Patent Application
20220370527
Cancer is the second leading cause of death in the United States. In recent years, great progress has been made in cancer immunotherapy, including immune checkpoint inhibitors, T cells with chimeric antigen receptors, and oncolytic viruses.
Oncolytic viruses are naturally occurring or genetically modified viruses that infect, replicate in, and eventually kill cancer cells while leaving healthy cells unharmed. A recently completed Phase III clinical trial of the oncolytic herpes simplex virus T-VEC in 436 patients with unresectable stage IIIB, IIIC or IV melanoma was reported to meet its primary end point, with a durable response rate of 16.3% in patients receiving T-VEC compared to 2.1% in patients receiving GM-CSF. Based on the results from this trial, FDA approved T-VEC in 2015.
Oncolytic virus constructs from at least eight different species have been tested in various phases of clinical trials, including adenovirus, herpes simplex virus-1, Newcastle disease virus, reovirus, measles virus, coxsackievirus, Seneca Valley virus, and vaccinia virus. It has become clear that oncolytic viruses are well tolerated in patients with cancer. The clinical benefits of oncolytic viruses as stand-alone treatments, however, remain limited. Due to concerns on the safety of oncolytic viruses, only highly attenuated oncolytic viruses (either naturally avirulent or attenuated through genetic engineering) have been used in both preclinical and clinical studies. Since the safety of oncolytic viruses has now been well established it is time to design and test oncolytic viruses with maximal anti-tumor potency. Oncolytic viruses with a robust oncolytic effect will release abundant tumor antigens, resulting in a strong immunotherapeutic effect.
Provided herein are compositions comprising a recombinant oncolytic virus comprising a nucleic acid molecule encoding one or more human or bacterial sialidases or a functional portion thereof. The oncolytic viruses can be derived from a poxvirus, an adenovirus, a herpes virus or any other suitable oncolytic virus. Suitable recombinant oncolytic viruses can be created by inserting an expression cassette that includes a sequence encoding a sialidase or a portion thereof with sialidase activity into an oncolytic virus.
Many cancer cells are hypersialylated. The recombinant oncolytic viruses described herein are capable of delivering sialidase to tumor cells and the tumor cell environment. The delivered sialidase can reduce sialic acid present on tumor cells and render the tumor cells more vulnerable to killing by immune cells, immune cell-based therapies and other therapeutic agents whose effectiveness is diminished by hypersialylation of cancer cells.
Also provided are methods for delivering a sialidase to the tumor microenvironment. Within the tumor microenvironment the sialidase can remove terminal sialic acid residues on cancer cells, thereby reducing the barrier for entry of immunotherapy reagents and promote cellular immunity against cancer cells.
The term “recombinant” when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
The terms “virus” or “virus particle” are used according to its plain ordinary meaning within Virology and refers to a virion including the viral genome (e.g. DNA, RNA, single strand, double strand), viral capsid and associated proteins, and in the case of enveloped viruses (e.g. herpesvirus, poxvirus), an envelope including lipids and optionally components of host cell membranes, and/or viral proteins.
The term “poxvirus” is used according to its plain ordinary meaning within Virology and refers to a member of Poxviridae family capable of infecting vertebrates and invertebrates which replicate in the cytoplasm of their host. In embodiments, poxvirus virions have a size of about 200 nm in diameter and about 300 nm in length and possess a genome in a single, linear, double-stranded segment of DNA, typically 130-375 kilobase.
