The present application contains a Sequence Listing, which has been submitted via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy of the Sequence Listing was created on Apr. 21, 2015, is named Sequence.txt, and is 2 kilobytes in size.
The present invention relates generally to detection units and methods for detecting a target analyte such as natural, synthetic, modified or unmodified nucleic acids or proteins in a sample for general diagnostic purposes.
Many detection systems for determining the presence or absence of a particular target analyte in a sample are known. Examples of detection systems for detecting analytes include immunoassays, such as an enzyme linked immunosorbent assays (ELISAs), which are used in numerous diagnostic, research and screening applications. Generally, these detection systems detect the target analyte when it binds to a specific binding agent or probe resulting in a measurable signal.
When using known detection systems, such as immunoassays, the ability to detect a target analyte is often limited by the low concentration of the target analyte in the sample, non-specific binding of the target analyte and background interference generated by other molecules or substances in the sample. The ability to detect a target analyte in a sample taken from biological materials is often limited by most, if not all, of these factors.
Target analytes present in a sample are difficult to detect because the number of potential analytes capable of generating a signal is often limited. A common solution to this problem is to amplify the target analyte using polymerase chain reaction (PCR). However, PCR is only available for nucleic acid analytes and the method takes at least an hour to produce enough of the target analyte to generate a detectable signal in most systems.
Additionally, detection of short nucleic acids, such as micro-RNA molecules and short DNA molecules circulating in blood, is difficult to achieve using PCR. Micro-RNA molecules are shorter (˜22 nucleotides) than the combined size of regular PCR primers (˜40 nucleotides) and therefore cannot be detected using a standard PCR reaction. A number of strategies exist to circumvent this problem, such as ligating DNA molecules and conducting PCR amplification on the enlarged fragment or hybridizing the target to radiolabeled probes to detect them without PCR amplification. However, these alternatives are time consuming, labor intensive, require specialized reagents or equipment, and/or have low sensitivity.
The presence of other molecules in the sample can also interfere with the detection of the target analyte by producing background noise. For example, in systems where the detection probe is bound to a surface, a common source of signal interference is the non-specific interaction between molecules in the sample and the surface surrounding the probe.
Purification of a sample is often performed to remove the undesired interfering molecules from the sample in order to better detect the target analyte. However, purification is time consuming, often results in a reduction in the amount of the target analyte in the sample and can alter the concentration of the target analyte in the sample by diluting or concentrating the sample.
Recently, methods and detection systems to selectively detect the presence of a target analyte have been developed, such as those disclosed in U.S. Pub. No. 2009/0011946. In another method, micromechanical devices are used as sensors for detecting physical or chemical changes caused by chemical interactions between natural bio-polymers, which are non-identical binding partners, where one binding partner or probe molecule is placed on a cantilever for possible reaction with a sample analyte molecule. U.S. Pat. No. 6,436,647, “Method for Detecting Chemical Interactions Between Naturally Occurring Biological Analyte Molecules that are Non-Identical Binding Partners.” According to this method, a chemical analyte is detected by generating a physical or chemical change, whether through affinity binding, hydrogen bonding, electrostatic attractions, hydrophobic effects, dipole interactions or a heat reaction. The physical or chemical change induces stress on the cantilever which causes the cantilever to move or deflect, which is measured using methods commonly used for detecting cantilever deflection. However, this method requires a relatively high target concentration in the sample since cantilever deflection requires binding of a large number of target molecules. Additionally, the method is prone to non-specific interactions that produce background noise. Since signal generation occurs upon target binding to probes located on a surface, nonspecific binding to the surface can generate signal and background noise.
Accordingly, there is a need for a detection unit and systems of such units as well as methods capable of detecting very low concentrations of target analytes while reducing non-specific binding in the sample.
In the detection units and methods of this invention, binding of a target analyte to a filament causes a first property change of the filament. Although this property change, in theory, is detectable, it is difficult to detect, due in part to interference from non-specific binding events. Twisting the filament or adding a breaking agent causes a second property change of the filament, such as supercoiling or breaking, which is more easily detected and less likely to be caused by non-specific interactions. Therefore, few target molecules, and in some cases just one target molecule, are enough to produce a detectable signal.
One aspect of the invention relates to a detection unit for identifying a target analyte in a sample. The detection unit comprises a first and second surface connected by at least one filament, wherein the at least one filament comprises at least two strands comprising an active segment, wherein the active segment is capable of binding the target analyte in the sample, wherein the binding of the target analyte in the sample to the active segment causes a first detectable property change of the filament, and wherein the addition of one or more agents or the rotation of the first or second surface causes a second detectable property change of the filament that is transduced to a medium which generates a detectable signal.
In one embodiment of any aspect of the invention, the agent is a twisting agent and/or a breaking agent. According to this embodiment, the twisting agent includes small molecules or an enzyme. According to this embodiment, the breaking agent is a restriction enzyme or restriction endonuclease.
In another embodiment of any aspect of the invention, the physical rotation of the first or second surface where the filament is attached causes the second detectable property change of the filament.
In another embodiment of this aspect of the invention, the detection unit comprises one or more filaments comprising at least one active segment with one or more strands. According to this embodiment, the active segment comprises at least one strand that includes one or more binding sites or optionally includes one or more probes. According to this embodiment, the active segment comprises a continuous single strand and a discontinuous single strand or the active segment comprises two continuous single strands.
In still another embodiment of this aspect, the detection unit contains a filament having an active segment comprising a continuous single strand and a discontinuous single strand. According to this embodiment, the target analyte is capable of binding to the discontinuous single strand and thereby changing the state of the active segment to include two continuous strands. According to this embodiment, after the target analyte is bound to the filament, either a twisting agent is added, which results in an accumulation of torsional stress on the filament, or the physical rotation of the first or second surface where the filament is attached is initiated, which also results in an accumulation of torsional stress on the filament. The accumulation of torsional stress causes the filament to buckle or bend. Once the filament buckles or bends, additional twisting causes the filament to form supercoils or plectonemes.
According to this embodiment, where the filament of the detection unit is immobilized between the first and second surfaces by attaching the ends of the filament to the two surfaces, then supercoiling causes a detectable change of the force that the filament applies on the surfaces. The supercoiling of the filament, where the distance between the first and second surfaces is not fixed, results in a measurable reduction in the distance between the two surfaces. Alternatively, if the distance is fixed, then a measureable increase in force applied by the filament to the surfaces can be detected.
In still another embodiment of this aspect of the invention, the detection unit comprises a filament having an active segment of two continuous strands. According to this embodiment, binding of the target analyte generates a site recognizable by a breaking agent, for example, a restriction endonuclease, which can cause at least one of the strands to be broken.
In still another embodiment of this aspect of the invention, the detection unit comprises a filament having an active segment comprising only one continuous single strand and a discontinuous single strand. According to this embodiment, binding of the target analyte generates a site recognizable by a breaking agent, for example, a restriction endonuclease, which can break the continuous strand causing a measureable change in the force exerted by the filament.
In one embodiment of any aspects of the invention, target analyte binding occurs prior to attachment of the filament to the detection unit. According to this embodiment, the target analyte is exposed to the filament wherein binding of the analyte to the filament occurs. Following exposure of the target analyte to the filament, the filament is then attached to the detection unit under conditions such that target analyte bound to the filament is not disrupted.
Another aspect of the invention relates to a method for detecting the presence of a target analyte in a sample. According to this aspect of the invention, the method comprises: (a) exposing a sample to at least one detection unit under conditions such that if the target analyte is present in the sample, then it binds to at least one active segment of a filament in a detection unit, wherein binding of the target analyte to the active segment of the filament causes a first detectable change in the property of the filament; (b) exposing the filament to an agent, wherein the exposure of the filament to an agent generates a second detectable change in the property of the filament; (c) transduction of the second detectable change to a medium which generates a detectable signal; and (d) detection of the signal.
Another aspect of the invention relates to a method for identifying or detecting the presence of a target analyte in a sample, the method comprising: (a) providing a filament with an active segment, the filament comprising at least two strands, the active segment having a continuous and discontinuous strand; (b) exposing the filament to the sample under conditions such that if the target analyte is present in the sample, then it either binds to both ends of the discontinuous strand in the active segment or it binds to probes attached at both ends of the discontinuous strand in the active segment; (c) exposing the filament to a twisting agent; and (d) detecting the supercoiling of the filament.
Another aspect of the invention is a method to electrically detect single elongated conductive and semi-conductive nanoparticles. The method consists of providing a substantially flat surface with at least two conductive strips with a non-conductive gap between them. Providing elongated particles with their longest dimension longer than the non-conductive gap, preferably between 100 nm and 10 μm long. One or more particles can get close to the surface when one or more forces act on the particles. Particles on the surface can be detected if they bridge two strips significantly reducing the electrical resistance between them.
