Provided are methods and related systems for characterization of polynucleotides that traverse a nanopore under an applied electric field. There is a need in the art for system that can: (1) detect target molecules at low concentrations from minute sample volumes; (2) detect biomolecular parameters of the target molecules, such as a combination of methylation aberrations across a variety of genes (important in monitoring disease progression and prognosis); (3) detect subtle variations in biomolecular parameters, such as methylation patterns across alleles, that would not be detected using bulk ensemble averaging methods such as PCR and gel-electrophoresis; (4) perform rapid analysis, such as methylation analysis; (5) reduce cost and simplify steps of experiment and analysis by eliminating cumbersome PCR, DNA sequencing and bisulfite conversion steps while maintaining sensitivity.
The methods and systems provided herein address these needs by providing a specially configured and integrated system that collects polynucleotides of interest from a sample and concentrates them in a desired region around a nanopore entrance. In this manner, highly sensitive and accurate characterization of polynucleotides is possible, with important applications in the field of medical testing, diagnostics and fundamental research.
Methods and related systems are described for characterizing a polynucleotide property in a reliable, low cost and efficient system without sacrificing or impacting sensitivity and resolution. This is achieved, in part, by special handling and processing of biological samples that facilitate subsequent capture and concentration of a polynucleotide of interest in a well-defined region adjacent to a nanopore entrance. In this manner, the need for polynucleotide amplification or more specialized isolation and involved handling is avoided, while ensuring even a small level of a polynucleotide of interest in a sample is provided to and detected by the nanopore. This provides access to a platform that is well-integrated, with a range of applications related to characterization of polynucleotides, including in assays for various diseases and diagnostics related thereto.
In an aspect, the invention is a method for characterizing a biomolecular parameter of a polynucleotide by concentrating a polynucleotide of interest from a sample comprising a heterogeneous mixture of polynucleotides; providing the concentrated polynucleotide of interest to a first fluid compartment of a solid-state nanopore, wherein the solid-state nanopore separates the first fluid compartment from a second fluid compartment, and a nanopore fluidically connects the first fluid compartment and the second fluid compartment; establishing an electric potential across the solid-state nanopore to force the polynucleotide of interest from the first fluid compartment to the second fluid compartment via the nanopore; and monitoring a passage parameter output during passage of the polynucleotide of interest through the nanopore, wherein the passage parameter output depends on the biomolecular parameter status of the polynucleotide of interest.
The methods and systems are compatible with a wide range of biomolecular parameters, depending on the application of interest. Examples include, an oxidative modification; an epigenetic modification; and a nucleotide sequence of interest. For example, if known DNA sequences are associated with a disease state, such as a mutation that indicates a predisposition to cancer, or that is associated with cancer, the nucleotide sequence of interest may correspond to that sequence. Accordingly, any of the methods provided herein may use a probe or biomarker that is selective to that sequence.
The methods and systems provided herein are particularly suited for characterization of a biomolecular parameter that is methylation, such as hypermethylation or a pattern of methylation sites in the polynucleotide of interest.
The methods and systems provided herein may further comprise the step of introducing a biomarker to the polynucleotide of interest prior to passage of the polynucleotide of interest through the nanopore, wherein the biomarker specifically binds to a polynucleotide of interest having the biomolecular parameter. As described, such biomarkers are useful for increasing sensitivity with respect to determining presence or absence of a biomolecular parameter for a polynucleotide transiting the nanopore. For example, it can be difficult to reliably resolve methylated from unmethylated DNA solely by nanopore transit. This difficulty is addressed herein by use of a biomarker, so that methylated versus not methylated DNA is identified. In a similar manner, any number of biomolecular parameters can be characterized for biomarkers that have specific binding to the biomolecular parameter status. Use of such a biomarker is indicated for those polynucleotide sequences and nanopore geometry wherein the presence or absence of the biomolecular parameter does not result in a reliable difference in passage parameter output. In contrast, a biomarker that is specific to the biomolecular parameter condition can effect a relatively large change in a passage parameter output, thereby allowing a user to distinguish between a polynucleotide of interest without the biomolecular parameter (e.g., no biomarker bound) from an equivalent polynucleotide of interest with the biomolecular parameter (e.g., with a biomarker bound).
In an embodiment, the biomarker is selected from the group consisting of: a methylation binding protein; a sequence-specific binding motif; an antibody specific to a nucleotide-binding protein; a base excision repair protein; and a nucleotide-binding protein. Exemplary specific biomarkers may include at least one of: Uhrf, MBD, Kaiso family, ZBTB4 or ZBTB38, and the biomolecular parameter is methylation of DNA. As discussed, the invention is compatible with any biomarker that is associated with a biomolecular parameter, and that provides a substantial change in a process parameter output for the nanopore.
As desired, any number of passage parameter outputs may be monitored, measured or calculated. Examples include blockade current, nanopore transit time, or both blockade current or nanopore transit time.
In an aspect, the blockade current for a methylated DNA polynucleotide:MBD complex is at least 2-fold greater than a blockade current for a corresponding unmethylated DNA polynucleotide traversing the nanopore. Similarly, the method may further relate to a biomarker:polynucleotide of interest complex that provide an at least 2-fold difference, at least 3-fold, or at least 5-fold difference in the passage parameter output compared to polynucleotide of interest transiting without a biomarker.
In an aspect, there is a biomarker to polynucleotide of interest ratio that is greater than or equal 1:1, 1.5:1, or 3:1, or selected from a range that is between 1:1 and 5:1.
The methods and systems provided herein are compatible with a range of polynucleotides, such as single stranded DNA, double stranded DNA or RNA. A particular advantage of the systems and methods herein is the compatibility with a range of polynucleotide lengths, ranging from short, less than 100 base pairs, to long, such as greater than 800 base pairs, and intermediate lengths thereof. In an aspect, the polynucleotide has a nucleotide length that is greater than or equal to 30 nucleotides and less than or equal to 100 nucleotides. Accordingly, any of the samples used in the assay, may be processed to provide smaller polynucleotide lengths, such as by restriction enzymes, thermal digestion, and the like, without having to amplify the polynucleotides.
Examples of passage parameter output include any of: blockade current, threshold voltage, pattern of blockade current, frequency of blockade current, duration of blockade current, translocation velocity, translocation time, and statistical parameters thereof, such as averages. In an aspect, a biomarker is provided to bind to the polynucleotide of interest, wherein a binding complex comprising the biomarker and polynucleotide of interest changes an average passage parameter output value by at least 100% compared to a polynucleotide of interest without the bound biomarker. For example, there may be an at least 2-fold increase in blockade current or transit time, including between 2-fold and 10-fold. “Threshold voltage” is used herein to indicate a driving voltage required to force a polynucleotide through the nanopore, so that without a biomarker, the threshold voltage may be much smaller than compared to a polynucleotide having the biomarker connected thereto.
Depending on the application of interest, the nanopore has an average diameter that is greater than or equal to 5 nm and less than or equal to 12 nm. In an aspect, the solid state nanopore comprises a dielectric membrane having a thickness less than or equal to 20 nm. The dielectric membrane may comprise SiN, Al2O3, graphene, or HfO2, and multi-stacked layers thereof. In an aspect, the dielectric membrane comprises graphene having a thickness of less than 0.5 nm through which the nanopore traverses.
The systems and methods are compatible with a range of samples, with the sample selected depending on the application of interest. For example, the sample may comprise a biologic sample obtained from an individual, the biological sample selected from the group consisting of a blood sample, a stool sample, urine sample, saliva or sputum sample, or a tissue sample.
A unique aspect of the systems and methods provided herein is the integrated aspect wherein polynucleotides of interest in a sample are specifically concentrated at or near a nanopore entrance. In an aspect, the concentrating step comprises: binding the polynucleotide of interest to a capture element; separating unbound polynucleotides from the bound polynucleotides of interest; and releasing the polynucleotide of interest from the capture element. The released polynucleotide of interest may be transported to the first fluid compartment.
Alternatively, the capture element may be positioned in the first fluid compartment and polynucleotides of interest provided to the positioned capture element. In this manner, the capture element ensures that polynucleotide of interest is concentration in the first fluid compartment.
Any of the methods may further comprise the step of introducing a biomarker specific to the polynucleotide of interest before or after binding of the polynucleotide of interest to the capture element. A biomarker specific to the polynucleotide of interest may be introduced: after binding of the polynucleotide of interest to the capture element; or after releasing of the polynucleotide of interest from the capture element. Alternatively, the biomarker may be part of the capture element, such as connected to the capture element and used to specifically capture a polynucleotide of interest having the biomolecular parameter. For example, a methyl binding domain may be connected to a surface of a capture element comprising a bead, so that the specific binding property of the methyl binding domain facilitates specific binding of polynucleotide of interest having methylated nucleotides (e.g., methylated cytosine) to the bead. Similar targeting of biomarkers that specifically bind to other biomolecular parameters are compatible with the instant methods and systems. In this manner, the capture element is specific to the polynucleotide of interest having the biomolecular parameter present.
The functional benefit of the systems and methods may be characterized in terms of an increase in concentration of the polynucleotide of interest, particularly at or near the nanopore entrance. In an aspect, the concentrating step increases a polynucleotide of interest concentration by at least a factor of 500 in a region adjacent to the nanopore compared to the polynucleotide of interest concentration in a region that is not adjacent to the nanopore, such as a range of between 500 and 10,000 or between 500 and 2,000, and any sub-ranges thereof. A region may be considered “adjacent” to a nanopore if, upon energization of the driving electric field, the polynucleotide is forced into contact with the nanopore entrance. If after a user-selected time, the polynucleotide has not entered the nanopore, that location where the polynucleotide initially started may be considered to be not adjacent to the nanopore entrance. Of course, this functional definition will depend on operating conditions, such as strength of electric field, electrolyte composition, nanopore size, polynucleotide size. Accordingly, adjacent may also be defined in terms of absolute values, such as within 500 μm, 250 μm or 100 μm of a nanopore. Adjacent may also be defined in terms of a chamber that is provided around the nanopore passage, with an according volume. Capture elements, or components thereof, may be matched with the region considered to be adjacent, such that polynucleotides of interest are forced into the region, such as by application of a magnetic force, electric field, bulk fluidic convection and the like.
In an aspect, the first fluid compartment has a sample-containing volume that is fluidically adjacent to a nanopore entrance and that is less than or equal to 500 μL, 250 μL, or 100 μL. In this manner, the polynucleotide concentration is increased dramatically, simply by virtue of ensuring the polynucleotide is forced into this region. Accordingly, polynucleotide amplification is avoided.
