3	ARP3 actin-related protein 3 homolog (yeast)	202.84	72.82	0.103
433529	RPS11	Ribosomal protein S11	659.56	130.65	0.069
433540	DNAJC8	DnaJ (Hsp40) homolog, subfamily C, member 8	164.57	66.59	0.172
433573	C11orf68	Chromosome 11 open reading frame 68	109.74	74.58	0.379
433615	TUBB2C	Tubulin, beta 2C	1313.99	109.59	0.034
433701	RPL37A	Ribosomal protein L37a	941.22	280.38	0.034
433722	KIAA1967	KIAA1967	137.26	57.51	0.345
433732	CLK1	CDC-like kinase 1	179.68	71.24	0.379
433750	EIF4G1	Eukaryotic translation initiation factor 4 gamma, 1	509.92	79.20	0.138
433759	BANF1	Barrier to autointegration factor 1	185.36	115.51	0.103
433795	SHC1	SHC (Src homology 2 domain containing) transforming protein 1	307.01	110.48	0.103
433863	PEBP1	Phosphatidylethanolamine binding protein 1	349.44	89.20	0.034
433901	COX8A	Cytochrome c oxidase subunit 8A (ubiquitous)	335.34	202.06	0.207
433951	GPX4	Glutathione peroxidase 4 (phospholipid hydroperoxidase)	265.60	84.94	0.207
434102	HMGB1	High-mobility group box 1	638.86	104.01	0.000
434207	HARS2	Histidyl-tRNA synthetase 2	146.76	94.43	0.276
434219	ANKHD1	Ankyrin repeat and KH domain containing 1	190.31	76.42	0.103
434401	ZNF638	Zinc finger protein 638	127.61	80.05	0.276
434937	PPIB	Peptidylprolyl isomerase B (cyclophilin B)	258.12	78.54	0.069
434953	HMGB2	High-mobility group box 2	275.63	95.40	0.138
434980	APP	Amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer	228.56	92.10	0.172
		disease)
435044	TBC1D22A	TBC1 domain family, member 22A	160.02	137.97	0.310
435064	DENND1A	DENN/MADD domain containing 1A	99.58	55.26	0.379
435120	KIF1C	Kinesin family member 1C	210.09	68.46	0.241
435136	TXN	Thioredoxin	346.61	189.66	0.276
435166	LBR	Lamin B receptor	188.22	185.85	0.310
435231	ZFR	Zinc finger RNA binding protein	158.35	73.83	0.172
435255	UBXD1	UBX domain containing 1	173.66	118.04	0.241
435326	ACTL6A	Actin-like 6A	152.42	64.63	0.172
435512	PPP3CA	Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha	156.63	85.19	0.345
		isoform (calcineurin A alpha)
435535	ZNF395	Zinc finger protein 395	126.06	79.68	0.310
435610	WAC	WW domain containing adaptor with coiled-coil	197.21	111.45	0.172
435741	GCSH	IQ motif and WD repeats 1	165.11	72.41	0.138
435759	THAP4	THAP domain containing 4	133.58	83.98	0.379
435771	API5	Apoptosis inhibitor 5	191.29	106.97	0.276
435841	TNRC15	Trinucleotide repeat containing 15	115.02	60.28	0.310
435850	LYPLA1	Lysophospholipase I	278.94	96.93	0.138
435933	PHF10	Chromosome 6 open reading frame 120	160.27	71.75	0.276
435948	ATAD1	ATPase family, AAA domain containing 1	119.77	79.07	0.310
435952	CDK5RAP1	CDK5 regulatory subunit associated protein 1	122.11	83.77	0.310
435974	MTHFD1	Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1,	193.28	103.81	0.172
		methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate
		synthetase
436035	TUBA1C	Tubulin, alpha 1c	3419.68	98.12	0.000
436093	BAT2	HLA-B associated transcript 2	414.35	96.65	0.172
436204	ZNF289	Zinc finger protein 289, ID1 regulated	187.48	70.10	0.138
436298	EMP1	Epithelial membrane protein 1	139.81	90.61	0.310
436405	IDH3B	Isocitrate dehydrogenase 3 (NAD+) beta	233.17	64.64	0.172
436437	ALDH2	Aldehyde dehydrogenase 2 family (mitochondrial)	213.99	91.66	0.207
436446	ARMET	Arginine-rich, mutated in early stage tumors	238.76	107.79	0.379
436500	DBNL	Drebrin-like	322.18	106.61	0.241
436568	CD74	CD74 antigen (invariant polypeptide of major histocompatibility	3672.46	211.82	0.345
		complex, class II antigen-associated)
436578	POLR2F	Polymerase (RNA) II (DNA directed) polypeptide F	106.90	73.50	0.345
436657	CLU	Clusterin (complement lysis inhibitor, SP-40,40, sulfated	586.91	158.76	0.241
		glycoprotein 2, testosterone-repressed prostate message 2,
		apolipoprotein J)
436687	SET	SET translocation (myeloid leukemia-associated)	285.02	84.84	0.034
436803	VBP1	Von Hippel-Lindau binding protein 1	182.84	93.52	0.207
437056	SUPT5H	Suppressor of Ty 5 homolog (S. cerevisiae)	216.64	117.71	0.207
437060	CYCS	Cytochrome c, somatic	1874.90	252.41	0.207
437110	ANXA2	Annexin A2	2060.10	130.61	0.034
437178	ACADVL	Acyl-Coenzyme A dehydrogenase, very long chain	288.37	92.69	0.069
437256	GRINL1A	Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A	151.07	83.14	0.345
437277	MGAT4B	Mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-	1083.50	147.46	0.103
		acetylglucosaminyltransferase, isoenzyme B
437367	GBAS	Glioblastoma amplified sequence	143.22	113.71	0.276
437388	PIGT	Phosphatidylinositol glycan, class T	227.91	106.45	0.103
437403	PPA1	Pyrophosphatase (inorganic) 1	159.06	72.02	0.138
437594	RPLP2	Ribosomal protein, large, P2	498.18	148.73	0.034
437638	XBP1	X-box binding protein 1	319.21	100.78	0.069
437779	C11orf10	Chromosome 11 open reading frame 10	241.39	149.44	0.345
437831	C14orf32	Chromosome 14 open reading frame 32	175.37	74.13	0.241
438072	UNC84A	Unc-84 homolog A (C. elegans)	146.52	82.20	0.345
438219	GPS2	G protein pathway suppressor 2	172.78	109.64	0.172
438429	RPS19	Ribosomal protein S19	721.53	169.75	0.103
438678	TALDO1	Transaldolase 1	280.29	75.06	0.138
438720	MCM7	MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)	548.49	107.89	0.138
438970	TBL1XR1	Transducin (beta)-like 1X-linked receptor 1	185.70	86.87	0.241
438974	CUTL1	Cut-like 1, CCAAT displacement protein (Drosophila)	159.65	95.91	0.310
439480	RBM5	RNA binding motif protein 5	145.24	117.34	0.379
439481	SUPT4H1	Suppressor of Ty 4 homolog 1 (S. cerevisiae)	139.55	62.12	0.207
439548	FAM96A	Family with sequence similarity 96, member A	155.35	85.61	0.241
439552	MAP2K3	Mitogen-activated protein kinase kinase 3	2617.77	147.47	0.000
439815	HBXIP	Hepatitis B virus x interacting protein	127.08	97.39	0.310
440382	TRIM27	Tripartite motif-containing 27	155.33	68.54	0.172
440544	CLIC4	Chloride intracellular channel 4	337.71	121.54	0.103
440599	DDX1	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	433.83	283.30	0.103
440604	PSMD7	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	156.07	77.17	0.138
		(Mov34 homolog)
440899	TTYH3	Tweety homolog 3 (Drosophila)	229.54	97.64	0.172
440932	SEPT9	Septin 9	361.78	96.86	0.034
440960	RAD23A	RAD23 homolog A (S. cerevisiae)	214.38	69.61	0.207
440961	CAST	Calpastatin	194.31	90.01	0.207
441072	POLR2L	Polymerase (RNA) II (DNA directed) polypeptide L, 7.6 kDa	225.44	138.68	0.379
441550	ABHD12	Abhydrolase domain containing 12	215.47	106.70	0.241
442344	IRS2	Insulin receptor substrate 2	134.97	79.52	0.379
442798	RNF10	Ring finger protein 10	210.73	75.43	0.103
443134	GBA2	Glucosidase, beta (bile acid) 2	132.85	60.27	0.379
443379	PSMD11	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	180.98	64.45	0.172
443837	NPEPPS	Aminopeptidase puromycin sensitive	173.54	73.65	0.172
443914	SOD1	Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1	341.06	88.95	0.103
		(adult))
444279	GPBP1	GC-rich promoter binding protein 1	132.98	56.92	0.241
444356	GRB2	Growth factor receptor-bound protein 2	167.92	61.94	0.172
444468	CTDSP1	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A	187.59	76.37	0.241
		small phosphatase 1
444472	SDHC	Succinate dehydrogenase complex, subunit C, integral membrane	175.42	71.22	0.207
		protein, 15 kDa
444569	TMEM49	Transmembrane protein 49	212.58	83.31	0.241
444673	CLPTM1L	CLPTM1-like	229.08	106.76	0.207
444724	AZI2	5-azacytidine induced 2	132.28	73.71	0.345
444818	CGGBP1	CGG triplet repeat binding protein 1	177.53	83.72	0.241
444931	CRSP6	Cofactor required for Sp1 transcriptional activation, subunit 6, 77 kDa	88.71	48.78	0.379
444969	MEMO1	Mediator of cell motility 1	96.52	59.19	0.276
444986	METAP2	Methionyl aminopeptidase 2	169.09	73.08	0.172
445081	OAF	OAF homolog (Drosophila)	113.21	58.71	0.345
445351	LGALS1	Lectin, galactoside-binding, soluble, 1 (galectin 1)	564.16	197.93	0.241
445394	VPS29	Vacuolar protein sorting 29 (yeast)	278.97	108.32	0.138
445498	SNW1	SNW domain containing 1	143.71	69.55	0.138
445511	RIOK3	RIO kinase 3 (yeast)	110.92	105.70	0.379
445570	CD63	CD63 antigen (melanoma 1 antigen)	489.45	199.49	0.034
445803	DC2	DC2 protein	658.16	215.09	0.138
445893	KHDRBS1	KH domain containing, RNA binding, signal transduction	227.64	88.75	0.138
		associated 1
445977	GTF3A	General transcription factor IIIA	160.66	73.81	0.172
446017	WSB1	WD repeat and SOCS box-containing 1	239.91	93.71	0.276
446091	WTAP	Wilms tumor 1 associated protein	119.70	95.46	0.379
446123	CAPZA2	Capping protein (actin filament) muscle Z-line, alpha 2	370.83	95.48	0.138
446149	LDHB	Lactate dehydrogenase B	1544.78	120.53	0.000
446260	PSMA6	Proteasome (prosome, macropain) subunit, alpha type, 6	224.07	106.72	0.172
446336	PXN	Paxillin	259.56	97.96	0.138
446345	FTH1	Ferritin, heavy polypeptide 1	2359.77	133.58	0.034
446414	CD47	CD47 antigen (Rh-related antigen, integrin-associated signal	165.59	95.67	0.310
		transducer)
446427	OAZ1	Ornithine decarboxylase antizyme 1	673.68	62.71	0.069
446445	YIF1A	Yip1 interacting factor homolog A (S. cerevisiae)	151.87	80.99	0.276
446450	ITM2B	Integral membrane protein 2B	511.62	115.21	0.138
446574	TMSB10	Thymosin beta 10	524.43	177.08	0.103
446588	RPS13	Ribosomal protein S13	183.34	95.13	0.345
446623	HNRPL	Heterogeneous nuclear ribonucleoprotein L	113.61	53.54	0.276
446628	RPS4X	Ribosomal protein S4, X-linked	1285.06	89.84	0.000
446641	ARAF	V-raf murine sarcoma 3611 viral oncogene homolog	176.49	69.57	0.241
446852	EIF3S6IP	Eukaryotic translation initiation factor 3, subunit 6 interacting	925.97	188.87	0.034
		protein
447477	ST13	Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70	272.29	141.17	0.103
		interacting protein)
447492	PGAM1	Phosphoglycerate mutase 1 (brain)	781.46	84.70	0.034
447547	VPS35	Hypothetical protein MGC34800	195.14	67.15	0.103
448226	RPLP0	Ribosomal protein, large, P0	3809.20	75.92	0.000
448588	NGFRAP1	Nerve growth factor receptor (TNFRSF16) associated protein 1	218.09	83.14	0.310
448646	RPL27A	Ribosomal protein L27a	766.60	139.37	0.276
448879	LOC38834	similar to ribosomal protein L13	471.24	99.11	0.069
449114	HNRPC	Heterogeneous nuclear ribonucleoprotein C (C1/C2)	803.24	90.38	0.034
449171	HNRPK	Heterogeneous nuclear ribonucleoprotein K	403.79	69.90	0.034
454534	USF2	Upstream transcription factor 2, c-fos interacting	111.98	76.53	0.310
454699	IL6ST	Interleukin 6 signal transducer (gp130, oncostatin M receptor)	266.74	139.73	0.103
456507	KIAA0319L	KIAA0319-like	131.45	85.77	0.241
456557	C1orf164	chromosome 1 open reading frame 164	143.89	71.60	0.276
458320	C3orf37	chromosome 3 open reading frame 37	170.49	148.07	0.310
458358	TSPYL1	Squamous cell carcinoma antigen recognized by T cells 2	101.91	73.81	0.345
458414	IFITM1	Interferon induced transmembrane protein 1 (9-27)	278.31	223.88	0.345
458458	FAM108A1	Family with sequence similarity 108, member A1	149.77	96.59	0.276
458747	ANP32A	Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	197.57	100.71	0.172
459106	AZIN1	Antizyme inhibitor 1	209.63	95.22	0.207
459149	BTBD1	BTB (POZ) domain containing 1	136.20	84.67	0.310
459174	FAM91A1	Family with sequence similarity 91, member A1	133.90	80.72	0.379
459211	AKAP13	A kinase (PRKA) anchor protein 13	217.52	97.30	0.310
459596	MPG	N-methylpurine-DNA glycosylase	110.09	94.77	0.241
459649	CLCN7	Chloride channel 7	161.09	107.31	0.207
459927	PTMA	Prothymosin, alpha (gene sequence 28)	1066.55	86.69	0.000
459940	LITAF	Lipopolysaccharide-induced TNF factor	184.70	98.75	0.069
460238	SH3GLB2	SH3-domain GRB2-like endophilin B2	146.60	86.41	0.207
460317	SETX	Senataxin	132.56	111.94	0.310
460336	GGA2	Golgi associated, gamma adaptin ear containing, ARF binding	253.27	171.03	0.241
		protein 2
460468	XPO6	Exportin 6	212.84	80.39	0.172
460499	ATXN2L	Ataxin 2-like	228.25	84.67	0.310
460574	LOC12444	Hypothetical protein BC017488	125.84	87.37	0.379
460923	CNOT1	CCR4-NOT transcription complex, subunit 1	173.85	65.75	0.207
460929	GOT2	Glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate	397.62	79.42	0.103
		aminotransferase 2)
460978	APPBP1	Amyloid beta precursor protein binding protein 1	133.67	64.71	0.241
461047	G6PD	Glucose-6-phosphate dehydrogenase	274.16	130.32	0.207
461131	CYB5B	Cytochrome b5 type B (outer mitochondrial membrane)	192.30	75.56	0.138
461361	CFDP1	Craniofacial development protein 1	111.79	67.73	0.310
461379	GABARAPL2	GABA(A) receptor-associated protein-like 2	122.55	63.48	0.345
461722	TRAPPC2L	Trafficking protein particle complex 2-like	97.91	62.09	0.379
461777	CHMP1A	Chromatin modifying protein 1A	171.31	77.92	0.207
461896	CRK	V-crk sarcoma virus CT10 oncogene homolog (avian)	158.10	68.61	0.276
461925	RPA1	Replication protein A1, 70 kDa	160.13	72.42	0.103
462035	UBE2G1	Ubiquitin-conjugating enzyme E2G1 (UBC7 homolog, yeast)	149.46	102.82	0.207
462086	RPAIN	RPA interacting protein	129.54	77.35	0.379
462306	UBE2S	Ubiquitin-conjugating enzyme E2S	216.54	74.27	0.310
462316	TTC19	Hypothetical protein LOC125150	116.49	89.17	0.241
462492	USP22	Ubiquitin specific peptidase 22	379.95	165.78	0.138
462550	PIGS	Phosphatidylinositol glycan, class S	164.57	97.00	0.345
462956	PPARBP	PPAR binding protein	106.51	76.59	0.379
462998	IGFBP4	Insulin-like growth factor binding protein 4	345.88	87.71	0.207
463010	SMARCE1	SWI/SNF related, matrix associated, actin dependent regulator of	173.85	56.13	0.069
		chromatin, subfamily e, member 1
463035	FKBP10	FK506 binding protein 10, 65 kDa	164.51	91.24	0.310
463041	RERE	Arginine-glutamic acid dipeptide (RE) repeats	200.18	92.99	0.276
463059	STAT3	Signal transducer and activator of transcription 3 (acute-phase	205.74	114.93	0.207
		response factor)
463295	CDC27	Cell division cycle 27	115.34	79.50	0.310
463506	AKAP1	A kinase (PRKA) anchor protein 1	124.11	52.64	0.345
463702	BCAS3	Breast carcinoma amplified sequence 3	98.88	74.57	0.379
463797	MRTO4	mRNA turnover 4 homolog (S. cerevisiae)	142.20	59.85	0.276
464071	PGD	Phosphogluconate dehydrogenase	338.78	85.70	0.138
464137	ACOX1	Acyl-Coenzyme A oxidase 1, palmitoyl	103.04	66.74	0.241
464210	SYNGR2	Synaptogyrin 2	348.69	97.83	0.276
464336	P4HB	Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-	859.74	89.54	0.069
		hydroxylase), beta polypeptide (protein disulfide isomerase-
		associated 1)
464438	AGTRAP	Angiotensin II receptor-associated protein	117.55	68.62	0.379
464472	MRLC2	Myosin regulatory light chain MRLC2	233.35	102.50	0.034
464595	PPP4R1	Protein phosphatase 4, regulatory subunit 1	181.18	80.16	0.241
464652	TNFSF5IP1	Tumor necrosis factor superfamily, member 5-induced protein 1	145.59	119.46	0.345
464912	P15RS	Hypothetical protein FLJ10656	142.03	83.19	0.276
465224	NARS	Asparaginyl-tRNA synthetase	220.96	70.84	0.103
465374	EFHD2	EF-hand domain family, member D2	265.91	113.85	0.241
465498	TXNL4A	Thioredoxin-like 4A	121.61	80.29	0.276
465529	MIDN	Midnolin	139.65	96.07	0.345
465543	BTBD2	BTB (POZ) domain containing 2	204.49	98.92	0.207
465627	MAP2K2	Mitogen-activated protein kinase kinase 2	154.59	85.81	0.310
465645	C19orf10	Chromosome 19 open reading frame 10	204.93	79.48	0.276
465808	HNRPM	Heterogeneous nuclear ribonucleoprotein M	258.95	99.76	0.103
465849	PIN1	Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1	121.36	61.35	0.310
465924	SDHB	Succinate dehydrogenase complex, subunit B, iron sulfur (lp)	161.79	65.94	0.241
466044	PKN1	Protein kinase N1	252.31	87.50	0.276
466088	TPM4	Tropomyosin 4	139.00	71.29	0.345
466148	NR2F6	Nuclear receptor subfamily 2, group F, member 6	179.12	94.04	0.379
466471	GPI	Glucose phosphate isomerase	502.15	94.80	0.069
466693	SIRT2	Sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)	214.11	113.63	0.379
466766	LTBP4	Latent transforming growth factor beta binding protein 4	174.46	77.33	0.379
466775	SNRPA	Small nuclear ribonucleoprotein polypeptide A	196.94	63.74	0.138
467084	EIF4G3	Eukaryotic translation initiation factor 4 gamma, 3	102.77	64.71	0.310
467097	SNRP70	Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen)	294.48	80.04	0.103
467192	PPP2R1A	Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65)	475.55	80.67	0.069
		alpha isoform
467279	LENG4	Leukocyte receptor cluster (LRC) member 4	315.24	116.72	0.310
467284	RPS9	Ribosomal protein S9	986.04	73.58	0.069
467408	TRIM28	Tripartite motif-containing 28	715.33	79.78	0.138
467637	CDC42	Cell division cycle 42 (GTP binding protein, 25 kDa)	158.07	97.05	0.138
467696	HPCAL1	Hippocalcin-like 1	172.64	83.71	0.379
467701	ODC1	Ornithine decarboxylase 1	351.16	77.30	0.103
467807	LAPTM4A	Lysosomal-associated protein transmembrane 4 alpha	482.50	88.89	0.069
467824	PUM2	Pumilio homolog 2 (Drosophila)	153.26	86.50	0.207
467960	RAB10	RAB10, member RAS oncogene family	162.79	57.31	0.103
468018	PPP1CB	Protein phosphatase 1, catalytic subunit, beta isoform	203.84	64.65	0.207
468415	PIGF	Phosphatidylinositol glycan, class F	150.01	71.46	0.241
468442	CALM2	Calmodulin 2 (phosphorylase kinase, delta)	1841.31	235.41	0.000
468760	AFTPH	Aftiphilin	93.25	61.52	0.310
469022	DGUOK	Deoxyguanosine kinase	116.26	75.71	0.241
469171	C1orf160	Chromosome 1 open reading frame 160	116.05	66.17	0.172
469331	STARD7	START domain containing 7	312.84	91.19	0.138
469820	RALB	V-ral simian leukemia viral oncogene homolog B (ras related; GTF	125.95	59.65	0.379
		binding protein)
469863	YWHAZ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	385.89	74.53	0.034
		activation protein, zeta polypeptide
469925	FAM128B	Family with sequence similarity 128, member B	157.81	62.74	0.345
469970	SFRS4	Splicing factor, arginine/serine-rich 4	134.13	54.16	0.310
470091	YWHAE	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	330.87	97.70	0.069
		activation protein, epsilon polypeptide
470233	ARL5A	ADP-ribosylation factor-like 5A	137.43	81.25	0.345
470417	PEF1	Penta-EF-hand domain containing 1	144.07	63.57	0.241
470477	PTP4A2	Protein tyrosine phosphatase type IVA, member 2	163.45	69.99	0.103
470577	EIF2S2	Eukaryotic translation initiation factor 2, subunit 2 beta, 38 kDa	175.54	98.23	0.379
470588	KPNA6	Karyopherin alpha 6 (importin alpha 7)	105.07	66.63	0.207
470943	STAT1	Signal transducer and activator of transcription 1, 91 kDa	204.00	91.39	0.207
471011	SF3B1	Splicing factor 3b, subunit 1, 155 kDa	171.22	65.74	0.276
471104	NOP5/NOP58	Nucleolar protein NOP5/NOP58	119.95	77.84	0.207
471207	NDUFS1	NADH dehydrogenase (ubiquinone) Fe—S protein 1, 75 kDa	152.75	64.26	0.207
		(NADH-coenzyme Q reductase)
471441	PSMB2	Proteasome (prosome, macropain) subunit, beta type, 2	160.02	84.75	0.207
471461	ACSL3	Acyl-CoA synthetase long-chain family member 3	143.25	48.15	0.207
471593	CAB39	Calcium binding protein 39	125.47	90.94	0.276
471768	STK40	Serine/threonine kinase 40	150.57	81.43	0.310
471818	CAPRIN1	Cell cycle associated protein 1	233.39	93.24	0.069
471851	HDLBP	High density lipoprotein binding protein (vigilin)	770.41	90.63	0.034
471873	DTYMK	Deoxythymidylate kinase (thymidylate kinase)	151.55	81.98	0.276
471933	FKBP1A	FK506 binding protein 1A, 12 kDa	284.05	83.21	0.138
471975	C20orf116	Chromosome 20 open reading frame 116	168.09	95.60	0.379
472010	PRNP	Prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-	151.22	82.78	0.276
		Strausler-Scheinker syndrome, fatal familial insomnia)
472024	C20orf30	Chromosome 20 open reading frame 30	180.50	82.62	0.138
472031	UBE2D3	Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)	305.38	72.17	0.069
472038	UTP11L	UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)	116.49	107.41	0.379
472056	SYNCRIP	Synaptotagmin binding, cytoplasmic RNA interacting protein	198.01	71.24	0.103
472119	MKKS	McKusick-Kaufman syndrome	110.70	82.99	0.276
472185	NDUFS5	NADH dehydrogenase (ubiquinone) Fe—S protein 5, 15 kDa	317.85	115.06	0.172
		(NADH-coenzyme Q reductase)
472213	RRBP1	Ribosome binding protein 1 homolog 180 kDa (dog)	194.55	81.99	0.276
472330	C20orf3	Chromosome 20 open reading frame 3	210.62	71.28	0.345
472475	MACF1	Glycine-rich protein (GRP3S)	170.84	81.77	0.310
472535	AURKAIP1	Aurora kinase A interacting protein 1	236.28	92.32	0.345
472558	ERGIC3	ERGIC and golgi 3	273.22	82.09	0.138
472651	BLCAP	Bladder cancer associated protein	174.08	74.85	0.241
472737	TOP1	Topoisomerase (DNA) I	145.07	71.88	0.310
473296	TPD52L2	Tumor protein D52-like 2	198.42	74.39	0.172
473583	YBX1	Y box binding protein 1	706.53	98.38	0.034
473648	GART	Phosphoribosylglycinamide formyltransferase,	159.98	70.49	0.138
		phosphoribosylglycinamide synthetase,
		phosphoribosylaminoimidazole synthetase
473721	SLC2A1	Solute carrier family 2 (facilitated glucose transporter), member 1	496.75	142.19	0.345
473761	RTN3	Reticulon 3	222.45	76.58	0.103
473788	OTUB1	OTU domain, ubiquitin aldehyde binding 1	235.08	75.48	0.207
474005	SUMO3	SMT3 suppressor of mif two 3 homolog 3 (yeast)	224.13	104.97	0.138
474010	PTTG1IP	Pituitary tumor-transforming 1 interacting protein	472.39	85.43	0.138
474053	COL6A1	Collagen, type VI, alpha 1	240.21	60.68	0.345
474083	B4GALT2	UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2	118.57	65.47	0.345
474213	UFD1L	Ubiquitin fusion degradation 1 like (yeast)	117.12	72.56	0.276
474584	AKR1A1	Aldo-keto reductase family 1, member A1 (aldehyde reductase)	216.03	70.29	0.138
474643	C22orf28	Chromosome 22 open reading frame 28	331.66	109.80	0.138
474751	MYH9	Myosin, heavy polypeptide 9, non-muscle	426.57	109.52	0.069
474833	CSNK1E	Casein kinase 1, epsilon	193.49	86.78	0.138
474914	RUTBC3	RUN and TBC1 domain containing 3	190.23	157.68	0.345
474938	SLC25A17	Solute carrier family 25 (mitochondrial carrier; peroxisomal	113.70	81.93	0.345
		membrane protein, 34 kDa), member 17
474949	RBX1	Ring-box 1	145.55	82.29	0.241
474982	ACO2	Aconitase 2, mitochondrial	307.04	91.01	0.034
475125	ATXN10	Ataxin 10	198.54	95.44	0.172
475319	LRRFIP2	Leucine rich repeat (in FLII) interacting protein 2	104.35	72.12	0.310
475382	MTMR14	Myotubularin related protein 14	149.47	83.39	0.172
475392	TMEM111	Transmembrane protein 111	136.12	88.37	0.379
475663	RAB5A	RAB5A, member RAS oncogene family	119.70	91.27	0.241
475733	TOP2B	Topoisomerase (DNA) II beta 180 kDa	180.06	113.03	0.172
475812	STT3B	STT3, subunit of the oligosaccharyltransferase complex, homolog	108.24	76.02	0.310
		B (S. cerevisiae)
476018	CTNNB1	Catenin (cadherin-associated protein), beta 1, 88 kDa	138.21	58.20	0.310
476033	TXNDC12	Thioredoxin domain containing 12 (endoplasmic reticulum)	146.57	70.89	0.172
476179	SMARCC1	SWI/SNF related, matrix associated, actin dependent regulator of	171.16	127.75	0.138
		chromatin, subfamily c, member 1
476221	IHPK2	Inositol hexaphosphate kinase 2	145.26	55.31	0.241
476231	IMPDH2	IMP (inosine monophosphate) dehydrogenase 2	1006.91	110.38	0.034
476308	ALAS1	Aminolevulinate, delta-, synthase 1	132.82	82.50	0.345
476365	SCP2	Sterol carrier protein 2	690.56	180.11	0.276
476448	FLNB	Filamin B, beta (actin binding protein 278)	189.01	103.49	0.310
476706	MRPL37	Mitochondrial ribosomal protein L37	249.66	66.27	0.172
476930	CHMP2B	Chromatin modifying protein 2B	143.22	100.41	0.310
477157	DULLARD	Dullard homolog (Xenopus laevis)	158.37	96.36	0.103
477789	ATP1B3	ATPase, Na+/K+ transporting, beta 3 polypeptide	167.45	84.60	0.138
477892	GYG1	Glycogenin 1	151.92	63.62	0.345
478000	MBNL1	Muscleblind-like (Drosophila)	304.13	90.08	0.241
478044	PA2G4	Proliferation-associated 2G4, 38 kDa	460.10	87.56	0.103
478553	EIF4A2	Eukaryotic translation initiation factor 4A, isoform 2	403.21	91.85	0.069
479208	FBXL5	F-box and leucine-rich repeat protein 5	140.68	84.67	0.276
479264	LAP3	Leucine aminopeptidase 3	140.16	84.68	0.241
479634	SLC30A9	Solute carrier family 30 (zinc transporter), member 9	123.90	63.55	0.379
479693	SFRS11	Splicing factor, arginine/serine-rich 11	189.39	69.99	0.172
479728	GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	7330.72	80.18	0.000
479747	BCAR1	Breast cancer anti-estrogen resistance 1	183.08	85.45	0.310
479814	POLR2B	Polymerase (RNA) II (DNA directed) polypeptide B, 140 kDa	170.30	62.57	0.310
480073	HNRPD	Heterogeneous nuclear ribonucleoprotein D (AU-rich element RN/	229.02	68.01	0.103
		binding protein 1, 37 kDa)
480311	PDLIM5	PDZ and LIM domain 5	273.24	235.65	0.241
480465	SCYE1	Small inducible cytokine subfamily E, member 1 (endothelial	107.39	55.27	0.276
		monocyte-activating)
480653	ANXA5	Annexin A5	303.60	104.16	0.069
481571	UQCRH	Similar to Ubiquinol-cytochrome C reductase complex 11 kDa	229.54	102.84	0.138
		protein, mitochondrial precursor (Mitochondrial hinge protein)
		(Cytochrome C1, nonheme 11 kDa protein) (Complex III subunit
		VIII)
481720	MYO10	Myosin X	140.50	130.53	0.310
481898	CCBL2	Cysteine conjugate-beta lyase 2	134.41	54.32	0.310
482144	RPL26	Similar to 60S ribosomal protein L26	447.43	95.30	0.034
482363	SLC30A5	Solute carrier family 30 (zinc transporter), member 5	78.30	56.98	0.379
482526	TINP1	TGF beta-inducible nuclear protein 1	121.52	61.06	0.241
482868	KIAA0372	KIAA0372	126.07	60.99	0.241
483036	PJA2	Praja 2, RING-H2 motif containing	158.62	65.91	0.276
483067	C5orf13	Chromosome 5 open reading frame 13	318.12	190.12	0.379
483305	HINT1	Histidine triad nucleotide binding protein 1	236.40	118.42	0.207
483408	PPP2CA	Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha	230.50	94.12	0.138
		isoform
483454	CNN3	Calponin 3, acidic	211.93	89.89	0.207
483486	JMJD1B	Jumonji domain containing 1B	107.12	52.95	0.310
484138	FBXW11	F-box and WD-40 domain protein 11	117.64	68.50	0.379
484188	ATP6V0E1	ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1	159.10	68.32	0.138
484242	UBXD8	UBX domain containing 8	125.98	75.93	0.207
484288	DDX41	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	214.13	74.98	0.138
484363	RNF130	Ring finger protein 130	97.65	67.32	0.138
484551	CPM	Carboxypeptidase M	186.28	78.16	0.310
484813	DEK	DEK oncogene (DNA binding)	260.77	83.22	0.172
485155	RPL35	Ribosomal protein L35	281.04	111.39	0.172
485195	SORT1	Sortilin 1	150.82	80.52	0.345
485246	PSMA5	Proteasome (prosome, macropain) subunit, alpha type, 5	164.31	83.49	0.207
485262	MTCH1	Mitochondrial carrier homolog 1 (C. elegans)	364.72	91.85	0.103
485365	AHCYL1	S-adenosylhomocysteine hydrolase-like 1	182.57	61.85	0.207
485616	DST	Dystonin	144.43	74.83	0.276
486542	BCLAF1	BCL2-associated transcription factor 1	184.76	58.42	0.207
487027	VIL2	Villin 2 (ezrin)	228.59	71.02	0.138
487054	TCP1	T-complex 1	209.76	78.62	0.138
487635	BZW2	Basic leucine zipper and W2 domains 2	250.31	146.18	0.172
487774	HNRPA2B1	Heterogeneous nuclear ribonucleoprotein A2/B1	218.53	87.55	0.103
488171	NUDCD3	NudC domain containing 3	607.73	183.50	0.034
488181	OGDH	Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	245.90	110.90	0.207
488307	ECOP	EGFR-coamplified and overexpressed protein	151.47	75.46	0.345
488478	C7orf42	Chromosome 7 open reading frame 42	151.66	70.90	0.207
488671	BAZ1B	Bromodomain adjacent to zinc finger domain, 1B	114.54	65.20	0.207
489207	ASNS	Asparagine synthetase	262.06	124.38	0.172
489284	ARPC1B	Actin related protein 2/3 complex, subunit 1B, 41 kDa	555.08	109.32	0.103
489287	CPSF4	Cleavage and polyadenylation specific factor 4, 30 kDa	171.76	69.89	0.172
489336	SYAP1	Synapse associated protein 1, SAP47 homolog (Drosophila)	126.10	45.09	0.310
489615	PBEF1	Pro-B-cell colony enhancing factor 1	211.67	111.85	0.276
490203	CALD1	Caldesmon 1	242.44	103.25	0.207
490394	SSBP1	Single-stranded DNA binding protein 1	444.28	309.52	0.241
490415	ZYX	Zyxin	259.67	90.01	0.138
490745	DNAJB6	DnaJ (Hsp40) homolog, subfamily B, member 6	182.26	74.39	0.103
490795	FAM62B	Family with sequence similarity 62 (C2 domain containing)	256.81	139.32	0.276
		member B
490874	MTX1	Metaxin 1	139.52	83.02	0.310
491336	ELP3	Elongation protein 3 homolog (S. cerevisiae)	98.38	59.66	0.379
491359	LMNA	Lamin A/C	797.11	108.53	0.138
491440	PPP2CB	Protein phosphatase 2 (formerly 2A), catalytic subunit, beta	146.90	77.42	0.276
		isoform
491494	CCT3	Chaperonin containing TCP1, subunit 3 (gamma)	1152.31	109.73	0.034
491597	VDAC3	Voltage-dependent anion channel 3	189.10	60.03	0.207
491695	UBE2V2	Ubiquitin-conjugating enzyme E2 variant 2	1324.03	205.58	0.276
491745	TCEA1	Transcription elongation factor A (SII), 1	180.17	63.49	0.241
491988	TRAM1	Translocation associated membrane protein 1	151.74	62.44	0.172
492236	WDR42A	WD repeat domain 42A	135.63	62.96	0.310
492314	LAPTM4B	Lysosomal associated protein transmembrane 4 beta	315.85	98.92	0.138
492445	UBR5	Ubiquitin protein ligase E3 component n-recognin 5	133.59	70.25	0.345
492599	EIF3S3	Eukaryotic translation initiation factor 3, subunit 3 gamma, 40 kDa	457.44	91.86	0.069
492805	NMD3	NMD3 homolog (S. cerevisiae)	154.69	68.25	0.276
493362	AK3L1	Adenylate kinase 3	138.22	63.01	0.241
493750	WDR40A	WD repeat domain 40A	158.95	64.13	0.345
494173	ANXA1	Annexin A1	663.71	206.40	0.138
494419	LAMP1	Lysosomal-associated membrane protein 1	278.30	123.84	0.276
494457	NINJ1	Ninjurin 1	146.99	120.17	0.379
494604	ANP32B	Acidic (leucine-rich) nuclear phosphoprotein 32 family, member B	297.30	74.71	0.069
494614	BAT2D1	BAT2 domain containing 1	103.03	72.44	0.310
494691	PFN1	Profilin 1	582.68	96.95	0.069
