Patent Application
20240093208
The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on Oct. 30, 2023, is named 745307_UIUC-041_SL.xml and is 146,377 bytes in size.
Synthetic biology has shown remarkable potential to program living microorganisms for applications. However, a significant discrepancy exists between the current engineering practice-which focuses predominantly on planktonic cells—and the ubiquitous observation of microbes in nature that constantly alternate their lifestyles upon environmental variations. Methods are needed in the art for regulation of the bacterial life cycle and that enables phase-specific gene expression.
Provided herein are methods of controlling transition between planktonic growth phase and biofilm growth phase in a bacterial host cell. The methods comprise growing a bacterial host cell in a medium, wherein the bacterial host cell comprises:
The addition of a repressor for the first repressible promoter to the medium results in suppression of the expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits planktonic growth phase. In the absence of the repressor for the first repressible promoter and the presence of repressor for the second repressible promoter in the medium results in expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and suppression of the expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits biofilm growth phase.
In some aspects the bacterial host cell additionally comprises a recombinant polynucleotide encoding a protein operably linked to an inducible promoter for orthogonal expression in both biofilm growth phase and planktonic growth phase, wherein when an inducer is added to the medium, the bacterial host cell expresses the protein in both biofilm growth phase and planktonic growth phase. The bacterial host can cell additionally comprise a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter for protein expression in planktonic growth phase. A second repressible promoter can be PsczD, wherein the host cell additionally comprises a polynucleotide encoding a sczA operably linked to a PsczA promoter. The first repressible promoter can be PzitR, wherein the bacterial host cell additionally comprises a polynucleotide encoding zitR operably linked to the PzitR promoter. The repressor can be zinc. The one or more biofilm assembly genes can encode P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30, P31, P32, P33, P34, P35, P36, P37, P38, P39, P40, P41, P42, P43, P44, P45, P45IS1, P45IS2, P45IS3, P45IS4, or P45IS5. The protease can be Neutral protease B, Bacillolysin, or Subtilisin E. The inducible promoter can be PnisA. The inducer can be nisin.
An aspect provides expression cassettes, vectors, and recombinant bacterial host cells comprising a recombinant polynucleotide encoding one or more biofilm assembly proteins operably linked to a first repressible promoter; and a recombinant polynucleotide encoding a protease capable of breaking down the one or more biofilm assembly proteins operably linked to a second repressible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can further comprise a recombinant polynucleotide encoding a protein operably linked to an inducible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can additionally comprise a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can further comprise a recombinant polynucleotide encoding a protein operably linked to an inducible promoter and a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter.
Other aspects provide expression cassettes comprising a polynucleotide encoding one or more biofilm assembly genes operably linked to an inducible or repressible promoter. The inducible promoter can be PnisA and the expression cassette can further comprise a polynucleotide encoding nisK/nisR operably linked to a constitutive promoter. The expression cassettes can be present in a vector or a population of host cells. The population of host cells can be used to express one or more biofilm assembly genes such that the host cells form a biofilm in culture. Nisin can be added to the population of host cells in culture such that the population of host cells expresses the one or more biofilm assembly genes and forms a biofilm.
In some aspects, the repressible promoter of an expression cassette can be PsczD, and the expression cassette can further comprise a polynucleotide encoding sczA operably linked to a PsczA promoter. These expression cassettes can be present in a vector or a population of host cells. The population of host cells can be used to express one or more biofilm assembly genes such that the population of host cells form a biofilm in culture. Zinc can be added to the population of host cells in culture such that the population of host cells express the one or more biofilm assembly genes and forms a biofilm.
In some aspects, the repressible promoter of an expression cassette is PzitR, and further comprises a polynucleotide encoding zitR that is also operably linked to the repressible promoter PzitR. The expression cassette can be present in a vector or a population of host cells. The population of host cells can be used to control expression of one or more biofilm assembly genes in a population of host cells in culture. Zinc can be added to the population of host cells in culture such that the population of host cells does not express the one or more biofilm assembly genes. Optionally the zinc can be removed such that the population of host cells expresses the one or more biofilm assembly genes and forms a biofilm.
Another aspect provides an expression cassette comprising one or more biofilm assembly genes operably linked to a constitutive promoter, a gRNA having specificity for the constitutive promoter, and a polynucleotide encoding a dCas, wherein the gRNA having specificity for the constitutive promoter and the polynucleotide encoding dCas are operably linked to an inducible promoter. The inducible promoter can be PnisA and the expression cassette can further comprise a polynucleotide encoding nisK/nisR operably linked to a constitutive promoter. The expression cassette can be present in a vector or a population of host cells. The population of host cells can be used in a method of controlling expression one or more biofilm assembly genes in a population of host cells in culture. Nisin can be added to the population of host cells in culture such that the population of host cells express the gRNA having specificity for the constitutive promoter and the dCas such that expression of the one or more biofilm assembly genes is prevented. Optionally, nisin can be removed such that the population of host cells express the one or more biofilm assembly genes and forms a biofilm.
Even another aspect comprises an expression cassette comprising:
The polynucleotide encoding a protease can be operably linked to repressible promoter PsczD, and can further comprise one or more functional genes or marker genes also operably linked to the repressible promoter PsczD. The expression cassette can further comprise a polynucleotide encoding one or more functional genes or marker genes operably linked to a PnisA promoter. The expression cassette can be present in a vector or a population of host cells. The population of host cells can be used in a method of controlling expression of one or more biofilm assembly genes in a population of host cells in culture in the absence of zinc such that the population of host cells form a biofilm. Optionally, zinc can be added to the population of host cells such that the population of host cells switches to planktonic growth.
The population of host cells can comprise a polynucleotide encoding one or more functional genes or marker genes operably linked to a PnisA promoter. Nisin can be added to the population of host cells such that the polynucleotide encoding the one or more functional genes or marker genes is expressed.
In an aspect, the one or more biofilm assembly genes can encode P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30, P31, P32, P33, P34, P35, P36, P37, P38, P39, P40, P41, P42, P43, P44, P45, P45IS1, P45IS2, P45IS3, P45IS4, or P45IS5. The protease can be Neutral protease B, Bacillolysin, or Subtilisin E. The zitR transcriptional repressor protein and PzitR can be derived from Lactococcus. The PsczD promoter, sczA, and PsczA promoter can be derived from Lactococcus Iactis. The PnisA and nisK/nisR can be derived from Streptococcus.
Another aspect provides a biofilm assembly protein comprising P45IS5 (SEQ ID NO:51). Even another aspect comprises a biofilm assembly protein comprising P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30, P31, P32, P33, P34, P35, P36, P37, P38, P39, P40, P41, P42, P43, P44, P45, and SEQ ID NO:49, wherein SEQ ID NO:49 is present in the biofilm assembly protein such that the protein is biologically functional and is capable of being cleaved by one or more proteases.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Biofilms are important for bacterial ecology and evolution and have implications in the human gut microbiome where they enables bacteria to persist through variations in nutrient availability and can be used in wastewater treatment and environmental cleanup. Methods of controlling a switch between planktonic and biofilm life phases can be useful in manipulating host cells. Provided herein are gene circuits that can control the transition between planktonic and biofilm states. Gene circuit designs can include biofilm assembly genes to program a biofilm state, which can be reversed by a protease that degrades the biofilm Expression of these components in response to an inducer and/or repressor can lead to reversible transition between two phases. Despite the conceptual simplicity of this strategy, achieving effective transition is non-trivial. Both rational protein design and screening can be required to optimize these components. Additional components provide the ability to enable both coupled and orthogonal gene expression. For the coupled function, cells in the planktonic life phase can express a recombinant protein the in the presence of a repressor or inducer. For the orthogonal function, which can be controlled independently of life phase by a second external input, cells could be induced to express another recombinant protein.
The designs presented herein have modularity, such that components behave similarly in isolation to the way they do in combination. In addition to demonstrating the modular control of biofilm formation by multiple inputs, control of life phase (e.g., biofilm or planktonic) can be coupled with a secondary function. This coupling can enable engineered biological devices to capitalize on the benefits of each phase for optimal performance.
Many applications can be envisioned. For example, methods and compositions can be used for smart drug delivery. Bacteria entering a planktonic phase can form a biofilm in response to signals detected upon reaching their final desired location. On-demand transitioning of bacterial states can be also useful for biomanufacturing, where the planktonic state can enable more effective production of biomolecules, while the biofilm state can enable long-term survival in harsh environments.