In an aspect, the transport of the polynucleotide of interest to the first fluid compartment is by a microfluidic channel. For example, the microfluidic channel may directly convey the sample, or the sample may have undergone upstream processing so that the polynucleotide has been pre-processed. For example, the polynucleotide may be bound to a particle or bead having properties conducive to subsequent capture. The microfluidic channel may have a characteristic dimension that is less than 1 mm, less than 100 μm, or between about 1 μm and 100 μm, or between 1 μm and 20 μm.
In an embodiment, the capture element comprises a magnetic bead to which the polynucleotide of interest is attached, and the capture element is suspended in a microfluidic channel. Alternatively, the bead may have other properties conducive for capture by other forces, such as an electrostatic force, such as by electrophoresis.
In an aspect, the concentrating step further comprises: applying a magnetic force to drive the magnetic bead with polynucleotide of interest from the microfluidic channel to a first fluid compartment region fluidically adjacent to a nanopore entrance; introducing a cleavage element into the microfluidic channel and fluidically flowing the cleavage element to the first fluid compartment region to cleave the polynucleotide of interest from the magnetic bead at a cleavable linker site; wherein the establishing the electric potential step forces polynucleotide of interest in the first fluid compartment region to the nanopore entrance and through the nanopore and the monitoring the passage parameter output distinguishes between biomarker and polynucleotide of interest complexes traversing the nanopore from polynucleotide of interest without biomarker traversing the nanopore.
The cleavage element during the establishing the electric potential step may be positively charged, and the established electric field forces the cleavage element in a direction that is away from the nanopore entrance. This advantageously minimizes risk of cleavage elements interfering with subsequent polynucleotide nanopore transit and measurements related thereto.
The cleavable linker site may be any number of elements given the range of specific cleavage mechanisms, including by restriction enzymes and the like that target specific sequences. One example of a suitable linker site comprises four uracils positioned between an amino conjugation terminal and a complementary sequence. In this manner, the paired cleavage element to that linker site may be a glycosylase that selectively cleaves the cleavable linker site.
The method may further comprise the step of introducing a biomarker into the microfluidic channel and fluidically flowing the biomarker to the first fluid compartment region to bind the biomarker to polynucleotide of interest having a biomolecular parameter that provides specific binding to the biomarker. In an aspect, the biomarker is a MBD protein.
The concentrating step may comprise providing the polynucleotide of interest to a first fluid compartment region having a confined volume. For example, the confined volume may be within 500 μm of an entrance of the nanopore, or have a confined volume that is less than or equal to 50,000 μm3. Alternatively, the confined volume may be defined in terms of a fraction of the first fluid compartment volume, such as a central portion that surrounds the nanopore entrance, such as 50% or less, 30% or less, or 10% or less of the first fluid compartment region. Alternatively, the first fluid compartment may be configured to have walls, or wall portions, that define edges of the confined volume.
The method of the present invention may comprise the step of directing a magnetic force through a microfluidic channel containing the polynucleotide of interest bound to a magnetic bead flowing through the microfluidic channel to capture magnetic beads within the confined volume. The magnetic force may be generated by a permanent magnet or a pattern of microfabricated magnets. The pattern of microfabricated magnets may comprise a ferromagnetic material arranged in a pattern to decrease velocity of the magnetic bead flowing in the microfluidic channel and to increase distribution uniformity of the magnetic beads in a region adjacent to the nanopore entrance. One example of a ferromagnetic material is nickel. For example, particles in a center streamline position in the microfluidic channel may be pulled toward a surface into a slower streamline position, particularly for laminar flow, thereby further increasing the likelihood of capture.
Any of the methods provided herein may further comprise the step of directing a magnetic force through a microfluidic channel containing a magnetic bead flowing through the microfluidic channel to capture magnetic beads within the confined volume, wherein the magnetic beads are coated with an oligonucleotide complementary to a target sequence of the polynucleotide of interest. A polynucleotide of interest may be provided to the magnetic bead to bind the polynucleotide of interest to the magnetic bead.
Other examples of capture elements include those based on electrokinetic techniques such as dielectrophoresis or isotachophoresis to concentrate the bead/DNA/protein complex around the nanopore. In an aspect, the capture element comprises a particle positioned within a concentrating electric field that directs the particle to the first fluid compartment. The particle may be a charged bead to which the polynucleotide of interest in attached. The concentrating electric field may be applied in a dielectrophoretic or isotachophoretic manner.
The invention may be further described in terms of selecting a nanopore passage geometry to provide an intermittent interaction between the polynucleotide of interest transiting the nanopore and an inner surface of the nanopore, corresponding to the biomolecular parameter, wherein the intermittent interaction is detectable as a change in passage parameter output. For example, the biomolecular parameter may comprise a nucleotide binding protein that is specific to the biomolecular parameter, including a biomolecular parameter of methylation and the nucleotide binding protein that is a MBD protein.
Any of the nanopores provided herein may be functionalized with an antibody for specific binding to the biomolecular parameter during transit of the polynucleotide of interest.
The methods and systems provided herein are particularly well suited for distinguishing those polynucleotides of interest not having the biomolecular parameter from those that do. For example, the polynucleotide of interest may comprise a plurality of polynucleotides formed from a first population of polynucleotides having the biomolecular parameter of interest and a second population of polynucleotides without the biomolecular parameter of interest. In this manner, the method may further comprise identifying a fraction of polynucleotides having the biomolecular parameter of interest. As desired, a plurality of systems may be employed to provide, for example, high-throughput screeing, such as by a plurality of nanopores.
The polynucleotide of interest may be present in the sample at a ratio of less than 1 polynucleotide of interest to 1000 total polynucleotides. The methods provided are capable of characterizing the biomolecular parameter at a polynucleotide of interest concentration that is as low as 1000 molecules/μL or about 1 fM. The method may screen a blood sample or a stool sample for a biomolecular parameter indicative of a disease state. Examples of disease states include cancer, neurodegeneration, single nucleotide polymorphisms associated with a genetic disease. The concentrating may, in turn, effectively increase the concentration at a region adjacent to the nanopore, such as about 500-fold or more than the original sample, 500,000 molecules/μl or about 500 fM.
In another embodiment, the concentrating step may comprise providing a bead having a probe connected to a surface of the bead that specifically binds to a polynucleotide of interest. For example, the probe may comprise a biomarker that specifically binds to a polynucleotide of interest having the biomolecular parameter to be characterized. The probe may comprise a methyl-binding protein that specifically binds a methylated region of the polynucleotide of interest. The methyl binding protein may bind to a hemi-methylated region of double-stranded DNA.
The methods and systems provided herein may have a sensitivity capable of detecting a single biomolecular parameter in the polynucleotide of interest, such as a single cytosine methylation in a polynucleotide of interest.
In another embodiment, the invention is a device, system, or assay for performing any of the methods provided herein. In an aspect, provided herein is an integrated diagnostic system comprising: a solid state nanopore that traverses a dielectric membrane, the nanopore having a diameter less than 20 nm, such as between about 5 nm and 18 nm; the membrane having a thickness less than 30 nm, such as between 1 nm and 30 nm, and a top and a bottom surface with the thickness extending therebetween. A nanopore entrance is coincident with the dielectric membrane top surface and a first fluid compartment is positioned adjacent to the dielectric membrane top surface. A first fluid compartment region is positioned within the first fluid compartment and fluidically adjacent to the nanopore entrance. The first fluid compartment may also correspond the first fluid compartment region. A nanopore exit is coincident with the dielectric membrane bottom surface, wherein the nanopore fluidically connects the first fluid compartment and the second fluid compartment. A power supply is electrically connected to the first fluid compartment and the second fluid compartment to provide an electric potential difference between the first fluid compartment and the second fluid compartment. This potential difference is used to force polynucleotides in the first fluid compartment region from the first fluid compartment to the second fluid compartment, via the nanopore. A detector is operably connected to the nanopore, the detector configured to monitor a passage parameter output for a polynucleotide traversing the nanopore under the electric potential difference between the first fluid compartment and the second fluid compartment. For example, any of current, resistance, capacitance or other electrical parameter through the nanopore may be detected. Similarly, other variables may be calculated therefrom, including transit time, transit velocity, and the like. A microfluidic passage is configured to fluidically transport a sample to the first fluid compartment region. A capture element positioned in the microfluidic passage and/or the first fluid compartment region captures and concentrates a polynucleotide of interest in the first fluid compartment region. A release element is in fluidic contact with the microfluidic passage for controllably releasing the polynucleotide of interest from the capture element to the first fluid compartment region. Upon energization of the power supply, the released polynucleotide of interest in the first fluid compartment region traverses the nanopore to the second fluid compartment.
The system may further comprise a biomarker in fluidic contact with the microfluidic passage for binding to a polynucleotide of interest having a biomolecular parameter that provides specific binding with the biomarker.
The system may further comprise a magnet positioned to provide a magnetic force to capture a capture element that is a magnetic particle at the first fluidic compartment region, wherein the first fluidic compartment region is within 500 μm of the nanopore entrance. The magnet may comprise a plurality of ferromagnetic elements arranged in magnetic contact with the microfluidic channel and in a pattern configured to decrease velocity of a magnetic particle flowing in the microfluidic channel, capture and uniformly distribute magnetic particles relative to the nanopore entrance. The capture pattern may be symmetrically aligned relative to the nanopore entrance perimeter, so that the captured particles are uniformly distributed out to a maximum separation distance from the nanopore, such as out to 500 μm, 250 μm, or 100 μm. “Uniformly distributed” is used herein to refer to a less than 30%, less than 20% or less than about 10% maximum deviation from average over the entire region.
In an aspect, at least 70% of all magnetic particles flowing in the microfluidic channel are captured by the magnetic force and positioned around the nanopore entrance.
The release element may comprise an enzyme that selectively cleaves the polynucleotide of interest from the magnetic particle at a cleavable linker site to release polynucleotide of interest to the first fluidic compartment region.
Without wishing to be bound by any particular theory, there may be discussion herein of beliefs or understandings of underlying principles relating to the devices and methods disclosed herein. It is recognized that regardless of the ultimate correctness of any mechanistic explanation or hypothesis, an embodiment of the invention can nonetheless be operative and useful.
In general, the terms and phrases used herein have their art-recognized meaning, which can be found by reference to standard texts, journal references and contexts known to those skilled in the art. The following definitions are provided to clarify their specific use in the context of the invention.