494700	SLC44A1	Solute carrier family 44, member 1	156.34	79.78	0.379
494985	FBXW2	F-box and WD-40 domain protein 2	97.45	68.65	0.379
495039	NDUFA8	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19	100.91	70.67	0.345
495349	KIAA0515	KIAA0515	213.73	62.92	0.069
495471	PMPCA	Peptidase (mitochondrial processing) alpha	174.09	84.07	0.172
495605	CD99	CD99 antigen	171.31	62.16	0.138
495851	APOO	Apolipoprotein O	144.33	80.53	0.345
495960	ATP6AP2	ATPase, H+ transporting, lysosomal accessory protein 2	177.66	91.25	0.276
496068	PCTK1	PCTAIRE protein kinase 1	177.60	80.15	0.207
496098	OTUD5	OTU domain containing 5	171.08	119.61	0.207
496271	?	Full-length cDNA clone CS0DJ002YF04 of T cells (Jurkat cell line)	552.58	198.74	0.172
		Cot 10-normalized of Homo sapiens (human)
496487	ATF4	Activating transcription factor 4 (tax-responsive enhancer element	644.83	92.22	0.069
		B67)
496646	IL13RA1	Interleukin 13 receptor, alpha 1	117.23	77.35	0.310
496684	LAMP2	Lysosomal-associated membrane protein 2	175.62	85.98	0.241
497183	IVNS1ABP	Influenza virus NS1A binding protein	156.30	56.55	0.241
497599	WARS	Tryptophanyl-tRNA synthetase	328.30	141.43	0.103
497692	NSL1	NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)	142.41	132.49	0.379
497893	ENAH	Enabled homolog (Drosophila)	133.62	90.22	0.276
498239	FH	Fumarate hydratase	304.63	108.28	0.276
498313	ADSS	Adenylosuccinate synthase	138.41	96.89	0.276
498317	C1orf121	Chromosome 1 open reading frame 121	139.90	108.25	0.379
498455	LARP5	La ribonucleoprotein domain family, member 5	142.32	72.97	0.241
498548	RBM17	RNA binding motif protein 17	119.60	106.34	0.207
498727	DHCR24	24-dehydrocholesterol reductase	380.21	178.18	0.207
499145	YME1L1	YME1-like 1 (S. cerevisiae)	218.20	87.96	0.241
499158	GGA1	Golgi associated, gamma adaptin ear containing, ARF binding	149.92	94.46	0.276
		protein 1
499594	TIMM23	Translocase of inner mitochondrial membrane 23 homolog (yeast)	116.05	77.66	0.241
499833	REEP3	Receptor accessory protein 3	97.26	86.49	0.345
499891	HNRPH3	Heterogeneous nuclear ribonucleoprotein H3 (2H9)	152.75	70.91	0.103
499925	VPS26A	Vacuolar protein sorting 26 homolog A (S. pombe)	129.39	63.83	0.172
499960	SAR1A	SAR1 gene homolog A (S. cerevisiae)	122.18	69.10	0.172
500067	PPP3CB	Protein phosphatase 3 (formerly 2B), catalytic subunit, beta	120.27	66.72	0.241
		isoform (calcineurin A beta)
500101	VCL	Vinculin	197.78	102.19	0.207
500375	ENTPD6	Ectonucleoside triphosphate diphosphohydrolase 6 (putative	163.42	84.78	0.276
		function)
500409	GLUD1	Glutamate dehydrogenase 1	161.37	95.54	0.138
500546	IDE	Insulin-degrading enzyme	112.83	68.82	0.310
500674	TM9SF3	Transmembrane 9 superfamily member 3	215.50	58.43	0.207
500775	ZNF207	Zinc finger protein 207	233.29	62.27	0.034
500842	MGEA5	Meningioma expressed antigen 5 (hyaluronidase)	179.67	93.93	0.310
500874	CUEDC2	CUE domain containing 2	129.96	52.06	0.310
501012	ADD3	Adducin 3 (gamma)	223.70	119.75	0.310
501023	MXI1	MAX interactor 1	94.44	62.74	0.345
501203	TIAL1	TIA1 cytotoxic granule-associated RNA binding protein-like 1	146.01	73.16	0.276
501293	BSG	Basigin (OK blood group)	737.88	112.29	0.103
501309	CIRBP	Cold inducible RNA binding protein	265.44	117.90	0.034
501353	PLEKHJ1	Pleckstrin homology domain containing, family J member 1	100.87	56.61	0.379
501376	UROS	Uroporphyrinogen III synthase (congenital erythropoietic porphyria)	130.07	71.33	0.241
501420	NCLN	Nicalin homolog (zebrafish)	177.01	86.48	0.241
501629	IER2	Immediate early response 2	140.79	60.99	0.241
501684	NAP1L4	Nucleosome assembly protein 1-like 4	166.93	111.13	0.138
501735	STIM1	Stromal interaction molecule 1	117.62	71.87	0.276
501853	TMEM9B	TMEM9 domain family, member B	110.79	91.41	0.379
501924	USP47	Ubiquitin specific peptidase 47	132.14	118.32	0.345
501991	MLSTD2	Male sterility domain containing 2	96.74	62.95	0.379
502302	CAT	Catalase	158.19	107.96	0.345
502328	CD44	CD44 antigen (homing function and Indian blood group system)	366.11	100.63	0.172
502461	DGKZ	Diacylglycerol kinase, zeta 104 kDa	109.99	96.64	0.310
502528	NDUFS3	NADH dehydrogenase (ubiquinone) Fe—S protein 3, 30 kDa	119.28	75.88	0.207
		(NADH-coenzyme Q reductase)
502630	C11orf31	Chromosome 11 open reading frame 31	170.27	98.83	0.276
502659	RHOC	Ras homolog gene family, member C	253.62	101.47	0.138
502705	PRPF19	PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)	198.31	100.04	0.276
502745	FADS2	Fatty acid desaturase 2	266.18	116.45	0.276
502769	SLC3A2	Solute carrier family 3 (activators of dibasic and neutral amino acid	276.24	84.47	0.138
		transport), member 2
502773	ADI1	Acireductone dioxygenase 1	159.84	55.74	0.103
502823	PRDX5	Peroxiredoxin 5	183.65	76.11	0.241
502829	SF1	Splicing factor 1	263.86	66.20	0.069
502836	ARL2	ADP-ribosylation factor-like 2	134.06	114.72	0.310
502842	CAPN1	Calpain 1, (mu/I) large subunit	287.11	101.89	0.207
502872	MAP3K11	Mitogen-activated protein kinase kinase kinase 11	128.70	82.13	0.276
502876	RHOB	Ras homolog gene family, member B	165.00	92.57	0.310
503093	ZFP36L2	Zinc finger protein 36, C3H type-like 2	150.79	67.83	0.207
503222	RAB6A	RAB6A, member RAS oncogene family	152.69	73.96	0.241
503251	PPME1	Protein phosphatase methylesterase 1	123.71	52.56	0.207
503597	HSPC148	Hypothetical protein HSPC148	107.89	76.02	0.276
503709	TMEM123	Transmembrane protein 123	339.10	161.64	0.172
503716	DCUN1D5	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)	167.32	87.13	0.138
503787	DARS	Aspartyl-tRNA synthetase	147.34	55.17	0.138
504237	STT3A	STT3, subunit of the oligosaccharyltransferase complex, homolog	117.19	108.95	0.345
		A (S. cerevisiae)
504517	RPS27	Tetraspanin 9	176.40	121.62	0.379
504613	PTMS	Parathymosin	175.13	81.37	0.345
504620	PHB2	Prohibitin 2	506.51	79.86	0.069
504687	MYL9	Elongation factor Tu family protein	343.66	100.94	0.379
504828	DDX47	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	130.63	59.08	0.379
504895	STRAP	Serine/threonine kinase receptor associated protein	221.43	95.09	0.138
505033	KRAS	v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	115.82	83.04	0.310
505059	PSMD4	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	259.00	62.63	0.103
505625	C12orf10	Chromosome 12 open reading frame 10	105.33	77.88	0.345
505652	COPZ1	Coatomer protein complex, subunit zeta 1	204.89	87.20	0.000
505676	CIP29	Cytokine induced protein 29 kDa	184.81	88.39	0.241
505705	MYL6	Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle	438.52	109.87	0.069
505806	PBXIP1	Pre-B-cell leukemia transcription factor interacting protein 1	115.75	83.63	0.310
505824	SAMM50	Sorting and assembly machinery component 50 homolog (S. cerevisiae)	242.60	117.59	0.172
506215	RARS	Arginyl-tRNA synthetase	192.15	85.96	0.172
506325	NUDT4	Nudix (nucleoside diphosphate linked moiety X)-type motif 4	121.40	87.04	0.379
		pseudogene 2
506759	ATP2A2	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	375.19	241.76	0.241
506861	DDX54	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	199.70	104.77	0.241
507074	KIAA0152	KIAA0152	244.90	89.86	0.069
507162	VPS37B	Vacuolar protein sorting 37 homolog B (S. cerevisiae)	142.45	79.66	0.276
507584	POLR1D	Polymerase (RNA) I polypeptide D, 16 kDa	121.94	73.07	0.241
507680	PFAAP5	Phosphonoformate immuno-associated protein 5	143.30	68.40	0.345
507910	PGRMC2	Progesterone receptor membrane component 2	131.09	75.85	0.207
507916	TSC22D1	TSC22 domain family, member 1	344.52	102.84	0.172
508010	FNDC3A	Fibronectin type III domain containing 3A	264.21	157.30	0.241
508644	FLJ10154	Hypothetical protein FLJ10154	183.99	75.88	0.310
509163	ERGIC1	Endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	147.54	71.85	0.103
509226	FKBP3	FK506 binding protein 3, 25 kDa	146.28	97.77	0.241
509264	KLHDC2	Kelch domain containing 2	117.21	72.23	0.207
509414	KTN1	Kinectin 1 (kinesin receptor)	196.92	103.65	0.207
509622	RGL2	Ral guanine nucleotide dissociation stimulator-like 2	136.36	70.20	0.345
509736	HSP90AB1	Heat shock protein 90 kDa alpha (cytosolic), class B member 1	2045.82	87.83	0.000
509791	ERH	Enhancer of rudimentary homolog (Drosophila)	148.95	80.20	0.207
509909	NUMB	Numb homolog (Drosophila)	115.97	62.99	0.241
510087	ENSA	Endosulfine alpha	196.15	70.81	0.034
510328	DDX24	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	446.38	126.73	0.103
510402	CD46	CD46 molecule, complement regulatory protein	255.43	87.89	0.276
511067	FAM82C	Family with sequence similarity 82, member C	193.94	125.16	0.345
511138	TMEM87A	Transmembrane protein 87A	153.90	71.25	0.241
511149	SNAP23	Synaptosomal-associated protein, 23 kDa	159.76	70.15	0.276
511425	SRP9	Signal recognition particle 9 kDa	1439.84	206.14	0.069
511504	TCF12	Transcription factor 12 (HTF4, helix-loop-helix transcription factors	175.22	83.75	0.276
		4)
511862		Similar to 60S acidic ribosomal protein P1	182.40	88.27	0.379
511952	CBX6	Chromobox homolog 6	153.88	81.20	0.276
512005	ARPC3	Actin related protein 2/3 complex, subunit 3, 21 kDa	175.09	73.61	0.241
512465	SURF4	Surfeit 4	272.49	79.31	0.069
512525	RPS17	Ribosomal protein S17	1561.21	128.47	0.069
512607	MIR16	Membrane interacting protein of RGS16	243.63	112.71	0.207
512640	PRKCSH	Protein kinase C substrate 80K-H	369.95	87.75	0.172
512661	ISY1	ISY1 splicing factor homolog (S. cerevisiae)	247.17	110.21	0.241
512676	RPS25	Ribosomal protein S25	200.49	132.68	0.241
512693	METT11D1	Methyltransferase 11 domain containing 1	119.37	86.98	0.345
512756	THAP7	THAP domain containing 7	139.40	88.58	0.345
512815	AP3D1	Adaptor-related protein complex 3, delta 1 subunit	260.40	98.20	0.034
512857	CD151	CD151 antigen	289.17	93.65	0.207
512867	CASC4	Cancer susceptibility candidate 4	130.94	70.38	0.207
512908	ARPP-19	Cyclic AMP phosphoprotein, 19 kD	226.51	76.75	0.207
513043	IMP3	IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)	135.64	58.16	0.310
513055	WDR61	WD repeat domain 61	114.60	53.12	0.345
513057	RANBP5	RAN binding protein 5	280.02	118.69	0.172
513058	TMED3	Transmembrane emp24 protein transport domain containing 3	180.01	81.33	0.138
513071	MESDC1	Mesoderm development candidate 1	153.38	113.49	0.276
513083	RPL9	Ribosomal protein L9	1564.85	164.78	0.034
513141	IDH2	Isocitrate dehydrogenase 2 (NADP+), mitochondrial	276.13	73.73	0.103
513145	NGRN	Neugrin, neurite outgrowth associated	292.66	85.21	0.034
513153	FURIN	Furin (paired basic amino acid cleaving enzyme)	171.95	95.68	0.379
513230	MRPL28	Mitochondrial ribosomal protein L28	206.58	141.00	0.241
513242	RHOT2	Ras homolog gene family, member T2	146.56	66.79	0.345
513261	HN1L	Hematological and neurological expressed 1-like	169.07	73.84	0.138
513266	NDUFB10	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22	141.77	93.82	0.345
513470	NFATC2IP	Nuclear factor of activated T-cells, cytoplasmic, calcineurin-	123.18	55.34	0.310
		dependent 2 interacting protein
513488	MVP	Major vault protein	276.00	95.97	0.276
513490	ALDOA	Aldolase A, fructose-bisphosphate	1575.38	81.23	0.034
513520	BCKDK	Branched chain ketoacid dehydrogenase kinase	181.01	99.21	0.276
513522	FUS	Fusion (involved in t(12; 16) in malignant liposarcoma)	402.21	88.89	0.034
513631	ARL2BP	ADP-ribosylation factor-like 2 binding protein	133.32	76.06	0.379
513856	DPH1	DPH1 homolog (S. cerevisiae)	153.80	77.15	0.172
513984	FLII	Flightless 1 homolog (Drosophila)	218.66	80.64	0.103
514012	MAP2K3	Mitogen-activated protein kinase kinase 3	206.91	198.73	0.379
514036	SDF2	Stromal cell-derived factor 2	139.48	83.16	0.379
514038	FLOT2	Flotillin 2	205.94	75.37	0.241
514174	JUP	Junction plakoglobin	311.95	175.04	0.310
514196	RPL27	Ribosomal protein L27	445.53	163.18	0.103
514211	TMEM101	Transmembrane protein 101	207.70	66.43	0.345
514216	SLC25A39	Solute carrier family 25, member 39	372.09	78.71	0.103
514220	GRN	Granulin	569.94	118.75	0.103
514297	UBE2Z	Ubiquitin-conjugating enzyme E2Z (putative)	149.22	70.83	0.172
514303	PHB	Prohibitin	337.86	78.21	0.103
514435	SF3B3	Splicing factor 3b, subunit 3, 130 kDa	245.52	67.98	0.138
514489	WBP2	WW domain binding protein 2	367.18	97.07	0.138
514535	LGALS3BP	Lectin, galactoside-binding, soluble, 3 binding protein	714.12	134.59	0.172
514581	ACTG1	Actin, gamma 1	6790.08	96.54	0.000
514590	HGS	Hepatocyte growth factor-regulated tyrosine kinase substrate	234.48	89.80	0.241
514819	AP2B1	Adaptor-related protein complex 2, bela 1 subunit	184.47	53.67	0.207
514870	ATP5F1	ATP synthase, H+ transporting, mitochondrial F0 complex, subuni	441.56	130.47	0.034
		b, isoform 1
514920	CALCOCO	Calcium binding and coiled-coil domain 2	151.26	76.62	0.241
514934	CAPZA1	Capping protein (actin filament) muscle Z-line, alpha 1	232.49	84.07	0.276
515003	C19orf6	Chromosome 19 open reading frame 6	218.92	96.61	0.172
515005	STK11	Serine/threonine kinase 11 (Peutz-Jeghers syndrome)	127.27	85.12	0.379
515018	GNA13	Guanine nucleotide binding protein (G protein), alpha 13	162.22	105.65	0.345
515053	AES	Amino-terminal enhancer of split	314.90	95.73	0.138
515070	EEF2	Eukaryotic translation elongation factor 2	403.41	101.00	0.034
515092	CLPP	ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit	173.03	103.29	0.241
		homolog (E. coli)
515155	C19orf43	Chromosome 19 open reading frame 43	161.94	77.42	0.138
515162	CALR	Calreticulin	575.58	88.03	0.034
515164	GADD45GIP1	Growth arrest and DNA-damage-inducible, gamma interacting	191.12	69.42	0.276
		protein 1
515210	DNAJB1	DnaJ (Hsp40) homolog, subfamily B, member 1	233.68	80.33	0.207
515255	LSM4	LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)	266.66	105.98	0.276
515266	UPF1	UPF1 regulator of nonsense transcripts homolog (yeast)	163.88	99.99	0.276
515271	SFRS14	Splicing factor, arginine/serine-rich 14	124.30	81.86	0.310
515329	RPL22	Ribosomal protein L22	191.43	75.49	0.138
515371	CAPNS1	Calpain, small subunit 1	404.46	95.10	0.069
515406	AKT2	V-akt murine thymoma viral oncogene homolog 2	139.00	124.72	0.345
515417	EGLN2	Egl nine homolog 2 (C. elegans)	257.04	138.23	0.379
515432	DEDD2	Death effector domain containing 2	94.65	52.25	0.379
515472	SNRPD2	Small nuclear ribonucleoprotein D2 polypeptide 16.5 kDa	292.31	154.43	0.207
515475	SYMPK	Symplekin	133.18	53.29	0.241
515487	CALM3	Calmodulin 3 (phosphorylase kinase, delta)	439.26	95.22	0.069
515494	SLC1A5	Solute carrier family 1 (neutral amino acid transporter), member 5	448.32	106.79	0.138
515500	SAE1	SUMO-1 activating enzyme subunit 1	380.21	79.67	0.034
515515	KDELR1	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention	261.62	81.81	0.138
		receptor 1
515517	RPL18	Ribosomal protein L18	743.38	74.48	0.103
515524	NUCB1	Nucleobindin 1	350.34	117.21	0.103
515540	PTOV1	Prostate tumor overexpressed gene 1	175.30	98.47	0.172
515550	LOC284361	Hematopoietic signal peptide-containing	135.48	82.61	0.310
515598	PRPF31	PRP31 pre-mRNA processing factor 31 homolog (yeast)	368.40	151.24	0.276
515607	PPP1R12C	Protein phosphatase 1, regulatory (inhibitor) subunit 12C	165.22	97.14	0.379
515642	GPSN2	Glycoprotein, synaptic 2	171.37	74.21	0.345
515785	BLVRB	Biliverdin reductase B (flavin reductase (NADPH))	143.92	94.30	0.310
515846	RUVBL2	RuvB-like 2 (E. coli)	354.78	98.40	0.138
515848	HADHB	Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme	213.42	90.90	0.103
		thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta
		subunit
515890	YPEL5	Yippee-like 5 (Drosophila)	181.92	82.16	0.276
516075	TIA1	TIA1 cytotoxic granule-associated RNA binding protein	183.23	80.58	0.310
516077	FLJ14668	Hypothetical protein FLJ14668	112.96	75.82	0.276
516087	TEX261	Testis expressed sequence 261	146.81	110.15	0.241
516111	DCTN1	Dynactin 1 (p150, glued homolog, Drosophila)	261.96	94.41	0.103
516114	WBP1	WW domain binding protein 1	114.03	56.61	0.310
516157	MAT2A	Methionine adenosyltransferase II, alpha	195.52	68.87	0.172
516450	SMPD4	Sphingomyelin phosphodiesterase 4, neutral membrane (neutral	248.30	97.54	0.172
		sphingomyelinase-3)
516522	INTS3	Integrator complex subunit 3	142.16	102.91	0.379
516539	HNRPA3	Heterogeneous nuclear ribonucleoprotein A3	223.52	72.69	0.138
516587	UBE2Q1	Ubiquitin-conjugating enzyme E2Q (putative) 1	131.58	55.37	0.345
516533	NCKAP1	NCK-associated protein 1	198.42	62.97	0.241
516711	CHPF	Chondroitin polymerizing factor	213.73	142.81	0.379
516790	ARHGEF2	Rho/rac guanine nucleotide exchange factor (GEF) 2	133.62	84.47	0.379
516807	STK25	Serine/threonine kinase 25 (STE20 homolog, yeast)	455.41	109.35	0.138
516826	TRIB3	Tribbles homolog 3 (Drosophila)	228.24	99.31	0.241
516855	CENPB	Centromere protein B, 80 kDa	202.67	80.52	0.276
517080	SLC35C2	Solute carrier family 35, member C2	163.93	94.82	0.207
517106	CEBPB	CCAAT/enhancer binding protein (C/EBP), beta	178.82	93.37	0.345
517134	C20orf43	Chromosome 20 open reading frame 43	247.39	69.92	0.069
517145	ENO1	Enolase 1, (alpha)	3401.32	102.15	0.000
517168	TAGLN2	Transgelin 2	626.02	75.92	0.069
517216	PEA15	Phosphoprotein enriched in astrocytes 15	283.17	82.20	0.172
517232	PEX19	Peroxisomal biogenesis factor 19	151.27	57.99	0.207
517240	IFNGR2	Interferon gamma receptor 2 (interferon gamma transducer 1)	158.55	79.26	0.172
517262	SON	SON DNA binding protein	197.08	79.92	0.138
517293	F11R	F11 receptor	215.86	109.54	0.276
517338	ATP6V1E1	ATPase, H+ transporting, lysosomal 31 kDa, V1 subunit E isoform 1	197.20	81.17	0.069
517342	DEDD	Death effector domain containing	136.31	62.93	0.276
517356	COL18A1	Collagen, type XVIII, alpha 1	388.40	175.92	0.345
517357	DGCR2	DiGeorge syndrome critical region gene 2	214.17	92.03	0.241
517421	PCQAP	PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-	205.74	178.98	0.241
		associated protein
517438	ASCC2	Activating signal cointegrator 1 complex subunit 2	138.59	89.52	0.138
517517	EP300	E1A binding protein p300	124.61	92.25	0.379
517543	PES1	Pescadillo homolog 1, containing BRCT domain (zebrafish)	242.64	124.33	0.276
517582	MCM5	MCM5 minichromosome maintenance deficient 5, cell division	424.00	105.24	0.172
		cycle 46 (S. cerevisiae)
517622	UNC84B	Unc-84 homolog B (C. elegans)	131.34	80.16	0.310
517641	L3MBTL2	L(3)mbt-like 2 (Drosophila)	116.46	67.43	0.345
517666	CYB5R3	Cytochrome b5 reductase 3	314.58	161.98	0.138
517731	TRABD	TraB domain containing	180.88	102.41	0.276
517768	BRP44	Brain protein 44	127.10	104.51	0.345
517792	C3orf10	Chromosome 3 open reading frame 10	175.04	80.24	0.069
517817	TMEM43	Transmembrane protein 43	136.66	75.36	0.310
517821		CDNA clone IMAGE: 5278517	120.53	66.29	0.310
517888	CRTAP	Cartilage associated protein	208.15	77.38	0.207
517948	DHX30	DEAH (Asp-Glu-Ala-His) box polypeptide 30	209.13	121.04	0.207
517949	MAP4	Microtubule-associated protein 4	306.69	79.18	0.103
517969	APEH	N-acylaminoacyl-peptide hydrolase	330.37	60.97	0.207
517981	TUSC2	Tumor suppressor candidate 2	129.92	69.61	0.310
518060	ARL6IP5	ADP-ribosylation-like factor 6 interacting protein 5	303.59	116.09	0.207
518123	TFG	TRK-fused gene	189.81	59.70	0.138
518236	SEC61A1	Sec61 alpha 1 subunit (S. cerevisiae)	272.42	82.37	0.138
518244	RPN1	Ribophorin I	232.54	86.03	0.172
518249	CNBP	CCHC-type zinc finger, nucleic acid binding protein	307.66	69.72	0.034
518250	COPG	Coatomer protein complex, subunit gamma	205.51	104.21	0.276
518265	CDV3	CDV3 homolog (mouse)	192.56	91.81	0.138
518326	SERP1	Stress-associated endoplasmic reticulum protein 1	233.71	64.27	0.069
518346	SSR3	Signal sequence receptor, gamma (translocon-associated protein	133.69	62.65	0.241
		gamma)
518374	QSOX1	Quiescin Q6 sulfhydryl oxidase 1	151.71	84.80	0.310
518424	NDUFB5	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16 kDa	625.19	180.45	0.276
518460	AP2M1	Adaptor-related protein complex 2, mu 1 subunit	584.10	76.35	0.069
518464	PSMD2	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	538.23	93.02	0.103
518525	GLUL	Glutamate-ammonia ligase (glutamine synthetase)	326.37	86.68	0.138
518551	RPL31	Ribosomal protein L31	883.50	204.46	0.103
518608	MRFAP1L1	Morf4 family associated protein 1-like 1	107.24	53.27	0.172
518609	ARPC5	Actin related protein 2/3 complex, subunit 5, 16 kDa	226.65	65.59	0.172
518750	OCIAD1	OCIA domain containing 1	121.73	78.62	0.172
518805	HMGA1	High mobility group AT-hook 1	1583.57	131.69	0.172
518827	CCNI	Cyclin I	495.99	157.57	0.034
519276	MAPKAPK2	Mitogen-activated protein kinase-activated protein kinase 2	172.89	87.16	0.172
519304	PELO	Pelota homolog (Drosophila)	204.10	151.63	0.310
519346	ERBB2IP	Erbb2 interacting protein	171.05	83.90	0.241
519347	SFRS12	Splicing factor, arginine/serine-rich 12	99.98	49.97	0.310
519520	RPS25	Ribosomal protein S25	717.45	181.09	0.034
519523	SERPINB6	Serpin peptidase inhibitor, clade B (ovalbumin), member 6	180.64	74.06	0.172
519557	TMEM14C	Transmembrane protein 14C	139.62	70.39	0.276
519718	TTC1	Tetratricopeptide repeat domain 1	119.41	63.74	0.276
519756	STK10	Serine/threonine kinase 10	131.85	89.36	0.379
519818	MGAT1	Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-	179.60	85.97	0.138
		acetylglucosaminyltransferase
519909	MARCKS	Myristoylated alanine-rich protein kinase C substrate	360.12	219.46	0.310
519930	C6orf62	Chromosome 6 open reading frame 62	131.39	63.83	0.138
520026	VARS2	Valyl-tRNA synthetase	317.40	77.78	0.241
520028	HSPA1A	Heat shock 70 kDa protein 1A	267.63	174.20	0.241
520037	NEU1	Sialidase 1 (lysosomal sialidase)	229.35	119.62	0.310
520070	CUTA	CUtA divalent cation tolerance homolog (E. coli)	154.48	68.26	0.207
520140	SRF	Serum response factor (c-fos serum response element-binding	130.75	59.73	0.379
		transcription factor)
520189	ELOVL5	ELOVL family member 5, elongation of long chain fatty acids	137.81	70.07	0.276
		(FEN1/Elo2, SUR4/Elo3-like, yeast)
520205	EIF2AK1	Eukaryotic translation initiation factor 2-alpha kinase 1	238.20	66.39	0.138
520210	KDELR2	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention	225.97	94.83	0.138
		receptor 2
520287	C6orf111	Chromosome 6 open reading frame 111	170.77	69.67	0.207
520313	CD164	CD164 antigen, sialomucin	387.43	78.65	0.172
520383	STX7	Syntaxin 7	200.61	198.70	0.379
520421	PERP	PERP, TP53 apoptosis effector	278.10	105.31	0.379
520459	GTF2I	General transcription factor II, i	179.36	111.40	0.345
520623	C7orf27	Chromosome 7 open reading frame 27	107.46	71.73	0.345
520640	ACTB	Actin, beta	4381.34	95.98	0.034
520740	SCRN1	Secernin 1	162.41	76.80	0.276
520794	YKT6	SNARE protein Ykt6	322.61	99.65	0.276
520898	CTSB	Cathepsin B	555.78	100.98	0.034
520943	EIF4H	Eukaryotic translation initiation factor 4H	520.03	71.02	0.069
520967	MDH2	Malate dehydrogenase 2, NAD (mitochondrial)	368.83	66.26	0.069
520973	HSPB1	Heat shock 27 kDa protein 1	608.95	126.99	0.138
520974	YWHAG	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase	171.99	87.92	0.310
		activation protein, gamma polypeptide
521064	ZNF655	Zinc finger protein 655	100.31	68.90	0.379
521151	ZNF672	Zinc finger protein 672	185.36	113.36	0.310
521289	REPIN1	Replication initiator 1	220.03	101.31	0.172
521487	TMEM66	Transmembrane protein 66	276.62	74.21	0.138
521640	RAD23B	RAD23 homolog B (S. cerevisiae)	334.78	294.31	0.241
521809	RP13-	Cofactor of BRCA1	180.78	84.61	0.172
	122B23.3
521903	LY6E	Lymphocyte antigen 6 complex, locus E	425.61	138.70	0.172
521924	SIAHBP1	Fuse-binding protein-interacting repressor	381.93	82.10	0.103
521969	NDUFB11	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3 kDa	144.58	114.75	0.379
521973	WDR13	WD repeat domain 13	177.47	106.14	0.172
522074	TSC22D3	TSC22 domain family, member 3	194.81	93.94	0.207
522110	CREB3	CAMP responsive element binding protein 3	153.05	94.31	0.241
522114	CLTA	Clathrin, light polypeptide (Lca)	317.85	88.44	0.103
522310	NANS	N-acetylneuraminic acid synthase (sialic acid synthase)	114.60	62.52	0.310
522373	GSN	Gelsolin (amyloidosis, Finnish type)	434.41	204.85	0.138
522394	HSPA5	Heat shock 70 kDa protein 5 (glucose-regulated protein, 78 kDa)	367.53	102.24	0.172
522463	EEF1A1	Eukaryotic translation elongation factor 1 alpha 1	9324.87	148.86	0.000
522507	FBXW5	F-box and WD-40 domain protein 5	199.15	90.48	0.276
522584	TMSB4X	Thymosin, beta 4, X-linked	1362.45	161.68	0.172
522590	EIF1AX	Eukaryotic translation initiation factor 1A, X-linked	136.35	67.99	0.207
522632	TIMP1	TIMP metallopeptidase inhibitor 1	386.91	180.87	0.241
522665	MAGED2	Melanoma antigen family D, 2	430.71	110.49	0.138
522675	LAS1L	LAS1-like (S. cerevisiae)	201.59	69.13	0.241
522752	PSMD10	Proteasome (prosome, macropain) 26S subunit, non-ATPase, 10	122.91	60.90	0.276
522817	BCAP31	B-cell receptor-associated protein 31	290.93	84.50	0.172
522819	IRAK1	Interleukin-1 receptor-associated kinase 1	382.94	97.80	0.138
522823	EMD	Emerin (Emery-Dreifuss muscular dystrophy)	171.35	87.58	0.379
522932	NCOA4	Nuclear receptor coactivator 4	209.19	70.05	0.138
522995	EIF4EBP2	Eukaryotic translation initiation factor 4E binding protein 2	176.81	73.83	0.103
523004	PSAP	Prosaposin (variant Gaucher disease and variant metachromatic	1098.27	123.65	0.034
		leukodystrophy)
523012	DDIT4	DNA-damage-inducible transcript 4	415.15	125.10	0.276
523054	TMEM50A	Transmembrane protein 50A	139.64	109.41	0.276
523131	TRAPPC3	Trafficking protein particle complex 3	139.68	66.61	0.310
523145	DDOST	Dolichyl-diphosphooligosaccharide-protein glycosyltransferase	338.02	90.17	0.103
523215	NDUFB8	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19 kDa	199.51	106.37	0.172
523238	NOLC1	Nucleolar and coiled-body phosphoprotein 1	176.02	83.34	0.138
523262	TMEM59	Transmembrane protein 59	262.49	95.63	0.069
523299	EIF3S10	Eukaryotic translation initiation factor 3, subunit 10 theta, 150/170 kDa	180.25	76.56	0.172
523302	PRDX3	Peroxiredoxin 3	948.84	182.31	0.138
523560	HSP90AA2	Heat shock protein 90 kDa alpha (cytosolic), class A member 2	971.87	81.16	0.000
523680	SSRP1	Structure specific recognition protein 1	259.94	67.23	0.138
523789	TncRNA	Trophoblast-derived noncoding RNA	290.76	109.38	0.310
523829	POLD4	Polymerase (DNA-directed), delta 4	192.79	92.64	0.310
523836	GSTP1	Glutathione S-transferase pi	363.83	79.45	0.103
523852	CCND1	Cyclin D1	257.94	79.21	0.310
523875	INPPL1	Inositol polyphosphate phosphatase-like 1	198.48	82.78	0.310
524009	AASDHPPT	Aminoadipate-semialdehyde dehydrogenase-phosphopantetheiny	139.83	74.10	0.345
		transferase
524081	DPAGT1	Dolichyl-phosphate (UDP-N-acetylglucosamine) N-	125.85	78.99	0.345
		acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase
524084	RNF26	Ring finger protein 26	170.50	95.60	0.310
524161	RSU1	Ras suppressor protein 1	173.91	80.13	0.276
524171	RAD52	RAD52 homolog (S. cerevisiae)	128.36	73.88	0.345
524183	FKBP4	FK506 binding protein 4, 59 kDa	345.04	165.12	0.138
524195	ARHGAP2	Rho GTPase activating protein 21	118.87	87.10	0.379
524214	MLF2	Myeloid leukemia factor 2	271.91	68.75	0.138
524219	TPI1	Triosephosphate isomerase 1	1085.58	88.77	0.069
524271	PHC2	Polyhomeotic-like 2 (Drosophila)	333.79	105.07	0.138
524367	CBARA1	Calcium binding atopy-related autoantigen 1	133.75	65.29	0.207
524395	TUBA1A	Tubulin, alpha 1a	423.08	127.26	0.241
524464	ATP5G2	ATP synthase, H+ transporting, mitochondrial F0 complex, subunit	300.01	124.98	0.172
		c (subunit 9), isoform 2
524502	RNF41	Ring finger protein 41	110.38	68.59	0.241
524530	CTDSP2	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A	286.91	136.97	0.103
		small phosphatase 2
524590	RAB21	RAB21, member RAS oncogene family	112.13	48.40	0.379
524599	NAP1L1	60S ribosomal protein L6 (RPL6A)	559.97	99.14	0.034
524690	PPIE	Peptidylprolyl isomerase E (cyclophilin E)	224.33	109.34	0.207
524788	RAB35	RAB35, member RAS oncogene family	97.18	65.96	0.379
524809	CLIP1	CAP-GLY domain containing linker protein 1	121.91	90.76	0.345
524899	SAP18	Sin3-associated polypeptide, 18 kDa	129.03	72.41	0.172
524920	ZFP91	Zinc finger protein 91 homolog (mouse)	128.10	83.51	0.207
524969	UFM1	Ubiquitin-fold modifier 1	172.41	84.47	0.310
525134	POMGNT1	Protein O-linked mannose beta1,2-N-	161.82	102.74	0.345
		acetylglucosaminyltransferase
525163	ANKRD10	Ankyrin repeat domain 10	156.22	79.59	0.207
525232	LRP10	Low density lipoprotein receptor-related protein 10	201.98	129.16	0.138
525238	C14orf119	Chromosome 14 open reading frame 119	141.96	104.26	0.276
525330	ARF6	ADP-ribosylation factor 6	191.66	134.63	0.103
525391	C1orf123	Chromosome 1 open reading frame 123	98.24	87.20	0.310
525527	RER1	RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)	137.56	72.32	0.310
525626	PACS2	Phosphofurin acidic cluster sorting protein 2	126.74	98.42	0.345
525899	C6orf49	Chromosome 6 open reading frame 49	144.67	83.87	0.172
526464	PML	Promyelocytic leukemia	129.51	84.95	0.345
526521	MDH1	Malate dehydrogenase 1, NAD (soluble)	414.98	150.61	0.103
527105	HNRPDL	Heterogeneous nuclear ribonucleoprotein D-like	215.39	95.16	0.207
527193	RPS23	Ribosomal protein S23	178.23	128.51	0.207
527348	AKAP9	A kinase (PRKA) anchor protein (Yotiao) 9	103.64	60.76	0.310
527412	ASAH1	N-acylsphingosine amidohydrolase (acid ceramidase) 1	216.47	95.28	0.241
527861	OS9	Amplified in osteosarcoma	317.55	151.86	0.138
