This disclosure relates to methods of amplifying enterovirus (EV) nucleic acid molecules and to methods of detecting an EV infection in a subject.
Enteroviruses (EVs) (genus Enterovirus, family Picornaviridae) constitute a broad range of pathogens etiologically responsible for a wide range of diseases in both humans and in other animals. Enteroviruses are small RNA viruses that contain positive, single stranded RNA as the genome. Five groups are found within the enteroviruses: coxsackievirus A, coxsackievirus B, echovirus, poliovirus, and the numbered enteroviruses. Most EV infections are asymptomatic or result in only mild symptoms, such as non-specific febrile illness or mild upper respiratory symptoms (for example, the common cold). However, enteroviruses can also cause a wide variety of other clinical illnesses, including acute hemorrhagic conjunctivitis, aseptic meningitis, undifferentiated rash, acute flaccid paralysis, myocarditis, and neonatal sepsis-like disease.
Molecular diagnostic tests to detect EV in clinical specimens usually target highly conserved sites in the 5′ non-translated region (5′-NTR), allowing detection of all members of the genus (Romero, J. R., Arch. Path. & Lab. Med. 123:1161-69, 1999). These tests are genus-specific and provide an EV-positive or EV-negative result but cannot be used to identify the serotype.
Molecular diagnostic tests that target the EV VP1 capsid gene, which correlates with serotype determined by antigenic methods (Oberste et al., J. Virol. 73:1941-48, 1999), can provide both virus detection and identification (Oberste et al., J. Clin. Microbiol. 38:1170-74, 2000 and Oberste et al., J. Clin. Virol. 26:375-77, 2003). However, the identification of serotype, particularly from clinical specimens, is problematic because the virus titer is very low in original specimens. As a result, non-specific amplification can out-compete virus-specific amplification. Additionally, highly degenerate, inosine-containing primers used in diagnostic tests to broaden specificity to include all serotypes (Casas et al., J. Med. Virol. 65:138-48, 2001) often result in non-specific amplification of host cell nucleic acids that obscure the virus-specific product (Rose et al., Nucl. Acids. Res. 26:1628-35, 1998). To overcome these limitations additional molecular diagnostic methods are needed.
Methods that allow the detection and identification of EVs have been developed and are described herein. The methods include detecting the presence of an EV amplicon containing at least a portion of the EV VP1 encoding sequence and sequencing the EV amplicon, and permit the diagnosis and identification of the EV serotype involved in a enterovirus infection. The provided methods are useful in detecting the presence of an EV in a sample and/or diagnosing an EV infection in a subject.
This disclosure also provides isolated nucleic acid molecules, which nucleic acid molecules have a nucleotide sequence as set forth in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14. In disclosed examples, these nucleic acid molecules are EV-specific primers for the detection and identification of EV infection. Also described herein are kits that include one or more nucleic acid cDNA primers that hybridize to an EV VP1 encoding sequence, a first PCR nucleic acid primer pair, wherein the first forward PCR primer hybridizes to an EV VP3 encoding sequence and the first reverse PCR primer hybridizes to an EV VP1 sequence, and a second PCR nucleic acid primer pair, wherein both the second forward and reverse PCR primers hybridize to an EV VP1 encoding sequence.
The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NOs: 1-4 show the nucleic acid sequence of several EV-specific reverse oligonucleotide primers for cDNA synthesis.
SEQ ID NOs: 5-14 show the nucleic acid sequence of several EV-specific oligonucleotide primers (forward and reverse) for DNA amplification.
SEQ ID NO: 15 shows the nucleic acid sequence of the non-degenerate “clamp” portion of primer AN89.
SEQ ID NO: 16 shows the nucleic acid sequence of the non-degenerate “clamp” portion of primer AN88.
SEQ ID NOs: 17 and 18 show the nucleic acid sequence of a pair of EV-specific oligonucleotide primers (sense and antisense) for generation of a synthetic RNA standard.
SEQ ID NOs: 19-32 show the amino acid sequence of several conserved amino acid sequences from which EV-specific oligonucleotide primers were derived by back-translation.
I. Abbreviations
BAL: bronchoalveolar lavage
° C.: degrees Celsius
cDNA: complementary DNA
CSF: cerebrospinal fluid
DTT: dithiothreitol
ES: eye (conjunctival) swab
EV: enterovirus
g: gram
min: minute(s)
ml: milliliter
NPS: nasopharyngeal swab
PCR: polymerase chain reaction
RS: rectal swab
RT-snPCR: reverse transcription semi-nested polymerase chain reaction
μg: microgram(s)
μl: microliter(s)
s: second(s)
II. Terms
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and other similar references.
