Desaturases and methods of using them for synthesis of polyunsaturated fatty acids

Information

  • Patent Grant
  • 6825017
  • Patent Number
    6,825,017
  • Date Filed
    Friday, August 17, 2001
    22 years ago
  • Date Issued
    Tuesday, November 30, 2004
    19 years ago
Abstract
The amino acid and nucleic acid sequences of a Δ5-desaturase enzyme and a Δ8-desaturase enzyme are disclosed. The nucleic acid sequences can be used to design recombinant DNA constructs and vectors. These vectors can then be used to transform various organisms, including for example, plants and yeast. The transformed organisms will then produce polyunsaturated fatty acids. The amino acid sequences are useful for generating enzyme-specific antibodies that are useful for identifying the desaturases.
Description




FIELD OF THE INVENTION




The invention relates to desaturase enzymes that can be used to produce polyunsaturated fatty acids with important dietary applications.




BACKGROUND




Fatty acids are fundamental components of living systems. They make up the major component of cytoplasmic membranes, common to plants, animals and protists alike.




Fatty acids of 20 carbons, with more than one unsaturated carbon—carbon bond along the hydrocarbon chain, are known to be of particular importance. Arachidonate (20:4) (Heinz,


Lipid Metabolism in Plants


, pp. 33-89, 1993; Yamazaki et al.


Biochim. Biophys. Acta


1123:126, 1992; Ulsamer et al.,


J. Cell Biol.


43:105-114, 1969; and Albert et al. Lipids 14:498-500, 1979) and eicosapentaenoate (20:5) (Heinz,


Lipid Metabolism in Plants


, pp. 33-89, 1993; Yamazaki et al.,


Biochim. Biophys


. Acta 1123:18-26, 1992; Ulsamer et al.,


J. Cell Biol.


43:105-114, 1969; Albert et al.


Lipids


14:498-500, 1979; and Cook et al.,


J. Lipid Res.


32:1265-1273, 1991), commonly referred to as EPA, are significant components of mammalian cell membranes and are also precursors of signal molecules including prostaglandins. Certain specialized mammalian tissues such as brain (Naughton,


J. Biochem.


13:21-32, 1981), testes (Wilder and Coniglio,


Proc. Soc. Exp. Biol. Med.


177:399-405, 1984), and retina (Aveldano de Caldironi et al.,


Prog. Lipid Res.


20:49-57, 1981) are especially rich in unsaturated fatty acids.




Arachidonate and eicosapentaenoate serve both as precursors for synthesis of 22-carbon polyunsaturated fatty acids and, with dihomoy-γ-linoleate (20:3) (Yamazaki et al.,


Biochim. Biophys. Acta


1123:18-26, 1992; Ulsamer et al.,


J. Cell Biol.


43:105-114, 1969; and Albert et al., Lipids 14:498-500, 1979), as precursors to the synthesis of eicosanoid metabolic regulators (Hwang,


Fatty Acids in Foods and Their Heath Implications,


545-557, 1992). Key enzymes in the synthesis of 20 carbon fatty acids are desaturases, which introduce cis double bonds by removing two hydrogen atoms at specific locations along the aliphatic hydrocarbon chains. Desaturase enzymes are specific to the position, number, and stereochemistry of the double bonds already present in the target fatty acid (Heinz,


Lipid Metabolism in Plants,


33-89, 1993).




To synthesize 20 carbon polyunsaturated fatty acids, mammals must acquire the essential fatty acids 18:2 (Brenner,


The Role of Fats in Human Nutrition


, pp. 45-79, 1989) and 18:3 (Nelson,


Fatty Acids in Foods and Their Health Implications


, pp. 437-471, 1992; Brenner.


The Role of Fats in Human Nutrition


, pp. 45-79,1989; and Hulanicka et al.


J. Biol Chem.


239:2778-2787,1964) from their diet (Nelson,


Fatty Acids in Foods and Their Health Implications,


437-471,1992). These dietary polyunsaturated fatty acids are metabolized in the endoplasmic reticulum by an alternating series of position-specific desaturases and malonyl-CoA-dependent chain-elongation steps (FIG.


1


A), which results in the characteristic methylene-interrupted double bond pattern. In the liver, which is the primary organ of human lipid metabolism, the first step in biosynthesis of 20-carbon fatty acids is desaturation of the essential fatty acids at the Δ


5


position. The desaturation products are elongated to 20:3 and 20:4 (Cook et al.,


J. Lipid Res.


32:1265-1273, 1991). In turn, these 20-carbon products are desaturated by a Δ


8


-desaturase to produce arachidonate and eicosapentaenoate. The Δ


6


-desaturation step is rate-limiting in this metabolic pathway (Bernet and Sprecher,


Biochim. Biophys. Acta


398:354-363, 1975; and Yamazaki et al.,


Biochim. Biophys. Acta


1123:18-26, 1992) and, not surprisingly, is subject to regulation by dietary and hormonal changes (Brenner,


The Role of Fats in Human Nutrition


, pp. 45-79, 1989).




In contrast to the liver, an alternate pathway for biosynthesis of 20-carbon polyunsaturated fatty acids has been demonstrated in a few organisms and tissues (FIG.


1


B). Instead of desaturation, the first step in the alternate pathway is elongation of the essential 18-carbon fatty acids to 20 carbon chain lengths, producing 20:2 (Ulsamer et al.,


J. Cell Bio.


43:105-114, 1969; and Albert et al.


Lipids


14:498-500, 1979) and 20:3., Subsequent denaturation occurs via a Δ


8


-desaturase (FIG.


1


). The products of this elongation-desaturation, 20:3 and 20:4, are the same as the more usual desaturation-elongation pathway. The Δ


8


pathway is present in the soil amoebae Acanthamoeba sp. (Ulsamer et al,


J. Cell Biol.


43:105-114, 1969), and in euglenoid species, where it is the dominant pathway for formation of 20 carbon polyunsaturated fatty acids (Hulanicka et al.,


Journal of Biological Chemistry


239:2778-2787, 1964).




This Δ


8


-desaturation pathway occurs in mammals, both in rat testis (Albert and Coniglio,


Biochim. Biophys. Acta


489:390-396, 1977) and in human testis (Albert et al.,


Lipids


14:498-500, 1979). While Δ


8


activity has been observed in breast cancer cell lines (Grammatikos et al., Br.


J. Cancer


70:219-227, 1994; and Bardon et al.,


Cancer Lett.


99:51-58, 1996) and in glioma (Cook et al.,


J. Lipid Res.


32:1265-1273, 1991), no Δ


8


activity is detectable in a corresponding non-cancerous breast cell line (Grammatikos et al.,


Br. J. Cancer


70:219-227, 1994) or in the brain (Dhopeshwarkar and Subramanian,


J. Neurochem.


36:1175-1179, 1976). The significance of Δ


8


-desaturation to normal or cancer cell metabolism is unclear, since analysis of desaturase activities in mammalian systems is frequently complicated by the presence of competing Δ


6


reactions and chain-shortening retroconversion of fatty acid substrates in tissue (Sprecher and Lee,


Biochim. Biophys. Acta


388:113-125, 1975; Geiger et al.,


Biochim. Biophys. Acta


1170:137-142, 1993).




Polyunsaturated 20-carbon fatty acids are, for the reasons outlined above, important in the human diet, and there has been considerable recent interest in incorporating such fatty acids into infant food, baby formula, dietary supplements, and nutriceutical formulations.




It would therefore be desirable to produce new transgenic plants and animals with enhanced ability to produce polyunsaturated 20-carbon fatty acids.




SUMMARY OF THE DISCLOSURE




The invention provides novel Δ


5


-(

FIG. 6A

) and Δ


8


(

FIG. 7A

) desaturase enzymes that may be cloned and expressed in the cells of various organisms, including plants, to produce 20-carbon polyunsaturated fatty acids. Expression of such fatty acids enhances the nutritional qualities of such organisms. For instance, oil-seed plants may be engineered to incorporate the Δ


5


- and Δ


8


-desaturases of the invention. Such oil-seed plants would produce seed-oil rich in polyunsaturated 20:3, 20:4, 20:5, 22:4, and 22:5 fatty acids. Such fatty acids could be incorporated usefully into infant formula, foods of all kinds, dietary supplements, nutriceutical, and pharmaceutical formulations.




The invention also provides proteins differing from the proteins of FIG.


6


A and

FIG. 7A

by one or more conservative amino acid substitutions. Also provided are proteins that exhibit “substantial similarity” (defined in the “Definitions” section) with the proteins of FIG.


6


A and FIG.


7


A.




The invention provides isolated novel nucleic acids that encode the above-mentioned proteins, recombinant nucleic acids that include such nucleic acids and cells, and plants and organisms containing such recombinant nucleic acids.




The novel Δ


5


- and Δ


8


desaturase enzymes can be used individually, or in conjunction with one another, for instance in a metabolic pathway, to produce polyunsaturated fatty acids, such as 20:3, 20:4, 20:5, 22:4, and 22:5 fatty acids.




The scope of the invention also includes portions of nucleic acids encoding the novel Δ


5


- and Δ


8


-desaturase enzymes, portions of nucleic acids that encode polypeptides substantially similar to these novel enzymes, and portions of nucleic acids that encode polypeptides that differ from the proteins of FIG.


6


A and

FIG. 7A

by one or more conservative amino acid substitutions. Such portions of nucleic acids may be used, for instance, as primers and probes for research and diagnostic purposes. Research applications for such probes and primers include the identification and cloning of related Δ


5


- and Δ


8


-desaturases in other organisms including humans.




The invention also includes methods that utilize the Δ


5


- and/or the Δ


8


-desaturase enzymes of the invention. An example of this embodiment is a yeast or plant cell that carries genes for one or both desaturases of the invention and that, by virtue of these desaturases, is able to produce arachidonic acid and/or EPA.











BRIEF DESCRIPTION OF THE DRAWINGS





FIG. 1A

shows a common pathway for synthesis of 20-carbon polyunsaturated fatty acids that begins with Δ


6


desaturation of 18-carbon fatty acids followed by 2-carbon elongation, and then further desaturation and elongation.





FIG. 1B

shows an alternate pathway that begins with an elongation of 18-carbon fatty add to 20-carbon fatty acids, followed by Δ


8


desaturation and a second desaturation at the Δ


5


position.





FIG. 1C

shows alternate pathways for the synthesis of polyunsaturated fatty acids using Δ


5


-, Δ


8


, and Δ


8


-desaturases to produce arachidonic acid and EPA.





FIG. 2

shows gas chromatographic (GC) analysis of fatty acid methyl esters from


E. gracilis


grown (heterotrophically) in the dark with sucrose as carbon source. Fatty acids were identified by comparison of retention times with known standards. Significant peaks are numbered with their retention times and proportion of the total fatty acid indicated.





FIG. 3

shows amino acid sequence similarities between the


Euglena


Δ


8


-desaturase protein (EFD1) (SEQ ID NO: 4) and the desaturase enzymes of


C. elegans


. The deduced amino acid sequence of the EFD1 gene shows similarity with the


C. elegans


Δ


6


(FAT-3) (SEQ ID NO: 14) and Δ


5


(FAT-4) (SEQ ID NO: 2) desaturases (Napier et al.,


Biochem. J.


330:611-614, 1998). The similarity is strongest in the regions of conserved fiction. In the N-terminal region amino acids forming a cytochrome b


5


-like domain (Lederer,


Biochimie


76:674-692, 1994) are indicated. The His-box motifs indicated by underlined characters are present in other identified membrane desaturases (Napier et al.,


Biochem. J.


330:611-614, 1998; Michaelson et al.,


J. Biol. Chem.


273:19055-19059, 1998; and Shanklin and Cahoon,


Annu. Rev. Plant Physiol. Plant Mol. Biol.


48:611-641, 1998).





FIG. 4

shows the results of gas chromatography of fatty acid methyl esters from recorlibinant yeast. Cultures of yeast containing eithercontrol pYES2 or pYES2-541, which expresses the


Euglena






Δ


8


-desaturase (EFD1) gene, were supplemented with the indicated 20-carbon fatty acids. The control strain does not desaturate the exogenous fatty acids. For the experimental strain, an arrow indicates the desaturation peak.





FIG. 5

shows the results of mass spectrometry (MS) of desaturation products. DMOX derivatives of EFD1 desaturation products were analyzed by GC-mass spectrometry. The molecular ion of each fatty acid is 2 a.m.u. (atomic mass units) less than the substrate provided, as expected for insertion of a double bond. Desaturation at the Δ


8


position is established by characteristic m/z peaks of 182 and 194 for each product; indicated by the bracket





FIG. 6A

shows the primary amino acid sequence of the fatty acid Δ


5


-desaturase from


Caenorhabditis elegans


(SEQ ID NO: 2).





FIG. 6B

shows a nucleotide sequence including the ORF (open reading frame) that encodes the fatty acid Δ


5


-desaturase from


Caenorhabditis elegans


(SEQ ID NO: 1).





FIG. 7A

shows the primary amino acid sequence of the fatty acid Δ


8


-desaturase from the protist


Euglena gracilis


(SEQ ID NO: 4).





FIG. 7B

shows a nucleotide sequence including the ORF that encodes the Δ


8


-desaturase from the protist


Euglena gracilis


(SEQ ID NO: 3).





FIG. 8

shows certain features of the structure of the


C. elegans


Δ


5


- and Δ


6


-desaturase genes. The relative location of gene products T13F2.1 and WO8D2.4 on their respective cosmids is shown above. The exon structure of T13F2.1 (fat4) and WO8D2.4 (fat-3) showing the sites of sequences encoding the SL1 splice site, the heme-binding motif of cytochrome b


5


(cyt b


5


), and the three conserved histidine box motifs (HBX) is shown below.





FIG. 9

shows a comparison of the predicted amino acid sequences of the borage Δ


6


-desaturase (bord6) (SEQ ID NO: 15),


C. elegans


FAT-3 (fat3) (SEQ ID NO: 14),


C. elegans


FAT-4 (fat4) (SEQ ID NO: 2), and the


Mortierella alpina


Δ


5


-(mord5) desaturase (SEQ ID NO: 16). Identical or conserved residues are shaded, and the conserved HPGG heme-binding domain and the conserved histidine boxes are underlined. Abbreviations: bord6=Borago officinalis Δ


6


-desaturase (GenBank accession number U79010); fat4


=C. elegans


FAT-4 desaturase; fat3


=C. elegans


a desaturase sequence of WO8D2.4 (GenBank accession number Z70271), edited to remove amino acids 38-67, on the basis of the cDNA sequence; mord5


=Mortierella alpina


Δ


5


desaturase (GenBank accession number AF054824).




Δ


6


-desaturase (GenBank accession number U79010); fat4


=C. elegans


FAT-4 desaturase; fat3


=C. elegans


Δ


6


desaturase sequence of WO8D2.4 (GenBank accession number Z70271), edited to remove amino acids 38-67, on the basis of the cDNA sequence; mord5


=Mortierella alpina


Δ


5


desaturase (GenBank accession number AF054824).