527862	PKD1	Hypothetical protein LOC339047	142.25	87.72	0.345
527980	DUT	DUTP pyrophosphatase	150.77	79.02	0.207
528050	HARS	Histidyl-tRNA synthetase	171.62	84.32	0.138
528222	NDUFS4	NADH dehydrogenase (ubiquinone) Fe—S protein 4, 18 kDa	112.10	94.04	0.276
		(NADH-coenzyme Q reductase)
528300	PITRM1	Pitrilysin metallopeptidase 1	122.00	61.07	0.276
528305	DDX17	DEAD (Asp-Glu-Ala-Asp) box polypeptide 17	298.20	91.95	0.138
528572	SORBS3	Sorbin and SH3 domain containing 3	187.70	104.57	0.345
528668	RPL6	Ribosomal protein L6	1037.68	85.03	0.034
528780	GSPT1	G1 to S phase transition 1	170.88	56.71	0.138
528803	UQCRC2	Ubiquinol-cytochrome c reductase core protein II	272.39	84.82	0.103
529059	EIF3S4	Eukaryotic translation initiation factor 3, subunit 4 delta, 44 kDa	311.33	92.44	0.172
529132	SEPW1	Selenoprotein W 1	231.08	110.89	0.276
529244	NCK2	NCK adaptor protein 2	236.70	169.13	0.345
529280	ANAPC7	Anaphase promoting complex subunit 7	94.04	52.31	0.379
529303	ARPC2	Actin related protein 2/3 complex, subunit 2, 34 kDa	329.77	127.35	0.034
529369	AFAP1	Actin filament associated protein 1	101.03	56.96	0.379
529400	IFNAR1	Interferon (alpha, beta and omega) receptor 1	108.71	56.53	0.310
529420	UBE2G2	Ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)	160.64	100.65	0.103
529591	TLOC1	Translocation protein 1	141.82	65.80	0.172
529618	TFRC	Transferrin receptor (p90, CD71)	212.76	85.52	0.241
529631	RPL35A	Ribosomal protein L35a	453.58	173.13	0.103
529782	VCP	Valosin-containing protein	532.58	85.03	0.034
529798	BTF3	Basic transcription factor 3	400.11	94.96	0.069
529862	CSNK1A1	Casein kinase 1, alpha 1	210.72	69.09	0.103
529890	CANX	Calnexin	399.31	129.28	0.069
529892	SQSTM1	Sequestosome 1	789.12	108.86	0.034
529957	SEC63	SEC63-like (S. cerevisiae)	120.12	80.80	0.276
530096	EIF3S2	Eukaryotic translation initiation factor 3, subunit 2 beta, 36 kDa	451.94	86.61	0.034
530118	LUC7L2	LUC7-like 2 (S. cerevisiae)	132.76	59.55	0.172
530291	ANXA11	Annexin A11	279.25	86.71	0.069
530314	SSNA1	Sjogren's syndrome nuclear autoantigen 1	122.20	58.54	0.379
530331	PDHA1	Pyruvate dehydrogenase (lipoamide) alpha 1	179.99	79.37	0.207
530381	PIM3	Pim-3 oncogene	114.61	72.86	0.345
530412	SERBP1	SERPINE1 mRNA binding protein 1	289.56	66.47	0.069
530436	STXBP3	Syntaxin binding protein 3	113.84	77.40	0.276
530479	PMF1	Polyamine-modulated factor 1	128.35	73.53	0.241
530687	RNH1	Ribonuclease/angiogenin inhibitor 1	342.47	102.27	0.172
530734	MRPL16	Mitochondrial ribosomal protein L16	106.22	67.89	0.345
530753	C11orf59	Chromosome 11 open reading frame 59	153.75	63.46	0.276
530823	COPS7A	COP9 constitutive photomorphogenic homolog subunit 7A	202.70	132.83	0.138
		(Arabidopsis)
530862	PRKAG1	Protein kinase, AMP-activated, gamma 1 non-catalytic subunit	136.75	73.16	0.241
531081	LGALS3	Lectin, galactoside-binding, soluble, 3 (galectin 3)	318.01	134.08	0.241
531089	PSMA3	Proteasome (prosome, macropain) subunit, alpha type, 3	218.40	93.16	0.276
531176	SARS	Seryl-tRNA synthetase	297.55	88.08	0.138
531330	CBWD1	COBW domain containing 2	123.09	79.22	0.310
531614	BTBD14B	BTB (POZ) domain containing 14B	123.09	63.39	0.310
531752	RANBP3	RAN binding protein 3	122.49	64.65	0.310
531856	GAS5	Growth arrest-specific 5	227.80	134.55	0.241
531876	DYNLRB1	Dynein, light chain, roadblock-type 1	167.51	104.22	0.241
531879	RAD1	RAD1 homolog (S. pombe)	115.15	74.02	0.379
532359	RPL5	Ribosomal protein L5	747.39	72.96	0.000
532399	ZC3H11A	Zinc finger CCCH-type containing 11A	139.50	74.48	0.241
532755	C16orf80	Chromosome 16 open reading frame 80	95.17	63.38	0.207
532790	NMT1	N-myristoyltransferase 1	165.97	105.96	0.172
532793	KPNB1	Karyopherin (importin) beta 1	568.94	129.62	0.000
532803	HN1	Hematological and neurological expressed 1	225.82	90.89	0.103
532826	MCL1	Myeloid cell leukemia sequence 1 (BCL2-related)	252.48	83.80	0.207
532853	NDUFB7	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18 kDa	145.80	84.03	0.345
533030	TRIOBP	TRIO and F-actin binding protein	339.95	148.19	0.207
533059	TUBB	Tubulin, beta polypeptide	2476.41	87.07	0.000
533122	SFRS10	Splicing factor, arginine/serine-rich 10 (transformer 2 homolog,	182.52	60.97	0.034
		Drosophila)
533136	LRPAP1	Low density lipoprotein receptor-related protein associated protein 1	234.76	108.38	0.207
533192	TOMM20	Translocase of outer mitochondrial membrane 20 homolog (yeast)	208.87	77.43	0.138
533222	DIMT1L	DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)	129.17	69.14	0.379
533245	DDX46	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	118.53	50.97	0.345
533282	NONO	Non-POU domain containing, octamer-binding	842.92	104.94	0.034
533308	PPP2R5D	Protein phosphatase 2, regulatory subunit B (B56), delta isoform	223.23	100.62	0.138
533317	VIM	Vimentin	1800.81	137.19	0.069
533437	TCEB1	Transcription elongation factor B (SIII), polypeptide 1 (15 kDa,	121.08	94.03	0.276
		elongin C)
533440	WWP1	WW domain containing E3 ubiquitin protein ligase 1	146.51	87.93	0.345
533474	PPP1R8	Protein phosphatase 1, regulatory (inhibitor) subunit 8	95.08	118.26	0.379
533479	LYPLA2	Lysophospholipase II	223.79	59.26	0.276
533526	ATRX	Alpha thalassemia/mental retardation syndrome X-linked (RAD54	149.83	61.38	0.276
		homolog, S. cerevisiae)
533624	H3F3A	H3 histone, family 3A	322.44	81.23	0.103
533712	RBM4	RNA binding motif protein 4	169.22	66.18	0.138
533732	SRP14	Signal recognition particle 14 kDa (homologous Alu RNA binding	223.87	85.87	0.172
		protein)
533771	STUB1	STIP1 homology and U-box containing protein 1	238.45	84.03	0.241
533782	KRT8	Keratin 8	1307.25	94.61	0.379
533977	TXNIP	Thioredoxin interacting protein	429.73	92.27	0.034
533985	EXOC7	Exocyst complex component 7	168.92	93.23	0.276
533986	ZMYM6	Zinc finger, MYM-type 6	99.16	62.99	0.310
534125	HLA-C	Major histocompatibility complex, class I, C	610.10	155.80	0.034
534168	NDUFA1	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5 kDa	261.51	202.07	0.310
534212	SEC22B	SEC22 vesicle trafficking protein homolog B (S. cerevisiae)	107.96	68.79	0.379
534255	B2M	Beta-2-microglobulin	1303.98	172.16	0.000
534307	CCND3	Cyclin D3	471.76	356.89	0.207
534314	EIF5A	Eukaryotic translation initiation factor 5A	438.38	88.29	0.207
534326	ITGB4BP	Integrin beta 4 binding protein	360.06	78.91	0.103
534338	PPP4C	Protein phosphatase 4 (formerly X), catalytic subunit	191.52	75.42	0.138
534346	RPS7	Ribosomal protein S7	572.81	120.27	0.000
534350	SMARCB1	SWI/SNF related, matrix associated, actin dependent regulator of	210.96	162.57	0.172
		chromatin, subfamily b, member 1
534453	NDUFA13	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	194.91	119.87	0.138
534456	ANAPC11	APC11 anaphase promoting complex subunit 11 homolog (yeast)	164.01	99.17	0.172
534457	C14orf166	Chromosome 14 open reading frame 166	171.37	66.04	0.138
534473	TOMM22	Translocase of outer mitochondrial membrane 22 homolog (yeast)	144.72	100.10	0.207
534483	PHF23	PHD finger protein 23	123.34	63.04	0.276
536275	PACS1	Phosphofurin acidic cluster sorting protein 1	217.82	86.00	0.345
541269	NDUFB9	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22 kDa	269.72	132.31	0.172
546248	CTSD	Cathepsin D (lysosomal aspartyl peptidase)	660.73	119.52	0.103
546250	DYNC1I2	Dynein, cytoplasmic 1, intermediate chain 2	154.54	71.13	0.172
546253	FDFT1	Farnesyl-diphosphate farnesyltransferase 1	249.53	81.90	0.034
546261	HNRPA1	Heterogeneous nuclear ribonucleoprotein A1	649.46	94.55	0.000
546269	RPL10A	Ribosomal protein L10a	706.14	175.46	0.103
546271	PCBP2	Poly(rC) binding protein 2	293.34	87.15	0.103
546286	RPS3	Ribosomal protein S3	2290.87	95.60	0.000
546289	RPS12	Ribosomal protein S12	527.74	281.85	0.103
546290	RPS18	Ribosomal protein S18	939.29	233.81	0.069
546291	RPS27	Ribosomal protein S27 (metallopanstimulin 1)	725.59	382.56	0.172
546339	C11orf58	Chromosome 11 open reading frame 58	580.69	190.75	0.138
546356	RPL13A	Ribosomal protein L13a	1352.43	84.32	0.000
546394	CCDC72	Coiled-coil domain containing 72	244.28	200.01	0.241
547759	SSBP3	Single stranded DNA binding protein 3	124.35	57.76	0.310
549178	C9orf86	Chromosome 9 open reading frame 86	219.13	114.79	0.138
552590	HTF9C	HpaII tiny fragments locus 9C	107.24	77.34	0.276
553496	PGM3	Phosphoglucomutase 3	103.08	61.39	0.379
553512	MBOAT5	Membrane bound O-acyltransferase domain containing 5	124.81	75.10	0.310
554767	NUP88	Nucleoporin 88 kDa	120.01	86.75	0.345
554776	SREBF1	Sterol regulatory element binding transcription factor 1	171.91	88.02	0.276
554894	WDR54	WD repeat domain 54	114.62	72.99	0.345
554896	C7orf50	Chromosome 7 open reading frame 50	193.18	101.69	0.207
555194	FAM36A	Family with sequence similarity 36, member A	120.40	52.67	0.276
555866	C1QBP	Complement component 1, q subcomponent binding protein	312.33	77.95	0.138
555873	HNRPAB	Heterogeneous nuclear ribonucleoprotein A/B	316.21	89.74	0.034
555875	IDH3A	Isocitrate dehydrogenase 3 (NAD+) alpha	143.01	87.51	0.345
555889	PSMC2	Proteasome (prosome, macropain) 26S subunit, ATPase, 2	219.37	69.24	0.172
555890	RBBP4	Retinoblastoma binding protein 4	204.72	80.47	0.172
555911	RBM8A	RNA binding motif protein 8A	125.26	75.03	0.172
555969	RIC8A	Resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)	261.31	93.56	0.172
555971	TMBIM1	Transmembrane BAX inhibitor motif containing	219.28	114.17	0.207
555973	MRPS25	Mitochondrial ribosomal protein S25	152.15	62.00	0.207
555994	LONP2	Ion peptidase 2, peroxisomal	135.95	87.69	0.379
556267	FBXL10	F-box and leucine-rich repeat protein 10	81.84	65.86	0.379
556461	NDUFV2	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24 kDa	146.86	108.59	0.207
556795	PAICS	Phosphoribosylaminoimidazole carboxylase,	253.76	89.34	0.138
		phosphoribosylaminoimidazole succinocarboxamide synthetase
557550	NPM1	Nucleophosmin (nucleolar phosphoprotein B23, numatrin)	1675.95	168.64	0.000
558296	ACP1	Acid phosphatase 1, soluble	123.81	58.79	0.172
558313	COX6A1	Cytochrome c oxidase subunit VIa polypeptide 1	170.58	93.53	0.241
558322	EEF1B2	Eukaryotic translation elongation factor 1 beta 2	450.71	94.79	0.034
558325	EIF5	Eukaryotic translation inititation factor 5	232.38	85.09	0.172
558328	FKBP5	FK506 binding protein 5	117.84	59.52	0.310
558330	FTL	Ferritin, light polypeptide	2521.41	158.72	0.069
558338	HSPE1	Heat shock 10 kDa protein 1 (chaperonin 10)	270.37	133.18	0.207
558345	IK	IK cytokine, down-regulator of HLA II	252.13	99.25	0.138
558354	RPSA	Ribosomal protein SA	1322.76	86.38	0.034
558360	NDUFB4	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15 kDa	211.99	145.77	0.345
558361	NME2	Non-metastatic cells 2, protein (NM23B) expressed in	300.76	113.65	0.276
558362	NUMA1	Nuclear mitotic apparatus protein 1	186.63	72.04	0.207
558376	RAC1	Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP	310.27	151.23	0.000
		binding protein Rac1)
558381	SNORA65	Small nucleolar RNA, H/ACA box 65	182.13	140.06	0.172
558382	RPL15	Ribosomal protein L15	675.76	128.40	0.000
558383	RPL18A	Ribosomal protein L18a	705.56	175.27	0.034
558384	RPL19	Ribosomal protein L19	526.89	137.15	0.034
558385	RPL23A	Ribosomal protein L23a	699.13	138.42	0.069
558386	RPL34	Ribosomal protein L34	697.35	378.17	0.069
558388	RPS3A	Ribosomal protein S3A	2474.40	122.86	0.034
558389	RPS8	Ribosomal protein S8	962.64	129.92	0.000
558390	RPS24	Ribosomal protein S24	612.43	101.36	0.034
558391	RPS26	Ribosomal protein S26	165.48	119.11	0.276
558396	SCD	Stearoyl-CoA desaturase (delta-9-desaturase)	914.63	104.45	0.069
558424	CSDA	Cold shock domain protein A	226.19	107.82	0.103
558426	EIF3S5	Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47 kDa	303.80	92.52	0.172
558429	BUD31	BUD31 homolog (S. cerevisiae)	144.18	63.32	0.172
558431	RPL14	Ribosomal protein L14	572.84	76.90	0.069
558442	PDCD6IP	Programmed cell death 6 interacting protein	197.37	92.14	0.241
558448	TXNL2	Thioredoxin-like 2	190.19	99.31	0.276
558453	ATP5L	ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g	303.51	169.99	0.172
558454	NUDC	Nuclear distribution gene C homolog (A. nidulans)	366.87	118.17	0.207
558458	COPS8	COP9 constitutive photomorphogenic homolog subunit 8	143.44	86.61	0.207
		(Arabidopsis)
558473	C18orf10	Chromosome 18 open reading frame 10	143.75	80.47	0.172
558499	CD320	CD320 molecule	188.81	75.95	0.379
558511	PARL	Presenilin associated, rhomboid-like	126.27	91.30	0.276
558521	C2orf33	Chromosome 2 open reading frame 33	133.19	79.12	0.241
558591	ORMDL1	ORM1-like 1 (S. cerevisiae)	156.16	85.13	0.345
558825	PDE4DIP	Phosphodiesterase 4D interacting protein (myomegalin)	192.79	111.41	0.241
558995	C1orf151	Chromosome 1 open reading frame 151	718.64	244.03	0.103
567260	CD2BP2	CD2 antigen (cytoplasmic tail) binding protein 2	161.65	79.42	0.207
567263	C1orf43	Chromosome 1 open reading frame 43	337.41	80.70	0.172
567267	ATP2C1	ATPase, Ca++ transporting, type 2C, member 1	95.02	60.83	0.345
567279	SAP30BP	SAP30 binding protein	178.67	103.35	0.207
	Genomic Variants on Human
	Genome Assembly Build 36
UniGene	SHORT SAGE	LONG SAGE	Affymetrix		Locus
cluster	Mean	CV	0's P	Mean	CV	0's P	Mean	CV	Variation	Cytogen	ID
120	222.30	77.57	0.000	182.28	77.83	0.000	536.31	44.78	CopyNumber	1q25.1	177
142	177.46	78.94	0.036	83.00	75.28	0.000			CopyNumber	16p11.2	2900
202	233.57	113.47	0.000	199.28	96.07	0.111	419.21	51.49
429	522.98	82.18	0.000	551.21	81.48	0.000	865.18	43.60
695	151.39	90.92	0.000	118.87	85.62	0.111	1052.98	100.96	CopyNumber	21q22.3	3455
808	137.03	66.96	0.000	135.76	77.44	0.222	210.67	38.17
861	68.60	107.22	0.000	36.11	50.87	0.222	127.15	87.08	CopyNumber	16p11.2	2903
1063	96.52	67.18	0.036	100.31	75.40	0.222	194.60	33.14
1103	106.49	111.80	0.036	125.52	97.41	0.111	106.24	57.23
2430	41.98	80.01	0.071	47.30	88.89	0.222	218.15	32.90
2533	60.36	77.46	0.071	74.01	77.57	0.111	354.31	47.43
2795	334.22	95.03	0.000	259.59	82.14	0.111	2250.38	43.77
2853	154.67	63.43	0.036	186.93	60.34	0.111	926.32	22.95
3100	67.12	76.40	0.000	61.24	67.08	0.222	517.42	29.81
3254	97.41	78.32	0.036	113.88	73.94	0.111	211.49	31.45	Inversion	11p15.5	2202
3353	78.09	56.37	0.071	216.42	70.65	0.000	881.36	27.96
3416	109.67	131.08	0.036	68.67	112.87	0.222	360.44	151.18	CopyNumber	9p22.1	1912
3439	70.64	80.75	0.036	89.54	93.24	0.111	191.34	38.33
3530	79.35	72.15	0.036	108.31	56.32	0.000	136.00	30.88
3989	98.71	108.38	0.036	134.74	83.01	0.111	427.22	43.37
4055	257.29	135.83	0.000	441.94	118.93	0.111	64.49	38.32
4742	107.98	119.15	0.036	39.71	65.93	0.222	275.64	44.77	CopyNumber	8q24.3	1879
4747	62.19	73.50	0.071	71.07	73.04	0.111	307.46	47.47
4766	55.17	86.86	0.036	72.60	84.36	0.222	262.05	27.51
4859	101.90	103.29	0.071	110.40	111.52	0.000	299.38	40.44
4997	65.10	62.12	0.000	50.72	94.59	0.111	264.44	22.10
4998	60.81	63.22	0.036	28.78	51.61	0.222	229.36	56.84
5062	333.07	101.42	0.000	111.82	81.88	0.111	800.47	52.13	CopyNumber	15q24.3	2811
5086	62.72	72.25	0.036	53.42	73.36	0.222	135.70	28.77
5120	212.71	71.64	0.000	204.68	69.54	0.111	1158.59	29.63
5158	163.14	67.54	0.000	138.55	60.73	0.111	383.95	36.39
5245	64.41	74.90	0.000	80.69	73.69	0.000	219.54	21.60
5258	122.13	84.40	0.071	133.74	77.92	0.111	589.76	55.05
5268	71.67	78.70	0.000	46.25	73.83	0.111	113.40	37.54
5298	78.91	59.08	0.000	58.54	49.70	0.111	296.11	31.82
5308	354.49	83.81	0.000	479.50	73.38	0.000	2422.20	38.02
5324	73.70	64.23	0.000	62.22	66.74	0.111	694.81	25.69
5345	69.83	86.81	0.071	61.41	84.79	0.111	73.49	30.51	CopyNumber	2q37.3	515
5662	632.04	87.26	0.000	651.22	57.10	0.000	2861.36	36.28
5710	58.67	67.53	0.071	34.13	80.74	0.111	452.86	45.78
5719	289.65	94.26	0.000	65.99	56.36	0.000	55.53	45.18	CopyNumber	12p13.31	2368
5912	53.23	65.61	0.000	30.20	60.87	0.111	430.78	30.03
5947	44.57	68.42	0.036	34.91	59.37	0.222	368.59	33.28
6396	138.04	72.90	0.036	94.01	39.56	0.222	869.88	31.02
6454	233.69	77.38	0.000	290.31	91.04	0.000	504.85	40.25	CopyNumber	19p13.12	3223
6459	117.70	121.97	0.036	88.34	85.38	0.111	157.79	41.08	CopyNumber	8q24.3	1880
6551	113.84	102.10	0.000	99.28	83.28	0.000	515.56	45.37
6891	113.93	68.55	0.000	79.36	95.32	0.000	437.26	34.58
7101	57.03	85.77	0.071	81.04	84.26	0.000	183.19	27.20
7236	73.56	91.55	0.000	89.02	123.50	0.111	150.63	53.39	CopyNumber	19q13.33	3277
7476	134.42	85.55	0.000	91.48	67.53	0.000	1250.83	39.30
7527	91.89	92.63	0.036	52.36	54.01	0.222	97.43	36.93
7744	253.95	85.28	0.000	77.42	71.13	0.000	415.46	37.27	CopyNumber	11q13.1-11q13.2	2278
7753	200.10	136.12	0.000	138.00	85.95	0.111	100.65	48.84	CopyNumber	7q32.1	1639
7768	81.86	65.21	0.000	63.80	65.95	0.111	269.17	27.39	CopyNumber	11q13.1	2276
7862	93.55	74.15	0.036	84.67	63.85	0.111
7910	165.96	72.05	0.036	78.63	65.90	0.111	153.70	42.23
7917	249.49	78.00	0.000	135.78	112.82	0.111	661.73	52.63	CopyNumber	3p22.1	572
8102	918.89	83.01	0.000	1410.01	75.01	0.000	4250.06	30.72
8372	357.79	108.88	0.000	146.74	79.82	0.111	788.19	32.34
8737	102.30	68.38	0.036	88.71	85.75	0.111	253.06	44.11
8752	56.83	57.76	0.071	52.10	62.17	0.222	102.13	32.76	CopyNumber	12q13.2	2429
8765	48.25	64.21	0.000	53.71	59.12	0.000	228.43	30.56
8859	74.83	111.07	0.036	53.33	94.17	0.222	234.96	73.37
8867	187.29	137.92	0.000	273.81	95.23	0.111	547.98	79.93
9003	73.69	69.05	0.000	66.15	65.61	0.000	148.11	36.69
9015	184.94	65.95	0.000	180.11	68.32	0.000
9043	56.29	67.83	0.000	38.48	97.33	0.111	162.00	25.78
9234	68.85	79.49	0.071	68.18	62.80	0.111	434.76	37.42
9235	93.18	92.25	0.000	67.77	88.26	0.222	256.46	58.39
9527	81.51	84.48	0.036	51.11	48.09	0.222	538.70	28.49
9534	98.58	72.74	0.000	86.28	73.16	0.222	626.14	29.63
9573	46.97	92.63	0.036	31.79	54.71	0.222	778.41	33.32
9589	75.93	61.30	0.036	71.77	49.75	0.111	919.32	26.81
9788	82.06	88.77	0.071	127.59	72.78	0.000	377.13	38.24
9825	76.79	66.79	0.000	56.23	48.85	0.111	365.07	28.07
9857	194.06	122.60	0.000	232.82	151.99	0.000	463.40	157.98
10326	164.06	73.58	0.000	197.00	75.36	0.000	369.97	68.55
10842	182.70	94.54	0.000	239.28	115.19	0.222	718.72	44.58
10848	38.94	67.53	0.071	31.76	66.74	0.111	104.71	37.33	CopyNumber	10q11.21	2093
11125	94.29	68.78	0.071	93.47	59.46	0.000	817.21	27.49
11184	129.52	59.84	0.036	115.93	46.13	0.000	292.68	27.77	CopyNumber	9p13.3	1937
11223	52.37	88.67	0.071	78.63	87.24	0.222	57.89	55.15
11355	63.16	104.32	0.036	66.99	75.00	0.222	62.56	35.20
11463	123.53	61.89	0.036	113.19	84.50	0.111	429.95	40.75
12013	47.30	64.76	0.036	45.75	69.36	0.222	99.02	32.35
12084	235.78	81.01	0.000	364.40	89.06	0.000	623.07	39.39	CopyNumber	16p11.2	2900
12102	131.08	67.05	0.071	114.17	52.22	0.111	518.73	22.82	CopyNumber	6q21	1407
12107	76.75	72.91	0.036	50.80	59.67	0.111	329.36	29.47
12109	66.06	61.69	0.036	46.73	59.25	0.111	118.79	29.00	CopyNumber	2q11.2	378
12144	39.29	73.94	0.071	41.87	82.28	0.222	162.21	31.04
12152	64.91	79.55	0.036	58.29	64.64	0.222	30.47	58.95
12272	50.41	64.89	0.071	48.28	64.28	0.111	236.82	29.21
12341	99.54	71.85	0.000	80.90	63.60	0.222	646.53	35.91
12457	69.13	60.75	0.036	41.32	44.32	0.222	141.28	35.86
12865	48.09	77.51	0.036	56.10	68.14	0.111	161.87	24.52
13662	52.31	73.45	0.071	42.54	82.56	0.111	286.77	29.53
14317	169.22	85.06	0.000	210.81	76.29	0.111	707.56	30.56	CopyNumber	15q14	2760
14333	150.04	93.92	0.000	49.69	65.95	0.222	52.91	32.36	CopyNumber	1p36.11	49
14745	86.24	67.71	0.036	34.86	68.85	0.222	344.17	44.46
14839	89.01	60.79	0.036	72.24	59.97	0.000	425.45	27.99	CopyNumber	11q12.3	2269
14846	60.63	71.11	0.036	35.42	56.40	0.111	290.22	58.28
14894	121.24	82.05	0.000	60.76	70.36	0.111	126.08	28.41
15277	84.56	127.86	0.000	94.06	82.10	0.111	147.72	37.89	CopyNumber	16p13.3	2866
15591	83.92	67.01	0.000	41.12	58.74	0.111	131.70	28.53	CopyNumber	7q22.1	1598
15738	120.91	72.04	0.000	129.69	48.46	0.111	417.14	23.56
16059	96.29	66.35	0.000	71.91	74.39	0.111	679.76	46.08
16130	63.36	62.56	0.036	43.34	61.70	0.222	18.64	94.29	CopyNumber	17q25.1	3075
16349	39.01	59.57	0.071	31.68	64.66	0.222	148.04	24.93	CopyNumber	16q23.2	2956
17118	67.64	62.14	0.071	46.03	69.29	0.111	213.73	40.31	CopyNumber	1p34.3	58
17250	105.68	79.64	0.071	117.82	78.92	0.111	294.70	33.94
17680	55.65	73.53	0.071	48.01	54.77	0.111	516.93	33.95	CopyNumber	6q24.2	1437
17731	64.78	70.13	0.000	29.51	60.36	0.111	520.71	54.10
17883	159.30	65.60	0.000	135.33	70.28	0.000	114.89	33.02
18069	74.08	90.49	0.036	63.83	85.91	0.111	211.65	49.02
18128	50.49	74.70	0.036	28.66	43.42	0.222	141.00	37.06	CopyNumber	20q11.22	3366
18349	42.98	74.07	0.036	49.61	83.49	0.222	300.87	45.97
19673	71.97	80.92	0.071	95.67	73.57	0.222	562.71	37.51	CopyNumber	8q24.3	1879
20013	80.86	65.84	0.000	62.25	52.78	0.000	173.94	35.93	CopyNumber	1p36.11	48
20107	78.88	96.88	0.036	39.46	139.41	0.222	175.52	41.33	CopyNumber	14q32.33	2746
20157	79.43	77.35	0.036	59.44	87.93	0.222	376.62	32.83
20521	131.53	94.01	0.000	152.96	89.93	0.111	383.24	40.81	CopyNumber	19q13.33	3277
20529	50.65	69.78	0.071	39.76	53.17	0.222	749.10	34.18	CopyNumber	1p36.32	11
20573	106.46	67.85	0.000	81.56	153.79	0.111	23.55	41.49
20716	84.45	71.00	0.036	66.00	55.65	0.222	276.11	36.03	CopyNumber	1q32.1	209
22393	66.26	64.62	0.036	63.67	82.21	0.222	228.15	33.72
22543	92.47	56.69	0.036	63.96	65.55	0.222	34.14	49.75
22546	52.24	71.92	0.036	42.45	98.37	0.222	651.22	63.93	CopyNumber	11q12.2	2266
22616	39.21	75.10	0.071	35.69	58.10	0.222	144.92	52.15	CopyNumber	17p13.3	2978
23033	38.96	58.71	0.071	39.15	53.57	0.222	341.82	43.42
23111	48.89	77.82	0.071	52.47	83.58	0.222	105.11	33.54	CopyNumber	19p13.13	3220
23978	63.83	66.48	0.036	58.25	63.84	0.222	128.24	28.55
24301	85.97	143.33	0.036	116.94	59.98	0.111	286.08	26.26	CopyNumber	19p13.3	3198
24379	110.66	89.22	0.000	90.75	71.03	0.000	479.98	29.85
24601	156.54	136.75	0.000	195.56	129.74	0.222	34.60	49.50	CopyNumber	22q13.31	3508
24950	142.46	186.79	0.071	189.81	135.70	0.222	307.39	104.91
25155	72.57	120.45	0.071	52.76	77.03	0.222	204.80	58.51
25450	64.55	206.58	0.036	103.43	106.19	0.222	124.80	61.30
25723	67.63	98.01	0.036	74.46	92.32	0.111	204.78	31.78
26010	141.32	107.96	0.036	71.92	87.71	0.111	127.90	44.05	CopyNumber	10p15.2-10p15.3	2038
26023	59.94	71.18	0.036	27.14	63.42	0.222	32.41	34.48
26136	217.48	64.61	0.000	126.52	71.60	0.000	1187.97	29.30
26232	35.17	90.53	0.071	26.46	93.62	0.222	122.41	30.42
26403	60.70	79.12	0.036	49.19	87.28	0.222	49.29	121.55
26518	86.39	108.83	0.036	82.68	57.69	0.111	145.35	56.07	CopyNumber	11p15.5	2200
27222	108.00	70.07	0.036	92.82	77.94	0.111	408.36	36.92
28491	378.42	110.80	0.000	366.05	99.16	0.000	1987.13	39.05
28914	95.10	124.19	0.036	75.99	55.29	0.111	172.22	38.11	CopyNumber	16q24.3	2971
29203	80.31	106.14	0.000	45.04	65.31	0.111	60.43	48.50	CopyNumber	16p13.3	2866
29665	167.80	99.16	0.036	72.28	88.66	0.111	350.56	37.72
30011	65.81	81.69	0.071	81.96	82.93	0.222	133.44	28.49	CopyNumber	17p13.3-17p13.2	2981
30026	99.27	86.33	0.000	93.91	62.29	0.111	123.60	30.35	CopyNumber	1p36.33	0003
30345	96.17	88.62	0.000	124.96	92.01	0.222	262.70	34.03
30954	53.56	68.95	0.000	33.38	69.19	0.222	151.11	40.16
31053	115.61	81.65	0.000	122.44	66.60	0.111	341.88	36.28	CopyNumber	19q13.12	3250
31334	96.19	61.03	0.036	78.51	49.15	0.111	134.99	47.91	CopyNumber	20q13.33	3420
31387	72.05	84.87	0.000	46.14	75.32	0.222	173.71	43.22
34045	33.71	74.24	0.071	45.53	64.82	0.111	117.61	48.58
34576	127.07	64.28	0.036	73.10	58.20	0.000	402.96	28.27	CopyNumber	7p15.2	1525
34906	62.63	68.64	0.071	61.99	53.16	0.111	625.46	46.98
35052	357.59	57.78	0.000	362.25	60.57	0.000	855.32	36.18
35828	74.00	62.01	0.000	45.72	60.60	0.222	108.48	23.16	CopyNumber	14q32.33	2744
36587	55.81	71.83	0.000	30.96	65.30	0.222	179.98	30.62
36927	178.86	121.45	0.000	211.50	111.53	0.222	291.25	56.92
37616	103.87	95.13	0.036	111.55	102.44	0.000	164.13	70.51
37916	134.29	76.45	0.036	73.92	86.57	0.000	160.38	37.39	CopyNumber	9q34.3	2030
42806	55.59	98.22	0.071	67.92	66.52	0.222	113.20	27.89	CopyNumber	1p36.33	0002
43297	192.32	62.31	0.036	167.46	70.07	0.000
47062	77.76	81.09	0.000	51.75	59.62	0.111	279.70	38.81	CopyNumber	19q13.12	3250
50098	773.46	97.25	0.000	197.41	66.02	0.111	889.01	34.95
50308	85.98	69.01	0.071	64.21	68.46	0.111	590.61	33.23	CopyNumber	4p14	824
50425	332.11	59.02	0.000	452.95	56.90	0.000	981.84	28.48
53066	68.61	89.79	0.036	84.91	123.45	0.222	86.87	42.17
54277	100.96	70.86	0.036	96.39	65.47	0.222	198.46	29.56
54457	141.89	101.21	0.000	70.72	79.45	0.111	1276.93	35.83
54642	61.78	66.57	0.036	50.30	60.80	0.222	504.88	34.60
54649	75.69	62.12	0.000	39.30	61.93	0.222	114.82	27.65
55682	89.94	77.92	0.000	55.77	52.38	0.111	1742.75	35.36	CopyNumber	22q12.3	3492
55847	154.55	133.75	0.000	127.47	77.36	0.222	1589.77	32.09	CopyNumber	12p13.31	2368
58488	68.29	91.55	0.000	55.35	57.10	0.222	204.60	74.27
58992	72.95	99.33	0.036	54.95	72.92	0.000	19.90	46.40	CopyNumber	19q13.2	3258
59486	63.64	80.61	0.000	36.11	94.51	0.222	125.78	61.69
61812	108.97	62.20	0.036	81.03	52.93	0.222	163.53	35.91
65234	62.30	85.90	0.000	45.56	51.74	0.111	230.78	28.28
65238	54.91	74.65	0.036	76.11	68.06	0.111	138.90	30.03	CopyNumber	16p11.2	2904
66048	47.23	75.95	0.000	37.75	57.98	0.111	62.79	37.57	CopyNumber	19p13.11	3229
66915	60.49	138.86	0.071	97.34	71.78	0.222	1098.67	81.32
68714	98.30	72.45	0.000	52.63	57.22	0.222	320.40	27.38
69293	71.52	98.44	0.071	85.35	81.08	0.000	585.49	38.47
69554	55.88	69.56	0.036	55.49	73.57	0.111	83.68	28.75
69855	304.45	188.78	0.000	305.44	48.54	0.000	727.35	25.99
71465	77.51	105.85	0.071	66.00	78.37	0.222	243.96	77.49
71787	86.87	77.93	0.071	83.49	81.21	0.222	200.16	37.18
73527	101.19	70.51	0.071	124.08	51.87	0.111	583.61	28.44
73722	230.38	85.72	0.000	261.97	71.05	0.000	463.11	27.57
73799	56.56	65.89	0.071	58.08	66.99	0.000	377.98	28.45
73965	222.54	70.12	0.000	283.48	68.03	0.000	235.15	31.88
74047	68.32	87.12	0.071	30.09	43.70	0.222	43.44	43.38
74050	59.60	65.00	0.000	50.61	69.46	0.222	85.49	33.47
74137	150.00	67.80	0.036	162.33	96.54	0.000	765.38	31.85
74375	79.92	80.65	0.000	94.05	93.83	0.222	79.06	34.15	CopyNumber	1p36.33	2
74405	420.70	70.95	0.000	376.04	102.24	0.000	1073.13	29.89	CopyNumber	2p25.1	280
74471	500.49	146.61	0.000	820.91	82.84	0.222	309.99	88.83
74563	86.41	91.47	0.000	161.30	79.91	0.000	220.82	27.96
74564	107.44	86.90	0.071	98.67	73.67	0.222	853.95	35.62
74576	161.01	103.63	0.036	206.54	105.86	0.111	372.42	51.84
75056	109.02	95.92	0.036	196.13	70.63	0.000	175.01	40.98
75061	136.56	134.90	0.036	139.52	106.48	0.222	694.54	68.77
75066	72.68	57.57	0.071	59.08	75.04	0.222	49.39	28.04
75087	123.07	78.42	0.000	102.46	73.16	0.111	222.76	28.01	CopyNumber	7q36.1	1667
75117	86.61	68.05	0.000	108.92	67.92	0.222	298.96	40.82
75133	47.20	90.78	0.036	33.87	52.50	0.222
75139	37.76	77.20	0.071	32.14	56.90	0.111	265.49	32.96
75189	143.76	71.71	0.036	88.49	96.81	0.111	273.22	47.07
75227	97.37	98.77	0.000	103.41	83.59	0.111	330.85	41.09
75243	150.65	86.87	0.000	163.16	69.12	0.000	306.90	30.86	CopyNumber	6p21.32	1316
75249	141.78	79.25	0.036	72.48	58.84	0.111	451.23	40.81	CopyNumber	16p12.3	2889
75254	57.56	85.88	0.036	35.63	92.11	0.222	167.60	35.94	CopyNumber	19q13.33	3277
75318	72.41	107.17	0.071	47.29	77.96	0.222	245.52	63.96
75348	139.00	83.65	0.000	90.61	53.97	0.000	742.51	27.52
75438	88.56	135.05	0.071	104.15	222.79	0.111	241.61	96.64
75527	46.87	75.11	0.036	50.93	81.60	0.222	188.80	30.23
75724	144.95	72.09	0.000	117.37	63.92	0.000	284.42	34.05
75798	52.53	66.34	0.000	46.25	98.54	0.111	132.09	26.63
75841	109.13	67.70	0.036	111.03	66.56	0.222	697.12	38.13
75890	59.34	63.35	0.071	55.70	53.32	0.222	192.57	34.39
75914	201.28	75.69	0.000	149.78	60.21	0.111	998.68	31.35	CopyNumber	12q24.31	2518
76111	97.04	74.32	0.036	91.80	91.74	0.222	349.38	32.91
76394	101.19	97.13	0.071	85.81	54.54	0.111	723.48	75.27	CopyNumber	10q26.3	2199
76480	41.09	72.15	0.071	42.20	50.89	0.222	107.11	31.94
76662	57.18	75.63	0.071	39.52	102.23	0.222	371.15	30.57
76686	234.43	89.86	0.000	260.60	79.93	0.111	786.14	45.48
76847	252.72	66.20	0.000	156.31	84.21	0.111	534.34	30.42	CopyNumber	11q12.3	2268
77060	150.18	84.28	0.000	108.25	74.95	0.111	304.90	32.72	CopyNumber	17p13.2	2984
77269	370.28	77.93	0.000	395.01	92.11	0.000	212.81	53.48	CopyNumber	3p21.31	586
77313	69.26	109.12	0.036	102.72	140.65	0.000	74.75	36.55	CopyNumber	16q24.3	2973
77422	104.42	91.72	0.000	60.73	89.20	0.111	377.17	61.65	Inversion	Xp11.23	3552
77558	171.44	84.61	0.000	101.75	71.51	0.111	662.90	46.96
77578	52.03	77.49	0.000	102.87	121.76	0.222	171.09	31.33
77793	68.74	72.60	0.000	34.98	96.71	0.222	170.28	52.53
77897	81.46	69.16	0.071	111.11	71.27	0.000	112.01	24.87
77961	105.86	169.44	0.000	823.99	124.02	0.000	4899.68	43.03	CopyNumber	6p21.33	1313
77978	70.16	75.97	0.000	91.06	68.25	0.111	264.14	34.17
78466	119.08	105.76	0.000	115.24	59.35	0.111	296.95	45.96
78601	96.65	74.95	0.036	60.03	61.28	0.000	209.16	29.30
78771	423.67	85.53	0.000	445.96	90.90	0.000	1179.63	41.05	CopyNumber	Xq21.1	3567
78880	101.11	89.08	0.036	41.08	84.35	0.222	167.42	38.32	CopyNumber	19p13.12	3225
78888	166.57	111.41	0.036	130.51	70.31	0.000	1459.58	43.93
78989	89.94	75.96	0.000	94.26	93.28	0.000	363.83	37.58
79064	47.03	65.62	0.071	37.14	60.46	0.222	93.49	36.45
79081	100.43	93.36	0.036	167.72	99.22	0.111	499.05	34.22