In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided:
Amplification of or amplifying a nucleic acid sequence: Increasing the amount of (number of copies of) a nucleic acid sequence, wherein the increased sequence is the same as or complementary to the existing nucleic acid template. The resulting amplification products are called “amplicons.” An example of amplification is the polymerase chain reaction (PCR). Other examples of amplification techniques include reverse-transcription PCR (RT-PCR), semi-nested RT-PCR (RT-snPCR), strand displacement amplification (see U.S. Pat. No. 5,744,311), transcription-free isothermal amplification (see U.S. Pat. No. 6,033,881), repair chain reaction amplification (see WO 90/01069), ligase chain reaction amplification (see EP-A-320 308), gap filling ligase chain reaction amplification (see U.S. Pat. No. 5,427,930), coupled ligase detection and PCR (see U.S. Pat. No. 6,027,889), and NASBA™ RNA transcription-free amplification (see U.S. Pat. No. 6,025,134).
The products of amplification may be characterized by, for instance, electrophoresis, restriction endonuclease cleavage patterns, hybridization, ligation, and/or nucleic acid sequencing, using standard techniques.
Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects, for example, humans, non-human primates, dogs, cats, horses, and cows.
Antisense and sense: Double-stranded DNA (dsDNA) has two strands, a 5′ to 3′ strand, referred to as the plus strand, and a 3′ to 5′ strand, referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5′ to 3′ direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand, and identical to the plus strand (except that the base uracil is substituted for thymine).
Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA.
Detect: To determine the existence or presence of something. For example, to determine whether an enterovirus or an EV nucleic acid sequence is present in a sample (such as a biological sample), or to determine if an amplicon is present following amplification.
Electrophoresis: Electrophoresis refers to the migration of charged solutes or particles in a liquid medium under the influence of an electric field. Electrophoretic separations are widely used for analysis of macromolecules. Of particular importance is the identification of proteins and nucleic acid sequences. Such separations can be based on differences in size and/or charge. Nucleotide sequences have a uniform charge and are therefore separated based on differences in size. Electrophoresis can be performed in an unsupported liquid medium, but more commonly the liquid medium travels through a solid supporting medium. The most widely used supporting media are gels, such as, polyacrylamide and agarose gels (used, for example, in capillary gel electrophoresis and slab gel electrophoresis).
Sieving gels (for example, agarose) impede the flow of molecules. The pore size of the gel determines the size of a molecule that can flow freely through the gel. The amount of time to travel through the gel increases as the size of the molecule increases. As a result, small molecules travel through the gel more quickly than large molecules and thus progress further from the sample application area than larger molecules, in a given time period. Such gels are used for size-based separations of nucleotide sequences.
Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log10 of their molecular weight. By using gels with different concentrations of agarose, different sizes of DNA fragments can be resolved. Higher concentrations of agarose facilitate separation of small DNAs, while low agarose concentrations allow resolution of larger DNAs.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. “Complementary” refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
“Specifically hybridizable,” “specifically hybridizes” and “specifically complementary” are terms which indicate a sufficient degree of complementarity such that stable and specific binding occurs between an oligonucleotide and its DNA or RNA target. An oligonucleotide need not be 100% complementary to its target DNA or RNA sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, or under conditions in which an assay is performed.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ and/or Mg++ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9 and 11; and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
The following is an exemplary set of hybridization conditions for PCR and is not meant to be limiting:
Isolated or purified: An “isolated” or “purified” biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been “isolated” thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids or proteins.
The term “isolated” or “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell. Preferably, a preparation is purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater of the total biological component content of the preparation.
Label: A detectable compound or composition that is conjugated or otherwise attached directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non-limiting examples of labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent markers or dyes, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
Nucleic acid sequence (or polynucleotide): A deoxyribonucleotide or ribonucleotide polymer in either single or double stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides, and includes polynucleotides encoding full length proteins and/or fragments of such full length proteins which can function as a therapeutic agent. A polynucleotide is generally a linear nucleotide sequence, including sequences of greater than 100 nucleotide bases in length. In one embodiment, a nucleic acid is labeled (for example, biotinylated, fluorescently labeled or radiolabled nucleotides).
Nucleotide: “Nucleotide” includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in an oligonucleotide/polynucleotide. A nucleotide sequence refers to the sequence of bases in an oligonucleotide/polynucleotide.
The major nucleotides of DNA are deoxyadenosine 5′-triphosphate (dATP or A), deoxyguanosine 5′-triphosphate (dGTP or G), deoxycytidine 5′-triphosphate (dCTP or C) and deoxythymidine 5′-triphosphate (dTTP or T). The major nucleotides of RNA are adenosine 5′-triphosphate (ATP or A), guanosine 5′-triphosphate (GTP or G), cytidine 5′-triphosphate (CTP or C) and uridine 5′-triphosphate (UTP or U). Inosine is also a base that can be integrated into DNA or RNA in a nucleotide (dITP or ITP, respectively).