Another aspect of the invention is directed to a recombinant linear double-stranded DNA molecule, wherein the linear DNA molecule comprises a first double-stranded end and a second double-stranded end, an active segment, and is modified to hybridize to a target nucleic acid within the active segment, wherein a first strand of the double-stranded DNA is continuous and a second strand of the double-stranded DNA is discontinuous, wherein the discontinuous strand has a 3′ end and a 5′ end in the active segment, wherein the binding of the target nucleic acid to the active segment results in the discontinuous strand becoming continuous and makes the linear double-stranded DNA molecule capable of accumulating torsional stress, wherein the first double-stranded end of the linear double-stranded DNA molecule comprises a first functional group that permits the attachment of the first double-stranded end of the linear DNA molecule to at least two sites on a first surface, wherein the second double-stranded end of the linear double-stranded DNA molecule comprises a second functional group that permits the attachment of the second double-stranded end of the linear DNA molecule to at least two sites on a second surface, and wherein the first functional group is different than the second functional group.
In one embodiment, between 5 and 100 unpaired nucleotides at each of the 3′ and 5′ ends of the discontinuous strand do not form base pairs with the continuous strand and wherein at least some of the unpaired nucleotides in the discontinuous strand have sequence complementarity sufficient to hybridize with the target nucleic acid molecule.
In another embodiment, either the 3′ end or the 5′ end of the discontinuous strand comprises between 5 and 100 unpaired nucleotides that do not form base pairs with the continuous strand and wherein at least some of the unpaired nucleotides in the discontinuous strand have sequence complementarity sufficient to hybridize with the target nucleic acid molecule.
In one embodiment, the linear DNA molecule comprises between 3,000 and 30,000 base pairs. In another embodiment, the linear DNA molecule comprises either part of a bacterial plasmid or a complete bacterial plasmid.
In one embodiment, the first and second functional groups are selected from Octadiynyl, an amino group and its derivatives, an azide group and it derivatives, an NHS ester and its derivatives, a biotin molecule and its derivatives, digoxigenin, an antibody, a streptavidin molecule or other antigen binding proteins, a thiol group and its derivatives, Hexynyl, Acrydite™, I-Linker™ and Uni-Link™.
In one embodiment, the continuous strand has a section of between 1 and 100 unpaired nucleotides in the active segment, wherein the unpaired nucleotides in the continuous strand do not have sequence complementarity sufficient to hybridize with the target nucleic acid.
Another aspect of the invention is directed to a method of detecting a nucleic acid in a sample, the method comprising:
a) exposing the linear DNA molecule described above to the sample containing the nucleic acid under conditions such that the target nucleic acid binds to unpaired nucleotides in the discontinuous strand, wherein binding of the nucleic acid to the unpaired nucleotides makes the discontinuous strand become continuous;
b) exposing the linear DNA molecule to magnetic particles under conditions that result in the first functional group of the first double-stranded end of the linear DNA molecule coupling to at least two sites on the magnetic particles;
c) exposing the linear DNA molecule to a solid support under conditions that result in the second functional group of the second double-stranded end of the linear DNA molecule coupling to at least two sites on the solid support, such that the magnetic particle is tethered by the linear DNA molecule to the solid support;
d) rotating the magnetic particles using a magnetic field or exposing the linear DNA molecule to a twisting agent; and
e) detecting the supercoiling of the linear DNA molecule, wherein detection of supercoiling indicates the presence of the nucleic acid in the sample.
In one embodiment, the order of the steps (a), (b) and (c) is changed to a-c-b, b-a-c, c-a-b, b-c-a, or c-b-a. In another embodiment, two out of the three steps a), b) and c) are conducted simultaneously. In another embodiment, the three steps (a), (b) and (c) are conducted simultaneously.
In one embodiment, detection of supercoiling of the linear DNA molecule is achieved by applying a force, such as a magnetic or hydrodynamic force, to the magnetic particle that is tethered by the linear DNA molecule to the solid surface and detecting the displacement of the magnetic particle when the force is applied. In another embodiment, detection of supercoiling of the linear DNA molecule is achieved by detecting a reduction in the Brownian motion of the particle to which the linear DNA molecule is attached.
In one embodiment, the twisting agent is a molecule selected from actinomycin D, ethidium bromide, propidium, berberine, acridine and its derivatives, such as 9-aminoacridine, proflavine or quinacrine, daunomycin, doxorubicin, thalidomide, ellipticine, psoralen and its derivatives, Gelred™, Gelgreen™, Sybr® Gold, Sybr® Green, DNA gyrase, a type II topoisomerase.
In one embodiment, the nucleic acid is a short nucleic acid molecule selected from small interfering RNA, micro-RNA and its precursors, and fragmented DNA molecule obtained from a body fluid.
In one embodiment, the method is used to detect a single nucleotide of interest in the target nucleic acid. In one embodiment of the method, the unpaired nucleotides in the discontinuous strand of the linear DNA molecule share 100% complementarity with the target nucleic acid containing the single nucleotide of interest, such that supercoiling of the linear DNA molecule occurs only if the target nucleic acid of interest containing the single nucleotide of interest is present in the sample and wherein supercoiling will not occur when the only difference in the target nucleic acid is a different nucleotide at the single nucleotide of interest, such that the method can be used to discriminate between target nucleic acids that differ by only a single nucleotide.
In another embodiment of the method, the continuous strand has a section of between 1 and 100 unpaired nucleotides in the active segment, wherein between 5 and 100 unpaired nucleotides at each of the 3′ and 5′ ends of the discontinuous strand do not form base pairs with the continuous strand, wherein the unpaired nucleotides in the continuous strand do not have sequence complementarity sufficient to hybridize with the target nucleic acid, and wherein the target nucleic acid hybridizes to the unpaired nucleotides at the 3′ and 5′ ends of the discontinuous strand.
In one embodiment, of the method, the single nucleotide of interest in the target nucleic acid represents a single nucleotide polymorphism or a somatic mutation.
Another aspect of the invention is directed to a detection unit comprising the recombinant linear double-stranded DNA molecule, wherein the linear DNA molecule comprises a first double-stranded end and a second double-stranded end, an active segment, and is modified to hybridize to a target nucleic acid within the active segment (as described in this application), a particle, and a solid support, wherein the first functional group of the first double-stranded end of the linear DNA molecule is attached by a covalent or non-covalent bond to at least two sites on a particle and wherein the second functional group of the second double stranded end of the linear DNA molecule is attached by a covalent or non-covalent bond to at least two sites on a solid support.
It should be appreciated that the particular implementations shown and described herein are examples and are not intended to otherwise limit the scope of the application in any way.
The published patents, patent applications, websites, company names, and scientific literature referred to herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter. Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.
As used in this specification, including the claims, the singular forms “a,” “an” and “the” specifically also encompass the plural forms of the terms to which they refer, unless the content clearly dictates otherwise. The terms “about” and “substantially” are used herein to mean approximately, in the region of, roughly, or around. When the terms “about” and “substantially” are used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the terms “about” and “substantially” are used herein to modify a numerical value above and below the stated value by a variance of less than about 20%.
Technical and scientific terms used herein have the meaning commonly understood by one of skill in the art to which the present application pertains, unless otherwise defined. Reference is made herein to various methodologies and materials known to those of skill in the art. Standard reference works setting forth the general principles of recombinant DNA technology include Sambrook et al., “Molecular Cloning: A Laboratory Manual,” 2nd Ed., Cold Spring Harbor Laboratory Press, New York (1989); Kaufman et al., Eds., “Handbook of Molecular and Cellular Methods in Biology in Medicine,” CRC Press, Boca Raton (1995); and McPherson, Ed., “Directed Mutagenesis: A Practical Approach,” IRL Press, Oxford (1991), the disclosures of each of which are incorporated by reference herein in their entireties.
The invention pertains to a novel detection unit comprising a first and second surface connected by at least one filament, preferably a nucleic acid. The filament has at least two strands which have at least one active segment. The invention further pertains to methods of identifying a target analyte in a test sample utilizing the detection unit(s) described herein. Related embodiments that may be used in conjunction with the teachings of this application are described in Published PCT Application WO2013/059044 and Published U.S. Application 2014-0099635, which are hereby incorporated by reference in their entirety.
Preferably, the detection unit is useful to identify a target analyte in a sample. The detection unit may contain a first and second surface connected by at least one filament, wherein the filament has at least two strands having an active segment, wherein the active segment is capable of binding the target analyte in the sample, and wherein the binding of the target analyte in the sample to the active segment causes a detectable property change of the filament. The filament may be immobilized between the first and second surfaces by attaching the ends of the filament to the two surfaces. Upon binding of the target analyte to one of the filaments, the addition of an agent causes another detectable property change of the filament that generates a detectable signal.
