1. Field of the Invention
Embodiments of the present invention relate generally to the detection of methylated nucleic acids, and to Raman spectroscopy.
2. Background Information
Although regulation of gene expression is a complex process, epigenetic events, such as the methylation of DNA, play important roles in the regulation of gene expression. DNA methylation in vivo is a post-synthetic modification associated with the silencing (or turning off) of genes. Mechanistically, DNA methylation has been associated with closed chromatin state (the three dimensional structure adopted by DNA in a cell nucleus) and therefore repressed or inactive genes. DNA methylation typically occurs at CpG sites or clusters of CpG called CpG islands. Epigenetic alterations, such as the methylation of DNA, modify genetic expression without changes to the DNA sequence.
Epigenetic traits can be inherited, yet are not based on a change in the DNA sequence of a gene. It has been found that DNA methylation patterns differ between healthy and diseased tissue thereby allowing DNA methylation to serve as a biomarker for disease states. Sensitive detection of DNA methylation or lack thereof in samples of DNA from patients may allow the early detection of disease. For example, in breast cancers DNA methylation is the most common cause of inactivation of the p16 gene, an important regulator of cell division. In addition, cells with a methylated p16 gene in substantial number of healthy, cancer-free women have been found suggesting that p16 methylation may be an important early event in the transition of normal breast cells into a pre-cancerous state. This data provides just one example of the possibility for the early detection of a disease based on the methylation of a portion of the genome. In many diseases, like cancer, early detection leads to improved outcomes for patients.
Among the many analytical techniques that can be used for chemical analyses, surface-enhanced Raman spectroscopy (SERS) has proven to be a sensitive method. A Raman spectrum, similar to an infrared spectrum, consists of a wavelength distribution of bands corresponding to molecular vibrations specific to the sample being analyzed (the analyte). Raman spectroscopy probes vibrational modes of a molecule and the resulting spectrum, similar to an infrared spectrum, is fingerprint-like in nature. As compared to the fluorescent spectrum of a molecule which normally has a single peak exhibiting a half peak width of tens of nanometers to hundreds of nanometers, a Raman spectrum has multiple structure-related peaks with half peak widths as small as a few nanometers.
To obtain a Raman spectrum, typically a beam from a light source, such as a laser, is focused on the sample generating inelastically scattered radiation which is optically collected and directed into a wavelength-dispersive spectrometer. Although Raman scattering is a relatively low probability event, SERS can be used to enhance signal intensity in the resulting vibrational spectrum. Enhancement techniques make it possible to obtain a 106 to 1014 fold increase in Raman signal intensity.
A polynucleotide can be RNA or DNA, and can be a gene or a portion thereof, a cDNA, a synthetic polydeoxyribonucleic acid sequence, or the like, and can be single stranded or double stranded, as well as a DNA/RNA hybrid. In various embodiments, a polynucleotide, including an oligonucleotide (for example, a probe or a primer) can contain nucleoside or nucleotide analogs, or a backbone bond other than a phosphodiester bond. In general, the nucleotides comprising a polynucleotide are naturally occurring deoxyribonucleotides, such as adenine, cytosine, guanine or thymine linked to 2′-deoxyribose, or ribonucleotides such as adenine, cytosine, guanine or uracil linked to ribose. However, a polynucleotide or oligonucleotide also can contain nucleotide analogs, including non-naturally occurring synthetic nucleotides or modified naturally occurring nucleotides. One example of an oligomeric compound or an oligonucleotide mimetic that has been shown to have good hybridization properties is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example an aminoethylglycine backbone. In this example, the nucleobases are retained and bound directly or indirectly to an aza nitrogen atom of the amide portion of the backbone. PNA compounds are disclosed in Nielsen et al., Science, 254:1497-15 (1991), for example.
The covalent bond linking the nucleotides of a polynucleotide generally is a phosphodiester bond. However, the covalent bond also can be any of a number of other types of bonds, including a thiodiester bond, a phosphorothioate bond, a peptide-like amide bond or any other bond known to those in the art as useful for linking nucleotides to produce synthetic polynucleotides. The incorporation of non-naturally occurring nucleotide analogs or bonds linking the nucleotides or analogs can be particularly useful where the polynucleotide is to be exposed to an environment that can contain nucleolytic activity, including, for example, a tissue culture medium or upon administration to a living subject, since the modified polynucleotides can be less susceptible to degradation.