The term poxvirus includes, without limitation, all genera of poxviridae (e.g., betaentomopoxvirus, yatapoxvirus, cervidpoxvirus, gammaentomopoxvirus, leporipoxvirus, suipoxvirus, molluscipoxvirus, crocodylidpoxvirus, alphaentomopoxvirus, capripoxvirus, orthopoxvirus, avipoxvirus, and parapoxvirus). In embodiments, the poxvirus is an orthopoxvirus (e.g., smallpox virus, vaccinia virus, cowpox virus, monkeypox virus), parapoxvirus (e.g., orf virus, pseudocowpox virus, bovine popular stomatitis virus), yatapoxvirus (e.g., tanapox virus, yaba monkey tumor virus) or molluscipoxvirus (e.g., molluscum contagiosum virus). In embodiments, the poxvirus is an orthopoxvirus (e.g., cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, vaccinia virus strain WR, vaccinia virus strain IHD, vaccinia virus strain Elstree, vaccinia virus strain CL, vaccinia virus strain Lederle-Chorioallantoic, or vaccinia virus strain AS). In embodiments, the poxvirus is a parapoxvirus (e.g., orf virus strain NZ2 or pseudocowpox virus strain TJS).
A “sialidase catalytic domain protein” is a protein that comprises the catalytic domain of a sialidase, or an amino acid sequence that is substantially homologous to the catalytic domain of a sialidase, but does not comprise the entire amino acid sequence of the sialidase the catalytic domain is derived from, wherein the sialidase catalytic domain protein retains substantially the same activity as the intact sialidase the catalytic domain is derived from. A sialidase catalytic domain protein can comprise amino acid sequences that are not derived from a sialidase, but this is not required. A sialidase catalytic domain protein can comprise amino acid sequences that are derived from or substantially homologous to amino acid sequences of one or more other known proteins, or can comprise one or more amino acids that are not derived from or substantially homologous to amino acid sequences of other known proteins.
=T-test P value<0.05, suggesting that DAS181 alone boosts NK cell-mediated U87 tumor killing in vitro, compared to enzyme-dead DAS185. *=T-Test P value<0.05.
Numerous oncolytic viruses, including Vaccina virus, Coxsackie virus, Adenovirus, Measles, Newcastle disease virus, Seneca Valley virus, Coxsackie A21, Vesicular stomatitis virus, Parvovirus H1, Reovirus, Herpes virus, Lentivirus, and Poliovirus, and Parvovirus. Vaccinia Virus Western Reserve, GLV-1h68, ACAM2000, and OncoVEX GFP, are available. The genomes of these oncolytic virus can be genetically modified to insert a nucleotide sequence encoding a protein that includes all or a catalytic portion of a sialidase. The nucleotide sequence encoding a protein that includes all or a catalytically active portion of a sialidase is placed under the control of a viral expression cassette so that the sialidase is expressed by infected cells.
VSV has been used in multiple oncolytic virus applications. In addition, VSV has been engineered to express an antigenic protein of human papilloma virus (HPV) as a method to treat HPV positive cervical cancers via vaccination (REF 18337377, 29998190) and to express pro-inflammatory factors to increase the immune reaction to tumors (REF 12885903). Various methods for engineering VSV to encode an additional gene have been described (REF 7753828). Briefly, the VSV RNA genome is reverse transcribed to a complementary, doubled stranded-DNA with an upstream T7 RNA polymerase promoter and an appropriate location within the VSV genome for gene insertion is identified (e.g., within the noncoding 5′ or 3′ regions flanking VSV glycoprotein (G) (REF 12885903). Restriction enzyme digestion can be accomplished, e.g., with Mlu I and Nhe I, yielding a linearized DNA molecule. An insert consisting of a DNA molecule encoding the gene of interest flanked by appropriate restriction sites can be ligated into the linearized VSV genomic DNA. The resulting DNA can be transcribed with T7 polymerase, yielding a complete VSV genomic RNA containing the inserted gene of interest. Introduction of this RNA molecule to a mammalian cell, e.g., via transfection and incubation results in viral progeny expressing the protein encoded by the gene of interest.
