Devices and methods for oligonucleic acid library synthesis

Information

  • Patent Grant
  • 11691118
  • Patent Number
    11,691,118
  • Date Filed
    Monday, July 6, 2020
    3 years ago
  • Date Issued
    Tuesday, July 4, 2023
    10 months ago
Abstract
Devices and methods for de novo synthesis of large and highly accurate libraries of oligonucleic acids are provided herein. Devices include structures having a main channel and microchannels, where the microchannels have a high surface area to volume ratio. Devices disclosed herein provide for de novo synthesis of oligonucleic acids having a low error rate.
Description
SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Apr. 15, 2016, is named 44854_713_302_SL.txt and is 28,372 bytes in size.


BACKGROUND

Highly efficient chemical gene synthesis with high fidelity and low cost has a central role in biotechnology and medicine, and in basic biomedical research. De novo gene synthesis is a powerful tool for basic biological research and biotechnology applications. While various methods are known for the synthesis of relatively short fragments in a small scale, these techniques often suffer from scalability, automation, speed, accuracy, and cost.


BRIEF SUMMARY

Provided herein are devices for synthesizing oligonucleic acids, comprising: a plate; a main channel, wherein the main channel extends vertically into the plate from an opening on a top side of the plate, and wherein the main channel has a width of 0.5 to 2 mm; and a plurality of microchannels connected to the main channel, wherein each microchannel of the plurality of microchannels extends vertically from an opening on a bottom side of the plate into the main channel, and wherein each microchannel of the plurality of microchannels has a surface area to volume ratio of greater than 0.2 (l/um). Devices are further provided wherein the surface area to volume ratio provides for rapid exchange of chemical exposure during de novo synthesis of oligonucleic acids. Devices are further provided wherein the surface area to volume ratio is about 0.4 (l/um). Devices are further provided wherein the surface area to volume ratio is greater than 0.4 (l/um). Devices are further provided wherein the surface area to volume ratio is 0.41 (l/um). Devices are further provided wherein each microchannel of the plurality of microchannels has a surface area greater than 10,000 um2. Devices are further provided wherein each microchannel of the plurality of microchannels has a surface area greater than 12,000 um2. Devices are further provided wherein each microchannel of the plurality of microchannels has a surface area of about 13,000 um2. Devices are further provided wherein the plurality of microchannels comprises 50 to 500 microchannels. Devices are further provided wherein the plurality of microchannels comprises 100 to 150 microchannels. Devices are further provided wherein a ratio of width to depth of a narrowest segment of each microchannel is from 0.5 to 0.01. Devices are further provided wherein a ratio of width to depth of a narrowest segment of each microchannel is about 0.05, 0.1, or 0.2. Devices are further provided wherein each microchannel of the plurality of microchannels has a total width of 30 um to 100 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a total width of about 60 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a depth of 10 to 500 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a depth of about 30 um. Devices are further provided wherein the main channel has a width from 0.5 to 1.5 mm. Devices are further provided wherein the main channel has a width of about 1.2 mm. Devices are further provided wherein the main channel has a width of 1.15 mm. Devices are further provided wherein the device comprises more than 250 main channels. Devices are further provided wherein the device comprises more than 10,000 main channels. Devices are further provided that further comprising a first molecule, wherein the first molecule is bound to an interior surface of the plurality of microchannels and comprises a reactive group that binds to a nucleoside phosphoramidite. Devices are further provided wherein the first molecule is a silane. Devices are further provided wherein the first molecule is an aminosilane. Devices are further provided wherein the first molecule is 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane or N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. Devices are further provided further comprising a second molecule, wherein the second molecule is bound to an interior surface of the main channel and lacks a reactive group that binds to a nucleoside phosphoramidite. Devices are further provided wherein the second molecule is a fluorosilane. Devices are further provided wherein the fluorosilane is (tridecafluorotetrahydrooctyl)-triethoxysilane. Devices are further provided wherein the first molecule has a higher surface energy than the second molecule, and wherein the first molecule has a greater hydrophobicity than the second molecule. Devices are further provided wherein the plate is a silicon plate. Devices are further provided wherein the device comprises at least 30,000 microchannels. Devices are further provided wherein the device comprises at least 700,000 microchannels.


Provided herein are devices for synthesizing oligonucleic acids, comprising: a plate; a main channel, wherein the main channel extends vertically into the silicon plate from an opening on a top side of the plate, and wherein the main channel has a width of 0.5 to 2 mm; and a plurality of microchannels connected to the main channel, wherein each microchannel of the plurality of microchannels extends vertically from an opening on a bottom side of the plate into the main channel, and wherein each microchannel of the plurality of microchannels comprises a total width that is less than 100 um, a microchannel surface area greater than 10,000 um, and a maximum width for the narrowest segment of the microchannel of 10 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a surface area greater than 12,000 um2. Devices are further provided wherein each microchannel of the plurality of microchannels has a surface area of about 13,000 um2. Devices are further provided wherein the plurality of microchannels comprises 50 to 500 microchannels. Devices are further provided wherein the plurality of microchannels comprises 100 to 150 microchannels. Devices are further provided wherein a ratio of width to depth of a narrowest segment of each microchannel is from 0.5 to 0.01. Devices are further provided wherein a ratio of width to depth of a narrowest segment of each microchannel is about 0.05, 0.1, or 0.2. Devices are further provided wherein each microchannel of the plurality of microchannels has a total width of 30 um to 100 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a total width of about 60 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a depth of 10 to 500 um. Devices are further provided wherein each microchannel of the plurality of microchannels has a depth of about 30 um. Devices are further provided wherein the main channel has a width from 0.5 to 1.5 mm. Devices are further provided wherein the main channel has a width of about 1.2 mm. Devices are further provided wherein the main channel has a width of 1.15 mm. Devices are further provided wherein the device comprises more than 250 main channels. Devices are further provided wherein the device comprises more than 10,000 main channels. Devices are further provided further comprising a first molecule, wherein the first molecule is bound to an interior surface of the plurality of microchannels and comprises a reactive group that binds to a nucleoside phosphoramidite. Devices are further provided wherein the first molecule is a silane. Devices are further provided wherein the first molecule is an aminosilane. Devices are further provided wherein the first molecule is 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane or N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. Devices are further provided further comprising a second molecule, wherein the second molecule is bound to an interior surface of the main channel and lacks a reactive group that binds to a nucleoside phosphoramidite. Devices are further provided wherein the second molecule is a fluorosilane. Devices are further provided wherein the fluorosilane is (tridecafluorotetrahydrooctyl)-triethoxysilane. Devices are further provided wherein the first molecule has a higher surface energy than the second molecule, and wherein the first molecule has a greater hydrophobicity than the second molecule. Devices are further provided wherein the plate is a silicon plate. Devices are further provided wherein the device comprises at least 30,000 microchannels. Devices are further provided wherein the device comprises at least 700,000 microchannels.