The terms “target analyte” or “analyte,” are used herein to denote the molecule or atom to be detected in the test sample. According to the invention, there can be one, two, three, four, five, ten, fifteen, twenty, hundred, thousand or more different target analytes in the test sample. The target analyte can be any molecule or atom for which there exists a naturally or artificially prepared specific binding member. Examples of target analytes include, but are not limited to, a nucleic acid, oligonucleotide, DNA, RNA, protein, peptide, polypeptide, amino acid, antibody, carbohydrate, hormone, steroid, toxin, vitamin, any drug administered for therapeutic and illicit purposes, a bacterium, a virus, cell, as well as any antigenic substances, haptens, antibodies, metabolites, and combinations thereof.
In a preferred embodiment, the target analyte is a nucleic acid. The nucleic acid can be from any source in purified or unpurified form including DNA (dsDNA and ssDNA) and RNA, including tRNA, mRNA, rRNA, siRNA, mitochondrial DNA and RNA, chloroplast DNA and RNA, DNA-RNA hybrids, or mixtures thereof, genes, chromosomes, plasmids, the genomes of biological materials, including microorganisms such as bacteria, yeast, viruses, viroids, molds, fungi, plants, animals, humans, and fragments thereof. The target analyte can be obtained from various biological materials by procedures well known in the art.
In another preferred embodiment, the target analyte is a short nucleic acid containing less than about 100 base pairs or less than about 100 nucleotides. In general, such molecules are difficult to detect using PCR-based techniques because suitable primers often cannot be found in such a short sequence. A particular case of small DNA molecules are molecules of less than about 40 nucleotides. These molecules are smaller than the combined size of standard PCR primers (each primer about 20 nucleotides). Short nucleic acid molecules are common in nature, exemplary cases are small interfering RNA (siRNA), micro-RNA (miRNA) and its precursors, pri-miRNA and pre-miRNA, and fragmented DNA molecules produced after cell death and present in blood, urine and other body fluids.
The terms “test sample” or “sample” are used interchangeably herein and include, but are not limited to, biological samples that can be tested by the methods of the present invention described herein and include human and animal body fluids such as whole blood, serum, plasma, cerebrospinal fluid, urine, lymph fluids, and various external secretions of the respiratory, intestinal and genitourinary tracts, tears, saliva, milk, white blood cells, myelomas and the like, biological fluids such as cell culture supernatants, fixed tissue specimens and fixed cell specimens, PCR amplification products or a purified product of one of the above samples. A “sample” may include gaseous mediums, such as ambient air, chemical or industrial intermediates, chemical or industrial products, chemical or industrial byproducts, chemical or industrial waste, exhaled vapor, internal combustion engine exhaust, or headspace vapor such as vapor surrounding foods, beverages, cosmetics, vapor surrounding plant or animal tissue and vapor surrounding a microbial sample. Additional sample mediums include supercritical fluids such as supercritical CO2 extricate. Other exemplary mediums include liquids such as water or aqueous solutions, oil or petroleum products, oil-water emulsions, liquid chemical or industrial intermediates, liquid chemical or industrial products, liquid chemical or industrial byproducts, and liquid chemical or industrial waste. Additional exemplary sample mediums include semisolid mediums such as animal or plant tissues, microbial samples, or samples containing gelatin, agar or polyacrylamide.
The terms “first and second surface,” “surface,” “first surface” and “second surface” are used herein to denote any material suitable for being connected by at least one filament and which are amenable to at least one detection method disclosed herein. The number of possible suitable materials is large and would be readily known by one of ordinary skill in the art.
In exemplary embodiments, the surface may be composed of modified or functionalized glasses, inorganic glasses, plastics, including acrylics, polystyrene and copolymers of styrene, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, polysaccharides, nylon or nitrocellulose, resins, and other polymers, carbon, metals, ceramics, silica or silica-based materials including silicon and modified silicon and silicon wafers. The surfaces can be functionalized by a monolayer of one or more molecules. Methods of producing self-assembled monolayers are well known in the art. In particular, there are several known methods to assemble monolayers of thiolates on metal surfaces. See e.g., Love, J. C. et al., Chem. Rev., 105, 1103 (2005). The surface can be a composite material. For example, superparamagnetic micro-scale beads, which are well known in the art, consisting of iron oxide nanoparticles dispersed in a polystyrene matrix.
The surface can be a silicon wafer with an insulating layer, such as an oxide layer, produced on the wafer by a wet thermal environment, although an insulating layer is not necessarily critical to all embodiments of the detection unit. Additional insulating layers include, but are not limited to, silicon nitride and polyamide.
According to another embodiment, the surface may be a nonconductive material with a conductive or semiconductive pattern fabricated using methods well known in the art, such as photolithography. For example, it can be a glass with a conductive pattern of a metal, such as gold, platinum, chromium or copper.
In another exemplary embodiment, the surface is a nanoparticle. As used herein a nanoparticle is a particle with at least one dimension less than 1 μm, such as a nanorod, nanowire, or nanosphere. According to this embodiment, the nanoparticle is made of one or more metals, each part of the particle of a different metal. The metals can be electrical conductor, such as gold, silver, copper and platinum, semiconductor, for example cadmium selenide (CdSe), cadmium sulfide (CdS) or CdSe or CdS coated materials with zinc sulfide (ZnS). In additional embodiments, the metals can be magnetic, such as iron, iron oxides or nickel. In additional embodiments, the nanoparticle comprises zinc oxide (ZnO), titanium dioxide (TiO2), silicone (Si), indium nitride (InN), silver iodide (AgI), silver bromide (AgBr), mercuric iodide (HgI2), lead sulfide (PbS), lead selenide (PbSe), zinc telluride (ZnTe), cadmium telluride (CdTe), In2, S3, cadmium phosphide (Cd3P2), cadmium (Cd3), As2, indium arsenide (InAs), GaAs or gallium nitride (GaN).
In a preferred embodiment the nanoparticle is conductive or semi-conductive and has an elongated shape, such as a nanorod or nanowire. Publication US 2004/0014106 A1 describes a method to electrically detect the presence of nanoparticles when they contact a surface. In this publication, the presence of nanoparticles is detected when they bridge two patterned conductors separated by a non-conductive gap. However, single spherical nanoparticles are not able to bridge non-conductive gaps between patterned conductors and therefore more than one particle are needed and/or one additional Silver enhancement step is needed to electrically connect the two conductors and detect the presence of the particles.
According to this embodiment, a method is provided to electrically detect single elongated conductive and semi-conductive magnetic nanoparticles. The method consists on providing a substantially flat surface with at least two conductive strips with a non-conductive gap between them. Providing elongated particles with their longer dimension longer than the non-conductive gap, preferably between 100 nm and 10 μm long. One or more particles can get close to the surface when one or more forces act on the particles. Particles on the surface can be detected if they bridge two strips significantly reducing the electrical resistance between them. The longer dimension of the nanoparticles can be chosen considering the width of the conductive strips and non-conductive gaps to ensure that most nanoparticles on the surface bridges at least two strips. The number of nanoparticles bridging two strips can be inferred from the decrease on electrical resistance between the strips. Two electrodes with interdigitated strips instead of a pair of strips can be used to increase the number of non-conductive gaps between electrodes (FIG. 2b in Publication US 2004/0014106 A1). The particles can have different electrical properties to allow for identification of the specific type of particle that is bridging the electrodes. For example, type 1 particles have an electrical resistance of 1 kΩ while type 2 particle have an electrical resistance of 100 kΩ. The number of type 1 particles and the number of type 2 particles contacting two conductive strips can be estimated from the total electrical resistance between strips.
In an aspect of this detection method, the particles can have at least one segment of a magnetic material which gives the particles a magnetic moment. In this aspect, a magnetic field is provided that orients the magnetic particles substantially perpendicular to the conductive strips and substantially parallel to the surface. If the particles are substantially perpendicular to the strips, it can be ensured that each particle on the surface bridges at least two strips.
Methods of making metal, semiconductor and magnetic nanoparticles are well-known in the art. See, e.g., Schmid, G. (ed.) Clusters and Colloids (V C H, Weinheim, 1994); Hayat, M. A. (ed.) Colloidal Gold: Principles, Methods, and Applications (Academic Press, San Diego, 1991); Massart, R., IEEE Taransactions On Magnetics, 17, 1247 (1981); Ahmadi, T. S. et al., Science, 272, 1924 (1996); Henglein, A. et al., J. Phys. Chem., 99, 14129 (1995); Curtis, A. C., et al., Angew. Chem. Int. Ed. Engl., 27, 1530 (1988).