79088	99.10	81.96	0.000	99.08	109.91	0.222	156.03	53.20	CopyNumber	15q24.3	2811
79101	82.44	141.29	0.071	153.49	137.97	0.111	444.07	49.53
79110	210.54	86.13	0.036	372.48	77.25	0.000	913.17	31.25
79322	149.07	74.35	0.036	132.17	60.84	0.000	691.01	34.62
79335	54.24	73.95	0.036	64.11	77.17	0.222	67.72	31.29
79387	158.29	62.64	0.000	149.41	65.96	0.111	377.33	28.18
79402	62.49	69.22	0.036	42.24	54.66	0.111	237.05	27.80
79411	81.59	67.91	0.000	66.14	69.85	0.222	231.21	28.82
79625	218.44	136.24	0.000	189.30	141.24	0.222	1792.59	46.21	CopyNumber	20q13.33	3419
80545	2167.23	88.80	0.000	3675.93	53.49	0.000	8897.81	33.60
80919	132.20	76.35	0.036	67.97	78.25	0.111	313.08	32.42
80986	223.23	120.32	0.000	219.34	96.44	0.000	231.11	44.42	CopyNumber	17q21.32	3034
81328	367.44	217.63	0.036	729.78	176.26	0.000	845.91	66.53
81424	338.47	60.84	0.000	178.67	63.11	0.222	343.25	25.72
81848	102.70	71.54	0.071	108.12	78.45	0.222	261.11	47.46
81964	56.08	75.88	0.071	37.25	88.70	0.222	173.27	38.81
82201	77.63	64.48	0.071	52.80	63.18	0.222	227.05	31.28
82327	47.74	80.48	0.000	34.79	79.12	0.222	199.40	38.88	CopyNumber	20q11.22	3365
82719	40.25	66.25	0.071	23.77	44.79	0.111	85.74	30.33
82793	168.49	128.02	0.036	83.47	68.72	0.222	611.12	45.54
82887	36.52	77.92	0.071	29.21	62.08	0.222	470.22	22.27
82890	176.07	66.89	0.000	89.92	89.16	0.111	541.67	28.47
82916	155.89	94.85	0.000	244.03	94.29	0.000	218.30	42.67
82927	62.69	105.59	0.036	43.00	75.49	0.222	123.23	36.72
83190	249.20	182.78	0.036	211.86	121.95	0.222	263.79	128.00
83347	75.73	69.02	0.036	71.54	56.24	0.000	154.79	25.38
83383	62.85	84.31	0.036	68.79	80.95	0.111	617.70	83.89
83734	65.02	69.26	0.071	53.32	60.39	0.000	140.82	29.73	CopyNumber	16p11.2	2905
83753	206.87	88.26	0.000	302.30	80.76	0.111	314.59	48.19	CopyNumber	20p13	3302
83765	60.49	85.58	0.071	65.48	111.40	0.222	99.10	47.99	CopyNumber	5q14.1	1155
83916	146.78	87.67	0.000	53.16	106.27	0.222	192.48	51.98
84359	153.83	91.88	0.000	190.01	97.99	0.111	1358.12	25.26
84753	142.25	105.87	0.036	215.33	92.76	0.222	92.58	76.88
85155	254.51	135.45	0.000	398.59	101.28	0.111	463.10	46.79
85769	54.58	68.76	0.036	46.70	56.56	0.111	203.84	26.22
85962	49.58	84.29	0.071	75.97	60.72	0.222	14.60	66.14
86131	69.23	79.74	0.036	38.81	70.54	0.222	91.70	50.98
87752	181.99	96.06	0.000	186.51	80.13	0.111	86.54	36.98
89545	224.28	67.58	0.000	183.77	60.61	0.111	631.69	33.52	CopyNumber	1q21.2-	152
89643	201.22	142.36	0.000	365.70	117.06	0.111	120.47	36.69
89649	128.11	104.25	0.000	82.36	107.95	0.111	606.74	180.62
89781	117.56	68.82	0.000	113.28	69.11	0.111	494.30	21.89	CopyNumber	17q21.31	3026
89864	46.22	114.71	0.071	29.48	76.43	0.222	163.77	23.54	CopyNumber	6p21.32	1314
90061	99.80	83.92	0.036	91.42	74.05	0.222	651.40	42.91
90093	62.89	92.05	0.036	105.16	101.89	0.222	155.51	38.77
90107	107.95	77.30	0.000	83.77	71.73	0.111	271.86	37.65	CopyNumber	20q13.33	3417
90443	151.21	101.63	0.000	70.31	56.02	0.222	263.10	39.12	CopyNumber	11q13.2	2278
91142	191.59	77.58	0.000	202.64	43.73	0.000	163.39	35.82
91531	48.01	96.12	0.071	80.15	95.45	0.111	637.99	34.78
93659	119.28	83.46	0.000	155.28	76.20	0.111	167.42	46.25
93832	138.95	74.43	0.000	74.64	79.56	0.222	186.80	32.78
95577	70.34	87.03	0.071	71.04	85.81	0.222	371.35	99.75
96530	44.09	62.70	0.000	32.79	68.25	0.222	65.51	38.27	CopyNumber	17q22	3042
96852	49.12	64.09	0.071	35.77	59.97	0.111	461.69	19.35
96996	175.06	71.81	0.000	189.55	52.96	0.000	218.21	29.32
97616	109.70	65.77	0.036	108.39	65.74	0.222	102.19	51.76	CopyNumber	19p13.3	3206
97887	128.29	68.13	0.000	92.61	67.37	0.222	239.81	49.52	CopyNumber	11p13	2237
98751	79.69	70.96	0.036	59.19	66.83	0.222	66.72	38.38
98791	46.33	67.83	0.036	28.93	101.87	0.222	224.90	22.28	CopyNumber	2q11.2	379
102696	89.54	79.18	0.000	92.68	80.38	0.111	211.23	39.36
102798	117.56	87.39	0.000	110.04	53.06	0.111	793.97	25.38
103561	125.24	85.04	0.036	55.08	51.00	0.111	262.35	26.56	CopyNumber	12q24.31	2517
103834	88.84	80.57	0.036	64.54	76.68	0.222	293.02	59.69
104839	326.45	100.99	0.000	225.26	136.95	0.222	87.68	65.32
105547	240.66	81.74	0.000	160.68	82.23	0.111	143.20	86.05	CopyNumber	9q34.3	2030
106185	94.40	89.36	0.036	64.50	91.88	0.000	183.56	43.28
106876	90.28	63.88	0.000	56.12	75.64	0.222	138.98	35.36
106909	82.82	79.27	0.036	39.60	58.13	0.222	516.81	27.82
107003	2470.25	124.40	0.000	813.78	84.52	0.000	197.77	54.64
107101	102.36	89.68	0.000	175.98	78.98	0.111	268.93	27.15	CopyNumber	1p36.33	4
107387	85.47	70.31	0.000	76.67	74.85	0.000	253.94	39.88
107393	55.41	83.93	0.036	59.30	71.63	0.222	267.59	45.01
108029	173.06	93.33	0.000	169.75	68.54	0.000	579.34	50.79
108080	326.55	130.54	0.000	212.70	124.15	0.111	825.21	73.65
108371	64.69	71.05	0.036	43.89	82.98	0.222	479.16	32.37
108408	115.29	68.23	0.036	119.79	74.72	0.111	307.87	34.75
108957	197.20	105.42	0.000	125.72	97.21	0.000	1244.98	34.19
108969	145.21	69.16	0.000	54.94	59.23	0.111	484.04	31.51
109051	158.45	126.66	0.036	115.04	127.27	0.222	405.39	56.02
109052	191.48	93.26	0.000	149.09	47.63	0.111	1050.08	33.47	CopyNumber	14q32.33	2746
109672	67.37	98.84	0.036	29.04	57.79	0.111	108.91	98.07
109798	94.17	88.57	0.036	97.36	91.62	0.111	559.23	64.63
110695	280.95	89.57	0.000	421.58	103.23	0.000	476.37	28.95
110849	78.88	75.22	0.000	67.73	71.02	0.000	181.15	45.21
111286	53.04	105.86	0.071	18.21	107.86	0.222	110.28	32.60
111577	172.80	146.37	0.071	118.94	80.20	0.111	415.46	141.25
111801	50.72	62.24	0.036	45.24	48.41	0.111	283.10	26.11	CopyNumber	7q22.1	1600
112058	75.36	86.73	0.000	80.73	66.67	0.111	82.86	34.43
112318	376.30	59.33	0.036	328.41	54.43	0.000			CopyNumber	7p15.3	1519
112955	63.30	83.18	0.000	68.65	74.54	0.222	175.05	32.35
114033	55.66	66.61	0.071	46.31	51.12	0.111	208.35	29.63
114286	227.35	105.50	0.000	160.45	104.16	0.111	138.02	46.31
114412	120.38	69.57	0.000	89.73	60.94	0.000	565.48	23.70
115474	40.56	68.64	0.000	26.75	40.02	0.222	38.04	51.64
115792	51.01	86.72	0.000	64.83	84.38	0.111	84.30	30.92	CopyNumber	3p21.31	574
116448	38.83	76.33	0.071	42.71	91.17	0.111	92.28	52.71
117176	277.14	57.12	0.000	213.98	51.77	0.000	546.64	24.11
117715	68.40	73.13	0.036	39.78	89.12	0.222	139.79	48.24	CopyNumber	11p15.4	2212
118110	177.54	135.94	0.000	197.86	123.23	0.111	289.38	139.96
118400	277.47	143.18	0.036	396.12	82.68	0.222	45.89	81.52	CopyNumber	7p22.1	1487
118463	139.17	114.64	0.036	277.75	88.48	0.000	489.97	35.21	CopyNumber	11p15.5	2200
118638	202.48	91.73	0.000	150.66	112.93	0.111	502.98	55.85
118722	65.86	70.58	0.071	36.51	53.51	0.222	115.71	60.62
118964	40.82	81.48	0.071	54.63	51.42	0.111	180.13	35.29
118983	147.97	116.33	0.000	216.74	115.85	0.000	112.11	59.33
119177	139.61	54.58	0.000	89.84	57.06	0.222	287.10	32.29	CopyNumber	12q13.12	2421
119192	221.14	136.52	0.071	366.01	79.98	0.111	746.04	45.80
119251	152.44	77.27	0.000	105.57	82.18	0.000	510.26	60.79
119591	121.28	132.87	0.000	85.25	60.89	0.111	277.18	26.93	CopyNumber	19q13.32	3268
119598	1976.38	65.34	0.000	1828.88	55.92	0.000	5605.82	37.33
120323	119.93	72.42	0.000	82.14	75.76	0.222	139.72	33.20
121088	76.28	71.71	0.036	49.78	72.44	0.111	167.42	38.93	CopyNumber	6p22.3	1297
121549	115.81	59.29	0.036	72.38	43.55	0.111	348.76	34.62
122363	78.30	70.90	0.071	47.10	52.74	0.222	69.77	30.93
122523	106.76	74.89	0.000	118.63	57.28	0.000	262.80	35.66
124126	122.85	115.07	0.000	66.49	67.09	0.111	404.01	47.98	CopyNumber	7q22.1	1597
124147	52.87	80.00	0.036	49.60	67.28	0.111	88.88	40.69
124246	76.17	73.44	0.000	67.23	50.90	0.222	78.00	25.49
124366	56.68	64.80	0.036	31.83	72.36	0.222	296.88	27.96	CopyNumber	3q13.12	644
125113	136.62	208.71	0.000	207.39	70.50	0.000	130.39	26.17
125867	196.70	149.28	0.071	249.31	163.63	0.000	127.51	42.41
125898	471.82	68.47	0.000	463.77	95.22	0.000	3114.95	38.76
126497	126.95	92.86	0.071	174.55	58.17	0.000	240.18	42.08
126774	58.18	85.40	0.071	39.13	64.55	0.222	142.39	51.09
126938	106.30	74.59	0.036	93.26	77.82	0.111	106.86	32.06	CopyNumber	19q13.32	3269
127092	51.60	112.32	0.071	30.80	75.39	0.222	57.16	37.84	CopyNumber	16q22.3	2939
127249	125.84	54.54	0.000	80.21	58.63	0.111	216.47	28.77	CopyNumber	17q21.32	3034
127386	343.27	80.59	0.000	307.40	63.02	0.111
127764	245.24	63.23	0.036	156.09	58.22	0.000
128065	76.06	98.69	0.071	111.69	94.46	0.222	59.95	51.61
128199	90.00	77.43	0.000	73.49	95.92	0.222	302.61	35.57
128548	103.72	78.55	0.000	160.67	43.75	0.111	510.95	31.27	CopyNumber	4p16.1	773
129634	34.81	74.38	0.071	38.63	51.13	0.222	58.68	27.28
129673	380.49	76.37	0.000	374.81	65.02	0.111	2050.10	29.97
130031	334.92	141.77	0.036	61.66	100.82	0.111	124.88	40.58
130098	50.98	68.07	0.036	21.50	58.55	0.222	72.44	30.73
130293	191.28	74.37	0.036	143.21	63.05	0.111	394.94	46.49
130413	49.93	62.69	0.036	35.34	73.66	0.111	763.95	36.55
131226	50.95	77.45	0.036	40.35	61.36	0.222	211.50	44.83
132497	103.21	62.00	0.000	89.82	78.68	0.000	67.63	44.78	CopyNumber	1p34.1	66
132513	48.15	64.29	0.036	33.27	58.33	0.222	474.25	37.94	CopyNumber	11p11.2	2252
133892	189.30	129.65	0.000	246.87	96.64	0.111	1107.22	68.63
134074	72.41	100.43	0.071	26.96	119.73	0.222	90.07	25.91
134688	57.48	70.25	0.071	68.24	53.74	0.000	72.44	28.26
135406	51.10	65.02	0.071	70.87	53.64	0.111	258.58	31.26
136905	75.28	88.95	0.071	63.87	56.85	0.111	420.31	25.48
136947	169.57	61.39	0.000	83.24	64.45	0.111	164.27	33.47
137510	47.10	78.32	0.071	33.03	97.57	0.222	338.93	38.22	CopyNumber	12q24.31	2520
138860	92.98	75.60	0.000	63.39	84.41	0.222	104.45	29.18
139896	56.94	65.18	0.000	67.60	55.36	0.111	240.43	26.38
140452	119.07	115.93	0.000	61.69	109.34	0.222	149.10	37.19
142442	72.01	65.85	0.000	96.04	76.63	0.222	900.30	25.31
143187	59.63	74.48	0.000	61.96	104.03	0.111	114.98	39.16
143766	76.29	70.65	0.036	56.38	78.56	0.222	131.85	31.29
143873	675.77	123.17	0.000	265.13	64.14	0.111	1812.20	70.31
144058	45.72	67.40	0.071	30.59	57.17	0.222	91.15	33.46
144468	103.94	77.62	0.000	72.08	68.21	0.000	369.59	42.51	CopyNumber	11p15.5	2200
144835	1929.11	59.90	0.000	1239.80	47.18	0.000	4424.16	35.78	CopyNumber	11q12.3	2268
144868	47.28	61.94	0.036	46.48	65.44	0.222
144941	45.67	99.27	0.036	30.70	62.58	0.222	27.70	47.48
144949	63.37	89.85	0.036	51.55	71.38	0.111	139.69	32.40
144980	60.46	66.37	0.036	31.70	83.79	0.111	78.74	45.38
145049	45.61	79.64	0.036	44.08	75.91	0.222
145442	57.21	67.35	0.071	65.14	62.03	0.111	227.44	39.23
145575	90.10	224.58	0.036	45.18	76.11	0.222	202.49	59.73
146070	175.65	128.18	0.000	178.96	54.77	0.000	93.05	36.84
146393	101.04	72.80	0.000	88.78	95.83	0.111	667.21	52.63
146602	312.78	102.89	0.000	281.39	83.54	0.000	1415.55	49.65
146804	46.25	74.69	0.036	67.23	67.16	0.222	54.96	64.90
146806	69.33	65.76	0.036	76.43	55.00	0.111	156.47	27.78
147433	92.79	173.87	0.036	100.81	101.76	0.111	185.23	55.89
148078	81.01	68.19	0.000	44.30	49.13	0.222	259.39	36.71
148272	76.34	78.08	0.000	40.88	58.49	0.222	282.89	43.22
148330	153.40	68.24	0.000	195.74	61.44	0.111	882.12	30.42
148340	252.27	57.95	0.000	129.05	74.68	0.111	97.73	64.77	CopyNumber	3p14.2	601
148670	47.31	89.45	0.036	35.45	93.34	0.222	56.01	87.59
149004	71.24	102.91	0.036	30.71	66.15	0.222			CopyNumber	16q24.2	2967
149957	62.80	81.12	0.071	47.00	76.13	0.222	125.85	48.66
149983	43.40	68.84	0.071	42.84	78.77	0.222	75.44	36.59	CopyNumber	1p36.22	27
150107	78.67	116.09	0.071	20.91	61.58	0.222	573.50	21.98	CopyNumber	2p22.3	302
150540	53.76	90.93	0.036	48.36	86.76	0.000	183.75	29.74
150580	865.15	80.15	0.000	1108.77	70.34	0.000	3122.23	30.91	CopyNumber	17q21.2	3022
150837	99.46	124.23	0.036	86.20	120.91	0.222	778.59	48.51
151134	62.00	57.73	0.071	45.75	78.70	0.222	289.38	30.06
151220	113.44	73.17	0.036	66.67	96.14	0.222	744.16	63.01	CopyNumber	4q32.3	1031
151413	113.32	80.50	0.000	79.73	76.85	0.000	300.73	30.47
151787	105.28	65.45	0.036	107.49	74.56	0.111	592.77	39.14
152536	75.62	151.78	0.036	64.94	62.87	0.111	437.32	51.09
153177	1095.00	82.65	0.000	1290.76	62.05	0.000
154023	51.92	69.11	0.071	35.70	66.65	0.111	83.15	28.46	CopyNumber	9q31.1	1976
154073	52.53	75.96	0.036	33.22	53.61	0.222	218.58	39.39
155165	64.84	68.65	0.036	52.72	66.13	0.111	79.58	31.11
155218	175.01	57.46	0.000	200.28	53.39	0.000	216.50	35.53
155396	76.81	76.82	0.071	67.48	97.34	0.222	405.26	42.07
155829	61.75	66.32	0.000	59.97	79.36	0.000	238.12	23.08
156171	72.51	68.16	0.000	68.13	52.36	0.222	147.78	34.78
156367	2469.70	87.67	0.000	1712.42	68.63	0.000	4735.69	38.82
156667	48.15	92.93	0.036	26.62	69.37	0.222	239.39	35.65
157160	94.71	92.71	0.071	89.61	69.92	0.000	100.13	36.59	CopyNumber	16p13.3	2866
157351	86.88	66.51	0.036	91.00	77.95	0.000	484.52	37.70
157379	196.03	88.98	0.000	245.35	78.54	0.000
157394	58.25	115.85	0.036	40.70	64.13	0.111	128.63	71.71	CopyNumber	16p13.3	2866
159014	87.15	63.78	0.036	89.22	60.16	0.111	163.73	32.17
159118	87.60	93.76	0.000	80.22	75.94	0.222	173.36	116.76
159130	75.30	70.14	0.036	83.65	78.95	0.000	257.93	22.84
159161	124.37	97.10	0.000	133.32	61.43	0.000	599.74	28.29	CopyNumber	17q25.3	3087
159699	78.43	69.52	0.000	37.41	64.94	0.111	210.99	69.05	CopyNumber	12q24.22	2509
159799	57.41	64.26	0.036	34.74	59.78	0.111	91.07	36.21	CopyNumber	12q24.21	2506
160958	93.25	79.14	0.000	114.90	52.77	0.222	127.25	40.40
161357	57.45	64.76	0.000	46.29	76.91	0.000	147.60	39.89
162032	76.14	67.26	0.036	70.53	79.73	0.000	255.04	27.58
162233	209.93	74.14	0.000	90.72	65.27	0.000	179.64	29.18
162877	88.79	69.59	0.036	50.56	52.07	0.000	521.49	49.22
163645	59.81	76.60	0.071	24.93	67.74	0.111	84.40	61.57
163776	47.01	71.14	0.071	37.56	78.72	0.111	528.53	41.20
163893	98.35	57.76	0.000	58.05	59.53	0.000	271.42	33.87
165195	115.35	65.00	0.036	108.29	54.09	0.222	943.91	27.36
166011	75.94	93.62	0.000	49.61	56.41	0.222	312.99	31.66
166204	43.53	68.68	0.071	31.97	87.75	0.000	320.35	36.72
166463	185.87	56.02	0.000	192.95	59.71	0.000	787.81	25.31
166924	99.75	72.91	0.036	55.96	77.29	0.111	350.25	27.79
166975	153.47	84.13	0.000	175.23	59.39	0.111	567.33	40.53
167535	43.01	67.25	0.071	31.16	78.48	0.222	189.62	34.78	CopyNumber	14q13.2	2665
168073	95.49	57.46	0.000	79.97	43.40	0.000	97.12	34.22	CopyNumber	20q11.22	3365
168799	71.62	72.15	0.000	85.51	85.35	0.111	127.53	38.40	CopyNumber	14q11.2	2643
169611	41.81	69.54	0.071	37.43	50.49	0.222	285.98	24.97
169718	133.00	96.71	0.000	139.45	63.02	0.222	232.68	35.86	CopyNumber	19p13.3	3198
170107	76.06	87.41	0.071	47.18	78.34	0.222	1036.03	59.06
170131	73.22	67.79	0.036	50.82	86.27	0.111	99.84	47.80	CopyNumber	19p13.3	3203
170553	62.09	58.81	0.071	60.80	61.32	0.222	725.07	33.82
170622	1717.53	78.58	0.000	2283.14	56.69	0.000	9908.08	42.82	CopyNumber	11q13.1	2276
171626	403.46	63.32	0.000	241.54	57.86	0.000	1649.53	25.79
172550	138.65	105.11	0.000	212.10	66.20	0.111	549.43	25.49
172755	90.49	131.11	0.036	69.54	193.88	0.111	31.12	77.04
172928	1790.49	223.12	0.000	3277.02	184.20	0.222	23.83	59.75
173024	49.89	72.45	0.000	18.77	58.78	0.222	607.15	31.58
173162	48.81	77.43	0.071	64.12	75.11	0.111	116.53	36.61
173381	337.96	129.69	0.036	196.90	150.06	0.222	416.10	84.50
173464	241.30	130.72	0.000	144.94	86.56	0.000	106.78	43.86
173611	103.79	74.38	0.036	72.63	73.41	0.222	450.20	37.71
173705	105.45	71.42	0.036	77.12	54.80	0.111	1003.69	44.66
173724	500.02	129.37	0.000	480.96	98.37	0.111	328.75	117.68
174050	295.84	81.34	0.000	161.44	58.99	0.111	435.08	32.67	CopyNumber	9q34.3	2030
174195	123.33	121.69	0.000	59.79	61.62	0.222	1541.94	54.35
175473	154.31	178.89	0.000	74.84	74.19	0.111	39.59	55.77
175955	51.24	78.53	0.071	82.37	63.20	0.000	407.41	30.39	CopyNumber	4q13.2	868
										4q13.3-4q13.2
177530	738.25	105.78	0.000	370.63	61.86	0.000	1399.62	34.95
177766	88.33	110.71	0.036	85.86	98.28	0.222	258.95	47.27
178551	951.00	80.06	0.000	709.53	80.15	0.000	4043.69	42.24
178728	150.69	82.99	0.000	68.39	77.86	0.222	178.39	24.90
179986	173.68	66.32	0.000	162.17	96.06	0.000	650.73	31.17	CopyNumber	6p21.33	1312
180141	58.91	117.29	0.036	32.50	84.00	0.222	371.27	77.91
180312	43.03	89.37	0.036	55.94	83.19	0.222	153.55	46.39
180414	543.94	84.33	0.000	849.88	48.98	0.000	1613.00	26.72
180877	322.18	77.30	0.000	324.36	71.18	0.000	1202.80	34.96
180903	66.01	87.91	0.000	76.16	118.67	0.111	44.42	26.29	CopyNumber	22q13.33	3520
180909	346.95	80.07	0.000	371.75	106.26	0.000	1474.92	40.32
180933	51.48	80.42	0.071	73.33	92.53	0.111	346.11	27.13
181046	74.49	71.47	0.000	52.77	69.61	0.111	76.22	39.96
181112	52.19	67.48	0.000	56.45	51.99	0.111	58.24	39.41	CopyNumber	13q14.2	2567
181163	504.02	101.97	0.036	209.51	59.97	0.000	1671.22	28.67
181244	945.29	84.91	0.000	615.31	92.95	0.000			CopyNumber	6p21.33	1311
181368	57.52	73.25	0.036	72.19	59.47	0.222	877.69	37.35
181444	99.45	77.92	0.000	93.53	65.83	0.111	428.12	41.92
182255	216.97	70.26	0.000	258.19	78.53	0.000	575.25	28.65
182626	85.24	59.53	0.036	77.65	60.50	0.111	114.59	33.95
182885	71.21	72.14	0.071	79.54	72.22	0.111	658.87	31.09
183684	244.19	66.42	0.000	167.12	47.95	0.000	1226.24	19.58
183706	124.62	87.65	0.000	71.68	63.07	0.111	129.53	32.44
183800	82.36	73.34	0.000	88.07	68.82	0.111	79.80	39.64	CopyNumber	22q13.2	3503
183850	50.00	63.02	0.071	42.45	54.66	0.222	201.07	30.38
183994	122.79	111.25	0.036	107.82	63.33	0.222	314.08	45.04
184062	106.44	80.16	0.000	108.22	79.79	0.111	885.45	50.28
184211	44.05	68.32	0.071	35.11	53.79	0.222	316.88	34.51
184233	155.04	67.24	0.000	149.88	69.13	0.111	465.50	38.54
184492	61.10	63.40	0.071	46.02	72.84	0.222	397.55	26.36	CopyNumber	19p13.2	3210
185172	146.97	91.53	0.000	246.66	86.19	0.000	344.82	34.87	CopyNumber	7q22.1	1600
185597	85.24	59.04	0.000	83.15	71.88	0.111	139.56	35.15	CopyNumber	16q24.3	2972
187199	982.17	115.54	0.000	303.70	76.68	0.000
187635	584.60	101.59	0.000	380.46	78.22	0.000	28.66	51.48	CopyNumber	16p12.3	2889
187763	92.81	66.27	0.000	76.79	54.16	0.222	500.24	26.46
187866	127.00	73.60	0.000	111.79	64.50	0.111	680.00	34.53
187946	79.95	84.06	0.000	104.34	48.89	0.222	200.66	75.07
188501	75.71	67.55	0.000	55.47	53.26	0.222	45.76	34.94
188614	53.09	65.47	0.071	44.10	82.41	0.222	84.46	53.64	CopyNumber	12p12.3	2387
188879	79.10	68.81	0.071	103.91	56.06	0.111	141.32	40.35
188882	41.12	62.39	0.036	30.53	64.74	0.222	163.76	30.89
189075	103.18	84.72	0.000	48.42	71.25	0.222	232.97	38.78
189119	191.46	95.87	0.000	83.56	64.37	0.222	64.39	50.46
189329	46.81	60.19	0.071	28.86	71.76	0.222	86.40	35.87
189716	59.73	84.20	0.000	79.20	72.95	0.111	798.87	31.92
189772	124.53	112.18	0.071	233.62	107.40	0.222	546.84	44.02
190028	87.26	96.99	0.036	64.26	55.28	0.222	715.65	50.89
190086	204.74	108.77	0.000	238.35	55.47	0.111	312.07	29.80
190334	49.76	64.40	0.000	45.95	69.08	0.222	275.10	42.89
190384	59.12	61.06	0.036	49.81	60.07	0.111	232.13	26.89
190722	75.54	69.16	0.000	105.73	67.89	0.000	144.16	53.90
190904	74.69	86.92	0.036	32.05	61.63	0.222	95.24	30.61	CopyNumber	19q13.32	3268
191186	43.91	70.71	0.071	39.12	55.01	0.222	614.82	24.31
191346	196.34	80.55	0.000	98.52	86.95	0.111	757.36	36.32	CopyNumber	7p14.2	1530
191518	61.56	87.09	0.071	92.92	81.35	0.222	176.63	30.67
191987	35.20	71.55	0.071	50.78	45.94	0.222	307.98	24.32	CopyNumber	1p36.33	2
192316	83.41	65.32	0.036	43.60	69.01	0.222	176.27	33.07	CopyNumber	1p36.33	3
192374	487.07	78.84	0.000	407.58	81.92	0.000	1068.05	35.28
192425	382.10	76.85	0.000	311.90	64.60	0.000			InversionBreak	16p11.2	2900
									point
									InversionBreak
									point
									CopyNumber
193118	103.91	62.88	0.036	41.98	71.16	0.000	331.29	46.59	CopyNumber	10q22.3	2141
193163	86.88	145.45	0.000	64.92	125.23	0.222	62.71	48.89	CopyNumber	2q14.3	408
193491	85.60	92.35	0.000	115.38	71.01	0.111	286.47	58.62	CopyNumber	18p11.21	3105
194329	98.50	73.07	0.000	93.43	82.64	0.000	315.47	84.07
194718	60.86	66.93	0.071	50.97	67.72	0.111	497.18	30.12
195464	45.29	98.64	0.036	248.43	76.79	0.000	442.92	71.56	Inversion	Xq28	3630
195642	49.42	78.70	0.071	39.60	101.58	0.222	88.25	56.73
196983	41.49	83.49	0.071	33.94	63.95	0.222	186.36	59.61
198281	562.77	108.54	0.000	400.81	102.64	0.111	57.29	51.53
199561	78.36	68.25	0.036	72.08	76.53	0.000	89.48	31.20
199625	231.23	89.82	0.000	222.28	87.19	0.111	383.94	32.48
200063	66.57	131.93	0.071	68.93	74.04	0.111	65.10	51.46
200600	82.26	81.79	0.036	59.63	66.67	0.222	239.47	30.41	CopyNumber	1q22	160
200804	100.60	109.85	0.000	135.85	90.16	0.000	879.77	36.77	CopyNumber	8q12.1	1762
201253	51.67	75.54	0.071	53.03	72.88	0.111	150.04	34.96
201390	66.73	61.96	0.036	64.00	58.40	0.111	410.22	35.22
201712	62.32	78.85	0.036	29.07	57.59	0.222	96.84	37.35	CopyNumber	16q22.3	2941
202011	152.06	64.61	0.000	88.75	53.56	0.111	189.04	35.21
202085	154.71	70.60	0.000	180.75	62.87	0.000
202166	183.12	57.15	0.000	166.73	45.76	0.111	1023.72	33.49	Inversion	5q35.3	1270
									CopyNumber
202179	77.19	59.85	0.000	59.18	64.11	0.222	53.16	43.92	CopyNumber	5q13.2	1143
203099	56.63	55.11	0.036	50.48	63.52	0.222	113.15	27.96
203910	124.15	83.11	0.000	151.92	125.87	0.000	46.20	51.50
204041	131.33	74.62	0.036	106.38	86.68	0.111	254.62	59.64
204773	65.95	71.71	0.000	60.94	64.50	0.000	135.31	39.98
205163	129.59	62.46	0.000	151.99	70.71	0.000	517.07	39.92	CopyNumber	3q22.1	670
206500	85.71	81.07	0.036	62.30	49.78	0.222
206824	218.52	89.50	0.000	195.81	83.44	0.111	2218.86	36.90
208597	213.99	62.01	0.000	112.96	50.60	0.000	481.51	24.72
209983	198.15	132.48	0.071	257.96	130.11	0.222	101.23	38.96
210469	57.31	70.29	0.036	21.05	72.93	0.222	64.90	43.40
210532	62.91	74.09	0.071	82.09	84.33	0.111	61.52	28.17
211463	81.50	73.34	0.000	101.29	69.16	0.222	98.91	38.82	CopyNumber	19p13.2	3217
211594	67.56	102.99	0.071	73.05	66.89	0.111	104.24	46.28	CopyNumber	19q13.2	3258
211914	86.83	107.07	0.036	59.20	53.55	0.111	128.87	42.11	CopyNumber	19p13.3	3198
212102	160.42	78.06	0.000	138.13	60.95	0.111	393.98	37.87
212395	50.78	62.26	0.071	31.35	67.76	0.222	59.26	42.89
213061	231.69	98.05	0.000	327.00	72.73	0.000	1227.71	41.68
213470	222.67	67.83	0.000	192.87	68.35	0.111	410.41	31.28
213541	67.95	84.63	0.036	85.44	89.94	0.000	429.86	31.21
213666	68.88	61.77	0.036	27.18	63.86	0.222	107.77	28.26
213724	52.16	81.67	0.071	54.83	74.71	0.111	278.03	30.19
216653	50.09	74.68	0.071	33.21	71.69	0.222	343.12	32.18
220950	91.70	71.10	0.071	83.15	93.30	0.000	1027.22	35.80
221847	281.04	107.96	0.000	214.24	135.53	0.111	687.16	51.69
222510	67.85	93.05	0.071	88.95	63.95	0.222	113.62	30.43	CopyNumber	19p13.3	3198
223141	103.03	99.93	0.036	131.95	62.74	0.111	1035.61	39.53
224607	119.67	152.50	0.036	87.86	158.09	0.222	137.21	45.23
226007	92.30	164.81	0.071	47.81	52.32	0.222	40.09	36.30
226117	127.49	83.46	0.000	65.79	116.54	0.111	371.84	56.86	CopyNumber	22q13.1	3496
226755	191.85	93.25	0.000	194.51	65.63	0.111	278.34	38.95
227067	57.56	67.54	0.071	33.57	86.75	0.222	231.33	33.85	CopyNumber	1p36.33	3
227253	87.82	81.31	0.036	55.73	71.93	0.111	101.17	28.59
227777	131.83	72.56	0.000	81.21	76.44	0.111	415.86	66.71
229641	147.72	64.35	0.000	118.72	79.68	0.000	809.47	34.84	CopyNumber	5p13.3	1105
231295	63.03	68.62	0.071	21.81	62.84	0.222	87.17	37.84	CopyNumber	17q24.2	3061
231616	102.58	83.55	0.036	105.55	56.13	0.000	385.33	37.02	CopyNumber	19p13.13-19p13.12	3221
232194	84.98	64.71	0.000	51.79	57.10	0.111	405.35	23.20
232543	189.22	132.95	0.036	98.19	105.59	0.222	74.17	72.02
233458	89.24	89.76	0.000	44.01	49.80	0.000	127.26	26.28
233552	29.61	59.88	0.071	23.54	97.43	0.222	130.13	32.17	CopyNumber	7p14.1	1535
233952	431.24	90.17	0.000	319.55	67.24	0.000	101.92	36.48
234521	59.41	91.19	0.071	81.43	91.57	0.222	69.82	35.53
236030	34.66	71.56	0.036	23.36	61.13	0.222	83.17	36.95	CopyNumber	12q13.2	2429
237536	95.40	90.09	0.036	49.15	76.51	0.111	483.90	44.44
237971	58.94	91.89	0.036	78.94	95.20	0.222	246.47	64.85
238839	144.41	67.07	0.000	145.01	65.51	0.000	190.91	36.76
240170	96.25	87.00	0.000	118.73	122.83	0.222	37.21	46.26	CopyNumber	12q13.2	2429
241336	224.03	61.07	0.000	155.72	77.04	0.111	721.67	34.47
241543	66.91	76.34	0.000	45.73	60.57	0.222	203.39	33.10
241558	65.16	64.15	0.000	47.89	63.03	0.222	122.71	28.63
241575	73.29	70.86	0.000	45.40	74.01	0.222	432.03	30.80	CopyNumber	16p13.3	2866
241576	72.57	71.75	0.000	35.61	63.06	0.222	626.29	37.40
241579	198.12	107.31	0.000	207.46	85.28	0.222
242458	76.41	57.83	0.036	73.30	49.12	0.000	415.64	29.35
242947	4086.25	58.36	0.000	3864.18	41.07	0.000	13.84	72.12
246112	160.68	67.73	0.000	136.82	57.97	0.111	1178.68	27.77	CopyNumber	2q11.2	378
246310	232.33	76.17	0.000	145.70	64.99	0.111	618.59	39.03
246413	93.63	81.25	0.036	112.38	61.72	0.111	183.60	54.30
246781	48.14	62.94	0.071	41.90	55.75	0.222	10.39	88.93
247077	545.41	67.52	0.000	567.58	47.87	0.000	1471.14	26.19	CopyNumber	3p21.31	583
247186	70.03	64.96	0.000	37.62	80.54	0.222	77.06	31.82	CopyNumber	16p11.2	2904
247975	238.18	105.68	0.000	438.14	91.84	0.000	104.18	46.50
248267	80.10	96.06	0.036	85.59	77.62	0.000	267.18	59.58
248941	54.96	61.08	0.036	51.35	63.24	0.222	221.26	33.54	CopyNumber	5q13.2	1143
249600	98.90	70.96	0.071	67.36	81.11	0.222	73.53	34.15
250009	134.21	61.55	0.000	59.19	55.14	0.111	418.28	26.81
250429	44.11	69.07	0.071	30.41	44.58	0.222	130.29	29.98
250758	111.57	61.91	0.000	91.07	70.47	0.222	135.51	35.81
250899	141.99	79.57	0.000	193.37	90.68	0.000	526.51	34.77
250905	77.54	66.32	0.000	77.23	58.42	0.111	1248.73	26.47
251531	172.42	101.66	0.000	119.04	61.83	0.222	359.88	30.37
252457	65.93	76.40	0.000	54.99	74.23	0.000	13.56	94.81	CopyNumber	16q24.2-16q24.3	2970
252713	75.68	72.27	0.071	50.47	59.99	0.111	74.87	50.43
252967	105.98	64.23	0.000	74.53	57.70	0.111	168.08	23.83
253726	118.24	58.02	0.000	89.50	50.88	0.000	451.23	27.68
253903	100.22	101.02	0.071	152.14	104.18	0.222	591.87	57.57
254042	144.69	67.31	0.000	162.34	45.49	0.000	920.76	27.97	CopyNumber	6p21.33	1313
255015	79.90	52.53	0.036	52.05	70.92	0.111	607.92	28.15
255093	167.85	61.27	0.000	87.62	65.22	0.111	184.42	34.31
255932	53.31	75.20	0.071	63.07	84.50	0.111	246.82	28.40
255935	264.18	97.23	0.000	310.78	117.34	0.111	10.29	49.34
255973	174.44	77.67	0.000	121.74	58.40	0.111	88.24	45.36
256301	158.37	143.00	0.036	131.52	125.09	0.111	193.25	117.05
256549	76.00	73.37	0.071	66.78	109.62	0.111	72.47	43.74	CopyNumber	16p13.3	2866
257008	203.69	94.53	0.000	239.54	60.00	0.000	206.91	69.09
257341	34.40	80.14	0.071	32.10	94.24	0.222
257761	70.17	74.40	0.071	57.97	89.39	0.222	90.97	44.23
258551	38.05	113.91	0.036	31.42	52.51	0.111	212.75	23.35	CopyNumber	2q35	496
258563	67.33	74.13	0.000	51.06	53.28	0.222	270.95	35.45
258798	366.69	192.40	0.000	100.67	52.60	0.222	109.62	31.17
259461	128.63	79.93	0.036	118.37	49.94	0.000	119.14	28.75
260603	94.30	112.19	0.036	28.87	96.98	0.111	114.76	44.19
262823	118.15	101.47	0.036	35.90	64.77	0.222	268.43	30.93
265829	109.76	134.13	0.036	60.09	147.84	0.222	88.23	82.34
268488	54.76	75.37	0.000	22.47	50.04	0.222	260.69	28.22	CopyNumber	1p36.32	12
268530	107.13	81.96	0.036	168.88	85.78	0.000	106.18	37.76
268742	212.21	79.56	0.000	96.43	68.28	0.111	881.42	37.73
268849	179.31	62.43	0.000	127.97	70.40	0.222	666.34	58.26	CopyNumber	6p21.2	1325
268939	241.08	88.77	0.000	69.60	63.46	0.111	993.14	26.39
269528	110.90	65.55	0.000	77.77	59.98	0.111	321.03	37.48
269577	168.07	52.27	0.036	116.39	58.52	0.000	163.78	33.49	CopyNumber	20p13	3304
269782	52.13	67.13	0.071	73.22	67.37	0.111	139.08	34.10
269944	70.20	60.66	0.000	46.86	64.04	0.222	297.40	32.90	CopyNumber	11p11.2	2254
270291	419.64	83.84	0.000	288.23	52.39	0.000	489.18	51.55
270428	106.33	69.26	0.036	56.42	53.38	0.000	575.82	78.18
270525	57.78	70.97	0.071	49.58	95.80	0.222	482.93	25.81
270869	53.74	61.79	0.036	41.81	83.43	0.222	159.67	24.39
271135	135.97	68.23	0.036	96.12	59.45	0.000	1364.03	36.20
271695	47.43	74.54	0.071	51.23	58.22	0.222	431.22	39.81
272062	119.22	90.33	0.071	134.84	67.71	0.222	403.60	48.89
272168	39.75	70.53	0.071	24.14	85.55	0.222	235.12	31.23
272630	78.13	60.27	0.000	49.35	72.52	0.111	70.37	33.27
272927	52.45	66.36	0.000	55.23	67.21	0.111	132.83	49.23
273077	63.88	75.82	0.071	65.81	74.94	0.111	284.35	38.35
274184	57.28	70.70	0.071	73.81	63.57	0.111	79.41	33.16
274772	82.77	65.96	0.000	78.91	69.49	0.000	341.50	37.35
274873	82.54	81.69	0.000	64.18	62.49	0.111	401.63	28.94
275243	591.93	132.16	0.000	386.53	100.02	0.222	2365.31	75.71
275775	121.63	134.20	0.071	141.95	138.41	0.222	1379.68	60.08
275865	83.52	62.60	0.071	77.19	60.06	0.111	390.18	35.84
276878	65.66	85.73	0.071	75.29	88.57	0.222	41.28	79.67
277035	116.15	117.16	0.000	49.43	96.96	0.111	820.49	57.32	CopyNumber	3q21.3	667
277517	127.65	74.29	0.000	43.19	64.65	0.222	340.59	48.75
278186	73.95	85.24	0.071	64.92	117.05	0.111	125.86	38.10
278362	98.75	66.62	0.000	67.90	71.94	0.000	328.98	38.55
278426	106.94	62.04	0.000	92.55	57.10	0.111	156.41	42.46	CopyNumber	7q22.1	1597
278429	63.78	64.98	0.036	103.18	62.08	0.111	94.29	29.86
278500	80.44	68.19	0.036	75.86	73.54	0.222	106.63	48.00
278569	132.92	82.25	0.000	200.20	102.95	0.222	107.25	51.36
278573	154.72	101.10	0.000	114.44	148.80	0.111	650.32	46.92
278721	71.42	83.27	0.036	71.10	71.24	0.222	72.60	42.44
279061	65.97	67.08	0.036	44.30	63.18	0.222	197.52	31.29	CopyNumber	17p13.3	2975
279245	103.52	76.47	0.000	75.15	85.55	0.111	91.87	45.55