Provided herein are methods for de novo oligonucleic acid synthesis, comprising: providing predetermined sequences for a plurality of non-identical oligonucleic acids; providing a device described herein; adding a droplet of fluid comprising an extension reaction reagent specific to a microchannel; allowing sufficient time for an extension reaction step to occur; and repeating steps (c) and (d) until the plurality of non-identical oligonucleic acids are synthesized, wherein each oligonucleic acid at least 10 bases in length and attached to an inside region of the microchannel, and wherein the synthesized non-identical oligonucleic acids encode sequences with an aggregate error rate of less than 1 in 2000 bases compared to the predetermined sequences. Methods are further provided wherein the synthesized non-identical oligonucleic acids encode sequences with an aggregate error rate of less than 1 in 3000 bases compared to the predetermined sequences. Methods are further provided wherein the synthesized non-identical oligonucleic acids encode sequences with an insertion error rate of less than 1 in 5000 bases compared to the predetermined sequences. Methods are further provided wherein the synthesized non-identical oligonucleic acids encode sequences with a deletion error rate of less than 1 in 2000 bases compared to the predetermined sequences. Methods are further provided that further comprising washing the surface with a washing reagent, and wherein washing removes greater than 95% of unincorporated extension reaction reagent. Methods are further provided wherein washing removes greater than 99% of unincorporated extension reaction reagent. Methods are further provided wherein the droplet of fluid is less than about 32 pL in volume. Methods are further provided wherein the method is completed in less than 24 hours. Methods are further provided wherein the synthesized plurality of non-identical oligonucleic acids are fluidically connected to a single main channel and collectively encode for a single gene. Methods are further provided wherein the oligonucleic acids collectively encode for at least 200 genes at least 1 kb in length. Methods are further provided further comprising: releasing the plurality of non-identical oligonucleic acids from the surface; and subjecting the plurality of non-identical oligonucleic acids to a polymerase chain assembly reaction to assemble at least 200 genes. Methods are further provided wherein the at least 200 genes have an aggregate error rate of less than 1 in 2000 bases compared to the predetermined sequences without correcting errors. Methods are further provided wherein the at least 200 genes have an aggregate error rate of less than 1 in 3000 bases compared to the predetermined sequences without correcting errors. Methods are further provided wherein each oligonucleic acid has a tether region 12 to 25 bases in length. Methods are further provided wherein the tether region is homopolymeric. Methods are further provided wherein each oligonucleic acid is at least 30 bases in length. Methods are further provided wherein each oligonucleic acid 50 to 500 bases in length.


Provided herein are devices for synthesizing oligonucleic acids, comprising a silicon plate; a main channel, wherein the main channel extends vertically into the silicon plate from an opening on a top side of the silicon plate, and wherein the main channel has a width of 0.5 to 2 mm; and 50 to 500 microchannels connected to the main channel, wherein each of the 50 to 500 microchannels extends vertically from an opening on a bottom side of the silicon plate into the main channel, and wherein each microchannel of the 50 to 500 microchannels has a surface area to volume ratio of greater than about 0.4 (l/um), and a ratio of width to depth of a narrowest segment of each microchannel is from 0.5 to 0.01.


INCORPORATION BY REFERENCE

All publications, patents, and patent applications disclosed herein are incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict between a term disclosed herein and a term in an incorporated reference, the term herein controls.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 illustrates a plate configured for oligonucleic acid synthesis comprising 24 regions, or sub-fields, each having an array of 256 clusters.



FIG. 2 illustrates a closer view of the sub-field in FIG. 1 having 16×16 of clusters, each cluster having 121 individual loci.



FIG. 3 illustrates a detailed view of the cluster in FIG. 2, where the cluster has 121 loci.



FIG. 4A illustrates a front view of a plate with a plurality of microchannels.



FIG. 4B illustrates a sectional view of plate with a plurality of microchannels.



FIG. 5 illustrates three-dimensional arrangements for microchannels.



FIG. 6 illustrates a cluster having a plurality of loci with double comb shapes.



FIG. 7 illustrates a cluster having a plurality of loci with single comb shapes.



FIG. 8 illustrates a cluster having a plurality of loci with single serpentine shapes.



FIGS. 9A-9F illustrate a workflow for the passive and active functionalization of an etched substrate.



FIGS. 10A-10C illustrate reagent deposition directly into microchannels within a main channel, where: microchannels are actively functionalized (FIG. 10A), main channels are passively functionalized (FIG. 10B); and microchannels are actively functionalized and main channels are passively functionalized (FIG. 10C). The dotted lines indicate that the image depicts one main channel of many in a single substrate (e.g., a plate).



FIGS. 11A-11C illustrate reagent deposition directly into microchannels within a main channel, where a plate contains a silicon oxide later at a boundary between a main channel and a microchannel, where: microchannels are actively functionalized (FIG. 11A), main channels are passively functionalized (FIG. 11B); and microchannels are actively functionalized and main channels are passively functionalized (FIG. 11C). The dotted lines indicate that the image depicts one main channel of many in a single substrate (e.g., a plate).



FIG. 12 illustrates a workflow for de novo oligonucleotide synthesis.



FIG. 13 illustrates a computer system.



FIG. 14 is a block diagram illustrating architecture of a computer system.



FIG. 15 is a diagram demonstrating a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).



FIG. 16 is a block diagram of a multiprocessor computer system using a shared virtual address memory space.



FIG. 17 depicts read counts from a sub-array having 256 clusters (left), and an image of a cluster having 121 loci (right).



FIG. 18 is a graphical representation of oligonucleic acid frequency versus abundance from an experiment where oligonucleic acids were synthesized on the substrate of FIG. 17.



FIG. 19 is a graphical representation of oligonucleic acid frequency versus abundance for four representative clusters of the substrate of FIG. 17.



FIG. 20 is a graphical representation of oligonucleic acid frequency versus error rate for oligonucleic acids synthesized on the substrate of FIG. 17.



FIG. 21 is a graphical representation of oligonucleic acid frequency versus error rate for oligonucleic acids synthesized on four representative clusters of the substrate of FIG. 17.



FIG. 22 is a representation of read counts from 240 assembled genes from a library of oligonucleic acids synthesized on a substrate.



FIGS. 23, 24, 25 and 26 provide digital images from gel electrophoresis of 240 assembled genes from a library of oligonucleic acids synthesized on the substrate of FIG. 17.



FIG. 27 provides an output reading from next generation sequencing of 240 assembled genes from a library of oligonucleic acids synthesized on the substrate of FIG. 17.



FIG. 28 provides a graphical representation of insertion/deletion (“indel”) error count as a function of read cycle for a synthesized library of oligonucleic acids.



FIG. 29 provides a digital image of an electrophoresis gel showing 25mer to 200mer oligonucleic acids synthesized using a substrate and methods provided herein.





DETAILED DESCRIPTION

The present disclosure provides compositions, devices, methods and systems for the de novo synthesis of a library of oligonucleic acids with low error rates. The oligonucleic acids are useful components, such as for the generation of larger nucleic acids, such as genes as part of gene libraries.


Described herein are devices having structural features that control the flow of fluid through small channels (“microchannels”) which also serve as locations for oligonucleic acid extension. Factors that can impact the flow of fluid throw the surface include, without limitation, the number of microchannels, microchannel size, the shape of the microchannels, the width of a main channel which a group of microchannels collectively connect, and the chemical properties of surfaces involved (e.g., hydrophobicity and surface energy). During oligonucleic acid synthesis, it is desirable to have channels to have enough width to support the extension of multiple oligonucleic acids, while at the same time be narrow enough to support rapid fluid transfer. Rapid fluid transfer is desirable to provide for efficient chemical exchange during various steps of the de novo nucleic acid synthesis process, and reduce unwanted side reactions that may lead to increased error rates. Devices described herein increase fluid transfer rate through a substrate and also increase the amount of surface available for nucleic acid extension is by having microchannels with a high surface area to volume ratio. Such devices also provide for synthesis of oligonucleic acids with low error rates.


In some cases, oligonucleic acids synthesized within a cluster of extension locations (“loci”) comprise specific predetermined sequences that are configured to be assembled to generate a larger nucleic acid. In this manner, the parallel generation of genes is done on a single substrate. The average error rates for oligonucleic acids synthesized within a library using the systems and methods provided are often less than 1 in 1000, and are preferably less than about 1 in 2000, 1 in 5000 or less often.


Definitions

The present disclosure employs, unless otherwise indicated, conventional molecular biology techniques, which are within the skill of the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which these inventions belong.


Throughout this disclosure, various instances are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any instances. Accordingly, the description of a range should be considered to have specifically described all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically described subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.


Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers +/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.


The terminology used herein is for the purpose of describing particular instances only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.


As used herein, the term “comprising” is inclusive or open-ended and does not exclude additional unrecited elements, device features, compositional components, or method steps.


The term “locus” as used herein refers to a discrete region on a structure which provides support for extension of an oligonucleic acid.