“Polynucleotide” is used broadly herein and includes, for example, DNA, RNA, oligonucleotides, and combinations thereof, and may be single stranded or double stranded. The polynucleotide may be naturally occurring or may be engineered or synthetic. A “biomolecular parameter” refers to a measurable or quantifiable property of the polynucleotide. The parameter may be a constant, or a yes/no state, such as the sequence or a sequence portion. The parameter may vary for a particular biomolecule depending on the state or conditions of the biomolecule, such as for a biomolecular parameter that is a methylation state, binding event and/or secondary structure. An “electrical parameter” refers to a parameter that can be electrically measured or determined and that relates to the biomolecular parameter. Of particular relevance herein, are electrical parameters used to monitor a passage parameter output. “Passage parameter output” refers to a measurable or calcutable variable that reflects passage of a polynucleotide through the nanopore, and tends to be derived from or may relate to the electrical parameter. Examples include blockade current, threshold voltage, transit time, transit velocity, resistance, conductance, and statistical parameters thereof. The process parameter is described as an output to reflect that it it can be measured or determined and that it may be temporally varying.
“Polynucleotide of interest” refers to a portion of a longer polynucleotide, or a smaller fragment thereof, that contains information about a desired biomolecular parameter. For example, a specific portion of DNA may contain information about a genetic mutation state (mutation present or absent), methylation state (e.g., level or pattern of methylation), or other factor that can be measured herein. Those specific portions may be contained within a specific fragment, so that other fragments not of interest are present. Advantages of the instant invention include the ability to precisely locate the polynucleotides of interest to the region of the nanopore of interest, for subsequent high-quality analysis and characterization, without any corresponding increase in concentration of polynucleotides not of interest. Without this important aspect, there is a risk of loss of desirable signal in the noise of the overwhelming number other polynucleotides that may be irrelevant for the application on hand. Polynucleotide of interest, for clarity, are those polynucleotides that may or may not have a biomolecular parameter of interest, but that are to be studied so as to characterize the biomolecular parameter of interest.
“Methylation” refers to DNA having one or more residues that are methylated. For example, in all vertebrate genomes some of the cytosine residues are methylated. DNA methylation can affect gene expression and, for some genes, is an epigenetic marker for cancer. Two different aspects of DNA methylation can be important: methylation level or content as well as the pattern of methylation. “Methylation state” is used broadly herein to refer to any aspect of methylation that is of interest from the standpoint of epigenetics, disease state, or DNA status and includes methylation content, distribution, pattern, density, and spatial variations thereof along the DNA sequence. Methylation detection and parameter characterization via nanopores is further discussed in U.S. Pat. Nos. 8,394,584, 8,748,091 and 2014/0174927.
In addition, biomolecular parameter refers to a quantitative variable that is measurable and that can be reflected by the polynucleotide transit through a nanopore, such as for example, translocation speed through a nanopore, variations in an electrical parameter (e.g., changes in the electric field, ionic current, resistance, impedance, capacitance, voltage) in the nanopore as the polynucleotide enters and transits the pore, including temporary or transitory interactions between the polynucleotide and a nanopore surface region functionalized with a chemical moiety.
“Dielectric” refers to a non-conducting or insulating material. In an embodiment, an inorganic dielectric comprises a dielectric material substantially free of carbon. Specific examples of inorganic dielectric materials include, but are not limited to, silicon nitride, silicon dioxide, boron nitride, and oxides of aluminum, titanium, tantalum or hafnium. A “high-k dielectric” refers to a specific class of dielectric materials, for example in one embodiment those dielectric materials having a dielectric constant larger than silicon dioxide. In some embodiments, a high-k dielectric has a dielectric constant at least 2 times that of silicon dioxide. Useful high-k dielectrics include, but are not limited to Al2O3, HfO2, ZrO2, HfSiO2, ZrSiO2 and any combination of these. In an aspect, any of the methods and devices provided herein have a dielectric that is Al2O3.
“Conductor-dielectric stack” refers to a plurality of layers, with at least one layer comprising an electrical conductor and another layer a dielectric. In an embodiment, a layer may be geometrically patterned or deposited, such as in a nanoribbon configuration including a conductor layer that is a conducting nanoribbon having a longitudinal direction that is transverse to the passage formed by the nanopore. In an aspect, the stack comprises 2 or more layers, 3 or more layers, or a range that is greater than or equal to 5 layers and less than or equal to 20 layers. In an aspect, adjacent conductor layers are separated from each other by a dielectric layer. In an aspect the outermost layers are conducting layers, dielectric layers, or one outermost layer that is dielectric and the other outermost layer at the other end of the stack is a conductor. In an aspect, local electric field may be applied and controlled near the membrane surface by selectively patterning a dielectric layer that covers an underlying conductor layer that is electrically energized. Any of the methods and devices provided herein have a conducting layer that is grapheme. As exemplified herein, the term graphene can be replaced, as desired, with other atomically thin electrically conducting layers, such as MoS2, doped silicon, silicene, or ultra-thin metal.
“Fluid communication” or “fluidly connects” refers to a nanopore that permits flow of electrolyte, and specifically ions in the electrolyte from one side of the membrane (e.g., first fluid compartment) to the other side of the membrane (e.g., second fluid compartment), or vice versa. In an aspect, the fluid communication connection is insufficient to readily permit polynucleotide transit between sides without an applied electric field to facilitate transit through the nanopore. This can be controlled by combination of nanopore geometry (e.g., diameter), nanopore surface functionalization, applied electric field through the nanopore and polynucleotide and fluid selection.
“Specific binding” refers to an interaction between two components wherein one component has a targeted characteristic. Binding only occurs if the one component has the targeted characteristic and substantially no binding occurs in the absence of the targeted characteristic. In an embodiment, the targeted characteristic is a nucleotide type (e.g., A, T, G, C), an amino acid, or a specific sequence of nucleotides, chemical change of one or more nucleotides, such as oxidation, methylation, or the like.
Unless described otherwise, “adjacent” refers to a relative position between components that permit a functional and beneficial interaction between the components. For example, a position may be functionally described as adjacent to a nanopore entrance. This refers to positions that result in an desired interaction with the nanopore entrance, such as the ability to enter the nanopore under an applied electric field. Alternatively, adjacent may refer to an absolute dimension, such as within 500 μm, within 250-μm, or within 100 μm.
The invention may be further understood by the following non-limiting examples. All references cited herein are hereby incorporated by reference to the extent not inconsistent with the disclosure herewith. Although the description herein contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of the invention. For example, the scope of the invention should be determined by the appended claims and their equivalents, rather than by the examples given. US 2014/0174927 is specifically incorporated by reference to the extent not inconsistent herewith for the systems, devices and methods provided therein as related to biomolecular characterization by transit of the biomolecule through a nanopore under an applied electric field.
Oxidative mechanisms in DNA and RNA are known to contribute to the initiation, promotion, and progression of disease. A list of oxidative modifications to DNA are outlined herein and summarized by Cooke et al. FASEB J. 2003; 17:1195-1214. The systems provided herein facilitate detection of a variety of these modifications through selective binding of an antibody and monitoring a passage parameter output during nanopore transit.
Oxidative DNA damage or DNA lesions including 8-OH-dG are established biomarkers of oxidative stress and coupled with their mutagenicity in mammalian cells, this has led to their proposed use as biomarkers in diseases such as cancer. For example, significantly higher levels of 8-OH-dG in tumor vs. non-tumor tissue was observed in primary breast cancer, elevated levels of 8-OH-dG in tumor tissue compared to normal mucosa in colon cancer, and lymphocyte DNA lesion levels significantly elevated in acute lymphoblastic leukemia (8-OH-Gua, 8-OHAde, 5-OH-Cyt) vs. controls.
Many oxidative base lesions are mutagenic. For example, 8-OH-dG has mutation frequencies of 2.5-4.8% in mammalian cells and for the most part, 8-OH-dG formed in situ results in G→T substitutions; alternatively, 8-OH-dGTP may be misincorporated opposite dA, producing an A→C substitutions. DNA oxidative damage also affects expression in other ways, for example, by altering DNA conformation during replication and transcription, preferential repair of certain oxidative subtypes and microsatellite instability in the promoters of various genes. Examples of this include reduced activities of the antioxidant enzymes catalase, glutathione peroxidase, and superoxide dismutase, with concomitant increased levels of oxidative DNA damage, as reported in acute lymphoblastic leukemia. GC3TA transversions potentially derived from 8-OH-dG have been observed in vivo in the ras oncogene and the p53 tumor suppressor gene in lung and liver cancer.
Detection of all of these different types of DNA and RNA modifications with a nanopore coupled with up-stream sample preparation described herein are applications compatible with any of the methods and systems provided herein.
Detection of Epigenetic Modifications: Demonstrated herein is detection of 5-methylcytosine (5mC). Genomic DNA, of course, contains other forms of modified cytosines, such as 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC), hemi-methylated DNA. All of these act as epigenetic marks that regulate gene expression. The nanopore based methylation detection assay described herein is compatible with any of these markers, with detection of 5mC being but one specifically exemplified embodiment.
5hmC exists as an independent epigenetic mark, as a potential demethylation intermediate product from 5mC in certain types of neurons and embryonic stemcells and as an intermediate oxidation state in the formation of 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). Thus the detection of these different states in single genes may be useful as a tool for monitoring progression or changes in DNA.
Weng et al. (Neurotherapeutics (2013) 10:556-567) suggest that neurons exhibit 5-10 times higher levels of 5hmC than other somatic tissues. Substantial increases in brain 5hmC levels with aging have also been observed. Together, these findings indicate that 5hmC may play a role in neurodevelopment, as well as pathogenesis of neurodegenerative diseases.
Families of proteins exist that bind to epigenetic modifications to translate this information into downstream biological processes. In mammals there are 3 families of methylCpG binding proteins that recognize methylated DNA: the Uhrf family, the methylCpG binding domain (MBD) family, and the Kaiso family. ZBTB4 and ZBTB38 are capable of recognizing a single methylated CpG dinucleotide. The methods and systems provided herein are compatible with any of these families, as well as any targeted antibody.
Pharmacogenetics and Monitoring Drug Response: Systems and methods provided herein can be used to monitor the demethylation status of specific genes in response to a variety of drug treatments, such as Decitabine. To date, a number of pharmacological agents that modify the epigenome—including inhibitors of DNA methylation and various histone modifications—have been developed and used both for research and the clinic. This is described further in Weng et al. Response to those drugs in terms of monitoring the binding to catalytic sites of DNMTs, hence preventing the formation of the DNA-protein complex can be studied. Note, 5-Aza and 5-Daz are nucleotide analogs of cytidine. Mechanistically, it is believed that 5-Aza and 5-Daz must be integrated into genome before irreversibly binding to the catalytic sites of DNMTs.
Detection of SNPs and Sequence Modifications: A number of proteins look for specific sequences on DNA (motifs) that they recognize before binding at that location. For example, Kaiso and ZBTB4 can recognize the consensus Kaiso binding site, TCCTGC, while ZBTB38 binds to the CACCTG E-box motif. These notable differences in DNA binding preferences indicate that generic protein-DNA binding interactions can be studied using the present nanopore-based platform to look for single nucleotide polymorphisms in these binding domains, which in certain cases correlate with specific diseases.