Referring now to
In further embodiments of the present invention, priming and complementary DNA synthesis occurs in the presence of labeled nucleotides, such as, for example, labeled adenine or labeled thymine nucleotides, or labeled guanine or labeled cytosine nucleotides. In this case the labeled nucleotides are incorporated into the growing complementary DNA polymers. The labels are capable of providing distinctive Raman spectra. Thus, when the converted and the unconverted samples of DNA are associated with a Raman-active surface and Raman spectra are obtained, the distinctive spectra from the label molecules are visible. A comparison between the converted and the unconverted DNA polymer samples provides the ability to determine the methylation state of the DNA polymer. Some exemplary labeled nucleotides include, trinitrophenyl (TNP) labeled nucleotides, TMR labeled nucleotides, Texas Red labeled nucleotides, ROX labeled nucleotides, Rhodamine labeled nucleotides, Rhodamine Green labeled nucleotides, R6G labeled nucleotides, R110 labeled nucleotides, Fluorescein labeled nucleotides, Digoxigenin labeled nucleotides, Cy3 labeled nucleotides, Cy5 labeled nucleotides, Alexa Fluor labeled nucleotides, Aminonaphthalenesulfonate (AmNS) labeled nucleotides, BODIPY labeled nucleotides, caged nucleotides, Coumarin labeled nucleotides, fluorescein-12-dUTP, tetramethylrhodamine-6-dUTP, texas red-5-dUTP, lissamine-5-dUTP, diethylaminocoumarin-5-dUTP, cyanine-3-dUTP, cyanine-5-dUTP, fluorescein-12-dATP, and texas red-5-dATP. In general, any dye labeled dU (deoxy Uridine triphosphate), dT (deoxy Thymidine triphosphate), and dA (deoxy Adenine triphosphate) analogs are useful for labeling methylation site nucleotides. Suitable labeled nucleotides are, for example, commercially available from PerkinElmer Life and Analytical Science (Waltham, Mass., USA), Jena Bioscience (Jena, Germany), and Sierra Bioresearch (Phoenix, Ariz., USA).
Optionally other nucleotide base modification procedures may be employed and a resulting change in DNA sequence detected with surface-enhanced Raman spectroscopy. For example, at neutral or alkaline pH, 5-methyl cytosine in DNA can be deaminated using high temperature, with grater rate than that of cytosine, resulting in the replacement of the 5-methyl cytosine with a thymine base. See for example, Wang, R. Y. et al., “Heat- and alkali-induced deamination of 5-methylcytosine residue in DNA,” Biochim. Biophys ACTA, 697:3, 371-7 (1982).
Further optionally, DNA methylation sites may be detected by using an enzymatic process other than the primer-extension process. For example, Uracil DNA Glycosylases (UDG) (an enzyme) removes dU from the DNA to form an apurinic/apyrimidinic site, which in turn can be modified by other DNA repair enzymes such as APE 1 and Enconuclease IV to form a free 3′-OH group. This free 3′-OH group can be further modified through terminal addition by terminal transferase (TdT) (an enzyme) incorporation of labeled nucleotide(s) or analogs. (UDG, TdT, APE1, and Endonuclease IV are commercially available, for example, from New England Biolabs-NEB, Ipswich, Mass., USA). The labeled nucleotide(s) or analogue(s) can then serve as detection target(s) for SERS analysis.
The nucleic acid analyte may be found directly in a sample such as a body fluid from a host. The sample can be examined directly or may be pretreated to render the analyte more readily detectible. The body fluid can be, for example, urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears, mucus, and the like. In addition, the detection target can be any type of animal or plant cell, or unicellular organism. For example, an animal cell could be a mammalian cell such as an immune cell, a cancer cell, a cell bearing a blood group antigen such as A, B, D, etc., or an HLA antigen, or virus-infected cell. Further, the target cell could be a microorganism, for example, bacterium, algae, or protozoan.
Typically, a sample obtained from a biologic source, such as for example, a bodily fluid or cell lysate solution, is a complex mixture of proteins and other molecules. The components of the mixture can be separated using known techniques for isolating nucleic acid containing fractions, from biologic samples, such as for example, physical or affinity based separation techniques. The isolated nucleic acid fraction can then optionally be digested into smaller nucleic acids and or oligonucleotides. Typical methods include enzymatic digestions using, for example, type II restriction enzymes such as, AluI, BamHI, EcoRI, EcoRII, EcoRV, KpnI, NotI, HaeII, HindIII, BglI, and MboII. Restriction enzymes are endonucleases that cleave DNA polymers in response to a specific sequence of nucleotides, called restriction or recognition sites. DNA methylation site-related enzymes include, for example, McrBC endonuclease (commercially available from New England Biolabs-NEB, Ipswich, Mass., USA), which specifically recognizes methylation sites, and restriction endonucleases that are sensitive to methylation sites (and do not cut the DNA at the site), which include, AatII, AciI, AclI, AfeI, AscI, AsiSI, AvaI, BceAI, BmgBI, BasAI, BasHI, BsiEI, BsiWI, BsmBI, BspDI, BspEI, BsrBI, BsrFI, BssHII, BstBI, BstUI, ClaI, EagI, FauI, FseI, FspI, NotI, NGoMIV, NarI, NaeI, KasI, HpaII, HinPlI, SacII, SalI, SfoI, SmaI, SnaBI, and Xhol (among others) (commercially available from New England Biolabs-NEB, Ipswich, Mass., USA).