As used herein, the terms “preselected sequence,” “predefined sequence” or “predetermined sequence” are used interchangeably. The terms refer to sequence of a polymer that is known and chosen before synthesis or assembly of the polymer. In particular, various aspects of the invention are described herein primarily with regard to the preparation of nucleic acid molecules, the sequence of the oligonucleotide or polynucleotide being known and chosen before the synthesis or assembly of the nucleic acid molecules.


Substrates, Sub-Fields, Clusters and Loci


Provided herein are devices having a substrate (e.g., a plate) for the generation of a library of oligonucleic acids. An exemplary substrate 100 is illustrated in FIG. 1, wherein the substrate 100 has about the same size dimensions as a standard 96 well plate: 140 mm by 90 mm. The substrate 100 comprises clusters grouped in 24 regions or sub-fields 105, each sub-field 105 comprising an array of 256 clusters 110. An expanded view of an exemplary sub-field 105 is shown in FIG. 2. In the expanded view of four clusters (FIG. 2), a single cluster 110, has a Y axis cluster pitch (distance from center to center of adjacent clusters) of 1079.210 um or 1142.694 um, and an X axis cluster pitch of 1125 um. An illustrative cluster 110 is depicted in FIG. 3, where the Y axis loci pitch (distance from center to center of adjacent loci) is 63.483 um, and an X axis loci pitch is 75 um. The locus width at the longest part, e.g., diameter for a circular loci, is 50 um and the distance between loci is 24 um. The number of loci 305 in the exemplary cluster in FIG. 3 is 121.


Fluid Conditioning


Provided herein are substrates comprising features which are segregated to allow for efficient chemical exchange of reagents during de novo oligonucleic acid synthesis. An exemplary arrangement is illustrated in FIGS. 4A-4B where a plate 405 is illustrated comprising a main channel 410 and a plurality of microchannels 415 connected to the main channel 410. The connection between the main channel 410 and the plurality of microchannels 415 provides for a fluid communication for flow paths from the main channel 410 to the each of the plurality of microchannels 415. A plate 405 described herein can comprise multiple main channels 410. The plurality of microchannels 415 collectively forms a cluster within the main channel 410. In some cases, a library of oligonucleic acids is synthesized in a plurality of loci where the loci are collectively a plurality of microchannels 415 of a cluster where the cluster is within a main channel 410, followed by the assembly of the oligonucleic acids into a large nucleic acid such as gene, wherein the assembly of the large nucleic acid optionally occurs within a main channel of the cluster, e.g., by using PCA. In further cases, a different oligonucleic acid is grown in each of the microchannels 415 with a main channel 410, and the oligonucleic acids collectively encode for a single gene.


The structure is configured to allow for controlled flow for de novo oligonucleic acid synthesis by providing for rapid exchange of chemical exposure during de novo synthesis of oligonucleic acids. For example, in some cases, configuration described herein provide for the controlled and even distribution of mass transfer paths, chemical exposure times, and/or wash efficiency during oligonucleic acid synthesis. In some instances, the configuration of a substrate allows for increased sweep efficiency, for example by providing sufficient volume for a growing an oligonucleic acid such that the excluded volume by the growing oligonucleic acid does not take up more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of the initially available volume that is available or suitable for growing the oligonucleic acid.


In addition to the physical segregation between each of the microchannels 415 of the plurality of microchannels, chemical coatings also provide and additional means for segregating oligonucleic acid species situated within a microchannel. Segregation can be achieved by differential functionalization of the surface, for example by having active and passive regions for oligonucleic acid synthesis coated on the surface. Differential functionalization can also be achieved by alternating the hydrophobicity across the substrate surface, thereby creating water contact angle effects that may cause beading or wetting of the deposited reagents. Employing larger structures can decrease splashing and cross-contamination of distinct oligonucleic acid synthesis locations with reagents of the neighboring spots. A device, such as an oligonucleic acid synthesizer, may be used to deposit reagents to distinct oligonucleic acid synthesis locations.


Microchannels: Structural Features


Microchannels described herein provide chemical properties, dimensions (width, height/depth, or length) de novo synthesized oligonucleic acids having a low error rate. While the plurality of microchannels 415 in FIG. 4 are circular, various shapes can be used to enhance flow rates through the channel, e.g., microchannels with curves or combs. A microchannel having a shape providing an increased surface area to volume ratio may be desirable for several reasons. First, an increase in surface area provides an increase in area that is suitable for oligonucleic acid attachment and synthesis. Second, a locus in the shape of a microchannel with increased surface area to volume ratio requires less fluid for efficient flow through the channel, thereby allowing less reagent volume per reaction. Third, without wishing to be bound by theory, the efficient flow through a locus in the shape of a microchannel with increased surface area to volume ratio minimizes residual occupation of reagents during flow through the microchannel and enhances wash efficiency, thereby minimizing or essentially eliminating undesirable secondary reactions during the chemical steps involved in the oligonucleotide extension process. Minimizing undesirable secondary reactions is another factor for keeping error rate down during oligonucleic acid synthesis.


Exemplary microchannels are illustrated in FIG. 5 which shows a top view of a double comb 510, single comb 520 or serpentine microchannel shape 530. In each exemplary microchannel in FIG. 5, the width of the microchannel at the narrowest segment is 5 um, and each of the microchannel comprises at least one turn greater than 90 degrees in total. In some cases, the microchannel comprises 1 to 10 or more turns greater than 90 degrees in total. In some cases, the turns are curved and the microchannel comprises 1 to 10 or more turns in total. In the case of the single comb 520 and double comb 510, the turns are 90 degrees, i.e. perpendicular fluid paths from a top view. In the case of the serpentine comb 530, the turns are curved and 180 degrees, i.e. a U turn is viewed from top view. In some cases, a turn in a microchannel fluid path is 45 to 180 degrees in total, when viewed from a top view.


In a first example, a main channel 600 comprises a cluster of double comb channels, where each double comb channel 510 has a total width of 57 um, the width of the microchannel at the narrowest segment is 5 um, and each stick of the “comb” is 14 um apart from the center of another stick (FIG. 6). In a second example, a main channel 700 comprises a cluster of single comb channels, where each single comb channel 520 has a total width of 49 um, the width of the microchannel at the narrowest segment is 5 um, and each stick of the “comb” is 14 um apart from the center of another stick (FIG. 7). In a third example, a main channel 800 comprises a cluster of serpentine shaped channels, where each serpentine shaped channel 530 has a total width of 54 um, the width of the microchannel at the narrowest segment is 5 um, and each turn of the shape results in a parallel region 14 um apart from another region (FIG. 7). In some instances, the microchannel extends vertically into the substrate, e.g., a plate.


In some instances, a total surface area for a locus (e.g., a microchannel) in a device described herein is greater than about 9000, 10000, 11000, 12000, 12500, 12600, 12700, 12800, 12900 or 13000 um2. In some instances, the total surface area for a locus in a device described herein is about 10000 to about 15000 um2. In some instances, the total surface area for a locus in a device described herein is about 12000 to about 13000 um2. In some instances, the total surface area to volume ratio (l/um) for a locus in a device described herein is about 0.2 to 0.5. In some instances, the total surface area to volume ratio (l/um) for a locus in a device described herein is greater than 0.20. In some instances, the total surface area to volume ratio (l/um) for a locus in a device described herein is greater than about 0.40. In some instances, the total surface area to volume ratio (l/um) for a locus in a device described herein is about 0.40. In some instances, the total surface area to volume ratio (l/um) for a locus in a device described herein is 0.41.


In some instances, a microchannel described herein has a width to depth (or height) ratio of 1 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the microchannel. In some instances, a microchannel described herein has a width to depth (or height) ratio of 0.5 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the microchannel. In some instances, a microchannel described herein has a width to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, or 1.


In some instances, a substrate is provided comprises a plurality of microchannels corresponding to a plurality of loci within a cluster, wherein the height or depth of the microchannel is from about 5 um to about 500 um, from about 5 um to about 400 um, from about 5 um to about 300 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 10 um to about 50 um. In some cases, the height of a microchannel is less than 100 um, less than 80 um, less than 60 um, less than 40 um or less than 20 um. In some cases, microchannel height is about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 um or more.