279257	102.09	66.80	0.036	93.74	71.44	0.111	194.76	31.27
279413	75.52	129.76	0.036	110.16	104.82	0.111	47.09	59.50
279529	102.94	81.69	0.036	104.37	66.22	0.222	1363.23	45.45	CopyNumber	5q35.3	1268
279583	146.63	71.86	0.036	199.42	57.52	0.000	103.71	39.63	Inversion	16p12.2-16p12.1	2894
									CopyNumber
279623	47.48	77.55	0.071	41.14	84.94	0.111	251.43	82.76	CopyNumber	16p13.3	2866
279640	69.84	65.23	0.036	40.21	83.36	0.222	301.86	23.97
279652	110.73	91.16	0.000	56.36	73.29	0.222	122.30	52.34
279669	72.06	82.14	0.071	83.17	76.56	0.222	90.40	49.23
279696	127.55	83.17	0.036	102.39	93.03	0.000	431.21	44.69
279806	856.99	69.81	0.000	647.74	79.09	0.111	1392.91	24.99
279836	60.58	58.12	0.000	42.38	77.37	0.222	109.90	38.28	CopyNumber	11p13-11p12	2245
279920	251.99	78.76	0.000	209.25	54.55	0.111	1143.94	32.04
279929	202.03	81.28	0.000	119.27	50.43	0.111	615.57	32.57
280202	36.29	67.43	0.036	34.06	68.28	0.111
280342	209.46	64.79	0.000	190.05	68.21	0.111	507.64	35.59
280378	68.06	78.00	0.036	59.08	52.49	0.111	324.22	34.79
282410	513.80	75.08	0.000	346.66	83.21	0.000	863.13	37.39
282700	59.54	59.59	0.071	89.12	64.76	0.111	474.36	29.57
282901	181.79	61.28	0.000	161.17	55.92	0.111	586.28	30.27
282998	145.15	87.12	0.000	109.61	89.33	0.000	203.95	38.00
283111	73.74	77.12	0.000	54.33	58.77	0.111	148.42	37.10
283454	47.89	55.19	0.071	33.55	62.22	0.111	72.33	42.83
283521	92.73	77.37	0.000	76.39	64.83	0.222	21.40	67.57
283610	49.24	59.73	0.071	45.77	73.57	0.111	113.35	30.58
283652	58.55	77.33	0.036	55.65	73.75	0.222	173.00	38.91
283739	62.49	146.71	0.071	51.69	109.60	0.222	360.93	32.32
284208	46.63	78.08	0.071	29.66	65.71	0.111	301.23	63.92
284279	50.68	69.22	0.000	39.54	69.82	0.222	123.20	36.70
284286	71.40	81.75	0.036	67.66	95.49	0.222	1531.44	35.52	CopyNumber	7p13	1537
284491	787.92	136.63	0.000	305.06	99.27	0.000	226.73	38.91	CopyNumber	21q22.3	3455
285354	64.26	59.95	0.071	60.82	74.39	0.222	168.00	27.87
285976	132.14	94.65	0.000	98.07	53.23	0.111	573.85	77.02
286221	199.12	75.65	0.000	248.30	58.65	0.000	3463.94	35.74
286226	90.05	101.42	0.036	32.24	72.06	0.222	207.01	28.47
288193	59.34	61.78	0.000	45.54	63.87	0.111	349.23	36.00
288856	320.21	87.34	0.071	197.77	57.17	0.000	1020.14	40.67
288969	34.41	73.68	0.071	31.39	60.73	0.222	278.99	36.61
289008	68.14	59.92	0.036	63.72	61.38	0.222	271.56	30.69
289092	167.69	116.11	0.036	289.77	159.61	0.111	458.68	76.94	CopyNumber	16q24.1	2960
289123	89.02	66.03	0.000	78.85	81.68	0.000	272.21	82.53	CopyNumber	12q13.3	2432
289271	242.81	87.86	0.000	314.40	88.75	0.000	394.29	60.90	CopyNumber	8q24.3	1879
290243	632.98	125.85	0.000	761.77	103.49	0.000	101.29	27.98
290404	45.05	75.80	0.071	40.20	86.49	0.111	1710.99	28.57
290758	190.14	67.69	0.000	91.13	56.76	0.222	361.48	36.00	CopyNumber	11q12.2	2266
291587	73.22	59.78	0.000	43.57	53.60	0.111	178.10	32.56
292026	46.59	69.01	0.036	40.56	58.47	0.222	211.07	26.51
292063	148.75	62.83	0.000	145.61	55.21	0.000	49.54	46.81
292078	105.37	78.84	0.036	77.92	77.84	0.111	475.13	31.13
292265	56.47	64.89	0.071	34.72	84.99	0.222	384.26	31.49	CopyNumber	10p15.3	2033
292457	289.85	160.14	0.000	215.82	73.61	0.111	63.85	61.00
292493	318.36	70.67	0.000	424.46	81.44	0.000	831.58	26.17
292524	32.70	67.18	0.071	25.82	53.79	0.222	195.08	27.33
292579	67.07	75.20	0.036	75.85	66.75	0.111	420.33	36.15
293563	65.61	104.96	0.036	137.26	82.64	0.111	165.89	47.95
295917	62.97	77.96	0.036	56.00	89.69	0.222	319.57	47.66
297324	200.02	107.68	0.000	190.59	111.57	0.222	155.47	67.70
298198	95.15	79.37	0.000	97.17	92.03	0.111	293.20	59.13
298280	473.59	86.67	0.000	235.59	89.33	0.111	1546.16	35.33
298654	98.88	101.00	0.071	136.05	94.16	0.111	181.32	68.18
299002	162.19	118.98	0.036	211.61	81.78	0.000	590.01	51.94	CopyNumber	19q13.2	3258
299055	72.16	67.41	0.071	60.49	51.37	0.000	1136.65	27.04
300141	791.80	82.66	0.000	880.44	79.56	0.000
300684	39.78	86.52	0.036	19.56	66.08	0.222	55.18	33.61
300772	294.55	407.50	0.000	144.07	60.22	0.111	11.36	80.27
300816	175.17	68.45	0.000	144.04	91.05	0.222	258.49	31.17
300834	76.65	53.83	0.000	46.55	59.38	0.111
301404	117.20	84.83	0.036	127.77	69.34	0.000	48.88	37.40
301412	155.60	70.03	0.000	161.71	51.02	0.000	573.46	31.44
302742	99.50	97.96	0.036	99.87	126.82	0.222	620.43	57.69	CopyNumber	21q22.11	3448
302903	95.85	73.32	0.036	155.07	64.76	0.111	503.88	36.57	CopyNumber	16p13.3	2866
303676	98.85	78.57	0.036	106.32	83.93	0.222	263.04	37.05
304192	79.90	89.25	0.071	87.57	78.41	0.111	1681.62	40.81
304682	802.25	146.41	0.000	586.08	115.24	0.000	1233.74	48.30
306123	64.12	69.15	0.071	59.10	53.26	0.222	125.75	44.20
306242	66.12	71.12	0.000	48.63	99.39	0.222	136.24	37.00
306329	111.07	62.26	0.000	60.88	78.67	0.222	316.67	32.67
306425	71.02	73.63	0.000	34.17	79.05	0.000	84.65	38.45	CopyNumber	6q14.1	1383
308122	53.88	77.12	0.036	78.26	58.86	0.111	226.98	30.91	CopyNumber	14q32.12	2733
308340	50.55	93.90	0.071	39.81	69.75	0.222	83.71	47.24
308709	175.08	105.53	0.000	111.91	66.83	0.000	310.05	37.58	CopyNumber	15q15.3	2771
309090	104.22	85.59	0.071	177.79	69.74	0.111	45.16	35.63
309231	66.08	80.54	0.036	63.95	73.06	0.111	580.07	23.13
309641	187.15	75.27	0.000	99.07	83.98	0.000	264.53	42.66
309753	95.69	69.18	0.000	71.16	72.16	0.111	742.22	44.20	CopyNumber	7p14.1	1534
309849	43.93	73.60	0.071	28.98	68.38	0.222	94.62	48.92
310542	50.95	92.37	0.071	77.69	87.64	0.222	156.90	38.84
310645	104.46	69.28	0.036	100.90	54.85	0.000	1125.09	21.18
311072	40.18	86.83	0.036	27.73	57.37	0.222	367.02	38.90
311346	48.58	67.53	0.036	44.51	86.22	0.111	53.25	44.95	CopyNumber	12p12.1	2391
311609	102.82	70.74	0.000	104.20	81.30	0.000	237.18	48.06	CopyNumber	19p13.12	3223
311640	830.70	106.83	0.000	510.33	73.34	0.000	93.77	42.99
312098	77.56	97.67	0.071	80.93	101.94	0.111	35.13	77.49
313847	35.55	55.80	0.036	26.60	71.34	0.222	299.35	40.72
314263	70.15	68.60	0.071	103.11	55.03	0.000	89.94	34.68	CopyNumber	12q13.3	2430
314359	350.37	69.38	0.000	355.31	42.03	0.000	154.82	30.01
315177	58.92	90.19	0.000	79.21	90.27	0.000	225.39	34.43	CopyNumber	3p21.31	586
315230	160.77	75.35	0.000	128.92	93.04	0.222	276.19	37.74
319334	131.55	88.71	0.036	167.66	92.28	0.000	64.37	38.27
321391	60.37	64.74	0.000	42.64	64.44	0.111	435.65	30.96
321541	123.34	59.35	0.036	127.00	41.41	0.111	662.88	41.93	CopyNumber	15q22.31	2793
323363	47.64	64.47	0.000	29.43	51.70	0.222
323489	49.53	81.42	0.036	73.56	84.83	0.222	152.22	30.03
324250	183.95	79.24	0.000	158.34	82.02	0.000	324.22	27.86
324844	138.96	83.37	0.000	138.52	92.47	0.111	368.21	49.14
325650	116.94	136.52	0.000	82.13	109.38	0.222	108.42	62.31
326387	189.57	61.74	0.000	159.12	60.70	0.111	1355.73	29.26
330384	118.15	69.44	0.000	68.69	88.89	0.222	263.52	45.28
331431	64.31	64.62	0.036	34.89	61.05	0.222	164.96	25.51	CopyNumber	4p14	825
333388	404.01	90.31	0.000	248.00	49.98	0.000	56.06	41.65	CopyNumber	8q24.3	1878
333579	163.96	73.99	0.000	207.00	86.45	0.000	578.55	32.43
333786	197.41	82.77	0.000	297.78	97.96	0.000	88.80	27.84
333823	44.81	89.78	0.036	42.96	56.87	0.222	126.65	54.02
334017	1202.13	82.51	0.000	1496.72	84.82	0.111
334479	56.99	72.52	0.036	61.34	57.88	0.222	224.68	33.05	CopyNumber	16p13.3	2866
334534	73.76	94.59	0.000	64.42	72.27	0.222	230.52	56.05
334587	76.18	98.49	0.036	127.44	77.96	0.222	56.82	48.84
334713	71.93	72.87	0.071	69.27	86.41	0.222	158.37	38.36
334851	98.51	102.17	0.000	101.40	41.98	0.111	553.93	45.99
334868	40.49	56.26	0.071	23.15	52.67	0.222	170.24	29.57
335003	85.85	52.84	0.000	53.68	52.65	0.111	280.86	27.96	CopyNumber	16q24.3	2972
335057	203.38	68.54	0.000	137.12	58.17	0.000	682.36	27.44
335163	58.83	75.40	0.071	45.38	129.15	0.222	69.59	99.48
335918	75.25	98.06	0.071	79.89	54.30	0.222	222.21	54.25	CopyNumber	1q22	160
337295	108.95	84.21	0.036	137.57	72.92	0.111	116.16	50.84	CopyNumber	11q13.1	2272
337766	227.03	68.01	0.000	202.91	74.78	0.000	3513.66	53.34	CopyNumber	12q23.3	2494
339278	121.58	66.75	0.000	93.08	54.14	0.111	612.93	27.37
339639	200.80	71.56	0.000	59.94	63.25	0.222	530.98	32.89
339697	251.13	73.00	0.000	206.27	69.44	0.111	207.55	60.06
343911	162.16	79.02	0.000	73.68	85.85	0.111	126.75	36.12
345694	54.57	57.05	0.000	44.59	53.30	0.000	118.43	29.68
346868	75.67	85.04	0.071	86.46	71.11	0.222	78.76	41.86
348418	45.01	65.21	0.036	41.25	56.56	0.111	133.63	28.30
349656	210.49	69.11	0.000	122.42	91.03	0.111	65.67	33.86
350194	37.72	67.50	0.071	57.18	56.35	0.222	974.29	21.31
350229	114.41	97.88	0.000	64.62	89.22	0.111	182.02	57.82
350268	118.60	84.85	0.071	121.48	94.64	0.111	854.94	33.25
350364	41.56	62.80	0.071	32.70	56.87	0.222	489.36	49.85
350927	444.35	60.49	0.000	549.42	42.63	0.000	1242.87	45.82
351099	39.55	73.49	0.071	48.32	58.61	0.111	151.95	26.94
351296	87.27	70.85	0.000	100.35	47.00	0.111	210.84	29.83	CopyNumber	11q12.3	2268
351316	449.98	231.65	0.000	962.00	171.72	0.222	602.84	78.49
351474	84.43	98.35	0.000	56.04	104.42	0.111	65.42	73.26
351680	120.23	134.97	0.036	51.32	81.83	0.222	1028.80	33.00
351875	559.91	195.85	0.000	285.77	81.89	0.000	1982.14	49.61
352341	58.92	75.79	0.071	26.39	65.54	0.222	37.24	43.85
352656	63.14	71.84	0.036	58.63	44.06	0.111	875.31	43.75
352768	177.54	72.88	0.036	106.19	71.31	0.111	881.32	24.35	CopyNumber	6q27	1479
354056	74.23	76.13	0.071	56.50	78.63	0.111	126.70	123.02	CopyNumber	7q11.23	1572
355141	102.36	91.77	0.000	101.53	69.50	0.111	220.79	44.58
355606	80.22	60.91	0.071	76.85	66.68	0.000	574.94	34.63
355643	105.94	77.96	0.036	108.17	72.63	0.111	1201.76	27.22	CopyNumber	16p13.3	2866
355708	45.95	63.12	0.036	37.30	87.81	0.222	262.34	29.20	CopyNumber	2q11.2	378
355750	147.10	71.27	0.000	106.84	50.91	0.000	80.87	40.21
355753	47.02	84.23	0.036	38.89	56.95	0.111	336.82	37.01
355867	59.52	93.77	0.071	48.09	62.22	0.222	280.34	54.64	CopyNumber	12q13.3	2432
355927	141.28	64.41	0.000	147.13	64.66	0.111	941.32	36.63
355934	128.50	69.80	0.036	156.14	50.78	0.000	161.58	25.13
355983	181.32	66.37	0.000	154.52	67.35	0.222	404.14	34.07
356061	166.48	67.49	0.000	116.51	74.14	0.111	218.65	28.55	CopyNumber	16q24.2	2967
356096	152.55	70.29	0.000	168.35	68.41	0.111	168.20	43.07
356190	716.73	88.54	0.000	478.54	95.96	0.000	3961.19	25.93
356270	47.58	65.90	0.036	46.04	72.70	0.222	257.48	42.37
356285	330.79	79.82	0.000	329.64	78.06	0.000	799.76	33.14
356331	1646.83	59.53	0.000	1683.27	56.79	0.000	5223.43	28.46
356368	1894.42	92.12	0.000	1928.74	63.68	0.000			CopyNumber	16p13.3	2866
356371	2001.52	75.13	0.000	2350.46	66.23	0.000	112.06	33.10
356377	92.73	82.23	0.000	62.50	63.16	0.222	320.21	50.05
356487	76.36	66.21	0.000	55.00	59.52	0.000	527.54	28.10
356501	160.28	153.63	0.000	51.63	63.33	0.000	250.13	58.63
356502	2388.08	73.27	0.000	2501.03	44.31	0.000	4303.08	32.44	CopyNumber	15q23	2800
356549	81.89	65.60	0.000	84.68	67.51	0.222	294.91	45.11
356630	186.27	59.68	0.000	135.65	56.95	0.111	256.98	31.53
356647	94.88	75.20	0.000	113.95	64.30	0.000	982.39	31.67	Inversion	14q13.1-14q13.2	2663
356654	80.59	68.00	0.036	50.52	58.00	0.111	529.64	18.33
356766	203.56	85.27	0.036	207.71	52.85	0.111	3532.27	54.09
356769	102.94	148.76	0.071	82.19	77.74	0.111	211.91	50.28
356799	350.34	127.42	0.000	82.88	66.53	0.000
357901	273.44	181.23	0.036	350.43	80.27	0.111	407.08	74.43
362728	110.63	62.46	0.000	117.00	40.93	0.222	292.65	31.92
365116	103.78	68.53	0.036	126.74	72.33	0.222	109.68	38.27
368084	70.90	67.93	0.036	82.52	74.16	0.111	330.85	36.03
368149	253.53	84.73	0.000	319.23	99.32	0.000	306.87	38.36
368157	262.01	132.67	0.000	60.76	64.42	0.222	96.04	37.48
368240	80.76	63.21	0.036	41.47	63.19	0.222	282.82	29.11
368264	78.57	104.35	0.036	82.07	152.01	0.000	93.79	33.59
368376	64.69	63.69	0.000	60.30	75.16	0.111	475.42	40.92
368402	50.69	86.05	0.036	31.92	91.55	0.111	104.92	68.11	CopyNumber	8q24.3	1876
368404	64.81	74.03	0.036	46.42	53.59	0.000	79.74	27.69
368525	94.01	121.26	0.000	89.35	75.68	0.222	699.89	47.37
368598	63.93	79.84	0.036	50.09	69.21	0.222	212.95	33.37	CopyNumber	2q32.1	464
368934	510.24	97.54	0.000	420.24	80.76	0.000	2026.16	62.15
368985	74.13	64.59	0.000	54.64	54.70	0.222	245.08	30.39
369017	120.37	64.56	0.000	69.11	41.17	0.222	181.79	39.53
369052	114.17	64.31	0.000	70.30	47.70	0.000	455.50	36.14
369068	167.20	62.84	0.000	90.18	99.10	0.111	210.93	35.73
369125	74.34	86.12	0.036	66.78	75.85	0.222			CopyNumber	2q24.2	437
369285	266.65	183.68	0.000	62.35	137.25	0.222	34.54	60.02
369356	76.27	80.32	0.071	113.07	56.67	0.111	217.18	43.38
369606	63.91	78.57	0.071	63.17	66.71	0.111	145.32	32.96
369607	72.66	63.47	0.036	49.42	69.10	0.111	289.22	36.24	CopyNumber	4p16.3	758
369614	36.98	68.46	0.071	43.68	55.15	0.222	348.84	31.68
369615	43.41	89.80	0.071	29.44	70.80	0.222	118.05	30.52
369761	187.75	72.58	0.036	199.77	81.21	0.000	1028.59	25.79
369785	85.83	70.47	0.000	99.64	68.29	0.000	519.82	35.06
369920	172.27	77.09	0.000	168.51	77.20	0.111	505.36	31.36
370024	159.51	81.89	0.000	128.78	60.25	0.000	422.20	27.11
370247	295.17	75.77	0.000	233.67	70.23	0.000	40.90	41.82	CopyNumber	11q24.3	2355
370292	54.66	77.28	0.036	36.54	69.28	0.000	327.17	36.76	CopyNumber	10q26.2	2190
370312	56.14	65.22	0.036	69.14	59.74	0.222	173.14	30.85
370408	81.80	81.05	0.000	47.84	69.75	0.000	458.21	44.61	CopyNumber	22q11.21	3466
370581	202.38	86.13	0.000	191.83	64.65	0.111	579.49	33.71	CopyNumber	1p34.2	60
370770	86.09	84.48	0.036	95.64	93.45	0.111	452.54	31.23	CopyNumber	2p15	345
370771	221.01	116.09	0.036	242.66	151.31	0.222	251.27	55.14
370895	151.28	82.56	0.000	100.06	76.14	0.111	881.82	34.34
370927	68.76	121.90	0.036	52.90	64.05	0.222	432.84	47.49
370937	115.35	87.18	0.071	124.70	85.67	0.111	561.13	45.91
371001	193.59	69.51	0.000	170.33	68.79	0.111	454.07	35.94
371416	44.92	78.55	0.036	36.50	64.63	0.111	96.75	35.90	CopyNumber	19p13.2	3217
371563	90.16	63.43	0.036	59.64	75.25	0.111	202.76	25.54
371783	40.80	59.70	0.000	54.31	56.93	0.222	206.21	29.90
371889	245.88	68.61	0.000	325.06	67.81	0.000	936.64	56.60
372003	130.10	61.79	0.000	80.84	79.74	0.111	89.46	30.69
372050	58.15	66.34	0.071	46.09	73.62	0.222	82.63	32.40
372286	55.91	64.63	0.036	30.00	59.49	0.222	354.14	23.10
372331	141.12	89.80	0.036	81.60	144.08	0.222	232.33	49.08
372541	72.26	65.94	0.071	66.46	82.62	0.111	186.66	25.95
372616	53.90	72.02	0.036	35.25	60.41	0.222	143.19	33.51
372914	84.08	126.22	0.000	100.73	126.29	0.111	231.60	56.38
373550	133.12	88.97	0.036	184.03	68.60	0.222	209.76	48.79
373741	144.47	79.81	0.000	77.80	98.88	0.000	412.67	38.36
373763	190.45	63.54	0.036	195.53	52.32	0.111
373952	50.38	94.13	0.036	30.34	82.68	0.111	96.20	32.08	CopyNumber	17p13.2	2984
373959	71.58	63.44	0.000	33.58	71.55	0.000	183.05	41.76
374043	116.01	66.27	0.036	34.15	82.28	0.222	106.28	22.55
374257	73.50	90.84	0.071	57.56	72.95	0.222	65.71	68.99
374378	113.85	119.35	0.036	125.53	97.64	0.111	225.89	60.82
374477	133.82	56.99	0.000	105.78	48.32	0.000	246.92	24.70
374503	303.22	59.32	0.000	271.15	56.47	0.000	2139.38	28.45
374588	1232.67	75.34	0.000	683.86	56.24	0.000	413.28	42.63
374596	3569.27	85.39	0.000	2551.73	61.31	0.000	5206.59	33.30
374650	406.62	126.18	0.036	88.32	93.01	0.222	2238.80	53.03
374973	44.01	72.70	0.071	33.02	75.69	0.222	110.84	45.58
375001	109.38	70.26	0.000	87.30	74.38	0.222	100.50	40.21
375108	518.62	143.73	0.071	764.58	129.71	0.222	128.99	45.16
375217	50.53	66.70	0.000	45.51	78.12	0.222	38.58	33.48
376046	52.79	131.46	0.071	67.73	85.63	0.222	324.83	59.30
376933	308.91	85.54	0.000	188.71	94.17	0.111	932.24	43.14
377155	132.35	84.44	0.000	52.03	67.04	0.000	165.50	32.72
378103	568.97	84.12	0.036	640.07	72.81	0.000	2299.39	45.40	CopyNumber	19q13.43	3293
378532	36.24	74.21	0.071	19.77	57.36	0.222	143.45	34.11
378808	71.81	80.58	0.071	42.68	76.86	0.222	1023.41	32.72
380403	49.37	77.18	0.071	39.70	97.70	0.111	152.35	50.89
380774	292.30	69.78	0.036	367.07	72.51	0.000	704.94	28.60
380953	1234.08	120.40	0.000	1164.30	50.87	0.000	4148.67	36.69	CopyNumber	17q25.1	3072
380973	516.19	66.60	0.000	541.31	51.30	0.000	636.85	33.23
381008	189.44	113.07	0.000	775.01	80.40	0.000	541.08	39.56
381058	68.75	68.41	0.036	40.33	63.46	0.222	25.40	47.69
381072	101.71	76.95	0.000	77.98	75.38	0.111	163.52	63.87
381123	2223.30	73.37	0.000	1876.45	45.25	0.000	8803.79	35.35
381126	890.77	143.53	0.000	523.32	77.49	0.000	40.73	27.35	CopyNumber	5q33.1	1236
381189	202.41	74.68	0.036	232.19	94.40	0.000	495.84	37.72
381219	690.41	98.54	0.000	704.33	65.39	0.000	1933.04	37.91
381256	107.25	99.47	0.036	83.41	96.68	0.111	46.96	62.16
382044	63.91	92.25	0.036	85.09	76.07	0.111	98.39	41.13
382168	47.57	65.61	0.071	40.65	65.81	0.222	47.88	50.87	CopyNumber	20q13.12-20q13.13	3395
385913	98.67	75.07	0.071	85.26	93.35	0.222	200.81	51.44
385986	133.50	67.61	0.036	72.40	68.58	0.000	238.36	27.33
386434	79.18	72.97	0.036	52.83	73.51	0.111	344.41	26.93
386465	43.91	67.39	0.071	32.55	77.62	0.111	144.09	43.35
386939	49.17	79.30	0.036	38.64	50.55	0.111	171.14	24.98
387208	653.75	63.45	0.000	727.99	60.47	0.000	2811.53	37.85
387804	382.83	85.40	0.036	481.25	60.76	0.000	2686.84	38.70
388034	38.31	67.46	0.071	48.51	81.22	0.222	140.62	25.58
388654	97.60	81.47	0.000	93.30	67.09	0.111	637.15	55.44	CopyNumber	9q32	1992
388664	1553.26	53.99	0.000	1460.59	41.29	0.000	6835.36	34.82
388739	162.11	68.80	0.036	122.75	82.72	0.111	520.74	24.62
388927	127.70	71.40	0.071	139.68	66.05	0.111	356.99	30.26
388956	55.36	85.77	0.036	71.01	94.85	0.111
389037	70.85	84.61	0.036	47.66	65.23	0.222	91.25	34.83
389107	238.25	94.66	0.036	263.90	108.16	0.000	892.91	48.86	CopyNumber	16p13.3	2866
389171	74.04	82.45	0.036	44.74	103.84	0.111	192.72	33.61
389649	88.57	125.20	0.036	163.93	82.73	0.000	425.65	32.06	CopyNumber	17q25.3	3084
389734	43.98	78.85	0.071	38.68	121.32	0.111	289.67	51.68
389996	337.24	180.39	0.000	327.19	82.08	0.000	1922.00	29.42
390667	152.19	74.42	0.000	105.64	80.72	0.111	468.47	48.33
393201	119.86	67.22	0.071	96.98	68.05	0.111	509.48	35.05
395482	42.01	65.92	0.036	44.74	59.27	0.111	102.70	40.91	CopyNumber	8q24.3	1874
396644	96.51	69.48	0.036	133.73	60.82	0.111	1142.75	35.09
396740	47.28	68.39	0.036	43.05	64.23	0.111	445.56	26.13
396783	107.54	118.29	0.036	110.63	82.09	0.111	261.57	76.08
397609	1068.13	254.69	0.000	633.23	56.50	0.000	13138.69	29.06
399800	63.09	66.18	0.036	44.45	64.79	0.111	75.35	36.85
400295	2027.75	72.44	0.000	2244.41	48.14	0.000	13951.77	33.35
401509	69.36	85.63	0.036	115.39	64.94	0.000	118.05	44.04
401903	296.35	90.23	0.000	453.74	70.31	0.000	114.88	45.33
401929	2240.90	68.45	0.000	2446.06	47.57	0.000	4419.77	40.15	Inversion	Xq28	3631
403917	83.03	63.27	0.071	80.15	43.62	0.222	142.49	52.88
404056	62.42	68.09	0.036	52.37	46.66	0.000	187.40	29.97
404321	166.21	116.89	0.000	104.40	74.14	0.111	419.99	34.26
405144	293.88	69.11	0.000	415.47	73.52	0.000	396.95	31.07
405410	87.05	76.64	0.071	78.70	71.34	0.000	433.35	42.84
405514	72.89	69.02	0.071	38.09	82.50	0.111	418.51	26.82	CopyNumber	17q21.32-17q21.31	3030
405590	174.41	81.80	0.036	169.04	77.14	0.000	245.79	24.62
405880	145.69	78.38	0.000	92.99	92.66	0.000	940.03	50.82
405942	77.12	83.39	0.071	57.96	72.26	0.000	158.43	35.77
406062	194.39	84.43	0.000	131.48	52.80	0.222	1502.27	27.41
406068	94.66	75.82	0.036	114.88	92.45	0.111	127.41	44.39
406096	318.23	82.26	0.036	155.28	110.89	0.222	111.15	33.70
406277	83.36	63.86	0.036	80.15	58.28	0.111	262.74	27.77
406300	1844.46	110.40	0.000	1789.62	51.80	0.000	3379.42	39.25
406423	58.42	82.14	0.036	108.09	55.19	0.222	227.08	30.58
406510	206.51	99.80	0.000	362.39	97.60	0.000	1484.49	47.35
406520	188.85	68.92	0.000	79.16	46.52	0.000	552.71	43.50	CopyNumber	7q22.1	1598
406534	66.80	76.53	0.036	84.44	74.61	0.111	81.66	48.02	CopyNumber	19p13.3	3204
406590	195.87	80.43	0.000	116.59	54.77	0.111	3669.45	26.79
406620	437.99	105.57	0.000	937.84	74.78	0.000			CopyNumber	6p21.31	1319
406683	137.98	397.62	0.036	101.26	87.65	0.111	4567.96	36.31	CopyNumber	19p13.3	3198
406799	50.22	62.82	0.036	34.19	47.08	0.222	624.11	32.91
406840	42.86	63.67	0.071	35.33	63.00	0.222	417.25	27.92
407368	296.81	85.75	0.000	208.80	51.34	0.000	189.03	26.77
407580	111.02	55.41	0.071	40.52	91.55	0.111	136.75	49.37
407995	820.62	102.74	0.000	792.47	129.50	0.000	1327.53	53.18
408018	1665.77	73.73	0.000	1638.52	53.51	0.000	1595.26	49.48
408073	1215.89	101.78	0.000	1040.65	78.37	0.000	5022.25	35.22
408236	189.91	178.08	0.036	191.09	140.73	0.111	166.92	28.73
408257	166.96	73.75	0.000	176.37	73.95	0.000	346.00	33.39
408293	56.47	79.96	0.071	55.21	76.68	0.222
408324	54.49	79.03	0.000	70.97	91.67	0.222	261.14	38.52
408428	87.86	57.10	0.000	54.54	56.13	0.111
408581	98.78	168.89	0.000	47.66	93.70	0.111	22.32	70.59	CopyNumber	10p11.23	2079
408909	103.46	55.91	0.000	107.48	55.68	0.000	462.90	38.03	CopyNumber	5p13.3	1105
409140	187.51	68.36	0.000	146.00	65.13	0.111	1015.79	34.02
409223	154.53	88.98	0.000	109.75	63.00	0.111	1498.41	63.96
409230	71.39	77.08	0.000	45.77	60.03	0.222	368.93	29.50	CopyNumber	6p21.32	1314
409834	132.98	82.56	0.000	145.39	69.35	0.000	1395.23	31.06	CopyNumber	9q34.3	2030
410197	43.88	63.50	0.071	28.39	50.29	0.111	193.36	31.09
410596	37.03	66.47	0.071	34.69	51.96	0.111	972.56	29.87
410817	2237.07	89.11	0.000	967.12	38.98	0.000	4919.57	40.81	CopyNumber	16q24.3	2972
411480	130.09	73.79	0.000	66.40	53.89	0.222	180.20	28.59	CopyNumber	2p13.1	356
411641	96.89	133.02	0.000	73.09	72.11	0.111	141.55	88.01
411847	67.09	71.19	0.036	79.52	59.04	0.000	277.48	39.90
412103	74.51	67.52	0.036	35.32	74.96	0.111	239.50	42.79	CopyNumber	13q12.11	2541
412117	81.81	79.30	0.036	72.03	73.91	0.111	106.69	32.88
412196	49.42	75.22	0.071	30.98	71.64	0.222	199.00	43.49
412433	95.68	63.22	0.036	78.22	90.02	0.111	272.65	29.98	CopyNumber	11q13.1-11q13.2	2278
412468	60.90	119.89	0.036	65.27	91.38	0.111	141.12	32.72
412842	68.47	70.86	0.071	69.10	79.95	0.111	232.58	28.04
413036	73.81	70.20	0.071	69.74	59.75	0.111	243.79	34.29
413482	72.11	80.49	0.036	49.57	57.15	0.111	337.81	43.89
414579	89.15	80.14	0.071	71.27	55.92	0.222
415342	122.55	79.01	0.000	111.61	77.60	0.222	459.69	25.69
416049	77.32	68.55	0.036	43.93	72.18	0.222	197.48	40.51
416436	85.38	70.64	0.000	58.84	53.49	0.000	108.37	40.38	InversionBreak	7q11.23-7q11.22	1569
									point
									CopyNumber
									CopyNumber
417004	317.66	136.17	0.000	201.17	72.90	0.222	521.74	63.64
417029	84.10	74.72	0.036	99.27	71.29	0.000	200.46	37.83
418123	94.78	202.05	0.036	138.03	241.75	0.222	319.38	64.64	CopyNumber	9q21.33-9q22.1	1960
418175	126.20	85.40	0.000	67.13	69.58	0.111	354.32	39.90	CopyNumber	8q24.3	1880
418233	91.94	101.45	0.000	117.46	123.53	0.000	280.39	36.32
418450	53.11	105.88	0.000	56.80	81.39	0.222	159.74	29.02
418533	73.29	61.17	0.036	73.40	66.43	0.222	340.85	38.60
418668	249.44	90.41	0.000	162.79	95.51	0.111	100.95	36.86	CopyNumber	19p13.3	3198
419640	80.33	82.10	0.071	72.52	61.17	0.111	1390.88	23.87
420269	327.11	205.21	0.036	412.78	162.70	0.222	70.62	57.13
420272	156.87	65.09	0.000	101.26	85.37	0.000	239.55	31.21
421257	773.71	83.68	0.000	1327.95	45.08	0.000	5761.57	31.60
421509	100.96	88.01	0.036	110.18	89.29	0.000	938.99	34.34
422113	56.61	70.57	0.036	55.85	49.24	0.111	252.93	58.42	CopyNumber	10q26.3	2199
423935	90.04	65.96	0.000	87.90	52.75	0.222	148.10	43.63	CopyNumber	6p21.32	1314
423968	184.40	79.75	0.000	113.92	73.70	0.111	461.34	31.00	CopyNumber	7q22.1	1600
424126	442.70	98.54	0.000	300.03	49.27	0.000	154.40	28.34	CopyNumber	15q15.3	2771
424908	84.59	81.21	0.000	64.53	78.90	0.111	265.87	44.69
425777	95.06	80.47	0.036	77.84	85.16	0.111	366.93	47.98	CopyNumber	11q12.1	2261
426296	104.09	64.88	0.071	75.24	62.36	0.111	1457.22	32.65
426359	127.55	87.85	0.000	111.22	63.93	0.222	458.50	41.77
429052	216.47	92.93	0.000	242.82	57.76	0.222	1214.90	32.34
429353	102.88	79.94	0.036	65.42	71.89	0.111	343.74	43.42
429581	320.92	114.95	0.000	135.56	64.30	0.222	1000.39	35.21
429819	119.10	89.35	0.000	44.35	56.24	0.111	112.40	29.86
429839	63.92	70.25	0.036	59.72	96.19	0.000	526.01	27.93	CopyNumber	1p32.3	71
430425	129.12	77.22	0.000	63.83	73.92	0.000	645.48	26.65	CopyNumber	1p36.33	3
430551	88.02	76.02	0.000	71.02	65.06	0.000	221.97	39.09
430606	147.21	54.49	0.000	144.68	41.23	0.111	503.23	31.70
430657	83.08	80.31	0.071	49.61	85.30	0.222	278.49	29.31
430733	62.07	68.85	0.036	62.86	88.39	0.111	19.58	102.83
431101	108.86	80.78	0.036	82.46	93.00	0.111	302.22	42.11
431367	43.97	68.42	0.071	40.76	57.01	0.222	317.45	23.88
431498	98.20	58.31	0.000	50.68	71.27	0.111	215.07	31.63
431550	138.08	68.11	0.000	104.26	94.29	0.222	36.35	49.04	CopyNumber	2q11.2	384
431668	425.55	67.73	0.000	220.78	53.03	0.111	783.69	38.20
431850	66.06	72.50	0.036	34.04	80.31	0.111	12.95	42.74	CopyNumber	22q11.22-22q11.21	3472
431861	99.20	75.28	0.036	122.14	101.94	0.222	73.76	32.92
431926	59.70	135.79	0.071	84.76	110.75	0.222	190.15	30.68
432121	287.03	83.85	0.000	184.40	74.24	0.111	42.79	41.58	CopyNumber	19p13.13	3220
432438	67.18	80.60	0.071	52.75	89.48	0.111	211.51	33.45
432491	68.19	76.58	0.036	40.08	63.63	0.222	127.64	31.44
432690	62.18	65.69	0.000	31.94	67.02	0.222	611.10	28.10
432760	950.43	97.72	0.000	118.99	66.08	0.111	278.03	25.41
432898	1111.01	79.34	0.000	1010.53	58.63	0.000	4901.72	34.25
432976	79.20	72.23	0.000	73.94	60.54	0.222	75.50	28.05
433154	42.73	96.48	0.071	34.89	56.17	0.222	376.16	26.85
433201	153.26	91.66	0.036	152.71	94.95	0.111	576.21	55.18
433222	149.92	103.15	0.036	189.47	72.45	0.000	1186.75	51.60
433291	64.82	85.16	0.071	76.18	72.63	0.111	114.48	38.12
433307	89.54	77.86	0.071	96.78	92.13	0.000	114.79	35.45
433343	178.03	65.49	0.000	184.42	53.88	0.000	291.09	38.55	CopyNumber	16p13.3	2866
433345	109.07	120.01	0.000	213.51	71.24	0.000	862.00	56.26
433419	402.93	60.89	0.000	500.10	50.66	0.000	1779.46	34.78
433512	95.46	84.34	0.071	85.96	81.88	0.222	1236.34	38.08
433529	457.96	170.20	0.036	2199.40	54.31	0.000	14172.61	40.90	CopyNumber	19q13.33	3277
433540	102.38	69.15	0.000	64.51	73.27	0.000	211.95	23.86
433573	76.09	63.03	0.000	57.01	59.43	0.111	123.88	31.69	CopyNumber	11q13.1	2276
433615	501.20	92.22	0.000	388.92	80.94	0.111	1034.66	46.90	CopyNumber	9q34.3	2030
433701	2360.84	71.70	0.000	2139.00	50.10	0.000	7744.18	32.81
433722	37.39	74.06	0.036	27.81	59.03	0.222	141.76	60.11	CopyNumber	8p21.3	1710
433732	66.75	90.12	0.071	85.09	83.28	0.111	103.47	51.61
433750	129.41	73.70	0.000	60.65	76.09	0.222	80.25	36.40	CopyNumber	3q27.1	733
433759	199.75	58.35	0.000	139.75	61.48	0.111	411.26	35.14
433795	93.40	85.23	0.036	87.81	51.85	0.111	404.06	43.69
433863	565.16	66.30	0.000	430.25	65.24	0.000	1139.88	60.50
433901	527.55	72.42	0.000	618.72	88.72	0.000	1212.52	34.44
433951	646.53	77.15	0.000	631.83	67.81	0.111	627.74	38.31	CopyNumber	19p13.3	3198
434102	439.56	72.84	0.000	538.05	84.61	0.000	2487.38	32.06
434207	50.79	74.97	0.071	49.39	68.58	0.222	97.26	42.61	CopyNumber	20p11.23	3342
434219	265.78	137.02	0.036	51.48	60.93	0.222	80.88	28.08
434401	97.81	76.58	0.000	58.22	90.45	0.222	245.63	25.67
434937	426.54	79.45	0.000	143.66	68.38	0.111	736.59	35.97
434953	90.55	126.26	0.000	167.82	113.49	0.111	50.78	49.08
434980	645.54	73.22	0.000	373.57	81.91	0.111	63.94	46.60
435044	159.88	119.14	0.036	65.58	58.30	0.222	171.64	27.03	CopyNumber	22q13.31	3512
435064	37.16	53.57	0.071	27.55	70.25	0.222	213.71	32.00
435120	114.26	91.12	0.036	52.68	89.10	0.222	111.38	57.81
435136	221.38	83.96	0.000	172.33	62.24	0.000	53.09	51.23
435166	68.73	68.02	0.071	73.27	65.77	0.111	310.78	56.86
435231	48.65	128.11	0.071	40.03	61.55	0.000	85.70	26.38	CopyNumber	5p13.3	1105
435255	59.99	62.36	0.071	56.26	62.36	0.222	90.51	30.90
435326	41.79	74.42	0.071	49.09	59.90	0.222	78.17	52.63	CopyNumber	3q26.33	731
435512	114.98	77.87	0.000	34.15	50.88	0.222	190.85	63.23
435535	50.14	73.62	0.071	34.83	91.49	0.000	260.08	66.53
435610	100.47	69.17	0.000	86.37	78.22	0.111	404.43	20.92
435741	121.99	64.08	0.000	87.01	63.94	0.000	98.47	35.51	CopyNumber	16q23.2	2956
435759	45.48	74.67	0.071	52.90	67.87	0.222	332.76	29.01	CopyNumber	2q37.3	516
435771	59.57	67.86	0.036	56.30	74.26	0.111	90.36	28.25
435841	37.44	72.67	0.071	23.60	100.76	0.222	161.24	24.64
435850	132.98	84.40	0.036	105.96	99.27	0.111	267.53	47.21	CopyNumber	8q11.23	1756
435933	72.80	58.96	0.036	57.82	69.98	0.111	211.82	30.44
435948	46.76	62.53	0.036	29.62	71.91	0.222	149.70	30.57
435952	40.84	57.02	0.036	28.36	84.91	0.111	104.05	37.95
435974	55.52	78.61	0.071	68.25	91.00	0.222	218.66	65.62
436035	275.68	91.16	0.000	187.52	75.63	0.000	3174.68	46.99
436093	98.56	78.08	0.000	76.39	64.46	0.111	136.65	33.53
436204	33.87	64.95	0.036	29.22	78.13	0.222	250.23	22.99
436298	164.61	167.91	0.036	265.70	177.92	0.222	42.37	74.64
436405	72.68	77.90	0.036	27.67	56.95	0.222	313.71	26.76
436437	112.73	94.20	0.036	77.60	93.12	0.222	918.38	80.58
436446	112.15	66.68	0.000	99.63	53.06	0.111	309.25	35.80
436500	68.08	72.80	0.036	60.68	75.22	0.222	472.17	25.55	CopyNumber	7p13	1537
436568	1315.63	131.69	0.000	1219.01	117.62	0.111	50.53	68.91
436578	88.14	90.18	0.000	113.73	79.39	0.000	140.58	43.95
436657	1709.53	178.41	0.000	500.52	138.23	0.111	15.83	89.67
436687	483.49	75.22	0.000	611.23	84.03	0.000	638.97	31.31
436803	77.53	73.05	0.000	85.70	97.89	0.111	316.09	35.27