Oligonucleotide: A nucleic acid molecule generally comprising a length of 300 bases or fewer. The term often refers to single-stranded deoxyribonucleotides, but it can refer as well to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others. The term “oligonucleotide” also includes oligonucleosides, that is, an oligonucleotide minus the phosphate. In some examples, oligonucleotides are about 7 to about 50 bases in length, for example, 8, 9, 10, 15, 20, 25, 30, or 35 bases in length. Other oligonucleotides are about 40 or about 45 bases in length.
Oligonucleotides may be single-stranded, for example, for use as probes or primers, or may be double-stranded, for example, for use in the construction of a mutant gene. Oligonucleotides can be either sense or antisense oligonucleotides. An oligonucleotide can be modified as discussed herein in reference to nucleic acid molecules. Oligonucleotides can be obtained from existing nucleic acid sources (for example, genomic or cDNA), but can also be synthetic (for example, produced by laboratory or in vitro oligonucleotide synthesis).
Polypeptide: A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used. The terms “polypeptide” or “protein” as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins. The term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced. The term “residue” or “amino acid residue” includes reference to an amino acid that is incorporated into a peptide, polypeptide, or protein.
Primers and probes: Primers are short nucleic acid molecules, for instance DNA oligonucleotides 7 nucleotides or more in length, for example that hybridize to contiguous complementary nucleotides or a sequence to be amplified. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs (that is, forward/sense and reverse/antisense) can be used for amplification of a nucleic acid sequence, for example, by the PCR or other nucleic-acid amplification methods known in the art.
A probe includes an isolated nucleic acid sequence attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
Methods for preparing and using nucleic acid primers and probes are described, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999; and Innis et al. PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif., 1990. Amplification primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 25, 30, 35, 40, 45, 50, 75, 90 or more consecutive nucleotides of a target nucleotide sequence.
Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques.
Sample: A portion, piece, or segment that is representative of the whole from which the sample is obtained. This term encompasses any material, including for instance samples obtained from an animal, a plant, or the environment.
An “environmental sample” includes a sample obtained from inanimate objects or reservoirs within an indoor or outdoor environment. Environmental samples include, but are not limited to: soil, water, dust, and air samples; bulk samples, including building materials, furniture, and landfill contents; and other reservoir samples, such as animal refuse, harvested grains, and foodstuffs. It is to be understood that environmental samples can and often do contain biological components.
A “biological sample” is a sample obtained from a subject, and may also be referred to as a “clinical specimen.” As used herein, a biological sample includes all samples useful for detection of enterovirus infection in subjects, including, but not limited to: cells, tissues, and bodily fluids, such as blood; derivatives and fractions of blood (such as serum); extracted galls; biopsied or surgically removed tissue, including tissues that are, for example, unfixed, frozen, fixed in formalin and/or embedded in paraffin; tears; milk; skin scrapes; surface washings; oropharyngeal wash; urine; sputum; cerebrospinal fluid; prostate fluid; semen; pus; bone marrow aspirates; bronchoalveolar lavage (BAL); saliva; nasopharyngeal swabs, eye swabs, cervical swabs, vaginal swabs, and rectal swabs; and stool and stool suspensions.
As used herein, the singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Also, as used herein, the term “comprises” means “includes.” Hence “comprising A or B” means including A, B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
III. Overview of Several Embodiments
Provided herein are isolated nucleic acid molecules, which nucleic acid molecules have a nucleotide sequence as set forth in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14. In certain embodiments, these nucleic acid molecules are EV-specific primers for the detection and identification of EV infection.
Also provided herein in various embodiments is a method of detecting an EV RNA sequence in a sample. In one embodiment, the method includes (i) contacting the sample with one or more nucleic acid cDNA primers that hybridize to an EV VP1 encoding sequence, (ii) reverse transcribing EV cDNA from the EV RNA sequence, (iii) amplifying at least a portion of the EV cDNA using a first nucleic acid primer pair, wherein the first forward primer hybridizes to an EV VP3 encoding sequence and the first reverse primer hybridizes to an EV VP1 encoding sequence, thereby generating an EV amplicon, (iv) amplifying at least a portion of the EV amplicon using a second nucleic acid primer pair, wherein both the second forward and reverse primers hybridize to an EV VP1 encoding sequence, and (v) determining whether an amplified EV amplicon is present, thereby detecting an EV nucleic acid sequence in the sample.