In some instances, the width of a locus (e.g., microchannel or microwell) is from about 0.5 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 100 um, or from about 0.1 um to about 100 um, for example, about 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um, 10 um, 5 um, 1 um or 0.5 um. In some instances, the width of a locus (e.g., microchannel) is less than about 100 um, 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, the distance between the center of two adjacent loci is from about 1 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 5 um to about 30 um, for example, about 20 um. In some instances, the total width of a microchannel is about 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um, or 100 um. In some instances, the total width of a microchannel is about 10 um to 100 um, 30 um to 100 um, or 50 um to 70 um.


In some cases, each locus supports the synthesis of a population of oligonucleic acids having a different sequence than a population of oligonucleic acids grown on another locus. Provided herein are surfaces which comprise at least 10, 100, 256, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. Provided herein are surfaces which comprise more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 5,000,000; or 10,000,000 or more distinct loci (e.g., microchannels). In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 500 or more loci. In some cases, each cluster includes 50 to 500, 50 to 200, 50 to 150, or 100 to 150 loci. In some cases, each cluster includes 100 to 150 loci. In exemplary arrangements, each cluster includes 109, 121, 130 or 137 loci.


Provided herein are structures wherein the distance between the centers of two adjacent loci within a cluster is from about 1 um to about 500 um, from about 5 um to about 200 um, or from about 0.5 um to about 100 um. Provided herein are structures wherein the distance between two centers of adjacent loci is about 0.5 um, 20 um, 25 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um, or 100 um.


Provided herein are loci having a width at the longest segment of 5 to 100 um. In some cases, the loci have a width at the longest segment of about 30, 35, 40, 45, 50, 55 or 60 um. In some cases, the loci are microchannels having multiple segments, wherein each segment has a center to center distance apart of 5 to 50 um. In some cases, the center to center distance apart for each segment is about 5, 10, 15, 20 or 25 um.


Main Channels: Structural Features


Main channels described herein extend from a top surface of a substrate, e.g., a plate, into the plate until reaching an interface with a plurality of microchannels, each microchannel connecting to a bottom surface of the substrate. In some instances, the main channel extends vertically. Main channels, e.g., main channel 410, can be in circular, rectangular, tapered, or rounded shapes.


In some instances, a width (a diameter in the case of a circle) of a cluster or the width of a main channel comprising a cluster, or both, is between about 0.05 mm to about 50 mm, between about 0.05 mm to about 10 mm, between about 0.05 mm and about 5 mm, between about 0.05 mm and about 4 mm, between about 0.05 mm and about 3 mm, between about 0.05 mm and about 2 mm, between about 0.05 mm and about 1 mm, between about 0.05 mm and about 0.5 mm, between about 0.05 mm and about 0.1 mm, between about 0.1 mm and 10 mm, between about 0.2 mm and 10 mm, between about 0.3 mm and about 10 mm, between about 0.4 mm and about 10 mm, between about 0.5 mm and 10 mm, between about 0.5 mm and about 5 mm, between about 0.5 mm and about 1.5 mm, or between about 0.5 mm and about 2 mm. In some instances, the width of a cluster or main channel or both is less than or about 5 mm, 4 mm, 3 mm, 2 mm, 1.5 mm, 1.2 mm, 1.15 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm or 0.05 mm. In some instances, the width of a cluster or main channel is between about 1.0 and about 1.3 mm. In some instances, the width of a cluster or main channel, or both is about 1.150 mm. In some instances, the width of a cluster or main channel, or both is about 0.08 mm.


In some instances, the height (depth) of a main channel is from about 20 um to about 1000 um, from about 50 um to about 1000 um, from about 100 um to about 1000 um, from about 200 um to about 1000 um, from about 300 um to about 1000 um, from about 400 um to about 1000 um, or from about 500 um to about 1000 um. In some cases, the height of a main channel is less than about 1000 um, less than about 900 um, less than about 800 um, less than about 700 um, or less than about 600 um. In some cases, the height of a main channel is about 500 um. In some cases, the height of a main channel is about 450 um.


In some instances, the number of distinct nucleic acids or genes assembled from a plurality of oligonucleic acids synthesized on a substrate is dependent on the number of clusters available in the substrate. In some instances, the density of clusters within a substrate is at least or about 1 cluster per 100 mm2, 1 cluster per 10 mm2, 1 cluster per 5 mm2, 1 cluster per 4 mm2, 1 cluster per 3 mm2, 1 cluster per 2 mm2, 1 cluster per 1 mm2, 2 clusters per 1 mm2, 3 clusters per 1 mm2, 4 clusters per 1 mm2, 5 clusters per 1 mm2, 10 clusters per 1 mm2, 50 clusters per 1 mm2 or more. In some instances, a substrate comprises from about 1 cluster per 10 mm2 to about 10 clusters per 1 mm2. In some instances, the distance between the centers of two adjacent clusters is less than about 50 um, 100 um, 200 um, 500 um, 1000 um, or 2000 um or 5000 um. In some cases, the distance between the centers of two adjacent clusters is between about 50 um and about 100 um, between about 50 um and about 200 um, between about 50 um and about 300 um, between about 50 um and about 500 um, and between about 100 um to about 2000 um. In some cases, the distance between the centers of two adjacent clusters is between about 0.05 mm to about 50 mm, between about 0.05 mm to about 10 mm, between about 0.05 mm and about 5 mm, between about 0.05 mm and about 4 mm, between about 0.05 mm and about 3 mm, between about 0.05 mm and about 2 mm, between about 0.1 mm and 10 mm, between about 0.2 mm and 10 mm, between about 0.3 mm and about 10 mm, between about 0.4 mm and about 10 mm, between about 0.5 mm and 10 mm, between about 0.5 mm and about 5 mm, or between about 0.5 mm and about 2 mm.


In some instances, the number of distinct oligonucleic acids synthesized on a substrate is dependent on the number of distinct loci available in the substrate. In some instances, the density of loci within a cluster of a substrate is at least or about 1 locus per mm2, 10 loci per mm2, 25 loci per mm2, 50 loci per mm2, 65 loci per mm2, 75 loci per mm2, 100 loci per mm2, 130 loci per mm2, 150 loci per mm2, 175 loci per mm2, 200 loci per mm2, 300 loci per mm2, 400 loci per mm2, 500 loci per mm2, 1,000 loci per mm2 or more. In some cases, a substrate comprises from about 10 loci per mm2 to about 500 mm2, from about 25 loci per mm2 to about 400 mm2, from about 50 loci per mm2 to about 500 mm2, from about 100 loci per mm2 to about 500 mm2, from about 150 loci per mm2 to about 500 mm2, from about 10 loci per mm2 to about 250 mm2, from about 50 loci per mm2 to about 250 mm2, from about 10 loci per mm2 to about 200 mm2, or from about 50 loci per mm2 to about 200 mm2. In some instances, the distance between the centers of two adjacent loci within a cluster is from about 10 um to about 500 um, from about 10 um to about 200 um, or from about 10 um to about 100 um. In some cases, the distance between two centers of adjacent loci is greater than about 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some cases, the distance between the centers of two adjacent loci is less than about 200 um, 150 um, 100 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um.


A device described herein may comprise multiple main channels. In some cases, a device described herein comprises 1 to 250, 2 to 250, 1 to 500 or more main channels. In some cases, a device described herein comprises about 2, 10, 50, 100, 150, 200, 250, 256, 500, 512, 1000, 2500, 3000, 4000, 5000, 6000, 6144, 10000 or more main channels. In some cases, a plate described herein comprises about 2, 10, 50, 100, 150, 200, 250, 256, 500, 512, 1000, 2500, 3000, 4000, 5000, 6000, 6144, 10000 or more main channels. In some cases, the plate is a silicon plate or a silicon on insulator (SOI) plate.


In some instances, a substrate comprises a surface that supports the synthesis of a plurality of oligonucleic acids having different predetermined sequences at addressable locations on a common support. In some instances, a substrate described herein provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical oligonucleic acids. In some cases, the substrate provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more oligonucleic acids encoding for distinct sequences. In some instances, at least a portion of the oligonucleic acids have an identical sequence or are configured to be synthesized with an identical sequence. In some instances, the substrate provides a surface environment for the growth of oligonucleic acids having at least about 50, 60, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.