437056	47.97	103.58	0.036	43.41	77.96	0.222	163.82	26.89
437060	102.41	74.69	0.000	167.53	67.12	0.000	1114.79	54.47
437110	483.00	118.34	0.000	457.69	74.53	0.111
437178	176.48	108.35	0.000	118.41	93.36	0.000	491.49	49.15
437256	42.69	85.27	0.071	27.23	74.49	0.222	133.85	34.04
437277	98.94	113.92	0.036	112.16	68.25	0.222	562.98	51.58	CopyNumber	5q35.3	1271
437367	128.35	80.84	0.036	76.15	78.20	0.111	240.02	54.01
437388	55.36	92.45	0.071	42.31	57.64	0.222	238.37	40.11
437403	83.72	73.99	0.036	83.00	65.86	0.000	913.95	48.77
437594	2903.18	63.31	0.000	2995.32	44.60	0.000	3402.65	43.18	CopyNumber	11p15.5	2200
437638	381.08	230.82	0.000	332.76	161.65	0.000	726.60	84.34
437779	178.08	79.94	0.000	162.25	59.57	0.000	1026.73	29.41
437831	47.62	69.32	0.071	42.55	70.99	0.222	349.70	25.46
438072	53.45	75.82	0.071	37.78	63.33	0.111	226.25	39.89
438219	71.49	66.65	0.071	41.29	63.30	0.222	161.95	25.67
438429	3026.84	82.19	0.000	2234.04	58.24	0.000	4443.85	41.78
438678	109.07	95.46	0.000	66.45	74.83	0.111	417.69	43.11	CopyNumber	11p15.5	2200
438720	192.09	110.88	0.036	245.01	102.14	0.000	150.74	57.91	CopyNumber	7q22.1	1596
438970	73.49	65.73	0.036	35.85	46.43	0.111	1820.04	33.55
438974	59.88	65.29	0.036	44.97	79.81	0.111			CopyNumber	7q22.1	1603
439480	56.89	63.35	0.036	57.48	70.79	0.111	236.05	33.28
439481	121.04	387.86	0.000	88.09	67.88	0.222	169.24	40.86	CopyNumber	17q22	3047
439548	32.78	61.68	0.071	37.93	64.75	0.222	1054.07	45.16
439552	97.32	95.86	0.071	229.49	79.88	0.111	6558.96	35.24
439815	188.94	64.93	0.036	157.75	73.89	0.000	568.16	45.34
440382	80.66	63.06	0.000	67.84	45.41	0.111	163.60	26.30
440544	116.71	76.58	0.000	183.45	74.43	0.111	120.48	60.51	CopyNumber	1p38.11	46
440599	194.20	545.85	0.000	639.75	338.15	0.000	377.40	37.66
440604	99.15	69.40	0.000	120.21	77.49	0.222	219.86	29.08	CopyNumber	16q22.3	2941
440899	81.97	108.09	0.036	90.62	83.07	0.111	375.62	48.63
440932	158.17	67.69	0.000	103.15	59.03	0.111	1062.06	42.62	CopyNumber	17q25.2	3077
440960	56.98	72.81	0.071	47.81	52.64	0.111	258.65	30.69	CopyNumber	19p13.13	3220
440961	86.43	70.30	0.000	77.69	104.24	0.000	450.65	39.28
441072	278.78	127.50	0.000	185.74	85.71	0.000	731.13	33.84	CopyNumber	11p15.5	2200
441550	69.22	76.06	0.036	56.52	72.10	0.222	236.69	37.99
442344	117.65	88.49	0.071	72.66	94.29	0.000	207.03	63.14	CopyNumber	13q33.3-13q34	2880
442798	80.34	54.05	0.036	54.26	57.73	0.222	231.34	26.39
443134	64.55	85.46	0.036	64.44	87.35	0.222	198.90	27.17
443379	49.98	72.92	0.071	67.86	68.96	0.111	224.78	38.54
443837	51.38	77.55	0.071	46.32	62.18	0.222	174.43	34.43	CopyNumber	17q21.32	3031
443914	267.67	58.76	0.000	247.64	46.39	0.000	1457.78	49.68
444279	63.11	61.65	0.000	80.72	51.79	0.111	746.56	26.60
444356	146.51	57.17	0.036	92.25	70.76	0.222	182.95	39.12	CopyNumber	17q25.1	3073
444468	92.85	78.70	0.000	67.26	84.13	0.111	310.40	27.53
444472	45.51	73.19	0.071	54.83	62.43	0.111	195.91	35.50
444569	197.09	110.59	0.000	189.12	138.53	0.000	519.72	46.05
444673	91.56	71.14	0.036	92.42	75.43	0.111	67.52	34.65
444724	44.74	59.51	0.036	21.27	56.05	0.222	81.02	40.08
444818	66.90	72.48	0.071	40.54	62.78	0.111	209.04	23.65
444931	43.14	61.84	0.071	30.56	69.88	0.222	113.86	30.06
444969	59.89	72.90	0.071	59.68	83.21	0.000	136.35	35.35
444986	54.25	81.88	0.071	31.66	59.27	0.222	182.02	33.14
445081	57.76	108.71	0.036	70.28	132.55	0.222	544.37	97.39
445351	1304.52	153.11	0.000	1533.86	144.30	0.111	39.15	60.06	CopyNumber	22q13.1	3496
445394	82.01	61.72	0.000	60.05	68.24	0.000	1169.19	31.54
445498	43.68	69.47	0.071	37.53	51.18	0.111	126.46	22.30	CopyNumber	14q24.3	2709
445511	54.46	100.89	0.071	43.28	70.81	0.222	220.12	43.86
445570	182.09	85.23	0.000	287.35	53.42	0.000	2381.68	28.41
445803	77.15	90.03	0.000	123.83	68.80	0.111	1202.42	33.85
445893	189.36	61.34	0.036	158.23	69.47	0.000	147.47	27.99
445977	82.05	66.19	0.036	69.10	64.20	0.111	644.29	43.60
446017	231.33	76.51	0.036	155.50	54.07	0.000	397.35	48.34
446091	83.46	71.17	0.036	85.02	65.59	0.111	941.23	28.02	CopyNumber	6q25.3	1460
446123	88.07	64.84	0.000	57.10	56.16	0.222	166.18	39.16
446149	250.91	93.31	0.000	369.45	112.87	0.000	1387.86	59.45	CopyNumber	12p12.1	2390
446260	227.02	71.29	0.000	126.46	62.05	0.111	720.78	37.72
446336	155.02	118.95	0.000	56.90	54.31	0.111	182.90	31.05
446345	3636.50	75.64	0.000	2881.93	51.03	0.000
446414	83.15	79.62	0.036	56.65	96.50	0.111	83.57	42.55	Inversion	3q13.12	646
446427	576.39	55.94	0.000	444.92	41.01	0.000	1860.94	22.07	CopyNumber	19p13.3	3199
446445	76.17	117.64	0.000	85.11	64.37	0.111	220.61	30.91
446450	528.00	91.72	0.000	785.60	75.69	0.000	1838.91	35.62
446574	1381.46	101.45	0.000	1048.70	47.73	0.111	4295.62	48.23
446588	603.82	74.06	0.000	514.97	50.47	0.000	10114.50	28.56
446623	351.95	59.32	0.000	440.12	53.84	0.000	280.15	39.09
446628	2026.83	69.18	0.000	1715.03	60.31	0.000	4069.97	36.87
446641	54.08	74.66	0.000	70.78	78.14	0.000	226.36	28.05
446852	160.77	65.91	0.036	169.80	67.64	0.000	1472.64	39.26	CopyNumber	22q13.1	3496
447477	139.88	59.67	0.036	112.12	53.27	0.222
447492	498.68	70.38	0.000	576.32	85.45	0.111	128.97	28.68
447547	121.44	68.05	0.036	63.65	59.13	0.222
448226	1108.65	91.01	0.000	1605.76	74.12	0.000	1886.46	41.47
448588	364.70	89.27	0.000	289.59	98.53	0.222	1421.10	61.15
448646	3106.03	106.73	0.000	2172.80	57.81	0.000
448879	126.52	104.70	0.071	169.47	88.62	0.000
449114	241.77	62.43	0.000	277.65	67.95	0.111	25.47	56.84
449171	266.35	78.63	0.000	672.77	37.65	0.000			CopyNumber	9q21.32	1957
454534	62.62	72.76	0.036	51.63	64.52	0.222	87.97	34.37	CopyNumber	19q13.12	3247
454699	48.68	69.32	0.071	522.93	101.80	0.000
456507	73.31	68.08	0.036	50.47	65.93	0.222	358.16	38.22
456557	116.20	65.44	0.036	88.99	75.61	0.222	120.23	30.51	CopyNumber	1p34.1	66
458320	35.84	67.14	0.071	31.00	50.77	0.222	136.02	27.81
458358	127.17	94.79	0.071	58.21	86.21	0.222	256.39	41.07
458414	119.42	135.42	0.036	193.99	95.48	0.222	1264.21	74.29
458458	93.53	96.04	0.000	151.41	91.30	0.000
458747	46.30	58.82	0.036	95.42	71.07	0.222	98.53	30.78
459106	49.61	67.41	0.036	30.94	43.03	0.222	350.68	35.89
459149	54.21	77.24	0.071	63.96	81.98	0.222	208.67	32.53
459174	82.35	64.84	0.071	65.88	81.46	0.111	430.22	38.61
459211	70.77	74.24	0.071	63.93	96.88	0.111	121.40	39.40	CopyNumber	15q25.3	2828
459596	78.83	97.43	0.036	59.17	70.19	0.111	97.92	30.16	CopyNumber	16p13.3	2866
459649	57.89	98.22	0.071	74.77	93.41	0.111	141.86	39.47	CopyNumber	16p13.3	2866
459927	1205.32	87.23	0.000	2248.86	63.06	0.000	1030.19	45.59	CopyNumber	2q37.1	507
459940	118.47	87.15	0.000	129.67	70.79	0.222	677.27	59.84
460238	54.58	100.06	0.000	31.15	69.28	0.000	250.78	29.94
460317	59.22	72.75	0.036	35.75	55.10	0.222	115.06	30.41
460336	51.31	67.69	0.071	40.70	46.75	0.000	45.79	44.88
460468	58.36	64.03	0.036	56.42	63.75	0.111	230.88	23.36	CopyNumber	16p11.2	2900
460499	66.95	92.61	0.071	48.97	54.21	0.000	37.47	53.32	CopyNumber	16p11.2	2900
460574	74.28	83.01	0.071	78.45	91.21	0.111	746.92	27.83
460923	67.45	71.51	0.036	28.17	61.28	0.222	152.22	22.68	CopyNumber	16q21	2926
460929	126.69	96.28	0.071	141.87	83.05	0.111	370.86	56.55	CopyNumber	16q21	2926
460978	46.47	73.44	0.036	49.25	81.01	0.222	250.20	31.68
461047	81.94	103.47	0.071	67.54	106.04	0.111	70.12	87.63
461131	76.12	122.98	0.036	127.62	157.34	0.222	76.67	41.61
461361	79.79	78.50	0.036	30.76	40.03	0.222	174.78	41.86	CopyNumber	16q23.1	2944
461379	184.34	83.32	0.000	96.52	91.91	0.111	641.27	33.25
461722	78.84	71.51	0.000	48.48	53.92	0.111	186.99	29.54	CopyNumber	16q24.3	2971
461777	77.23	79.87	0.000	81.52	105.93	0.111
461896	68.65	75.47	0.000	126.02	74.34	0.000	134.80	28.05
461925	83.76	71.77	0.000	103.12	73.82	0.222	147.49	38.95
462035	72.02	62.46	0.000	66.85	67.94	0.111	216.51	26.40	CopyNumber	17p13.2	2983
462086	70.39	56.55	0.036	58.35	72.87	0.111	140.21	27.82	Inversion	17p11.2	2999
462306	226.76	151.24	0.036	384.89	136.76	0.111	93.89	42.37
462316	83.84	52.50	0.036	45.98	51.91	0.000	305.99	31.78
462492	95.69	75.74	0.000	101.26	70.86	0.222	889.15	34.30
462550	61.36	77.59	0.036	37.84	47.17	0.111	481.28	40.17
462956	65.65	121.13	0.071	41.50	83.60	0.111	272.89	75.13
462998	238.31	165.03	0.000	412.00	132.76	0.222	318.32	32.43
463010	51.34	74.65	0.036	48.26	79.91	0.000	297.90	46.77	CopyNumber	17q21.2	3021
463035	88.10	84.60	0.036	88.96	78.41	0.222	29.55	123.40
463041	112.05	60.04	0.000	61.76	105.33	0.111	85.41	37.40	CopyNumber	1p36.23	24
463059	286.52	99.58	0.000	97.24	64.76	0.000	708.36	33.04
463295	47.81	128.90	0.000	22.01	67.66	0.222	89.26	24.02	CopyNumber	17q21.32-17q21.31	3030
463506	401.26	144.88	0.036	69.53	99.95	0.000	311.25	41.57	CopyNumber	17q22	3044
463702	44.08	182.82	0.071	17.71	63.68	0.222	71.51	32.11
463797	48.55	86.43	0.071	35.50	77.38	0.222	60.88	56.60
464071	159.65	87.71	0.000	221.39	89.76	0.000	219.07	81.15	CopyNumber	1p36.22	27
464137	64.57	80.94	0.036	49.33	90.69	0.000	60.37	44.17
464210	159.36	106.68	0.000	141.21	95.75	0.111	537.14	49.17
464336	354.48	99.04	0.000	283.74	88.39	0.000	2084.95	55.71	CopyNumber	17q25.3	3087
464438	100.58	107.95	0.036	166.40	112.66	0.000	98.95	38.69
464472	303.55	95.86	0.000	207.88	42.93	0.000	1126.38	32.54
464595	61.71	58.98	0.000	59.05	58.88	0.111	215.87	47.07	CopyNumber	18p11.22	3100
464652	59.73	61.77	0.036	54.95	54.53	0.222	517.28	24.42
464912	65.87	70.39	0.000	76.41	70.71	0.111	213.12	37.13
465224	91.32	72.99	0.036	75.36	57.77	0.222	700.57	30.47
465374	121.77	103.77	0.071	157.39	115.14	0.000	330.15	48.22
465498	118.06	68.89	0.000	88.16	71.12	0.111	400.88	28.38
465529	77.19	122.89	0.036	107.98	78.16	0.111	288.27	45.92	CopyNumber	19p13.3	3198
465543	90.71	63.89	0.071	84.61	58.95	0.111	64.19	57.71
465627	176.08	70.89	0.000	133.95	67.91	0.000	301.85	37.18	CopyNumber	19p13.3	3205
465645	122.81	77.44	0.000	75.74	54.65	0.000	386.74	35.78
465808	126.89	66.58	0.000	143.70	66.22	0.111	434.39	30.19
465849	157.79	69.39	0.000	91.55	80.10	0.111	44.47	66.21
465924	76.80	84.07	0.036	50.18	61.81	0.222	165.00	42.35	CopyNumber	1p36.13	35
466044	62.96	72.79	0.036	84.23	68.24	0.111	73.78	52.32	CopyNumber	19p13.12	3223
466088	150.55	111.92	0.000	181.29	71.15	0.111	179.65	56.72
466148	157.14	84.06	0.000	97.34	76.06	0.111	203.63	72.98
466471	172.27	105.82	0.000	168.18	142.62	0.000	626.83	50.67
466693	122.41	102.86	0.000	67.60	126.08	0.222	176.70	34.39
466766	68.26	118.35	0.036	34.50	83.74	0.222	45.08	45.77
466775	58.13	79.83	0.036	68.63	60.69	0.222	244.72	28.23	CopyNumber	19q13.2	3260
467084	58.39	54.54	0.036	34.59	66.69	0.222	99.92	38.09	CopyNumber	1p36.12	37
467097	100.15	76.10	0.036	128.68	86.64	0.111	397.83	35.85	CopyNumber	19q13.33	3276
467192	102.67	73.99	0.000	138.33	71.24	0.111	315.89	28.78
467279	169.43	53.14	0.000	77.66	63.14	0.111	125.33	61.82	CopyNumber	19q13.42	3287
467284	638.08	110.65	0.036	1280.99	75.58	0.000			CopyNumber	19q13.42	3287
467408	235.85	83.16	0.000	325.76	90.96	0.111	393.32	76.72
467637	282.31	49.68	0.000	192.26	43.69	0.111	218.92	31.71	CopyNumber	1p36.12	39
467696	94.69	92.22	0.000	54.70	92.68	0.111	81.56	46.18
467701	112.30	84.27	0.036	80.50	96.79	0.222	611.36	76.96
467807	380.71	67.35	0.000	271.07	62.85	0.000	1249.38	26.16
467824	60.01	65.40	0.036	37.46	47.95	0.222	425.41	25.22
467960	100.37	55.30	0.071	78.25	53.53	0.222	1591.91	35.68
468018	243.47	78.99	0.000	181.90	57.84	0.111	221.20	50.86
468415	85.62	66.24	0.071	77.48	62.56	0.111	149.98	25.30	CopyNumber	2p21	325
468442	448.88	60.35	0.000	431.37	47.50	0.000	3361.97	24.79
468760	56.19	79.05	0.036	31.54	72.64	0.111	405.11	28.06
469022	55.33	70.82	0.071	71.82	59.11	0.111	223.87	28.02
469171	59.47	71.16	0.071	32.92	79.80	0.222	196.57	24.11
469331	3007.75	87.59	0.000	191.43	51.78	0.111	1314.48	35.64	CopyNumber	2q11.2	378
469820	51.68	71.71	0.000	38.70	85.72	0.222	246.69	30.95	CopyNumber	2q14.2	402
469863	262.56	57.98	0.000	457.07	59.63	0.000
469925	481.47	77.87	0.000	361.73	80.70	0.000	456.73	35.81	CopyNumber	2q14.3-2q21.1	410
469970	62.81	76.12	0.000	60.03	58.11	0.000	250.41	21.69
470091	590.76	62.78	0.000	636.64	72.45	0.000
470233	39.57	104.74	0.071	31.04	74.54	0.111	227.42	28.85
470417	62.85	65.73	0.000	36.16	73.00	0.222	240.63	29.90	CopyNumber	1p35.2-1p35.1	53
470477	138.21	78.56	0.000	176.13	76.36	0.000	704.61	35.82	CopyNumber	1p35.2-1p35.1	53
470577	164.48	112.63	0.000	64.25	63.02	0.000
470588	91.23	62.13	0.000	49.83	47.08	0.222	38.39	32.85
470943	99.04	79.99	0.036	73.35	126.49	0.222	655.85	58.91
471011	54.27	67.05	0.071	67.25	53.93	0.222	121.32	42.55
471104	107.80	89.45	0.000	149.19	59.04	0.111	602.32	48.56
471207	53.27	63.61	0.071	49.29	54.88	0.222	136.91	52.19
471441	132.08	78.02	0.000	176.65	89.29	0.111	498.87	39.72
471461	55.56	73.53	0.071	32.43	58.01	0.222	196.76	59.72
471593	71.62	53.91	0.071	36.64	49.61	0.222	288.93	31.86
471768	76.01	90.76	0.071	70.68	83.24	0.111	111.27	42.60	CopyNumber	1p34.3	57
471818	48.75	63.33	0.071	35.69	55.32	0.111	1268.99	34.78
471851	284.45	70.38	0.000	115.85	67.87	0.111	499.38	30.04
471873	61.06	109.74	0.071	97.75	113.82	0.111	48.62	53.92
471933	166.80	63.18	0.000	202.14	53.09	0.000	624.43	29.36
471975	46.80	70.45	0.071	36.48	73.24	0.222	242.80	24.13	CopyNumber	20p13	3306
472010	217.32	105.00	0.000	67.84	111.58	0.222	155.71	45.29
472024	87.82	64.21	0.036	69.70	48.63	0.111	1913.94	28.06
472031	161.41	59.04	0.000	211.67	50.43	0.111			CopyNumber	4q24	915
472038	46.16	67.26	0.071	32.17	50.19	0.111	123.01	32.36
472056	97.30	68.89	0.036	112.97	60.49	0.111
472119	43.01	66.76	0.071	31.86	112.28	0.222	139.92	34.83
472185	175.84	78.25	0.000	242.12	90.19	0.000	1069.96	32.56
472213	81.63	95.80	0.071	41.74	48.04	0.111	48.90	42.31
472330	111.23	96.95	0.036	69.76	90.01	0.111	465.49	45.06
472475	117.24	69.13	0.000	78.28	70.30	0.000	139.49	37.18
472535	87.41	99.64	0.071	77.90	44.78	0.222	199.94	32.50	CopyNumber	1p36.33	2
472558	150.94	74.34	0.000	132.04	58.70	0.000	639.31	31.64
472651	69.65	79.84	0.000	36.65	74.11	0.222	314.39	34.69
472737	79.62	61.99	0.071	43.99	48.64	0.222	363.10	33.74	CopyNumber	20q12	3378
473296	87.51	84.70	0.000	63.19	58.70	0.222	168.83	41.41	CopyNumber	20q13.33	3420
473583	340.36	80.46	0.000	514.27	77.95	0.000	1676.15	36.77
473648	51.98	73.17	0.036	64.60	71.35	0.222	102.03	32.42
473721	157.66	128.82	0.000	134.23	123.75	0.111	33.23	53.19
473761	160.89	72.57	0.000	132.69	52.87	0.111	657.85	38.65
473788	93.09	64.69	0.000	111.64	71.83	0.222	157.28	26.24
474005	71.57	61.86	0.000	75.34	61.40	0.111	478.66	29.39
474010	111.37	78.81	0.000	59.76	58.87	0.222	891.19	36.45
474053	421.26	147.51	0.000	499.17	168.59	0.222	29.70	60.90
474083	74.49	72.19	0.036	75.46	78.10	0.111	114.78	33.60
474213	42.38	79.94	0.000	36.27	50.63	0.222	196.39	29.08
474584	94.42	80.62	0.071	112.70	73.66	0.000	162.31	31.89
474643	100.93	74.60	0.000	58.12	75.67	0.222	795.97	39.57	CopyNumber	22q12.3	3485
474751	127.27	97.07	0.000	78.94	84.91	0.222	372.66	35.97	CopyNumber	22q12.3	3492
474833	68.93	89.25	0.036	58.59	72.73	0.111	237.54	48.09
474914	74.06	69.41	0.036	62.09	108.62	0.111	72.32	40.96
474938	33.74	60.89	0.036	23.46	63.42	0.222	59.35	36.45
474949	69.87	73.51	0.036	92.75	72.43	0.111	309.31	39.95
474982	105.23	85.98	0.000	78.19	80.45	0.111	320.54	79.01	CopyNumber	22q13.2	3503
475125	118.31	207.12	0.000	64.68	86.52	0.222	119.70	27.01
475319	69.04	67.49	0.036	43.01	77.46	0.222	62.08	33.32
475382	114.62	139.32	0.036	33.09	54.60	0.222	133.66	23.64
475392	46.89	65.47	0.036	34.18	68.93	0.222	258.78	29.27
475663	74.69	63.62	0.000	53.92	65.40	0.111	432.72	25.21
475733	121.72	81.21	0.036	146.31	89.30	0.222	173.94	39.02
475812	55.56	68.94	0.071	52.89	70.48	0.222	1013.17	36.02
476018	215.94	69.79	0.000	149.54	73.93	0.000	200.35	60.22
476033	52.90	64.70	0.000	34.53	60.01	0.111	864.12	31.66	CopyNumber	1p32.3	71
476179	91.06	79.60	0.000	59.30	85.57	0.111	194.12	38.59	CopyNumber	3p21.31	580
476221	77.62	67.55	0.000	66.80	51.17	0.222	603.05	35.35
476231	120.62	80.66	0.000	113.22	65.22	0.111	228.30	24.27
476308	50.43	72.23	0.000	22.50	50.59	0.222	178.95	107.93	CopyNumber	3p21.1	590
476365	125.14	67.35	0.036	87.65	77.78	0.111	406.18	49.02	CopyNumber	1p32.3	73
476448	56.29	82.54	0.036	26.09	48.03	0.111	273.21	70.63
476706	97.03	89.82	0.000	112.58	110.62	0.222	81.22	37.20
476930	73.54	58.53	0.000	66.80	47.34	0.111	174.86	28.52
477157	97.30	67.07	0.000	152.23	52.84	0.111
477789	135.93	79.84	0.000	117.57	72.54	0.222	721.27	53.90
477892	54.22	78.36	0.036	57.25	57.97	0.222	310.08	37.49
478000	61.18	64.58	0.071	50.48	78.17	0.111	341.67	50.94	CopyNumber	3q25.2	695
478044	157.68	91.75	0.000	243.91	67.91	0.000
478553	357.47	71.73	0.000	280.28	57.47	0.000	1815.88	27.23	CopyNumber	3q27.3	735
479208	55.97	70.67	0.036	49.83	85.49	0.222	273.64	45.06	CopyNumber	4p15.33-4p15.32	780
479264	106.91	90.31	0.036	53.68	100.71	0.222	408.08	53.78	CopyNumber	4p15.32	782
479634	75.32	68.03	0.036	41.66	53.90	0.000	172.97	40.28	CopyNumber	4p13	831
479693	199.97	56.38	0.000	130.06	53.34	0.111	284.38	38.70
479728	3167.05	83.62	0.000	3178.15	102.50	0.000	4934.56	42.86	CopyNumber	12p13.31	2368
479747	58.32	70.99	0.036	64.38	45.15	0.222	7.50	52.67	Inversion	16q23.1	2943
									CopyNumber
479814	102.92	68.90	0.071	58.18	86.26	0.111	282.68	26.04
480073	241.33	71.32	0.036	300.48	64.32	0.000	630.71	24.05
480311	95.21	89.15	0.036	59.40	90.37	0.222	67.76	39.38
480465	55.39	68.49	0.036	34.96	55.94	0.111	256.72	29.28
480653	169.77	90.52	0.000	190.63	63.63	0.222	682.67	41.50
481571	431.88	70.58	0.000	535.04	63.11	0.000	1077.46	44.16
481720	91.75	79.80	0.036	93.11	81.12	0.222	200.72	60.41
481898	48.63	73.18	0.000	50.50	72.53	0.111	147.39	32.08	CopyNumber	1p22.2	109
482144	699.37	85.86	0.000	471.96	66.50	0.000
482363	57.46	60.86	0.000	36.22	51.54	0.222	233.09	31.51
482526	173.99	63.94	0.000	168.03	60.84	0.000	627.83	38.92
482868	71.13	62.26	0.000	47.36	57.55	0.111	85.83	30.54
483036	72.48	86.03	0.071	34.06	72.88	0.222	186.72	49.93
483067	195.11	195.81	0.000	113.05	119.75	0.222	107.96	48.75
483305	113.38	77.80	0.000	53.80	57.74	0.222	1552.44	38.45	CopyNumber	5q31.1	1221
483408	105.32	59.58	0.000	101.17	58.25	0.222	332.91	23.51
483454	399.33	95.38	0.000	276.29	56.43	0.222	240.02	66.66
483486	64.58	70.29	0.071	53.21	62.00	0.111	273.51	21.50
484138	109.27	135.13	0.071	55.94	56.87	0.222	135.74	33.03	CopyNumber	5q35.1	1257
484188	71.54	89.14	0.071	98.14	90.97	0.111	1025.85	27.84	CopyNumber	5q35.2	1260
484242	66.51	68.78	0.000	36.97	64.48	0.222	152.49	26.36
484288	47.70	72.10	0.000	44.27	51.35	0.222	205.62	31.99
484363	111.91	74.19	0.000	128.94	71.40	0.000	135.92	30.55
484551	71.14	83.81	0.071	35.00	75.65	0.111
484813	114.27	92.28	0.071	140.15	85.01	0.222	357.48	42.75
485155	1995.97	104.91	0.000	1053.71	62.95	0.000	233.33	38.86
485195	91.72	72.46	0.036	32.33	115.62	0.222	98.61	44.74
485246	72.99	89.00	0.036	63.99	82.34	0.222	305.16	41.61
485262	222.02	65.94	0.000	121.08	68.51	0.111	1132.47	23.10
485365	87.98	89.21	0.036	50.62	83.69	0.222	24.30	39.23
485616	159.14	118.44	0.036	54.62	126.87	0.222	202.89	41.15
486542	57.11	66.70	0.036	40.95	55.22	0.111	532.52	25.97
487027	203.46	102.66	0.036	172.51	92.92	0.000	456.64	51.77
487054	162.70	83.58	0.000	196.99	81.02	0.111	96.63	33.00	CopyNumber	6q25.3	1460
487635	96.11	90.09	0.036	87.13	86.36	0.111	418.48	59.45
487774	476.18	69.59	0.000	441.11	76.24	0.000	858.14	28.90
488171	2935.95	78.74	0.000	1889.50	43.31	0.000	205.88	23.98
488181	93.55	66.18	0.000	72.82	72.57	0.111	150.84	51.09
488307	105.70	118.69	0.000	40.98	83.43	0.222	116.63	31.66
488478	70.53	63.31	0.000	60.31	56.88	0.222	531.39	27.89	CopyNumber	7q11.21-7q11.22	1563
488671	97.87	63.52	0.000	66.99	86.38	0.222	146.22	35.88	CopyNumber	7q11.23-7q11.22	1569
489207	159.98	229.58	0.036	95.96	93.07	0.000	100.25	84.19	CopyNumber	7q21.3	1596
489284	249.26	174.12	0.000	270.09	108.06	0.111	502.47	67.41	CopyNumber	7q22.1	1597
489287	88.36	72.56	0.000	89.22	87.25	0.111	137.90	40.47	CopyNumber	7q22.1	1597
489336	51.70	73.40	0.036	29.14	50.97	0.222	434.70	40.35
489615	110.09	157.53	0.000	87.65	120.96	0.111	238.13	62.54
490203	84.05	94.98	0.000	149.77	111.35	0.222	71.14	35.48
490394	86.70	80.08	0.036	124.86	65.68	0.000	343.69	34.12
490415	278.36	84.59	0.000	165.38	70.44	0.111	321.85	40.17
490745	170.33	67.85	0.000	174.03	73.05	0.111	107.47	33.33
490795	67.48	84.72	0.036	61.57	91.56	0.222	366.95	44.62
490874	62.57	71.64	0.071	51.50	59.92	0.222	199.27	40.49	CopyNumber	1q22	160
491336	43.04	79.86	0.071	26.67	61.36	0.222	59.45	31.69
491359	415.19	117.62	0.000	444.58	141.63	0.000	144.60	37.95
491440	218.31	84.00	0.000	127.99	68.91	0.111	584.73	41.60
491494	207.97	76.88	0.000	179.06	70.15	0.111	578.57	38.69
491597	82.40	68.90	0.071	78.66	71.01	0.111	47.73	29.91
491695	58.78	61.10	0.036	47.66	66.95	0.111	115.13	36.13	CopyNumber	8q11.21	1744
491745	69.36	79.23	0.036	91.43	97.21	0.222	517.81	34.02	CopyNumber	8q11.23	1756
491988	147.67	80.07	0.036	148.34	53.25	0.000	761.27	37.05
492236	61.94	58.47	0.071	53.23	50.26	0.111	378.81	31.38
492314	124.30	134.13	0.000	280.47	119.64	0.111	867.01	82.56
492445	51.32	79.94	0.071	34.07	68.47	0.222	235.18	33.32
492599	165.21	63.87	0.000	104.23	64.07	0.222	1025.28	42.75
492805	64.99	98.49	0.071	45.41	54.06	0.222	714.35	33.62
493362	49.75	78.53	0.036	36.00	66.40	0.111	1207.36	49.22
493750	28.58	62.06	0.036	19.06	55.52	0.222	369.95	32.38
494173	439.06	148.42	0.000	295.60	110.96	0.111	876.15	113.53
494419	112.59	79.67	0.000	84.24	54.97	0.222	1836.27	27.61
494457	192.87	75.88	0.000	131.41	71.03	0.111	140.35	49.81
494604	142.74	77.33	0.000	102.64	45.34	0.000	1093.70	32.75
494614	133.29	67.07	0.071	131.49	59.76	0.111	271.73	34.09
494691	1198.54	100.32	0.000	1473.17	85.74	0.000	1356.61	41.82	CopyNumber	17p13.2	2984
494700	88.15	111.44	0.036	45.03	71.95	0.222	142.65	50.45	CopyNumber	9q31.1	1982
494985	40.27	58.47	0.000	23.54	51.61	0.111	69.32	28.36
495039	82.23	77.88	0.000	53.22	87.48	0.111	241.85	32.88
495349	129.84	51.38	0.000	73.03	68.57	0.000	128.78	41.86
495471	85.88	132.48	0.000	61.04	104.84	0.222	111.31	28.11	CopyNumber	9q34.3	2030
495605	198.26	103.21	0.000	259.83	98.52	0.000	1069.64	37.36	CopyNumber	Xp22.33	3522
495851	129.92	103.41	0.036	155.32	96.68	0.000	133.50	48.69
495960	67.87	75.83	0.071	89.70	72.01	0.222	23.52	45.21
496068	56.40	80.35	0.036	68.03	85.57	0.222	133.18	34.99
496098	43.34	67.73	0.036	47.15	59.31	0.222	174.56	31.62
496271	70.79	89.89	0.071	67.91	73.61	0.222
496487	179.34	88.77	0.000	227.53	59.84	0.111	1039.79	27.70
496646	54.24	74.01	0.071	51.96	94.43	0.222	242.03	33.02
496684	127.56	91.16	0.000	90.84	89.82	0.111	116.47	51.77	CopyNumber	Xq24	3603
497183	76.25	76.76	0.036	93.97	66.65	0.111	259.92	53.23
497599	158.85	111.15	0.036	134.22	94.08	0.111	192.73	115.77
497692	45.74	81.57	0.036	38.61	69.57	0.222	88.50	26.06	CopyNumber	1q32.3	223
497893	73.14	70.25	0.036	80.49	54.75	0.222	85.47	38.00	CopyNumber	1q42.12	234
498239	51.25	85.83	0.071	42.11	68.85	0.222	313.30	70.17
498313	66.59	73.37	0.071	61.83	57.22	0.222	166.23	33.54
498317	67.33	97.53	0.036	34.96	52.65	0.222	241.17	32.40
498455	56.84	60.99	0.071	41.69	52.75	0.222	159.22	29.80
498548	84.57	65.53	0.036	83.74	56.09	0.111	544.75	28.88
498727	125.92	212.50	0.000	375.51	152.25	0.111	393.92	82.64
499145	85.44	63.76	0.036	90.25	49.65	0.000	362.61	30.38	CopyNumber	10p12.1	2075
499158	59.38	77.10	0.036	36.41	89.25	0.111	487.66	24.83	CopyNumber	22q13.1	3496
499594	46.30	68.79	0.000	38.30	61.11	0.111	43.26	67.66	CopyNumber	10q11.23	2097
499833	48.48	65.54	0.036	31.78	67.31	0.111	65.25	48.78
499891	103.56	64.27	0.036	90.85	48.08	0.000	119.21	32.55
499925	66.21	99.08	0.071	47.23	93.94	0.111	425.42	26.54
499960	87.25	53.38	0.036	75.36	58.96	0.111	230.51	30.46
500067	124.28	91.39	0.000	42.67	83.69	0.222	85.13	38.67
500101	122.06	91.91	0.000	122.55	71.82	0.222	523.98	46.28
500375	93.92	72.57	0.000	42.54	60.50	0.111	173.31	57.99
500409	228.78	90.31	0.000	97.98	79.16	0.222	111.85	38.24	CopyNumber	10q23.2	2151
500546	46.45	80.29	0.071	32.37	73.60	0.222	114.50	26.14
500674	132.96	61.65	0.036	100.83	54.64	0.111	101.84	40.78
500775	165.68	56.77	0.000	154.32	52.88	0.111	358.69	18.38
500842	194.92	76.32	0.000	109.14	53.92	0.000	70.07	32.85
500874	136.22	92.56	0.000	190.37	116.30	0.000	302.13	30.53
501012	80.79	80.92	0.036	59.53	67.35	0.222	56.69	51.38
501023	62.06	76.62	0.036	34.17	71.76	0.222	359.89	46.05
501203	75.46	60.32	0.036	58.65	70.61	0.000	203.01	29.78
501293	664.58	159.72	0.000	331.94	61.09	0.111	257.95	64.96
501309	203.81	91.32	0.000	179.56	76.44	0.000	74.58	38.37	CopyNumber	19p13.3	3198
501353	75.27	76.11	0.000	85.50	67.94	0.111	165.38	38.49	CopyNumber	19p13.3	3199
501376	54.58	74.39	0.000	46.23	52.90	0.222	117.83	30.84	CopyNumber	10q26.2	2190
501420	51.28	72.23	0.071	51.43	76.62	0.222	8.49	69.55
501629	197.55	193.96	0.071	304.65	100.03	0.000	1073.10	56.96
501684	77.93	67.20	0.071	72.15	58.11	0.111	182.45	25.59	CopyNumber	11p15.4	2203
501735	85.58	80.80	0.036	48.77	90.13	0.222	66.88	36.29	CopyNumber	11p15.4	2205
501853	55.61	66.72	0.036	45.46	83.18	0.111	258.40	27.75	CopyNumber	11p15.4	2212
501924	43.63	70.20	0.036	22.66	58.29	0.111			CopyNumber	11p15.3	2216
501991	51.17	74.39	0.071	51.32	69.18	0.222	239.62	40.48
502302	78.26	104.67	0.036	65.09	114.45	0.111	58.12	61.81
502328	183.18	105.65	0.036	192.87	102.65	0.000	277.01	57.86	CopyNumber	11p13	2243
502461	78.41	88.29	0.000	63.08	66.07	0.222	92.47	41.06
502528	151.30	68.66	0.000	135.26	95.87	0.111	414.87	34.37	CopyNumber	11p11.2	2254
502630	149.13	86.54	0.000	188.95	62.55	0.111	974.26	31.28
502659	234.42	83.71	0.000	137.92	78.61	0.000	418.65	40.34	CopyNumber	1p13.2-1p13.1	141
502705	84.60	75.99	0.000	63.68	62.88	0.222	200.89	34.78
502745	221.93	116.28	0.000	165.50	152.75	0.111	33.94	90.81
502769	123.67	70.29	0.000	127.45	65.13	0.000	146.88	43.18	CopyNumber	11q12.3	2269
502773	57.70	85.33	0.000	36.02	52.79	0.222	382.36	89.13
502823	216.88	89.25	0.000	97.58	72.37	0.000	1483.75	48.37
502829	141.67	49.99	0.000	140.90	56.82	0.000	377.34	29.68	CopyNumber	11q13.1	2274
502836	119.31	80.42	0.000	108.10	81.32	0.222	186.99	39.86
502842	88.58	98.83	0.071	91.38	63.44	0.111	262.91	27.81
502872	72.97	160.73	0.000	168.69	130.10	0.111	162.72	27.57
502876	283.76	121.94	0.036	240.25	126.64	0.111	1110.19	63.79
503093	280.17	105.81	0.000	272.03	101.56	0.000	1003.83	41.56
503222	119.21	70.44	0.000	78.57	60.15	0.111	436.02	32.33
503251	59.51	75.49	0.036	52.37	80.76	0.000	269.32	30.58	CopyNumber	11q13.4	2286
503597	58.03	72.02	0.036	44.54	65.19	0.222	993.22	28.63
503709	79.34	80.48	0.036	56.09	56.61	0.000	359.18	41.09
503716	54.63	74.54	0.036	67.10	57.41	0.111	401.83	39.72	CopyNumber	11q22.3	2327
503787	100.30	62.10	0.036	88.32	64.96	0.222	94.48	36.57
504237	77.26	84.57	0.071	67.58	73.38	0.111	96.18	41.40
504517	2547.00	74.64	0.000	2607.18	71.46	0.000
504613	308.10	89.25	0.000	223.84	85.33	0.111	62.36	60.07
504620	136.79	86.81	0.000	160.25	104.00	0.111	1302.64	32.11
504687	340.49	187.11	0.000	417.49	95.88	0.222	784.44	114.26
504828	43.21	60.20	0.036	35.05	61.58	0.222	272.03	32.15
504895	122.68	88.83	0.000	185.08	83.41	0.000	509.46	28.54
505033	57.38	85.57	0.071	37.32	52.34	0.000	231.87	47.13
505059	180.27	69.53	0.000	146.67	85.08	0.000	401.54	42.58
505625	80.93	85.89	0.036	105.74	98.40	0.111	141.17	35.31
505652	217.03	54.99	0.000	128.09	56.80	0.000	337.62	27.67
505676	118.62	67.86	0.036	90.76	76.70	0.222	152.86	29.88
505705	1121.48	81.22	0.000	811.93	36.92	0.000	2225.97	26.97	CopyNumber	12q13.2	2429
505806	72.04	90.69	0.036	62.89	118.65	0.222	193.34	42.44
505824	59.28	125.62	0.071	46.25	72.86	0.111	171.87	30.26	CopyNumber	22q13.31	3505
506215	103.05	79.99	0.000	94.43	66.41	0.000	157.71	28.13
506325	161.89	83.72	0.071	84.67	58.55	0.111	347.25	61.58
506759	195.37	118.14	0.036	94.62	70.61	0.111	37.81	36.31
506861	74.73	78.06	0.000	95.81	90.86	0.000	79.06	33.92
507074	77.13	74.70	0.000	83.96	62.86	0.222	432.06	61.29
507162	143.42	98.40	0.000	29.80	68.25	0.111	92.08	59.64
507584	107.77	68.17	0.000	150.24	63.80	0.000	369.22	38.69
507680	63.32	54.78	0.036	49.68	77.53	0.222	203.53	42.58
507910	124.83	69.11	0.000	69.36	64.68	0.111	88.32	41.59
507916	243.46	97.27	0.036	192.99	102.63	0.000	52.82	43.91
508010	110.98	93.45	0.036	32.99	90.85	0.222	166.37	35.28
508644	65.60	68.43	0.036	49.21	55.85	0.222	110.99	40.54
509163	94.35	93.24	0.036	35.34	54.15	0.222	375.23	41.32
509226	140.21	88.83	0.000	236.57	70.64	0.000	179.58	33.62
509264	121.90	71.38	0.000	82.07	77.38	0.000	427.67	35.66
509414	88.75	89.01	0.036	72.77	69.54	0.000	512.55	27.88
509622	93.28	105.94	0.036	112.54	148.47	0.000	237.96	45.40
509736	550.72	72.67	0.000	720.87	60.73	0.111	4674.01	38.38
509791	256.46	66.04	0.036	289.40	66.68	0.000	2482.97	38.50
509909	58.22	66.97	0.036	31.58	63.60	0.222	102.28	29.40
510087	159.53	96.58	0.036	144.88	56.65	0.000
510328	75.63	60.49	0.000	87.51	60.32	0.111	344.12	27.98
510402	81.27	70.87	0.071	74.30	67.71	0.222	332.17	39.17
511067	39.66	63.37	0.071	30.52	92.27	0.222	178.77	26.75
511138	82.26	72.01	0.071	51.32	77.97	0.111	386.10	50.09	CopyNumber	15q15.1	2768
511149	51.21	73.09	0.071	47.43	61.92	0.222	219.59	40.88