In a specific, non-limiting example of the provided method, the amplification includes a polymerase chain reaction amplification. In another specific, non-limiting example, determining whether an amplified EV amplicon is present includes gel electrophoresis and visualization of the amplified EV amplicon, capillary electrophoresis and detection of the amplified EV amplicon, and/or hybridization of a labeled probe to the amplified EV amplicon. In yet another specific, non-limiting example of the provided method, the one or more nucleic acid cDNA primers include a sequence as set forth in any one of SEQ ID NOs: 1-4, the first forward primer includes a sequence as set forth in SEQ ID NO: 5, the first reverse primer includes a sequence as set forth in SEQ ID NO: 6, the second forward primer includes a sequence as set forth in any one of SEQ ID NOs: 7-11 and 13, and the second reverse primer includes a sequence as set forth in any one of SEQ ID NOs: 6, 12 and 14.
In a further specific example of the provided method, the method includes extracting EV RNA from the sample. In yet a further specific example of the provided method, the method includes electrophoresing and sequencing at least a portion of the amplified EV amplicon, wherein the method of detecting an EV RNA sequence in a sample includes a method of identifying the EV in the sample.
A method of detecting an EV in a biological sample is also described herein. This method includes (i) extracting EV RNA contained in the sample, (ii) contacting the EV RNA with one or more nucleic acid cDNA primers that hybridize to an EV VP1 encoding sequence (iii) reverse transcribing EV cDNA from the EV RNA, (iv) amplifying at least a portion of the EV cDNA using a first nucleic acid primer pair, wherein the first forward primer hybridizes to an EV VP3 encoding sequence and the first reverse primer hybridizes to an EV VP1 encoding sequence, thereby generating an EV amplicon, (v) amplifying at least a portion of the EV amplicon using a second nucleic acid primer pair, wherein both the second forward and reverse primers hybridize to an EV VP1 encoding sequence, and (vi) determining whether an amplified EV amplicon is present, thereby detecting an EV in the biological sample.
In a specific, non-limiting example of the provided method, the amplification includes a polymerase chain reaction amplification. In another specific, non-limiting example, determining whether an amplified EV amplicon is present includes gel electrophoresis and visualization of the amplified EV amplicon, capillary electrophoresis and detection of the amplified EV amplicon, and/or hybridization of a labeled probe to the amplified EV amplicon. In yet another specific, non-limiting example of the provided method, the one or more nucleic acid cDNA primers include a sequence as set forth in any one of SEQ ID NOs: 1-4, the first forward primer includes a sequence as set forth in SEQ ID NO: 5, the first reverse primer includes a sequence as set forth in SEQ ID NO: 6, the second forward primer includes a sequence as set forth in any one of SEQ ID NOs: 7-11 and 13, and the second reverse primer includes a sequence as set forth in any one of SEQ ID NOs: 6, 12 and 14.
In yet a further specific example of the provided method, the method includes electrophoresing and sequencing at least a portion of the amplified EV amplicon, wherein the method of detecting an EV in a biological sample includes a method of identifying the EV in the sample. In another specific, non-limiting example, the biological sample contains free EV particles and/or EV infected cells.
Kits are also disclosed herein that include one or more nucleic acid cDNA primers that hybridize to an EV VP1 encoding sequence, a first PCR nucleic acid primer pair, wherein the first forward PCR primer hybridizes to an EV VP3 encoding sequence and the first reverse PCR primer hybridizes to an EV VP1 sequence, and a second PCR nucleic acid primer pair, wherein both the second forward and reverse PCR primers hybridize to an EV VP1 encoding sequence.
In one embodiment, the one or more nucleic acid cDNA primers include a sequence as set forth in any one of SEQ ID NOs: 1-4. In another embodiment, the first forward PCR primer includes a sequence as set forth in SEQ ID NO: 5 and the first reverse PCR primer includes a sequence as set forth in SEQ ID NO: 6. In still another embodiment, the second forward PCR primer includes a sequence as set forth in any one of SEQ ID NOs: 7-11 and 13 and the second reverse PCR primer includes a sequence as set forth in any one of SEQ ID NOs: 6, 12 and 14. In yet another embodiment, the one or more nucleic acid cDNA primers include a sequence as set forth in any one of SEQ ID NOs: 1-4, the first forward PCR primer includes a sequence as set forth in SEQ ID NO: 5, the first reverse PCR primer includes a sequence as set forth in SEQ ID NO: 6, the second forward PCR primer includes a sequence as set forth in SEQ ID NO: 11, and the second reverse PCR primer includes a sequence as set forth in SEQ ID NO: 12.
IV. Synthesis of Oligonucleotide Primers and Probes
In vitro methods for the synthesis of oligonucleotides are well known to those of ordinary skill in the art; such methods can be used to produce primers and probes for the disclosed methods. The most common method for in vitro oligonucleotide synthesis is the phosphoramidite method, formulated by Letsinger and further developed by Caruthers (Caruthers et al., Chemical synthesis of deoxyoligonucleotides, in Methods Enzymol. 154:287-313, 1987). This is a non-aqueous, solid phase reaction carried out in a stepwise manner, wherein a single nucleotide (or modified nucleotide) is added to a growing oligonucleotide. The individual nucleotides are added in the form of reactive 3′-phosphoramidite derivatives. See also, Gait (Ed.), Oligonucleotide Synthesis. A practical approach, IRL Press, 1984.