In some instances, oligonucleic acids are synthesized on distinct loci of a substrate, wherein each locus supports the synthesis of a population of oligonucleic acids. In some cases, each locus supports the synthesis of a population of oligonucleic acids having a different sequence than a population of oligonucleic acids grown on another locus. In some instances, the loci of a substrate are located within a plurality of clusters. In some instances, a substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a substrate comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150 or more loci. In some instances, each cluster includes 50 to 500, 100 to 150, or 100 to 200 loci. In some instances, each cluster includes 109, 121, 130 or 137 loci. In some instances, each cluster includes 5, 6, 7, 8, 9, 10, 11 or 12 loci.


In some instances, oligonucleic acids from distinct loci within one cluster have sequences that, when assembled, encode for a contiguous longer oligonucleic acid of a predetermined sequence, for example, a gene. In some cases, a substrate comprising more than 20,000 loci (e.g., microchannels) is used for the synthesis of up to 200 distinct genes of predetermined sequence. In some cases, a substrate comprising more than 29,000 loci (e.g., microchannels) is used for the synthesis of about 240 distinct genes of predetermined sequence. In some cases, a substrate comprising more than 700,000 loci is used for the synthesis of about 6,000 distinct genes of predetermined sequence.


Substrate: Materials


Substrates provided may be fabricated from a variety of materials suitable for the methods and compositions described herein. In certain instances, substrate materials are fabricated to exhibit a low level of nucleotide binding. In some cases, substrate materials are modified to generate distinct surfaces that exhibit a high level of nucleotide binding. In some instances, substrate materials are transparent to visible and/or UV light. In some instances, substrate materials are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of a substrate. In some instances, conductive materials may be connected to an electric ground. In some cases, the substrate is heat conductive or insulated. In some cases, the materials are chemical resistant and heat resistant to support chemical or biochemical reactions, for example oligonucleic acid synthesis reaction processes. In some instances, a substrate comprises flexible materials. Flexible materials include, without limitation, modified nylon, unmodified nylon, nitrocellulose, polypropylene, and the like. In some instances, a substrate comprises rigid materials. Rigid materials include, without limitation, glass, fuse silica, silicon, silicon dioxide, silicon nitride, plastics (for example, polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like), and metals (for example, gold, platinum, and the like). In some instances, a substrate is fabricated from a material comprising silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), glass, or any combination thereof. The substrates may be manufactured with a combination of materials listed herein or any other suitable material known in the art. In some instances, substrates described herein are in the shape of a plate, film or tape.


Substrate: Structural Features


In some instances, a substrate is about the size of a standard 96 well plate, for example between about 100 and 200 mm by between about 50 and 150 mm. In some instances, a substrate has a diameter less than or equal to about 1000 mm, 500 mm, 450 mm, 400 mm, 300 mm, 250 nm, 200 mm, 150 mm, 100 mm or 50 mm. In some instances, the diameter of a substrate is between about 25 mm and 1000 mm, between about 25 mm and about 800 mm, between about 25 mm and about 600 mm, between about 25 mm and about 500 mm, between about 25 mm and about 400 mm, between about 25 mm and about 300 mm, or between about 25 mm and about 200. Non-limiting examples of substrate size include about 300 mm, 200 mm, 150 mm, 130 mm, 100 mm, 76 mm, 51 mm and 25 mm. In some instances, a substrate has a planar surface area of at least about 100 mm2; 200 mm2; 500 mm2; 1,000 mm2; 2,000 mm2; 5,000 mm2; 10,000 mm2; 12,000 mm2; 15,000 mm2; 20,000 mm2; 30,000 mm2; 40,000 mm2; 50,000 mm2 or more. In some instances, the thickness of a substrate is between about 50 mm and about 2000 mm, between about 50 mm and about 1000 mm, between about 100 mm and about 1000 mm, between about 200 mm and about 1000 mm, or between about 250 mm and about 1000 mm. Non-limiting examples of substrate thickness include 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm and 925 mm. In some cases, the thickness of a substrate varies with diameter and depends on the composition of the substrate. For example, a substrate comprising materials other than silicon may have a different thickness than a silicon substrate of the same diameter. Substrate thickness may be determined by the mechanical strength of the material used and the substrate must be thick enough to support its own weight without cracking during handling.


In some instances, a substrate described herein comprises a plurality of smaller regions, for example, at least about 2, 4, 6, 8, 10, 16, 24, 39, 50, 100 or more regions, wherein each region may be used independently from another region. In some cases, regions of a substrate are sub-fields or chips of a substrate. In some instances, reference to a substrate includes a region of a substrate.


Active and Passive Functionalization


Selective deposition or selective functionalization refers to a process that produces two or more distinct areas on a structure, wherein at least one area has a different surface or chemical property that another area of the same structure. Such properties include, without limitation, surface energy, chemical termination, surface concentration of a chemical moiety, and the like. In some cases, active functionalization refers to a method comprising the functionalization of a surface that will be utilized for oligonucleic acid synthesis. In some cases, passive functionalization refers to a method comprising the functionalization of a surface that will render these areas ineffective for oligonucleic acid synthesis. Any suitable process that changes the chemical properties of the surface described herein or known in the art may be used to functionalize the surface, for example chemical vapor deposition of an organosilane. Typically, this results in the deposition of a self-assembled monolayer (SAM) of the functionalization species.


In some instances, a method for functionalizing a surface of a substrate for oligonucleic acid synthesis comprises a resist or photoresist coat. Photoresist, in many cases, refers to a light-sensitive material useful in photolithography to form patterned coatings. It can be applied as a liquid to solidify on a substrate as volatile solvents in the mixture evaporate. In some instances, the resist is applied in a spin coating process as a thin film, e.g., 1 um to 100 um. In some cases, the coated resist is patterned by exposing it to light through a mask or reticle, changing its dissolution rate in a developer. In some cases, the resist cost is used as a sacrificial layer that serves as a blocking layer for subsequent steps that modify the underlying surface, e.g., etching, and then is removed by resist stripping. In some instances, the flow of resist throughout various features of the structure is controlled by the design of the structure. In some instances, a surface of a structure is functionalized while areas covered in resist are protected from active or passive functionalization.


In some instances, a substrate suitable for functionalization (e.g., an etched substrate comprising three-dimensional features) is deposited with resist, for example, by an oligonucleic acid synthesizer devices capable of delivering drops of fluid with micrometer accuracy. To resist coat only a small region of the substrate (e.g., lowered features such as a well and/or channel), a droplet of resist may be deposited into the lowered feature where it optionally spreads. In some instances, a portion of the resist is removed, for example, by etching (e.g., oxygen plasma etch) to leave a smooth surface covering only a select area. In some instances, the substrate is passively functionalized with a passive functionalization agent comprising a chemically inert moiety to create a surface having low surface energy. In some instances, the passively functionalized substrate is resist stripped, exposing areas of the substrate that were exposed during front-end processing (etched regions).