Detecting RNA Modifications (see Lee et al. Cell 158, Aug. 28, 2014, 980-987). Through the nanopore assay, we can detect modifications to RNA. Abundant noncoding RNAs such as rRNAs and tRNAs are extensively modified, whereas mRNA modifications are thought to be relatively low in frequency apart from the common terminal modifications, m7G cap and poly(A) tail. The most abundant internal modification on mRNA is N6-methyladenosine (m6A). Studies have revealed that the methylation status of some m6A sites dynamically changes in stress conditions, implicating a potential role of m6A in stress responses, preventing mRNA decay and disease. A number of approaches have been taken up to detect m6A. e.g. Methylation of a specific site can be quantitated by a digestion-based method called SCARLET as well as RNA seq. Through a nanopore assay of the instant invention, we can detect m6A by binding to specific proteins. For example, FTO is an m6A demethylase implicated in the dynamic and reversible nature of m6A modification with a binding domain to this modification. The YTH domain family is widespread in eukaryotes and is known to bind to ssRNA through the YTH domain. Though all YTHDF1-3 show selective binding to m6A embedded in consensus sequences, YTHDF2 has the highest affinity.
Epigenetic modifications in eukaryotic genomes occur primarily in the form of 5-methylcytosine (5 mC). These modifications are heavily involved in transcriptional repression, gene regulation, development and the progression of diseases including cancer. Provided herein is a new single-molecule assay for the detection of DNA methylation using solid-state nanopores. Methylation is detected by selectively labeling methylation sites with MBD1 (MBD-1x) proteins, the complex inducing a 3-fold increase in ionic blockage current relative to unmethylated DNA. Furthermore, the discrimination of methylated and unmethylated DNA is demonstrated in the presence of only a single bound protein, thereby giving a resolution of a single methylated CpG dinucleotide. The extent of methylation of a target molecule can also be coarsely quantified using this novel approach. This nanopore-based methylation sensitive assay circumvents the need for bisulfite conversion, fluorescent labeling, and PCR and is, therefore, very useful in studying the role of epigenetics in human disease.
DNA methylation is one of the most important and frequently occurring epigenetic modifications in mammalian cells and plays an essential role in regulating cell growth and proliferation. In humans, the most common epigenetic modification of DNA involves the addition of a methyl group at the 5-carbon position of cytosine (5-methylcytosine or 5 mC), which occurs exclusively at symmetric CO sites on the DNA double helix and are referred to as CpG dinucleotides. Hypermethylation of the promoter sequences of various genes has generally been associated with transcriptional repression through mechanisms such as the recruitment of methylated CpG binding proteins (MBDs), histone deacetylation and chromatin remodeling1,2. Furthermore, aberrant methylation in the promoter sequences of various genes can point to specific pathways disrupted in almost every tumor type including cancers of the prostate, breast, head and neck, lung and liver, whilst correlating with disease severity and metastatic potential3,4,5,6,7,8. In fact, the tumor prevalence of many methylation markers is considerably higher than that of genetic markers4; one example being the hypermethylation of CpG dinucleotides in the promoter sequence of the glutathione S-transferase pi (GSTP1) gene and is observed in over 90% of prostate cancer patients9. Methylation analysis will therefore likely play a pivotal role in the diagnosis and treatment of such diseases.
Interestingly, cancer-specific methylated DNA from most tumor types is present in biopsy specimens and also exist at very low concentrations in the form of free-floating DNA shed by apoptotic cancer cells4. Current genome-wide methylation analysis techniques rely on bisulfite genomic sequencing10 (bisulfite conversion of DNA, PCR amplification and DNA sequencing) and typically require large sample volumes due to DNA degradation during bisulfite conversion11, can exhibit low amplification efficiency and PCR bias12, and are labor intensive. Targeted methods involving analysis at specific loci or groups of genes such as methylation specific PCR (MSP)12, MethyLight13,14 and DNA microarrays15 overcome the need for sequencing but still rely on bisulfite conversion, amplification and complex probe design. Therefore, a bisulfite free, amplification free method capable of rapidly and accurately determining the methylation status of panels of genes from minute clinical sample volumes could be of tremendous clinical value.
This example demonstrates a new single molecule assay for determining the methylation status of DNA using solid-state nanopores. Nanopores use the principle of ionic current spectroscopy to electrically interrogate individual DNA molecules with the sensitivity to discern subtle structural motifs16,17. Fabrication of these devices typically involves the physical sputtering of a single nanometer sized aperture in a dielectric membrane using a focused electron beam18,19. The electrophoretic transport of biomolecules through these nano-scale pores has enabled the study of various biophysical phenomena at the single molecule level29, with potential applications in DNA sequencing and medical diagnostics16,21,22,23. (For reviews of nanopore research, see refs 24,25,26,27,28,29,30) Recently, methylated and unmethylated DNA has been examined optically in nanofluidic channels using fluorescently labeled proteins bound to the methylation sites31,32. Nanopore-based ionic current spectroscopy, however, is ideal for single molecule epigenetic analysis eliminating the need for optical measurements. Using nanopore based ionic current spectroscopy, the differentiation of methylcytosine from cytosine has previously been demonstrated by passing these individual nucleotides through a biological nanopore33, requiring an exonuclease based cleaving of the bases from the original molecule. To date ionic current measurements obtained using a solid-state nanopore, have yet to differentiate methylated from unmethylated single molecules of DNA34,35.
Herein, we demonstrate the electrical discrimination of unmethylated and methylated DNA using solid-state nanopores. Our technique does not require bisulfite conversion, sequencing or fluorescent tags but rather relies on the detection of methylated CpG dinucleotides in DNA by labeling with a 75 amino acid region of the methyl DNA binding protein MBD1, which includes a his-tagged single DNA binding domain and will hereafter be referred to as MBD-1x. The translocation of the methylated DNA—MBD-1x complex through a solid-state nanopore induced approximately a 3-fold increase in the measured blockage current relative to unmethylated DNA. The binding of a single MBD-1x protein to a methylated DNA fragment was sufficient for differentiation with high fidelity, thereby enabling single CpG dinucleotide sensitivity. Methylation could also be coarsely quantified based on the number of bound MBD-1x proteins per molecule, characterized by distinct timescales in the event translocation time histograms. As a result, this amplification- and fluorescent label-free, single molecule assay can be significantly useful in the rapid screening of epigenetic biomarkers for the early detection of diseases such as cancer.
Detection of unlabeled methylated and unmethylated DNA: The electrophoretic transport of double stranded DNA (dsDNA) through a solid-state nanopore is illustrated in the schematic of
Formation of DNA/MBD-1x Complex: To specifically label methylated DNA, we use the 75 amino acid methylated DNA binding domain of the protein MBD1. MBD1 plays an important role in gene silencing by recruiting AFT71P, which in turn recruits factors such as the histone methyltransferase SETDB1 and is essential in histone deacetylation and transcriptional repression in vertebrates43. Importantly, MBD1 binds symmetrically to methylated but not unmethylated CpG dinucleotides with high affinity44 and specificity43. The 75 amino acid MBD-1x is expressed in E. coli and protein purity verified using Coomassie stained gels and Western blot analysis (
Discrimination of mDLX1/MBD-1x complex from unmethylated DNA: Control experiments with nanopores of diameter of 4.5 nm and 7 nm, where these sizes are comparable with a single MBD-1x bound to DNA (5 nm) and multiple MBD-1x bound to DNA (7.6 nm), show that mDLX1/MBD-1x complex cannot translocate through these pores (
Methylation Quantification: To quantify the extent of DLX1 methylation, various ratios of MBD-1x to mDLX1 are incubated and then translocated through nanopores of diameter ranging from 9 to 10 nm. A pore diameter of 9-10 nm was specifically selected to allow for slower complex translocation. Translocation data for 1:30, 1:5 and 1:1 ratios of mDLX1/MBD-1x are shown in
Given a 1:1 DNA-protein ratio, the number of bound proteins per DNA molecule can be calculated using a Poisson limited random statistical distribution48. According to this model, the probability that a single DNA molecule will contain one or fewer bound proteins is ˜74%. Therefore, the majority of translocation events observed in
This example presents a new solid-state nanopore-based direct electrical analysis technique for detecting unmethylated and methylated DNA at the single molecule level. Using MBD-1x as a methylation specific label, the methylation status of nucleotide sequences corresponding to the promoter of DLX1, a potential epigenetic biomarker for cancer, could be rapidly determined without the need for bisulfite conversion, sequencing or fluorescent tags. Notably, the translocation of the mDLX1-protein complex versus uDLX1 induces an about 3-fold signal enhancement in the pore blockage current, enabling the electrical detection of a single methylated CpG dinucleotide-protein complex with high fidelity. The number of methylation sites per molecule can also be coarsely determined using this approach based on the number of bound MDB-1x proteins, characterized by distinct timescales in the corresponding translocation time histograms. Additional studies will determine the ultimate spatial resolution of this technique, these findings have an application in low-resolution gene based methylation analysis and the mapping of methylated CpG islands in the promoter sequences of various genes, essential to transcriptional repression and gene silencing3. Extending this technique to high resolution epigenetic mapping requires further improvements to the nanopore architecture. Nanopores used in these studies are 20 nm-thick in length (equivalent to ˜60 bps of dsDNA) and thus multiple bound proteins contributed to the measured ionic current (
Methods. Nanopore electrical measurements: Single nanopores of various diameters are sculpted using a JEOL 2010F field emission gun transmission electron microscope in 20 nm thick, low stress SiN membranes with window sizes of 50×50 μm2, supported on a silicon chip. Following pore formation, nanopore chips were cleaned in Piranha solution (two parts 95% H2SO4 and one part of 30% of H2O2) for 10 min and thoroughly rinsed with DI H2O. The chip was then sandwiched in a custom acrylic holder with the nanopore forming the only electrical path for ions between the two reservoirs. The recording solution for both sides was prepared with desired concentrations of KCl at pH 8.0 with 10 mM Tris.HCl and 1 mM EDTA. Ag/AgCl electrodes were immersed in the two reservoirs and an Axopatch 200B was used for applying potentials and measuring currents at a bandwidth of 10 kHz. Data was recorded at a sampling frequency of 100 kHz using a Digidata 1440A data acquisition system. Instrumental control and data analysis was performed using Clampex 10.2. All nanopore experiments were performed in a dark, double Faraday cage on an anti-vibration table at room temperature (22±2° 0).