FIGS. 10A-10C

show identification of arachidonic acid in transgenic yeast by gas chromatography-mass spectroscopy (GC-MS). Fatty acid methyl esters of total lipids of


S. cerevisiae


grown for 16 hours under inducing conditions (2% galactose) supplemented with 0.2 mM di-homo-γ-linolenic acid were analyzed by GC-MS. (A) Yeast transformed with (empty) vector pYES2. (B) Yeast transformed with pYES2 vector carrying fat-4. The common peaks were identified as 16:0 (11.1911.12 min.), 16:1 (11.38 min.), 18:0 (13.07-13.08 min.), 18:1 (13.29 min.), 20:3 (11.6411.65 min.). The novel peaks are arachidonic acid (14.49 min.) and 18:2 (12.91 min.). (C) The mass spectrum of the peak eluting at 14.49 min. This spectrum is indistinguishable from that of authentic methyl-arachidonate.





FIGS. 11A and 11B

show the novel desaturation products from substrates lacking a Δ


8


double bond. (A) Partial GC trace of fatty acid methyl-esters derived from yeast expressing the fat-4 Δ


5


-desaturase supplemented with 20:2Δ


11,14


(14.81 min.). The desaturation product of this substrate elutes at 14.62 min. and has been identified as 20:3Δ


5,11,14


. (B) Partial GC trace of yeast expressing the fat-4




Δ


5


-desaturase supplemented with 20:3Δ


11,14,17


(14.87 min.). The desaturation product of this substrate elutes at 14.69 min. and has been identified as 20:4Δ


5,11,14,17


.





FIG. 12

is a table comparing the substrate specificities of


C. elegans


Δ


5


- and Δ


6


-desaturases.





FIG. 13

is a table comparing incorporation and desaturation of fatty acids by yeast strains transformed with a control construct pYES, and with pYES-541, a clone containing EGD1, the


E. gracilis


Δ


8


-desaturase gene.


S. cervisiae


strains containing a control vector (pYES) or expressing EFD1 (pYES-541) were cultured in the presence of the indicated fatty acids. The cultures were harvested, washed, and methyl esters prepared from total cells and analyzed by GC. The weight % of total fatty acid methyl esters is indicated.











SEQUENCE LISTING




The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand.




SEQ ID NO: 1 is the nucleotide sequence corresponding to the open reading frame of the fatty acid Δ


5


-desaturase from


Caenorhabditis elegans.






SEQ ID NO: 2 is the primary amino acid sequence of the fatty acid Δ


5


-desaturase from


Caenorhabditis elegans.






SEQ ID NO: 3 is the nucleotide sequence corresponding to the open reading frame of the fatty acid Δ


8


-desaturase from the probst


Euglena gracilis.






SEQ ID NO: 4 is the primary amino add sequence of fatty acid Δ


8


-desaturase from the probst


Euglena gracilis.






SEQ ID NOs: 5-8 are primers used to amplify and clone the Δ


8


-desaturase-encoding nucleic acid sequence.




SEQ ID NO: 9 is a polyadenylation signal.




SEQ ID NO: 10 is a primer used to amplify and clone the Δ


5


-desaturase-encoding nucleic acid sequence.




SEQ ID NO: 11 is a short RNA leader sequence.




SEQ ID NO: 12 is the amino acid sequence of a histidine box motif.




SEQ ID NO: 13 is the amino acid sequence of a histidine box motif




DESCRIPTION OF THE INVENTION




The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Definitions of common terms in molecular biology may also be found in Rieger et al.,


Glossary of Genetics: Classical and Molecular,


5th edition, Springer-Verlag: New York, 1991; and Lewin,


Genes VI


, Oxford University Press: New York, 1997. The nomenclature for DNA bases as set forth at 37 C.F.R. § 1.822 is used. The standard one- and three-letter nomenclature for amino acid residues is used.




Definitions




Portion: A portion of a nucleic acid molecule is a stretch of contiguous nucleic acids corresponding to the sequence of that molecule that may be about 15, 20, 30, 40, 50, or 60 nucleic acids in length. Such nucleotide portions may be used as probes or primers. A portion of a protein is a stretch of contiguous amino acids corresponding to the amino acid sequence of that protein that may be about 5, 10, 20, 30, 40, or 50 residues in length. As used herein, such a portion may correspond to any segment of a nucleic acid molecule, for instance such a portion may correspond to a segment consisting of nucleotides 1-500, 501-1000, or 1001-1451 of the sequence shown in

FIG. 6B

, or nucleotides 1-400, 401-800, 801-1251 of the sequence shown in FIG.


7


B.




Desaturase: A desaturase is an enzyme that promotes the formation of carbon—carbon double bonds in a hydrocarbon molecule.




Desaturase activity may be demonstrated by assays in which a preparation containing an enzyme is incubated with a suitable form of substrate fatty acid and analyzed for conversion of this substrate to the predicted fatty acid product. Alternatively, a DNA sequence proposed to encode a desaturase protein may be incorporated into a suitable vector construct and thereby expressed in cells of a type that do not normally have an ability to desaturate a particular fatty acid substrate. Activity of the desaturase enzyme encoded by the DNA sequence can then be demonstrated by supplying a suitable form of substrate fatty acid to cells transformed with a vector containing the desaturase-ncoding DNA sequence and to suitable control cells (for example, transformed with the empty vector alone). In such an experiment, detection of the predicted fatty acid product in cells containing the desaturase-encoding DNA sequence and not in control cells establishes the desaturase activity. Examples of this type of assay have been described in, for example, Lee et al.,


Science


280:915-918, 1998; Napier et al.,


Biochem. J.


330:611-614, 1998; and Michaelson et al.,


J. Biol. Chem.


273:19055-19059, 1998, which are incorporated herein by reference.




The Δ


5


-desaturase activity may be assayed by these techniques using, for example, 20:3Δ


8,11,14


as substrate and detecting 20:4Δ


5,8,11,14


as the product (Michaelson et al.,


J. Biol. Chem.


273:19005-19059, 1998). Other potential substrates for use in Δ


5


activity assays include (but are not limited to) 10:2Δ


11,14


(yielding 20:5Δ


5,11,14


as the product) and 20:3Δ


11,14,12


(yielding 20:4Δ


5,11,14,17


as the product).




The Δ


8


-desaturase may be assayed by similar techniques using, for example, 20:3Δ


11,14,17


as the substrate and detecting 20:4Δ


8,11,14,17


as the product.




ORF: Open reading frame. An ORF is a contiguous series of nucleotide triplets coding for amino acids. These sequences are usually translatable into a peptide.




Homologs: Two nucleotide or amino acid sequences that share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Homologs frequently show a substantial degree of sequence identity.




Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. The term encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.




Purified: The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the subject protein or other substance is more pure than in its natural environment within a cell. Generally, a protein preparation is purified such that the protein represents at least 50% of the total protein content of the preparation.




Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. If introns are present, the operably linked DNA sequences may not be contiguous.




Cell: A plant, animal, protist, bacterial, or fungal cell.




Sequence similarity: The similarity between two nucleic acids or two amino acid sequences is expressed in terms of percentage sequence identity. The higher the percentage sequence identity between two sequences, the more similar the two sequences are.




In the case of protein alignments, similarity is measured not only in terms of percentage identity, but also takes into account conservative amino acid substitutions. Such conservative substitutions generally preserve the hydrophobicity and acidity of the substituted residue, thus preserving the structure (and therefore function) of the folded protein. The computer programs used to calculate protein similarity employ standardized algorithms that, when used with standardized settings, allow the meaningful comparison of similarities between different pairs of proteins.




Sequences are aligned, with allowances for gaps in alignment, and regions of identity are quantified using a computerized algorithm. Default parameters of the computer program are commonly used to set gap allowances and other variables.




Methods of alignment of sequences for comparison are well-known in the art. Various programs and alignment algorithms are described by Pearson et al.,


Methods in Molecular Biology


24: 307-331, 1994, and in Altschul et al.,


Nature Genet.


6:119-129, 1994. Altschul et al. presents a detailed consideration of sequence alignment methods and homology calculations.




The NCBI Basic Local Alignment Search Tool (BLAST™) (Altschul et al.,


J. Mol. Biol.


215:403-410, 1990 is available from several sources, including the National Center for Biotechnology Information (NBCI, Bethesda, Md.) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. BLAST™ can be accessed at htp://www.ncbi.nlm.nih.gov/BLAST/. A description of how to determine sequence identity using this program is available at the web site. As used herein, sequence identity is commonly determined with the BLAST™ software set-to-default parameters. For instance, blastn (version 2.0) software may be used to determine sequence identity between two nucleic acid sequences using default parameters (expect=10, matrix=BLOSUM62, filter=DUST (Tatusov and Lipmann, in preparation as of Dec. 1, 1999; and Hancock and Armstrong,


Comput. Appl. Biosci.


10:67-70, 1994), gap existence cost=11, per residue gap cost=1, and lambda ratio=0.85). For comparison of two polypeptides, blastp (version 2.0) software may be used with default parameters (expect 10, filter=SEG (Wootton and Federhen,


Computers in Chemistry


17:149-163, 1993), matrix=BLOSUM62, gap existence cost=11, per residue gap cost=1, lambda=0.85).




When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).




An alternative alignment tool is the ALIGN Global Optimal Alignment tool (version 3.0) available from Biology Workbench at http://biology.ncsa.uiuc.edu. This tool may be used with settings set to default parameters to align two known sequences. References for this tool include Meyers and Miller, CABIOS4:11-17, 1989.




Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, i.e., the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. The table below shows amino acids that may be substituted for an original amino acid in a protein and that are regarded as conservative substitutions.















TABLE 1











Original Residue




Conservative Substitutions













ala




ser







arg




lys







asn




gln; his







asp




glu







cys




ser







gln




asn







glu




asp







gly




pro







his




asn; gln







ile




leu; val







leu




ile; val







lys




arg; gln; glu







met




leu; Ile







phe




met; leu; tyr







ser




thr







thr




ser







trp




tyr







tyr




trp; phe







val




ile; leu















Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.




The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.




Probe: An isolated nucleic acid attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes.




Primers: Short nucleic acids, preferably DNA oligonucleotides 10 nucleotides or more in length, that are annealable to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extendable along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art




Probes and primers as used in the present invention typically comprise at least 15 contiguous nucleotides. In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise at least 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 consecutive nucleotides of the disclosed nucleic acid sequences.




Alternatively, such probes and primers may comprise at least 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 consecutive nucleotides that share a defined level of sequence identity with one of the disclosed sequences, for instance, at least a 50%, 60%, 70%, 80%, 90%, or 95% sequence identity.




Alternatively, such probes and primers may be nucleotide molecules that hybridize, under specific conditions and remain hybridized under specific wash conditions such as those provided below. These conditions can be used to identifying variants of the desaturases. Nucleic acid molecules that are derived from the desaturase cDNA and gene sequences include molecules that hybridize under various conditions to the disclosed desaturase nucleic acid molecules, or fragments thereof. Generally, hybridization conditions are classified into categories, for example very high stringency, high stringency, and low stringency. The conditions for probes that are about 600 base pairs or more in length are provided below in three corresponding categories.




Very High Stringency (detects sequences that share 90% sequence identity)

























Hybridization




in




SSC




at




65° C.




16 hours







Wash twice




in




SSC




at




room temp.




15 minutes each







Wash twice




in




SSC




at




65° C.




20 minutes each















High Stringency (detects sequences that share 80% sequence identity or greater)

























Hybridization




in




SSC




at




65° C.-




16-20 hours











70° C.







Wash twice




in




SSC




at




room




 5-20 minutes each











temp.







Wash twice




in




SSC




at




55° C.-




  30 minutes each











70° C.















Low Stringency (detects sequences that share greater than 50% sequence identity)

























Hybridization




in




SSC




at




room temp.-




16-20 hours











55° C.







Wash at




in




SSC




at




room temp.-




20-30 minutes







least twice







55° C.




each















Methods for preparing and using probes and primers are described in the references, for example Sambrook et al.


Molecular Cloning: A Laboratory Manual,


2


nd


ed., Cold Spring Harbor Laboratory Press, NY, 1989; Ausubel et al.


Current Protocols in Molecular Biology


, Greene Publishing Associates and Wiley-Intersciences, 1987; and Innis et al., PCR Protocols,


A Guide to Methods and Applications


, Academic Press, Inc., San Diego, Calif. 1990. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version, 0.5,1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).




Recombinant nucleic acid: A sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook et al.


Molecular Cloning: A Laboratory Manual,


2


nd


ed., Cold Spring Harbor Laboratory Press, NY, 1989. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid.




Nativ : The term “native” refers to a naturally-occurring (“wild-type”) nucleic acid or polypeptde. The native nucleic acid or protein may have been physically derived from a particular organism in which it is naturally occurring or may be a synthetically constructed nucleic acid or protein that is identical to the naturally-occurring nucleic acid or protein.




Isolated: An “isolated” nucleic acid is one that has been substantially separated or purified away from other nucleic acid sequences in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachmmosomal DNA and RNA, by conventional nucleic acid-purification methods. The term also embraces recombinant nucleic acids and chemically synthesized nucleic acids.




Plant: The term “plant” encompasses any higher plant and progeny thereof, including monocots (e.g., corn, rice, wheat, barley, rapeseed, soy, sunflower, etc.), dicots (e.g., potato, tomato, etc.), and includes parts of plants, including seeds, fruit, tubers, etc.




The invention will be better understood by reference to the Examples herein. The scope of the invention is not to be considered limited thereto.




Description And General Methods of the Disclosure




The present invention utilizes standard laboratory practices for the cloning, manipulation, and sequencing of nucleic acids, the purification and analysis of proteins, and other molecular biological and biochemical techniques, unless otherwise stipulated. Such techniques are explained in detail in standard laboratory manuals such as Sambrook et al.,


Molecular Cloning. A Laboratory Manual,


2


nd


ed., Cold Spring Harbor Laboratory Press, NY. 1989; and Ausubel et al.,


Current Protocols in Molecular Biology, Green and Wiley


-


Interscience


, NY, 1987.




The inventors have identified, cloned, and expressed a novel fatty acid Δ


8


-desaturase from the protst


Euglena gracilis


and a novel fatty acid Δ


5


-desaturase from


Caenorhabditis elegans


that may be used together to produce polyunsaturated fatty acids.




The invention provides novel purified Δ


5


and Δ


8


proteins (FIG.


6


A and

FIG. 7A

, respectively). The invention also provides proteins differing from the proteins of FIG.


6


A and

FIG. 7A

by one or more conservative amino acid substitutions, as well as proteins that show “substantial similarity” with the proteins of FIG.


6


A and

FIG. 7A

Substantial similarity is defined in the “Definitions” section. Proteins of the invention include proteins that show at least 50% amino acid similarity with the proteins shown in FIG.


6


A and FIG.


7


A. The term “50% amino acid similarity” is objectively and-consistently defined by use of blastp sequence analysis software set at default parameters. Proteins of the invention also include proteins showing at least 60%, at least 70%, at least 80%, at least 90%, and at least 95% similarity (to the sequences of

FIG. 6A

or

FIG. 7A

) using blastp with default parameters.