Methods of making ZnS, ZnO, TiO2, AgI, AgBr, HgI2, PbS, PbSe, ZnTe, CdTe, In2S3, In2, Se3, Cd3, P2, Cd3, As2, InAs, and GaAs nanoparticles are also known in the art. See, e.g., Weller, Angew. Chem. Int. Ed. Engl., 32, 41 (1993); Henglein, Top. Curr. Chem., 143, 113 (1988); Henglein, Chem. Rev., 89, 1861 (1989); Brus, Appl. Phys. A., 53, 465 (1991); Bahncmann, in Photochemical Conversion and Storage of Solar Energy (eds. Pelizetti and Schiavello 1991), page 251; Wang and Herron, J. Phys. Chem., 95, 525 (1991); Olshaysky et al., J. Am. Chem. Soc., 112, 9438 (1990); Ushida et al., J. Phys. Chem., 95, 5382 (1992). Suitable nanoparticles are also commercially available from, e.g., Ted Pella, Inc. (gold), Amersham Corporation (gold) and Nanoprobes, Inc. (gold).
Methods of making nanorods or nanowires are known in the art. See for example, Hahm and Mieber, Nano Lett, 4, 51-54 (2004) (silicon nanorods); Li et al., Appl. Phys. Lett. 4, 4014-1016 (2003) (In2O3 nanorods); Liu et al., Phys. Ev. B. 58, 14681-14684 (1998) (Bismuth nanorods); Sun et al., Appl. Phys. Lett. 74, 2803 (1999) (Nickel nanorods); Ji et al., J. Electrochem. Soc. 150, C523-528 (2003) (Au/Ag multilayers and multisegment nanorods); Celedon et al., Nano Lett., 9, 1720-1725 (2009) (Pt/Ni multisegment nanorods); O'Brien et al., Adv. Mater. 18, 2379-2383 (2006) (polymer nanorods); Liu et al. Nanotechnology 20, 415703 (2009) (superparamagnetic and ferromagnetic Ni nanorods).
Methods of making carbon nanotubes and carbon nanotubes composites are known in the art. See for example, Milo et al., Adv. Mater., 11, 937-941 (1999); Stevens Appl. Phys. Lett., 77, 3453-3455 (2000).
The surfaces and/or, the filaments, are functionalized with a functional group in order to attach the filaments to the surfaces. Such methods are known in the art. For instance, if the filaments are nucleic acids, they can be functionalized with alkanethiols at their 3′-termini or 5′-termini for attachment to gold surfaces. See, for example, Whitesides, Proceedings of the Robert A. Welch Foundation 39th Conference On Chemical Research Nanophase Chemistry, Houston, Tex., pages 109-121 (1995). See also Mucic et al., Chem. Commun. 555-557 (1996) (describes a method of attaching 3′ thiol DNA to flat gold surfaces; this method can be used to attach oligonucleotides to nanoparticles). The alkanethiol method can also be used to attach oligonucleotides to other metal, semiconductor and magnetic colloids and to the other nanoparticles listed above. Other functional groups for attaching oligonucleotides to solid surfaces include phosphorothioate groups (see, e.g., U.S. Pat. No. 5,472,881 for the binding of oligonucleotide-phosphorothioates to gold surfaces), substituted alkylsiloxanes (see, e.g. Burwell, Chemical Technology, 4, 370-377 (1974) and Matteucci and Caruthers, J. Am. Chem. Soc., 103, 3185-3191 (1981) for binding of oligonucleotides to silica and glass surfaces, and Grabar et al., Anal. Chem., 67, 735-743 for binding of aminoalkylsiloxanes and for similar binding of mercaptoaklylsiloxanes)-. Oligonucleotides terminated with a 5′ thionucleoside or a 3′ thionucleoside may also be used for attaching oligonucleotides to solid surfaces.
The functional group for attaching a filament, such as a nucleic acid, to a surface may also be a label, such as biotin or streptavidin. For example, biotin-labeled filaments are put in contact with streptavidin functionalized surfaces; the biotin-streptavidin interaction attaches the filament to the surface. The following reference describes the attachment of biotin labeled oligonucleotides to a streptavidin functionalized surface. Shaiu et al., Nucleic Acids Research, 21, 99 (1993). Digoxigenin and anti-Digoxigenin antibodies can also be used to attach filaments to surfaces.
The following references describe other methods that may be employed to attach oligonucleotides to surfaces and in particular to nanoparticles: Nuzzo et al., J. Am. Chem. Soc., 109, 2358 (1987) (disulfides on gold); Allara and Nuzzo, Langmuir, 1, 45 (1985) (carboxylic acids on aluminum); Allara and Tompkins, J. Colloid Interface Sci., 49, 410-421 (1974) (carboxylic acids on copper); Iler, The Chemistry Of Silica, Chapter 6, (Wiley 1979) (carboxylic acids on silica); Timmons and Zisman, J. Phys. Chem., 69, 984-990 (1965) (carboxylic acids on platinum); Soriaga and Hubbard, J. Am. Chem. Soc., 104, 3937 (1982) (aromatic ring compounds on platinum); Hubbard, Acc. Chem. Res., 13, 177 (1980) (sulfolanes, sulfoxides and other functionalized solvents on platinum); Hickman et al., J. Am. Chem. Soc., 111, 7271 (1989) (isonitriles on platinum); Maoz and Sagiv, Langmuir, 3, 1045 (1987) (silanes on silica); Maoz and Sagiv, Langmuir, 3, 1034 (1987) (silanes on silica); Wasserman et al., Langmuir, 5, 1074 (1989) (silanes on silica); Eltekova and Eltekov, Langmuir, 3, 951 (1987) (aromatic carboxylic acids, aldehydes, alcohols and methoxy groups on titanium dioxide and silica); Lec et al., J. Phys. Chem., 92, 2597 (1988) (rigid phosphates on metals).
In order to introduce rotations (torsional stress) into a linear filament, such as a nucleic acid, attached at both ends to surfaces, the filament should be attached by at least two connections to each surface. In other words, the filament should be attached to at least two sites on each surface, such that when the target analyte binds to the active segment, converting a discontinuous strand into a continuous strand, there will be no single bonds left in the filament that are free to rotate around their axis. If the filament is attached to at least one of the surfaces by a single connection (or to a single site) or otherwise contains a single stranded portion having a single bond that is free to rotate around its axis, then the single connection or bond may swivel without accumulating torsional stress. A functional group linking the filament (e.g. nucleic acid) with a surface and having multiple bonds with the surface, represents a single connection if the functional group has a single bond that can rotate freely around its axis in the presence of torsional stress. Multiple connections can be obtained by filaments containing multiple functional (chemical) groups able to interact with a surface. For example, multiple biotin labels at one end of the filament and multiple digoxigenin labels at the other end allow attaching an oligonucleotide by multiple connections at surfaces functionalized with streptavidin and antidigoxigenin, respectively. Methods to produce oligonucleotides functionalized in this manner are well known in the art. See for example, Revyakin, et al., Nat. Methods, 2,127-138 (2005) and Celedon et al., Nano Lett., 9,1720-1725 (2009).
Oligonucleotides of defined sequences are used for a variety of purposes in the practice of the invention. Methods of making oligonucleotides of a predetermined sequence are well-known. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and F. Eckstein (ed.) Oligonucleotides and Analogues, 1st Ed. (Oxford University Press, New York, 1991). Solid-phase synthesis methods are preferred for both oligoribonucleotides and oligodeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Oligoribonucleotides and oligodeoxyribonucleotides can also be prepared enzymatically.
As used herein, “a detectable signal” which can be generated according to the invention includes, but is not limited to, an electrical (e.g., capacitance), mechanical, optical, acoustic or thermal signal. In a preferred embodiment, the detectable signal is electrical.
The term “filament” is used herein to denote at least two, three, four, five, six, seven, eight, nine, ten, twenty, thirty or more “strands”. The tem “strand” is used to denote a molecule substantially similar to a polymer. The term polymer is used herein to denote a molecule formed by covalently linking monomer units of one or more types into chains. Instead, a “strand” as used herein, can incorporate some molecules different to the basic monomers and these different molecules can be non-covalently linked to the rest of the structure. Examples of monomers that can be used to produce “polymers” useful in the invention can be found in U.S. Patent Publication No. U.S. 2009/0011946, which is herein incorporated by reference in its entirety. According to the invention, the detection unit has at least one first and second surface connected by at least two, five, ten, fifteen, or twenty, twenty-five, fifty, hundred, thousand or more filaments.
The filament is preferably a length of about 0.1 μm to about 2 cm, about 100 μm to about 1 cm. More preferably, the filament length is about 1 μm to about 3 μm.
Preferably, the strands of the filament are capable of interacting with one another, for example by Watson-Crick base pairing. Interaction between the strands facilitates the formation of plectonemes or supercoiling when the filament is twisted. The filament can be twisted by rotating one of the surfaces to which the filament is attached. Alternatively, the filament can be twisted by small molecules that bind to the filament. For example, double stranded nucleic acids can be twisted by molecules that intercalate between base pairs and unwind the double helix. Alternatively, double stranded nucleic acids can be twisted by topoisomerases enzymes. Generally, the formation of plectonemes or supercoiling results in an increase of tension in the filament which results in a measureable attractive force between the two surfaces.