DNA Preparation, Purification and Methylation: The 827 bp DNA fragment used was generated by conventional PCR of human genomic DNA (G304A, Promega, Madison, Wis.) and includes a region of the DLX1 gene (Homo sapiens distal-less homeobox). The region includes a nontranscribed area adjacent to a CpG island, the 5′ untranslated region (UTR), the complete first exon, part of the first intron and 36 potential CpG sites. The PCR primer sequences are; forward: gaccaatccccagtgattatgcaagac, reverse: ctcaatttgcaactatccagccaagg (as illustrated in
MBD-1x protein purification: BL21 DE3pLysS E. coli that had been transformed with a bacterial expression vector encoding his-tagged MBD-1x was exposed to 1 mM IPTG and incubated on an orbital shaker at 37° C. for 3 hours. Bacteria was then chilled on ice, centrifuged at 5000×g for 5 minutes at 4° C. and subjected to 3 freeze/thaw cycles. Lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) was added and the bacterial lysate was sonicated and spun at 10,000×g for 40 minutes at 4° C. The cleared lysate was added to a column packed with nickel-NTA agarose resin (Quiagen, Valencia, Calif.) on an Econo Protein Purification System (BioRad, Hercules, Calif.) and incubated for 2 hours to allow the his-tagged protein to bind to the nickel column. Guanadinium hydrochloride (5.5 M) was added to the column to denature the protein and a linear guanadinium hydrochloride gradient (5.5-0 M) was used to refold the protein. This renaturation step was critical for MBD-1x activity. The refolded MBD-1x was eluted with increasing concentrations of imidazole (10-250 mM) in elution buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0). Protein purity was assessed with Coomassie-stained gels and Western blot analysis using an anti-His antibody (SC-803, Santa Cruz Biotechnology, Santa Cruz, Calif.).
Gel shift assays: The 827 bp uDLX1 and mDLX1 DNA was end labeled with y[31P]ATP and T4 polynucleotide kinase (New England Biolabs, Ipswich, Mass.) and the radiolabeled DNA was separated from free 31P using Quick Spin Columns (Roche Diagnostics Corporation, Indianapolis, Ind.). The indicated amounts of purified MBD-1x were added to binding buffer (15 mM Tris pH 7.5, 80 mM KCl, 0.4 mM dithiothreitol, 0.2 mM EDTA, 1 ug poly[deoxyinosine/deoxycytosine], 10% glycerol) and incubated for 15 minutes at room temperature. Radiolabeled DNA was added and incubated for 25 minutes at room temperature in a final volume of 20 μl. Samples were fractionated on a low-ionic strength polyacrylamide gel at 4° C. with buffer recirculation as previously described55. Bands were visualized using autoradiography.
Molecular dynamics simulation—atomic model: The atomic model of silicon nitride membrane was constructed as described previously49. The thickness of the membrane is 20 nm. A symmetric double-conical pore was produced by removing atoms from the silicon nitride membrane with the diameter of the pore corresponds to experiment (9 nm, 10 nm and 12 nm). Atomic coordinates of mDNA-MBD complex were taken from the NMR structure of the methyl binding domain of MBD1 complexed with mDNA (Protein Data Bank entry code 1 IG446). Three mDNA-MBD complex were linked together to generate a long mDNA binding with three MBD proteins, see
DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on Example 1, we use methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and can be used to profile the position of methylated CpG sites on DNA fragments.
Epigenetic alterations involving DNA methylation, which include addition and/or removal of a methyl group at the 5-position of cytosine, are early and frequently observed events in carcinogenesis.13 Aberrant methylation occurs in the promoter sequences of various genes linked to many tumors.4_6 Hypermethylation is reported to be associated with cancers of the prostate, colon, lung, liver, breast, head and neck and further correlated with metastatic potential in many other tumor types.4,6-10 Also, high-throughput methylation analysis has uncovered aberrant DNA methylation in both premalignant and malignant neoplasia.11-14 Hypomethylation is reported to be associated with cancers of the kidney, stomach, liver, colon, pancreas, uterus, cervix, and lung.12,15-22 Thus, methylation analysis in DNA can play a critical role in the diagnosis of cancer, especially at an early, precancerous stage.
Previous studies have demonstrated the feasibility of detecting cancer by assessing methylation patterns from genomic extracts of body fluids such as plasma, serum, urine, and stool.4,23-25 However, the level of methylated DNA in these fluids is extremely low,26 and the size of the DNA fragments is quite small.27 As a result, most conventional methylation assays require large sample volumes. In addition to the DNA fragmentation that occurs in vivo, bisulfite conversion can lead to further DNA degradation,28,29 which additionally compromises the detection sensitivity of conventional methylation detection assays. Finally, most current assays employ polymerase chain reaction (PCR) amplification, which can introduce false-positive results.4 Thus, a simple, rapid, and reliable method to detect epigenetic modification of DNA, which uses small samples and eliminates bisulfite treatment and PCR amplification, has potential to revolutionize cancer diagnostics.
Here, we demonstrate a novel strategy to detect varying levels of methylation levels on double-stranded (ds) DNA using a solid-state nanopore-based sensor. The nanopore has been adapted to explore many biophysical questions through single-molecule investigation8,30-38 and in applications toward next generation DNA sequencing.39,40 A single-molecule detection technology using a nanopore sensor could be well-suited for gene-based methylation analysis,33,41 and here we demonstrate the capacity of nanopore sensors to detect methylation in 30, 60, and 90 bp double-stranded oligos. This approach is compatible with small amounts of genomic extracts and direct methylation detection without fluorescence labeling and bisulfite conversion. When integrated with sample preparation, the use of nanopore-based discrimination of various methylation patterns can provide a simple and affordable approach to early cancer detection.
Discrimination of a Variety of Methylation Levels in DNA Fragments: Nanopore-based sensors can detect single molecules as they traverse through a nanopore and alter the background ionic current. Using the principle of electrical current spectroscopy to interrogate biomolecules at the single-molecule level, the sensors can discern subtle structural motifs through sensitive detection of electrical current signatures. The crosssectional view of a solid-state nanopore is illustrated in
The methylated DNA detection method provided herein does not require bisulfite conversion and PCR amplification as is required for conventional methylation detection29 or fluorescent tags that are required for optical analysis.49 Rather, this nanopore-based detection method relies on direct, single-molecule electrical detection. Consequently, nanopore-based methylated DNA detection are useful in rapid screening for epigenetic biomarkers.
Selective Detection of Hypermethylation: A Nanopore relatively larger than the dimension of a methylated DNA fragment fully bound with MBD1x is utilized for the selective detection of hyMethDNA/MBD1x. The transmission electron microscopy (TEM) image of a 19 nm nanopore fabricated in a 10 nm thick SiN membrane (Norcada, Alberta, Canada) is shown in
In contrast, a series of significant nanopore current blockades are observed after adding a mixture containing 100 pM of hyMethDNA/MBD1x complex and 10 nM unMethDNA to the nanopore. The selective detection of hyMethDNA/MBD1x complex over unMethDNA through a 19 nm nanopore can be explained by rapid translocation velocity and a largely unoccupied nanopore with unMethDNA. Smeets et al. demonstrated translocation of 5k and 48.5k dsDNAs through a 24.2 nm nanopore, and the translocation velocity of those molecules was obtained at 0.173 and 0.039 μs/bp, respectively.50 The calculated translocation duration of 90 bp according to the velocity from these previous studies is ˜9.54 μs/molecule, which is undetectable from our recording sampling rate at 10 μs. Also, the current blockade of dsDNA of 2.2 nm diameter in a 19 nm nanopore is calculated to only be 1.2%, using the equation ΔI=(a/d)2, where a and dare diameters of the molecule and the nanopore, respectively. With about 20 nA open pore current with about 500 pA peak-to-peak baseline noise (
Meanwhile, the relatively larger diameter of the hyMethDNA/MBD1x complexes induces significant current blockade with larger blocked current during a prolonged translocation. Similar findings were reported with a RecA protein-coated dsDNA filament versus dsDNA alone.50 Due to an undetectable quick and shallow nanopore ionic current blockade of unMethDNA, the nanopore exclusively detected hyMethDNA bound to MBD1x in the mixture with unmethylated DNA. Also, we have shown that unbound MBD1x is positively charged at pH 7.6 of nanopore buffer solution, thus transport of unbound MBD1x is not observed at positive driving voltage across the nanopore.33 Consequently, a 19 nm nanopore can selectively detect translocation of the complexes and can screen the presence of methylated DNA in mixed sample solution. Representative long-term recordings of current blockades induced by transport of hyMethDNA/MBD1x complexes from 150 to 350 mV are shown in
The analyses of hyMethDNA/MBD1x complex transport through a 19 nm nanopore are presented in
Differentiation of hypermethylation from unmethylated DNA: The methylation patterns of human genomic DNA has recently been detected by collecting DNA on MBD chromatography columns after digesting methylated DNA into fragments with the restriction enzyme Msel.52 Herein, we further demonstrate the detection of hypermethylation using 30, 60, and 90 bp dsDNA. The hyMethDNA fragments contained 10% methylated CpGs uniformly distributed along the entire sequence, while unMethDNA fragments possessed no methylation. Nanopores with diameters ranging from 7.1 to 9.5 nm are utilized to detect methylated dsDNA. We demonstrated the discrimination of hypermethylated and nonmethylated DNA fragments.