The invention provides isolated novel nucleic acids that encode the above-mentioned proteins, recombinant nucleic acids that include such nucleic acids and cells containing such recombinant nucleic acids. Nucleic acids of the invention thus include nucleic acids that encode: (1) amino acid sequences as shown in FIG.


6


A and

FIG. 7A

; (2) amino acid sequences that differ from the sequences shown in FIG.


6


A and

FIG. 7A

by one or more conservative amino acid substitutions; and (3) amino acid sequences that show at least 50% similarity (as measured by blastp at default parameters) with the sequence of FIG.


6


A and

FIG. 7A






Nucleic acids of the invention also include nucleic acids that show at least the term “50% similarity” with the nucleic acids shown in FIG.


6


B and FIG.


7


B. The term “50% similarity” is objectively defined by the use of blastn software set at default perimeters. Nucleic acids of the invention also include nucleic acids showing at least 60%, at least 70%, at least 80%, at least 90%, and at least 95% similarity (to the sequences of FIG.


6


B and

FIG. 7B

) using blastn with default perimeters.




The novel Δ


5


- and Δ


8


-desaturase enzymes can be used individually, or in conjunction with one another, for instance in a metabolic pathway, to produce polyunsaturated fatty acids, such as 20:3 and 20:4 fatty acids.

FIG. 1B

shows an example of such a metabolic pathway. Such a pathway may be engineered into any cell by use of appropriate expression systems. A simple way to provide such elements is by the use of commercially available expression systems, discussed in detail below.




The scope of the invention covers not only entire nucleic acids encoding the novel Δ


5


- and Δ


8


desaturase enzymes (and substantially similar derivatives of such enzymes) but also covers “portions” of such nucleic acids (as defined in the “Definitions” section, herein). Such claimed portions are identified by their possession of a particular degree of similarity with similar sized portions of the nucleotides of FIG.


6


B and FIG.


7


B and may have a length of about 15, 20, 30, 40, or 50 contiguous nucleotides. Similarity is objectively measured by sequence comparison software, such as the “blastn” and “blastp” software available from the National Center for Biotechnology Information (NBCI. Bethesda, Md.) and on the Internet. Similarity between portions of nucleic acids claimed and similar sized portions of the nucleic acid sequences of FIG.


6


B and

FIG. 7B

may be at least 50%, 60%, 70%, 80%, 90%, 95%, or even 98%. Such portions of nucleic acids may be used, for instance, as primers and probes for research and diagnostic purposes. Portions of nucleic acids may be selected from any area of the sequences shown in

FIG. 6B

or

FIG. 7B

, for instance the first, second, third, etc., group of 100 nucleic acids as numbered in the figures.




Recombinant nucleic acids, as mentioned above, may, for instance, contain all or portion of a disclosed nucleic acid operably linked to another nucleic acid element such as a promoter, for instance, as part of a clone designed to express a protein. Cloning and expression systems are commercially available for such purposes.




Various yeast strains and yeast-derived vectors are commonly used for expressing and purifying proteins, for example,


Pichia pastoris


expression systems are available from Invitrogen (Carlsbad, Calif.). Such systems include suitable


Pichia pastoris


strains, vectors, reagents, sequencing primers, and media. A similar system for expression of proteins in


Saccharomyces cerevisiae


is also available from Invitrogen, which includes vectors, reagents and media. For example, a nucleotide sequence (e.g., a gene coding for the ≢


5


- or or Δ


8


-desaturase enzyme of the invention) may be cloned into the yeast expression vector pYES2 and expressed under the control of an inducible promoter, such as a galactose-inducible promoter (GAL1).




Non-yeast eukaryotc vectors may also be used for expression of the desaturases of the invention. Examples of such systems are the well known Baculovirus system, the Ecdysone-inducible mammalian expression system that uses regulatory elements from


Drosophila melanogaster


to allow control of gene expression, and the Sindbis viral expression system that allows high level expression in a variety of mammalian cell lines. These expression systems are also available from Invitrogen.




Standard prokaryotic cloning vectors may also be used, for example pBR322, pUC18 or pUC19 as described in Sambrook et al, 1989. Nucleic acids encoding the desaturases of the invention may be cloned into such vectors that may then be transformed into bacteria such as


Escherischia coli


(


E. coli


) which may then be cultured so as to express the protein of interest. Other prokaryotic expression systems include, for instance, the arabinose-induced pBAD expression system that allows tightly controlled regulation of expression, the IPTG-induced pRSET system that facilitates rapid purification of recombinant proteins and the IPTG-induced pSE402 system that has been constructed for optimal translation of eukaryotic genes. These three systems are available commercially from Invitrogen and, when used according to the manufacturer's instructions, allow routine expression and purification of proteins.




Alternatively, and of particular importance to this invention, a plant expression system could be used. Plant expression systems are commercially available. A gene of interest of the invention may be cloned into a vector and the construct used to transform a plant cell. Any well known vector suitable for stable transformation of plant cells and/or for the establishment of transgenic plants may be used, including those described in, eg., Pouwels et al.,


Cloning Vectors: A Laboratory Manual,


1985, supp. 1987; Weissbach and Weissbach,


Methods for Plant Molecular Biology


, Academic Press, 1989; and Gelvin et al.,


Plant Molecular Biology Manual


, Kluwer Academic Publishers, 1990. Such plant expression vectors can include expression control sequences (e.g., inducible or constitutive, environmentally or developmentally regulated, or cell or tissue-specific expression-control sequences).




Examples of constitutive plant promoters useful for expressing desaturase enzymes in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter (see, e.g., Odel et al.,


Nature


313:810, 1985; Dekeyser et al.,


Plant Cell


2:591, 1990; and Terada and Shimamoto,


Mol. Gen. Genet


220:389, 1990); the nopaline synthase promoter (An et al.,


Plant Physiol.


88:547, 1988) and the octopine synthase promoter (From et al.,


Plant Cell


1:977, 1989).




A variety of plantene promoters that are regulated in response to environmental, hormonal, chemical, and/or developmental signals, also can be used for protein expression in plant cells, including promoters regulated by (1) heat (Callis et al.,


Plant Physiol.


88:965, 1988), (2) light (e.g., pea rbcS3A promoter, Kuhlemeier et al.,


Plant Cell


1:471, 1989; maize rbcS promoter, Schaffner and Sheen,


Plant Cell


3:997, 1991; or chlorophyll a/b-binding protein promoter, Simpson et al., EMBO J. 4:2723, 1985), (3) hormones, such as abscisic acid (Marcotte et al.,


Plant Cell


1:969, 1989), (4) wounding (e.g., wuni, Siebertz et al.,


Plant Cell


1:961, 1989); or (5) chemicals such as methyl jasmonate, salicylic acid, or a safener. It may also be advantageous to employ (6) organ-specific promoters (e.g., Roshal et al., EMBO J. 6:1155, 1987; Schemthaner et al., EMBO J. 7:1249, 1988; Bustos et al.,


Plant Ceti


1:839, 1989; Zheng et al.,


Plant J.


4:357-366, 1993). Tissue-specific expression may be facilitated by use of certain types of promoters, for example, the napin promoter is a seed-storage protein promoter from Brassica and specific to developing seeds. The β-conglycinin promoters drive the expression of recombinant nucleic acids thus allowing, the Δ


5


or Δ


8


proteins of the invention to be expressed only in specific tissues, for example, seed tissues.




Plant expression vectors can include regulatory sequences from the 3′-untranslated region of plant genes (Thomburg et al.,


Proc. Natl Acad. Sci. USA


84:744, 1987; An et al.,


Plant Cell


1:115, 1989), e.g., a 3′ terminator region to increase mRNA stability of the mRNA, such as the PI-II terminator region of potato or the octopine or nopaline synthase 3′terminator regions.




Useful dominant selectable marker genes for expression in plant cells include, but are not limited to: genes encoding antibiotic-resistance genes (e.g., resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin, or spectinomycin); and herbicide resistance genes (e.g., phosphinothricin acetyltransferase). Useful screenable markers include, but are not limited to, β-glucuronidase and green fluorescent protein.




The invention also provides cells or plants or organisms transformed with recombinant nucleic acid constructs that include all or a portion of the newly discovered polynucleotides that encode the novel Δ


5


and/or Δ


8


desaturase enzymes. An example of such a transformed plant or organism would be a potato, tomato, rapeseed, sunflower, soy, wheat, or corn plant Multi-celled fungi, such as edible mushrooms, may also be transformed. Transformed oil-seed plants are of particular interest as 20-carbon polyunsaturated fatty acids would accumulate within the seed-oil.




Nucleic acid constructs that express a nucleic acid according to the invention can be introduced into a variety of host cells or organisms in order to alter fatty acid biosynthesis. Higher plant cells, eukaryotic, and prokaryotic host cells all may be so transformed using an appropriate expression system as described above.




After a cDNA (or gene) encoding a desaturase has been isolated, standard techniques may be used to express the cDNA in transgenic plants in order to modify the particular plant characteristic. The basic approach is to clone the cDNA into a transformation vector, such that the cDNA is operably linked to control sequences (e.g., a promoter) directing expression of the cDNA in plant cells. The transformation vector is then introduced into plant cells by any of various techniques, for example by Agrobacterium-mediated transformation of plants or plant tissues, or by electroporation of protoplasts, and progeny plants containing the introduced cDNA are selected. All or part of the transformation vector stably integrates into the genome of the plant cell. That part of the transformation vector that integrates into the plant cell and that contains the introduced cDNA and associated sequences for controlling expression (the introduced ‘transgene’) may be referred to as the “recombinant expression cassette.”




Selection of progeny plants containing the introduced transgene may be made based upon the detection of an altered phenotype. Such a phenotype may result directly from the cDNA cloned into the transformation vector or may be manifested as enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a dominant selectable marker gene incorporated into the transformation vector.




Successful examples of the modification of plant characteristics by transformation with cloned cDNA sequences are replete in the technical and scientific literature. Selected examples, which serve to illustrate the knowledge in this field of technology include.




U.S. Pat. No. 5,571,706 (“Plant Virus Resistance Gene and Methods”)




U.S. Pat. No. 5,677,175 (“Plant Pathogen Induced Proteins”)




U.S. Pat. No. 5,510,471 (“Chimeric Gene for the Transformation of Plants”)




U.S. Pat. No. 5,750,386 (“Pathogen-Resistant Transgenic Plants”)




U.S. Pat. No. 5,597,945 (“Plants Genetically Enhanced for Disease Resistance”)




U.S. Pat. No. 5,589,615 (“Process for the Production of Transgenic Plants with Increased Nutritional Value Via the Expression of Modified 2S Storage Albumins”)




U.S. Pat. No. 5,750,871 (“Transformation and Foreign Gene Expression in Brassica Species”)




U.S. Pat. No. 5,268,526 (“Overexpression of Phytochrome in Transgenic Plants”)




U.S. Pat. No. 5,262,316 (“Genetically Transformed Pepper Plants and Methods for their Production”)




U.S. Pat. No. 5,569,831 (“Transgenic Tomato Plants with Altered Polygalacturonase Isoforms”)




These examples include descriptions of transformation vector selection, transformation techniques, and the construction of constructs designed to over-express the introduced cDNA. In light of the foregoing and the provision herein of the desaturase amino acid sequences and nucleic acid sequences, it is thus apparent that one of skill in the art will be able to introduce the cDNAs, or homologous or derivative forms of these molecules, into plants in order to produce plants having enhanced desaturase activity. Furthermore, the expression of one or more desaturases in plants may give rise to plants having increased production of poly-unsaturated fatty acids.




The invention also pertains to antibodies to the desaturase enzymes, and fragments thereof, these antibodies may be useful for purifying and detecting the desaturases. The provision of the desaturase sequences allows for the production of specific antibody-based binding agents to these enzymes.




Monoclonal or polyclonal antibodies may be produced to the desaturases, portions of the desaturases, or variants thereof. Optimally, antibodies raised against epitopes on these antigens will specifically detect the enzyme. That is, antibodies raised against the desaturases would recognize and bind the desaturases, and would not substantially recognize or bind to other proteins. The determination that an antibody specifically binds to an antigen is made by any one of a number of standard immunoassay methods; for instance, Western blottng, Sambrook et al. (ed.),


Molecular Cloning: A Laboratory Manual,


2


nd


ed.: Vols. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.




To determine that a given antibody preparation (such as a preparation produced in a mouse against the Δ


5


-desaturase) specifically detects the desaturase by Western blotting, total cellular protein is extracted from cells and electrophoresed on a SDS-polyacrylamide gel. The proteins are then transferred to a membrane (for example, nitrocellulose) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase; application of 5-bromo-4-chloro-3-indoyl phosphate/nitro blue tetrazolium results in the production of a densely blue-colored compound by immuno-localized alkaline phosphatase.




Antibodies that specifically detect a desaturase will, by this technique, be shown to bind substantially only the desaturase band (having a position on the gel determined by the molecular weight of the desaturase). Non-specific binding of the antibody to other proteins may occur and may be detectable as a weaker signal on the Western blot (which can be quantified by automated radiography). The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific anti-desaturase binding. Antibodies that specifically bind to desaturases belong to a class of molecules that are referred to herein as “specific binding agents.” Specific binding agents that are capable of specifically binding to the desaturase of the present invention may include polyclonal antibodies, monoclonal antibodies, and fragments of monoclonal antibodies such as Fab, F(ab′)2, and Fv fragments, as well as any other agent capable of specifically binding to one or more epitopes on the proteins.




Substantially pure desaturase suitable for use as an immunogen can be isolated from transfected cells, transformed cells, or from wild-type cells. Concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few micrograms per milliliter. Alternatively, peptide fragments of a desaturase may be utilized as immunogens. Such fragments may be chemically synthesized using standard methods, or may be obtained by cleavage of the whole desaturase enzyme followed by purification of the desired peptide fragments. Peptides as short as three or four amino acids in length are immunogenic when presented to an immune system in the context of a Major Histocompatibility complex (MHC) molecule, such as MHC class I or MHC class II. Accordingly, peptides comprising at least 3 and preferably at least 4, 5, 6, or more consecutive amino acids of the disclosed desaturase amino acid sequences may be employed as immunogens for producing antibodies.




Because naturally occurring epitopes on proteins frequently comprise amino acid residues that are not adjacently arranged in the peptide when the peptide sequence is viewed as a linear molecule, it may be advantageous to utilize longer peptide fragments from the desaturase amino acid sequences for producing antibodies. Thus, for example, peptides that comprise at least 10, 15, 20, 25, or 30 consecutive amino acid residues of the amino acid sequence may be employed. Monoclonal or polyclonal antibodies to the intact, desaturase, or peptide fragments thereof may be prepared as described below.




Monoclonal antibody to any of various epitopes of the desaturase enzymes that are identified and isolated as described herein can be prepared from murine hybridomas according to the classic method of Kohler & Milstein,


Nature


256:495, 1975, or a derivative method thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall,


Enzymol.


70:419, 1980, or a derivative method thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow & Lane,


Antibodies, A Laboratory Manual


, Cold Spring Harbor Laboratory, New York, 1988.




Polyclonal antiserum containing antibodies to heterogenous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein, which can be unmodified or modified, to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than other molecules and may require the use of carriers and an adjuvant. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low-titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al.,


J. Clin. Endocrinol. Metab.


33:988-991, 1971.