Preferably, the strands of the filament are substantially linear polymers. A linear polymer is a molecule formed by monomers in which each monomer is covalently linked with two other monomers, with the exception of the first and the last monomers which are linked to just one other monomer.
The term “monomer” is used herein to refer to a single molecule that has the ability to combine with identical or other molecules in a process known as polymerization. The polymerization reaction may be a dehydration or condensation reaction (due to the formation of water (H2O) as one of the products) where a hydrogen atom and a hydroxyl (—OH) group are lost to form H2O and an oxygen molecule bonds between each monomer unit.
The term “monomer” includes any chemical group that can be assembled into a polymer. A wide variety of monomers may be used for synthesizing a polymer. For example, a polymer of the invention may be composed of monomers that have, for example, affinity property groups, hydrophilic groups, and/or hydrophobic groups pendant from their backbones. Accordingly, a polymer may include side chains “R” pendant from a structurally repetitive backbone. Exemplary backbones with side chains include:
Additional examples of suitable monomers include, but are not limited to, those described in the references cited in this written description and incorporated by reference herein. Nomenclature pertinent to molecular structures, as well as description of monomers and side chain structures useful for the present invention can be found in U.S. Patent Publication No. U.S. 2009/0011946, which is hereby incorporated by reference in its entirety.
Methods of assembling sequence specific polymers for use as probes in the present invention are known in the art (see e.g., U.S. Patent Publication No. US 2009/0011946).
Additionally, a variety of techniques known by one of skill in the art can be used to determine the type and property of the polymer useful in the present invention. Techniques such as wide angle X-ray scattering, small angle X-ray scattering, and small angle neutron scattering are used to determine the crystalline structure of polymers. Gel permeation chromatography is used to determine the number average molecular weight, weight average molecular weight, and polydispersity. FTIR, Raman and NMR can be used to determine composition.
Examples of polymers useful in the invention are known by one of skill in the art and include, but are not limited to, natural and synthetic materials. In a preferred embodiment, the polymer is a biopolymer. According to this embodiment, the biopolymer is selected from the group comprising polysaccharides, polypeptides, and polynucleotides.
The polymers of the invention can be a combination of polymers in which different types of polymers (polysaccharides, polypeptides, polynucleotides and any types of synthetic polymers) are attached to each other either covalently or non-covalently.
As used herein, the term “polysaccharides” refers to polymeric carbohydrate structures, formed of repeating units (either mono- or di-saccharides) joined together by glycosidic bonds. Polysaccharides of the invention are preferably linear, but may contain various degrees of branching. Additionally, polysaccharides are generally heterogeneous, containing slight modifications of the repeating unit. Examples of polysaccharides suitable for the invention include homopolysaccharides or homoglycans, where all of the monosaccharides in a polysaccharide are the same type, and heteropolysaccharides or heteroglycans, where more than one type of monosaccharide is present. In exemplary embodiments, the polysaccharide is a starch, glycogen, cellulose, or chitin.
Polysaccharides of the invention have the general formula of Cx(H20)y where X is about 100 to about 100,000, about 200 to about 10,000, about 500 to about 5,000, or about 1,000 to about 2,000. In another embodiment, polysaccharides have repeating units in the polymer backbone of about six-carbon monosaccharides and can be represented by the general formula of (C6H1005)n where n is about 30 to about 100,000, about 200 to about 10,000, about 500 to about 5,000, or about 1,000 to about 2,000.
As used herein, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”) or RNA/DNA hybrids. It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, siRNA, and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Oreg., as Neugene) polymers, and other synthetic nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. The term nucleotides include hybrids thereof, for example between PNAs and DNA or RNA, and also include known types of modifications, for example, labels, alkylation, “caps,” substitution of one or more of the nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalkylphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including enzymes (e.g. nucleases), toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine and psoralen), those containing chelates (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.).
As used herein, the term “polypeptides” refers to a polymer formed from the linking, in a defined order, of preferably, α-amino acids, D-, L-amino acids and combinations thereof. The terms “peptides,” “oligopeptides,” and “proteins” are included within the definition of polypeptide. The term includes polypeptides containing post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and sulphations. In addition, protein fragments, analogs (including amino acids not encoded by the genetic code, e.g. homocysteine, ornithine, D-amino acids, and creatine), natural or artificial mutants or variants or combinations thereof, fusion proteins, derivatized residues (e.g. alkylation of amine groups, acetylations or esterifications of carboxyl groups) and the like are included within the meaning of polypeptide. The link between one amino acid residue and the next is referred to as an amide bond or a peptide bond. The terms do not refer to a specific length of the polypeptide.
As used herein, a “plasmid” is a DNA molecule that is physically separate from, and can replicate independently of, chromosomal DNA within a cell. Most commonly found as circular, double-stranded DNA molecules in bacteria, with sizes that vary from 1 to 100 kbp.
The size and molecular configuration of nucleic acids can be determined using a variety of techniques. In particular, the size of nucleic acid molecules and the amount of supercoiling of a circular, double-stranded nucleic acid, can be determined using techniques in which molecules migrate forced by an external field inside a medium, such as gel electrophoresis, capillary electrophoresis and ultracentrifugation. In ultracentrifugation, molecules are placed in a medium which rotates at very high speed, producing a centrifugal force that drives the molecules through the medium separating them by size and molecular configuration. In gel and capillary electrophoresis, molecules are placed in a conductive gel or liquid medium and an electric field is applied. Because nucleic acids are negatively charged, they migrate towards the anode. Longer molecules migrate at lower speed than shorter molecules because they experience higher friction from the medium. Likewise, circular, non-supercoiled double-stranded molecules migrate at lower speed than circular, supercoiled double-stranded molecules of the same size. Moreover, the speed of migration increases with the amount of molecular supercoiling. Normally, a circular, non-supercoiled molecule migrates more slowly than the linearized version of the same molecule and the linearized molecule migrates more slowly than the circular, supercoiled molecule. This property allows for easy discrimination of a circular supercoiled molecule from a circular non-supercoiled molecule. Normally, nucleic acids are detected in gel and capillary electrophoresis using small fluorescent molecules which intercalate between base pairs and become more fluorescent than in solution. The medium is illuminated with UV light and the emissions are detected using a light sensitive device, such as a digital camera. Note that the small intercalator molecules are twisting agents.
As used herein, the term “active segment” refers to the region of a filament where binding of the target analyte occurs. Preferably, the region of the filament containing the active segment has at least one continuous and at least one discontinuous strand or has at least two continuous strands. As used herein, the term “continuous strand” refers to one strand having one first and one last monomer connected by a continuous chain of molecules linked to one another by covalent or non-covalent bonds. The molecules of the chain are not necessarily all of the same type of the monomers. As used herein, the term “discontinuous strand” refers to a strand having one first and one last monomer for which there is not a continuous chain of molecules linked to one another by covalent or non-covalent bonds, however, adding one covalent or non-covalent bond is enough to make the “discontinuous strand” become “continuous”. The term “non-covalent bond” refers here to an intermolecular interaction with free energy of at least 1 kcal/mol.
Only filaments comprising at least two continuous strands are able to accumulate torsional stress and/or supercoil when twisted. Single stranded filaments, for example alkane molecules, peptide chains or single stranded DNA, do not supercoil because the atoms of the single strand form a single bond and therefore are free to rotate around the axis of the bond. Consequently, as twisting is induced, no torsional stress is accumulated in the filament.
Filaments, comprising at least two continuous strands, have a key difference when exposed to a twisting agent or rotated compared to filaments comprising one continuous and one discontinuous strand. The strands of filaments comprising at least two continuous strands wind around each other and accumulate torsional stress when twisted. As torsional stress accumulates, the process eventually reaches a limit in which the filament buckles. The introduction of additional twists after the filament has buckled causes the filament to bend forming supercoils or plectonemes. Instead, filaments comprising one continuous and one discontinuous strand have a segment where the only connection between the two sides of the filament is a single strand, for example a single alkane molecule, or a single stranded DNA. These filaments do not supercoil because the single strand segment is free to rotate. Consequently, when these filaments are twisted, no torsional stress is accumulated.
Preferably, the target analyte binds to one continuous strand or to the two ends of one discontinuous strand, or the target analyte binds to at least one probe located at one end of one discontinuous strand and to at least one probe located at the other end of the discontinuous strand, within the active segment. Preferably, if the target binds to a strand either continuous or discontinuous, the strands of the active segment and the target analyte are nucleic acids. Preferably, if the target binds to probes located at each end of a discontinuous strand, the target analyte is not a nucleic acid.
As used herein, the term “ligating agent”, refers to an enzyme capable of catalyzing the formation of a phosphodiester bond between juxtaposed 5′ phosphate and 3′ hydroxyl termini of two adjacent oligonucleotides. Examples of ligating agent are T3 DNA ligase, T4 DNA ligase, T7 DNA ligase, Taq DNA ligase and E. Coli DNA ligase.