SERS Raman signal enhancement can occur through the association of the sample with a Raman active metal surface. Raman active surfaces of various forms can be used in embodiments of the present invention. For example, Raman active surfaces include, but are not limited to: a metallic surface, such as one or more layers of nanocrystalline and/or porous silicon coated with a metal or other conductive material; a particle, such as a metallic nanoparticle; an aggregate of particles, such as a metallic nanoparticle aggregate; a colloid of particles (with ionic compounds), such as a metallic nanoparticle colloid; or combinations thereof. Typical metals used for Raman enhancement include, silver, gold, platinum, palladium, copper, aluminum, zinc, iron or other conductive materials, although any metals capable of providing a SERS signal may be used. Especially large SERS enhancements have been observed with gold and silver surfaces. Additionally, the particles used to give SERS enhancements may be comprised of more than metal. For example, the particle could be silver coated gold or vice versa. The particles or colloid surfaces can be of various shapes and sizes. In various embodiments of the invention, nanoparticles of between 1 nanometer (nm) and 2 micrometers (μm) in diameter may be used. In alternative embodiments of the invention, nanoparticles of 2 nm to 1 μm, 5 nm to 500 nm, 10 nm to 200 nm, 20 nm to 100 nm, 30 nm to 80 nm, 40 nm to 70 nm or 50 nm to 60 nm diameter may be used. In certain embodiments of the invention, nanoparticles with an average diameter of 10 to 50 nm, 50 to 100 nm or about 100 nm may be used.
Substrate materials and or layer(s) used in embodiments of the invention may be porous or non-porous. For example, a substrate may be comprised of porous silicon. Further, substrates, including porous substrates, may be coated with a SERS-active metal layer in order to, for example, enhance SERS detection. Suitable porous materials include porous silicon (e.g., single crystal porous silicon), porous polysilicon, porous ceramics (e.g., those made from fibrous porous silicon nitride), porous silica, porous alumina, porous silicon-germanium, porous germanium, porous gallium arsenide, porous gallium phosphide, porous zinc oxide, and porous silicon carbide. Methods of making such porous materials are generally known. See, for example, Dougherty et al. (2002) Mat. Res. Soc. Symp. Proc. 687:B.7.3.1-B.7.3.6 (porous polysilicon), Ohji (2001) AIST Today 1:28-31 (porous ceramics), Trau et al. (1997) Nature 390:674-676 (porous silica), Masuda et al. (1995) Science 268:1466-1468 (porous alumina), Li et al. (1999) Adv. Mater. 11:483-487 (porous alumina), Nielsch et al. (2000) Adv. Mater. 12:582-586 (porous alumina), Buttard et al. (1997) Thin Solid Films 297:233-236 (porous silicon-germanium), van Vugt et al. (2002) Chem Commun. 2002:2054-2055 (porous germanium), Kamenev et al. (2000) Semiconductors 34:728-731 (porous gallium arsenide), Buzynin et al. (2000) Tech. Physics 45:650-652 (porous gallium arsenide), Shuurmans et al. (1999) Science 284:141-143 (porous gallium phosphide), Lubberhuizen et al. (2000) J. Porous Mat. 7:147-152 (porous gallium phosphide), Terada et al. (1999) 4th Int'l. Conf. on Ecomaterials P-30:559-562 (porous zinc oxide), Jessensky et al. (1997) Thin Solid Films 297:224-228 (porous silicon carbide), Spanier et al. (2000) Appl. Phys. Lett. 76:3879-3881 (porous silicon carbide), Spanier et al. (2000) Physical Review B 61:10437-10450 (porous silicon carbide), and Sangsig et al. (2000) Jpn. J. Appl. Phys. 39:5875-5878 (porous silicon carbide). The substrate can include a plurality of layers of the porous material.