Booster injections can be given at regular intervals, and antiserum harvested when the antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony et al.,


Handbook of Experimental Immunology


, Wier, D. (ed.), Chapter 19, Blackwell, 1973. A plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/mL of serum (about 12 μM). Affinity of the antisera for the antigen is determined by preparing competitive binding curves using conventional methods.




Antibodies may be raised against the desaturases of the present invention by subcutaneous injection of a DNA vector that expresses the enzymes in laboratory animals, such as mice. Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al.,


Particulate Sc. Technol.


5:27-37, 1987, as described by Tang et al.,


Nature


(London) 356:153-154, 1992). Expression vectors suitable for this purpose may include those that express the cDNA of the enzyme under the transcriptional control of either the human β-actin promoter or the cytomegalovirus (CMV) promoter. Methods of administering naked DNA to animals in a manner resulting in expression of the DNA in the body of the animal are well known and are described, for example, in U.S. Pat. Nos. 5,620,896(“DNA Vaccines Against Rotavirus Infections”); 5,643,578 (“Immunization by Inoculation of DNA Transcription Unit”): and 5,593,972(“Genetic Immunizaton”), and references cited therein.




Antibody fragments may be used in place of whole antibodies and may be readily expressed in prokaryotic host cells. Methods of making and using immunologically effective portions of monoclonal antibodies, also referred to as “antibody fragments,” are well known and include those described in Better & Horowitz,


Methods Enzymol.


178:476-496, 1989; Glockshuber et al.


Biochemistry


29:1362-1367, 1990: and U.S. Pat. Nos. 5,648,237 (“Expression of Functional Antibody Fragments”); No. 4,946,778 (“Single Polypeptide Chain Binding Molecules”); and U.S. Pat. No. 5,455,030 (“Immunotherapy Using Single Chain Polypeptide Binding Molecules”), and references cited therein.




EXPERIMENTAL EXAMPLES




Example 1




Organism Strains and Culture




The strain


Euglena gracilis


Z was obtained from Columbia Scientific. The organism was cultured on Cramer and Meyers medium (Cramer, and Meyers, Archiv fur Mikrobiologie 17:384-402, 1952) with the addition of sucrose as a carbon source. Cultures were maintained at 25° C. in absolute darkness.






C. elegans


was obtained from


Caenorhabditis


Genetics Center, St. Paul, Minn., and grown under standard conditions (Sulston et al., The Nematode


Caenorhabditis


elegant (Wood, W. B., Eds.), pp. 587-606, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988).




Example 2




Database Searches for


C. elegans


Gene Homologs




The Sanger Center (http://www.sanger.ac.uk/projects/c_elegans/blast_server.shtml)


C. elegans


genomic database was searched using BLAS™ with sequences of plant desaturase enzymes, including the


B. officinalis


Δ


8


-desaturase (GenBank accession number U79010). Two


C. elegans


polypeptides with the highest scores were a peptide on cosmid WO8D2 (high score 163), and one on T13F2 (high score 121).




Example 3




RNA Isolation, Reverse Transcription PCR, and RACE (Rapid Amplification of cDNA Ends)




For the


E. gracilis


Δ


8


gene, total RNA was isolated from heterotrophic cultures of


E, gracilis


using a phenol-SDS protocol (Ausubel,


Current Protocols in Molecular Biology,


1988). Messenger RNA was purified from total RNA using the PolyA-tract system (Promega Scientific, Madison, Wis.). Reverse transcription reactions were carried out using Superscript II (Life Technologies, Rockville, Md.). First-strand synthesis in the initial reactions was primed using anchored poly T primers (Clontech, Palo Alto, Calif.). Second-strand synthesis was conducted as described (Life Technologies), and polymerase chain reaction amplification of the core region of the gene was accomplished using the primers (GGCTGGCTGACNCAYGARTYTGYCAY; SEQ. ID NO. 5) and (CATCGTTGGAAANARRTGRTGYTCDATYTG; SEQ. ID NO. 6), designed to be completely degenerate to sequences overlapping the first and third His-box regions of the Δ


6


-desaturase


C. elegans


gene.




The amplification protocol was developed using published guidelines for use of degenerate primers (Compton, PCR Protocols:


A Guide To Methods And Applications,


1990). The amplification consisted of 5 preliminary cycles at very low annealing temperature (30 seconds at 94° C., 1-minute ramp to 37° C., 45 seconds at 37° C., 3-minute ramp to 72° C.) followed by 30 cycles with higher temperature (30 seconds at 94° C., 1-minute ramp to 50° C., 45 seconds at 50° C., 3-minute ramp to 72° C. Preliminary amplifications to optimize thermal cycling parameters used Pfu DNA polymerase (Stratagene, La Jolla, Calif.). Amplification was successful at 3 mM magnesium and each primer at 4 μM. Subsequently Taq polymerase was used for amplification under identical conditions.




Polymerase chain reaction products from 350 to 750 bp were isolated from agarose gels with commercial reagents (Qiagen, Valencia, Calif.) and sequenced directly using the degenerate primers and dye-termination sequencing technology (Applied Biosystems, Foster City, Calif.). A group of identical amplification products contained an open reading frame that was homologous to known desaturases when analyzed by BLAST™ search (Altschul et al.,


Nucleic Acids Res.


25:3389-3402,1997). The 5′ and 3′ sequences of the complete mRNA were obtained with the Marathon RACE system (Clontech), using pairs of nested primers designed to amplify from within the core sequence. To clone the complete 5′ end of the gene, it was necessary to repeat the reverse transcription with a primer specific to the sequence of the open reading frame and repeat the 5′ RACE amplification.




For the


C. elegans


Δ


5


gene. RNA isolation and reverse transcription-PCR were performed as follows. RT-PCR was used to amplify the coding sequences of the two putative desaturase genes. Total RNA from mixed stage


C. elegans


was used for the RT-PCR template. The nematodes were grown on agar plates as described and RNA was isolated using the phenol/SDS method (Sluder et al.,


Dev. Biol.


184:303-319, 1997). RT-PCR was performed using the Superscript™ One-step RT-PCR system (Gibco-BRL/Life Technologies). Approximately 1 μg of total RNA was added to a reaction mixture consisting 0.2 mM of each dNTP, 1.2 mM MgSO


4


, Superscript II™ RT/Taq polymerase mix, and 200 μM of appropriate downstream and upstream primers. The reactions were incubated at 50° C. for 30 min., then subject to 35 cycles of PCR amplification. For the T13F2.1 gene (fat-4) a 5′ primer corresponding to bases 34339-34361 of cosmid T13F2 was used. SmaI, HindIII, and XhoI restriction sites were added to these sequences to facilitate cloning. The resulting primer [CCCGGGAAGCTTCTCGAGGATTTTTCAATCCTCCTTGGGTC; SEQ. ID NO: 7] anneals to the cosmid T13F2 1942 base pairs upstream of the putative start codon ATG of the fat-4 gene. To amplify the 3′ end of the fat-4 gene, a primer was used corresponding to the inverse complement of bases 37075-37095 of cosmid T13F2; with the addition of SmaI and BamH-II sites to facilitate cloning the polynucleotide of interest CCCGGGTGGATCCGGMCATATCACACGAAACAG; SEQ. ID NO. 8). This primer begins 93 base pairs after the putative stop codon TAG and ends 20 base pairs upstream of the predicted polyadenylation signal (AAUAAA; SEQ ID NO: 9) of the fat-4 gene.




For the determination of trans-splicing of specific leader sequences, downstream primers corresponding to the complement of bases 35009-35028 of the T13F2 (TCTGGGATCTCTGGTTCTTG; SEQ. ID NO: 10) were used for the T13F2.1 gene. The upstream PCR primers were either SL1-20 or SL2-20 (Spieth et al.,


Cell


73:521-532, 1993). The


C. elegans


homologue of the ribosoma-protein L37 was used as an SL1-specific control, and K06H7.3 was used as an SL2-specific control (Zorio et al.,


Nature


372:270-272, 1994. SL1-20, SL2-20, and control primers were kindly provided by Diego A R. Zorio. RT-PCR products visualized by gel electrophoresis were confirmed by blotting the gel and probing with gene specific oligonucleotides corresponding to the appropriate gene as previously described (Spieth et al., Cell 73:21-532, 1993).




Example 4




PCR Amplification of the Genes Encodinq Δ


5


and Δ


8


Desaturases




DNA and protein sequences were analyzed using the Wisconsin-GCG package of programs (Devereux et al.


Nucleic Acids Res.


12:387-95, 1984).




To clone the


E. gracilis





8


) open reading frame as a single DNA fragment, a set of primers was used to prime a reverse transcription specifically for the open reading frame. The primer for the 5′ end of the gene began 3 nucleotides before the start codon and included the first 26 nucleotides of the open reading frame. The 3′ primer was complementary to the sequence between 22 and 52 nucleotides downstream from the predicted termination codon. This PCR amplification was conducted with Pfu polymerase to minimize the chance of an amplification error. The PCR reactions produced a single band of the predicted size when analyzed by agarose gel electrophoresis. This band was cloned into the vector PCR-Script Cam™ (Stratagene), and a single clone designated pJW541 was chosen for analysis.




The plasmid containing SEQ ID NO: 3, described herein as pJW541, was deposited in the American Type Culture Collection (10801 University Boulevard, Manassas, Va. 20110) on May 20, 2003 (ATCC Accession No. PTA-5206).




To express the


C. elegans


Δ


5


-desaturase, the fat-4 cDNA amplification product (see Example 3) was digested with HindIII and BamHIII and ligated to the yeast expression vector pYES2 (Invitrogen) cut with HindIII and BamH1. The resulting plasmid was named pYFAT4.




Example 5




Expression of Δ


5


and Δ


8


-desaturases




For


E. gracilis


, the cloned Δ


8


gene was transferred to the yeast expression vector pYES2 (Invitrogen, Carlsbad, Calif.) by standard cloning techniques (Ausubel,


Current Protocols in Molecular Biology,


1988) using enzymes obtained from New England Biolabs, Beverly, Mass. The resulting yeast expression construct containing the open reading frame under the control of a galactose-inducible promoter was designated pYES2-541.






Saccharomyces cerevisiae


strain INVSc1 (Invitrogen) was transformed with pYES2-541 and cultured using standard methods (Ausubel,


Current Protocols in Molecular Biology,


1988). Liquid medium containing 2% galactose was supplemented with fatty acid soaps (NuCheck Prep, Elysian Minn.) at a final concentration of 0.2 mM. Tergitol (1%, NP40) was added to the yeast cultures to enhance fatty acid uptake (Stukey et al., J. Biol. Chem. 264:16537-16544, 1989), except for cultures containing 20:1, where 5% DMSO was substituted. Yeast were incubated overnight at 28° C., harvested by centrifugation, washed once with 1% Tergitol, once with 0.5% Tergitol, and finally once with distilled water.




For the


C. elegans


Δ


5


gene, the constructs were transformed into


Saccharomyces cerevisiae


strain INVSc1 using the S.c. EasyComp transformation kit (Invitrogen). For experiments with the FAT-4 peptide, transformed yeast were grown overnight in uracil-deficient media containing 2% galactose, 0.2 mM fatty acid, and 1% NP-40. Under these conditions the percentage of these supplemented fatty acids which were incorporated into yeast lipids ranged from 14-28% of the total yeast fatty acids. For experiments in which 20:1Δ


11


was used as a substrate, the 1% NP-40 was replaced by 5% DMSO to achieve better incorporation of this fatty acid.




Example 6




Analysis of Fatty Acids Using Gas Chromatography and GC-mass Spectrometry




Extraction of lipids and preparation of fatty acid methyl esters was carried out by standard methods (Miquel and Browse,


J. Biol. Chem.


267:1502-1509, 1992). Gas chromatography of the methyl esters was conducted by established methods (Spychalla et al.,


Proc. Natl. Acad. Sci. USA


94:1142-1147, 1997). Fatty acid 4,4-Dimethyloxazoline (DMOX) derivatives of yeast lipid extracts were prepared by standard methods (Fay and Richli,


J. Chromatogr.


541:89-98, 1991). GC-mass spectrometry was conducted on a Hewlett-Packard 6890 series GC-MS fitted with a 30 m.×0.25 μm HP5MS column, operating at an ionization voltage of 70 eV with a scan range of 50-550 Da. Fatty acids and their derivatives were identified where possible by comparison with authentic standards (NuCheck Prep).




Example 7




Identification and Amplification of the


Euglena


Δ


8


-desaturase Gene




Messenger RNA isolated from heterotrophic cultures was used as template for reverse transcription followed by PCR amplification using degenerate primers that spanned the first and third conserved histidine rich regions of microsomal desaturase proteins. The


C. elegans


Δ


6


-desaturase gene, FAT-3, was used as the principal basis for primer design. To compensate for the high degeneracy necessary in the primer pair, amplification reactions began with five cycles of low-temperature annealing and a long temperature ramp between the annealing and polymerization steps. Preliminary amplifications to optimize thermal cycling parameters used the proofreading Pfu DNA polymerase. After successful Pfu amplification reactions using high primer and magnesium concentrations, Taq polymerase was used to generate a number of bands detectable on agarose gels.




Several of these bands, of approximately 650 bp, had identical sequence. This DNA sequence contained an open reading frame in which the predicted amino acid sequence was homologous to other membrane desaturases, and included a characteristic central His-box. Primers designed to be specific to the amplified sequence were used to amplify the termini of the cDNA using 3′ and 5′ RACE techniques. The full-length cDNA for this gene was 1745 bp in length. It included an open reading frame of 1272 bp and a 472 bp 3′ untranslated region. Most


Euglena


messenger RNAs are processed through the addition of a short 5′ RNA leader sequence, the trans-spliced leader (Tessier et al.,


Embo. J.


10:2621-2625, 1991). This RNA processing step left a conserved sequence (TTTTTTTCG; SEQ. ID NO. 11) at the beginning of each message (Cui et al.,


J. Biochem


. (Tokyo) 115:98-107, 1994). The presence of this leader in the cDNA sequence confirmed that the message was full length at the 5′ end. RT-PCR with primers flanking the open reading frame on the 5′ and 3′ ends resulted in a single band that was cloned into the vector pCR-Script Cam™ (Stratagene), and designated pJW541. The gene corresponding to this ORF was designated EFD1 (


Euglena


fatty acid desaturase 1).




Example 8




Similarity Between


Euglena


Δ


8


-desaturase and Other Proteins




The translated open reading frame indicated a protein of 422 amino acids with a predicted molecular mass of 48.8 kDa. (FIG.


3


). A BLAST™ search of sequence databases revealed that the predicted protein sequence exhibited regions of homology with the known group of membrane fatty acid desaturases, especially in the highly conserved histdine-rich regions (Shanklin et al.,


Biochemistry


33:12787-12794, 1994).




Each of the His-box motifs is present in the EFD1 protein. The first (HXXXH) starts at amino acid 146 and the second (HXXHH; SEQ ID NO: 12) at amino acid 183 (FIG.