Ad5 contains a human E2F-1 promoter, which is a retinoblastoma (Rb) pathway—defective tumor specific transcription regulatory element that drives expression of the essential Ela viral genes, restricting viral replication and cytotoxicity to Rb pathway-defective tumor cells (REF 16397056). A hallmark of tumor cells is Rb pathway defects. Engineering a gene of interest into Ad5 is accomplished through ligation into Ad5 genome. A plasmid containing the gene of interest is generated via and digested, e.g., with AsiSI and PacI. An Ad5 DNA plasmid, e.g., PSF-AD5 (REF Sigma OGS268) is digested with AsiSI and PacI and ligated with recombinant bacterial ligase or co-transformed with RE digested gene of interest into permissive E. coli as has been reported for the generation of human granulocyte macrophage colony stimulating factor (GM-CSF) expressing Ad5 (REF 16397056). Recovery of the DNA and transfection into a permissive host, e.g., human embryonic kidney cells (HEK293) or HeLa yields virus expressing the gene of interest.
Various strains of VV have been used as templates for OV therapeutics; the unifying feature is deletion of the viral thymidine kinase (TK) gene, rendering a virus dependent upon actively replicating cells, i.e. neoplastic cells, for productive replication and thus these VVs have preferential infectivity of cancer cells exemplified by the Western Reserve (WR) strain of VV (REF 25876464). Production of VV's with a gene of interest inserted in the genome is accomplished with homologous recombination utilizing lox sites, as described in greater detail below.
Polypeptides with Sialidase Activity for Expression by an Oncolytic Virus
The recombinant oncolytic virus expresses a polypeptide that includes all or a catalytic portion of a sialidase that is capable of removing sialic acid (N-acetylneuraminic acid (Neu5Ac)) from a glycan on a human cell. In general, Neu5Ac is linked via an alpha 2,3, an alpha 2,6 or alpha 2,8 linkage to the penultimate sugar in glycan on a protein by any of a variety of sialyl transferases. The common human sialyltransferases are summarized in Table 1.
Domains within Polypeptides Having Sialidase Activity
The expressed polypeptide, in addition to the sialidase or catalytic portion thereof can, optionally, include peptide or protein sequences that contribute to the therapeutic activity of the protein. For example, the protein can include an anchoring domain that promotes interaction between the protein and a cell surface. The anchoring domain and sialidase domain can be arranged in any appropriate way that allows the protein to bind at or near a target cell membrane such that the therapeutic sialidase can exhibit an extracellular activity that removes sialic acid residues. The protein can have more than one anchoring domains. In cases in which the polypeptide has more than one anchoring domain, the anchoring domains can be the same or different. The protein can have more than one sialidase domain. In cases in which a compound has more than one sialidase domain, the sialidase domains can be the same or different. Where the protein comprises multiple anchoring domains, the anchoring domains can be arranged in tandem (with or without linkers) or on alternate sides of other domains, such as sialidase domains. Where a compound comprises multiple sialidase domains, the sialidase domains can be arranged in tandem (with or without linkers) or on alternate sides of other domains.
The sialidase domain expressed by the oncolytic virus can be specific for Neu5Ac linked via alpha 2,3 linkage, specific for Neu5Ac linked via an alpha 2,6 or can cleave Neu5Ac linked via an alpha 2,3 linkage or an alpha 2,6 linkage. A variety of sialidases are described in Tables 2-5.
A sialidase that can cleave more than one type of linkage between a sialic acid residue and the remainder of a substrate molecule, in particular, a sialidase that can cleave both alpha(2, 6)-Gal and alpha(2, 3)-Gal linkages can be used in the compounds of the disclosure. Sialidases included are the large bacterial sialidases that can degrade the receptor sialic acids Neu5Ac alpha(2,6)-Gal and Neu5Ac alpha(2,3)-Gal. For example, the bacterial sialidase enzymes from Clostridium perfringens (Genbank Accession Number X87369), Actinomyces viscosus (GenBankX62276), Arthrobacter ureafaciens GenBank (AY934539), or Micromonospora viridifaciens (Genbank Accession Number D01045) can be used. Sialidase domains of compounds of the present disclosure can comprise all or a portion of the amino acid sequence of a large bacterial sialidase or can comprise amino acid sequences that are substantially homologous to all or a portion of the amino acid sequence of a large bacterial sialidase. In one preferred embodiment, a sialidase domain comprises a sialidase encoded by Actinomyces viscosus, such as that of SEQ ID NO: 1 or 2, or such as sialidase sequence substantially homologous to SEQ ID NO: 12. In yet another preferred embodiment, a sialidase domain comprises the catalytic domain of the Actinomyces viscosus sialidase extending from amino acids 274-666 of SEQ ID NO: or a substantially homologous sequence.