Described herein are methods for the synthesis of oligonucleic acids having a low error rate compared to a predetermined sequence using a device configured to regulate the flow of reagents in a microfluidic environment. An exemplary method is illustrated in FIGS. 9A-9F, which depicts a workflow for active functionalization of a microchannels and passive functionalization of surrounding areas, e.g., main channels. An etched substrate 905 is prepared for active functionalization. In FIG. 9A, the substrate is wet cleaned, for example, using a piranha solution. In some instances, the substrate is plasma cleaned, for example, by dry oxygen plasma exposure. In FIG. 9B, the device layer is coated with photoresist 910, optionally after cleaning. In some instances, the photoresist is coated by a process governed by wicking into the device layer channels. In some instances, the photoresist is patterned using photolithography to expose areas that are desired to be passive (i.e., areas where oligonucleic acid synthesis is not designed to take place). Patterning by photolithography may occur by exposing the resist to light through a binary mask that has a pattern of interest. After exposure, the resist in the exposed regions may be removed in developer solution in FIG. 9C, and leaves photoresist at predetermined regions 915. A subsequent step, as shown in FIG. 9D, involves exposure to a passive functionalization agent 920 such as a low surface energy silane (e.g., fluorosilane gas vapor), for example, by chemical vapor deposition (CVD). Exposure to fluorosilane gas results in the deposition of a fluorocarbon on the surfaces without photoresist. In some cases, the substrate is exposed to a hydrocarbon silane. In some instances, passive functionalization comprises exposing a substrate to a passive functionalization agent such as one comprising silane. In some instances, the passively functionalized substrate are unresponsive to additional layers of functionalization agent (e.g., active functionalization agent) creating a monolayer on the surface. A substrate that has been coated with resist, and optionally patterned by photolithography and/or optionally passively functionalized, in many cases, is resist stripped. Resist stripping as shown in FIG. 9E leaves some surfaces passively functionalized while exposing regions of the substrate that was underneath the resist 925. For example, a resist is dissolved in an organic solvent. As another example, resist stripping of a substrate that was passively functionalized with a fluorosilane gas, leaves a surface having some regions of fluorination. In some cases, regions that were underneath the resist comprise silicon or silicon dioxide. In FIG. 9F, the surface is actively functionalized to prepare the surface for oligonucleic acid synthesis. An exemplary active functionalization agent is one that has a higher surface energy than the passive functionalization agent.


An exemplary workflow for the generation of differential functionalization patterns of a substrate is described herein, FIGS. 9A-F. The following workflow is an example process and any step or component may be omitted or changed in accordance with properties desired of the final functionalized substrate. In some cases, additional components and/or process steps are added to the process workflows embodied herein. In some instances, a substrate is first cleaned, for example, using a piranha solution. An example of a cleaning process includes soaking a substrate in a piranha solution (e.g., 90% H2SO4, 10% H2O2) at an elevated temperature (e.g., 120° C.) and washing (e.g., water) and drying the substrate (e.g., nitrogen gas). The process optionally includes a post piranha treatment comprising soaking the piranha treated substrate in a basic solution (e.g., NH4OH) followed by an aqueous wash (e.g., water). In some instances, a substrate is plasma cleaned, optionally following the piranha soak and optional post piranha treatment. An example of a plasma cleaning process comprises an oxygen plasma etch. In some instances, the surface is deposited with an active functionalization agent following by vaporization. In some instances, the substrate is actively functionalized prior to cleaning, for example, by piranha treatment and/or plasma cleaning.


The process for substrate functionalization optionally comprises a resist coat and a resist strip. In some instances, following active surface functionalization, the substrate is spin coated with a resist, for example, SPR™ 3612 positive photoresist. The process for substrate functionalization, in various instances, comprises lithography with patterned functionalization. In some instances, photolithography is performed following resist coating. In some instances, after lithography, the substrate is visually inspected for lithography defects. The process for substrate functionalization, in some instances, comprises a cleaning step, whereby residues of the substrate are removed, for example, by plasma cleaning or etching. In some instances, the plasma cleaning step is performed at some step after the lithography step.


In some instances, a substrate coated with a resist is treated to remove the resist, for example, after functionalization and/or after lithography. In some cases, the resist is removed with a solvent, for example, with a stripping solution comprising N-methyl-2-pyrrolidone. In some cases, resist stripping comprises sonication or ultrasonication. In some instances, a resist is coated and stripped, followed by active functionalization of the exposed areas to create a desired differential functionalization pattern.


In various instances, the methods and compositions described herein relate to the application of photoresist for the generation of modified surface properties in selective areas, wherein the application of the photoresist relies on the fluidic properties of the substrates defining the spatial distribution of the photoresist. Without being bound by theory, surface tension effects related to the applied fluid may define the flow of the photoresist. For example, surface tension and/or capillary action effects may facilitate drawing of the photoresist into small structures in a controlled fashion before the resist solvents evaporate. In some instances, resist contact points are pinned by sharp edges, thereby controlling the advance of the fluid. The underlying structures may be designed based on the desired flow patterns that are used to apply photoresist during the manufacturing and functionalization processes. A solid organic layer left behind after solvents evaporate may be used to pursue the subsequent steps of the manufacturing process. Substrates may be designed to control the flow of fluids by facilitating or inhibiting wicking effects into neighboring fluidic paths. For example, a substrate is designed to avoid overlap between top and bottom edges, which facilitates the keeping of the fluid in top structures allowing for a particular disposition of the resist. In an alternative example, the top and bottom edges overlap, leading to the wicking of the applied fluid into bottom structures. Appropriate designs may be selected accordingly, depending on the desired application of the resist.


As illustrated in the detailed cross view of FIG. 10A, an exemplary described herein is coated with a layer of material comprising on or more active functionalization agent. FIG. 10A illustrates the deposition of reagents 1005 on a plate 405. The substrate 405 comprises a plurality of microchannels 415 in fluidic connection with a main channel 410. In this exemplary device, a single main channel 410 is depicted, and the dashed lines indicate that this is just one of many main channel 410/plurality of microchannels 415 connections in a single plate 405. Each of the plurality of microchannels 415 is coated with an active functionalization agent 1015. Each microchannel 415 of the plurality of microchannels in the example has a width of 5 um and a depth of 30 um. The main channel 410 has a diameter of 1150 um. The total height of the plate is 450 um. The main channel 410 encircles a cluster of microchannels. In some instances, as illustrated in FIG. 10B, a substrate described herein is coated with a layer of material comprising on or more passive functionalization agents. In this exemplary device, a passive functionalization agent 1020 coats surface of a plate 405. In some instances, as illustrated in FIG. 10C, a substrate described herein is coated with a layer of material comprising on or more passive functionalization agents and the microchannels of the substrate are coated with one or more active functionalization agents. In another exemplary device, the starting substrate is a silicon on insulator plate, where layers of silicon sandwich an insulator layer 1110, typically silicon dioxide. In some instances, the thickness of the insulator layer 1110 is from 1 to 50 um, e.g., 20 um. The remaining feature of this exemplary device, as shown in FIGS. 11A-11C, as the same as those depicted in FIGS. 10A-10C.


In some cases, only loci (i.e., microchannels) in a device described herein are coated with active functionalization agent. An active functionalization agent is a molecule that binds to the surface of the substrate and is also capable of binding to a nucleic acid monomer, thereby supporting a coupling reaction to the surface. Exemplary active functionalization agents are molecules having a hydroxyl group available for coupling with a nucleoside in a coupling reaction. In some cases, only main channels and/or surrounding areas (and not the microchannels) in a device described herein are coated with passive functionalization agent. A passive functionalization agent is a molecule that binds to the surface of the substrate and lacks a moiety available for coupling with a nucleoside in a coupling reaction.


Oligonucleic acids synthesized in the channels may be released for the purposes of generating longer nucleic acids. In some cases, following oligonucleic acid synthesis, oligonucleic acids within one cluster are released from their respective surfaces and pool into the main channel. In some cases, the pooled oligonucleic acids are assembled into a larger nucleic acid, such as a gene, within the main channel, so that the main channel functions as a reactor for nucleic acid assembly. In other cases, following oligonucleic acid synthesis, oligonucleic acids within one cluster are released from their respective surfaces and pool into a nanoreactor in fluidic communication with the microchannels.


In some embodiments, nucleic acid verification (e.g., sequencing of oligonucleic acids and/or assembled genes) is performed within a reactor or well. Nucleic acid assembly includes polymerase cycling assembly (PCA). In some cases, a capping element or other device is placed over open sides of the main channel to create an enclosed reactor. A substrate comprising a main channel that functions as a reactor for each cluster has the advantage that each cluster may have a different environment from another cluster in another reactor. As an example, sealed reactors (e.g., those with capping elements) may experience controlled humidity, pressure or gas content.