Provided herein are synthetic genetic programs that regulate the bacterial life cycle and enables phase-specific gene expression. The program is orthogonal and harnesses engineered proteins as biofilm matrix building blocks. It is also highly controllable, allowing directed biofilm assembly and decomposition as well as responsive autonomous planktonic-biofilm phase transition. Coupled to synthesis modules, it is further programmable for various functional realizations that conjugate phase-specific biomolecular production with lifestyle alteration. This provides a versatile platform for microbial engineering across physiological regimes, thereby shedding light on a promising path for gene circuit applications in complex contexts.
Engineered organisms harboring gene circuits can be developed to encode novel cellular behaviors and functions1-15. Gene circuits can be used in chemical synthesis16,17, material fabrication18,19, environmental remediation20,21 and disease treatment22-24. To date, the vast majority of these synthetic systems are designed, constructed and demonstrated in well controlled settings whereby cells remain exclusively planktonic and programmed functions are executed in exponential growth phase. By contrast, microorganisms in natural habitats often live in and switch between two distinctive lifestyles, a single-celled, planktonic form and a sessile, community form called biofilm25-28. The former allows cells to rapidly utilize substrate and thrive in nutrient-rich conditions; the latter provides microbes protection against disturbances and enhancement in substrate consumption under stress29. Such a lifestyle alternation enables cells to cope with environmental variations between limited resource supply and transient nutrient pulse such as the cases of deep oceans with marine snow30,31 and the human gut with daily food intake32,33. As a result, there exists a remarkable mismatch between engineered microbial plankton prevalent in the current synthetic biology practice and the ubiquitous observation of lifestyle switching microbes in natural contexts.
Provided herein is a platform with the traits of orthogonality, modularity and programmability. Adopting Lactococcus lactis (L. lactis) as the cellular chassis, 45 putative surface-associated proteins were expressed and characterized from which orthogonal building blocks for biofilm organization were identified. Gene circuit engineering was combined with protein design to establish externally controllable biofilm assembly and decomposition as well as autonomous planktonic-biofilm phase transition in response to zinc availability. The utility of the platform is demonstrated with different modes of synthesis of functional biomolecules. These systems provide a genetic program to control bacterial life cycle and function execution, thereby conferring programmable microbial transition between planktonic and biofilm states and facilitating the development of cellular functions across physiological domains.
Polynucleotides
Polynucleotides are polymers of nucleotides e.g., linked nucleosides. A polynucleotide can be, for example, a ribonucleic acid (RNA), a deoxyribonucleic acid (DNA), a threose nucleic acids (TNA), a glycol nucleic acid (GNA), a peptide nucleic acid (PNA), a locked nucleic acid (LNA), cDNA, genomic DNA, chemically synthesized RNA or DNA, or combinations or hybrids thereof. Polynucleotides of can be recombinant polynucleotides. A recombinant polynucleotide is a polynucleotide that is not in its native state, e.g., the polynucleotide comprises a nucleotide sequence not found in nature, or the polynucleotide is in a non-naturally occurring context, for example, separated from nucleotide sequences with which it typically is in proximity in nature, or adjacent (or contiguous with) nucleotide sequences with which it typically is not in proximity. For example, a recombinant polynucleotide can be cloned into a vector, or otherwise recombined with one or more additional nucleic acid.
Polynucleotides can be modified by, for example, chemical modification with respect to A, G, U (T in DNA) or C nucleotides. Modifications can be on the nucleoside base and/or sugar portion of the nucleosides which comprise the polynucleotide. In some embodiments, multiple modifications can be included in the modified nucleic acid or in one or more individual nucleoside or nucleotide. For example, modifications to a nucleoside can include one or more modifications to the nucleobase and the sugar. Polynucleotides contain less than an entire microbial genome and can be single- or double-stranded nucleic acids. Polynucleotides can be purified free of other components, such as proteins, lipids, and other polynucleotides. Polynucleotides can be isolated from nucleic acid sequences present in, for example, a bacterial or yeast culture. Polynucleotides can be synthesized in the laboratory, for example, using an automatic synthesizer. An amplification method such as PCR can be used to amplify polynucleotides from either genomic DNA or cDNA encoding the polypeptides.
A polypeptide can be produced recombinantly. A polynucleotide encoding a polypeptide can be introduced into a recombinant expression vector, which can be expressed in a suitable expression host cell system. A variety of bacterial, yeast, plant, mammalian, and insect expression systems are available in the art and any such expression system can be used. Polynucleotides can comprise coding sequences for naturally occurring polypeptides or can encode altered sequences that do not occur in nature.
“Operably linked” refers to the expression of a gene that is under the control of a promoter with which it is spatially connected. A promoter can be positioned 5′ (upstream) or 3′ (downstream) of a gene under its control. A promoter can be positioned 5′ (upstream) of a gene under its control. The distance between a promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. Variation in the distance between a promoter and a gene can be accommodated without loss of promoter function.
Polynucleotides can encode full-length polypeptides, polypeptide fragments, and variant or fusion polypeptides. A polynucleotide can encode a polypeptide, which can be an enzyme or protein that has biological activity. A polynucleotide can encode any polypeptide (e.g., a recombinant non-naturally occurring polypeptide or a naturally occurring polypeptide).
A polypeptide expressed by a polynucleotide can react substantially the same as a wild-type polypeptide in an assay of biological activity, e.g., has 80-120% of the activity of the wild-type polypeptide. A wild-type polypeptide is a polypeptide that is not genetically altered and that has an average biological activity in a natural population of the organism from which it is derived.
Expression Cassettes
Expression cassettes or constructs comprise two or more polynucleotide sequences and can comprise one or more promoters or other expression control sequences (e.g., enhancers, transcriptional terminator sequences, etc.), one or more coding polynucleotides, one or more non-coding polynucleotides. Expression cassettes or constructs can be inserted into a vector, transformed into a host cell, e.g., a bacterial host cell. The expression cassettes can be linear or circular. A linear or circular expression cassette can be integrated into a vector, host bacterial genome, or expression plasmid within the host cell.
The terms “derived from” or “from” when used in reference to a polynucleotide or polypeptide indicate that its sequence is identical or substantially identical to that of the organism of interest. For example a Mucus binding Mub polynucleotide derived from Lactobacillus acidophilus refers to a Mucus binding Mub polynucleotide from Lactobacillus acidophilus having a sequence identical or substantially identical (e.g., about 85, 90, 95, 97, 98, 99%, or more identical) to a native Mucus binding Mub polynucleotide from Lactobacillus acidophilus.
The terms “sequence identity” or “percent identity” are used interchangeably herein. To determine the percent identity of two polypeptide molecules or two polynucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first polypeptide or polynucleotide for optimal alignment with a second polypeptide or polynucleotide sequence). The amino acids or nucleotides at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical positions/total number of positions (i.e., overlapping positions)×100). In some embodiments the length of a reference sequence (e.g., SEQ ID NO:1-66) aligned for comparison purposes is at least 80% of the length of the comparison sequence, and in some embodiments is at least 90% or 100%. In an embodiment, the two sequences are the same length.
Ranges of desired degrees of sequence identity are approximately 80% to 100% and integer values in between. Percent identities between a disclosed sequence and a claimed sequence can be at least 80%, at least 83%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%. In general, an exact match indicates 100% identity over the length of the reference sequence (e.g., SEQ ID NO:1-66).
Polypeptides and polynucleotides that are sufficiently similar to polypeptides and polynucleotides described herein (e.g., SEQ ID NO:1-66) can be used herein. Polypeptides and polynucleotides that are about 90, 91, 92, 93, 94 95, 96, 97, 98, 99 99.5% or more identical to the polypeptides and polynucleotides described herein can also be used.
For example, a polypeptide of polynucleotide can have 80% 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO:1-66.
Vectors
A vector is a polynucleotide that can be used to introduce polynucleotides or expression cassettes into one or more host cells. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, cassettes, and the like. Any suitable vector can be used to deliver polynucleotides or expression cassettes to a population of host cells.
A plasmid is a circular double-stranded DNA construct used as a cloning and/or expression vector. Some plasmids can take the form of an extrachromosomal self-replicating genetic element (episomal plasmid) when introduced into a host cell. Other plasmids integrate into a host cell chromosome when introduced into a host cell. Expression vectors can direct the expression of polynucleotides to which they are operatively linked. Expression vectors can cause host cells to express polynucleotides and/or polypeptides other than those native to the host cells, or in a non-naturally occurring manner in the host cells. Some vectors may result in the integration of one or more polynucleotides (e.g., recombinant polynucleotides) into the genome of a host cell.