In one embodiment, the filament is a DNA molecule (circular or linear) comprising two nucleic acid strands, wherein the active segment comprises a continuous nucleic acid strand and a discontinuous nucleic acid strand. The discontinuous nucleic acid strand has a 3′ end and a 5′ end located in the active segment. The discontinuous nucleic acid strand has unpaired nucleotides at its 3′ and 5′ ends in the active segment. The unpaired nucleotides do not form base pairs with the continuous strand and are available to form base pairs with a target nucleic acid molecule. See e.g.,
In another embodiment, the filament is a DNA molecule (circular or linear) comprising two nucleic acid strands, wherein the active segment comprises a continuous nucleic acid strand and a discontinuous nucleic acid strand. The discontinuous nucleic acid strand has a 3′ end and a 5′ end located in the active segment. The discontinuous strand does not have any unpaired nucleotides at its 3′ and 5′ ends. The continuous strand has unpaired nucleotides in the active segment that do not form base pairs with the discontinuous strand and are available to form base pairs with the target molecule. See e.g.,
In another embodiment, the filament is a DNA molecule (circular or linear) comprising two nucleic acid strands, wherein the active segment comprises a continuous nucleic acid strand and a discontinuous nucleic acid strand. The discontinuous nucleic acid strand has a 3′ end and a 5′ end located in the active segment. The discontinuous nucleic acid strand has unpaired nucleotides at one of its ends in the active segment. The unpaired nucleotides do not form base pairs with the continuous strand and are available to form base pairs with a target nucleic acid molecule. The continuous strand has unpaired nucleotides in the active segment that do not form base pairs with the discontinuous strand and are available to form base pairs with the target nucleic acid molecule. See e.g.,
In one embodiment, the target analyte is a nucleic acid that has two regions, each preferably between 5 and 100 nucleotides. The two regions in the target are substantially complementary to two regions of unpaired nucleotides in the active segment. According to this embodiment, the two regions in the target may be adjacent to each other or may be separated by between 1-1000 nucleotides. The two regions are preferably between 0 and 300 nucleotides apart, or between 100 and 1,000 nucleotides apart.
In one embodiment, the detection unit comprises a linear double stranded DNA molecule having an active segment. The double stranded DNA molecule is attached by at least two connections to each of a first and second surface.
When the target is a nucleic acid molecule, exposure of the target solution to the active segment is preferably conducted under high stringency conditions. High stringency conditions favor the hybridization of nucleic acid molecules which are perfectly complementary or substantially perfectly complementary to nucleic acids in the active segment and make more unlikely the binding of targets which are not perfectly complementary or substantially perfectly complementary. After exposure of the target solution to the active segment, washing or exposing the active segment to a medium with high stringency can remove non-perfectly complementary molecules as well. High stringency conditions occur at high temperature, low salt concentration and high pH. Also the presence of certain chemicals, such as formamide, can increase the stringency of the solution. In this invention, exposure of the target to active segment and washing, when performed, are conducted preferably at temperatures between 20° C. and 70° C., ionic strength between 0.01 M and 0.3 M, and pH between 7 and 8. When supercoiling is detected using gel electrophoresis, the low salt conditions of the buffer expose molecules hybridized to the active segment to high stringency conditions. It is important to note that supercoiling of the molecule that contains the active segment exposes a molecule bound to the active segment to a force resulting from twisting. This force acts as a stringency condition which melts hybrids that contain mismatches at the active segment.
In one embodiment, the binding of the target analyte to the filament is performed prior to attachment of the filament to the detection unit. According to this embodiment, the target analyte is exposed to the filament and binding of the analyte to one continuous strand or to the two ends of one discontinuous strand, or the target analyte binds to at least one probe located at one end of one discontinuous strand and to at least one probe located at the other end of the discontinuous strand, within the active segment of the filament occurs. Following exposure of the target analyte to the filament, the filament is then attached to the detection unit under conditions such that target analyte bound to the filament is not disrupted.
As used herein, a “probe” is a specific binding member, which is covalently or non-covalently attached at one end of a discontinuous strand, capable of binding the target analyte. If a target analyte binds to one or more probes located at one end of the discontinuous strand and binds also to one or more probes located at the other end of the discontinuous strand, then the discontinuous strand becomes a continuous strand. Examples of probes useful in the invention are known by one of skill in the art and include, but are not limited to, an antibody, preferably a monoclonal antibody, a nucleic acid aptamer or peptide aptamer, a “sequence specific polymer’, as defined in U.S. Patent Publication No. U.S. 2009/0011946, proteins, peptides, amino acids, carbohydrates, hormones, steroids, vitamins, drugs, including those administered for therapeutic purposes as well as those administered for illicit purposes, bacteria, viruses, oligonucleotides having a sequence that is complementary to at least a portion of a nucleic acid target analyte, and metabolites of or antibodies to any of the above substances bound to the active segment of a filament through covalent or non-covalent attachment.
According to the invention, following the binding of the target analyte to the active segment of the filament, an agent is added to the detection unit or the physical rotation of at least one of the surfaces attached to the filament is initiated. As used herein, an “agent” includes, but is not limited to, “intercalating agents” or “twisting agents” and “breaking agents,” which are known to one of skill in the art. The term “twisting agent” includes, but is not limited to, an agent capable of causing the physical rotation of one of the surfaces to which the filament is attached, including small molecules and enzymes capable of binding and twisting the filament. The term “intercalating agent” refers to small molecules capable of binding and twisting a nucleic acid filament. Intercalator molecules intercalate between nucleic acid base pairs and unwind the strands at the intercalation point. Unwinding the strands effectively twists the filament causing the filament to form supercoils or plectonemes. Examples of small molecules suitable for use as intercalator molecules include, but are not limited to, actinomycin D, ethidium bromide, propidium, acridine and its derivatives, such as 9-aminoacridine, proflavine, or quinacrine, daunomycin, berberine, doxorubicin, thalidomide, ellipticine, psoralen and its derivatives, and the commercial dyes Gelred, Gelgreen, Sybr Gold or Sybr Green. Exemplary enzymes suitable for use as twisting agents include, but are not limited to, type II topoisomerases, such as DNA gyrase. These enzymes preferably cleave DNA molecules and pass another part of the duplex through the break and finally religate the cut DNA, resulting in a change in the linking number of the molecule.
As used herein, the term “breaking agent” refers to an agent capable of recognizing, binding to, and breaking a continuous strand having a target analyte bound to the active segment of the filament. Examples of breaking agents useful in the invention include, but are not limited to, restriction enzymes or restriction endonucleases. In an exemplary embodiment, one of the continuous strands of the active segment is a DNA oligonucleotide complementary to the target analyte and contains the sequence recognized by a specific restriction enzyme. Upon binding of the target analyte, the binding site for the restriction enzyme is created wherein the restriction enzyme cuts the continuous strand converting the strand to a discontinuous strand, as shown in
In one embodiment, a detection device (40) as shown in
In another aspect of the invention, a method is provided for detecting a target analyte in a sample using the detection unit(s) disclosed herein. According to this aspect of the invention, the methods involve exposing a sample having a target analyte to the detection unit under conditions such that the target analyte binds to the active segment of the filament, wherein binding of the target analyte to the active segment of the filament causes a first change in the property of the filament; exposing the filament to an agent, wherein the exposure of the filament to an agent generates a second detectable change in the property of the filament; transduction of the second detectable change to a medium which generates a detectable signal; and detection of the signal.
One embodiment of this aspect of the invention is shown in
Another embodiment of this aspect of the invention corresponds to a filament having an active segment which comprises a continuous strand making up a portion of one strand of a filament and a discontinuous strand making up a portion of another strand of the filament. The two ends of the filament are attached by multiple covalent or non-covalent connections to surfaces. The two ends of the discontinuous strand in the active segment have one or more covalently or non-covalently attached probes able to bind to portions of the target analyte.
According to this and the previous embodiments the detection unit is exposed to the sample under conditions such that the target binds to the active segment if the target is present in the sample. Upon binding of the target analyte to the active segment, the strand is converted from a discontinuous strand to a continuous strand, as shown in
As used herein, a “property change,” “first property change,” “second property change,” or “change in property of the filament” includes chemical, thermodynamic, mechanical, thermal, electromagnetic and quantum mechanical properties. Exemplary chemical changes include, but are not limited to, changes in chemical bond connectivity, stereochemical configuration, conformation, ionization state, oxidation state or redox potential, and protonation state or pKa. In a preferred embodiment, initial binding of the target analyte to the filament results in a chemical connectivity change, such as the formation of non-covalent bonds (first property change). Exemplary mechanical changes include, but are not limited to, changes in dimension(s), mass density, intramolecular and intermolecular interaction forces, stiffness modulus, strength, fracture toughness, acoustic impedance, and the speed of sound.