In some instances, a substrate is configured for both active and passive functionalization moieties bound to the surface at different areas of the substrate surface, generating distinct regions for oligonucleic acid synthesis to take place. In some instances, both active and passive functionalization agents are mixed within a particular region of the surface. Such a mixture provides a diluted region of active functionalization agent and therefore lowers the density of functionalization agent in a particular region.


Substrates described herein may comprise a high surface energy region at the site of active functionalization agent deposition. In some instances, the high surface energy region is coated with aminosilane. The silane group binds to the surface, while the rest of the molecule provides a distance from the surface and a free group at the end to which incoming bases attach. In some instances, the free group is a hydroxyl group. In some instances the high surface energy region includes an active functionalization reagent, e.g., a chemical that binds the substrate efficiently and also couples efficiently to monomeric nucleic acid molecules. In some cases, such molecules have a hydroxyl group which is available for interacting with a nucleoside in a coupling reaction. In some instances, the amino silane is selected from the group consisting of 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. In some instances the high surface energy region includes a passive functionalization reagent, e.g., a chemical that binds the substrate efficiently but does not couple efficiently to monomeric nucleic acid molecules.


In some instances, described herein are substrates comprising a plurality of clusters, wherein each cluster comprises a plurality of loci that support the attachment and synthesis of oligonucleic acids. In some instances, a locus is on a three-dimensional surface, e.g., a well, microchannel, channel, or post. In some instances, a surface of a locus comprises a material that is actively functionalized to attach to at least one nucleotide for oligonucleic acid synthesis, or preferably, a population of identical nucleotides for synthesis of a population of oligonucleic acids. In some instances, oligonucleic acid refers to a population of oligonucleic acids encoding for the same nucleic acid sequence. In some cases, a surface of a substrate is inclusive of one or a plurality of surfaces of a substrate.


In some cases, the addition of a chemical layer on top of a surface (referred to as adhesion promoter) facilitates structured patterning of loci on a surface of a substrate. Exemplary surfaces which can benefit from adhesion promotion include, without limitation, glass, silicon, silicon dioxide and silicon nitride. In some cases, the adhesion promoter is a chemical with a high surface energy. In some instances, a second chemical layer is deposited on a surface of a substrate. In some cases, the second chemical layer has a low surface energy. The surface energy of a chemical layer coated on a surface can facilitate localization of droplets on the surface. Depending on the patterning arrangement selected, the proximity of loci and/or area of fluid contact at the loci can be altered.


In some instances, a substrate surface, or resolved loci, onto which nucleic acids or other moieties are deposited, e.g., for oligonucleic acid synthesis, are smooth or substantially planar or have raised or lowered features. In some instances, a substrate surface is modified with one or more different layers of compounds. Such modification layers of interest include, without limitation, inorganic and organic layers such as metals, metal oxides, polymers, small organic molecules and the like. Non-limiting polymeric layers include peptides, proteins, nucleic acids or mimetics thereof (e.g., peptide nucleic acids and the like), polysaccharides, phospholipids, polyurethanes, polyesters, polycarbonates, polyureas, polyamides, polyetheyleneamines, polyarylene sulfides, polysiloxanes, polyimides, polyacetates, and any other suitable compounds described herein or otherwise known in the art. In some cases, polymers are heteropolymeric. In some cases, polymers are homopolymeric. In some cases, polymers comprise functional moieties or are conjugated.


In some instances, resolved loci of a substrate are functionalized with one or more moieties that increase and/or decrease surface energy. In some cases, a moiety is chemically inert. In some cases, a moiety is configured to support a desired chemical reaction, for example, one or more processes in an oligonucleic acid synthesis reaction. The surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of a nucleotide to attach onto the surface. In some instances, a method for substrate functionalization comprises: (a) providing a substrate (e.g., a plate); and (b) silanizing the loci (e.g., microchannels) with a suitable silanizing agent described herein or otherwise known in the art, for example, an organofunctional alkoxysilane molecule. In some cases, the organofunctional alkoxysilane molecule comprises dimethylchloro-octodecyl-silane, methyldichloro-octodecyl-silane, trichloro-octodecyl-silane, trimethyl-octodecyl-silane, triethyl-octodecyl-silane, or any combination thereof. In some instances, a substrate surface comprises functionalized with polyethylene/polypropylene (functionalized by gamma irradiation or chromic acid oxidation, and reduction to hydroxyalkyl surface), highly crosslinked polystyrene-divinylbenzene (derivatized by chloromethylation, and aminated to benzylamine functional surface), nylon (the terminal aminohexyl groups are directly reactive), or etched with reduced polytetrafluoroethylene.


In some instances, a substrate surface is functionalized by contact with a derivatizing composition that contains a mixture of silanes, under reaction conditions effective to couple the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface. Silanization generally can be used to cover a surface through self-assembly with organofunctional alkoxysilane molecules. A variety of siloxane functionalizing reagents can further be used as currently known in the art, e.g., for lowering or increasing surface energy. The organofunctional alkoxysilanes are classified according to their organic functions. Non-limiting examples of siloxane functionalizing reagents include hydroxyalkyl siloxanes (silylate surface, functionalizing with diborane and oxidizing the alcohol by hydrogen peroxide), diol (dihydroxyalkyl) siloxanes (silylate surface, and hydrolyzing to diol), aminoalkyl siloxanes (amines require no intermediate functionalizing step), glycidoxysilanes (3-glycidoxypropyl-dimethyl-ethoxysilane, glycidoxy-trimethoxysilane), mercaptosilanes (3-mercaptopropyl-trimethoxysilane, 3-4 epoxycyclohexyl-ethyltrimethoxysilane or 3-mercaptopropyl-methyl-dimethoxysilane), bicyclohepthenyl-trichlorosilane, butyl-aldehydr-trimethoxysilane, or dimeric secondary aminoalkyl siloxanes. The hydroxyalkyl siloxanes can include allyl trichlorochlorosilane turning into 3-hydroxypropyl, or 7-oct-1-enyl trichlorochlorosilane turning into 8-hydroxyoctyl. The diol (dihydroxyalkyl) siloxanes include glycidyl trimethoxysilane-derived (2,3-dihydroxypropyloxy)propyl (GOPS). The aminoalkyl siloxanes include 3-aminopropyl trimethoxysilane turning into 3-aminopropyl (3-aminopropyl-triethoxysilane, 3-aminopropyl-diethoxy-methylsilane, 3-aminopropyl-dimethyl-ethoxysilane, or 3-aminopropyl-trimethoxysilane). The dimeric secondary aminoalkyl siloxanes can be bis (3-trimethoxysilylpropyl) amine turning into bis(silyloxylpropyl)amine. In some instances, the functionalizing agent comprises 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide.


In some instances, a substrate surface is contacting with a mixture of functionalization groups, e.g., aminosilanes, which can be in any different ratio. In some instances, a mixture comprises at least 2, 3, 4, 5 or more different types of functionalization agents. In some instances, the mixture comprises 1, 2, 3 or more silanes. In cases, the ratio of the at least two types of surface functionalization agents in a mixture is about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 2:3, 2:5, 2:7, 2:9, 2:11, 2:13, 2:15, 2:17, 2:19, 3:5, 3:7, 3:8, 3:10, 3:11, 3:13, 3:14, 3:16, 3:17, 3:19, 4:5, 4:7, 4:9, 4:11, 4:13, 4:15, 4:17, 4:19, 5:6, 5:8, 5:9, 5:11, 5:12, 5:13, 5:14, 5:16, 5:17, 5:18, 5:19, 6:7, 6:11, 6:13, 6:17, 6:19, 7:8, 7:9, 7:10, 7:11, 7:12, 7:13, 7:15, 7:16, 7:18, 7:19, 8:9, 8:11, 8:13, 8:15, 8:17, 8:19, 9:10, 9:11, 9:13, 9:14, 9:16, 9:17, 9:19, 10:11, 10:13, 10:17, 10:19, 11:12, 11:13, 11:14, 11:15, 11:16, 11:17, 11:18, 11:19, 11:20, 12:13, 12:17, 12:19, 13:14, 13:15, 13:16, 13:17, 13:18, 13:19, 13:20, 14:15, 14:17, 14:19, 15:16, 15:17, 15:19, 16:17, 16:19, 17:18, 17:19, 17:20, 18:19, 19:20, or any other ratio to achieve a desired surface representation of two groups. In some instances, a ratio of silanes is about 1:100, 1:1000, 1:2000 or 1:3000.