Additional sialidases include the human sialidases such as those encoded by the genes NEU2 (SEQ ID NO:8; Genbank Accession Number Y16535; Monti, E, Preti, Rossi, E., Ballabio, A and Borsani G. (1999) Genomics 57:137-143) and NEU4 (SEQ ID NO:9; Genbank Accession Number NM080741; Monti et al. (2002) Neurochem Res 27:646-663). Sialidase domains of compounds of the present disclosure can comprise all or a portion of the amino acid sequences of a sialidase or can comprise amino acid sequences that are substantially homologous to all or a portion of the amino acid sequences of a sialidase. Preferably, where a sialidase domain comprises a portion of the amino acid sequences of a naturally occurring sialidase, or sequences substantially homologous to a portion of the amino acid sequences of a naturally occurring sialidase, the portion comprises essentially the same activity as the intact sialidase. The present disclosure also includes sialidase catalytic domain proteins. As used herein a “sialidase catalytic domain protein” comprises a catalytic domain of a sialidase but does not comprise the entire amino acid sequence of the sialidase from which the catalytic domain is derived. A sialidase catalytic domain protein has sialidase activity. Preferably, a sialidase catalytic domain protein comprises at least 10%, at least 20%, at least 50%, at least 70% of the activity of the sialidase from which the catalytic domain sequence is derived. More preferably, a sialidase catalytic domain protein comprises at least 90% of the activity of the sialidase from which the catalytic domain sequence is derived.
A sialidase catalytic domain protein can include other amino acid sequences, such as but not limited to additional sialidase sequences, sequences derived from other proteins, or sequences that are not derived from sequences of naturally occurring proteins. Additional amino acid sequences can perform any of a number of functions, including contributing other activities to the catalytic domain protein, enhancing the expression, processing, folding, or stability of the sialidase catalytic domain protein, or even providing a desirable size or spacing of the protein.
A preferred sialidase catalytic domain protein is a protein that comprises the catalytic domain of the A. viscosus sialidase. Preferably, an A. viscosus sialidase catalytic domain protein comprises amino acids 270-666 of the A. viscosus sialidase sequence (SEQ ID NO:12). Preferably, an A. Viscosus sialidase catalytic domain protein comprises an amino acid sequence that begins at any of the amino acids from amino acid 270 to amino acid 290 of the A. viscosus sialidase sequence (SEQ ID NO: 12) and ends at any of the amino acids from amino acid 665 to amino acid 901 of said A. viscosus sialidase sequence (SEQ ID NO: 12), and lacks any A. viscosus sialidase protein sequence extending from amino acid 1 to amino acid 269.
In some preferred embodiments, an A. viscosus sialidase catalytic domain protein comprises amino acids 274-681 of the A. viscosus sialidase sequence (SEQ ID NO: 12) and lacks other A. viscosus sialidase sequence. In some preferred embodiments, an A. viscosus sialidase catalytic domain protein comprises amino acids 274-666 of the A. viscosus sialidase sequence (SEQ ID NO: 12) and lacks any other A. viscosus sialidase sequence. In some preferred embodiments, an A. viscosus sialidase catalytic domain protein comprises amino acids 290-666 of the A. viscosus sialidase sequence (SEQ ID NO: 12) and lacks any other A. viscosus sialidase sequence. In yet other preferred embodiments, an A. viscosus sialidase catalytic domain protein comprises amino acids 290-681 of the A. viscosus sialidase sequence (SEQ ID NO: 12) and lacks any other A. viscosus sialidase sequence.