In general, the synthesis reactions proceed as follows: A dimethoxytrityl or equivalent protecting group at the 5′ end of the growing oligonucleotide chain is removed by acid treatment. (The growing chain is anchored by its 3′ end to a solid support such as a silicon bead.) The newly liberated 5′ end of the oligonucleotide chain is coupled to the 3′-phosphoramidite derivative of the next deoxynucleoside to be added to the chain, using the coupling agent tetrazole. The coupling reaction usually proceeds at an efficiency of approximately 99%; any remaining unreacted 5′ ends are capped by acetylation so as to block extension in subsequent couplings. Finally, the phosphite triester group produced by the coupling step is oxidized to the phosphotriester, yielding a chain that has been lengthened by one nucleotide residue. This process is repeated, adding one residue per cycle. See, for example, U.S. Pat. Nos. 4,415,732, 4,458,066, 4,500,707, 4,973,679, and 5,132,418. Oligonucleotide synthesizers that employ this or similar methods are available commercially (for example, the PolyPlex oligonucleotide synthesizer from Gene Machines, San Carlos, Calif.). In addition, many companies will perform such synthesis (for example, Sigma-Genosys, The Woodlands, Tex.; Qiagen Operon, Alameda, Calif.; Integrated DNA Technologies, Coralville, Iowa; and TriLink BioTechnologies, San Diego, Calif.).
V. Detection and Identification of Enteroviruses
A major application of the EV-specific primers presented herein is in the area of detection and diagnostic testing for EV infection. Methods for screening a subject to determine if the subject is infected with an EV are disclosed herein.
One such method includes providing a sample, which sample includes an EV or an EV nucleic acid (such as RNA), and providing an assay for detecting in the sample the presence of the EV or EV RNA sequence. Suitable samples include all biological samples useful for detection of viral infection in subjects, including, but not limited to, cells, tissues (for example, lung, liver and kidney), bodily fluids (for example, blood, serum, urine, saliva, sputum, and cerebrospinal fluid), bone marrow aspirates, BAL, oropharyngeal wash, nasopharyngeal swabs, eye swabs, cervical swabs, vaginal swabs, rectal swabs, stool, and stool suspensions. Additional suitable samples include all environmental samples useful for detection of viral presence in the environment, including, but not limited to, a sample obtained from inanimate objects or reservoirs within an indoor or outdoor environment. The detection in the sample of the EV or EV RNA sequence may be performed by a number of methodologies, non-limiting examples of which are outlined below.
In one embodiment, detecting in the sample the presence of an EV or EV RNA sequence includes the extraction of EV RNA. RNA extraction relates to releasing RNA from a latent or inaccessible form in a virion, cell or sample and allowing the RNA to become freely available. In such a state, it is suitable for effective amplification by reverse transcription and the use of, for example, PCR. Releasing RNA may include steps that achieve the disruption of virions containing viral RNA, as well as disruption of cells that may harbor such virions. Extraction of RNA is generally carried out under conditions that effectively exclude or inhibit any ribonuclease activity that may be present. Additionally, extraction of RNA may include steps that achieve at least a partial separation of the RNA dissolved in an aqueous medium from other cellular or viral components, wherein such components may be either particulate or dissolved.
One of ordinary skill in the art will know suitable methods for extracting RNA from a sample; such methods will depend upon, for example, the type of sample in which the EV RNA is found. For example, the RNA may be extracted using guanidinium isothiocyanate, such as the single-step isolation by acid guanidinium isothiocyanate-phenol-chloroform extraction of Chomczynski et al. (Anal. Biochem. 162:156-59, 1987). Alternatively, an EV virion may be disrupted by a suitable detergent in the presence of proteases and/or inhibitors of ribonuclease activity. Additional exemplary methods for extracting RNA are found, for example, in World Health Organization, Manual for the virological investigation of polio, World Health Organization, Geneva, 2001.