511425	454.09	66.07	0.000	306.59	64.17	0.000	766.85	32.72
511504	69.32	156.60	0.036	118.98	198.75	0.222	93.53	41.90
511862	84.86	113.15	0.036	78.27	91.67	0.111
511952	64.59	83.56	0.036	45.39	80.23	0.222	280.77	42.92
512005	119.68	86.15	0.000	177.05	97.71	0.000
512465	106.55	60.22	0.000	101.69	51.11	0.000	1328.32	37.34
512525	599.75	140.21	0.000	564.24	59.56	0.111			CopyNumber	15q25.2	2822
512607	98.46	74.76	0.000	66.75	86.55	0.111	188.34	40.78
512640	131.74	95.97	0.036	87.26	49.87	0.000	353.07	25.39
512661	115.05	114.56	0.036	78.95	73.16	0.111	225.56	27.09
512676	286.69	89.69	0.036	472.46	56.90	0.000	3826.23	33.98
512693	29.73	65.72	0.071	32.21	61.74	0.222	243.81	32.66	CopyNumber	14q11.2	2641
512756	51.73	68.12	0.071	36.00	87.05	0.222	82.76	24.22	CopyNumber	22q11.21	3469
512815	107.57	57.32	0.000	72.82	58.05	0.222	349.78	23.00	CopyNumber	19p13.3	3199
512857	378.94	98.39	0.000	389.64	108.93	0.000	236.30	44.67	CopyNumber	11p15.5	2200
512867	100.14	145.32	0.000	57.53	59.42	0.111	756.60	42.54
512908	146.97	81.46	0.000	139.12	83.26	0.000	529.32	26.51
513043	47.55	79.47	0.036	65.23	53.50	0.222	200.34	26.92
513055	70.68	71.45	0.036	46.53	69.38	0.111	428.66	34.03
513057	101.08	72.89	0.000	108.87	84.74	0.000	172.47	40.79
513058	114.71	89.89	0.000	89.17	120.69	0.111	251.55	55.04
513071	50.82	80.98	0.036	61.02	85.52	0.111	416.01	37.15
513083	740.57	90.78	0.000	747.03	87.03	0.000	13273.59	32.07
513141	172.64	104.92	0.000	106.35	102.92	0.222	68.76	57.99	CopyNumber	15q26.1	2836
513145	91.71	72.65	0.000	82.48	62.05	0.111	690.46	36.42	CopyNumber	15q26.1	2836
513153	67.56	127.64	0.036	57.82	56.98	0.000	112.68	79.81
513230	67.94	68.82	0.036	88.04	62.79	0.111	102.18	30.45	CopyNumber	16p13.3	2866
513242	59.56	76.58	0.036	70.14	78.60	0.000	134.47	29.60	CopyNumber	16p13.3	2866
513261	62.28	83.40	0.036	100.06	63.05	0.000	66.99	49.34	CopyNumber	16p13.3	2866
513266	42.16	88.47	0.000	43.44	51.74	0.222	420.41	37.37	CopyNumber	16p13.3	2866
513470	30.57	74.31	0.071	23.98	100.87	0.222	126.44	34.12	CopyNumber	16p11.2	2900
513488	79.08	126.33	0.071	80.83	109.04	0.111	135.41	35.18
513490	916.32	141.10	0.000	600.22	108.89	0.000	1936.06	50.21	CopyNumber	16p11.2	2903
513520	51.25	74.53	0.036	51.84	63.38	0.222	107.26	38.88
513522	172.34	86.72	0.000	262.60	56.68	0.000	109.64	38.78
513631	60.80	66.09	0.036	43.26	73.49	0.222	231.71	24.36
513856	162.16	69.11	0.000	58.26	78.43	0.111	50.56	33.92
513984	61.58	103.20	0.036	56.92	80.13	0.111	110.00	28.54	Inversion	17p11.2	2999
514012	68.18	104.20	0.000	68.14	88.15	0.222	111.02	33.44
514036	49.32	78.04	0.071	40.32	72.95	0.111	150.39	21.29
514038	103.22	71.06	0.071	98.33	73.54	0.222	282.81	33.39
514174	204.87	127.42	0.036	218.64	117.36	0.111	423.86	101.58
514196	927.28	72.49	0.000	707.66	61.15	0.000	8554.76	27.60	CopyNumber	17q21.31	3024
514211	109.02	139.51	0.036	50.70	81.92	0.222	182.87	97.71
514216	162.85	73.83	0.000	115.83	85.67	0.111	792.84	46.18
514220	216.06	104.37	0.000	175.85	118.04	0.222	722.34	44.39
514297	84.41	72.66	0.036	77.55	75.65	0.222	353.72	26.50	CopyNumber	17q21.32	3034
514303	142.93	86.25	0.000	174.64	95.39	0.222	134.97	51.53	CopyNumber	17q21.33	3035
514435	44.20	68.14	0.036	40.72	84.74	0.222	147.89	37.81	CopyNumber	16q22.1	2937
514489	147.04	80.99	0.071	44.98	74.04	0.000	217.12	36.85
514535	117.40	115.82	0.036	81.79	89.33	0.222	806.22	54.38
514581	1374.42	87.86	0.000	2385.84	64.09	0.000	12015.94	27.98	CopyNumber	17q25.3	3086
514590	88.17	79.57	0.000	82.16	60.88	0.111	270.30	30.55
514819	92.79	63.43	0.000	91.91	57.33	0.111	146.77	39.49	CopyNumber	17q12	3015
514870	84.88	75.67	0.036	116.52	66.41	0.111	1076.27	31.74
514920	46.59	70.87	0.036	42.93	92.05	0.222	305.87	26.30	CopyNumber	17q21.32	3034
514934	101.72	64.83	0.000	93.36	57.74	0.222	489.19	36.29	CopyNumber	1p13.2-1p13.1	141
515003	96.49	90.52	0.000	73.12	71.02	0.111	244.41	34.43	CopyNumber	19p13.3	3198
515005	66.15	84.23	0.036	84.14	115.67	0.111	111.71	28.21	CopyNumber	19p13.3	3198
515018	72.69	81.16	0.036	38.38	92.19	0.222	975.69	36.28	CopyNumber	17q24.1	3057
515053	258.48	79.56	0.036	327.53	82.45	0.000	130.71	37.38	CopyNumber	19p13.3	3201
515070	2097.60	61.50	0.000	1309.96	51.55	0.000	2287.41	36.04
515092	50.27	92.89	0.071	63.55	123.14	0.222	142.44	34.66
515155	117.34	77.95	0.000	107.39	48.32	0.222	1314.81	29.66
515162	110.24	99.70	0.000	174.56	65.50	0.111	738.50	33.21	CopyNumber	19p13.13	3220
515164	107.72	83.59	0.000	81.45	86.75	0.222	111.33	38.03
515210	330.45	159.79	0.000	500.13	127.33	0.111	405.99	51.27
515255	139.77	77.20	0.000	150.61	99.16	0.000	275.62	55.00
515266	60.23	74.02	0.036	54.18	59.54	0.222	129.69	29.52
515271	47.59	69.78	0.071	36.74	77.34	0.111	130.40	32.76
515329	455.30	66.72	0.000	534.24	65.17	0.000	3426.69	32.80	CopyNumber	1p36.31	17
515371	519.15	70.79	0.000	343.10	48.33	0.111	1005.23	29.71
515406	101.41	149.32	0.000	65.79	61.04	0.222	287.02	37.67	CopyNumber	19q13.2	3259
515417	141.94	66.12	0.000	107.98	54.42	0.000	153.02	44.34	CopyNumber	19q13.2	3260
515432	52.49	97.88	0.036	44.58	59.07	0.111	404.46	33.77
515472	250.23	85.54	0.000	277.80	71.92	0.000	1110.26	42.17
515475	43.73	68.85	0.071	36.35	61.24	0.222	28.67	48.11
515487	170.52	274.74	0.000	142.33	104.31	0.111	173.36	32.28
515494	90.90	119.52	0.071	146.78	92.71	0.111	112.41	47.69	CopyNumber	19q13.32	3268
515500	84.41	76.81	0.000	102.79	91.08	0.222
515515	278.16	49.82	0.000	182.19	48.37	0.000	152.89	38.45	CopyNumber	19q13.32	3273
515517	361.65	88.12	0.000	299.84	58.12	0.000	7157.08	36.30
515524	177.67	71.77	0.000	80.95	66.53	0.111	391.51	35.24	CopyNumber	19q13.33	3275
515540	165.98	75.18	0.000	189.06	82.37	0.111	165.22	50.26	CopyNumber	19q13.33	3278
515550	234.71	69.11	0.000	172.43	76.53	0.111	561.99	34.69
515598	57.93	74.86	0.071	38.40	66.79	0.111	138.35	27.47
515607	50.41	65.02	0.036	55.58	56.62	0.111	158.32	52.15	CopyNumber	19q13.42	3288
515642	122.06	65.18	0.000	99.65	61.65	0.000	197.53	45.80
515785	182.67	105.76	0.036	219.93	101.68	0.000	214.35	62.17
515846	97.93	76.72	0.036	69.80	136.41	0.222	151.33	51.40	CopyNumber	19q13.33	3276
515848	98.50	79.47	0.000	50.31	62.08	0.111	672.95	55.07
515890	123.75	80.81	0.036	100.90	82.45	0.111	935.79	30.21	CopyNumber	2p23.2-2p23.1	300
516075	93.19	80.99	0.036	54.66	76.57	0.222	157.18	35.84
516077	61.98	82.82	0.071	56.97	75.78	0.000	146.37	36.19
516087	33.17	72.96	0.071	33.52	80.94	0.222	302.28	19.82
516111	64.73	89.42	0.000	51.66	89.35	0.222	183.74	28.09	CopyNumber	2p13.1	358
516114	42.16	76.16	0.071	48.69	52.22	0.111	215.69	73.89	CopyNumber	2p13.1	356
516157	242.05	71.75	0.000	187.71	78.16	0.000	146.38	36.40
516450	118.46	82.86	0.000	54.05	65.03	0.222	129.56	29.36	CopyNumber	2q14.3-2q21.1	410
516522	59.15	78.65	0.000	43.56	73.85	0.222	158.20	39.84
516539	168.69	64.18	0.000	157.83	64.03	0.111	335.66	28.98
516587	69.25	75.09	0.036	89.91	71.91	0.111	266.02	25.33
516533	153.54	70.34	0.036	119.71	62.46	0.111	38.49	36.65	CopyNumber	2q32.1	456
516711	128.03	87.42	0.000	50.69	95.23	0.222	148.16	36.16
516790	59.83	76.19	0.071	46.62	74.67	0.222	107.23	36.95
516807	64.72	71.31	0.000	60.83	83.48	0.222	86.90	29.56	CopyNumber	2q37.3	516
516826	50.84	108.19	0.071	35.66	84.03	0.111	151.54	92.04
516855	82.21	76.73	0.000	81.22	90.29	0.111	67.23	34.92
517080	60.57	76.28	0.071	23.53	51.42	0.222	79.83	30.97
517106	155.23	158.42	0.036	155.61	98.37	0.222	1027.69	57.60
517134	79.36	72.40	0.000	77.76	62.28	0.111	210.01	25.80
517145	166.84	114.98	0.036	448.32	88.56	0.000	135.06	29.88
517168	595.39	83.39	0.000	616.48	87.90	0.000	607.75	49.57
517216	201.83	119.03	0.000	135.47	130.41	0.222	76.10	46.15
517232	78.36	73.76	0.071	32.93	49.49	0.111	125.67	43.67
517240	79.49	62.59	0.036	68.91	63.03	0.111	546.02	33.01
517262	111.91	56.95	0.036	106.71	47.20	0.000	453.65	25.51
517293	1045.83	86.33	0.000	196.11	66.38	0.111	1344.41	51.31
517338	122.60	80.24	0.000	77.61	75.20	0.111	340.46	41.14
517342	55.11	163.80	0.071	33.97	52.74	0.222	152.42	25.59
517356	169.44	140.28	0.000	114.91	84.11	0.222	170.23	74.30
517357	88.38	55.86	0.000	28.35	52.86	0.111	107.26	33.50	CopyNumber	22q11.21	3463
517421	70.11	80.19	0.000	44.23	77.66	0.222	119.57	29.20	CopyNumber	22q11.21	3467
517438	46.79	78.06	0.036	26.64	70.20	0.222	67.48	48.02
517517	70.50	71.96	0.036	47.98	48.58	0.222	59.52	37.67
517543	66.78	68.12	0.036	74.51	88.10	0.111	83.91	46.35
517582	49.05	97.38	0.071	65.71	77.50	0.222	104.81	77.46
517622	86.59	74.85	0.000	74.01	87.22	0.222	166.60	36.65
517641	35.18	62.07	0.036	22.98	61.04	0.222	296.00	30.89
517666	125.03	82.83	0.036	80.25	64.44	0.222	667.96	39.27	CopyNumber	22q13.2	3504
517731	83.26	91.26	0.000	65.22	73.35	0.000	220.84	43.41
517768	90.63	117.43	0.036	25.76	80.17	0.222	508.84	63.13
517792	101.16	64.90	0.000	96.83	54.04	0.000	859.89	24.77
517817	40.01	69.75	0.071	33.30	51.38	0.111	305.79	29.77
517821	154.05	70.35	0.000	131.04	69.12	0.000	671.35	29.32
517888	87.57	77.52	0.036	95.09	58.38	0.222	103.41	36.07
517948	70.11	68.83	0.036	63.83	84.82	0.222	141.09	23.16	CopyNumber	3p21.31	580
517949	204.68	71.07	0.036	123.55	64.91	0.222	203.81	34.54
517969	65.68	81.54	0.036	84.63	88.21	0.222	142.60	39.43
517981	47.18	78.80	0.000	22.98	50.79	0.222	103.97	29.66	CopyNumber	3p21.31	586
518060	144.14	65.51	0.036	134.03	74.66	0.000	392.29	40.39
518123	95.89	62.29	0.036	95.99	66.38	0.111	474.82	27.22
518236	130.33	84.23	0.036	80.10	61.00	0.000	319.95	36.04
518244	155.16	55.08	0.000	111.32	61.11	0.000	314.23	33.48	CopyNumber	3q21.3	668
518249	229.80	60.78	0.000	175.57	66.17	0.111	786.47	28.84
518250	130.03	62.86	0.036	67.52	62.70	0.111	145.96	34.99
518265	187.87	54.39	0.000	141.98	43.28	0.000	341.22	32.71
518326	106.11	63.93	0.036	210.14	56.18	0.000	903.16	40.84
518346	92.36	76.42	0.000	96.28	40.13	0.111	1384.11	39.61	CopyNumber	3q25.31	703
518374	145.16	194.16	0.000	83.91	105.38	0.111	228.30	73.20	CopyNumber	1q25.2-1q25.3	186
518424	63.18	65.39	0.000	65.91	71.07	0.111	472.78	36.48
518460	110.88	86.56	0.000	144.56	61.00	0.111	474.56	36.78	CopyNumber	3q27.1	733
518464	173.46	78.82	0.000	131.96	60.97	0.222	341.49	43.16	CopyNumber	3q27.1	733
518525	580.48	108.66	0.000	559.19	97.79	0.000	1176.03	58.17
518551	1315.12	87.47	0.000	989.61	83.61	0.000
518608	87.02	66.98	0.036	53.34	50.94	0.222	233.50	33.35
518609	86.13	135.38	0.000	166.56	130.43	0.111	588.35	32.89
518750	557.63	94.60	0.000	288.21	79.65	0.000	1360.79	25.92
518805	519.78	142.88	0.000	1068.25	127.25	0.000	249.62	81.08
518827	378.10	57.74	0.000	355.52	56.22	0.111	84.24	38.17
519276	110.38	93.94	0.000	113.47	81.01	0.000	230.33	36.58	CopyNumber	1q32.1	213
519304	91.66	60.54	0.036	36.33	87.42	0.222	114.84	33.78
519346	52.83	66.16	0.071	34.53	74.90	0.222	314.36	37.07	CopyNumber	5q12.3	1140
519347	53.48	68.95	0.071	34.71	73.49	0.222	207.52	27.55
519520	1253.26	70.03	0.000	741.35	73.96	0.000
519523	97.35	81.66	0.000	55.73	84.24	0.222	3.52	261.11
519557	71.79	79.60	0.000	93.24	91.88	0.111	2662.06	27.88
519718	51.02	67.90	0.036	45.99	67.49	0.000	115.89	35.44
519756	33.36	92.45	0.071	40.69	113.09	0.222	132.53	29.71	CopyNumber	5q35.1	1258
519818	124.43	97.23	0.000	59.90	67.91	0.111	188.05	33.00	CopyNumber	5q35.3	1273
519909	315.50	101.05	0.000	244.91	76.44	0.222	117.68	50.36
519930	140.39	69.33	0.036	121.92	56.23	0.111	110.92	29.41
520026	122.24	87.98	0.000	108.58	87.98	0.222	62.19	41.41
520028	697.50	222.76	0.000	1404.48	164.02	0.000	1040.72	63.83
520037	108.45	63.50	0.071	45.72	74.52	0.222	158.73	56.07
520070	234.43	64.71	0.000	185.65	53.29	0.111	672.92	34.49
520140	78.21	84.60	0.036	75.11	85.11	0.111	74.72	42.98
520189	92.84	97.80	0.036	77.42	57.29	0.222	38.86	41.39
520205	137.26	70.26	0.000	81.96	68.26	0.222	596.12	27.17
520210	163.28	74.37	0.000	122.94	70.34	0.222	538.81	39.96
520287	51.33	65.65	0.071	131.99	67.30	0.111	252.76	37.55
520313	179.75	83.70	0.036	103.31	73.66	0.000	842.14	32.44
520383	62.05	69.15	0.036	54.79	74.80	0.222	51.28	37.61
520421	142.93	121.20	0.071	155.06	87.58	0.111	2195.13	80.88
520459	291.72	84.53	0.000	159.85	66.78	0.111	399.69	40.23	InversionBreak	7q11.23	1572
									point
									CopyNumber
520623	33.85	81.68	0.036	27.31	61.61	0.222	248.55	33.13
520640	1348.49	91.02	0.000	1961.29	60.59	0.111	5036.63	31.42	CopyNumber	7p22.1	1487
520740	116.36	85.41	0.000	97.72	112.58	0.111	187.18	70.60
520794	50.36	70.80	0.036	49.78	44.95	0.111	40.24	56.59	CopyNumber	7p13	1537
520898	454.52	110.99	0.000	400.82	102.01	0.000	21.23	57.80
520943	219.24	59.21	0.000	305.60	62.29	0.000	662.42	26.48
520967	186.05	70.34	0.000	252.42	65.79	0.000	120.89	29.85	CopyNumber	7q11.23	1572
520973	466.81	130.49	0.000	298.97	145.41	0.111	1152.33	82.08	CopyNumber	7q11.23	1572
520974	260.44	80.79	0.036	179.20	74.93	0.111	1930.00	33.13	CopyNumber	7q11.23	1572
521064	78.88	70.08	0.071	60.61	80.98	0.111	558.65	43.97
521151	46.43	85.62	0.036	47.47	134.19	0.222	127.30	30.14
521289	86.72	65.97	0.036	64.57	62.31	0.222	236.18	49.64
521487	363.27	69.54	0.000	276.67	67.15	0.000	538.96	41.02
521640	1470.83	133.20	0.000	85.15	63.55	0.111	298.27	31.34
521809	78.57	69.55	0.000	72.24	94.32	0.000	125.31	30.12	CopyNumber	9q34.3	2030
521903	224.92	143.71	0.000	176.08	67.76	0.000	27.38	72.01
521924	89.56	82.37	0.036	59.55	73.11	0.111	401.23	45.90
521969	136.30	86.81	0.000	55.63	96.01	0.000	400.95	33.05
521973	49.95	80.96	0.036	39.93	90.53	0.111	142.18	54.69
522074	98.72	162.66	0.071	183.70	145.60	0.000	75.36	43.60
522110	42.72	63.85	0.071	29.44	57.72	0.222	152.37	38.21
522114	155.26	58.16	0.000	93.47	54.91	0.000	909.36	30.72
522310	91.19	102.19	0.036	111.23	114.70	0.111	227.49	72.44
522373	323.96	177.96	0.000	134.50	163.88	0.111	1015.67	83.01
522394	784.29	84.47	0.000	695.64	96.96	0.000	892.36	34.63
522463	3936.86	71.14	0.000	4621.60	78.17	0.000
522507	108.16	66.02	0.036	114.54	64.14	0.000	369.13	29.46	CopyNumber	9q34.3	2030
522584	1985.02	80.07	0.000	1864.38	65.53	0.000	2817.95	42.35
522590	125.35	65.85	0.000	87.04	74.78	0.111	155.78	39.35
522632	193.45	157.61	0.000	149.26	117.91	0.111	1399.30	82.97
522665	74.89	99.28	0.071	78.39	77.48	0.111	169.43	65.16
522675	56.35	68.02	0.071	35.39	56.96	0.222	89.16	49.55
522752	74.90	63.85	0.036	65.13	87.37	0.111	226.13	30.00
522817	110.80	92.87	0.000	243.72	76.57	0.000	446.45	43.91
522819	147.41	75.66	0.000	128.02	77.03	0.000	442.54	53.56
522823	89.83	65.96	0.000	55.52	55.51	0.111	80.40	39.08	Inversion	Xq28	3631
522932	63.66	74.41	0.071	62.12	87.31	0.222	932.94	35.74	CopyNumber	10q11.23	2097
522995	72.69	72.57	0.000	92.76	85.46	0.222	155.41	29.78
523004	854.93	91.74	0.000	1093.46	104.71	0.000	1020.96	39.57
523012	174.92	151.59	0.036	108.27	101.71	0.111	460.74	105.86
523054	109.08	58.03	0.000	85.81	56.99	0.111	215.84	28.86	CopyNumber	1p36.11	48
523131	61.64	64.37	0.036	54.95	87.13	0.000	176.91	27.06
523145	119.03	77.65	0.000	77.46	74.44	0.000	713.08	34.57
523215	132.65	72.87	0.000	87.19	71.68	0.111	515.77	29.73	CopyNumber	10q24.31	2164
523238	97.37	72.68	0.000	120.04	66.25	0.222	77.37	32.28
523262	168.88	70.08	0.036	131.35	69.97	0.000	1073.88	31.10
523299	112.29	84.00	0.071	94.08	72.86	0.222	94.93	27.98
523302	83.94	73.40	0.036	52.80	58.41	0.111	39.16	33.68
523560	822.83	81.28	0.000	971.82	62.39	0.000
523680	128.11	83.52	0.000	107.04	96.51	0.111	160.42	34.93
523789	400.45	160.56	0.000	399.15	138.88	0.000	126.46	81.17
523829	73.03	93.80	0.036	62.35	75.95	0.111	128.33	63.45
523836	390.11	118.62	0.000	551.15	91.25	0.000	692.25	64.89	CopyNumber	11q13.1-11q13.2	2278
523852	315.81	122.32	0.000	140.78	82.29	0.222	223.69	123.19	CopyNumber	11q13.2-11q13.3	2280
523875	52.62	85.23	0.036	67.45	82.01	0.222	138.28	32.54
524009	73.36	72.05	0.071	48.51	71.53	0.222	181.41	38.91
524081	43.70	79.74	0.036	25.40	66.56	0.222	131.07	30.87
524084	45.76	71.59	0.000	52.46	63.40	0.222	310.09	30.43
524161	81.94	56.55	0.071	58.04	46.88	0.000	158.34	33.48	CopyNumber	10p13	2062
524171	57.90	65.02	0.036	39.20	45.15	0.222
524183	195.27	99.77	0.036	250.38	82.32	0.111	259.10	66.52	CopyNumber	12p13.33	2363
524195	102.62	77.48	0.036	45.90	110.88	0.222	329.67	54.17
524214	109.61	65.06	0.000	93.97	80.62	0.111	429.42	38.04
524219	928.11	102.77	0.000	1283.75	138.72	0.000	1413.03	41.62
524271	59.03	101.04	0.000	72.07	117.41	0.111	303.87	28.52
524367	95.25	97.52	0.000	23.68	69.12	0.222	212.52	34.89
524395	779.97	160.71	0.071	629.43	152.46	0.111	691.04	113.98
524464	295.35	63.84	0.000	249.77	51.93	0.111	800.60	36.87
524502	55.12	63.30	0.036	38.16	53.21	0.222	35.02	67.39	CopyNumber	12q13.2	2429
524530	54.40	62.04	0.071	58.64	69.36	0.222	119.54	33.29
524590	39.33	62.24	0.071	32.90	59.64	0.222	168.27	24.98	CopyNumber	12q21.1	2454
524599	179.39	101.39	0.036	171.63	88.17	0.111	877.45	45.68
524690	60.86	157.16	0.071	37.45	91.05	0.222	129.11	25.70	CopyNumber	1p34.2	60
524788	47.40	66.86	0.071	46.71	77.38	0.222	152.65	26.13
524809	71.42	81.00	0.071	32.60	68.39	0.222	71.44	35.75
524899	89.47	64.26	0.000	95.67	74.61	0.222	638.70	30.17
524920	99.40	66.48	0.000	61.67	67.69	0.111	789.95	26.29
524969	85.23	65.49	0.000	50.51	61.47	0.222	159.56	35.37
525134	77.25	62.67	0.036	52.40	77.61	0.222	157.75	32.67
525163	92.10	68.79	0.036	118.15	66.40	0.000	209.09	38.04
525232	71.88	89.47	0.036	78.60	84.11	0.000	536.96	31.58
525238	130.29	93.87	0.000	59.16	67.35	0.111	602.44	37.66
525330	129.69	77.23	0.000	183.06	61.77	0.000	381.49	40.05
525391	44.15	59.57	0.036	42.13	65.68	0.222	156.20	32.83	CopyNumber	1p32.3	74
525527	57.33	71.43	0.071	100.14	58.46	0.111	184.06	29.23	CopyNumber	1p36.33-1p36.32	4
525626	36.14	70.54	0.036	28.27	80.56	0.222	93.85	33.60	CopyNumber	14q32.33	2747
525899	114.56	90.18	0.000	114.54	61.10	0.222	197.83	28.39
526464	75.33	68.99	0.036	26.13	58.80	0.222	142.58	30.88	CopyNumber	15q24.1	2808
526521	302.75	96.01	0.000	250.88	101.74	0.000	147.15	33.86
527105	425.77	68.10	0.000	371.42	53.26	0.000	445.41	26.61
527193	1153.32	66.74	0.000	1409.75	60.87	0.000	54.69	37.93
527348	39.34	68.02	0.071	31.17	107.14	0.111	156.88	41.93
527412	124.23	112.08	0.036	111.78	104.84	0.222	954.00	37.46
527861	157.27	75.05	0.000	174.55	93.72	0.000	778.13	44.76
527862	135.27	77.71	0.000	121.83	69.64	0.222			CopyNumber	16p13.3	2866
527980	96.02	93.19	0.000	140.08	80.91	0.111	72.21	28.28	CopyNumber	15q21.1	2774
528050	39.25	86.07	0.071	39.50	93.86	0.222	153.01	24.84
528222	72.79	71.25	0.000	56.92	67.43	0.222	297.99	38.18
528300	46.35	70.72	0.071	37.21	64.60	0.111	143.10	32.16	CopyNumber	10p15.2-10p15.3	2038
528305	235.95	69.32	0.000	323.87	54.84	0.000	1767.97	27.06
528572	62.31	107.18	0.036	40.58	69.71	0.222	121.35	39.94	CopyNumber	8p21.3	1710
528668	572.62	82.67	0.000	640.96	72.93	0.000
528780	73.97	78.91	0.036	95.64	74.72	0.111	545.27	28.60
528803	118.93	63.96	0.000	69.19	61.88	0.222	637.49	39.09	Inversion	16p12.2-16p12.1	2894
529059	112.54	86.70	0.000	155.84	79.33	0.000	436.61	43.10	CopyNumber	19p13.2	3216
529132	115.82	101.86	0.000	206.58	89.23	0.000	607.67	37.45
529244	42.17	79.26	0.036	48.81	59.97	0.222	299.18	31.69	CopyNumber	2q12.2	387
529280	51.63	59.84	0.036	42.59	87.27	0.222	122.27	29.28
529303	204.04	118.67	0.000	324.14	115.14	0.111	857.43	38.03
529369	54.85	89.29	0.000	25.26	76.50	0.111	9.01	69.95
529400	76.16	76.13	0.000	40.63	114.07	0.111	32.05	45.08
529420	928.90	107.73	0.000	106.80	48.77	0.000	56.41	37.58
529591	80.62	68.74	0.000	78.81	61.99	0.111	467.29	39.56
529618	89.51	87.09	0.036	82.62	91.59	0.111	36.01	56.84	CopyNumber	3q29	753
									Inversion
									CopyNumber
529631	891.99	74.72	0.000	620.31	56.60	0.000	176.79	30.79	CopyNumber	3q29	755
529782	173.75	58.53	0.000	130.67	66.49	0.000	146.41	27.77
529798	270.43	75.07	0.000	328.92	49.58	0.000	1755.52	30.60
529862	102.92	62.81	0.000	117.16	56.20	0.222
529890	448.92	63.76	0.000	331.32	41.79	0.000	3988.58	27.20	CopyNumber	5q35.3	1270
529892	194.96	108.94	0.036	139.13	107.43	0.222			CopyNumber	5q35.3	1271
529957	70.58	57.49	0.036	71.45	52.24	0.000	242.41	35.55
530096	284.86	68.28	0.000	137.92	57.16	0.111	422.18	29.43
530118	74.65	65.41	0.000	57.21	50.39	0.111	386.79	22.90
530291	75.64	94.65	0.000	62.14	78.23	0.000	77.23	37.30
530314	75.26	113.91	0.000	72.35	69.84	0.111	135.51	32.51	CopyNumber	9q34.3	2030
530331	104.89	79.95	0.071	96.65	72.31	0.111	393.16	48.43
530381	42.02	84.23	0.000	44.92	94.49	0.111	740.81	47.85
530412	569.26	108.42	0.000	884.31	121.35	0.000	755.69	25.73
530436	71.84	68.51	0.036	39.15	65.12	0.000	89.36	36.15
530479	60.22	68.09	0.071	50.16	67.87	0.222	130.74	30.76
530687	126.29	76.35	0.000	123.16	101.20	0.111	388.74	29.72	CopyNumber	11p15.5	2200
530734	48.51	78.25	0.036	43.82	67.00	0.222	203.80	36.73
530753	132.79	64.89	0.000	122.19	58.43	0.111	1049.37	27.21
530823	52.43	71.41	0.036	34.72	46.24	0.111	219.78	24.63
530862	38.26	76.97	0.071	24.06	57.79	0.111	216.03	27.91	CopyNumber	12q13.12	2421
531081	403.19	144.33	0.000	188.82	111.97	0.111	1778.83	73.47
531089	54.35	64.92	0.000	58.25	72.81	0.222	240.62	40.78
531176	137.35	69.91	0.036	192.02	57.22	0.111	407.01	25.65
531330	125.23	73.90	0.000	113.07	68.46	0.111	834.17	46.89	CopyNumber	9p24.3	1883
531614	79.33	75.55	0.071	84.93	89.38	0.111	260.94	66.65
531752	44.32	65.88	0.071	46.35	66.00	0.000	53.66	35.52
531856	609.96	113.19	0.000	567.60	102.77	0.000	10.32	101.76
531876	122.79	75.41	0.036	87.48	59.71	0.222	539.73	29.29
531879	58.80	73.81	0.071	33.40	53.04	0.111	88.51	36.03
532359	682.59	71.75	0.000	899.39	67.01	0.000	3112.89	40.25
532399	64.34	60.44	0.071	53.30	56.19	0.111	556.41	25.27
532755	37.29	59.70	0.071	35.53	57.88	0.222	174.78	35.47
532790	94.43	82.55	0.000	83.21	52.24	0.222	153.66	31.53
532793	88.10	105.70	0.036	160.69	81.87	0.111	299.76	37.08	CopyNumber	17q21.32	3031
532803	218.39	110.79	0.000	194.85	85.55	0.111	251.26	89.23
532826	221.93	124.52	0.036	436.04	83.52	0.000	55.92	39.14
532853	150.66	75.00	0.000	86.71	66.43	0.111	104.95	47.87
533030	108.55	90.84	0.036	91.99	90.93	0.111	235.53	30.97	CopyNumber	22q13.1	3496
533059	423.10	100.23	0.000	432.63	104.06	0.111	952.40	34.46	CopyNumber	6p21.33	1312
533122	111.10	60.64	0.071	124.04	67.72	0.000	610.09	26.23
533136	119.75	71.52	0.000	67.48	58.25	0.111	202.24	47.72	CopyNumber	4p16.2	761
533192	133.51	67.13	0.036	119.13	68.06	0.000	390.25	37.80
533222	42.41	60.55	0.071	36.87	44.13	0.111	164.72	28.30	CopyNumber	5q12.1	1137
533245	51.51	65.70	0.036	46.71	63.31	0.111	179.53	24.31	CopyNumber	5q31.1	1222
533282	184.07	56.67	0.000	183.69	77.18	0.000	1100.81	25.29
533308	47.46	68.45	0.036	48.77	64.22	0.222	202.26	24.39
533317	658.72	143.97	0.000	745.87	104.93	0.111	2393.96	70.88
533437	103.33	71.07	0.036	132.40	64.32	0.222
533440	60.09	143.68	0.036	45.51	61.68	0.222	235.54	58.67
533474	50.60	59.55	0.036	53.89	75.77	0.111	128.82	31.21
533479	107.17	69.59	0.036	96.22	76.98	0.111	86.44	31.09
533526	73.22	71.06	0.000	49.86	57.89	0.111	218.93	31.26
533624	986.85	70.85	0.000	959.57	58.54	0.000	1867.45	27.19
533712	54.47	65.23	0.036	55.59	73.88	0.222	259.05	30.12
533732	350.32	65.50	0.000	204.31	50.13	0.000	1297.83	21.87
533771	74.01	93.54	0.000	50.24	77.32	0.222	1094.17	25.43	CopyNumber	16p13.3	2866
533782	1096.00	221.65	0.036	544.77	104.33	0.222	29.71	50.29
533977	105.46	109.58	0.071	160.18	105.13	0.111	1758.85	51.28	CopyNumber	1q21.1	147
533985	83.81	197.67	0.036	55.92	64.84	0.111	188.23	31.85
533986	42.97	68.64	0.036	24.58	130.07	0.222	179.95	28.58
534125	477.32	142.62	0.000	832.59	105.81	0.111	4813.26	38.31	CopyNumber	6p21.33	1313
534168	304.79	75.97	0.036	323.99	55.72	0.000	1011.41	45.93	CopyNumber	Xq24	3602
534212	57.75	77.33	0.000	43.32	66.35	0.222	99.62	33.06	CopyNumber	1q21.1	147
534255	2594.12	96.87	0.000	2910.69	103.61	0.000	4736.90	32.54	CopyNumber	15q21.1	2773
534307	49.64	90.48	0.036	47.43	99.71	0.111	237.12	58.21
534314	745.09	85.64	0.000	902.22	82.80	0.000	123.06	45.02
534326	132.91	91.25	0.000	113.47	96.69	0.111	398.89	46.54
534338	85.04	66.09	0.036	78.26	71.00	0.222	158.13	58.47	CopyNumber	16p11.2	2903
534346	458.06	77.56	0.000	650.12	74.11	0.000
534350	56.06	71.06	0.071	29.73	56.39	0.222	141.64	41.82
534453	355.30	90.65	0.000	296.51	95.48	0.000	624.74	38.70
534456	159.17	130.28	0.000	192.47	72.01	0.000	88.66	32.89	CopyNumber	17q25.3	3087
534457	73.01	62.64	0.071	61.53	74.61	0.000	730.32	25.54
534473	64.20	63.86	0.071	93.62	63.87	0.222	453.91	46.23
534483	43.74	56.84	0.071	41.04	62.68	0.222	271.95	33.02
536275	46.64	69.43	0.071	36.99	76.62	0.222	305.46	30.60
541269	420.59	79.15	0.000	244.71	86.94	0.000
546248	104.98	137.05	0.036	819.47	122.30	0.000	277.15	66.77
546250	166.85	75.46	0.000	135.33	72.35	0.000	457.00	31.62
546253	124.83	79.22	0.036	154.37	88.05	0.222	80.29	33.55
546261	470.61	89.83	0.036	496.55	65.24	0.000	6040.82	27.54
546269	1748.03	75.45	0.000	1517.81	42.29	0.000	14429.75	31.95
546271	451.52	65.78	0.000	386.41	50.39	0.000	1283.29	34.90
546286	1021.82	89.05	0.000	1172.72	54.31	0.000	4362.29	39.28
546289	1459.28	108.77	0.000	1051.06	67.54	0.000	4831.90	38.49
546290	1853.80	94.06	0.000	2012.36	62.38	0.000	6697.93	38.63
546291	55.70	84.07	0.000	142.03	61.95	0.000	5073.35	34.62	CopyNumber	12p13.33-12p13.32	2364
546339	99.65	64.42	0.000	67.76	55.24	0.111	535.27	24.30
546356	3663.74	59.11	0.000	4388.69	51.21	0.000	6301.04	40.02	CopyNumber	19q13.33	3277
546394	175.77	111.80	0.000	185.13	58.61	0.000
547759	76.79	63.46	0.071	48.56	84.67	0.000
549178	106.75	82.90	0.000	82.93	55.18	0.111			CopyNumber	9q34.3	2030
552590	37.92	70.08	0.036	25.28	65.81	0.222			CopyNumber	22q11.21	3466
553496	48.42	72.62	0.071	41.08	79.89	0.222	43.50	72.79
553512	81.43	113.45	0.000	44.13	95.01	0.111
554767	41.31	64.47	0.071	35.90	65.85	0.222
554776	65.79	84.70	0.071	46.58	100.28	0.222			Inversion	17p11.2	2999
554894	48.56	87.26	0.071	45.88	73.07	0.222			CopyNumber	2p13.1	356
554896	156.46	89.43	0.000	112.49	60.07	0.000	291.19	31.70	CopyNumber	7p22.3	1481
555194	115.74	75.14	0.036	108.54	77.43	0.222
555866	179.94	100.49	0.000	206.53	89.92	0.000	185.01	47.68
555873	87.52	116.51	0.000	174.85	100.43	0.111
555875	43.03	78.46	0.036	17.73	91.10	0.222
555889	67.04	61.77	0.036	59.41	70.56	0.222
555890	148.13	64.41	0.000	151.98	72.68	0.111			CopyNumber	1p35.1	54
555911	110.86	83.61	0.000	120.74	64.55	0.000	182.74	32.39	CopyNumber	1q21.1	147
555969	42.50	85.57	0.036	27.90	60.28	0.222	187.95	28.62
555971	100.55	102.99	0.071	43.43	70.29	0.000
555973	47.22	61.02	0.071	25.39	54.32	0.222	365.86	37.66	CopyNumber	3p24.3	538
555994	37.87	67.15	0.071	17.47	70.28	0.222	113.88	43.85	CopyNumber	16q12.1	2912
556267	39.65	68.11	0.036	37.29	76.22	0.222
556461	99.23	109.80	0.000	89.26	94.15	0.111
556795	122.76	113.17	0.071	222.20	105.92	0.111
557550	707.78	90.20	0.000	781.42	91.24	0.000	2030.99	30.63
558296	76.31	65.84	0.000	71.76	64.47	0.222	293.40	20.63	CopyNumber	2p25.3	261
558313	268.12	83.46	0.000	103.84	61.28	0.111
558322	725.93	81.02	0.000	781.10	60.08	0.000
558325	121.20	58.04	0.071	105.00	59.17	0.000
558328	88.77	175.31	0.071	41.72	74.68	0.222	724.52	77.69	CopyNumber	6p21.31	1321
558330	1268.35	119.70	0.000	1306.25	81.82	0.000			CopyNumber	19q13.33	3275
558338	259.73	94.69	0.000	392.75	84.14	0.111
558345	52.12	68.96	0.036	47.70	48.55	0.222
558354	2215.71	85.28	0.000	3392.33	80.75	0.000
558360	213.80	85.52	0.000	198.33	51.08	0.111
558361	377.22	86.68	0.000	276.67	71.79	0.111
558362	70.26	74.08	0.036	45.59	64.87	0.222	229.35	49.45
558376	423.24	55.75	0.000	528.10	45.88	0.000
558381	167.44	127.10	0.000	52.20	90.63	0.000
558382	247.73	62.95	0.036	245.75	66.13	0.111
558383	1510.30	92.57	0.000	850.60	69.48	0.111
558384	913.52	70.50	0.000	972.23	66.45	0.000			CopyNumber	17q12	3020
558385	591.06	76.67	0.000	522.14	55.82	0.111
558386	994.94	70.79	0.000	1008.37	63.71	0.000
558388	1599.66	76.32	0.000	1561.96	59.50	0.000
558389	1884.53	86.31	0.000	2526.25	46.00	0.000
558390	1096.04	76.07	0.000	653.91	60.77	0.000
558391	1253.30	71.38	0.000	1018.49	62.26	0.000
558396	153.06	101.60	0.071	177.30	89.88	0.222	187.47	100.01
558424	153.84	92.40	0.000	144.32	74.76	0.000
558426	111.38	67.09	0.036	90.90	62.22	0.111
558429	74.41	78.14	0.036	73.01	72.78	0.111			CopyNumber	7q22.1	1597
558431	374.90	100.68	0.000	155.33	60.37	0.000
558442	62.39	68.18	0.000	51.45	69.20	0.000
558448	111.05	67.59	0.000	46.04	58.06	0.111
558453	614.08	82.84	0.000	530.26	57.92	0.000
558454	97.57	75.98	0.000	112.20	87.34	0.111			CopyNumber	1p36.11	49
558458	41.97	67.67	0.071	35.79	63.61	0.111
558473	66.89	70.64	0.000	40.37	55.42	0.222	104.21	36.46	CopyNumber	18q12.2	3132
558499	45.84	78.66	0.071	43.18	52.43	0.222	69.81	63.34	CopyNumber	19p13.2	3210
558511	60.47	54.61	0.000	46.40	50.18	0.222
558521	84.37	78.28	0.000	61.92	65.33	0.111
558591	92.26	68.02	0.071	85.80	56.76	0.111	687.61	32.03
558825	95.41	107.55	0.000	42.12	72.58	0.000			CopyNumber	1q21.1	147
558995	115.01	53.36	0.000	186.71	64.24	0.111
567260	55.10	63.25	0.036	44.20	70.83	0.222	14.03	385.13	CopyNumber	16p11.2	2903
567263	106.63	62.05	0.000	93.74	61.88	0.222	27.38	49.92
567267	74.61	57.55	0.036	44.12	65.62	0.000	26.18	56.35
567279	55.83	65.02	0.036	43.97	59.48	0.111			CopyNumber	17q25.1	3074
Mean: mean gene expression level,
CV: coefficient of variation, 0's
P: 0's proportion