Actinomyces viscosus
Actinomyces viscosus
Streptococcus oralis
Streptococcus oralis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Porphyromonas gingivalis
Tannerella forsythia
Tannerella forsythia
Akkermansia Muciniphila
Akkermansia Muciniphila
Bacteroides thetaiotaomicron
Actinotignum schaalii
Anaerotruncus colihominis
Ruminococcus gnavus
Clostridium difficile
Clostridium septicum
Clostridium perfringens
Clostridium perfringens
Clostridium perfringens
Vibrio cholerae
Salmonella typhimurium
Paeniclostridium sordellii
Streptococcus pneumoniae (NanA)
Streptococcus pneumoniae (NanB)
Pseudomonas aeruginosa
Aspergillus fumigatus
Arthrobacter ureafaciens
Micromonospora viridifaciens
As used herein, an “extracellular anchoring domain” or “anchoring domain” is any moiety that interacts with an entity that is at or on the exterior surface of a target cell or is in close proximity to the exterior surface of a target cell. An anchoring domain serves to retain a compound of the present disclosure at or near the external surface of a target cell. An extracellular anchoring domain preferably binds 1) a molecule expressed on the surface of a cancer cell, or a moiety, domain, or epitope of a molecule expressed on the surface of a cancer cell, 2) a chemical entity attached to a molecule expressed on the surface of a cancer cell, or 3) a molecule of the extracellular matrix surrounding a cancer cell.
Useful anchoring domains bind to heparin/sulfate, a type of GAG that is ubiquitously present on cell membranes. Many proteins specifically bind to heparin/heparan sulfate, and the GAG-binding sequences in these proteins have been identified (Meyer, F A, King, M and Gelman, R A. (1975) Biochimica et BiophysicaActa 392: 223-232; Schauer, S. ed., pp 233. Sialic Acids Chemistry, Metabolism and Function. Springer-Verlag, 1982). For example, the GAG-binding sequences of human platelet factor 4 (PF4) (SEQ ID NO:2), human interleukin 8 (IL8) (SEQ ID NO:3), humanantithrombin III (AT III) (SEQ ID NO:4), human apoprotein E (ApoE) (SEQ ID NO:5), human angio-associated migratory cell protein (AAMP) (SEQ ID NO:6), or human amphiregulin (SEQ ID NO:7) have been shown to have very high affinity to heparin.
A protein that includes a sialidase or a catalytic domain thereof can optionally include one or more polypeptide linkers that can join domains of the compound. Linkers can be used to provide optimal spacing or folding of the domains of a protein. The domains of a protein joined by linkers can be sialidase domains, anchoring domains, or any other domains or moieties of the compound that provide additional functions such as enhancing protein stability, facilitating purification, etc. Some preferred linkers include the amino acid glycine. For example, linkers having the sequence: (GGGGS (SEQ ID NO:10))n, where n is 1-20.
In this study the impact of DAS181 on the sialic acid burden of certain tumor cells was examined. Briefly, FACs and image-based quantitation of α-2,3 and α-2,6 sialic acid modifications on A549 (human alveolar basal epithelial adenocarcinoma) and MCF (human mamillary epithelial adenocarcinoma) tumor cells were conducted. Galatose exposure after sialic acid removal in A549 and MCF7 cells was detected by PNA-FITC using flow cytometry analysis and imaging approaches. As discussed above, there are two sialic acid is most often attached to the penultimate sugar by an α-2,3 linkage or an α-2,6 linkage, which can that can be detected by Maackia Amurensis Lectin II (MAL II) and Sambucus Nigra Lectin (SNA), respectively. In addition, surface galactose (e.g., galactose exposed after sialic acid removal) can be detected using Peanut Agglutinin (PNA).