Enterovirus RNA is subjected to reverse transcription to prepare a cognate cDNA that encompasses the region of the genome chosen for detecting and identifying the EV serotype (for example, the region encoding VP1). In one embodiment, a set of random oligonucleotide primers is used, such that certain of the primers in the set will hybridize to the EV RNA and yield one or more cDNA molecules from the virus encompassing the required serotype-specific nucleotide sequence. In another embodiment, gene-specific primers based on conserved amino acid motifs in aligned sequences of known EV serotypes (such as SEQ ID NOs: 1-4) are used for reverse transcription. Subsequently, the EV cDNA is amplified using a suitable amplification protocol to generate an EV amplicon. Any nucleic acid amplification method can be used. In one specific, non-limiting example, PCR is used to amplify the EV cDNA. In another non-limiting example, RT-PCR can be used to amplify the EV cDNA. In an additional non-limiting example, RT-snPCR can be used to amplify the EV cDNA. RT-snPCR refers to a pair of PCRs (PCR1 and PCR2) that is initiated with cDNA that has been reverse transcribed from RNA, and is run in series, each with a pair of primers flanking the same sequence. The first PCR(PCR1) amplifies a sequence, such as an EV cDNA sequence. The second primer pair (semi-nested primers) for the second PCR (PCR2) bind at one end of and within the first PCR product and produce a second PCR product that is shorter than the first one (see
In some embodiments, pairs of EV-specific primers are utilized in the RT-snPCR amplification reaction. Specific, non-limiting examples of EV-specific primers include, but are not limited to: 224 (SEQ ID NO: 5), 222 (SEQ ID NO: 6), 187 (SEQ ID NO: 7), 188 (SEQ ID NO: 8), 189 (SEQ ID NO: 9), 292 (SEQ ID NO: 10), AN89 (SEQ ID NO: 11), AN88 (SEQ ID NO: 12), AN79 (SEQ ID NO: 13), and AN78 (SEQ ID NO: 14).
Enterovirus amplicons obtained following nucleic acid amplification can be sequenced to determine the nucleotide sequence in each. Procedures that can be used for sequencing include the methods of Maxam and Gilbert (Meth. Enzymol. 65:499-566, 1980) and Sanger et al. (Proc. Natl. Acad. Sci. USA 74:5463-67, 1977). Sequencing methods are also discussed, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. The method of Sanger et al. involves the use of different 2′,3′dideoxynucleotide chain terminators in each of four template-driven DNA polymerase reactions, and is readily implemented in automated sequencing instruments, such as those of MJ Research, Inc. (San Francisco, Calif.), Stratagene (La Jolla, Calif.), or Applied Biosystems (Foster City, Calif.).
Enterovirus amplicon sequences can be compared with the sequences of EV reference strains (such as VP1 sequence of EV reference strains), including at least one representative of each recognized serotype, in order to identify (serotype) the EV. One of ordinary skill in the art will know suitable methods for comparing sequences. For example, script-driven sequential pairwise comparison using the program Gap, (Wisconsin Sequence Analysis Package, version 10.2, Accelrys, Inc., San Diego, Calif.) can be used to compare EV amplicon sequences to EV reference strains.
The subject matter of the present disclosure is further illustrated by the following non-limiting Examples.
This example describes the design and construction of primers for amplification and identification of EVs, particularly EVs in clinical specimens.
Consensus degenerate primers for the cDNA and PCR1 steps were designed from conserved amino acid motifs in the aligned capsid sequences of the 64 EV serotype prototype strains (Table 1;
One pair of internal primers used in PCR2 included forward internal primer 292 (SEQ ID NO: 10), which targets the conserved motif (Q/T)A(A/V)ETG (SEQ ID NO: 21), paired with reverse primer 222 (SEQ ID NO: 6) (Table 2;
CCAGCACTGACAGCAGYNGARAYNGGb
TACTGGACCACCTGGNGGNAYRWACATb
GAAGTACCAGCACTGACAGCAGYI
CTGTTTGGTACTGGACCACCTGG
AATTAACCCTCACTAAAGGGAGAAGATA
aLocation relative to the genome of PV1-Mahoney (GenBank accession number J02281), except for AN230 and AN231, whose locations are relative to the genome of EV68-Fermon (GenBank accession number AY426531).
bAN232 is the non-degenerate “clamp” portion of AN89 and AN233 is the non-degenerate clamp portion of AN88. Within the AN88 and AN89 sequences, these clamp regions are indicated by italic type.
cThe T3 RNA polymerase promoter sequence is underlined. IUB ambiguity codes: R = A or G; Y = C or T; W = A or T; N = A, C, G, or T; M = A or C; I = Inosine.
This example describes how enterovirus-specific nucleic acids can be amplified and detected using specific primers.
Nucleic acid from all 64 EV serotype reference strains, 15 additional reference strains for some serotypes and 22 proposed new serotypes (Table 1; 101 strains total) was extracted with the QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, Calif.), which was used according to the manufacturer's instructions. Eluted RNAs were dried passively in a bench top desiccator under vacuum. The dried RNA was resuspended in 16 μl of sterile nuclease-free water and stored at −20° C. until use.