First, 90 bp dsDNA fragments in a mixture (100 pM for both hyMethDNA and unMethDNA) were analyzed through a 7.7 nm diameter nanopore. The nanopore ionic current in
Current blockades are obtained by fitting the current blocking of events to a Gaussian function. Single-molecule transport of unMethDNA blocked a current of 0.433 nA at 250 mV and 0.561 nA at 300 mV, and fast-shallow events blocked a current of 0.429 nA at 250 mV and 0.537 nA at 300 mV. Consequently, the fast-shallow events in mixed solution represent single-molecule transport of unMethDNA through the nanopore rather than collisions of the complex at the entrance of the solid-state nanopore. Representative nanopore electrical signatures of single-molecule unMethDNA transport and single-molecule hyMethDNA/MBD1x complex transport in mixed events are shown in
Various length DNA fragments are also used to discriminate 10 pM of hyMethDNA fully bound with MBD1x in 1 nM of unMethDNA through nanopore ionic signatures of current blockage and duration. Representative current traces of unMethDNA and sample events of hyMethDNA/MBD1x are shown in
The comparison of single-molecule transport events between complex and unMethDNA recorded at 300 mV is shown in Table 1. Interestingly, the 90 bp hyMethDNA with 10 MBD1x shows significantly prolonged transport times compared to 30 bp hy-MethDNA with 3 MBD1x through nanopores of similar diameters (see Table 1). Interaction between MBD1x (on the DNA) and the surface of a nanopore with the opposite charge was reported to slow the translocation of hyMethDNA/MBD1x complexes through a nanopore.33 Consequently, more MBD1x-associated DNA has longer transport time. To confirm this interaction, single-molecule transport events of 90 bp hyMethDNA fully bound with MBD1x through 19 and 7.7 nm nanopores are also compared (
Detection of a CpG Dyad in Short dsDNA: The patterns of DNA epigenetic alterations in cancer vary from the individual CpG dyad at the local level to methylations in 1 million base pairs, or DNA demethylation during carcinogenesis which results in loss of methylation on both strands via possible intermediates of hemimethylated dyads.54 Although reduced methylation in DNA (hypomethylation) compared to a normal level is another major epigenetic modification in cancer cells, diagnosis of DNA hypomethylation using conventional techniques such as methylation-specific PCR is technically limited and challenging.55 Herein, a nanopore-based methylation assay demonstrates detection of reduced methylation at the local level single CpG dyad in the DNA fragment. We utilize KZF to detect local methylation in DNA fragments with its relevance to cancer and high binding affinity to methylated CpGs. KZF demonstrates high binding affinity of Kd=210 (±50 pM, forming 1:1 complexes with single consecutive methylated CpGs,45 and is reported to bind and silence aberrantly methylated DNA repair genes and tumor suppression in cancer cells.56 We select two repetitive methylated CpGs to mimic the methylation pattern of hypomethylation occurring in normally methylated CpG islands in somatic tissues.57
The target 90 bp loMethDNA fragments have 30 potential CpG methylation sites, but only two repetitive CpG sites at the center are methylated. The target fragments are also designed to have repeated sequences to mimic the hypomethylation occurring in repeated sequences of genomic DNA.54 The crystal structure of engineered KZF bound on DNA methylated sites is shown
Current blockade of the loMethDNA/KZF complex showed two distinct levels; the shallow current blockade of about 2 nA is attributed to transport of the DNA-only region of the complex, and the deeper blockage of about 4 nA is attributed to the region of DNA bound with KZF in complex. The peak of the shallow current blockade in the all-point histogram in
In summary, we utilize KZF to detect loMethDNA and to roughly determine the methylation location where the nanopore electrical current signature of loMethDNA/MBP demonstrated stepwise deeper current blocking, as shown in
This example is a direct electrical analysis technique to detect various methylation levels on DNA fragments at the single-molecule level using solid-state nanopores. Hypermethylated DNA, a molecular-level epigenetic biomarker for cancer, can be selectively labeled using MBD1x as a methylation-specific label and can be detected without the need for any further processes, such as bisulfite conversion, tagging with fluorescent agent, or sequencing. The large nanopore successfully exhibited exclusive detection of methylated DNA bound to MBD1x in a mixture with unmethylated DNA. This method has an initial application for screening the presence of hypermethylated DNA. Differentiation between hypermethylated and unmethylated dsDNA oligos is demonstrated using sub-10 nm nanopores, thus nanopore-based methylation assays also have the potential to identify abnormally methylated DNA in clinical tests aimed at diagnosis of diseases such as cancer. Hypomethylation in locally methylated CpG dyads is another epigenetic biomarker for cancer, and the methylated CpG dyads were labeled with KZF and discriminated from unmethylated DNA_hypomethylated DNA in this case. Furthermore, we can profile the methylation position in DNA. However, a nanopore-based methylation assay mproves the efficiency for low sample volume obtained from body fluids. Next steps include integrating a nanopore-based assay in a microfluidic system to collect genomic DNA samples adjacent to the nanopore and detect methylation in situ.
Bodily fluids, such as stool or blood, represent rich sources of genomic DNA that can be obtained noninvasively. DNA sequences can be hybrid-captured from such samples and concentrated near a nanopore integrated with a microfluidic system. Wanunu et al. showed successful nanopore detection of 1000 events in 15 min with a sample amount of 1 000 000 molecules/10 μL.58 The relative percentage of aberrantly methylated DNA in stool samples from patients with colorectal cancer averages about 5% but can be much lower in some instances.59 Using the approaches presented in this example, the nanopore-based methylation detection method may be used to develop a new methylation assay from small volume samples. This is a fundamental improvement and provides a rapid, accurate, and amplification-free methylation detection platform.
Solid-State Nanopore, Chemicals, and Materials: The free-standing low-stress SiN membranes with 10 nm thickness and 50×50 μm2 area, supported on a silicon substrate, were purchased from Norcada (Alberta, Canada). Single nanopores with various diameters were drilled with condensed electron beam using a JEOL 2010F field emission transmission electron microscope.
All custom DNA fragments including methylation patterns for nanopore experiments are synthesized and purchased from Integrated DNA Technologies (Coralville, Iowa). The nanopore measurements are performed in 1 M KCl at pH 7.6 containing 10 mM Tris and 1 mM ethylenediaminetetraacetic acid (EDTA) for hypermethylated DNA fragments bound with MBD1x and in 0.2 M NaCl at pH 7.6 containing 10 mM Tris and 1 mM EDTA for locally methylated DNA fragments bound with KZF. The methylated DNA/MBP complexes were prepared and incubated for 15 min at room temperature (25±2° C.) immediately before the nanopore experiment. Hypermethylated DNA was mixed with MBD1x in 80 mM KCl at pH 7.6 containing 10 mM Tris, 1 mM EDTA, and 0.4 mM DTT. The high ratio of MBD1x to methylated DNA is used to fully bind MBD1x to methylated DNA: ratio of 6:1 for 30 bp, 12:1 for 60 bp, and 20:1 for 90 bp methylated DNA. Locally methylated DNA and KZF are mixed in equal ratio in 200 mM NaCl at pH 7.6 containing 10 mM Tris, 1 mM ZnCl, and 1 mMTCEP.
Nanopore Electrical Measurements: Nanopore chips are piranha-cleaned (two-thirds of 95% H2SO4 and one-third of 30% H2O2) for 10 min and thoroughly rinsed five times with large amount of deionized H2O, and then the nanopore chip clamped and sealed between two custom acrylic chambers to form the nanopore, the only electrical path of ions between the two reservoirs. Ag/AgCl electrodes were immersed in reservoirs for ionic current recordings. Axopatch 200B was used for applying potentials and measuring currents, and data were recorded using a Digidata 1440A data acquisition system. Nanopore current traces were recorded using a 10 kHz built-in low-pass Bessel filter and 10 μs sampling rates. Instrumental control and data analysis were performed using Clampex 10.2 and Clampfit 10.2. All data points of current blockage were obtained using Gaussian fit, and transport duration was determined using an exponential decay function in Clampfit 10.2 software. Also, all error bars are given with standard error obtained during the fitting. All nanopore experiments were performed in a dark double Faraday cage on an antivibration table at room temperature (25±2° C.).
MBD1x Protein Purification: MBD1x purification is outlined in a previous report.33
Plasmid Construction: The Kaizo zinc finger DNA sequence is codon-optimized, PCR-amplified, and cloned into pUC19 (Fisher). The pUC19 plasmid is digested with Xma1 and subcloned into pQE80L (Quiagen) expression vector that is modified to contain mCherry and a thrombin cleavage site60 and digested with Xma1 (New England Biolabs) and calf intestinal alkaline phosphatase (New England Biolabs). The expression vector is transformed into DH5-alpha Escherichia coli, and positive colonies are checked by sequencing performed at the UIUC core sequencing facility.
KZF Protein Expression: The pQE80L expression vector containing mCherry-KZF is transformed into E. coli BL21 (DE3)pLysS. An overnight culture of a single colony was grown in Luria-Bertani medium with ampicillin (100 μg/L). The culture was expanded into 1 L of Luria-Bertani broth with ampicillin, and at OD600 of 0.3, isopropyl-D-thiogalactopyranoside (1.0 mM) was added to the culture. Cell pellets were harvested by centrifugation at 6000 g for 15 min at 4° C. and snap frozen.
KZF Protein Purification: Lysis buffer (20 mM Tris at pH 7.9, 0.1 mM ZnCl2, 8 M urea, 10% v/v glycerol, 500 mM NaCl, 10 mM imidazole) was added to the cell pellet and incubated with lysozyme (1 mg/mL) at 4° C. for 1 h. The lysate was sonicated and then centrifuged at 10 000 g at 4° C. for 1 h. The bacterial supernatant was added to a column packed with Ni-NTA resin for 1 h at 4° C. The column was extensively washed with wash buffer (20 mM Tris at pH 7.9, 0.1 mM ZnCl2, 10% v/v glycerol, 500 mM NaCl, 20 mM imidazole), and mCherry was cleaved by incubation with biotinlyated thrombin overnight at 4° C. Excess biotinylated thrombin was removed by streptavidin-coated beads and centrifugation. Protein was diluted in TDZ buffer (20 mM Tris at pH 7.9, 0.1 mM ZnCl2, 20% v/v glycerol) and injected into heparin column in an AKTA FPLC (GE HealthCare). The column was washed with 5-10 volumes of TDZ buffer with 200 mM NaCl, and the protein was eluted with TDZ buffer with q1 M NaCl; 70% glycerol was added, and the purified KZF protein was stored at −20° C.
Cancer is one of the leading causes of death in the United States accounting for nearly 1 in every 4 deaths, second only to heart disease. In 2014 alone, over 585,720 Americans were expected to die of cancer, more than 1,600 people a day.1 According to the American Cancer Society (ACS), about 1.67 million new cancer cases were expected to be diagnosed in the U.S. in 2014 not including the 1 million or so basal and squamous cell skin cancers. As a specific example, colorectal cancer and pancreatic cancer are the top two gastrointestinal cancers estimated of new cancer cases and deaths at both sexes in the US in 2014. See, e.g.,
As an epigenetic biomarker for cancer, the methylation profiles in human DNA hold enormous potential and may allow molecular staging, consequently utilizing methylation profiles is a promising approach for early cancer diagnosis, and monitoring progression and recurrence.4-8 Alterations in DNA methylation affect the structure of DNA without modifying the DNA sequence,4 and the epigenetic modification of human DNA involves the addition of a methyl group at the carbon-5 position of cytosine (5-methylcytosine) and occurs exclusively at CpG dinucleotides. The bulk of the human genome is depleted of CpG dinucleotides, however, there exist small CpG rich segments termed CpG islands located in the promoter sequences of various genes that are nearly always unmethylated.9,10 Hypermethylation of these islands has been associated with transcriptional repression through mechanisms such as the recruitment of methylated CpG binding proteins, histone deacetylation and chromatin remodeling.11,12 Aberrant methylation of these gene promoters can point to specific pathways disrupted in every type of cancer and can provide markers for sensitive detection of virtually all tumor types.13 In fact, the tumor prevalence of many methylation markers is considerably higher than that of genetic markers.9 Interestingly, epigenetic biomarker of methylated DNA (methDNA) can be obtained through noninvasive collection method.