A549 cells were treated with various concentrations of DAS181 and them stained to image 2,6 linked sialic acid (FITC-SNA), 2,3 linked sialic acid (FITC-MALII) or galactose (FITC-PNA). As can be seen in
In contrast, DAS185, a variant of DAS181 lacking sialidase activity due to Y348F mutation, was not able to remove 2,6 linked sialic acid or 2,3 linked sialic acid. As shown in
A549 cells were genetically labelled with a red fluorescent protein (A549-red). Fresh human PMBCs were harvested and stimulated with various cytokine and antibody combinations to activate effector T cells (CD3, CD38 and IL-2) or, in some cases, T cells and NK cells (CD3, CD28, IL-15 and IL-21). Activated PBMCs were then co-cultured with A549-red cells that had been exposed to DAS181 (100 nM). Tumor cell killing by PBMCs was monitored by live cell imaging and quantification with IncuCyte. The cell culture medium was collected and analyzed by ELISA to assess cytokine production by PBMCs.
In this study the impact of an oncolytic vaccina virus (Western Reserve) and DAS181 on NK cell-mediated killing was examined. DAS185, a variant protein lacking sialidase activity was used as a control.
Briefly, tumor cells (U87-GFP) were plated in a 96-well tissue culture plate at 5×104 cells per well (100 ul) in DMEM and incubated overnight at 37° C. On Day 2 the cells were infected with VV at MOI 0.5, 1, or 2 in fetal bovine serum-free medium for 2 hours and then exposed to 1 nM DAS181 or 1 mM DAS185. Tumor cells were then mixed with purified NK cells at Effector:Tumor (E:T)=1:1, 5:1, 10:1. The cells were cultured in medium supplemented with 2% FBS in order to decrease neuraminidase/sialidase background. After 24 hrs, tumor killing were measured by MTS assay (96 well plate), and cell culture medium was collected. Expression of IFN gamma were measured by ELISA. The results of this study are shown in
In this study, the impact of DAS181 on monocyte-derived dendritic cell was examined DAS185, a variant protein lacking sialidase activity was used as a control.
Briefly, monocyte-derived dendritic cells (DC) were prepared by resuspending 5×106 adherent PBMC in 3 ml of medium supplemented with 100 ng/ml of GM-CSF and 50 ng/ml of IL-4. After 48 hrs, 2 ml of fresh medium supplemented with 100 ng/ml of GM-CSF and 50 ng/ml of IL-4 was added to each well. After another 72 hrs, tumor cell (U87-GFP) were plated in 24-well plates in DMEM. The tumor cells were infected with VV at various MOI in FBS free medium for 2 hours. DC cultured in the presence of 1 nM DAS181 or DAS185 were mixed with tumor cells at 1:1 tumor cell:DC ratio. Dendritic cell maturation (expression of CD86, CD80, MHC-I) and production of pro-inflammatory cytokines (TNF-alpha) was then measured and quantified by flow cytometry and ELISA, respectively.
As can be seen in
The results of this study demonstrate that exposure to DAS181 increased and increased TNF-alpha secretion by dendritic cells (
A549 cells were genetically labelled with red fluorescent protein (A549-red). Tumor cell proliferation and killing by oncolytic adenovirus (Ad5) in the presence or absence of DAS181 was monitored by live cell imaging and quantification with IncuCyte. The cell culture medium was collected for ELISA measurement of cytokine production by PBMCs. As shown in
A549 cells were genetically labelled by a red fluorescent protein (A549-red). Fresh human PMBCs were harvested and stimulated with proper cytokine and antibody combinations to activate effector T cells. Activated PBMCs were then co-cultured with A549-red cells that have been treated with DAS181 with or without the oncolytic adenovirus (Ad5). Tumor cell killing by PBMCs was monitored by live cell imaging and quantification with IncuCyte. The cell culture medium was collected for ELISA measurement of cytokine production by PBMCs. As shown in
A construct designed for expression of DAS181 is depicted schematically in
To generate a recombinant VV expressing DAS181, a pSEM-1 vector was modified to include a sequence encoding DAS181 as well as two loxP sites with the same orientation flanking the sequence encoding the GFP protein (pSEM-1-TK-DAS181-GFP). DAS181 expression is under the transcriptional control of the F17R late promoter in order to limit the expression within tumor tissue. The sequences certain of the components and a portion of the construct and are shown in
Western Reserve VV was used as the parental virus. VV expressing DAS181 was generated by recombination with pSEM-1-TK-DAS181-GFP into the TK gene of Western Reserve VV to generated VV-DAS181.