Synthesis of cDNA was carried out in a 10 μl reaction containing 5 μl of RNA, 100 mM each dNTP (Amersham Biosciences, Piscataway, N.J.), 2 μl of 5× reaction buffer (Invitrogen, Carlsbad, Calif.), 0.01 M dithiothreitol (DTT), 1 pmol each cDNA primer (AN32 (SEQ ID NO: 1), AN33 (SEQ ID NO: 2), AN34 (SEQ ID NO: 3), and AN35 (SEQ ID NO: 4); Table 2), 20 U of RNasin (Promega Corp., Madison, Wis.), and 100 U of Superscript II reverse transcriptase (Invitrogen, Carlsbad, Calif.). Following incubation at 22° C. for 10 min, 45° C. for 45 min, and 95° C. for 5 min, the entire 10 μl RT reaction was then used in the first PCR reaction (50 μl final volume) (PCR1), consisting of 5 μl of 10×PCR buffer (Roche Applied Science, Indianapolis, Ind.), 200 μM each dNTP, 50 pmol each of primers 224 (SEQ ID NO: 5) and 222 (SEQ ID NO: 6) (Table 2), and 2.5 U of Taq DNA polymerase (Roche Applied Science, Indianapolis, Ind.), with 40 cycles of amplification (95° C. for 30 s, 42° C. for 30 s, 60° C. for 45 s). One microliter of the first PCR reaction was added to a second PCR reaction (PCR2) for semi-nested amplification. PCR2 contained 40 pmol each of primers AN89 (SEQ ID NO: 11) and AN88 (SEQ ID NO: 12) (Table 2), 200 μM each dNTP, 5 μl of 10× FastStart Taq buffer (Roche Applied Science, Indianapolis, Ind.), and 2.5 U of FastStart Taq DNA polymerase (Roche Applied Science, Indianapolis, Ind.) in a final volume of 50 μl. The FastStart Taq polymerase was activated by incubation at 95° C. for 6 min prior to 40 amplification cycles of 95° C. for 30 s, 60° C. for 20 s, and 72° C. for 15 s. Reaction products were separated and visualized on 1.2% agarose gels, containing 0.5 μg ethidium bromide per ml, and purified from the gel by using the QIAquick Gel Extraction Kit (Qiagen, Inc., Valencia, Calif.). The resulting DNA templates were sequenced with the Big Dye Terminator v1.1 Ready Reaction Cycle Sequencing Kit on an ABI Prism 3100 automated sequencer (both from Applied Biosystems, Foster City, Calif.), using primers AN89 (SEQ ID NO: 11) and AN88 (SEQ ID NO: 12) or primers AN232 (SEQ ID NO: 15) and AN233 (SEQ ID NO: 16) (Table 2).
Amplicon sequences were compared with the VP1 sequences of EV reference strains, including at least one representative of each recognized serotype, by script-driven sequential pairwise comparison using the program Gap (Wisconsin Sequence Analysis Package, version 10.2, Accelrys, Inc., San Diego, Calif.), as described by Oberste et al. (J. Gen. Virol. 86:445-51, 2005; J. Gen. Virol. 85:3205-12, 2004; J. Clin. Virol. 26:375-77, 2003). In cases where the result was not unequivocal (highest score less than 75% or second-highest score greater than 70%), deduced amino acid sequences were compared using a similar method.
All 64 EV serotype reference strains, 15 additional reference strains for some serotypes and 22 proposed new serotypes (Table 1; 101 strains total) were successfully amplified and sequenced using the CODEHOP VP1 RT-snPCR procedure (
NA: not applicable;
UNT: untypable.
This example describes the sensitivity of EV detection/identification methods using specific primers to amplify enterovirus-specific nucleic acids.