Polynucleotides or expression cassettes can be cloned into an expression vector optionally comprising expression control elements, including for example, origins of replication, promoters, enhancers, or other regulatory elements that drive expression of the polynucleotides or expression cassettes in host cells. One or more polynucleotides or expression cassettes can be present in the same vector. Alternatively, each polynucleotide or expression cassette can be present in a different vector.
Host Cells
A host cell or population of host cells can be any suitable host cell, for example, a bacterial cell such as Enterococcus sp., Streptococcus sp., Leuconostoc sp., Lactobacillus sp., and Pediococcus sp., Bacillus sp., Escherichia sp. Other examples include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus zooepidemicus, Enterococcus faecalis, E. coli, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus cereus, Lactobacillus helveticus, Lactobacillus casei, Lactobacillus plantarum, Lactobacillus paraplantarum, Lactobacillus keid, Lactobacillus gassei, Lactobacillus salivarius, Lactobacillus casei, Lactobacillus paracasei, Lactobacillus brevis, Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, and Lactobacillus reuter.
Promoters
A polynucleotide described herein can be operably linked to a promoter. An expression cassette can comprise one or more promoters operably linked to one or more polynucleotides. A promoter can be a constitutive promoter. A constitutive promoter can drive the expression of polynucleotides continuously and without interruption in response to internal or external cues. Constitutive promoters can provide robust polynucleotide expression. Bacterial constitutive promoters include, for example, promoter of an IcnA gene in gene cluster of lactococcin A from Lactococcus, E. coli promoters Pspc, Pbla, PRNAI, PRNAII, P1 and P2 from rrnB, and the lambda phage promoter PL. Constitutive promoters can be functional in a wide range of host cells.
A promoter can be an inducible promoter. An inducible promoter can drive expression of polynucleotides selectively and reliably in response to a specific stimulus. In some embodiments an inducible promoter will drive no polynucleotide expression in the absence of its specific stimulus, but drive robust polynucleotide expression upon exposure to its specific stimulus. Additionally, some inducible promoters can induce a graded level of expression that is tightly correlated with the amount of stimulus received. Stimuli for inducible promoters include, for example, heat shock, exogenous compounds or a lack thereof (e.g., a sugar, metal, drug, or phosphate), salts or osmotic shock, oxygen, and biological stimuli (e.g., a growth factor or pheromone).
Inducible promoters can be regulated by positive and negative control. A positively inducible promoter is inactive in an off state such that an activator cannot bind to the promoter. Once an inducer binds to the activator, then the activator protein can bind to the promoter, turning it on such that transcription occurs.
A negatively inducible promoter is inactive when bound to a repressor protein, such that the transcription does not occur. Once an inducer binds the repressor, the repressor is removed from the promoter and transcription is turned on.
In a Tet-On system the activator rtTA (reverse tetracycline-controlled transactivator) is inactive and cannot bind tetracycline response elements (TRE) in a promoter. Tetracycline and its derivatives are inducing agents that allow promoter activation such that transcription occurs.
A negative inducible pLac promoter requires removal of the lac repressor (lacI protein) for transcription to be activated. In the presence of lactose or lactose analog IPTG, the lac repressor undergoes a conformational change that removes the repressor from lacO sites within the promoter and such that transcription occurs.
In the absence of arabinose regulatory protein AraC binds O and I1 sites upstream of pBad, a negative inducible, thereby blocking transcription. The addition of arabinose causes AraC to bind I1 and I2 sites, allowing transcription to begin. In addition to arabinose, cAMP complexed with cAMP activator protein (CAP) can also stimulate AraC binding to I1 and I2 sites. Supplementing cell growth media with glucose decreases cAMP and represses pBad, decreasing promoter leakiness.
Another example of an inducible promoter is a positive inducible alcohol regulated promoters (AlcA promoter with AlcR activator).
Inducible promoters can be used to limit the expression of polynucleotides in desired circumstances. For example, since high levels of recombinant protein expression may sometimes slow the growth of a host cell, the host cell may be grown in the absence of recombinant polynucleotide expression, and then the promoter can be induced when the host cells have reached a desired density. Exemplary bacterial inducible promoters include for example promoters PnisA, PnisF, PzitR, PsczD, Pcst, Plac, Ptrp, Plac, PT7, PBAD, and PlacUV5. An inducible promoter can function in a wide range of host cells, e.g., bacterial cells.
A repressible promoter can be a positive repressible promoter or a negative repressible promoter. A positive repressible promoter works with an activator. When an activator is bound to the promoter transcription is turned on. When a repressor binds the activator protein, the activator cannot bind the promoter and transcription is turned off. A negative repressible promoter works by a co-repressor binding to a repressor protein, such that the repressor protein can bind to the promoter. The bound repressor then prevents transcription from occurring, such that transcription is turned off. Where a repressor is present, but no co-repressor, the repressor cannot bind to the promoter and transcription is turned on.
Tet-off systems can be used herein. Tetracycline repressor (TetR) can bind to tetracycline operator sequences (TetO), preventing transcription. In the presence of tetracycline (Tet), TetR preferentially binds Tet over the TetO elements, allowing transcription to proceed. This inducible system can also act as a repressible system using a tetracycline-controlled transactivator (tTA). TetR can be fused with the transcriptional activation domain VP16 from herpes simplex virus. tTA binds to promoters containing TetO elements (often linked in groups of seven as a Tet Response Element (TRE)), allowing transcription to proceed. When tetracycline or one of its derivatives is added, it binds tTA, resulting in a confirmation change that prevents binding to the promoter and turning transcription off.
Cumate-inducible gene expression systems can be used herein. Chimeric transactivator, cTA, which is a fusion of CymR and activation domain VP16, binds to promoters containing putative operator sequences (CuO) (linked in groups of 6), allowing transcription to proceed. When cumate is added, it binds cTA, resulting in a confirmation change that prevents binding to the promoter and such that transcription is turned off.
Biofilm Assembly Genes
A biofilm is any syntrophic consortium of microbial cells where the cells stick to each other and optionally, also to a living or non-living surface. The cells can become embedded within an extracellular matrix comprising extracellular polymeric substances (EPSs). Microbial cells within the biofilm can express EPS components, such extracellular polysaccharides, proteins, lipids and DNA. A biofilm can comprise a three-dimensional structure. Microbial cells growing in biofilms are distinct from planktonic cells, which are single cells that “float” in a liquid medium.
Polynucleotides as described herein can encode cell surface proteins that are involved in biofilm assembly. An expression cassette, vector, or population of host cells can comprise one or more polynucleotides encoding biofilm assembly proteins (e.g., 1, 2, 3, 4, 5, or more). A biofilm assembly protein can be, for example, cell surface proteins such as mucus-binding proteins with an LPXTG-motif (SEQ ID NO: 67) cell wall anchor, mannose-specific adhesin with an LPXTG-motif (SEQ ID NO: 67) cell wall anchor, or a Mucus binding protein Mub, adhesion proteins, cell surface protein CscC, outer membrane proteins, and K×YK×GK×W signal domain proteins. Biofilm assembly proteins, such as cell surface proteins, can be derived from Lactobacillus sp., such as Lactobacillus helveticus, Lactobacillus casei, Lactobacillus plantarum, Lactobacillus paraplantarum, Lactobacillus kenri, Lactobacillus gasseri, Lactobacillus paracasei, Lactobacillus brevis, Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, and Lactobacillus reuteri. Examples of cell surface proteins that can be used in the compositions and methods here include those listed in Table 1, and include, for example, P6, P12, P13, P23, P25, P32, P39, P40, P41, and P45. In an aspect a biofilm gene encodes P1-P45 (SEQ ID NO:1-45) or P1-P45 with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5).