Recombinant Virus can be Generated as Follows.
Seed CV-1 cells in 6-well plate at 5×105 cells/2 ml DMEM-10% FBS/well and grow overnight. Prepare parent VV virus (1 ml/well) by diluting a virus stock in DMEM/2% FBS at MOI 0.05. Remove medium from CV-1 wells and immediately add VV, and culture for 1-2 hours. CV-1 cells should be 60-80% confluent at this point. Transfection mix in 1.5 ml tubes. For each Transfection, dilute 9 ul Genejuice in 91 ul serum-free DMEM and incubate at room temperature for 5 min. Add 3 ug pSEM-1-TK-DAS181-GFP DNA gently by pipetting up and down two or three times. Leave at room temperature for 15 min. Aspirate VV virus from the CV-1 well and wash the cells once with 2 ml serum-free DMEM. Add 2 ml DMEM-2% FBS and add the DNA-genejuice solution drop-by-drop. Incubate at 37° C. for 48-72 hr or until all the cells round up. Harvest the cells by pipetting repeatedly. Release the virus from cells by repeated freeze-thawing of the harvested cells by first placing them in dry-ice/ethanol bath and then thawing them in a 37° C. water bath and vortexing. Repeat the freeze-thaw cycling three times. The cell lysate can be stored at −80° C.
Seed CV-1 cells in 6-well plates at 5×105 cells/2 ml DMEM-10% FBS/well and grow overnight. CV-1 cells should be 60-80% confluent when receiving cell lysate. Sonicate the cell lysate on ice using sonic dismembrator with an ultrasonic convertor probe for 4 cycles of 30 s until the material in the suspension is dispersed. Make 10-fold serial dilutions of the cell lysate in DMEM-2% FBS. Add 1 ml of the cell lysate-medium per well at dilutions 10−2, 10−3, 10−4, incubate at 37° C. Pick well-separated GFP+ plaques using pipet tip. Rock the pipet tip slightly to scrape and detach cells in the plaque. Gently transfer to a microcentrifuge tube containing 0.5 ml DMEM medium. Freeze-thaw three times and sonicate. Repeat the same process of plaque isolation 3-5 times.
Seed CV-1 cells 5×105 cells/2 ml DMEM-10% FBS/well and grow overnight in 6-well plate. CV-1 should be confluent when starting the experiment. Infect 1 well with 250 ul of plaque lysate/1 ml DMEM-2% FBS, and incubate at 37° C. for 2 h. Remove the plaque lysate and add 2 ml fresh DMEM-2% FBS, and incubate for 48-72 hr until cells round up. Collect the cells by repeatedly pipetting, freeze-thaw 3 times and sonicate. Add half of the cell lysate in 4 ml DMEM-2% FBS and infect CV-1 cells in 75-CM2 flask, after 2 h, remove virus and add 12 ml DMEM-2% FBS and culture 48-72 h (until cell round up). Harvest the cells, spin down 5 min at 1800 G, and discard supernatant and resuspend in 1 ml DMEM-2.5% FBS.