According to embodiments, the second detectable change in the filament is transduced to a medium which generates a detectable signal. Examples of the detectable signal which can be generated according to the invention include, but are not limited to, electrical (e.g., capacitance), mechanical, optical, acoustic or thermal signal. In one preferred embodiment, the exposure to a twisting agent results in a change of the filament intermolecular and intramolecular interaction forces in the specific form of torsional stress (second property change), which ultimately induce filament supercoiling. In another preferred embodiment, the exposure to a breaking agent results in a change of chemical connectivity (second property change).
In a preferred embodiment of the present invention, the first surface of the detection unit is a particle and the second surface is a substantially flat substrate. A force field acts on the particle and pulls it away from the second surface (e.g. a magnetic field acting on a magnetic particle). Each filament contains at least one active segment comprising one continuous and one discontinuous strand. The device is exposed to a sample in conditions such that if the target is present, then at least one target analyte binds to the active segment of at least one filament. Consequently, a filament having an active segment with two continuous strands is formed (first property change). Upon exposure of the filaments to intercalator molecules, the active segment with the bound target analyte cannot swivel, resulting in the accumulation of torsional stress and supercoiling (second property change). Supercoiling produces a change in distance between the particle and the flat surface which can be detected. Preferably, the movement of the particle towards the surface changes the electrical properties of a non-conductive gap between conductive strips patterned on the surface. For example, if the particle is conductive and elongated, such as a metallic nanorod, upon continued twisting of the filament, the metallic nanorod eventually touches and bridges two conductive strips causing a detectable drop in electrical resistance between the two strips (
In one embodiment, a detection device contains a plurality of detection units. The detection device is exposed to the sample in conditions such that the number of target analytes that bind to the detection units is proportional to the concentration of the target analyte. In this manner, the detectable signal is proportional to the concentration of the target analyte, thereby permitting the concentration of the target analyte in the sample to be determined.
Each detection unit may have a plurality of filaments with active segments attached to it, and as a result, each detection unit can bind to a plurality of target analytes.
A detection device may contain several detection units. Furthermore, the device may have a plurality of locations each location with one or more detection units. Each location can be exposed to a different sample. One location can be control-positive location and another, a control-negative location. When testing for a particular condition, for example, an infectious disease, the control-positive location is exposed to a control sample containing one biomarker correlated to the disease. The control-negative location is exposed to a control sample not containing the biomarkers. Other locations are exposed to samples from the patient.
In a further exemplary embodiment, the detectable signal can be the deflection of a deflectable element, such as a membrane or cantilever. As such, at least one surface of the detection unit is a cantilever. The term “cantilever” or “microcantilever” is used herein to denote any structural element that is attached so as to have at least one degree of freedom, enabling movement in at least one dimension. The movement is usually a bending, rotational and/or torsional motion. A cantilever or microcantilever generally has one end fixed to a substrate and an opposite end which is free and unattached. Generally, microcantilevers are preferably made of a semiconductor material. However other materials may be used, provided that such materials are capable of being fabricated in the requisite size, for instance, by a mask aligner. Microcantilevers are of a microscopic size, with a thickness on the order of 1 μm (e.g., 800 nm), a width on the order of 10 μm (e.g. 30 μm), and a length on the order of 100 μm (e.g., 200 or 300 μm). By “micro-membrane” is meant a thin disk or other shape preferably pre-coated with a wide range of films selected from metals, polymers, ceramics to bio-molecules. The micro-membrane may be oscillated at its resonance frequency. A large number of different micromembranes exist, see for example E. Quandt, K. Seemann, Magnetostrictive Thin Film Microflow Devices, Micro System Technologies 96, pp. 451-456, VDE-Verlag GmbH, 1996, which is expressly incorporated herein by reference. According to this embodiment, the detection device can include multiple microcantilevers and/or multiple micro-membranes are part of the present invention.
An additional embodiment of the invention is shown in
An additional embodiment of the invention is shown in
In an additional embodiment, an active segments of the “1 to 0” type described before can have also the functionality of a “1 to 2” type provided the necessary complementary monomer sequences or probes are present. Conversely, a “1 to 2” type can also have the functionality of a “1 to 0” type. Furthermore, once an active segment comprises two strands, for example, after target analyte binding to a “1 to 2” type, then the active segment can behave as a “2 to 1” type of active segment. Moreover, anytime an active segment comprises only one continuous strand, then it can behave as a “1 to 0” type of active segment.
In an additional embodiment, a detection unit can contain several filaments, each with several active segments along its length, capable of binding several target analytes. The detection unit is exposed to the sample and then to breaking agent and twisting agent. The signal obtained depends on the state of each of the active segments of the detection unit. The following are the main possible signals and the conditions that generate them: 1) Distance between surfaces becomes smaller, requires at least one filament to have all its active segments with two or more continuous strands; 2) Distance between surfaces increases, requires every filament to have at least one active segment with no continuous strand (active segments that underwent a “1 to 0” change). This case requires the presence of a force that pulls one surface away from the other. 3) No significant change in distance, in all other cases. For example, a detection unit with two filaments each with two active segments, both of them of the “1 to 2” type. Each of the four active segments have binding sites for a different oligonucleotide, one filament can have sites for A and B, and the other for C and D. The state of the detection unit can be described with a two by two matrix, where each column represents the state of the active segments of one of the filaments. The detection unit is exposed to a sample and then to intercalator molecules, the distance between the surfaces will decrease if A and B are present in the sample or if C and D are present in the sample. This case is shown below in matrix representation:
In an additional embodiment, a method is provided for identifying two, three, four, five, ten, fifteen, twenty, one hundred, one thousand or more different target analytes in a test sample. According to this embodiment, multiple types of detection units are provided in a detection device. Each type of detection unit contains substantially the same type and number of filaments, and therefore the same active segments. According to this embodiment the detection device may include two, three, four, five, ten, fifteen, twenty, one hundred, one thousand or more different detection units of each type.
Detection units of one type are distinguishable from detection units of another type by at least one physical property (e.g. by their location in the detection device or, when one of the surfaces is a particle, by the electrical properties of the particle). Thus, exposure of the device to a sample (and possible to a breaking agent) changes the state of the detection units in a manner that can be correlated with the target analytes present in the sample and their concentration. Subsequent exposure to a twisting agent produces a change in the distance between the surfaces comprising the devices in accordance with the devices state, in such a way that the detection device can not only sense different target analytes but also identify the specific target analytes present in the sample. According to this embodiment, a method is provided for creating a unique profile or fingerprint of a sample having two, three, four, five, ten, fifteen, twenty, one hundred, one thousand or more different target analytes. As such, profiles from different samples can be stored in a database and/or compared for diagnostic purposes for the detection of diseases or disorders.
The methods disclosed herein can be used to discriminate a single nucleotide difference in a target nucleic acid and, thus, can be used to detect a single mutation or variation in a target sequence. A common type of genetic variation is single nucleotide polymorphism (SNP), which may include polymorphism in both DNA and RNA at a position at which two or more alternative bases occur at appreciable frequency in a population. For example, two DNA fragments in the same gene of two individuals may contain a difference (e.g., CCTGGATC to CCTGAATC) in a single nucleotide to form a SNP.
Another type of genetic variation is a somatic mutation. A somatic mutation is not inherited from a parent or passed to offspring, but it occurs in a cell of an individual that is not a germ line cell. A mutation is transmitted only to the cells that descend from the original cell where the mutation first took place. Tumors are the result of somatic mutations that produce uncontrolled cell growth. Many mutations have been directly linked to human disease and genetic disorders including, for example, Factor V Leiden mutations, hereditary haemochromatosis gene mutations, cystic fibrosis mutations, Tay-Sachs disease mutations, and human chemokine receptor mutations.
The phenotypic implications of numerous SNPs have been identified. Particularly important for personalized medicine applications is the association of these polymorphisms with different rates of drug metabolism. In some cases, SNPs are not associated with a disease state. Instead they can serve as biological markers for locating a disease on the human genome map because they are usually located near a gene associated with a certain disease.
The methods disclosed herein can be used to discriminate a single nucleotide difference in a target nucleic acid. Thus, one embodiment is directed to detecting a single nucleotide of interest, such as a SNP or a somatic mutation. In one embodiment, the unpaired nucleotides in the discontinuous strand of the linear DNA molecule share 100% complementarity with the target nucleic acid containing the single nucleotide of interest, such that supercoiling of the linear DNA molecule occurs only if the target nucleic acid of interest containing the single nucleotide of interest is present in the sample and wherein supercoiling will not occur when the only difference in the target nucleic acid is a different nucleotide at the single nucleotide of interest. In one embodiment, the target nucleic acid hybridizes to unpaired nucleotides at the 3′ and 5′ ends of the discontinuous strand but not to the unpaired nucleotides of the continuous strand (see e.g.,
Disclosed is a strategy to detect oligonucleotide analytes. In this exemplified detection technique, the hybridization of the target analyte to a DNA molecule restores the capacity of the DNA molecule to supercoil. The detection unit in this example includes a double stranded DNA molecule (dsDNA), 2.5 μm long, attached at one end to a glass surface and at the other end to a 1 μm magnetic bead—a configuration used in magnetic tweezers experiments (see Strick et al., Science 271, 1835-1837 (1996); Celedon et al., Nano Lett 9, 1720 (2009)). (
In this example, the conformational state of multiple detection units is monitored simultaneously by video-microscopy (
The detection strategy was tested using detection units that had the active segment and the target shown in
Detailed Experimental Method
DNA Preparation.