Lactobacillus
gasseri
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
rhamnosus
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
casei
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
casei
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
gasseri
Lactobacillus
salivarius
Lactobacillus
plantarum
Lactobacillus
salivarius
Lactobacillus
plantarum
Lactobacillus
plantarum
plantarum ATCC 14917
Lactobacillus
brevis
Lactobacillus
brevis
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactiplantibacillus plantarum (strain ATCC BAA-793/
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
plantarum
Lactobacillus
acidophilus
Lactobacillus
acidophilus
Lactobacillus
acidophilus
PnisA/nisK/nisR Systems
An expression cassette can comprise a PnisA/PnisA/nisK/nisR system. Biosynthesis of nisin is encoded by a cluster of 11 genes, of which the first gene, nisA, encodes the precursor of nisin. Other genes include genes involved in the regulation of the expression of nisin genes (nisR and nisK). NisR and NisK belong to the family of bacterial two-component signal transduction systems. NisK is a histidine-protein kinase that acts as a receptor for the mature nisin molecule. Upon binding of nisin to NisK, it autophosphorylates and transfers the phosphate group to NisR, which is a response regulator that becomes activated upon phosphorylation by NisK. Activated NisR induces transcription of two out of three promoters in the nisin gene cluster: PnisA and PnisF. The promoter driving the expression of nisR and nisK is not affected. Since nisin induces its own expression the accumulation of small amounts of nisin in a growing culture leads to an auto-induction process.
The genes for the signal transduction system nisK and nisR can be used in an expression cassette. When a gene of interest, e.g., a biofilm assembly gene or a functional gene or a marker gene is placed downstream of the inducible promoter PnisA or PnisF in a vector or on the chromosome of a host cell, expression of that gene can be induced by the addition of sub-inhibitory amounts of nisin (e.g., about 0.1-10 ng/ml) to the culture medium. Depending on the presence or absence of targeting signals, protein can be expressed into the cytoplasm, into the membrane, or secreted into the medium.
A marker gene encodes a marker protein such as a fluorescent protein or an antibiotic resistance protein. A functional gene or recombinant gene is not limited in any way and encodes any protein or polypeptide that is desired to be expressed by a population of host cells.
In one embodiment, one expression cassette or vector carries both the nisR and nisK genes and a second expression cassette or vector carries the nisA promoter and the biofilm assembly gene or the functional gene. Alternatively, one expression cassette or vector carries the nisR and nisK genes, the nisA promoter, and the biofilm assembly gene or the functional gene.
In an aspect, the nisK and nisR genes are from L. lactis and are shown in GenBank: Z22813.1. In an aspect nisR is shown in UniProt Q07597. In an aspect, nisK is shown in UniProt Q48675. In an aspect PnisA and PnisF is shown in DeRuyter et al., J. Bact. 178:3434 (1996) or Eichenbaum et al., Appl. Environ. Microbiol. 64:2763 (1998) (all incorporated by reference herein).
PsczD/sczA/PsczA Promoter Systems
An expression cassette can comprise a PsczD/sczA/PsczA system. Pneumococcal repressor SczA and PsczD (also called PczcD) and PsczA (also called PczcA) tightly regulates the expression of genes under their control.
In an aspect a SczA gene is shown in SEQ ID NO:47 NCBI Reference Sequence: WP_238893273.1 and is described in Kloosterman et al., Mol. Microbiol., 65:1365 (2007) and Mu et al., Appl Environ Microbiol. (2013) July; 79: 4503-4508. A PsczA promoter is also shown in SEQ ID NO:47.
PzitR zitR Systems
A PzitR/zitR expression uses a PzitR promoter (also called Pzn promoter) and a zitR regulator gene from, for example the L. lactis MG1363 zit (zitRSQP) operon. A PzitR promoter and a zitR regulator gene are show in SEQ ID NO:46. Expression of genes under PzitR and zitR control are regulated by metallic cations, particularly Zn2+. Divalent cation starvation (Zn2+ concentration of <10 nM) leads to upregulation, whereas concentrated Zn2+ (Zn2+ concentration of >10 nM) maintains repression. See, e.g., Llull et al., Appl. Environ. Microbiol. 70:5398 (2004)(incorporated herein by reference).
dCas/gRNA Systems
Cas, such as Cas9, can be modified to render both catalytic domains (RuVC and HNH) of the protein inactive, resulting in a catalytically-dead Cas (dCas). The dCas is unable to cleave DNA, but maintains its ability to specifically bind to DNA when guided by a guide RNA (gRNA). This allows the CRISPR/dCas system to be used as a sequence-specific, non-mutagenic gene regulation tool. In this case gRNA can be targeted to a promoter, e.g., a constitutive promoter, to block the promoter such that transcription of any genes operably linked to the promoter does not occur.
Therefore, the CRISPR/dCas system is effective to modulate gene expression and includes a dCas protein and at least one guide RNA (gRNA) molecule. In some embodiments, the one or more gRNA molecules includes a CRISPR-associated (Cas) protein binding site and a targeting RNA sequence. In some embodiments, the one or more gRNA molecules specifically targets a promoter. This is possible by designing a gRNA to include a targeting nucleic acid sequence that is complementary to a target promoter. Given the promoter sequence a gRNA can be designed and generated. An example of a gRNA targeting a promoter is shown in SEQ ID NO:48.
In some embodiments, the one or more gRNA molecules specifically bind to the target sequence (e.g., a promoter sequence), which then guide the dCas to the target sequence, where it can interfere with transcription elongation by blocking RNA polymerase or transcription initiation by blocking RNA polymerase binding and/or transcriptions factor binding. This CRISPR/dCas system is highly efficient in suppressing genes, as it is specific, with minimal off-target effects, and is multiplexable, thus allowing for the interference with multiple promoters if desired.
In some embodiments, the dCas9 endonuclease is a Streptococcus pyogenes dCas9, a Streptococcus thermophilus dCas9, a Staphylococcus aureus dCas9, a Brackiella oedipodis dCas9, a Neisseria meningitidis dCas9, a Haemophilus influenzae dCas9, a Simonsiella muelleri dCas9, a Ralstonia solanacearum dCas9, a Francisella novicida dCas9, or a Listeria monocytogenes dCas9, or a derivative of any thereof.
As used herein, “single guide RNA,” “guide RNA (gRNA),” “guide sequence” and “sgRNA” can be used interchangeably herein and refer to a single RNA species capable of directing RNA-guided endonuclease mediated cleavage of target nucleic acid molecule (e.g. a promoter).
A gRNA can comprise any single stranded polynucleotide sequence of about 20 to 300 nucleotides having sufficient complementarity with a target sequence (e.g., a promoter sequence) to hybridize with the target sequence and to direct sequence-specific binding of an RNP complex comprising the gRNA and a CRISPR effector protein, such as dCas9, to the target sequence. A gRNA contains a spacer. The spacer can comprise a plurality of bases that are complementary to the target sequence (such as target 1 or target 2). For example, a spacer can contain about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, or more bases. The portion of the target sequence that is complementary to the guide sequence is known as the protospacer. When a gRNA molecule is specific for a target sequence (e.g., a promoter), the gRNA spacer pairs with a portion of the target sequence called the protospacer. The protospacer is the section of the target sequence that will be cut. The protospacer located next to a PAM sequence.
In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence (e.g., a promoter), when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment can be determined with the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
In some embodiments, a gRNAs can be synthetically generated or by making the sgRNA in vivo or in vitro, starting from a DNA template.
In some embodiments, a gRNA that is capable of binding a target sequence (e.g., a promoter) and binding an RNA-guided DNA endonuclease protein can be expressed from a vector comprising a type II promoter or a type III promoter.
Protease Genes
A protease gene can be used in the disclosed systems to breakdown a biofilm. Suitable protease genes include, for example, Protease A (neutral protease B), B (bacillolysin) and C (subtilisin E) (Table 2), however, any suitable protease can be used. Numerous organisms produce proteases and can be used as sources of protases. For example, Bacillus subtilis 168 produces many proteases. Based on the mechanism of catalysis, proteases are classified into six distinct classes, aspartic (e.g., pepsins, cathepsins, and renins), glutamic (e.g., scytalidoglutamic peptidase), and metalloproteases (e.g., mammalian sterol-regulatory element binding protein (SREBP) site 2 protease and Escherichia coli protease EcfE, stage IV sporulation protein FB), cysteine (e.g., papain, caspase-1), serine (e.g., subtilisin, Lon-A peptidase, Cp protease), and threonine proteases (e.g., omithine acetyltransferase). Any suitable protease can be used in the compositions and methods described herein.
In an aspect an insertion sequence comprising one or more target cleavage sites for one or more proteases can be added to a biofilm assembly gene sequence. An insertion sequence can comprise 2, 3, 4, 5, or more target cleavage sites for two or more (2, 3, 4, 5, or more) different proteases. An insertion sequence can be added to the biofilm assembly gene sequence such that the expressed biofilm assembly protein can be cleaved in the presence of a protease. This can inactivate the biofilm assembly protein such that a biofilm is not produced or a biofilm is broken down. An insertion sequence can be present in the biofilm assembly gene at any position such that when the biofilm assembly protein is expressed, the insertion sequence is available to the protease and such that the insertion sequence does not interfere with the biological function of the biofilm assembly protein. For example, the insertion sequence shown in SEQ ID NO:49 and 50 was added into the linker regions of P45.