3


). EFD1 contains a variant third His-box, QXHH (SEQ ID NO: 13), starting at amino acid 361, similar to the coned Δ


5


- and Δ


6


-desaturases. EFD1 exhibits conservation of protein sequence in the regions surrounding the highly conserved regions, especially with FAT-3 and FAT-4, the Δ


6


and Δ


5


-desaturases of


C. elegans


(FIG.


3


). Outside the highly conserved regions, the amino acid sequence shows considerably less similarity to other desaturases. Overall, the amino acid identity with FAT-3 and FAT-4 is 33%, compared to 28% identity with the borage Δ


8


-desaturase.




EFD1 also contains a cytochrome b


5


-like motif at its N-terminus. The protein encodes seven of the eight most highly conserved amino acids characteristic of cytochrome b


5


(FIG.


3


), which are responsible for heme binding. Similar motifs are found at the N-terminal regions of FAT-3 and FAT-4 (FIG.


3


), and the borage Δ


6


protein, as well as the carboxyl terminus of a yeast Δ


9


protein.




The structure of the


Euglena


protein also exhibits similarities with known desaturases. Membrane desaturases are type II multiple membrane spanning proteins, and hydropathy analysis of the cloned


Euglena


gene indicates that the predicted protein has at least three significant hydrophobic regions long enough to span the membrane bilayer twice. As is true for most desaturase enzymes, there are 31 amino acid residues between the first two His-boxes. The distance between the between the second and third His-box is 173 residues, within the range previously observed (Shanklin and Cahoon,


Annu. Rev. Plant Physiol. Plant Mol. Biol.


48:611-441, 1998).




Example 9




Activity of the


Euglena


Δ


8


-desaturase Protein




To confirm the activity of the enzyme, the EFD1 cDNA was transferred from pJW541 to yeast expression vector pYES2 under the control of a galactose-inducible promoter. The resulting construct, pYES2-541, was introduced into


S. cereviae


. Yeast membranes do not contain 20-carbon fatty acids but incorporate them from the culture medium. Accordingly, yeast cultures were supplemented with various fatty acid soaps, using a yeast strain containing the empty vector as control, and analyzed the fatty acids of the cultures by methyl-ester derivatization and gas chromatography.




The patterns of desaturation activity in these experiments indicated that pYES2-541 expresses a Δ


8


-desaturase enzyme that does not have Δ


5


or Δ


6


activity. The ability of the experimental yeast strain to produce Δ


8


desaturation was shown when the culture medium was supplemented with 20:2 (FIG.


4


). A desaturation peak whose retention time is identical to authentic 20:3 was produced. The vector-only control culture did not desaturate 20:2 (FIG.


4


). The yeast strain expressing the


Euglena


gene also desaturated 20:3 and 20:1 (FIG.


4


), again without desaturation activity in the control cultures. The cloned


Euglena


protein was most active with 20:3 and 20:2 as substrates, desaturating 70% and 73% of the total incorporated 20-carbon fatty acid. EFD1 was least active with 20:1, converting 32% of that substrate to a desaturation product (FIG.


4


).




When the culture medium was supplemented with a substrate for Δ


5


-desaturation, 20:4, the fatty acid was incorporated into the yeast, but no 20:5 desaturation product was produced. Similarly, when the medium was supplemented with 18:2 and 18:3, no desaturation occurred, demonstrating that the cloned gene did not express a Δ


6


-desaturase.




To confirm that desaturation had occurred at the Δ


8


-position, 4,4-dimethyloxazoline (DMOX) derivatives of yeast fatty acids were analyzed by GC-MS. DMOX derivatives have mass spectra that are more easily interpreted than spectra of methyl esters, and permit unambiguous determination of double-bond locations in polyunsaturated fatty acids (


Christie, Lipids


33:343353, 1998). For the experiment that desaturated the fatty acid 20:2, the retention time of the product on the GC-MS instrument was 16.8 min., identical to DMOX-derivatized authentic 20:3. The mass spectrum of this desaturation product and its molecular ion (m/z 359) indicated that it was the 20:3 compound. Two spectral frequency peaks at m/z 182 and 194, separated by only 12 a.m.u., showed that the introduced double bond was at the Δ


8


position (FIG.


5


). (The substrate 20:2, which is saturated at the 8-position, has peaks at 182 and 196, separated by 14 a.m.u.) The spectrum of the product, with its desaturation peaks, was identical to that of authentic 20:3 (Luthria and Sprecher,


Lipids


28:561-564, 1993). The other substrates, 20:1 and 20:3, were also desaturated at the Δ


8


-position by EFD1. The peaks at m/z 182 and m/z 194 appeared in the spectrum of each, and the molecular ion was reduced from that of the substrate by two in each case (FIG.


5


).




Example 10




Identification and Cloning of Two Fatty Acid


C. elegans


Desaturase Genes




Two high-scoring open reading frames were identified during a search of the


C. elegans


genomic DNA database with the borage Δ


5


-desaturase protein sequence. Both proteins predicted from these open reading frames, WO8D2.4 and T13F2.1, contained an N-terminal sequence resembling cytochrome b


5


, including the characteristic (HPGG) heme binding domain, and an H→Q substitution in the third histidine box. The WO8D2.4 gene was denoted fat-3 and the T13F2.1 gene was denoted fat-4, since they both appear to encode fatty acid desaturases. Interestingly, the fat-3 and fat-4 genes are located next to each other on overlapping cosmids in the same 5′ to 3′ orientation, with only 858 nucleotide base pairs separating the putative polyadenyladon signal of the fat-4 gene and the ATG start codon of the fat-3 gene (FIG.


8


). This gene organization is reminiscent of operons, in which two or more genes are transcribed under the control of a single promoter and regulatory region.




In


C. elegans


the polycistronic pre-mRNA is converted to monocistronic mRNA by cleavage and polyadenylation at the 3′ end of the upstream gene and transplicing to the SL2 sequence at the 5′ end of the downstream gene, with the two mRNAs being subsequently independently translated. However, out of more than 30 such operons that have been analyzed, the distances between the 3′ end of the upstream gene and the 5′ end of the downstream gene are generally about 100 base pairs, with a few separated by 300-400 base pairs (Blumenthal et al,


C. elegans II, pp.


117-145, Cold Spring Harbor Laboratory Press, Cold Spring. NY, 1997).




The


C. elegans


fat-3 and fat-4 genes were tested to determine whether they were trans-spliced to either SL1 or SL2 in order to determine if they might be co-transcribed in a single operon. It was found that the Fat-4 gene was transpliced to SL1, but that the fat-3 gene was not transpliced to either spliced leader sequence. Therefore, it was concluded that each gene contains its own 5′ promoter and regulatory region.




Both of these genes were cloned using RT-PCR. The fat4 gene sequence matched the T13F2 genomic sequence exactly. However the gene product encoded by the cDNA was seven amino acids shorter than predicted by Genefinder for T13F2.1 (GenBank accession numberZ81122) because the DNA sequence encoding amino acid residues 198-204 was not present in the fat-4 cDNA. The resulting peptide length was 447 amino acids instead of the previously predicted 454 amino acids. The gene product encoded by the fat-3 cDNA also matched the genomic sequence of WO8D2.4 (GenBank accession number Z70271) perfectly. However, the gene product was also shorter than the predicted protein sequence. Codons for amino acid residues 38-67 of WO8D2.4 were not present in the cDNA. In both cases the gene-prediction software used in the genomic sequencing project appeared to have misidentified some intron DNA as coding sequences.




Example 11




Sequence Comparisons for


C. elegans


Δ


5






The


C. elegans


FAT-3 and FAT-4 proteins, the Mortlerella alpina Δ


5


-desaturase, and the


B. officinalis


Δ


6


-desaturase appear to be proteins of similar structure in that they all contain an N-terminal cytochrome b


5


domain, three histidine boxes, and distinct hydrophobic membrane-spanning domains predicted by the TMHMM program from the Center for Biological Sequence Analysis, Technical University of Denmark (http://www.cbs.dtu.dk/services/TMHMM-1.0/). The predicted structure is consistent with the proposed desaturase structural model (Stukey et al.,


J. Biol. Chem.,


265:20144-20149, 1990). Despite these similarities, the overall sequence identity among the four proteins is quite low. For example, the FAT-3 Δ


6


-desaturase and the borage Δ


6


-desaturase share only 28% identity on the amino acid level. The fat-4 gene product shares 25% amino acid identity with the borage Δ


6


-desaturase and 19% amino acid identity with the Mortierella alpina Δ


5


-desaturase. Indeed the only portion of the FAT-4 protein that shows extended homology to the


M. alpina


Δ


5


-desaturase is a sequence of 36 residues incorporating the third His box which has 44% identity and 56% similarity. The most closely related pair of sequences are fat-3 and fat-4, which are 46% identical on the amino acid level and 54% identical over the entire cDNA sequence.





FIG. 9

shows the sequence comparison of the borage Δ


6


-desaturase,


C. elegans


FAT-3


., C. elegans


FATA, and the Mortierella alpina Δ


5


-desaturase. The similar heme-binding domains (HPGG) and th three histidine box regions are underlined. The presence of these conserved motifs indicate that the fat-4 gene may encode a desaturase or a related fatty acid modifying enzyme. However it is not possible, from these sequence comparisons alone, to predict whether this gene encodes a Δ


6


-desaturase, a Δ


5


-desaturase, or a more distantly related enzyme.




Example 12




Fatty Acid Desaturase Activity and Substrate Specificity in Yeast for


C. elegans Δ




5






To determine the enzymatic activity of the FAT-4 desaturase-like protein, the protein was expressed in


Saccharomyces cerevisiae


supplemented with polyunsaturated fatty acid substrates that are not normally present in this yeast. The FAT-4 protein was expressed in the yeast expression vector pYES2 from the GAL1 promoter by growing the cells in the presence of galactose and various fatty acids. After 16 hours of growth, the cells were analyzed for total fatty acid composition by gas chromatography (GC). Comparison of cells supplemented with di-homo-γ-linolenic acid (20:3Δ


8,11,14


) carrying pYES2 containing the fat-4 coding sequence and cells carrying the vector alone revealed the presence of a major new peak eluting at 14.49 minutes in the cells expressing FAT-4 (FIG.


10


B). The novel peak htd a retention time identical to that of the authentic arachidonic acid methyl ester (20:4Δ


5,8,11,14


), and was determined to be arachidonic acid (20:4Δ


5,8,11,14


) because its mass spectrum was identical to that of authentic arachidonic acid methyl ester, including a mass ion peak at m/z 318.




The identity of this compound was further verified by converting the yeast fatty acid methyl esters into oxazoline derivatives in order to produce structure specific mass spectra which simplify the determination of double-bond positions in a hydrocarbon chain. The mass spectrum of the DMOX derivative of the novel 20:4 component was consistent with the published spectrum for arachadonic acid and contained a prominent peak at m/z 153, which is diagnostic of a double bond at the Δ


5


position. Therefore, it was concluded that the fat-4 gene encodes a Δ


5


-desaturase capable of synthesizing arachidonic acid from the substrate di-homo-γ-linolenic acid. In contrast, the FAT-4 protein showed no activity when linoleic acid (18:2Δ


9,12


) or γ-linolenic acid (18:3Δ


9,12,15


) were provided as substrates, indicating an absence of Δ


6


-desaturase activity.




Further analysis of the GC trace of the total fatty acids of the yeast cells expressing fat-4 revealed the presence of a second novel peak eluting at 12.91 minutes which was not present in the empty vector control cells. Analysis of the mass spectrum of this novel peak revealed a molecular ion species of 294, identical to that of a methyl ester of an 18-carbon fatty acid with two double bonds (18:2), but its retention time and mass spectrum were not identical to the common isomer 18:2Δ


9,12


.




In microsomal extracts of mammalian liver, Δ


5


-desaturase activity has been reported to act on a number of 18 and 20-carbon precursors to produce uncommon fatty acids such as 18:24Δ


5,11


, 20:3Δ


5,11,14


and 20:4Δ


5,11,14,17


(28, 29). Two species of slime molds have also been reported to produce small amounts of 18:2Δ


5,9


, 18:2Δ


5,11


, 20:3Δ


5,11,14


and 20:4Δ


5,11,14,17


(Rezanka,


Phytochemistry,


33:1441-1444, 1993). These fatty acids are unusual in that their double bonds do not follow the conventional methylene-interrupted pattern (one double bond every three carbons).




Therefore, it was suspected that the novel peak exhibited on the GC spectrum is a result of the


C. elegans Δ




5


-desaturase acting on 18:1Δ


9


, [or 18:14Δ


11


, which in


S. cerevisiae


constitutes 15-20% of the total 18:1] compound, to produce the uncommon isomer 18:2Δ


5,9


or 18:2Δ


8,11


. These yeast fatty acid methyl esters were converted into oxazoline derivatives. It was found that the mass spectrum of the DMOX derivative of the novel 18:2 component contained the Δ


5


-specific peak at m/z 153. However the larger ion peaks characteristic of double bonds at the Δ


9


or Δ


11


position were not detected due to the small amount of this molecule present in the total yeast extracts.




To test if the


C. elegans


Δ


5


-desaturase was capable of desaturating other substrates to produce other uncommon, non-methylene-interrupted fatty acids, the yeast expressing the FAT-4-desaturase was supplemented with unconventional Δ


5


-substrates such as 20:1Δ


11


, 20:2Δ


11,14


, and 20:3Δ


11,14, 17


. No novel peaks were detected when the substrate 20:1Δ


11


was fed to yeast. However, when 20:2Δ


11,14


and 20:3Δ


11,14,17


were provided as substrates, novel peaks were detected eluting at 14.62 minutes and 14.69 minutes, respectively (

FIGS. 11A and 11B

, respectively). The mass-spectrum analysis of DMOX derivatives of these molecules yielded results consistent with published values for 20:3Δ


5,11,14


and 20:4Δ


5,11,14,17


including a prominent ion peak of m/z 153 (which is diagnostic of double bonds at the Δ


5


position). It was found, however, that these fatty acids were not produced to the same extent as arachidonic acid (20:4Δ


5,8,11,14


) (FIG.


12


). In these experiments, 55% of exogenously fed di-homo-γ-linolenic acid (20:3Δ


8,11,14


) was converted to arachidonic acid, while only 5%, 27%, and 26% of the 18:1, 20:3Δ


11,14


, and 20:2Δ


11,14,17


substrates were converted (FIG.


12


).




The fat-3 gene was expressed in the yeast expression vector pMK195 containing the constitutive ADH promoter. The FAT-3 protein was able to desaturate linoleic acid (18:2Δ


9,12


) into γ-linolenic acid (18:3Δ


6,9,12


), in agreement with published results (Napier et al.,


Biochem. J.


330:611-614, 1998). It was also found that FAT-3 was capable of desaturating α-linolenic acid (18.3Δ


9,12,15


) to 18.4


8,9,12,15


, a common reaction in animals. The FAT-3 protein showed no activity on 20:1Δ


11


, 20:2Δ


11,14, 20:3Δ




8,11,14


, or 20:3Δ


11,14,17


. Therefore, the substrate specificities of the


C. elegans


Δ


5


and Δ


6


-desaturases were determined to be specific and non-overlapping.