Functionalized dsDNAs were generated following a previously described procedure (Celedon et al., Nano Lett 9, 1720 (2009). In order to incorporate the active segment, an additional ligation step was conducted. Briefly, two DNA segments, 1 kilo base pair (kbp) long, were generated by PCR in the presence of modified nucleotides, either biotin-14-dCTP (Life Technologies, Carlsbad, U.S.) or digoxigenin-11-dUTP (Roche, Indianapolis, U.S.). The biotinylated segment was ligated to a 1 kbp DNA segment. The active segment (
Device Assembly.
Borosilicate capillary tubes (Vitrocom, Mountain Lakes, U.S) were washed with ethanol and deionized water and dried with nitrogen gas. The interior of the tubes was functionalized by incubation in Standard Buffer with 100 mM NaCl (SB100) (10 mM phosphate buffer, pH 7.2, 0.1% Tween-20) complemented with 0.1 mg/ml anti-digoxigenin (Polyclonal, Roche) for 1 hour at room temperature. Then, the capillaries were blocked by incubation with SB100 complemented with 50 mg/ml Bovine Serum Albumin (Sigma Aldrich, St. Louis, U.S.) for 1 hour at room temperature. Functionalized capillary tubes were incubated with approximately 1 ng of functionalized DNA molecules for 10 minutes. Streptavidin functionalized superparamagnetic beads (1 μm, Myone, Life Technologies) were flowed into the capillary tube and incubated for 10 minutes. Unbound beads were removed by flowing SB500 (SB with 500 mM NaCl). Two cube permanent magnets (5 mm side, N42) (K&J Magnetics, Inc., Jamison, U.S.) separated by 2 mm from each other were placed 5 mm above the capillaries to lift the beads away from the glass surface. The orientation of the magnets was such that their magnetization was in opposite directions and perpendicular to the capillary tubes.
Detection of Single Molecule Hybridization by Video-Microscopy.
SB500 containing the target oligonucleotide was flowed into the capillary using a syringe pump and incubated at room temperature for 15 minutes (*). Video microscopy of the beads was obtained using an inverted optical microscope (Nikon, TS 100) with bright field illumination and equipped with a digital camera connected to a PC. The camera was either a MicroPublisher 5.0 (Qimaging, Surrey, Canada) or QICAM (Qimaging). A low amplification objective (40×) was used in order to visualize a large number of beads (detection units) in a single field of view. An image analysis code written in Matlab was used to detect the state (extended/supercoiled) of all the detection units in the field of view simultaneously. Beads tethered by an extended non-supercoiled DNA molecule undertake large Brownian fluctuations (≈1 μm). The Matlab code detected this movement by acquiring 100 monochromatic frames and summing the square difference of successive frames, according to the formula, M=Σi=199(Ii+1−Ii)2 where Ii is the ith frame.
This example discloses a method to detect the presence of nanorods contacting a flat surface. The method can be used to detect supercoiling of a DNA molecule if the molecule is previously attached at one end to a nanorod and at the other end to the flat surface.
The presence of nanorods contacting a gold pattern was detected from the drop in electrical resistance between gold stripes (
Nanorods were prepared by electrodeposition into the 200 nm diameter pores of an aluminum oxide template membrane (Whatman, Springfield Mill, Kent, England), similar to previously published protocols. (Celedon et al., Nano Lett 9, 1720 (2009)) The nanorods formed by filling the pores of the membrane by the deposited material. Segments were deposited by changing the electrolytic solution. The template was finally etched to generate the nanorods. Pt/Ni nanorods about 20 μm long with 1 μm nickel segment were produced.
The patterned surface and the nanorods were separately incubated for 10 min in 10 mM phosphate buffer complemented with 1 mg/ml BSA (Sigma-Aldrich, St Louis, Mo., USA). The resistance between consecutive stripes and then applied a 1 μl drop containing nanorods to the surface was measured. We let dry for 30 min in the presence of a magnetic field that oriented the nanorods perpendicular to the gold stripes. Microscopy images of the nanorods on the gold pattern were taken (
This example discloses a method to detect the presence of a particle in the vicinity of an array of light sensors, such as complementary metal-oxide-semiconductor (CMOS) and charge-coupled devices (CCD), normally used in digital video cameras. The method can be used to detect supercoiling of a DNA molecule if the molecule is previously attached at one end to a particle and at the other end to the surface of the sensor.
The presence of 1 μm beads (Myone, Life Technologies) was detected on the surface of a CCD camera. Beads were placed directly on the surface of the sensor. A 2 μl drop of solution containing the beads was placed on the surface. After few minutes, the water in the solution had evaporated and an image of the surface of the sensor was obtained using an optical microscope (
A modification of this method is to use fluorescent particles and instead of detecting a decrease in the light intensity, detect an increase in light intensity as a result of the presence of the particles.
All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
While the invention has been described in detail and with reference to specific embodiments thereof, it will be readily apparent to one of ordinary skill in the relevant arts that other suitable modifications and adaptations to the methods and applications described herein can be made without departing from the scope of any of the embodiments.
This example discloses a method of discriminating a single nucleotide difference in a target molecule. The experimental procedures are the same as in Example 1 unless indicated. A recombinant linear DNA molecule was prepared as in Example 1 but using different restriction enzymes and a different active segment. The active segment sequences used were AS1-CYP2C19, AS2-CYP2C19 and AS3-CYP2C19.
CCACTCGTCACTCA
CTTACCTGGAT
C
CAG
TGGAACAGAGGTGGTGGC
AACATCAGGATTGTAAGCACCCCCTG
G
ATCCAGGTAAGGCCAAGTT
AACATCAGGATTGTAAGCACCCCCTG
A
ATCCAGGTAAGGCCAAGTT
The discontinuous strand had unpaired nucleotides both at the 3′ end and at the 5′ end of its discontinuity. The unpaired nucleotides at the 3′ end of the discontinuity were complementary to a section of 23 nucleotides of the sense strand of the human gene CYP2C19 (bases on italic font in AS1-CYP2C19). The unpaired nucleotides at the 5′ end of the discontinuity were complementary to an adjacent section in CYP2C19 15 nucleotides long that contained the polymorphic nucleotide rs4986893 (underlined base in AS3-CYP2C19). In this polymorphism, the wild type base is a guanine and the variant is an adenine.
The continuous strand had unpaired nucleotides in the active segment (the sequence of bases in standard font between the two sequences in bold font, in AS2-CYP2C19). We surprisingly found that the presence of unpaired nucleotides in the continuous strand increases the capacity to discriminate single nucleotide changes in the target because they reduce the stability of mismatched targets.
Devices were assembled similarly to Example 1, with two important differences. First, the recombinant linear DNA molecule was incubated 20 minutes with target molecules before flowing them into the capillary. Second, the beads were incubated with the linear DNA molecule after target incubation and before flowing them into the capillary.
Detection of supercoiling was conducted by analyzing images obtained with an inverted optical microscope located under the capillary and detecting different levels of Brownian motion, similarly to the procedure described in Example 1, with some modifications. Beads were rotated before detecting the moving beads, and supercoiling was measured at several time points. Beads were rotated 60 turns in the direction that unwind the two strands of DNA molecules attached to them. Rotation of the beads was conducted by rotating the external magnets. The vertical pulling force applied by the magnetic field to the beads was kept greater than 0.5 pN by controlling the distance between the external magnets and the capillary. This force was sufficient to prevent supercoiling of the negatively-twisted DNA molecules. One hundred iImages were acquired using the digital camera connected to the inverted microscope and processed as in Example 1 to obtain the location of beads tethered by an extended DNA molecule. After, the distance between the external magnets and the capillary was increased in order to reduce the force applied to the beads and allow supercoiling of the molecules bound to a target oligonucleotide. Then, a second set of 100 images were acquired and analyzed. Beads tethered by supercoiled DNA molecules had a restricted motion and appear smaller and black or dark gray, similar to
All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
While the invention has been described in detail and with reference to specific embodiments thereof, it will be readily apparent to one of ordinary skill in the relevant arts that other suitable modifications and adaptations to the methods and applications described herein can be made without departing from the scope of any of the embodiments.
This application claims the benefit of U.S. Provisional application No. 61/983,684, filed Apr. 24, 2014, the entire disclosure of which is incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| 61983684 | Apr 2014 | US |