Porous silicon is a material that can be made simply and inexpensively. As observed by high resolution scanning and transmission electron microscope, porous silicon typically has pore diameters varying from a few nanometers to several micrometers, depending upon the conditions under which the porous silicon was formed. The term “porous” as used herein may be defined consistent with the IUPAC guidelines, wherein “microporous” refers to pores having a size regime that is less than or equal to two nanometers (nm), “mesoporous” refers to pores having a size regime that is between about 2 and 50 nm, and “macroporous” refers to pores having a size regime that is greater than about 50 nm. See e.g., Cullis et al. (1997) J. Appl. Phys. Rev. 82:909-965. Porous materials, such as porous silicon, may be made by many different techniques, the most common of which is one using electrochemistry because a relatively large and relatively homogeneous substrate can be readily formed by such technique. While porous silicon substrates can be prepared by a variety of techniques, such as, for example, stain etching and anodic etching, preferably, porous silicon substrates are prepared by anodic electrochemical etching. Anodic electrochemical etching permits control of properties of the formed substrate such as, for example, microstructure, pore diameter, porosity, refractive index, and thickness. Anodic electrochemical etching includes immersing an electrode (e.g., a platinum electrode) and a silicon wafer in an electrolytic bath containing, for example, water, ethanol, and hydrofluoric acid (HF), or solutions of hydrogen nitrate (HNO3) in HF. While in solution, the wafer is subjected to a constant current in a range of about 1 mA/cm2 to about 1000 mA/cm2. The current is applied to the wafer for a time period ranging from several seconds to several hours, preferably for up to about one hour, to form a layer of porous silicon at or on the surface of the wafer. Etching and anodization can occur with or without illumination depending upon the type of substrate dopant.
Surface enhanced Raman spectroscopy is performed on a sample by, for example, mixing the sample with a SERS solution comprising a Raman active surface, such as for example, colloidal silver metal particles; depositing and drying the digested sample onto a substrate and subsequently adding a SERS solution, such as a colloidal silver solution; depositing the sample onto a SERS-active substrate; or it can be performed in-line in a component of a microfluidic or nanofluidic system, such as by using a micro or nanomixer to mix the SERS solution with a the sample and subsequently performing Raman analysis on the sample. A silver colloidal solution can be mixed with sample eluants in a fluidic format, optionally, on a chip using microfluidics, and the detection can be performed inline as the eluants are flowing through the laser detection volume. In additional embodiments, some or all of these steps are performed using microfluidic or nanofluidic systems. Optionally, Raman enhancements may be achieved through the use of lithium chloride (LiCl) in conjunction with the Raman active metal surface. For example, lithium chloride may be added to a silver nanoparticle solution at a final concentration of 0.18 M and the silver nanoparticle solution placed in contact with the DNA solution in order to enhance the Raman signal from the nucleic acids. See for example, U.S. Pat. No. 7,019,828, entitled “Chemical Enhancement in Surface Enhanced Raman Scattering Using Lithium Salts.”
Micro or nanofluidic analytical systems (lab-on-a-chip type devices) typically are created from a network of channels and reservoirs (or wells) formed in a substrate. Nanofluidics refers to devices having channels that are about 100 to 1000 times smaller than microfluidic channels. Typical substrates include, for example, glass, quartz, polymers, especially biocompatible polymers, such as for example polydimethylsiloxane (PDMS), polystyrene, polyethylene, metals, silicon, silicon nitride, and silicon oxide, although any machinable, etchable, reformable, moldable, stampable, embossable, or castable elastomeric material (a material that is capable of deforming when pressure is applied and returning to its original shape when pressure is removed) may potentially be used for all or some part(s) of the device. Fluid may be moved through the chip by a variety of mechanisms, including electrokinetic or electroosmotic forces, pumps, peristaltic pumps, gravity, injectors, syringes, and membrane-actuated pumps. Lab-on-a-chip devices may perform operations such as, for example, sample handling, mixing, dilution, eletrophoretic, chromatographic, and size-based separations, molecular labeling and detection. Because the volume of fluids within microchannels is very small, usually several nanoliters or less, the amount of reagents and analytes used is small.