EXAMPLE 3

Identification of ERG

Among the candidate ERGs, reference genes were further identified according to the following process.

First, CVs were calculated for each UniGene cluster in the datasets including EST, ShortSAGE, LongSAGE and microarray (Affymetrix HG-U133, CA), and genes were preferentially ranked in ascending order of CV. Out of the 400 genes (approx. 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs were found to be common to all four datasets (Table 3). The 13 ERGs were identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

The gene ontology thereof was determined from a Gene Ontology site (http://www.geneontology.org/).

Most of the identified genes (ZNF207, OAZ1, CTBP1, PAPOLA, and FBXW2) were involved in basic cellular physiological processes, particularly in cellular metabolic processes. TRIM27 and CUL1 are genes responsible for cell proliferation. OAZ1 showed the lowest CV in both ShortSAGE and LongSAGE. CTBP1 and ZNF207 were the most stable genes in CGAP and Microarray, respectively. OAZ1, which is involved in polyamine biosynthesis, showed the highest expression across all four datasets, with relatively low CV in all datasets except for the EST dataset.

EXPERIMENTAL EXAMPLE 4

Correlation Analysis of Reference Gene Between Datasets

Pearson and Spearman's rank correlation analyses were performed on the ERGs identified according to the present invention in a manner similar to that of Experimental Example 2 to compare the four datasets in terms of gene expression and CV.

Significant correlations between expression values were observed within some of the datasets, whereas no significant correlations of CV between any of the datasets were observed.

Although the Spearman correlation between EST-Microarray (0.374, P=0.206) and ShortSAGE-Microarray (0.511, P=0.076) was not significant, the gene expression of the 13 ERGs showed a significant Pearson correlation (p<0.001). No significant correlation in CV was found between the datasets (P>0.05). With the respective transcripts thereof found in all tissues in both ShortSAGE and LongSAGE, CDC42 and MYL6 were most stably expressed among the ERGs. HBP1 and PSMC1 showed the lowest CV in EST and Microarray.

EXPERIMENTAL EXAMPLE 5

Comparison Between Novel Reference Gene and Traditional Reference Gene in Gene Expression Datasets

The 13 endogenous reference genes identified according to the present invention were compared with 13 traditional reference genes (Table 4) in terms of gene expression level and CV.

As a result, the six traditional endogenous reference genes, RPLP0, ACTB, PPIA, GAPD, PGK1 and B2M, showed high expression levels, while the other genes, GUSB, HPRT1, TBP, TFRC, ALAS1, H6PD and HMBS, exhibited relatively low expression levels, in all four datasets (FIG. 6). These results are in line with those of the previous report, in which potential endogenous expression genes were analyzed for mRNA level using qRT-PCR (Radonic A et al., Biochem Biophys Res Commun, 313(4), 856-862, 2004). The expression levels of the endogenous reference genes identified according to the present invention were similar to or slightly higher than those of the low-abundance group of the traditional endogenous reference genes.

In addition, all of the endogenous reference genes identified according to the present invention, except for a few, showed lower CV values than traditional reference genes (FIG. 7). In other words, the endogenous reference genes of the present invention are generally low in expression variation across a wide range of tissues, indicating that the identified reference genes according to the present invention are more stably expressed than traditional endogenous reference genes.

TABLE 3
ERGs identified from four datasets
UniGene	EST	SHORT SAGE	LONG SAGE	Affymetrix	Gene Ontology
cluster	Symbol	Gene Title	Mean	CV	0's P	Mean	CV	0's P	Mean	CV	0's P	Mean	CV	Biological Process	Molecular Function
Hs.446427	OAZ1	Ornithine decarboxylase	673.68	62.71	0.069	576.39	55.94	0	444.92	41.01	0	1860.9	22.07	Polyamine biosynthesis	Ornithine decarboxylase
		antizyme 1													inhibitor activity
Hs.9589	UBQLN1	Ubiquilin 1	111.34	60.19	0.31	75.93	61.3	0.036	71.77	49.75	0.111	919.32	26.81		Kinase binding
Hs.444279	GPBP1	GC-rich promoter	132.98	56.92	0.241	63.11	61.65	0	80.72	51.79	0.111	746.56	26.6
		binding protein 1
Hs.208397	CTBP1	C-terminal binding	136.74	48.53	0.138	213.99	62.01	0	112.96	50.6	0	481.51	24.72	Negative regulation of cell	Protein C-terminus
		protein 1												proliferation; Protein	binding: Transcription
														phosphorylation; Viral	factor binding
														genome replication
Hs.253726	PAPOLA	Poly(A) polymerase	216.15	65.36	0.172	118.24	58.02	0	89.5	50.88	0	451.23	27.68	mRNA polyadenylation	RNA binding
		alpha
Hs.250009	ARL8B	ADP-ribosylation factor-	132.27	35.79	0.379	134.21	61.55	0	59.19	55.14	0.111	418.28	26.81	Chromosome segregation	α-tubulin binding;
		like 8B													β-tubulin binding; GDP
															binding: GTP binding;
															GTPase activity
Hs.242458	SPG21	Spastic paraplegia 21	120.35	59.44	0.31	76.41	57.83	0.036	73.3	49.12	0	415.64	29.35	Antigen receptor-mediated	CD4 receptor binding
		(autosomal recessive,												signalling pathway
		Mast syndrome)
Hs.530118	LUC7L2	LUC7-like 2 (S.	132.76	59.55	0.172	74.65	63.41	0	57.21	50.39	0.111	386.79	22.9
		cerevisiae)
Hs.500775	ZNF207	Zinc finger protein 207	233.29	62.27	0.034	165.68	56.77	0	154.32	52.88.	0.111	358.69	18.38	Regulation of transcription,	Transcription factor
														DNA-dependent	activity: Zinc ion binding
Hs.533222	DIMT1L	DIM1 dimethyladenosine	129.17	69.14	0.379	42.41	60.55	0.071	36.87	44.13	0.111	164.72	28.3
		transferase 1-like (S.
		cerevisiae)
Hs.440382	TRIM27	Tripartite motif	155.33	68.54	0.172	80.66	63.06	0	67.84	43.41	0.111	163.6	26.3	Cell proliferation;	Metal ion binding:
		containing 27												Spermatogenesis	Transmembrane receptor
															protein tyrosine kinase
															activity
Hs.146806	CUL1	Culin 1	120.27	57.5	0.207	69.33	63.76	0.036	76.43	55	0.111	156.47	27.78	Cell cycle arrest: G1/S	Protein binding
														transition of mitotic cell
														cycle; Induction of
														apoptosis by intracellular
														signals; Negative
														regulation of cell
														proliferation
Hs.494985	FBXW2	F-box and WD-40	97.45	68.65	0.379	40.27	58.47	0	23.54	51.61	0.111	69.32	28.36	Proteolysis	Protein binding: ubiquitin
		domain protein 2													conjugating enzyme
															activity: ubiqiutin-protein
															ligase activity
Mean: Mean gene expression level,
CV: Coefficient of variation,
0's P: 0's proportion

TABLE 4
Traditional ERGs used in present invention
UniGene	EST	SHORT SAGE
cluster	Symbol	Gene Title	Mean	CV	0's P	Mean	CV	0's P
Hs.448226	RPLP0	Ribosomal protein, large,	3,809.2	75.92	0	1,108.65	91.01	0
		P0
Hs.520640	ACTB	β-actin	4,381.34	95.98	0.034	1,348.49	91.02	0
Hs.356331	PPIA	Peptidylprolyl isomerase	1,225.7	78.02	0.034	1,646.83	59.53	0
		A (cyclophilin A)
Hs.479728	GAPDH	Glyceraldehyde-3-	7,330.72	80.18	0	3,167.05	83.62	0
		phosphate dehydrogenase
Hs.78771	PGK1	Phosphoglycerate kinase	681.19	86.72	0.034	423.67	85.52	0
		1
Hs.534255	B2M	β-2-microglobulin	1,303.98	172.16	0	2,594.12	96.87	0
Hs.255230	GUSB	β-Glucuronidase	116.77	89.37	0.414	40.98	67.81	0.107
Hs.412707	HPRT1	Hypoxanthine	103.48	63.18	0.345	32.51	63.51	0.107
		phosphoribosyltransferase
		1
Hs.1100	TBP	TATA box binding	71.46	47.77	0.448	31.94	62.8	0.286
		protein
Hs.529618	TFRC	Transferrin receptor	212.76	85.52	0.241	89.51	87.09	0.036
		(p90, CD71)
Hs.82609	HMBS	Hydroxymethylbilane	176.26	105.68	0.172	32.51	76.51	0.214
		synthase
Hs.463511	H6PD	Hexose-6-phosphate	101.9	86.9	0.483	44.65	70.8	0.071
		dehydrogenase (glucose-
		1-dehydrogenase)
Hs.476308	ALAS1	δ-Aminolevulinate	132.82	82.5	0.345	50.43	72.23	0
		synthase 1
	UniGene	LONG SAGE	Affymetrix
	cluster	Mean	CV	0's P	Mean	CV
	Hs.448226	1,605.76	74.12	0	1,888.46	41.47
	Hs.520640	1,961.29	60.59	0.111	5,036.63	31.42
	Hs.356331	1,683.27	56.79	0	5,223.43	28.46
	Hs.479728	3,178.15	102.5	0	4,934.56	42.86
	Hs.78771	445.96	90.9	0	1,179.63	41.05
	Hs.534255	2,910.69	103.61	0	4,736.9	32.54
	Hs.255230	11.42	89.36	0.556	360.37	49.14
	Hs.412707	33.29	49.07	0.222	233.36	40.85
	Hs.1100	17.58	69.22	0.444	25.44	73.23
	Hs.529618	82.62	91.59	0.111	36.01	56.84
	Hs.82609	28.04	42.5	0.444	119.08	33.63
	Hs.463511	25.33	101.45	0.222	25.04	28.85
	Hs.476308	22.5	50.59	0.222	178.95	107.93
	Mean: Mean gene expression level,
	CV: Coefficient of variation,
	0's P: 0's proportion

EXPERIMENTAL EXAMPLE 6

Gene Copy Number Variations of ERGs

The 13 ERGs identified according to the present invention were examined for gene copy number variation with reference to the Database of Genomic Variants (http://projects.tcag.ca/variation/). Only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found in chromosome regions known to exhibit gene copy number variation (Table 5). In contrast, many (ACTB, GAPDH, PGK1, B2M, TBP, TFRC, ALAS1) of the traditional reference genes were located at such genomic loci (Table 5). These results suggest that almost all of the identified reference genes of the present invention, except for the two genes, can be used as guide genes for the measurement of gene amplification because they might be highly unlikely to show variation in gene copy number.

EXPERIMENTAL EXAMPLE 7

Validation of Reference Gene

<7-1> Validation of Expression Level of ERG by Quantitative RT-PCR (qRT-PCR)

For use in validating the expression stability of the ERGs identified from the datasets, a total of 108 human samples, including 26 frozen human tissues, 60 formalin-fixed, paraffin embedded (FFPE) human tissues, and 22 human cancer cell lines were obtained (Table 6). The 60 FFPE tissues were composed of 10 breast cancer tissues, 8 normal stomach tissues, 9 stomach cancer tissues, 10 normal ovary tissues, 4 ovarian dropsy tissues, 9 borderline ovarian tumors, and 10 ovarian cancer tissues. Total RNA was isolated from these tissues and cell lines. For frozen human tissues and human cancer cell line samples, RNA which met the requirements of A260/280≥1.80 and rRNA (28S/18S)≥1.0 was used in qRT-PCR. cDNA was synthesized from the RNA using a standard technique and then diluted in distilled water (1:3 cDNA:DW) before qRT-PCR. PCR primers are summarized, together with the Universal Probe Library (UPL) thereof, in Table 7, below.

For use in this qRT-PCR, traditional ERGs were selected on the basis of the use frequency in previous reports and commercially available kits and the CV calculated from the database of the present invention. The 8 ERGs (B2M, ACTB, GAPDH, HMBS, PPIA, HPRT1, TBP and H6PD) that are most widely used can be found in commercially available kits such as Taqman human endogenous control plate (Applied Biosystems) and HKG selection kit (Roche Applied Science, Ohl F et, al., J Mol Med 83:1014-24, 2005; Roche Applied Science Technical Note No. LC 15/2005; Applied Biosystems, 2001). Each gene was measured at 530 nm using an FAM-conjugate UPL probe (Roche Applied Science) or a custom-made specific probe (TIB MOLBIOL GmbH, Germany). All PCR was performed in a Lightcycler 2.0 (Roche Applied Science, USA) using standard protocols.

PCR efficiency for each gene was measured using a cDNA serial dilution (Pfaffl M W et al., Nucleic Acids Res 29: e45, 2001) of the stomach cancer cell line MKN74 and calculated with Lightcycler software 4.0 (Roche Applied Science, USA). It was found to fall within a range from 90 to 100% (Table 8).

Also, PCR efficiency for each probe in tissue samples was estimated using a LinRegPCR program (Ramakers C et al., Neurosci Lett 339:62-6, 2003). A Cp value is an average of three measurements for each gene. The same genes from different tissue samples were measured under the same PCR conditions so as to minimize experimental variation. Because it was not measured in any of 4 samples, normal lung, liver, breast and kidney tissues, the Cp value of H6PD was omitted from subsequent calculations. For each experiment that was conducted in triplicate, the Cp values were found to have a CV less than 5%.

Expression levels of 20 genes, except for H6PD, across 48 samples, including frozen human tissues and cancer cell lines, are depicted in FIG. 8. The 13 novel ERGs of the present invention were expressed in all 48 samples. 7 traditional ERGs showed a wide expression range (Cp: 13.52˜29.39) whereas H6PD was not found in some tissues. The 13 ERGs ranged in Cp from 18.90 to 28.79 (FIG. 9). Traditional ERGs can be classified into a high-expression group (median<20 cycles) and a low-expression group (median>23 cycles). B2M, PPIA, GAPDH and ACTB are included in the high-expression group and HPRT1, TBP, and HMBS are found in the low-expression group. All of the novel ERGs of the present invention, except for OAZ1, show expression levels between those of the high-expression group and the low-expression group of the traditional ERGs. ZNF2007 had the highest expression level among the ERGs, followed by UBQLN1 and CUL1. OAZ1 had the lowest expression level.

TABLE 5
Gene copy number variations of traditional ERG and novel ERG
Novel candidate ERGs	Traditional ERGs
Gene	Genomic	Genomic Variation**	Gene	Genomic	Genomic Variation**
Symbol	location*	Variation type	Locus ID	References	symbol	location*	Variation type	Locus ID	References
ZNF207	17q11.2				RPLP0	12q24.23
OAZ1	19p13.3	Copy number	3199	Wong et al (2007)	ACTB	7p22.1	Copy number	1487	Wong et al (2007)
LUC7L2	7q34				PPIA	7p13
CTBP1	4p16.3				GAPDH	12p13.31	Copy number	2368	Redon et al (2006)
TRIM27	6p22.1				PGK1	Xq21.1	Copy number	3567	Iafrate et al (2004)
GPBP1	5q11.2				B2M	15q21.1	Copy number	2773	Redon et al. (2006)
UBQLN1	9q21.33				GUSB	7q11.21
ARL8B	3p26.1				HPRT1	Xq26.2
PAPOLA	14q32.2				TBP	6q27	Copy number	1479	Redon et al (2006)
CUL1	7q36.1				TFRC	3q29	Copy number	753	Iafrate et al (2004)
							Copy number		Redon et al. (2006)
DIMT1L	5q12.1	Copy number	1137	Redon et al (2006)	HMBS	11q23.3
FBXW2	9q33.2				H6PD	1p36.22
SPG21	15q22.31				ALAS1	3p21.2	Copy number	590	Wong et al (2007)
*Genomic location was searched from Ensembl (http://www.ensembl.org/index.html)
**Genomic variations were searched in the Database of Genomic Variants (http://projects.tcag.ca/variation/, Human Genome Assembly Build 36 (hgl8)).

<7-2> Validation of ERG Using Expression Stability Based on qRT-PCR Data

Gene expression stability was analyzed using geNorm v3.4 software (Vandesompele J et al., Genome Biol 3:RESEARCH0034, 2002) and NormFinder software (Andersen C L et al., Cancer Res 64:5245-50, 2004). For geNorm and NormFinder analysis, Cp values were converted into relative expression levels in consideration of the PCR efficiencies of genes shown in Table 8 (GeNorm software manual, update on Sep. 6, 2004. //medgen.ugnet.be/˜jvdesomp/genorm/).Relative expression was calculated according to the following Mathematical Formula 4.Relative Expression=(1+E)^ΔCp  <Mathematical Formula 4>

• • ΔCp=Minimum Cp−Sample Cp;
  • Minimum Cp=lowest Cp value; and
  • E=PCR Efficiency

Correlation between the gene expression stability calculated with the geNorm or NormFinder program (M by geNorm, S by NormFinder) and the CV calculated in each dataset was analyzed with R analysis software (//www.R-project.org).

All of the genes were found to have M values (<0.9) lower than the default limit, 1.5, of geNorm, with high expression stability, as analyzed using the geNorm program (Table 9). Lower M values for mean expression stability mean more stable expression. GPBP1 and CUL1 were observed to show the most stable expression. Among the genes analyzed, B2M is the lowest stable expression gene, with the highest M value of 0.888, followed by ACTB (M=0.843), HMBS (M=0.815) and GAPDH (M=0.793) in descending order of expression instability.

When using the NormFinder program, TBP and PAPOLA were ranked as the top two in terms of expression stability (Table 9). Consistent with the geNorm result, B2M, ACTB, GAPDH, HMBS and HPRT1 were found to be less stable in expression level than the novel ERGs of the present invention. Both programs demonstrated that most of the novel ERGs identified according to the present invention show more stable expression levels than do traditional ERGs. Further, when analyzed for gene expression stability using a LinRegPCR program on the basis of the relative expression calculated with PCR efficiency, most novel ERGs were found to maintain higher expression stability than traditional ERGs.

There is no significant correlation between the M values calculated with geNorm and the CV values in Microarray and LongSAGE (p>0.05), whereas significance was found in correlation between M values and CV values in EST (Pearson correlation coefficient: 0.676, p=0.001) and ShortSAGE (Pearson correlation coefficient: 0.659, p=0.002). Likewise, as for the Stability values (S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed higher agreement with CV in EST and ShortSAGE than in Affymetrix (Table 10).

Furthermore, the 13 novel ERGs were analyzed for expression in 60 FFPE samples using qRT-PCR in order to examine the possibility of applying them to the tissues in which high RNA degradation occurs. All of the genes, except for DIMT1L, were found to be expressed in all 60 samples. Cp was observed to range from 18.85 to 33.02 for traditional ERGs and from 23.33 to 31.38 for the novel ERGs (FIG. 9). Because of the lack of amplification in 5 samples, DIMT1L was omitted from subsequent stability analyses. Despite difference in the type of samples used in the experiments, almost all genes, except for several genes, were observed to be expressed in a pattern similar to that observed in the previous 48 samples. These results indicate that the novel ERGs of the present invention can be applied to gene expression in FFPE samples. geNorm and NormFinder analyses demonstrate that most of the novel ERGs are more stably expressed with lower Cp values in FFPE samples, as well as in the 48 samples, than are traditional ERGs (Table 9).

TABLE 6
Human tissues and cancer cell lines used in Real time-PCR
	Tissue or cell		Normal(N)/
No.	lines	Type	Tumor(T)	Diagnosis	Remarks
1	Adrenal gland	frozen tissue	N	Normal
2	Brain	frozen tissue	N	Normal
3	Breast	frozen tissue	N	Normal
4	Colon	frozen tissue	N	Normal	Normal tissue adjacent to signet ring
					cell carcinoma, ascending colon
5	Esophagus	frozen tissue	N	Normal
6	Kidney	frozen tissue	N	Normal
7	Liver	frozen tissue	N	Normal
8	Lung	frozen tissue	N	Normal
9	Omentum	frozen tissue	N	Normal
10	Ovary	frozen tissue	N	Normal
11	Placenta	frozen tissue	N	Normal
12	Placenta	frozen tissue	N	Normal	Immature placenta with focal
					intervillous calcifications, normal two
					umbilical arteries and one vein, and
					no evidence of chorioamnionitis
13	Rectum	frozen tissue	N	Normal
14	Salivary gland	frozen tissue	N	Normal
15	Thyroid gland	frozen tissue	N	Normal
16	Tonsil	frozen tissue	N	Normal
17	Uterus	frozen tissue	N	Normal
18	Vein	frozen tissue	N	Normal
19	Vulva	frozen tissue	N	Normal
20	Brain	frozen tissue	T	Glioblastoma mulfiforme
21	Breast	frozen tissue	T	Invasive ductal carcinoma, upper
				central
22	Transverse colon	frozen tissue	T	Ulcerofungating carcinoma,
				transverse colon, Mucinous
				adenocarcinoma
23	Lung	frozen tissue	T	Pleomorphic carcinoma
24	Ovary	frozen tissue	T	Transitional cell carcinoma, bilateral
				ovaries
25	Rectum	frozen tissue	T	Adenocarcinoma, moderately
				differentiated with mucin production
26	Stomach	frozen tissue	T	Advanced gastric carcinoma, Tubular
				adenocarcinoma, M/D
27	HL-60	cell lines	T	Leukemia	Blood
28	MDA-MB-231	cell lines	T	Breast cancer	Breast
29	C33A	cell lines	T	Cervical cancer	Cervix
30	HeLa	cell lines	T	Cervical cancer
31	HCC-44	cell lines	T	Lung cancer	Lung
32	A549	cell lines	T	Lung cancer
33	Caov3	cell lines	T	Ovarian cancer	Ovary
34	OV-90	cell lines	T	Ovarian cancer
35	OVCAR3	cell lines	T	Ovarian cancer
36	SK-OV3	cell lines	T	Ovarian cancer
37	SNU119	cell lines	T	Ovarian cancer
38	SW626	cell lines	T	Ovarian cancer
39	AGS	cell lines	T	Gastric cancer	Stomach
40	Kato III	cell lines	T	Gastric cancer
41	MKN1	cell lines	T	Gastric cancer
42	MKN74	cell lines	T	Gastric cancer
43	NCI-N87	cell lines	T	Gastric cancer
44	SNU5	cell lines	T	Gastric cancer
45	SNU16	cell lines	T	Gastric cancer
46	SNU484	cell lines	T	Gastric cancer
47	SNU601	cell lines	T	Gastric cancer
48	SNU638	cell lines	T	Gastric cancer
* Normal tissue adjacent to signet ring cell carcinoma, ascending colon; and
** immature placenta with focal intervillous calcifications, normal two umbilical arteries and one vein, and no evidence of chorioamnionitis.

TABLE 7
Primers and Taqman Probes for Real-Time PCR
Gene	UPL	Primers		Product
Names	No.	Sense Primers	Anti-Sense Primers	(bp)
GAPDH	60	SEQ ID NO. 1:	SEQ ID NO. 2:	66
		agccacatcgctcagaca	gcccaatacgaccaaatcc
ACTB	64	SEQ ID NO. 3:	SEQ ID NO. 4:	97
		ccaaccgcgagaagatga	ccagaggcgtacagggatag
B2M	42	SEQ ID NO. 5:	SEQ ID NO. 6:	86
		ttctggcctggaggctatc	tcaggaaatttgactttccattc
PPIA	#	SEQ ID NO. 7:	SEQ ID NO. 8:	326
		catctgcactgccaagactgag	tgcaatccagctaggcatg
HPRT1	73	SEQ ID NO. 9:	SEQ ID NO. 10:	102
		tgaccttgatttattttgcatacc	cgagcaagacgttcagtcct
HMBS	26	SEQ ID NO. 11:	SEQ ID NO. 12:	92
		tgtggtgggaaccagctc	tgttgaggtttccccgaat
TBP	3	SEQ ID NO. 13:	SEQ ID NO. 14:	60
		gctggcccatagtgatcttt	cttcacacgccaagaaacagt
H6PD	89	SEQ ID NO. 15:	SEQ ID NO. 16:
		tggagatcatcatgaaagagac	gcgaatgacaccgtactcct	74
		c
ZNF207	27	SEQ ID NO. 17:	SEQ ID NO. 18:	65
		ctgtttcctagcacagcacaa	ggtttgaaatctgtaccaacagg
OAZ1	74	SEQ ID NO. 19:	SEQ ID NO. 20:	67
		caccatgccgctcctaag	gagggagaccctggaactct
LUC7L2	85	SEQ ID NO. 21:	SEQ ID NO. 22:	60
		cgatcacacagcaagaatcc	agatcgatgtctgcgatgc
CTBP1	77	SEQ ID NO. 23:	SEQ ID NO. 24:	86
		actgcgtgaccctgcact	gccccttgtctcatctgc
TRIM27	7	SEQ ID NO. 25:	SEQ ID NO. 26:	71
		caggcacgagctgaactct	agctgctcaaactcccaaac
GPBP1	4	SEQ ID NO. 27:	SEQ ID NO. 28:	75
		tcacttgaggcagaacacaga	agcacatgtttcatcattttcac
UBQLN1	73	SEQ ID NO. 29:	SEQ ID NO. 30:	92
		gaatcctgaccttgctgcac	ttgggagctgttgtctcattt
ARL8B	82	SEQ ID NO. 31:	SEQ ID NO. 32:	66
		aagcatgtgggagcggtat	cgatctgcagcatctatcatgt
PAPOLA	78	SEQ ID NO. 33:	SEQ ID NO. 34:	91
		gctacgaagaccagtccattg	tgttggtcacagatgctgct
CUL1	65	SEQ ID NO. 35:	SEQ ID NO. 36:	86
		gcgaggtcctcactcagc	ttctttctcaattagaatgtcaatgc
DIMT1L	77	SEQ ID NO. 37:	SEQ ID NO. 38:	75
		tccagtgttgtaaggatagaacc	Ccttactagaccatcccattcct
		taag
FBXW2	3	SEQ ID NO. 39:	SEQ ID NO. 40:	111
		cggctctgcagacttcact	ttgcacttctgcaaaactacct
SPG21	21	SEQ ID NO. 41:	SEQ ID NO. 42:	88
		gatgtctttttccggcagat	cgagatggtcccaataaactg

TABLE 8
PCR Efficiency of Genes
	UPL Probe	PCR Efficiency	PCR Efficiency
Gene Name	Nos.	(Diluted)*	(LinRegPCR)**
GAPDH	60	1.899	1.735 ± 0.048(137)
ACTB	64	2.038	1.491 ± 0.034(137)
B2M	42	1.868	1.717 ± 0.068(140)
PPIA	#	1.877	1.773 ± 0.058(142)
HPRT1	73	1.800	1.771 ± 0.024(143)
HMBS	26	1.954	1.431 ± 0.031(143)
TBP	3	1.826	1.447 ± 0.038(142)
H6PD	89	1.874	1.832 ± 0.026(64)
ZNF207	27	1.869	1.648 ± 0.018(142)
OAZ1	74	2.068	1.498 ± 0.059(142)
LUC7L2	85	1.829	1.709 ± 0.047(143)
CTBP1	77	2.064	1.651 ± 0.055(141)
TRIM27	7	1.908	1.693 ± 0.034(143)
GPBP1	4	1.844	1.715 ± 0.031(141)
UBQLN1	73	1.864	1.723 ± 0.027(143)
ARL8B	82	1.838	1.499 ± 0.074(139)
PAPOLA	78	1.830	1.509 ± 0.032(141)
CUL1	65	1.810	1.695 ± 0.027(139)
DIMT1L	77	1.906	1.655 ± 0.037(141)
FBXW2	3	1.891	1.638 ± 0.02(142)
SPG21	21	1.826	1.636 ± 0.021(142)
*PCR Efficiency; calculated with Roche Lightcycler software 4.0 using serial diluted cDNA of MKN 74 stomach cancer cell line;
**PCR Efficiency; calculated with LinRegPCR(Ramakers et al., Neurosci Lett 339(1): 62-66, 2003); and,
#: F-ttcttgctggtcttgccatTcctgga-p; T: TAMRA-labeled; F: FAM-labeled; P: phosphate.

TABLE 9
Expression Stability of Novel and Traditional ERGs Calculated
by geNorm and NormFinder based on Real-Time PCR Data
48 Samples	60 FFPE Samples*
GeNorm	NormFinder	GeNorm	NormFinder
Genes	M	Genes	S	Genes	M	Genes	S
GPBP1	0.496	TBP	0.276	GPBP1	0.409	ARL8B	0.233
CUL1		PAPOLA	0.280	PAPOLA		LUC7L2	0.235
PAPOLA	0.536	CUL1	0.287	ARL8B	0.437	OAZ1	0.247
TBP	0.548	LUC7L2	0.290	CTBP1	0.454	CTBP1	0.251
LUC7L2	0.565	CTBP1	0.312	LUC7L2	0.483	UBQLN1	0.273
TRIM27	0.585	GPBP1	0.317	SPG21	0.509	SPG21	0.280
FBXW2	0.597	TRIM27	0.317	FBXW2	0.528	FBXW2	0.286
CTBP1	0.608	FBXW2	0.329	OAZ1	0.545	PAPOLA	0.290
UBQLN1	0.623	DIMT1L	0.364	UBQLN1	0.555	TRIM27	0.327
DIMT1L	0.637	PPIA	0.383	TRIM27	0.567	GPBP1	0.345
PPIA	0.661	UBQLN1	0.398	TBP	0.580	HPRT1	0.368
OAZ1	0.682	OAZ1	0.438	CUL1	0.593	CUL1	0.383
ZNF207	0.709	ARL8B	0.494	HPRT1	0.609	TBP	0.402
ARL8B	0.731	SPG21	0.502	ZNF207	0.625	HMBS	0.407
SPG21	0.749	ZNF207	0.502	HMBS	0.641	ZNF207	0.440
HPRT1	0.770	HPRT1	0.516	GAPDH	0.668	PPIA	0.461
GAPDH	0.793	HMBS	0.587	PPIA	0.692	GAPDH	0.527
HMBS	0.815	GAPDH	0.591	B2M	0.715	B2M	0.530
ACTB	0.843	ACTB	0.618	ACTB	0.737	ACTB	0.541
B2M	0.888	B2M	0.815
*DIMT1L was excluded from the analysis.
M: mean expression stability calculated with geNorm program;
S: Stability calculated with NormFinder program.

TABLE 10
Correlation between CV in each dataset and expression stability calculated with geNorm and NormFinder
	EST-M	EST-S	ShortSAGE-M	ShortSAGE-S	LongSAGE-M	LongSAGE-S	Affy-M	Affy-S	M-S
Pearson	0.676	0.792	0.659	0.75	0.427	0.561	0.039	0.017	0.953
P value	0.001	<0.001	0.002	<0.001	0.061	0.01	0.869	0.944	<0.001
Spearman	0.589	0.605	0.277	0.268	0.092	0.105	0.424	0.357	0.955
P value	0.006	0.005	0.237	0.254	0.701	0.661	0.063	0.123	<0.001
Pearson	0.623	0.626	0.656	0.737	0.481	0.672	0.243	0.335	0.852
P value	0.004	0.004	0.002	<0.001	0.037	0.002	0.317	0.161	<0.001
Spearman	0.663	0.596	0.515	0.502	0.374	0.567	0.521	0.583	0.841
P value	0.002	0.008	0.024	0.03	0.115	0.013	0.022	0.009	<0.001
M: Mean expression stability calculated with geNorm;
S: Stability calculated with NormFinder

TABLE 11
List of 567 Samples Including 13 Tissues in HG-U133 Array
			Nos. of
Tissues	Categories	Morphology	Samples
Brain	Benign	Meningioma	7	23
	Malignant	Glioblastoma Multiforme	7
		Oligodendroglioma	6
		Medulloblastoma	3
Breast	Normal	Normal Tissue	18	74
	Malignant	Infiltrating Duct Carcionma	36
		Infiltrating Duct and Lobular Carcinoma	7
		Infiltrating Lobular Carcinoma	13
Colon	Normal	Normal Tissue	22	62
	Malignant	Adenocarcinoma	33
		Mucinous Adenocarcinoma	7
Esophagus	Normal	Normal Tissue	11	17
	Malignant	Adenocarcinoma	6
Kidney	Normal	Normal Tissue	26	51
	Benign	Oncocytoma	5
	Malignant	Clear Cell Adenocarcinoma	6
		Renal Cell Carcinoma	14
Liver	Normal	Normal Tissue	10	29
	Malignant	Hepatocellular Carcinoma	19
Lung	Normal	Normal Tissue	26	58
	Malignant	Adenocarcinoma	15
		Squamous Cell Carcinoma	17
Lymph	Normal	Normal Tissue	4	23
Node	Malignant	Hodgkin's Disease	4
		Malignant Lymphoma	15
Ovary	Normal	Normal Tissue	10	50
	Malignant	Adenocarcinoma	5
		Clear Cell Adenocarcinoma	6
		Mucinous Cystadenocarcinoma	5
		Serous Cystadenocarcinoma	6
		Papillary Serous Adenocarcinoma	18
Pancreas	Normal	Normal Tissue	13	41
	Malignant	Adenocarcinoma	28
Prostate	Normal	Normal Tissue	14	41
	Malignant	Adenocarcinoma	27
Rectum	Normal	Normal Tissue	17	38
	Malignant	Adenocarcinoma	21
Stomach	Normal	Normal Tissue	17	60
	Malignant	Adenocarcinoma	37
		Signet Ring Cell Carcinoma	6
Total			567

Claims

1. A method for quantifying an expression level of a target gene, comprising: 1) synthesizing cDNA from RNA of a subject;2) performing real time PCR to amplify the target gene using a pair of primers and/or probes with the cDNA serving as a template and then performing real-time PCR to amplify an endogenous reference gene CUL1, wherein said endogenous reference gene CUL1 is selected by a method comprising (a) computing expression levels of genes from EST (expressed sequence tag), SAGE (serial analysis of gene expression), and microarray datasets; and (b) identifying constitutively expressed genes from more than one tissue type based on the computed gene expression level of step (a) and zero (0)'s proportions thereof; and3) normalizing an expression level of the target gene to that of the endogenous reference gene CUL1 of step 2).

2. A method for quantifying an expression level of a target gene, comprising: 1) synthesizing cDNA from RNA of a subject;2) performing real time PCR to amplify the target gene using a pair of primers and/or probes with the cDNA serving as a template and then performing real-time PCR to amplify an endogenous reference gene CUL1, wherein said endogenous reference gene CUL1 is selected by a method comprising (a) computing expression levels of genes from EST (expressed sequence tag), SAGE (serial analysis of gene expression), and microarray datasets; and (b) identifying constitutively expressed genes from more than one tissue type based on the computed gene expression level of step (a) and zero (0)'s proportions thereof; (c) determining the coefficient of variation (CV) for the endogenous reference gene; and (d) ranking the endogenous gene in an ascending order of CV; and3) normalizing an expression level of the target gene to that of the endogenous reference gene CUL1 of step 2).