Methods
Provided herein are methods of controlling transition between planktonic growth phase and biofilm growth phase in a host cell, such as a bacterial host cell. A host cell can be transitioned to planktonic growth, then to biofilm growth, and back to planktonic growth if desired. A host cell can be transitioned to biofilm growth, then to planktonic growth, and back to biofilm growth if desired. The methods comprise growing a bacterial host cell in a medium, wherein the bacterial host cell comprises:
The addition of a repressor for the first repressible promoter to the medium results in suppression of the expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits planktonic growth phase. In the absence of the repressor for the first repressible promoter and the presence of the repressor for the second repressible promoter in the medium results in expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and suppression of the expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits biofilm growth phase.
In an aspect, The addition of a repressor for the first repressible promoter and a repressor for the second repressible promoter to the medium results in suppression of the expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits planktonic growth phase. In the absence of the repressor for the first repressible promoter and the repressor for the second repressible promoter in the medium results in expression of the recombinant polynucleotide encoding one or more biofilm assembly proteins and suppression of the expression of the recombinant polynucleotide encoding a protease such that the bacterial host cell exhibits biofilm growth phase.
In some aspects the bacterial host cell additionally comprises a recombinant polynucleotide encoding a protein operably linked to an inducible promoter for orthogonal expression in both biofilm growth phase and planktonic growth phase, wherein when an inducer is added to the medium, the bacterial host cell expresses the protein in both biofilm growth phase and planktonic growth phase. The bacterial host can cell additionally comprise a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter for protein expression in planktonic growth phase. A second repressible promoter can be PsczD, wherein the host cell additionally comprises a polynucleotide encoding a sczA operably linked to a PsczA promoter. The first repressible promoter can be PzitR, wherein the bacterial host cell additionally comprises a polynucleotide encoding zitR operably linked to the PzitR promoter. The repressor can be zinc. The one or more biofilm assembly genes can encode P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30, P31, P32, P33, P34, P35, P36, P37, P38, P39, P40, P41, P42, P43, P44, P45, P45IS1, P45IS2, P45IS3, P45IS4, or P45IS5. The protease can be Neutral protease B, Bacillolysin, or Subtilisin E. The inducible promoter can be PnisA. The inducer can be nisin.
An aspect provides expression cassettes, vectors, and recombinant bacterial host cells comprising a recombinant polynucleotide encoding one or more biofilm assembly proteins operably linked to a first repressible promoter; and a recombinant polynucleotide encoding a protease capable of breaking down the one or more biofilm assembly proteins operably linked to a second repressible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can further comprise a recombinant polynucleotide encoding a protein operably linked to an inducible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can additionally comprise a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter. The expression cassettes, vectors, and recombinant bacterial host cells can further comprise a recombinant polynucleotide encoding a protein operably linked to an inducible promoter and a recombinant polynucleotide encoding a protein operably linked to the second repressible promoter.
Also provided herein are expression cassettes comprising a polynucleotide encoding a biofilm assembly gene (e.g., P1-P45, P45 with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5)) operably linked to an inducible or repressible promoter. An inducible promoter can be PnisA and the expression cassette can further comprises a polynucleotide encoding nisK/nisR operably linked to a constitutive promoter.
A population of host cells can comprise a vector encompassing an expression cassette comprising a polynucleotide encoding a biofilm assembly gene (e.g., P1-P45), optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5) operably linked to an inducible promoter. An inducible promoter can be PnisA and the expression cassette can further comprise a polynucleotide encoding nisK/nisR operably linked to a constitutive promoter. This population of cells can be used to express a biofilm assembly gene such that the population host cells form a biofilm. The population of host cells can be grown in culture and nisin can be added to the culture such that the population of host cells expresses the biofilm assembly gene and forms a biofilm.
In some aspects a biofilm assembly gene (e.g., P1-P45), optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5) is operably linked to a repressible promoter, e.g., PsczD, and the expression cassette further comprises a polynucleotide encoding sczA operably linked to a PsczA promoter. A population of host cells can comprise vectors comprising this expression cassette. Biofilm assembly genes can be expressed in this population of host cells such that the host cells form a biofilm. The population of host cells can be grown in culture. Zinc can be added to the population of host cells in culture such that the population of host cells expresses the biofilm assembly gene and forms a biofilm.
In some aspects a biofilm assembly gene (e.g., P1-P45), optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5) is operably linked a repressible promoter, e.g., PzitR. An expression cassette can further comprise a polynucleotide encoding zitR that is also operably linked to the repressible promoter PzitR. A population of host cells can comprise a vector comprising this expression cassette. In some aspects expression of the biofilm assembly gene can be controlled in a population of host cells. The population of host cells can be grown in culture. Zinc can be added to the population of host cells in culture such that the population of host cells does not express the biofilm assembly gene. Zinc can optionally be removed such that the population of host cells expresses the biofilm assembly gene and forms a biofilm. A zitR transcriptional repressor protein can be a Lactococcus transcriptional repression protein.
In an aspect, an expression cassette comprises a biofilm assembly gene (e.g., P1-P45), optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5)) operably linked to a constitutive promoter, a gRNA having specificity for the constitutive promoter, and a polynucleotide encoding a dCas, wherein the gRNA having specificity for the constitutive promoter and the polynucleotide encoding dCas are both operably linked to an inducible promoter. In an aspect an inducible promoter is PnisA and the expression cassette further comprises a polynucleotide encoding nisK/nisR operably linked to a constitutive promoter. A population of host cells comprising a vector having such an expression cassette can be generated. The population of host cells can be used in a method of controlling expression a biofilm assembly gene by growing the population of host cells in culture, and adding nisin to the population of host cells in culture such that the population of host cells express the gRNA having specificity for the constitutive promoter and the dCas such that expression of the biofilm assembly gene is prevented; and, optionally, removing nisin such that the population of host cells expresses the biofilm assembly gene and forms a biofilm. Alternatively, the population of host cells can be cultured in the absence of nisin such that a biofilm is generated. Nisin can then be added to the culture of host cells so that they shift from biofilm growth to planktonic growth. Growth can then be shifted back to biofilm growth if desired by removing or stopping the addition of nisin to the cell culture.
In an aspect an expression cassette comprises a polynucleotide encoding a protease operably linked to repressible promoter PsczD, a polynucleotide encoding sczA operably linked to a PsczA promoter, and a polynucleotide encoding a biofilm assembly gene (e.g., P1-P45 optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5)) and zitR operably linked to repressible promoter PzitR. The polynucleotide encoding a protease operably linked to repressible promoter PsczD, can further comprise one or more functional genes or marker genes also operably linked to the repressible promoter PsczD. The expression cassette can further comprise a polynucleotide encoding one or more functional genes or marker genes operably linked to a PnisA promoter. A protease can be, for example, Neutral protease B, Bacillolysin, or Subtilisin E.
In an aspect a population of host cells can comprise a vector comprising an expression cassette having a polynucleotide encoding a protease operably linked to repressible promoter PsczD, a polynucleotide encoding sczA operably linked to a PsczA promoter, a polynucleotide encoding a biofilm assembly gene (e.g., P1-P45), optionally, with one or more insertion sequences (e.g., P45IS1, P45IS2, P45IS3, P45IS4, P45IS5)) and zitR operably linked repressible promoter PzitR. The polynucleotide encoding a protease operably linked to repressible promoter PsczD, can further comprise one or more functional genes or marker genes also operably linked to the repressible promoter PsczD. The expression cassette can further comprise a polynucleotide encoding one or more functional genes or marker genes operably linked to a PnisA promoter. This population of host cells can be used in a method of controlling expression a biofilm assembly gene in a population of host cells. The population of host cells can form a biofilm when the cells are cultured in the absence of zinc. Zinc can be added to the population of host cells such that the population of host cells switches to planktonic growth. Alternatively, the population of host cells can grow in planktonic form when the cells are cultured with zinc. The zinc can then be removed or no more addition of zinc can used to move the cells to biofilm growth. Furthermore, nisin can be added to the culture to activate a PnisA promoter to transcribe a polynucleotide encoding one or more functional genes or marker genes to which it is operably linked such that the polynucleotide encoding one or more functional genes or marker genes is expressed.