Example 13




Discussion of the


E. gracilis


Δ


8


-desaturase.




Desaturation at the Δ


8


-position has not been reported for any previously cloned gene (Tocher et al.,


Prog. Lipid Res.


37:73-117, 1998).




The predicted EFD1 protein has 33% amino acid identity with both FAT-3 and FAT-4, (FIG.


9


), while its identity with the cloned borage Δ


6


-desaturase is 28%. The highest sequence conservation is found in the His-box motifs which are critical for desaturase activity, most likely because they serve as the diiron-oxo component of the active site (Shanklin et al.,


Biochemistry


33:12787-12794, 1994). Sequence conservation is also evident in the N-terminal cytochrome b


5


-like domain, where most of the essential residues of cytochrome b


5


(Lederer,


Biochimie


76:674-692, 1994) that are retained in FAT-3 and FAT-4 are also present in the EFD1 protein (FIG.


3


).




Expression of the EFD1 gene in yeast was used to characterize its activity. Three different 20-carbon substrates with double bonds at the Δ


11


-position were desaturated (FIG.


4


), and analysis of the products indicated that, for each one, desaturation had taken place at the Δ


8


position (FIG.


5


). The cloned


Euglena


desaturase showed a clear preference for the substrates of metabolic significance with greater than two-fold preference for 20:2 and 20:3 over 20:1 (Ulsamer et al.,


J. Cell Biol.


43:105-114, 1969). Even though EFD1 is quite similar to other microsomal desaturases, its activity was specific, as evidenced by its inactivity on substrates for Δ


5


and Δ


6


desaturation (FIG.


12


).




The 20-carbon substrates for Δ


8


desaturation are available in abundance in heterotrophically grown


E gracilis


(FIG.


2


). These same substrates also are available in mammals; since 20:2 and 20:3 are produced by elongation from 18:2 and 18:3, in competition with the typical Δ


6


desaturation (FIG.


1


). Labeling experiments with rat liver homogenates indicate that elongation of the 18-carbon fatty acids is five-fold more rapid than the competing desaturation (Pawlosky et al.,


J. Lipid Res.


33:1711-1717, 1992).




Implicit in the current understanding of the Δ


6


pathway of 20-carbon polyunsaturated fatty acid biosynthesis is a reliance on alternating desaturation and elongation to control flux through the pathway. While elongation often appears to be non-specific, most desaturations are specific both as to chain length of the substrate and to existing desaturation pattern of the fatty acid (Heinz,


Lipid Metabolism in Plants


, pp. 33-89, 1993). However, data from experiments in mammalian tissue (Bernert and Sprecher,


Biochim. Biophys. Acta.


398:354-363, 1975; Albert et al.,


Lipids


14:498-500, 1979) and with yeast expressing the


C. elegans


Δ


5


-desaturase gene (FIG.


12


), indicate that Δ


5


enzymes desaturate fatty acids having a double bond at the Δ


11


-position but not at the Δ


8


-position, producing the non-methylene interrupted 20:3 and 20:4 compounds at significant rates. For the Δ


8


pathway, Δ


8


desaturation occurs in competition with Δ


5


activity on the substrates 20:2 and 20:3. In spite of this promiscuity of Δ


5


enzymes, lipid profiles of mammalian tissue do not contain fatty acids with the Δ


5,11


(Heinz,


Lipid Metabolism in Plants


, pp. 33-89, 1993; and Ulsamer et al.,


J. Cell Biol.


43:105-114, 1969) desaturation pattern, nor are they seen in


Euglena


.




One explanation may be that Δ


8


-desaturation of the common substrates occurs very rapidly, while Δ


5


-desaturation proceeds more slowly, so that little Δ


5,11


, product is formed. In support of this explanation, the


Euglena


Δ


8


appears to be a very active desaturase when expressed in yeast (FIG.


4


), compared to similarly expressed Δ


5


-desaturase enzymes. The


Euglena


desaturase must be sufficiently active to account for all the long chain polyunsaturates of rapidly growing


Euglena


cultures (FIG.


2


). In contrast, the observed rates of Δ


8


-desaturation in mammalian tissue are relatively slow. The highest apparent rate occurs in cancerous tissues without Δ


6


activity, where Δ


8


desaturation permits production of arachidonic acid at only 17% of the level of comparable normal cells with Δ


6


activity (Grammatikos et al.,


Br. J. Cancer


70:219-227, 1994).




Alternatively, the lack of Δ


5,11


unsaturated fatty acids in membranes could be explained if the Δ


8


desaturase accepts these fatty acids for desaturation. The convention that Δ


8


-desaturation precedes Δ


6


activity (

FIG. 1

) is based on observations of desaturation reactions proceeding sequentially along the fatty acid hydrocarbon chain. The reverse order of desaturation, with Δ


5


-saturation preceding Δ


8


-desaturation, has been claimed (Takagi,


J. Chem. Bull


. Japan 38:2055-2057, 1965) and rejected (Schlenk et al.,


Lipids


5:575-577, 1970) in mammalian liver, and proposed as a likely pathway based on experiments with deuterated substrates in glioma cells (Cook et al.,


J. Lipid Res.


32:1265-1273, 1991).




In


Euglena


the products of Δ


8


-desaturation, 20:3Δ


8,11,14


and 20:4Δ


8,11,14,17


, may be incorporated directly into membranes, or subjected to desaturation at the Δ


5


-position to produce arachidonic and eicosapentaenoic acids (Hulanicka et al.,


J. Biol. Chem.


239;2778-2787, 1964). Further elongation and desaturation leads to several polyunsaturated 22-carbon fatty acids (FIG.


2


). In mammals, whether the products are derived from Δ


8


or Δ


6


activity, similar processes produce mostly arachidonic, eicosapentaenoic, and docosahexaenoic acid (22:6 (Hwang,


Fatty Acids in Foods and Their Health Implications


, pp. 545-557, 1992; Bernert and Sprecher,


Biochim. Biophys. Acta


398:354-363, 1975; Lees and Kom,


Biochemistry


5:1475-1481, 1966; Albert and Coniglio,


Biochim. Biophys. Acta


489:390-396, 1977; Bardon et al.,


Cancer Lett.


99:51-58, 1996; and Sprecher and Lee,


Biochim.Biophys.Acta.


388:113-125,1975), although some 20:3 is metabolized directly to series 1 eicosanoid metabolic regulators (Hwang,


Fatty Acids in Foods and Their Health Implications


, pp. 545-557, 1992).




It is interesting to note that the alternate pathway of Δ


8


-desaturation begins with an elongation step. This elongation is the standard pathway in


Euglena


, which produces substantial amounts of 20:2 (7.4%) and 20:3 (1.4%) (FIG.


2


). In mammalian tissue with little or no Δ


6


activity (Grammatikos et al.,


Br. J. Cancer


70:219-227, 1994); this would be the first step by which the essential fatty acids 18:2 and 18:3 are metabolized to their 20-carbon derivatives. Recently there has been a new emphasis on fatty acid chain elongation acting as a regulatory step in fatty acid biosynthesis (Garcia et al.,


Lipids


25:211-215, 1990; Sprecher et al.,


Prostag. Leukot. Essent Fatty Acids


52:99-101, 1995). Evidence that breast cancer cells may selectively elongate 18:3 in preference to 18:2, and that Δ


8


-desaturation follows this elongation (Bardon et al.,


Cancer Left.


99:51-58, 1996) implies that Δ


8


-desaturation may play an important role in some cancer cells.




The identification and cloning of a Δ


8


-desaturase gene permit examinations of the alternate pathway for biosynthesis of 20-carbon polyunsaturated fatty acids and will give insight into the possible mechanisms of Δ


8


-desaturation. In mammals, operation of this alternative pathway may be confined to specialized tissues, where the demand for polyunsaturated fatty exceeds the supply provided through rate-limiting Δ


6


desaturation. The pathway may be of greater significance where Δ


6


-desaturation is reduced or absent Since fatty acid desaturase metabolism is perturbed in many cell lines, both transformed (Grammatikos et al.,


Ann. N.Y. Acad. Sci.


745:92-105, 1994) and untransformed (Rosenthal,


Prog. Lipid Res.


26:87-124, 1987), it may be that Δ


8


activity is only revealed in the absence of Δ


8


activity. Alternatively, Δ


8


activity may arise or increase with cell neoplasia. The isolation and examination of this Δ


8


gene, and analysis of its substrate specificity, should facilitate the determination of the role of Δ


8


activity in both normal and cancerous mammalian tissue.




Example 14




Discussion of the


C eleagans


Δ


5


-desaturase




In this example, we describe a region of the


C. elegans


genome located at position 4.88 of chromosome IV is described that contains the Δ


5


- and Δ


6


-desaturase genes. The amino acid sequences encoded by the two genes are 46% identical to each other, and each contains an N-terminal heme binding domain typical of the electron carrier cytochrome b


5


and three histidine boxes. Both genes contain the consensus sequence of the third His box (QXXHH; SEQ. ID NO. 11) that has so far been shown to be unique to the microsomal desaturases involved in double-bond insertion at carbons below position 9.




Despite these similarities, these two microsomal desaturases show absolutely non-overlapping substrate specificities. When overexpressed in the yeast


Saccharomyces cerevisiae


, the


C. elegans


Δ


6


-desaturase (FAT-3) specifically acts on two 18-carbon substrates, linoleic and γ-linolenic acid, and always desaturates in a methylene-interrupted pattern (one double bond every three carbons). The mammalian Δ


6


-desaturase system has likewise been demonstrated to insert double bonds strictly in a methylene-interrupted pattern and to have no activity on 20-carbon substrates (Schmitz et al.,


Lipids


12:307-313, 1997). The


C. elegans


Δ


5


-desaturase (FAT-4), in contrast, acts on a number of 20-carbon substrates, as well as on an endogenous 18:1 fatty acid of yeast, and is capable of inserting double bonds in a non-methylene interrupted pattern.




Non-methylene-interrupted fatty acids such as 20:2Δ


5,11


, 20:3Δ


5,11,14


, 18:2Δ


5,11


have been detected in mammalian cells by feeding


14


C-labeled substrates to rats raised on a fat-deficient diet (Ulman et al.,


Biochem. Biophys. Acta


248:186-197,1971). However, these fatty acids are considered to be “dead end” metabolites, as they have not been demonstrated to serve as precursors to signaling molecules such as prostaglandins, nor are they detectable in tissue lipids of rats who are not preconditioned on a fat-deficient diet (We also did not detect these fatty acids in


C. elegans


lipid extracts.)




In yeast expressing the


C. elegans


Δ


5


-desaturase gene, the amount of substrate converted was greatest for the metabolically significant substrate 20:3Δ


8,11,14


(FIG.


13


). The amount of 20:2


1,14


and 20:3Δ


11,14,17


that was desaturated less than half the amount of conventional substrate that was desaturated. This was consistent with the rates of desaturation in microsomal extracts of mammalian liver, where the rate of conversion of labeled 20:2Δ


11,14


to 20:3Δ


5,11,14


is 41% of the rate of conversion of labeled 20:3Δ


8,11,14


to 20:4Δ


5,8,11,14


(Bernet et al.,


Biochem. Biophys. Acta


398:354-313, 1975).




The


C. elegans


fat-3 and fat-4 genes are present in a gene cluster in the same 5′ to 3′ orientation. Yet, unlike other gene clusters of this sort in


C. elegans


, the downstream fat-3 gene is not transpliced to SL2, and therefore is unlikely to be co-transcribed with the upstream fat-4 gene. The two genes could be located next to each other as a result of an ancient gene-duplication event. The DNA sequences share 54% identity over the entire cDNA coding sequence; however the genes do not share any common intron/exon boundaries (FIG.


8


).




This is the first disclosed sequence of a Δ


5


-desaturase gene from an animal. The sequence of the


C. elegans






Δ


5


-desaturase is quite distant from the bacterial and fungal Δ


5


-desaturases that have been reported, and this-animal sequence should facilitate the search for desaturase-encoding sequences from humans and other mammals. Both the Δ


5


- and Δ


6


-desaturases are important regulatory enzymes in humans. They participate in critical steps in the pathway to produce precursors for synthesis of hormone-like eicosanoid molecules from the essential dietary fatty acids, linoleic acid and α-linolenic acid. The activities of these desaturases have been shown to be under hormonal and nutritional control, but the mechanism of this control is still unknown.




Certain diseases, such as diabetes, result in low Δ


5


-desaturase activity, while HTC cells, isolated from an ascites tumor derived from a solid hepatoma, show increased Δ


5


-desaturase activity. The availability of mutational and reverse genetic tools and the expanding knowledge of cellular and developmental biology in


C. elegans


make this an attractive system to study the roles of polyunsaturated fatty acids and their metabolic products in development, reproduction, and other cellular processes of animals.




Example 15




A Plant Cell Transformed with the Δ


5


and Δ


8


-desaturase Genes of the Invention




Using the methods described herein, Δ


5


- and Δ


8


-desaturases of the invention may be cloned and expressed in plants to produce plants with enhanced amounts of 20-carbon polyunsaturated fatty acids. Such plants provide an inexpensive and convenient source of these important fatty acids in a readily harvestable and edible form.




For instance, the Δ


5


- and Δ


8


-desaturases of the invention can be cloned into a common food crop, such as corn, wheat, potato, tomato, yams, apples, pears, or into oil-seed plants such as sunflower, rapeseed, soy, or peanut plants. The resulting plant would express the appropriate enzyme that would catalyze the formation of 20-carbon polyunsaturated fatty acids. In the case of an oilseed plant, the seed oil would be a rich source of 20-carbon polyunsaturated fatty acids.




The Δ


5


- and Δ


8


-desaturase genes may be cloned and expressed either individually, or together in a host plant cell. The corresponding desaturases can be expressed using a variety of different control sequences, such as promoters, enhancers, and 3′-termination sequences. These control sequences can be used to control the expression of each desaturase individually. For example, the Δ


5


-desaturase can be cloned such that it is under the control of a strong promoter, and the




Δ


8


-desaturase can be cloned such that it is under the control of a weak promoter, thus yielding a transgenic plant that expresses more Δ


5


-desaturase than Δ


8


-desatursse. Furthermore, expression can be controlled by operably linking one or more of the desaturase genes of interest to a promoter that is activated by exposure of the plant cell to an appropriate regulatory agent such as an inducer, repressor, de-repressor or inhibitor agent Such regulation is discussed above. Alternatively, expression of non-contiguous genes may be coordinated by linking the expression of a first gene with the expression of an inducer or de-repressor molecule that induces or de-represses the expression of a second gene.




The genes of the invention can be integrated into the genome of a plant (for example, by Agrobacterium-mediated




T-DNA transfer) or animal (for example, by use of broad host-range retroviruses, e.g., an adenovirus vector) so that the Δ


5


and Δ


8


-desaturases of the invention are expressed as part of the genome. For transgenic plants, the T-DNA vector may be used that would result in integration of transgenes (Δ


5


and/or Δ


8


) into the host cell genome.