Seed CV-1 cells 5×105 cells/2 ml DMEM-10% FBS/well and grow overnight in 6-well plate. Dilute virus in DMEM-2% FBS, 50 ul virus/4950 ul DMEM-2% FBS (A, 10−2), 500 ul A/4500 ul medium (B, 10−3), and 500 ul B/4500 ul medium (C, 10−4), 10−7 to 10−10 for virus stock. Remove medium and wash 1× with PBS, and cells were infected with 1 ml virus dilution in duplicate. Incubate the cells for 1 h, rock the plate every 10 min. 1 h later, remove the virus and add 2 ml DMEM-10% FBS and incubate 48 h. Remove the medium, add 1 ml of 0.1% crystal violet in 20% ethanol for 15 min at room temperature. Remove the medium and allow to dry at room temperature for 24 hr. Count the plaque and express as plaque forming units (pfu) per ml.
CV-1 cells were infected with VV-DAS181 at MOI 0.2. 48 hours later, CV-1 cells were collected. DNA was extracted using Wizard SV Genomic DAN Purification System and used as template for DAS181 PCR amplification. PCR was conducted using standard PCR protocol and primer sequences (SialF: GGCGACCACCCACAGGCAACACCAGCACCTGCCCCA and SialR: CCGGTTGCGCCTATTCTTGCCGTTCTTGCCGCC). The expected PCR product (1251 bp) was found.
CV-1 cells were plated in six well plate. The cells were transduced with Sialidase-VV or control VV at MOI 0.1 or MOI 1. After 24 hrs, transfected cells were collected, and single cell suspension were made in PBS at 3×106/500 ul. Cell lysate was prepared using Sigma's Mammalian cell lysis kit for protein extraction (Sigma, MCL1-1KT), and supernatant was collected. The sialidase (DAS181) activity was measured using Neuraminidase Assay Kit (Abcam, ab138888) according to manufacturer's instruction. 1 nM, 2 nM, and 10 nM DAS181 was added to the VV-cell lysate as control and generated the standard curve. 1×10{circumflex over ( )}6 cells infected with Sialidase-VV express DAS181 equivalent to 0.78 nM-1.21 nM of DAS181 in 1 ml medium. As shown in
To determine if Sialidase-VV can promote DC activation and maturation, adherent human PBMC were re-suspend at 5×106 cells in 3 ml medium supplemented with 100 ng/ml of GM-CSF and 50 ng/ml of IL-4 then cultured in 6-well plates with 2 ml per well of fresh medium supplemented with same concentrations of GM-CSF and IL-4. After 48 hrs, the cells were cultured in the presence of Sialidase-VV infected tumor cell lysate, VV-infected tumor cell lysate, VV-infected tumor cell lysate plus synthetic DAS181 protein, or LPS (positive control). After another 24 hrs, expression of CD86, CD80, MHC-II, MHC-I were determined by flow cytometry. As shown in
To assess whether DAS181 can activate human T cells by inducing IFN-gamma (IFNr) and IL-2 expressing, human PBMCs were activated by adding CD3 antibody at 10 ug/ml, proliferation was further stimulated by adding IL-2 by every 48 hrs. On day 15, tumor cells (A549) were infected with VVs at MOI 0.5, 1, or 2 in 2.5% FBS medium for 2 hours. Activated T cells were added to the culture at effector:target ratio of 5:1 or 10:1 in the presence of CD3 antibody at 1 ug/ml. After another 24 hrs, tumor cytotoxicity was measured and cell culture medium was collected for cytokine array. As can be seen in
While certain embodiments have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
This application is a U.S. National Phase application under 35 U.S.C. § 371 of International Patent Application No. PCT/US2019/042848, filed Jul. 22, 2019, which claims the benefit of U.S. Provisional Patent Application Ser. No. 62/796,518, filed Jan. 24, 2019 and Ser. No. 62/701,481, filed Jul. 20, 2018. The entire contents of each of the foregoing applications are hereby incorporated by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/042848 | 7/22/2019 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62796518 | Jan 2019 | US | |
| 62701481 | Jul 2018 | US |