The compositions and methods are more particularly described below and the Examples set forth herein are intended as illustrative only, as numerous modifications and variations therein will be apparent to those skilled in the art. The terms used in the specification generally have their ordinary meanings in the art, within the context of the compositions and methods described herein, and in the specific context where each term is used. Some terms have been more specifically defined herein to provide additional guidance to the practitioner regarding the description of the compositions and methods.
As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items. As used in the description herein and throughout the claims that follow, the meaning of “a”, “an”, and “the” includes plural reference as well as the singular reference unless the context clearly dictates otherwise. The term “about” in association with a numerical value means that the value varies up or down by 5%. For example, for a value of about 100, means 95 to 105 (or any value between 95 and 105).
All patents, patent applications, and other scientific or technical writings referred to anywhere herein are incorporated by reference herein in their entirety. The embodiments illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are specifically or not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising,” “consisting essentially of,” and “consisting of” can be replaced with either of the other two terms, while retaining their ordinary meanings. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claims. Thus, it should be understood that although the present methods and compositions have been specifically disclosed by embodiments and optional features, modifications and variations of the concepts herein disclosed can be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of the compositions and methods as defined by the description and the appended claims.
Any single term, single element, single phrase, group of terms, group of phrases, or group of elements described herein can each be specifically excluded from the claims.
Whenever a range is given in the specification, for example, a temperature range, a time range, a composition, or concentration range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. It will be understood that any subranges or individual values in a range or subrange that are included in the description herein can be excluded from the aspects herein. It will be understood that any elements or steps that are included in the description herein can be excluded from the claimed compositions or methods
In addition, where features or aspects of the compositions and methods are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the compositions and methods are also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
The following are provided for exemplification purposes only and are not intended to limit the scope of the embodiments described in broad terms above.
Example 1. Mining matrix building blocks for orthogonal biofilm assembly. Biofilm formation is a foundational prerequisite for bacteria to alternate lifestyles; we thus started by searching for scaffold molecules that constitute biofilm extracellular matrix. We targeted those orthogonal to native counterparts because they promote the predictability of desired behaviors and flexibility of functionality programming by minimizing the crosstalk with endogenous circuitry. We also specifically chose protein as our potential building block over other extracellular polymeric substances such as polysaccharides, DNA and lipids due to its relative ease for production and modification.
Utilizing the UniProt protein database44, we explored surface-related proteins of lactobacillus species, from which 45 candidates were identified (Table 1).
We cloned the candidate genes into the constitutive expression vector, pleiss-pcon-gfp (
Lactococcus lactis
Listeria monocytogenes
Bacillus subtilis 168
To characterize these proteins, we cultured the strains for 24 hours with GM17 medium in 12-well plates that contain 18 mm glass cover slips on wells' bottoms. Using crystal violet staining45, we found that, compared to GFP encoded by the control strain, a large portion of the expressed proteins promoted biofilm formation on glass among which P6, P12, P13, P23, P25, P40 and P45 yielded densest biofilms (
Auto-aggregation enables planktonic cells to attach to each other and is often considered as another common trait of biofilms besides surface attachment46. We thus cultured the 45 strains in test tubes and quantified their auto-aggregation. We found that auto-aggregation (
Controllability is a key trait for engineered organisms to realize desired behaviors. To regulate bacterial life cycle, we proceeded to construct gene circuits that direct the organization of planktonic cells into biofilms.
We set out to exploit the NICE system, an externally inducible module for L. lactis47, by leveraging the integrated nisR/K cassette in the NZ9000 chromosome and using the nisin inducible promoter, PnisA, to drive the scaffold protein genes (
Additionally, we assessed whether synthetic biofilm assembly can be regulated by physiologically relevant variables akin to the formation of native biofilms triggered by nutrient limitation and stress. Adopting zinc as a responsive cue, we built a gene circuit involving the constitutively expressed transcriptional factor gene sczA49 and its cognate promoter PsczD driving the scaffold genes (
Opposite to biofilm assembly is its deconstruction, another key step of bacterial life cycle during which aggregated cells disperse from biofilms into single cells. Although engineering biofilm dispersal has been a long-standing challenge for researchers, microbes in nature have found remarkable strategies to break down matrix and release cells. For instance, they secrete enzymes to degrade polysaccharides and eDNA, common components of matrix, to achieve biofilm degradation. In our design, proteins are the building blocks of synthetic biofilms, so we were inspired to investigate protease for programmable biofilm destruction. Using Proteinase K and trypsin, we found that on both glass cover slips (
One limitation of the trio, however, is that they are much weaker than P45 toward biofilm formation (
Subsequently, we measured the biofilm formation ability and sensitivity to protease treatment for the strains expressing the variants. Compared to the original P45 (
In nature, microbes dynamically and autonomously alternate their lifestyles in response to environmental cues, which allows them to match different physiological needs and harness the benefits of both phases. To empower synthetic bacteria with such a trait, we tested the feasibility of in vivo protease expression and secretion. Three protease genes from Bacillus subtilis 168, Protease A (neutral protease B), B (bacillolysin) and C (subtilisin E)51 (Table 2), were cloned along with their native signal peptides and placed under the nisin inducible promoter (PnisA). Our SDS-PAGE results showed that all three proteases were secreted and cleaved correctly (
We then proposed an integrated gene circuit for environment-responsive autonomous planktonic-biofilm transition, which comprises the scaffold gene IS5, a zinc-repressed control module, a zinc-inducible control module, the protease gene X and the reporter gene gfp (
Next, we evaluated the autonomy of the circuit (IS5-Zn-gfp-prob)-loaded cells under different zinc-varying settings (
In nature, biofilm formation is often associated with the alteration of cellular functions through accompanied genetic, metabolic or signaling cascades. To demonstrate the potential of the lifestyle program for driving cellular functional phenotypes, we constructed a new circuit (IS5-orf29-P7-Erm-Zn-gfp-prob) that couples biofilm formation with erythromycin resistance, a model phenotype (
To illustrate the utility of this synthetic lifestyle program, we asked whether it can be utilized for phase-specific heterologous biosynthesis that aligns with the alteration of physiological homeostasis in changing environments. Explicitly, we targeted protein synthesis in the planktonic phase, as single cells have a better access than their biofilm counterparts to nutrient needed for biomolecule overproduction. Toward this goal, we created a modular design involving a generic functional cassette X that is substitutable for encoding different substances (
We specified X in the design with the amylase gene amyE53, which produces a hydrolase secreted to convert polymeric starch into simple sugars (
We continued the test by synthesizing and secreting the model therapeutic substance, mouse heme oxygenase 1 (mHO-1), which reduces superoxide and other reactive oxygen species and hence promotes the prevention of inflammation54 (
To explore if our synthetic program also confers dynamic, phase-specific modulation of intracellular, un-secreted molecules, we further adapted the circuit to encode GusA which catalyzes the hydrolysis of 3-D-glucuronic acid residues55 (
To further showcase the platform, we sought to explore orthogonal control over cellular lifestyle and function realization. In theory, such a management fashion allows engineered strains to sense multiple environmental stimuli, yield adjustable responses and behave beyond the imitation of native organisms, thereby expanding the programmability of cellular functionality.
To that end, we devised a pair of regulatory modules, including one zinc-responsive and the other nisin-inducible, which independently drive lifestyle transition and the expression of functional genes (e.g., bga) respectively (
Our first demonstration of the design involved the gene bga, which encodes a secreted beta-galactosidase that hydrolases lactose to glucose and galactose and helps to treat lactose intolerance57. We quantified the Bga level and biofilm thickness of the cells under varied zinc and nisin conditions. Despite cellular phase variations, we found the Bga level remained low as long as nisin was absent (
Our second demonstration included the synthesis of the pediocin PA-1 (
We established here a synthetic genetic program for bacterial lifestyle control that is orthogonal, tunable and programmable. The program utilizes an orthogonal mechanism centering around engineered surface proteins for matrix assembly. It is also highly controllable for biofilm formation and decomposition and accessible for responsive autonomous planktonic-biofilm transitions. The platform is further programmable for advanced function realization such as phase-coordinated and phase-independent biomolecule production.