Presented herein are exemplary integrated systems useful in reliable assays for diagnosis of disease states, such as a gastrointestinal cancer, incorporating a number of methodology; (1) Ability to extract DNA of interest from patients' stool sample allows the unique ability to interrogate epigenetic biomarker for gastrointestinal cancer; particularly methylation pattern on genomic DNA can provide diagnosis of the gastrointestinal cancer at its early-stage; (2) At the heart of the innovative method is a new detection approach using solid-state nanopore that allows electrical current signature to identify target methylation profiles on short DNA fragments bound with methyl-CpG-binding protein (MBP). This technique has the potential to detect methylation sites on a wide range of genomic dsDNA while circumventing laborious and low throughput PCR using bisulfite conversion of dsDNA; (3) The innovative on-chip nanopore integrated with a microfluidic channel to collect short DNA fragments captured on beads which are driven by magnetic forces to within a 500 μm×500 μm×150 μm chamber to increase the concentration of target sample at small volume above the nanopores, and the nanopore will detect methylation in short DNA fragments via electrical current signature. These approaches in combination result in a non-laborious, low cost, noninvasive and non-colonoscopic diagnostic tools toward gastrointestinal cancer for early-stage detection and prognosis monitoring. This technique is applicable to other cancers using patient samples from serum, urine, saliva, or biopsy for a range of clinical diagnostics.
The methods and integrated nanopore biosensors provide the most significant clinical diagnostic needs of noninvasive, affordable, and patient-friendly disease detection, including, but not limited to, cancer detection of GI cancers. We focus on detection of the methylation profile in short DNA fragments representative of GI cancer, including complete detection of bare DNA and MBP bound methDNA at single-molecule level through nanopore-based sensors. Other MBP binding to a portion of methylation CpG Island is investigated. Nanopores of diameter of 10 nm or less are used, fabricated in homogeneous membrane of SiN and surface chemically functionalized nanopore (SFN). We then demonstrate a diagnostic sensing technology with on-chip nanopore sensor equipped microfluidic system: extracting stool DNA from patients and forming complex with MBP, introducing the extracted DNA in microfluidic channel and concentrating immediately above a nanopore, releasing the DNA and methDNA/MBP complex from beads, and detecting methylation in DNA through solid-state nanopores. We focus on concentrating extracted DNA from buffer samples in a localized location in microfluidic channel; the extracted DNA in low concentration is attached on magnetic beads; the beads are captured in microfluidic device to increase the DNA concentration at the tiny local area, also referred herein as a “first fluid compartment region”, that is fluidically adjacent to a nanopore entrance”.
Detection of methylation in short DNA fragments: Current methods for gene based methylation analysis using bisulfite conversion are highly labor intensive, require large sample volumes, suffer from high per run cost and in most cases lack the sensitivity needed to derive useful clinical outcomes.28-31 In contrast, a nanopore based approach for early cancer detection and prognosis monitoring can deliver the sensitivity and speed needed in extracting useful clinical information, relevant to patient outcome. Nanopores detect and analyze biomolecules at the single-molecule level with high throughput.32 Recent progress in the nanopore research field, solid-state nanopores33 have shown great promise in healthcare oriented applications such as detecting biomolecules and distinguishing specific molecules in a mixture, leading to the development of diagnostic methods. Nanopore-based sensors have tremendous potential to discover novel methods for detecting disease and saving human life33,34 and for developing next generation DNA sequencing tools.35 As an investigation tool, nanopores have shown versatility in label-free DNA/RNA analysis. Nanopore-based sensor is obvious to create innovative healthcare applications. Our approach using nanopore-sensor is well suited for methylation analysis and is preferred over conventional methylation detection strategies due to its ability to (1) detect target molecules at low concentrations from minute sample volumes (2) detect a combination of methylation aberrations across a variety of genes (important in monitoring disease progression and prognosis) (3) detect subtle variations in methylation patterns across alleles that would not be detected using bulk ensemble averaging methods such as PCR and gel-electrophoresis (4) perform rapid methylation analysis (5) reduce cost and simplify steps of experiment and analysis by eliminating cumbersome PCR, DNA sequencing and bisulfite conversion steps (
Initial research focuses on the development of robust and versatile nanopores sensor for DNA analysis, and on the investigation of biophysics of single molecules. Solid-state nanopores are nanometer sized apertures formed in thin synthetic dielectric membranes (
Analysis of short DNA fragments: Most genomic stool DNA will have been digested into short fragments by restriction enzyme before delivered to the nanopore sensor. Due to the short length, swift transport duration of DNA through the nanopore-based sensor will make detection challenging. We synthesize control DNA (IDTDNA, Coralville, Iowa), imitating patients' stool DNA in length and methylation pattern. These control DNA dedicated for the control nanopore experiment, determining the optimal specification of the nanopore in terms of diameter and thickness. Nanopores in various diameters are fabricated in 10 nm-thick SiN membrane, widely used in nanopore research, and detected 90 bp DNA using 8 nm nanopore (
Analysis of MBP bound methDNA: Methylation in short DNA fragments will be detected with binding of MBPs. The passage of a MBP bound methDNA fragment through the nanopore will result in significantly different current signature from the passage of a bare DNA fragment. As the drop in pore current is attributed to the cross section of the translocating molecule, deeper current blockade are observed when the large, bound protein traverses the nanopore. Two types of MBP are used: MBD1x and KZF. These MBPs are engineered to contain only key element, required for binding to methylated CpG on DNA; MBD1x is key methyl-CpG-binding domain of Methyl-CpG-Binding Domain Protein (MBD);43 KZF is key domain binding to DNA of Kaiso Zinc Finger Protein.44,45 Consequently, these MBPs in compact size spanning to reduced number of base-pairs compared to its original protein form, therefore it could give more precise resolution of methylated CpG sites. Most of all, the compact dimension of these MBPs contributes to reduced dimension of the nanopores; making nanopore-based detection feasible for bare DNA. Otherwise, it would be more challenging to detect unlabeled short unmethylated DNA fragments using relatively large nanopore dimension of which would be required if using original form of MBPs. MBD1x spans 56 bps on DNA upon binding and molecular weight of 16.3 kDa,39 and KZF wraps around DNA, contacting 56 bps in total.44 Crystal structures of two MBPs on methylated DNA are shown in
Advanced analysis of methDNA using SFN: The detection of unlabeled methDNA (no bound MBP) using surface-functionalized nanopores (SFN) with anti-5-Methylcytosine (anti-5mC) antibodies is also attractive. The specificity and sensitivity of solid-state nanopore to methylation in DNA fragments can be greatly enhanced through surface chemical modification, using commercially available anti-5mC antibody. Translocation of unlabeled methDNA fragments through this SFN will result in highly specific anti-5mC antibody/methylation interactions that are expected to result in prolonged transport duration (
We target detecting MBP bound methDNA (10% methylation) and discrimination from unmethylated DNA with statistically significant difference in current blockage amplitude and duration. As described herein, we roughly quantify the methylation sites on the 827 bp DNA with careful analysis of transport duration.39 Similarly, we quantify the methylation sites on short DNA fragment with varying transport duration as well. As used herein, a short DNA fragment may refer to an oligonucleotide of less than 100 bp. In addition, KZF can detect single site of symmetric two continuous mCpGmCpG on 90 bp DNA. Consequently, KZF can be very useful to detect fragmented methylated CpG Island with less concentration of protein. Furthermore, SFN detect methylation with interaction between two chemicals without using MBP bound on DNA, thus this approach can be applied to single-stranded DNA as well. Our group has extensive experience in fabrication of nanopore as small as 1 nm in diameter so we expect to investigate methylated single-strand DNA as well.
The 30 bp long genes present challenges, but proper choice of dielectric and surface functionalization can slow the molecule enough to be detected via a 10 nm-thick Si3N4 member. Due to the short length of DNA fragments, methylation mapping on DNA would not be achieved through 10 nm-thick homogeneous membrane nanopore. While profiling is not needed for our specific application and information of hyper versus hypomethylation is extremely useful in itself, we can explore the use of a graphene layer embedded for sensitive discrimination. A single layer of graphene sheet as sensing electrode sandwiched between two dielectric layers from can possess the ability to sense a translocating molecule locally at the middle of membrane with 0.34 nm resolution.52 See also, U.S. Pub. No. 2014/0174927. Furthermore, a potential voltage can be applied through the graphene electrode to trap a MBP-bound region, because MBP is positively charged in solution due to the isoelectric point.39 This graphene could be used to study electrochemical exchange at an individual graphene edge and modulation of ionic current at the middle in the nanopore.52
Integrated diagnostic method using methylation profile detection: We demonstrate the feasibility of a complete diagnostic methods with control DNA from control samples (but designed toward later clinical samples of gastrointestinal cancer). Due to the ultra-low concentration of patients' stool DNA sample and to avoid laborious and low throughput of bisulfite treats and methyl specific PCR reaction, it is necessary to concentrate target DNA locally near the sensing element, i.e. the nanopore for integrated diagnosis. To fulfill this demand, we utilize a microfluidic system equipped with magnetic force driven beads as a collection technique. We will develop a nanopore-based on-chip sensor integrated with microfluidic system; introducing stool DNA on beads in microfluidic system, collecting beads immediately above the nanopore, release DNA and complex of DNA/protein, and detect the biomarkers using solid-state nanopore. Consequently, we make complex DNA/MBP on the beads and release the targets at very close distance from the nanopore. The concentration of DNA/beads can be performed via magnetic fields. The target DNA is extracted through methylated single stranded probe complementary to the target. The probe can be amino conjugated to the carboxylic acid-coated beads, bound to methyl-binding protein and equipped with releasable chemical linker between the bead and probe molecule. The probe is designed to have methylation on all CpG sites and four uracils in between terminal amino group and probe which that act as the releasable linker.