In the practice of embodiments of the present invention, a Raman spectrometer can be part of a detection unit designed to detect and quantify phosphopeptides labeled with Raman tags by Raman spectroscopy. Methods for detection of Raman labeled analytes, for example nucleotides, using Raman spectroscopy are known in the art. See, for example, U.S. Pat. Nos. 5,306,403; 6,002,471; and 6,174,677. A non-limiting example of a Raman detection unit is disclosed in U.S. Pat. No. 6,002,471. An excitation beam is generated by either a frequency doubled Nd:YAG laser at 532 nm wavelength or a frequency doubled Ti:sapphire laser at 365 nm wavelength. Pulsed laser beams or continuous laser beams may be used. The excitation beam passes through confocal optics and a microscope objective, and is focused onto the flow path and/or the flow-through cell. The Raman emission light from the labeled nanoparticles is collected by the microscope objective and the confocal optics and is coupled to a monochromator for spectral dissociation. The confocal optics includes a combination of dichroic filters, barrier filters, confocal pinholes, lenses, and mirrors for reducing the background signal. Standard full field optics can be used as well as confocal optics. The Raman emission signal is detected by a Raman detector, which includes an avalanche photodiode interfaced with a computer for counting and digitization of the signal.
Another example of a Raman detection unit is disclosed in U.S. Pat. No. 5,306,403, including a Spex Model 1403 double-grating spectrophotometer with a gallium-arsenide photomultiplier tube (RCA Model C31034 or Burle Industries Model C3103402) operated in the single-photon counting mode. The excitation source includes a 514.5 nm line argon-ion laser from SpectraPhysics, Model 166, and a 647.1 nm line of a krypton-ion laser (Innova 70, Coherent).
Alternate excitation sources include a nitrogen laser (Laser Science, Inc.) at 337 nm and a helium-cadmium laser (Liconox) at 325 nm (U.S. Pat. No. 6,174,677), a light emitting diode, an Nd:YLF laser, and/or various ions lasers and/or dye lasers. The excitation beam may be spectrally purified with a bandpass filter (Corion) and may be focused on the flow path and/or flow-through cell using a 6× objective lens (Newport, Model L6X). The objective lens may be used to both excite the Raman-active organic compounds and to collect the Raman signal, by using a holographic beam splitter (Kaiser Optical Systems, Inc., Model HB 647-26N18) to produce a right-angle geometry for the excitation beam and the emitted Raman signal. A holographic notch filter (Kaiser Optical Systems, Inc.) may be used to reduce Rayleigh scattered radiation. Alternative Raman detectors include an ISA HR-320 spectrograph equipped with a red-enhanced intensified charge-coupled device (RE-ICCD) detection system (Princeton Instruments). Other types of detectors may be used, such as Fourier-transform spectrographs (based on Michaelson interferometers), charged injection devices, photodiode arrays, InGaAs detectors, electron-multiplied CCD, intensified CCD and/or phototransistor arrays.
Any suitable form or configuration of Raman spectroscopy or related techniques known in the art may be used for detection of DNA, including but not limited to normal Raman scattering, resonance Raman scattering, surface enhanced Raman scattering, surface enhanced resonance Raman scattering, coherent anti-Stokes Raman spectroscopy (CARS), stimulated Raman scattering, inverse Raman spectroscopy, stimulated gain Raman spectroscopy, hyper-Raman scattering, molecular optical laser examiner (MOLE) or Raman microprobe or Raman microscopy or confocal Raman microspectrometry, three-dimensional or scanning Raman, Raman saturation spectroscopy, time resolved resonance Raman, Raman decoupling spectroscopy or UV-Raman microscopy.
In the following example, model oligonucleotides that allowed the comparison of a methylated CpG sequence with a non-methylated CpG sequence were detected by SERS. The first sequence was a self-annealing control sequence: CGCGCGCGCGCGCGCGCGCG (GC_control). The second sequence was designed to mimic the single methylase product CGCG to UGUG and its complementary strand. The second sequence was CGCGCGCGUGUGCGCGCGCG (U1) and CGCGCGCGCACACGCGCGCG (A1) where U1 and A1 form a duplex after annealing. The third sequence was UGUGUGUGUGUGUGUGUGUG (U_all) and its complement CACACACACACACACACACA (A_all) (also forming a duplex after annealing).
The experimental procedures were as follows:
Annealing reaction to form duplex: Concentrated oligos (50 or 100 μM) for annealing pair or self-annealing were prepared in Tris buffer containing 50 mM NaCl, boiled for 10 minutes, and cooled gradually to room temperature.
SERS experiment: 20 μM of annealed duplex oligonucleotides, in final concentration of 50 mM NaCl, was mixed with Ag colloid (0.15 M) for 1 minute, then acetylated-BSA (50 mg/ml) was added to stop the aggregation. After 1-3 minutes, SERS measurements with replicates were taken and analyzed. For each presented data, the background (solution with identical concentration and components minus oligonucleotide duplex) was subtracted from the measurement. In paired analysis, direct subtraction was made between the test pair duplex and GC_control duplex.