Rapid advances in synthetic biology have brought the engineering of living organisms from concept demonstration to the exciting stage for applications. Our synthetic system provides a promising platform for engineering microbes that are adaptive to changing habitats and capable of fulfilling tasks across physiologically distinct regimes. One potential application lies in industrial practices relating to biomanufacturing, biocatalysis and food production, by creating a genetic program that drives cells to switch between active product synthesis and sessile biofilm development in response to external signals for long-term, multi-round fermentations. Additionally, the system can be utilized to enhance and prolong the therapeutic effects of probiotics for chronic inflammation and infection by establishing a genetic system that enables custom-tailored strains to colonize in the gastrointestinal tract and secret therapeutic agents as needed. Meanwhile, to fully unlock biofilms for future use, our platform can be further augmented by introducing self-recognition circuits to facilitate rapid autonomous lifecycle transition and by extending the biofilm engineering of mono-species populations to multispecies communities. In parallel, the system can be adopted as a well-defined experimental model for studying the fundamental process of microbial environmental sensing and decision making, and as a possible testbed for evaluating strategies for biofilm prevention and removal. As biofilms are multicellular systems with spatial heterogeneity, the platform can be potentially utilized to interrogate microbial social interactions, spatial organization, and multicellularity development.
Strains and growth conditions. Lactococcus lactis (L. lactis) NZ9000 was used as the host for expression of biofilm forming proteins. Lactococcal strains were cultured in M17 medium with 0.5% glucose (GM17) at 30° C. Listeria monocytogenes 10403S was grown in TSB medium at 37° C. Antibiotic and chemicals were added as required: chloramphenicol (Cm, 5 μg ml−1), nisin (10 ng ml−1), ZnSO4 (1 mM) and EDTA (30 μM). A complete description of the strains and plasmids is provided in Table 2.
Plasmid construction. Genomic DNAs of lactic acid bacteria strains were prepared using the CTAB method59. Genes of 45 putative surface-binding and aggregation proteins were amplified from genomic DNAs and cloned into the plasmid pleiss-Pcon-gfp15 to replace the gfp gene. Gibson assembly was used for the construction of all plasmids. The gene fragments dcas9 and mf-lon were amplified from the plasmids pMJ841 and pECGMC3 which were purchased from Addgene. The amylase gene amyE was cloned from Bacillus subtilis 168. Mouse heme-oxygenase 1 gene mHO-1, β-galactosidase gene bga, zinc inducible circuit, zinc repressed circuit, pediocin gene ped and orf29 were all synthesized as Gblock from IDT. Sequences for promoters and genes are listed in Table 3.
TCGACCAGTTTCTTGGGGCAATTATGCAGTTTGCAGAAAACAAGCATGAAATA
TTACTCGGCGAATGCGAAAGTAATGTTAAGCTAACAAGCACGCAAGAACATAT
CTTAATGATTCTAGCTGCAGAGGTTTCGACAAACGCGAGAATTGCCGAGCAAC
TCAAGATTTCGCCAGCAGCGGTAACTAAAGCTCTCAAAAAATTACAAGAGCAA
GAACTGATTAAATCAAGTCGGGCAACAAATGACGAACGCGTAGTCCTTTGGA
GCCTGACAGAAAAAGCAATTCCAGTTGCTAAAGAACATGCTGCTCATCATGAG
AAAACTCTAAGTACCTACCAAGAATTAGGAGACAAATTTACTGACGAAGAACA
AAAAGTGATAAGTCAATTCTTATCAGTACTTACGGAGGAGTTTCGATGAAG
AAATTGTACAACTTCTTGATCTGTGAAGTCTTGTCCTTTCTTCAACCACCATGT
CAAAGTTTCAATAAAATTTGACATAACCAAATGTTGCAAATATGATGTTGGTAA
ATTTGGATGAGCTTCTTTCAAATTATCAGCTAAAACTGAATAAACATGATGTTC
TAATTCCTTATGTAATTGTCTTAAGAAATAATCATTCTTTGAGAACAATAATGAT
GTAATATGATCTTGATTCTTATGGAAATGTAAGAATAAATGAGCCAAATAATCT
TCTGTTGAAATAGCTTGTTCTCTTTCAAACAAATGATGAAACAAATATCTACATA
ATTGATCCAATAATAATTCTTTAGATTCATAATGACAATAGAATGTTGATCTTCC
AACATCAGCCAAATCAATAATATCTTGAACAGTTGTAGCTTCATATCCTTTAGC
ATTTAATAATTGAATAAATGCTTGATAGATGGCTTTTTTGGTTTTGCTGATACGA
CGGTCAATGTTAGTCATATGGACACTTAAGGCAAATTGTTCAGAACTGAATAA
GTGTATAAAATTTTAATAGTTGATGATGATCAGGAAATTTTAAAATTAATGAA
GACAGCATTAGAAATGAGAAACTATGAAGTTGCGACGCATCAAAACATTTC
ACTTCCCTTGGATATTACTGATTTTCAGGGATTTGATTTGATTTTGTTAGATAT
CATGATGTCAAATATTGAAGGGACAGAAATTTGTAAAAGGATTCGCAGAGA
AATATCAACTCCAATTATCTTTGTTAGTGCGAAAGATACAGAAGAGGATATT
ATAAACGGCTTAGGTATTGGTGGGGATGACTATATTACTAAGCCTTTTAGCC
TTAAACAGTTGGTTGCAAAAGTGGAAGCAAATATAAAGCGAGAGGAACGCA
ATAAACATGCAGTTCATGTTTTTTCAGAGATTCGTAGAGATTTAGGACCAATT
ACATTTTATTTAGAAGAAAGGCGAGTCTGTGTCAATGGTCAAACAATTCCAC
TGACTTGTCGTGAATACGATATTCTTGAATTACTATCACAACGAACTTCTAAA
GTTTATACGAGAGAGGATATTTATGATGACGTATATGATGAATATTCTAATG
CACTTTTTCGGTCAATCTCGGAGTATATTTATCAGATTAGGAGTAAGTTTGCA
CCATACGATATTAATCCGATAAAAACGGTTCGGGGACTTGGGTATCAGTGG
C
ATGGGTAAAAAATATTCAATGCGTCGACGGATATGGCAAGCTGTCATTGAAA
TTATCATAGGTACTTGTCTACTTATCCTGTTGTTACTGGGCTTGACTTTCTTTCT
ACGACAAATTGGACAAATCAGTGGTTCAGAAACTATTCGTTTATCTTTAGATTC
AGATAATTTAACTATTTCTGATATCGAACGTGATATGAAACACTACCCATATGA
TTATATTATGTTTGACAATGATACAAGTAAAATTTTGGGAGGACATTATGTCAA
GTCGGATGTACCTAGTTTTGTAGCTTCAAAACAGTCTTCACATAATATTACAGA
AGGAGAAATTACTTATACTTATTCAAGCAATAAGCATTTTTCAGTTGTTTTAAGA
CAAAACAGTATGCCAGAATTTACAAATCATACGCTTCGTTCAATTTCTTATAAT
CAATTTACTTACCTTTTCTTTTTTCTTGGTGAAATAATACTCATTATTTTTTCTGT
CTATCATCTCATTAGAGAATTTTCTAAGAATTTTCAAGCCGTTCAAAAGATTGC
ATTGAAGATGGGGGAAATAACTACTTTTCCTGAACAAGAGGAATCAAAAATTAT
TGAATTTGATCAGGTTCTGAATAACTTATATTCGAAAAGTAAGGAGTTAGCTTT
CCTTATTGAAGCGGAGCGTCATGAAAAGCATGATTTATCCTTCCAGGTTGCTG
CACTTTCACATGATGTTAAGACACCTTTAACAGTATTAAAAGGAAATATTGAAC
TGCTAGAGATGACTGAAGTAAATGAACAACAAGCTGATTTTATTGAGTCAATG
AAAAATAGTTTAACTGTTTTTGACAAGTATTTTAACACAATGATTAGTTATACAA
AACTTTTGAATGATGAAAATGATTACAAAGCGAGAATCTCCCTGGAGGATTTTT
TGATAGATTTATCAGTTGAGTTGGAAGAGTTGTCAACAACTTATCAAGTGGATT
ATCAGCTAGTTAAAAAAACAGATTTAACCACTTTTTACGGAAATACATTAGCTT
TAAGTCGAGCACTTATCAATATCTTTGTTAATGCCTGTCAGTATGCTAAAGAGG
GTGAAAAAATAGTTAGTTTGAGTATTTATGATGATGAAAAATATCTCTATTTTGA
AATCTGGAATAATGGTCATCCTTTTTCTGAACAAGCAAAAAAAAATGCTGGAAA
ACTATTTTTCACAGAAGATACTGGACGTAGTGGGAAACACTATGGGATTGGAC
TATCTTTTGCTCAAGGTGTAGCTTTAAAACATCAAGGAAACTTAATTCTCAGTA
ATCCTCAAAAAGGTGGGGCAGAAGTTATCCTAAAAATAAAAAAGTAA
Characterization of biofilm forming proteins. All biofilm forming proteins and their sources are listed in Table 1. Gene expression and biofilm formation were performed by inoculating 150 μl of 1:50 diluted overnight culture of each sample into 96-well cell culture treated plates (Nunclon Delta surface, Thermo Scientific 167008) and 96-well non-treated plates (Falcon, 351172). In addition, for each sample, 2 ml of 1:50 diluted overnight culture was inoculated into a 12-well plate (Thermo Scientific 150628) containing an 18 mm circle cover glass (VWR 16004-300) at the bottom for testing biofilm formation on glass surface. The culture was grown for 24 hours and the biofilm was quantified by crystal violet method45.