For example, the expression of the Δ


5


and Δ


8


-desaturases in a plant, such as Arabidopsis, can be achieved by constructing a plant transformation vector to introduce the cDNA of each desaturase into the plant. The vector can contain a tissue specific promoter so that the desaturase protein will be expressed during seed development Examples of seed specific promoters include that for phaseolin (van der Geest and Hall,


Plant Mol. Biol.


32:579-88, 1996) or the promoter for napin (Stalberg et al.,


Plant Mol. Biol.


23: 671-83, 1993). Other seed-specific promoters that can be used are those located on the genomic BAC clone T24A1B (LOCUS ATT24A18. (1999) 45980 bp


Arabidopsis thaliana


DNA chromosome 4,ACCESSION # AL035680, NID g4490701) of the Arabidopsis genome. These promoters regulate seed storage protein expression in Arabidopsis. Other promoters which express genes specifically in seeds like those described in (Parcy et al.,


Plant Cell


6:1567-1582, 1994) can also be used. The constructs containing the desaturase coding sequence and promoter sequence can then transferred to standard plant transformation T-DNA vectors similar to pART27 (Gleave,


Plant Mol. Biol.


20:1203-1207, 1992), pGPTV (Becker et al.,


Plant Mol. Biol.


20:1195-7, 1992), or pJITi 19 (Guerineau et al.,


Plant Mol. Biol.


15:127-136, 1992). If the plant is to be transformed with two constructs, i.e. one encoding the Δ


8


-desaturase and the other encoding the Δ


5


-desaturase, then it is preferable to choose two different selectable markers so that only double transformants will regenerate. For example, the vector carrying the Δ


5


-desaturase can be constructed such that it contains the kanmycin (nptil) gene, and the vector carrying the Δ


8


-desaturase can be constructed such that it contains the phosphinothricin (bar) gene. Transformants are then selected on media containing kanmycin and phosphinothricin. Transformation of Arabidopsis is readily achieved using the Agrobacterium-mediated vacuum infiltration process (Katavic et al.,


Mol. Gen. Genet


245:363-70, 1994) or the floral dip modification of it (Clough and Bent,


Plant J.


16:735-43, 1998), although several other methods are also commonly used. Transgenic progeny will be identified by selection using the appropriate antibiotic or herbicide, either kanmycin or phosphinothricn, or both. Since the Δ


8


and Δ


5


constructs use different selectable markers the double transformants are readily isolated. Plants which survive the transgenic s lection are grown to maturity and their seed harvested. The seeds of transformed plants are analyzed by isolation of fatty acid methyl esters followed by gas chromatography to determine the fatty acid composition.




Plants expressing only the Δ


8


-desaturase will desaturate the 20:1Δ


11


fatty acid that occurs naturally in the Arabidopsis seed to 20:2Δ


8,11


. Seed harvested from plants doubly transformed with both desaturases will, in addition, convert the 20:2Δ


8,11


product of the Δ


8


-desaturase plants to 20:3Δ


5,8,11


as a result of the expression of the Δ


5


-desaturase. These changes will be easily detected by the fatty acid methyl ester analysis.




Example 16




A Yeast Cell Transformed With the Δ


5


- and Δ


8


-desaturase Genes of the Invention




The cDNA portion of pJW541 (Wallis and Browse,


Arch. Biochem. Biophys.


365:307-316, 1999) containing the


Euglena


Δ


8


-desaturase was excised from that plasmid with the restriction enzymes EcoRI and SpeI. The purified DNA fragment representing the insert was ligated into the yeast expression vector pYX232 (R&D Systems, Inc.) that had been prepared by digestion with EcoRI and NheI, to give compatible sticky ends. (Plasmid pYX232 carries the marker conferring yeast prototrophy for tryptophan (TRP1 mutation), and uses the triose phosphate isomerase (TPI) promoter for constitutive expression of the inserted DNA.) The resulting plasmid, pYX232-541, was introduced into the


Saccharomyces cerevisiae


strain already harboring the Δ


5


-desaturase (pYFAT4; Watts and Browse,


Arch. Biochem. Biophys.


362:175-182, 1999) plasmid that confers yeast prototrophy for uracil using a lithium acetate transformation procedure (Invitrogen). Transformants were selected simultaneously for uracil and tryptophan prototrophy. Selected colonies arising after the transformation were inoculated into yeast minimal medium that also lacked both uracil and tryptophan.




For analysis of activity, separate cultures were supplemented with one of three fatty acid substrates provided as sodium salts as described (Wallis and Browse,


Arch. Biochem. Biophys.


365:307-316,1999). After overnight culture at 28° C., the cultures were harvested by centrifugation and washed. Fatty acid methyl esters were prepared using the standard methods described in Miquel and Browse


J. Biol. Chem.


267:1502-1509, 1992.




Analysis by gas chromatography indicated that each substrate had been desaturated twice. The incorporation of the three substrates varied, with more unsaturated substrates becoming a greater part of the fatty add composition of the cells, as seen in other experiments (Wallis and Browse,


Arch. Biochem. Biophys.


365:307-316, 1999, and Watts and Browse,


Arch. Biochem. Biophys.


362:175-182, 1999. For the tri-unsaturated substrate 20:3Δ


11,14,17


, the 20-carbon fatty acid represented 37% of the total cellular fatty acid, for 20:2Δ


11,14


the 20-carbon fatty acid level 21%, and for 20:1Δ


11


the 20-carbon fatty acid level reached only 13%. However, the activities of the desaturases were substantially identical against all three substrates. Between 70 and 72% of the substrate was not converted, and 17 or 18% underwent a single desaturation by only one of the enzymes. However, for each substrate, between 11 and 13% of the substrate was desaturated by both enzymes acting in concert to produce a fatty acid with two double bonds more than in molecules of the supplied substrate.
















TABLE 2










Fatty




Uncon-





Doubly






Fatty acid




acid




verted




One added




desaturated






supplement




uptake*




substrate #




desaturation#




product #




























20:3




37




71




17




11




20:5






(11, 14, 17)








(5, 8, 11, 14, 17)






20:2




21




70




18




13




20:4






(11, 14)








(5, 8, 11, 14)






20:1




13




72




18




11




20:3






(11)








(5, 8, 11)











*as mass percent of whole cell fatty acids










#as mass percent of incorporated 20-carbon fatty acids













The foregoing embodiments and examples are provided only as examples and are in no way meant to limit the scope of the claimed invention.




It should be apparent to one skilled in the art that the invention described herein can be modified in arrangement and detail without departing from the scope or spirit of the invention. We claim all such modifications.




The references and publications referred to herein are hereby incorporated by reference.







16




1


1461


DNA


Caenorhabditis elegans



1
gaattttcaa tcctccttgg gtcccaccgc tgtgatatca aaatggtatt acgagagcaa 60
gagcatgagc cattcttcat taaaattgat ggaaaatggt gtcaaattga cgatgctgtc 120
ctgagatcac atccaggtgg tagtgcaatt actacctata aaaatatgga tgccactacc 180
gtattccaca cattccatac tggttctaaa gaagcgtatc aatggctgac agaattgaaa 240
aaagagtgcc ctacacaaga accagagatc ccagatatta aggatgaccc aatcaaagga 300
attgatgatg tgaacatggg aactttcaat atttctgaga aacgatctgc ccaaataaat 360
aaaagtttca ctgatctacg tatgcgagtt cgtgcagaag gacttatgga tggatctcct 420
ttgttctaca ttagaaaaat tcttgaaaca atcttcacaa ttctttttgc attctacctt 480
caataccaca catattatct tccatcagct attctaatgg gagttgcgtg gcaacaattg 540
ggatggttaa tccatgaatt cgcacatcat cagttgttca aaaacagata ctacaatgat 600
ttggccagct atttcgttgg aaacttttta caaggattct catctggtgg ttggaaagag 660
cagcacaatg tgcatcacgc agccacaaat gttgttggac gagacggaga tcttgattta 720
gtcccattct atgctacagt ggcagaacat ctcaacaatt attctcagga ttcatgggtt 780
atgactctat tcagatggca acatgttcat tggacattca tgttaccatt cctccgtctc 840
tcgtggcttc ttcagtcaat catttttgtt agtcagatgc caactcatta ttatgactat 900
tacagaaata ctgcgattta tgaacaggtt ggtctctctt tgcactgggc ttggtcattg 960
ggtcaattgt atttcctacc cgattggtca actagaataa tgttcttcct tgtttctcat 1020
cttgttggag gtttcctgct ctctcatgta gttactttca atcattattc agtggagaag 1080
tttgcattga gctcgaacat catgtcaaat tacgcttgtc ttcaaatcat gaccacaaga 1140
aatatgagac ctggaagatt cattgactgg ctttggggag gtcttaacta tcagattgag 1200
caccatcttt tcccaacgat gccacgacac aacttgaaca ctgttatgcc acttgttaag 1260
gagtttgcag cagcaaatgg tttaccatac atggtcgacg attatttcac aggattctgg 1320
cttgaaattg agcaattccg aaatattgca aatgttgctg ctaaattgac taaaaagatt 1380
gcctagatta cgattaatta atcaatttat tttcatgttc tattcgtgtg ttttaatatt 1440
ttccaaattt ttacctattc c 1461




2


447


PRT


Caenorhabditis elegans



2
Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp
1 5 10 15
Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly
20 25 30
Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe
35 40 45
His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu
50 55 60
Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys
65 70 75 80
Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn
85 90 95
Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu
100 105 110
Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe
115 120 125
Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe
130 135 140
Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly
145 150 155 160
Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His
165 170 175
Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val
180 185 190
Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His
195 200 205
Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu
210 215 220
Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr
225 230 235 240
Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His
245 250 255
Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser
260 265 270
Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg
275 280 285
Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp
290 295 300
Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met
305 310 315 320
Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val
325 330 335
Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn
340 345 350
Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met
355 360 365
Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln
370 375 380
Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr
385 390 395 400
Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr
405 410 415
Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe
420 425 430
Arg Asn Ile Ala Asn Val Ala Ala Lys Leu Thr Lys Lys Ile Ala
435 440 445




3


1281


DNA


Euglena gracilis



3
attttttttc gaaatgaagt caaagcgcca agcgcttccc cttacaattg atggaacaac 60
atatgatgtg tctgcctggg tcaatttcca ccctggtggt gcggaaatta tagagaatta 120
ccaaggaagg gatgccactg atgccttcat ggttatgcac tctcaagaag ccttcgacaa 180
gctcaagcgc atgcccaaaa tcaatcccag ttctgagttg ccaccccagg ctgcagtgaa 240
tgaagctcaa gaggatttcc ggaagctccg agaagagttg atcgcaactg gcatgtttga 300
tgcctccccc ctctggtact catacaaaat cagcaccaca ctgggccttg gagtgctggg 360
ttatttcctg atggttcagt atcagatgta tttcattggg gcagtgttgc ttgggatgca 420
ctatcaacag atgggctggc tttctcatga catttgccac caccagactt tcaagaaccg 480
gaactggaac aacctcgtgg gactggtatt tggcaatggt ctgcaaggtt tttccgtgac 540
atggtggaag gacagacaca atgcacatca ttcggcaacc aatgttcaag ggcacgaccc 600
tgatattgac aacctccccc tcttagcctg gtctgaggat gacgtcacac gggcgtcacc 660
gatttcccgc aagctcattc agttccagca gtattatttc ttggtcatct gtatcttgtt 720
gcggttcatt tggtgtttcc agagcgtgtt gaccgtgcgc agtctgaagg acagagataa 780
ccaattctat cgctctcagt ataagaagga ggccattggc ctcgccctgc attggacatt 840
gaaggccctg ttccacttat tctttatgcc cagcatcctc acatcgctgt tggtattttt 900
cgtttcggag ctggttggcg gcttcggcat tgcgatcgtg gtgttcatga accactaccc 960
actggagaag atcggggact cggtctggga tggccatgga ttctcggttg gccagatcca 1020
tgagaccatg aacattcggc gagggattat cacagattgg tttttcggag gcttgaacta 1080
ccagatcgag caccatttgt ggccgaccct ccctcgccac aacctgacag cggttagcta 1140
ccaggtggaa cagctgtgcc agaagcacaa cctgccgtat cggaacccgc tgccccatga 1200
agggttggtc atcctgctgc gctatctggc ggtgttcgcc cggatggcgg agaagcaacc 1260
cgccgggaag gctctataag g 1281




4


421


PRT


Euglena gracilis



4
Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr
1 5 10 15
Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile
20 25 30
Ile Glu Asn Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met
35 40 45
His Ser Gln Glu Ala Phe Asp Lys Leu Lys Arg Met Pro Lys Ile Asn
50 55 60
Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu Ala Gln Glu
65 70 75 80
Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp
85 90 95
Ala Ser Pro Leu Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu
100 105 110
Gly Val Leu Gly Tyr Phe Leu Met Val Gln Tyr Gln Met Tyr Phe Ile
115 120 125
Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp Leu Ser
130 135 140
His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn
145 150 155 160
Leu Val Gly Leu Val Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr
165 170 175
Trp Trp Lys Asp Arg His Asn Ala His His Ser Ala Thr Asn Val Gln
180 185 190
Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser Glu
195 200 205
Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe
210 215 220
Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp
225 230 235 240
Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg Asp Asn
245 250 255
Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala Leu
260 265 270
His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile
275 280 285
Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe
290 295 300
Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile
305 310 315 320
Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His
325 330 335
Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly
340 345 350
Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg
355 360 365
His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys
370 375 380
His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile
385 390 395 400
Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro
405 410 415
Ala Gly Lys Ala Leu
420