Sensitivity was tested by two methods. Sensitivity relative to cell culture infectivity was measured using a titered stock of the EV68 prototype strain, Fermon. Serial 10-fold dilutions of the EV68-Fermon stock were made in Hank's balanced salt solution, and RNA from 100 μl of each dilution was extracted with the QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, Calif.). RNAs representing from 104 cell culture infectious dose 50% endpoint units (CCID50) to 10−3 CCID50 per 5 μl were tested with the VP1 RT-snPCR assay. The VP1 RT-snPCR assay detected RNA extracted from as little as 0.01 CCID50 per 5 μl of EV68-Fermon (
Absolute sensitivity was measured by using an in vitro-transcribed synthetic RNA standard derived from EV68-Fermon. To make the synthetic RNA standard, RT-PCR primers were designed to flank the VP3-VP1 RT-snPCR assay cDNA product. The sense primer AN230 (SEQ ID NO: 17) contains the 23-base T3 RNA polymerase promoter at the 5′ end, and it was used with the antisense primer AN231 (SEQ ID NO: 18) (Table 2) in a two-step RT-PCR. cDNA was made with SuperScript II RT (Invitrogen, Carlsbad, Calif.) according to the kit instructions, using 10 pmol AN231 (SEQ ID NO: 18) to prime the cDNA. PCR was performed with FastStart Taq (Roche Applied Science, Indianapolis, Ind.), using the manufacturer's 10× buffer with MgCl2, 2 μl of cDNA, 200 μM each dNTP, and 20 pmol each of AN230 (SEQ ID NO: 17) and AN231 (SEQ ID NO: 18) primers, in a final reaction volume of 50 μl. The thermocycler program consisted of 40 cycles of 95° C. for 30 s, 55° C. for 40 s, and 72° C. for 40 s. The PCR product was purified using the High Pure PCR Product Purification Kit (Roche Applied Science, Indianapolis, Ind.) according to the manufacturer's instructions. Purified PCR product was quantitated spectrophotometrically, and 1 μg of PCR product was used as template for in vitro RNA transcription, using the MEGAscript High Yield Transcription Kit (Ambion, Inc., Austin, Tex.) according to the manufacturer's protocol. The VP3-VP1 single-stranded, positive-sense standard RNA product (VP3-VP1 sRNA; 1082 nt) was digested with DNase I to remove template DNA and then purified with the QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, Calif.). The manufacturer's instructions were followed, except no carrier tRNA was added to the kit's lysis buffer. The purified VP3-VP1 sRNA was quantitated spectrophotometrically, and the concentration was calculated in units of RNA molecules per microliter. Two separate lots of the VP3-VP1 sRNA were synthesized and diluted to contain from 104 copies to 1 copy per 5 μl and then tested in two separate experiments with the VP1 RT-snPCR assay. As few as 10 copies of the in vitro-transcribed VP3-VP1 sRNA produced a detectable gel band in two independent experiments, indicating a low limit of absolute sensitivity (
The sensitivity of the VP1 RT-snPCR assay was also compared to that of a 5′NTR RT-snPCR assay (Nix et al., Neurol. 62:1372-77, 2004) by serially diluting RNA extracted from a recent EV68 clinical isolate and running both the VP1 and 5′NTR RT-snPCR assays in parallel using the same diluted RNA preparations. The diluted EV68 clinical isolate RNA was amplified from the 10−1-10−7 dilutions with the 5′NTR RT-snPCR assay, and from the 10−1-10−8 dilutions with the VP1 RT-snPCR assay (
This example demonstrates the application of methods of using specific primers to amplify and identify enteroviruses from clinical specimens.
To demonstrate the clinical application of the VP1 RT-snPCR method, RNA was extracted from original clinical specimens obtained from patients with a number of different enteroviral illnesses. The specimens and associated illnesses included cerebrospinal fluid (aseptic meningitis), stool (aseptic meningitis), rectal swab (febrile rash), nasopharyngeal swab (mild upper respiratory illness), conjunctival swab (acute hemorrhagic conjunctivitis), serum (febrile rash), and postmortem liver tissue (neonatal sepsis-like illness).
Stool suspensions were prepared by adding 5 ml of phosphate-buffered saline, 1 g of glass beads (Corning Inc., Corning, N.Y.), and 0.5 ml of chloroform to 1 g of stool, shaking the mixture vigorously for 20 min in a mechanical shaker, and centrifugation at 1500 g for 20 min at 4° C. (World Health Organization, Manual for the virological investigation of polio, World Health Organization, Geneva, 2001). For rectal swab samples, the fluid was centrifuged at 13,000 g for 1 min at room temperature to remove solids, and the supernatant was transferred to a fresh tube. For fecal specimens (stool suspensions or clarified rectal swab supernatants), 140 μl of the specimen extract was combined with an equal volume of Vertrel XF (Miller-Stephenson Chemical Co., Danbury, Conn.), shaken vigorously, and then centrifuged at 13,000 g for 1 min at room temperature. The aqueous phase was transferred to a fresh tube. Other specimen types, including cerebrospinal fluid, virus isolates, and supernatants from nasopharyngeal, oropharyngeal, and conjunctival swab samples, were processed without pretreatment. Twenty micrograms of proteinase K (Roche Applied Science, Indianapolis, Ind.) was added to 140 μl of each liquid specimen or fecal extract, and then incubated for 30 min at 37° C. Nucleic acid was extracted from the digested specimen with the QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, Calif.), which was used according to the manufacturer's instructions. Eluted RNAs were dried passively in a bench top desiccator under vacuum. The dried RNA was resuspended in 16 μl of sterile nuclease-free water and stored at −20° C. until use. Synthesis of cDNA and RT-PCR amplification were carried out as described herein in Example 2.
From each of these RNA templates, a specific product was amplified by VP1 RT-snPCR (
While this disclosure has been described with an emphasis upon preferred embodiments, it will be obvious to those of ordinary skill in the art that variations of the preferred embodiments may be used and it is intended that the disclosure may be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications encompassed within the spirit and scope of the disclosure as defined by the claims below.