Auto-aggregation. Cells from overnight cultures of 45 strains were collected by centrifuge at 3000 g for 5 minutes, re-suspended in PBS buffer, and adjusted to a final OD600 of 1.0. Three microliters of cell suspensions were added into a 5 ml test tube (Falcon, 352008) and incubated at room temperature. After incubation for 1, 2, 4, and 6 hours, 1 ml of top supernatant was carefully taken from the tube by pipetting and used for measurement of OD600 which is labelled as OD600_final. The aggregation rate was calculated as (1−OD600_final)/1×100%.
Induction of biofilm formation. For nisin induced or repressed biofilm formation, 150 μl of 1:50 dilution of overnight cultures in fresh GM17/Cm were added to a 96-well cell culture treated plate and incubated at 30° C. for 2 hours. Then nisin was added at a final concentration of 10 ng m−1 and the plate was incubated at 30° C. for 24 hours for biofilm formation. For zinc induced or repressed induction, overnight cultures were directly diluted at 1:50 in GM17/Cm with zinc or EDTA and 150 μl of cultures were added to a 96-well plate at 30° C. for 24 hours for biofilm formation. The biofilms were quantified using the crystal violet method45.
Protease treatment. Biofilms were first grown in a 12-well plate with an 18 mm circle cover glass at the bottom for 24 hours. Then, the supernatants were removed by pipetting and biofilms were washed once by PBS buffer. Proteinase K or Trypsin dissolved in PBS was added to biofilms at a final concentration of 10 μg ml−1. Biofilms were treated at 30° C. for 2 hours and then washed once by PBS. The remaining biofilms were quantified by crystal violet staining. For auto-aggregation assay, cells from overnight cultures were collected by centrifuge at 3000 g for 5 minutes, re-suspended in PBS buffer, and adjusted to OD600 of 1.0. Three microliters of cell suspensions were added into 5 ml test tubes (Falcon, 352008) and Proteinase K was added at a final concentration of 10 μg ml−1. The test tubes were incubated at room temperature for 4 hours and images were taken.
Transition between planktonic and biofilm states. Overnight cultures were diluted 1:50 by fresh GM17 medium with zinc and inoculated in 12-well plates with each containing an 18 mm circle cover glass at the bottom. The plate was incubated at 30° C. for biofilm formation. Every 12 hours, the supernatant of each sample was carefully removed and fresh medium with zinc was added. At hour 36, the supernatant of each sample was removed and each well was washed once by fresh M17 medium. Then GM17 medium with EDTA was added to the plate for state transition. Every 12 hours, medium was changed with fresh GM17/EDTA. At hour 72, the wells were washed again with M17 medium and then changed back to GM17/Zinc medium. At hour 36, 62, and 108, supernatants were used to measure enzyme activity and biofilms were quantified by crystal violet staining. For nisin induced expression, the supernatant of each sample was taken after induction by nisin for 5 hours to measure protein production.
Measurement of GFP fluorescence. To prepare samples to measure GFP fluorescence of planktonic cells, supernatants were taken from 12-well plates, centrifuged, and re-suspended with PBS buffer. To measure GFP fluorescence of biofilm cells, biofilms were released from the glass cover slips by adding PBS buffer and violently pipetting up and down for 15 seconds. To ensure all the cells including those in the supernatant and in the biofilm of a sample were collected for fluorescence measurement, the cells growing on the bottom of each 12-well plate were scraped off and thoroughly mixed with the corresponding supernatant by vigorously pipetting up and down. Then, the mixture was transferred into a microcentrifuge tube and centrifuged. The resulting cell pellet was re-suspended with PBS buffer by vortex. The GFP fluorescence was measured by a BioTek Synergy H1M reader and OD600 was measured by Nanodrop 2000 Spectrophotometers. The relative GFP unit (RFU) is defined as fluorescent units per OD600 per 100 μl. Notably, at each time point, six samples were prepared, of which three were taken to measure GFP as described here and the other three were used to measure biofilm formation.
Measurement of enzyme activity. The activity of amylase was measured using EnzChek™ Ultra Amylase Assay Kit (Thermo Fisher, E33651). The activity of mouse Heme Oxygenase-1 in the culture was quantified by Mouse Heme Oxygenase 1 ELISA Kit (abcam, ab204524). To measure β-glucuronidase activity, 50 μl of 20 mM PNPG (p-Nitrophenyl-β-D-glucuronide) was added to 1 ml of cell culture in the 12-well plate that expresses GusA and incubated at room temperature for 15 minutes. Then, 500 μl of supernatant was taken from the 12-well plate and added to a 1.5 ml microcentrifuge tube containing 500 μl of 1 M NaCO3 for stopping the reaction. The mixture was centrifuged and 200 μl of the mixture was added to a 96-well plate to measure the absorbance at 420 nm. For standard curve, 100 μl of 0-1000 μM PNP (4-Nitrophenol) and 100 μl of 1 M NaCO3 were added to the same 96-well plate for measurement of absorbance at 420 nm. The relative unit of β-glucuronidase is defined as the micromole of PNP generated per ml of samples per minute.
To measure β-galactosidase activity, 50 μl of supernatant of the bacterial culture was mixed with 25 μl of 20 mM ONPG (o-nitrophenyl-β-galactoside) and 25 μl of PBS buffer in a 96-well plate. The plate was kept at 37° C. for 30 minutes, then 100 μl of 1 M NaCO3 was added to terminate the reaction. The resulting samples were measured at 420 nm for absorbance. The standard curve was made by dilution of 10 mM ONP (2-Nitrophenol) to the final concentration of 0-1000 μM. 100 μl of each concentration was added to 96 well plate, incubated the same time as samples, and added with 100 μl NaCO3 at the end of the experiment. The relative unit is defined as the micromole of ONP generated per ml of samples per minute.
To determine the anti-listeria effect of expressed pediocin, agar diffusion assay was performed as previously described80. In brief, 25 ml of melted TSB agar (0.85% agar) was cool down to 48° C. by incubating in water bath and added with 200 μl overnight culture of L. monocytogenes 10403S. The cells were gently mixed and poured into a 90 mm plate. A PCR plate was put on the melted agar mix to make wells on it. After incubation at room temperature for half an hour, the PCR plate was removed and pediocin samples were added into the wells. The plate was first incubated at room temperature for 2 hours to diffuse the pediocin into the agar and then incubated at 30° C. for 24 hours to form the inhibition zone.
Scanning electron microscopy (SEM) analysis. Biofilms were grown on 6 mm round glass coverslips in a 24-well plate for 24 hours. Then biofilms were fixed with 2.0% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M Na-Cacodylate buffer (pH 7.4) at 4° C. for 4 hours. After rinse with 0.1 M Na-Cacodylate buffer, they were dehydrated by washing through a graded ethanol series (37, 67, 95, and 3×100% (v/v)] for 10 minutes each. Dehydrated samples were dried in critical point dryer in 100% ethanol and then coated with gold-palladium. Finally, samples were observed using a FEI Quanta FEG 450 ESEM microscope.
Statistical analysis. All of the experiments were performed for at least three times. Replicate numbers of the experiments (n) are indicated in the figure legends. Sample sizes were chosen based on standard experimental requirement in molecular biology. Data are presented as mean±standard deviation (s.d.). Microscopy images are representatives of the images from multiple experimental replicates.
From Tables 1-3
This application claims the benefit of 63/404,971, filed on Sep. 9, 2022, which is incorporated by reference herein in its entirety.
This invention was made with government support under N000141612525 awarded by the Office of Naval Research, under 1553649 awarded by the National Science Foundation, and under GM133579 awarded by the National Institute of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63404971 | Sep 2022 | US |