5


27


DNA


artificial sequence




PCR Primer





5
ggctggctga cncaygartt ytgycay 27




6


30


DNA


artificial sequence




PCR Primer





6
catcgttgga aanarrtgrt gytcdatytg 30




7


41


DNA


artificial sequence




PCR Primer





7
cccgggaagc ttctcgagga attttcaatc ctccttgggt c 41




8


34


DNA


artificial sequence




PCR Primer





8
cccgggtgga tccggaacat atcacacgaa acag 34




9


6


RNA


artificial sequence




Consensus sequence





9
aauaaa 6




10


20


DNA


artificial sequence




PCR Primer





10
tctgggatct ctggttcttg 20




11


9


RNA


artificial sequence




Consensus sequence





11
uuuuuuucg 9




12


5


PRT


artificial sequence




Consensus sequence





12
His Xaa Xaa His His
1 5




13


5


PRT


artificial sequence




Consensus sequence





13
Gln Xaa Xaa His His
1 5




14


443


PRT


Caenorhabditis elegans



14
Met Val Val Asp Lys Asn Ala Ser Gly Leu Arg Met Lys Val Asp Gly
1 5 10 15
Lys Trp Leu Tyr Leu Ser Glu Glu Leu Val Lys Lys His Pro Gly Gly
20 25 30
Ala Val Ile Glu Gln Tyr Arg Asn Ser Asp Ala Thr His Ile Phe His
35 40 45
Ala Phe His Glu Gly Ser Ser Gln Ala Tyr Lys Gln Leu Asp Leu Leu
50 55 60
Lys Lys His Gly Glu His Asp Glu Phe Leu Glu Lys Gln Leu Glu Lys
65 70 75 80
Arg Leu Asp Lys Val Asp Ile Asn Val Ser Ala Tyr Asp Val Ser Val
85 90 95
Ala Gln Glu Lys Lys Met Val Glu Ser Phe Glu Lys Leu Arg Gln Lys
100 105 110
Leu His Asp Asp Gly Leu Met Lys Ala Asn Glu Thr Tyr Phe Leu Phe
115 120 125
Lys Ala Ile Ser Thr Leu Ser Ile Met Ala Phe Ala Phe Tyr Leu Gln
130 135 140
Tyr Leu Gly Trp Tyr Ile Thr Ser Ala Cys Leu Leu Ala Leu Ala Trp
145 150 155 160
Gln Gln Phe Gly Trp Leu Thr His Glu Phe Cys His Gln Gln Pro Thr
165 170 175
Lys Asn Arg Pro Leu Asn Asp Thr Ile Ser Leu Phe Phe Gly Asn Phe
180 185 190
Leu Gln Gly Phe Ser Arg Asp Trp Trp Lys Asp Lys His Asn Thr His
195 200 205
His Ala Ala Thr Asn Val Ile Asp His Asp Gly Asp Ile Asp Leu Ala
210 215 220
Pro Leu Phe Ala Phe Ile Pro Gly Asp Leu Cys Lys Tyr Lys Ala Ser
225 230 235 240
Phe Glu Lys Ala Ile Leu Lys Ile Val Pro Tyr Gln His Leu Tyr Phe
245 250 255
Thr Ala Met Leu Pro Met Leu Arg Phe Ser Trp Thr Gly Gln Ser Val
260 265 270
Gln Trp Val Phe Lys Glu Asn Gln Met Glu Tyr Lys Val Tyr Gln Arg
275 280 285
Asn Ala Phe Trp Glu Gln Ala Thr Ile Val Gly His Trp Ala Trp Val
290 295 300
Phe Tyr Gln Leu Phe Leu Leu Pro Thr Trp Pro Leu Arg Val Ala Tyr
305 310 315 320
Phe Ile Ile Ser Gln Met Gly Gly Gly Leu Leu Ile Ala His Val Val
325 330 335
Thr Phe Asn His Asn Ser Val Asp Lys Tyr Pro Ala Asn Ser Arg Ile
340 345 350
Leu Asn Asn Phe Ala Ala Leu Gln Ile Leu Thr Thr Arg Asn Met Thr
355 360 365
Pro Ser Pro Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln Ile
370 375 380
Glu His His Leu Phe Pro Thr Met Pro Arg Cys Asn Leu Asn Ala Cys
385 390 395 400
Met Lys Tyr Val Lys Glu Trp Cys Lys Glu Asn Asn Leu Pro Tyr Leu
405 410 415
Val Asp Asp Tyr Phe Asp Gly Tyr Ala Met Asn Leu Gln Gln Leu Lys
420 425 430
Asn Met Ala Glu His Ile Gln Ala Lys Ala Ala
435 440




15


448


PRT


Borago officinalis



15
Met Ala Ala Gln Ile Lys Lys Tyr Ile Thr Ser Asp Glu Leu Lys Asn
1 5 10 15
His Asp Lys Pro Gly Asp Leu Trp Ile Ser Ile Gln Gly Lys Ala Tyr
20 25 30
Asp Val Ser Asp Trp Val Lys Asp His Pro Gly Gly Ser Phe Pro Leu
35 40 45
Lys Ser Leu Ala Gly Gln Glu Val Thr Asp Ala Phe Val Ala Phe His
50 55 60
Pro Ala Ser Thr Trp Lys Asn Leu Asp Lys Phe Phe Thr Gly Tyr Tyr
65 70 75 80
Leu Lys Asp Tyr Ser Val Ser Glu Val Ser Lys Asp Tyr Arg Lys Leu
85 90 95
Val Phe Glu Phe Ser Lys Met Gly Leu Tyr Asp Lys Lys Gly His Ile
100 105 110
Met Phe Ala Thr Leu Cys Phe Ile Ala Met Leu Phe Ala Met Ser Val
115 120 125
Tyr Gly Val Leu Phe Cys Glu Gly Val Leu Val His Leu Phe Ser Gly
130 135 140
Cys Leu Met Gly Phe Leu Trp Ile Gln Ser Gly Trp Ile Gly His Asp
145 150 155 160
Ala Gly His Tyr Met Val Val Ser Asp Ser Arg Leu Asn Lys Phe Met
165 170 175
Gly Ile Phe Ala Ala Asn Cys Leu Ser Gly Ile Ser Ile Gly Trp Trp
180 185 190
Lys Trp Asn His Asn Ala His His Ile Ala Cys Asn Ser Leu Glu Tyr
195 200 205
Asp Pro Asp Leu Gln Tyr Ile Pro Phe Leu Val Val Ser Ser Lys Phe
210 215 220
Phe Gly Ser Leu Thr Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp
225 230 235 240
Ser Leu Ser Arg Phe Phe Val Ser Tyr Gln His Trp Thr Phe Tyr Pro
245 250 255
Ile Met Cys Ala Ala Arg Leu Asn Met Tyr Val Gln Ser Leu Ile Met
260 265 270
Leu Leu Thr Lys Arg Asn Val Ser Tyr Arg Ala His Glu Leu Leu Gly
275 280 285
Cys Leu Val Phe Ser Ile Trp Tyr Pro Leu Leu Val Ser Cys Leu Pro
290 295 300
Asn Trp Gly Glu Arg Ile Met Phe Val Ile Ala Ser Leu Ser Val Thr
305 310 315 320
Gly Met Gln Gln Val Gln Phe Ser Leu Asn His Phe Ser Ser Ser Val
325 330 335
Tyr Val Gly Lys Pro Lys Gly Asn Asn Trp Phe Glu Lys Gln Thr Asp
340 345 350
Gly Thr Leu Asp Ile Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly
355 360 365
Gly Leu Gln Phe Gln Ile Glu His His Leu Phe Pro Lys Met Pro Arg
370 375 380
Cys Asn Leu Arg Lys Ile Ser Pro Tyr Val Ile Glu Leu Cys Lys Lys
385 390 395 400
His Asn Leu Pro Tyr Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met
405 410 415
Thr Leu Arg Thr Leu Arg Asn Thr Ala Leu Gln Ala Arg Asp Ile Thr
420 425 430
Lys Pro Leu Pro Lys Asn Leu Val Trp Glu Ala Leu His Thr His Gly
435 440 445




16


449


PRT


Mortierella alpina



16
Met Gly Thr Asp Gln Gly Lys Thr Phe Thr Trp Glu Glu Ile Ala Ala
1 5 10 15
His Asn Thr Lys Gly Asp Ile Phe Leu Ala Ile Thr Gly Arg Val Tyr
20 25 30
Asp Val Thr Lys Phe Leu Ser Arg His Pro Gly Gly Val Asp Thr Ile
35 40 45
Leu Leu Gly Ala Gly Arg Asp Val Thr Pro Val Phe Glu Met Tyr His
50 55 60
Ala Phe Gly Ala Ala Asp Ala Ile Met Lys Lys Tyr Tyr Val Gly Thr
65 70 75 80
Leu Val Ser Asn Phe Leu Pro Val Phe Pro Glu Pro Thr Val Phe His
85 90 95
Lys Thr Leu Lys Thr Arg Val Glu Gly Tyr Phe Thr Asp Arg Asp Ile
100 105 110
Asp Pro Lys Asn Arg Pro Glu Thr Trp Gly Arg Tyr Ala Leu Ile Phe
115 120 125
Gly Ser Leu Ile Ala Ser Tyr Tyr Ala Gln Leu Glu Val Val Glu Arg
130 135 140
Thr Trp Leu Gln Val Val Phe Ala Ile Ile Met Gly Phe Ala Cys Ala
145 150 155 160
Gln Val Gly Leu Asn Pro Leu His Asp Ala Ser His Pro Asp Val Thr
165 170 175
His Asn Pro Thr Val Trp Lys Thr Leu Gly Ala Thr His Asp Phe Asp
180 185 190
Asn Gly Ala Ser Tyr Leu Val Trp Met Tyr Gln His Met Leu Gly His
195 200 205
His Pro Tyr Thr Asn Ile Ala Gly Ala Asp Pro Asp Val Ser Thr Glu
210 215 220
Glu Pro Asp Val Arg Thr Lys Arg Asn Gln Lys Trp Phe Val Asn His
225 230 235 240
Ile Asn Gln Asp Met Phe Val Pro Phe Leu Tyr Gly Leu Leu Ala Phe
245 250 255
Lys Val Arg Ile Gln Asp Ile Asn Ile Ile Tyr Phe Val Lys Thr Asn
260 265 270
Asp Ala Ile Arg Val Asn Pro Ile Ser Thr Trp His Thr Val Met Phe
275 280 285
Trp Gly Gly Lys Ala Phe Phe Val Tyr Arg Leu Ile Val Pro Leu Gln
290 295 300
Tyr Leu Pro Leu Gly Lys Val Ile Leu Leu Glu Thr Val Ala Asp Met
305 310 315 320
Val Ser Ser Tyr Trp Leu Ala Leu Thr Phe Gln Ala Asn His Val Met
325 330 335
Glu Glu Val Gln Trp Pro Leu Pro Asp Glu Asn Gly Ile Ile Gln Lys
340 345 350
Asp Trp Ala Ala Met Gln Val Glu Thr Thr Gln Asp Tyr Ala His Asp
355 360 365
Ser His Leu Trp Thr Ser Ile Thr Gly Ser Leu Asn Tyr Gln Ala Val
370 375 380
His His Leu Phe Pro Asn Val Ser Gln His His Thr Pro Asn Val Ser
385 390 395 400
Gln His His Tyr Pro Asp Ile Leu Ala Ile Ile Lys Asn Thr Gln Ser
405 410 415
Ser Tyr Lys Val Pro Tyr Leu Val Lys Asp Thr Phe Trp Gln Ala Gly
420 425 430
Ala Ser His Leu Glu His Leu Arg Val Leu Gly Ile Arg Pro Lys Glu
435 440 445
Glu






Claims
  • 1. A purified protein having Δ8 fatty acid desaturase activity, and comprising an amino acid sequence selected from the group consisting of:(a) an amino acid sequence as shown in SEQ ID NO: 4; (b) an amino acid sequence that differs from that specified in (a) by one or more conservative amino acid substitutions; and (c) an amino acid sequences having at least 95% sequence identity to the sequences specified in (a) or (b).
  • 2. An isolated nucleic acid molecule encoding a protein according to claim 1.
  • 3. The isolated nucleic acid molecule of claim 2, comprising a sequence as shown in SEQ ID NO: 3.
  • 4. A recombinant nucleic acid molecule, comprising a control sequence operably linked to the nucleic acid sequence of claim 2.
  • 5. A cell transformed with the recombinant nucleic acid molecule of claim 4.
  • 6. A cell transformed with the recombinant nucleic acid molecule of claim 4 and a nucleic acid molecule that encodes a protein having Δ5 fatty acid desaturase activity, selected from the group consisting of:(a) a nucleic acid molecule as shown in SEQ ID NO: 1; and (b) a nucleic acid molecule that has at least 95% sequence identity to the nucleic acid molecule shown in (a).
  • 7. The cell of claim 5, wherein the cell is a plant cell.
  • 8. An isolated nucleic acid molecule that:(a) hybridizes under high-stringency conditions with a nucleic acid probe, the probe comprising a sequence as shown in SEQ ID NO: 3; and (b) encodes a protein having Δ8 fatty acid desaturase activity.
  • 9. An isolated or recombinant Δ8 fatty acid desaturase encoded by the nucleic acid molecule of claim 8.
  • 10. A recombinant nucleic acid molecule, comprising a promoter sequence operably linked to the nucleic acid molecule of claim 8.
  • 11. A cell transformed with the recombinant nucleic acid molecule of claim 10.
  • 12. An isolated nucleic acid molecule that:(a) has at least 95% sequence identity with a nucleic acid sequence as shown in SEQ ID NO: 3; and (b) encodes a protein having Δ8 fatty acid desaturase activity.
  • 13. The isolated nucleic acid molecule of claim 8, wherein the nucleic acid molecule hybridizes under very high-stringency conditions with said nucleic acid probe.
  • 14. An isolated or recombinant Δ8 fatty acid desaturase encoded by the nucleic acid molecule of claim 13.
  • 15. A recombinant nucleic acid molecule, comprising a promoter sequence operably linked to the nucleic acid molecule of claim 13.
  • 16. A cell transformed with the recombinant nucleic acid molecule of claim 15.
  • 17. The cell of claim 16, wherein the cell is a plant cell.
  • 18. A recombinant nucleic acid molecule, comprising a control sequence operably linked to the nucleic acid sequence of claim 3.
  • 19. A cell transformed with the recombinant nucleic acid molecule of claim 18.
  • 20. A cell transformed with the recombinant nucleic acid molecule of claim 18 and a nucleic acid molecule that encodes a protein having Δ5 fatty acid desaturase activity, selected from the group consisting of:(a) a nucleic acid molecule as shown in SEQ ID NO: 1; and (b) a nucleic acid molecule that has at least 95% sequence identity to the nucleic acid molecule shown in (a).
  • 21. The cell of claim 20, wherein the cell is a plant cell.
  • 22. The cell of claim 21, wherein the cell is a plant cell.
  • 23. The cell of claim 6, wherein the cell is a plant cell.
  • 24. A cell transformed with the recombinant nucleic acid molecule of claim 10 and a nucleic acid molecule that encodes a protein having Δ5 fatty acid desaturase activity, selected from the group consisting of:(a) a nucleic acid molecule as shown in SEQ ID NO: 1; and (b) a nucleic acid molecule that has at least 95% sequence identity to the nucleic acid molecule shown in (a).
  • 25. The cell of claim 11, wherein the cell is a plant cell.
  • 26. The cell of claim 21, wherein the cell is a plant cell.
CROSS REFERENCE TO RELATED APPLICATIONS

This is the National Stage of International Application No. PCT/US99/28655, filed Dec. 6, 1999, and claims the benefit of U.S. Provisional Application No. 60/111,301, filed Dec. 7, 1998. The provisional application is incorporated herein in its entirety.

STATEMENT OF GOVERNMENTAL INTEREST

This work was supported by funds from the U.S. Department of Agriculture under NRICGP contract numbers 95-37301-2287 and 97-35301-4426. The government may have certain rights in this invention.

PCT Information
Filing Document Filing Date Country Kind
PCT/US99/28655 WO 00
Publishing Document Publishing Date Country Kind
WO00/34439 6/15/2000 WO A
US Referenced Citations (3)
Number Name Date Kind
5057419 Martin et al. Oct 1991 A
6051754 Knutzon Apr 2000 A
6051755 Zou et al. Apr 2000 A
Foreign Referenced Citations (3)
Number Date Country
WO 9621022 Jul 1996 WO
WO 9845461 Oct 1998 WO
WO 9846764 Oct 1998 WO
Non-Patent Literature Citations (1)
Entry
Michaelson et al., “Functional identification of a fatty acids Δ5 desaturase gene from Caenorhabditis elegans,” FEBS Letters 439:215-218, 1998.
Provisional Applications (1)
Number Date Country
60/111301 Dec 1998 US