Briefly a capture element 10 illustrated as a magnetic bead with polynucleotide of interest 15 attached thereto (step 1). A biomarker 20 (step 2) may be provided that specifically binds to polynucleotide of interest exhibiting a biomolecular parameter. Step 3 is a close-up view of one DNA:biomarker complex 50, connected to bead surface 30 via cleavable linker 40. In this example, biomarker 20 is a MBD1x protein that binds methylated cytonsine. In step 4, a release element 60 selectively cleaves at the cleavable linker 40 to release the DNA:biomarker complex 50. The middle panel is a schematic illustration as to how steps 1-4 may be implemented within an integrated diagnostic system. Bead 10 with polynucleotide 15 obtained from a sample connected thereto via cleavable linker 40 may be provided to a microfluidic passage 100, which, in turn, fluidically transports the polynucleotide from the sample with the bead to a first fluid compartment region 90. Magnet 80 may capture the polynucleotide of interest in a region that is adjacent to the nanopore 140, specifically part of top fluid compartment formed in part by dielectric membrane top surface 150. To facilitate capture, the microfluidic passage 100 may have a cross-sectional area that is less than the cross-sectional area of the first fluid compartment region 90, that can substantially expand around the nanopassage pore by a separation distance indicated by arrow 160, such as a distance of between about 100 μm and 1000 m. In contrast, the microfluidic channel may have a characteristic cross-section distance of between 1 μm and 1000 μm. The first fluid compartment region may have a maximum cross-sectional area to flow, as indicated by arrow 161. This may be expressed as a ratio of cross-sectional area of flow at 161 to microfluidic passage 100 cross-sectional area to flow, that is greater than or equal to 10, 50, 100, or 500. In this manner, fluid velocity slows over the nanopore region, encouraging both settling of beads, and increase capture time via the capture element component 80, exemplified as magnetic beads 10 and magnetic elements 80. Other forces, of course may be used, including electrokinetic paired with compatible polynucleotides and/or beads. The various fluidic components are added to the microfluidic channel, as indicated by 110 (sample), 120 (biomarker), and 130 (release element). Accordingly, any of the methods and systems may further comprise the step decreasing polynucleotide of interest flow velocity in a region adjacent to a nanopore entrance, thereby increasing the time for capture in a desired region of the first fluid compartment, and improvising distribution relative to the nanopore entrance to provide the functional benefit of increased sensitivity, signal to noise, and overall reliability and robustness of the method.
Turning to the solid state nanopore and related elements,
We have successfully extracted genomic methylated stool DNA through sequence-specific purification. Stool DNA is isolated from solids and clarified. To capture the target DNA, an amount of 150 μl of carboxylic acid-coated beads with amino conjugated oligonucleotides complementary to target sequence (IDTDNA) is added and mixed to allow hybridization at room temperature. Supernatant is removed when sample tubes were placed on magnetic beads, then washed in MOPs buffer (10 mM MOPS, 150 mM NaCl, pH 7.5) to remove remaining inhibitors. Finally, heated tRNA elution buffer was added and the beads removed with centrifugation to collect target DNA. After capturing, target DNA was bisulfite treated and amplified using methylation-specific PCR (MSP) reactions.16 Most commonly used gold standard assay technique so far for DNA methylation assay requires bisulfite conversion and amplification due to low-concentration of DNA analytes obtained from patients' sample. Consequently, alternative method to increase DNA concentration at the sensing point is demanded for amplification-free high throughput DNA assay. To achieve reliable and fast detection of DNA using a nanopore-based sensor, high concentration of DNA close to the nanopore sensor is required. We will use carboxylic acid-coated magnetic beads to capture and deliver DNA to the specific local volume in on-chip nanopore sensor. Magnetic beads are easily pulled to the permanent magnet and carboxylic acid-coated surface can capture DNA (
Extracting DNA fragments in buffer solution. The methods and systems described herein provide for an improved extracting method that can handle multiple functions: capturing DNA fragments, allowing biomarker (such as MBP) to selectively bind the DNA (for MBP: only on symmetrically methylated CpG dinucleotides), and releasing DNA from magnetic beads. The methylated DNA fragments are extracted from buffer solution in sequence-specific way using complementary probe. The probe will be designed to be complementary to the target methDNA fragments and amino conjugated to the carboxylic acid-coated beads. Beads will be introduced to the buffer solution containing target and extract target DNA via hybridization with the probe at room temperature. On the probe, all CpG sites will be methylated, and, upon hybridization between complementary probe and target sequence DNA, only the dsDNA paired with methylated target DNA would form symmetric methylation on CpG dinucleotides, which MBP can bind to. We have specially engineered and purified in-vitro MBP and shown that MBD1x binds specifically and exclusively to a single symmetric methylated CpG dinucleotides.39 Consequently, although the fully methylated complementary hybridized with unmethylated target DNA, the hemi-methylation pattern would not allow MBD1x to bind on it. We also have another protein as described earlier, the Kaiso zinc finger (KZF) protein that binds specifically to adjacent two methylated CpG (MpGMpG) site, a pattern that is very common in fragmented methylated CpG island. This KZF is very useful to make a complex with aberrant methylation in CpG islands, which is known to be related with cancer occurrence. As continuous methylation in a row on dsDNA is ubiquitous in CpG island, usage of KZF protein would be suitable to detect cancer gene marker consisted of unspecific methylation pattern in CpG island. We will also examine the binding affinity of KZF to hemi-methylated DNA and single symmetric methylated CpG dinucleotides. It is known that KZF recognizes the asymmetric methylation on single strand, and also recognizes single symmetric methylated CpG dinucleotides with slightly less affinity.44 The binding affinity of KZF to hemi-methylated DNA is very useful to extract methylated DNA using unmethylated complementary probe.
Concentrating DNA on-chip microfluidic channel using magnet: We concentrate DNA using magnetic force driven beads collection method. Beads are introduced into a microfluidic flow passing the top of nanopore and collected from the microfluidic flow using a permanent magnet. Magnetic beads must overcome inertial force which follows flow stream line to turn their movement toward the permanent magnet so the average flow velocity should be as small as possible. In order to decrease the flow velocity near the nanopore, 5 mm in diameter flow reservoir was designed. With 5 ul/min flow through the microfluidic flow shown in
Releasing DNA and methDNA/MBP from the beads: The probe is designed to have four uracils between the amino conjugation terminal and complementary sequence. The four uracils in either form of ssDNA and dsDNA can be recognized and digested by Uracil-DNA glycosylase (UDG) restriction enzyme. Thus these four uracils form the cutting point of DNA from beads. We cut at this site with UDG and release the DNA and MBP bound methDNA from the beads. When the bead collection is saturated, we introduce UDG to the microfluidic flow. Since the beads are uniformly distributed along the rim of micromagnet for the case of
The protocols for the capture of DNA molecules and the integration with the nanopore sensors are optimized. Control experiments of amine conjugation of complementary to beads are performed. We will mix fluorescently labeled complementary with beads and optically monitor the flow of beads with fluorescence microscopy. With this fluorescently complementary, we confirm the conjugation of complementary to beads, beads capturing on micromagnet, and detachment of complementary from beads after adding UDG.
After releasing DNA and complex from the beads, UDG remains near the nanopore and could interfere with the electrical current measuring by touching or blocking the nanopore. However, the isoelectric point of UDG is 9.0 and our nanopore sensing performs in salt solution titrated pH in range of 7.6 and 8.0.53 Thus the protein is positively charged due to the isoelectric and will be pushed away from the nanopore at positively applied potential voltage. In addition to beads collection to increase local DNA concentration, we also can use DNA attraction using different salt ingredients at two chambers of nanopore setup. Previous salt gradient study reported up to 30-fold enhanced detection by providing higher salt gradient to trans side when molecule was added to cis side. Our preliminary typical patient's stool DNA collection can obtain 100,000 molecules in 60 μl with the plus margin to the 200,000 molecules in 60 μl. Wanunu et al. demonstrated successful detection of 1000 events in 15 minutes using DNA concentration of 1,000,000 in 10 μl.54 The DNA concentration may increase up to 500-fold near the nanopore area. Thus, increased concentration would be 833,000 molecules in 10 μl. If we use salt gradient in our on-chip, we will have 250,000,000 molecules in 10 μl.
Nanopore-based methylation detection can be extended to include the analysis of clinical stool DNA, specifically the detection of aberrant methylation patterns in stool DNA isolated from stool sample of gastrointestinal cancer patients. Aberrant methylation of the promoter sequences of various genes has been implicated in cancers and easily obtainable noninvasively from patients' body fluid. Nanopore-based gene based methylation detection for small volume can satisfy this important clinical need. The application of this nanopore-based screening of epigenetic cancer is broad and pervasive in providing simple gene based methylation detection for cancer diagnostics and prognostics.
All references throughout this application, for example patent documents including issued or granted patents or equivalents; patent application publications; and non-patent literature documents or other source material; are hereby incorporated by reference herein in their entireties, as though individually incorporated by reference, to the extent each reference is at least partially not inconsistent with the disclosure in this application (for example, a reference that is partially inconsistent is incorporated by reference except for the partially inconsistent portion of the reference).
The terms and expressions which have been employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments, exemplary embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. The specific embodiments provided herein are examples of useful embodiments of the present invention and it will be apparent to one skilled in the art that the present invention may be carried out using a large number of variations of the devices, device components, methods steps set forth in the present description. As will be obvious to one of skill in the art, methods and devices useful for the present methods can include a large number of optional composition and processing elements and steps.
When a group of substituents is disclosed herein, it is understood that all individual members of that group and all subgroups, are disclosed separately. When a Markush group or other grouping is used herein, all individual members of the group and all combinations and subcombinations possible of the group are intended to be individually included in the disclosure.
Every formulation or combination of components described or exemplified herein can be used to practice the invention, unless otherwise stated.
Whenever a range is given in the specification, for example, a temperature range, a size range, a parameter range, a time range, or a composition or concentration range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. It will be understood that any subranges or individual values in a range or subrange that are included in the description herein can be excluded from the claims herein.
All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. References cited herein are incorporated by reference herein in their entirety to indicate the state of the art as of their publication or filing date and it is intended that this information can be employed herein, if needed, to exclude specific embodiments that are in the prior art. For example, when composition of matter are claimed, it should be understood that compounds known and available in the art prior to Applicant's invention, including compounds for which an enabling disclosure is provided in the references cited herein, are not intended to be included in the composition of matter claims herein.
As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. In each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.
One of ordinary skill in the art will appreciate that starting materials, biological materials, reagents, synthetic methods, purification methods, analytical methods, assay methods, and biological methods other than those specifically exemplified can be employed in the practice of the invention without resort to undue experimentation. All art-known functional equivalents, of any such materials and methods are intended to be included in this invention. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
aValues are extracted from transport events recorded at 300 mV.
This application claims the benefit of priority from U.S. Provisional Patent Application No. 61/950,828 filed Mar. 10, 2014, which is hereby incorporated by reference in its entirety to the extent not inconsistent herewith.
This invention was made with government support under R21 CA155863 and NCI R25 CA154015 awarded by the National Institutes of Health. The government has certain rights in the invention.
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/US15/19630 | 3/10/2015 | WO | 00 |
Number | Date | Country | |
---|---|---|---|
61950828 | Mar 2014 | US |