In some cases, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane. In some cases, an active functionalization agent comprises n-decyltriethoxysilane. In some cases, the active functionalization areas comprise one or more different species of silanes, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more silanes. In some cases, one of the one or more silanes is present in the functionalization composition in an amount greater than another silane. For example, a mixed silane solution having two silanes comprises a 99:1, 98:2, 97:3, 96:4, 95:5, 94:6, 93:7, 92:8, 91:9, 90:10, 89:11, 88:12, 87:13, 86:14, 85:15, 84:16, 83:17, 82:18, 81:19, 80:20, 75:25, 70:30, 65:35, 60:40, 55:45 ratio of one silane to another silane. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane (e.g., in a ratio from about 20:80 to about 1:99, or about 10:90 to about 2:98, or preferably about 5:95). In some cases, an active functionalization agent comprises glycidyloxypropyltriethoxysilane (GOPS). In some instances, the silane is a fluorosilane. In some instances, the silane is a hydrocarbon silane. In some cases, the silane is 3-iodo-propyltrimethoxysilane. In some cases, the silane is octylchlorosilane. In some instances, an active functionalization agent comprises N-(3-triethosysilylpropyl)-4-hydroxybutyramide. In some cases, the passive functionalization agent comprises a silane. In some cases, the passive functionalization agent comprises a mixture of silanes. In some cases, the passive functionalization agent comprises perfluorooctyltrichlorosilane.


In some instances, desired surface tensions, wettabilities, water contact angles, and/or contact angles for other suitable solvents are achieved by providing a substrate surface with a suitable ratio of functionalization agents. In some cases, the agents in a mixture are chosen from suitable reactive and inert moieties, thus diluting the surface density of reactive groups to a desired level for downstream reactions. In some instances, the density of the fraction of a surface functional group that reacts to form a growing oligonucleotide in an oligonucleotide synthesis reaction is about 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 7.0, 10.0, 15.0, 20.0, 50.0, 75.0, 100.0 μMol/m2.


In some instances, a surface of a substrate is prepared to have a low surface energy. In some cases, a region of a surface of a substrate described herein is functionalized to enable covalent binding of molecular moieties that can lower the surface energy so that wettability can be reduced. In some instances, a region of surface of a substrate described herein is prepared to have a high surface energy and increased wettability. In some instances, a surface is modified to have a higher surface energy, or become more hydrophilic with a coating where the coating includes molecules having reactive hydrophilic moieties. By altering the surface energy of different parts of a substrate surface, spreading of a deposited reagent liquid (e.g., a reagent deposited during an oligonucleic acid synthesis method) can be adjusted, in some cases facilitated. In some instances, a droplet of reagent is deposited over a predetermined area of a surface with high surface energy. The liquid droplet can spread over and fill a small surface area having a higher surface energy as compared to a nearby surface. In some instances, a substrate surface is modified to comprise reactive hydrophilic moieties such as hydroxyl groups, carboxyl groups, thiol groups, and/or substituted or unsubstituted amino groups. Suitable materials include, but are not limited to, supports that can be used for solid phase chemical synthesis, e.g., cross-linked polymeric materials (e.g., divinylbenzene styrene-based polymers), agarose (e.g., Sepharose®), dextran (e.g., Sephadex®), cellulosic polymers, polyacrylamides, silica, glass (particularly controlled pore glass, or “CPG”), ceramics, and the like. The supports may be obtained commercially and used as is, or they may be treated or coated prior to functionalization.


In some instances, provided herein are methods for the manufacture of a substrate using a multilayer activation process. In some instances, one or more layers deposited during a multilayer activation process comprise one or more silanes. In some instances, a substrate, e.g., a silicon plate, is treated with a first layer of a material that modifies the surface to allow for adhesion of a photoresist. Non-limiting examples of materials for surface modification include 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, and mixtures thereof, and/or other suitable materials described elsewhere herein or known in the art. In some instances, the modified substrate is treated with resist, exposed, developed, and residual resist is removed by plasma cleaning, exemplary details of which are described previously herein. In some instances, the substrate is passively functionalized, for example, with fluorosilane, to generate hydrophobic regions. In some instances, the substrate is stripped to remove remaining resist. In some instances, the first modified layer of the substrate is activated to change one or more functional groups of the surface modification material to a hydroxyl group. In a subsequent step, the hydroxyl surface of the substrate is treated with a second layer of surface modification material to dilute surface functional groups and increase coupling efficiency for nucleotide attachment. In some instances, the second layer is activated to change one or more functional groups to a hydroxyl group to support oligonucleic acid synthesis. In some instances, steps comprising the addition of a surface modification material followed by subsequent activation are repeated for one or more additional cycles (e.g., 1, 2, 3, 4, 5 or more additional cycles) to provide optimal spacing between oligonucleic acids during synthesis. In some instances, second and subsequent layers have purely organic chemistries of the general form A-R1-B and C-R2-D where A reacts with the terminal OH group. The system is then purged and C-R2-D reacts with the B group. R1 and R2 chemistries can be repeated to yield the desired film thickness in a molecular layer deposition process. The terminal groups B and D can be hydroxyl or could be converted to hydroxyl in the final step of the deposition.


In some cases, the substrate may be two-dimensional (e.g., substantially planar) or three-dimension (e.g., comprise wells and/or channels). In some instances, an actively functionalized surface comprises a specific concentration of hydroxyl groups to achieve a pre-determined surface density for oligonucleic acid synthesis. In some instances, active functionalization is achieved by a wet process using a solution comprising an active functionalization agent. In some cases, the active functionalization agent comprises a silane or mixed silanes. In an example, a surface to be actively functionalized is treated with a solution comprising an active functionalization agent (e.g., 1% solution of N-(3-triethoxysilylpropyl-4hydroxybutyramide in ethanol and acetic acid) and the substrate incubated at a high temperature (e.g., 150° C. for 14 hours). In another example, a chemical vapor deposition process is employed wherein an active functionalization agent is delivered to the surface in a gaseous state. In some cases, an active functionalization agent is delivered by CVD with a controlled deposition pressure (e.g., 200 mTor) and temperature (e.g., 150° C.). A CVD process allows for in-situ plasma cleaning and is well suited for producing highly ordered self-assembled monolayers (SAMs).


Hydrophilic and Hydrophobic Surfaces


The surface energy, or hydrophobicity of a surface, can be evaluated or measured by measuring a water contact angle. Water contact angle is the angle between the drop surface and a solid surface where a water droplet meets the solid surface. A surface with a water contact angle of smaller than 90°, the solid surface can be considered hydrophilic or polar. A surface with a water contact angle of greater than 90°, the solid surface can be considered hydrophobic or apolar.


Surface characteristics of coated surfaces can be adjusted in various ways suitable for oligonucleotide synthesis. In some cases, the surface is selected to be inert to the conditions of ordinary oligonucleotide synthesis; e.g. the solid surface may be devoid of free hydroxyl, amino, or carboxyl groups to the bulk solvent interface during monomer addition, depending on the selected chemistry. In some cases, the surface may comprise reactive moieties prior to the start of a first cycle, or first few cycles of an oligonucleotide synthesis process, wherein the reactive moieties can be quickly depleted to unmeasurable densities after one, two, three, four, five, or more cycles of the oligonucleotide synthesis reaction. The surface can further be optimized for well or pore wetting, e.g., by common organic solvents such as acetonitrile and the glycol ethers or aqueous solvents, relative to surrounding surfaces.


Without being bound by theory, the wetting phenomenon is understood to be a measure of the surface tension or attractive forces between molecules at a solid-liquid interface, and is expressed in dynes/cm2. For example, fluorocarbons have very low surface tension, which is typically attributed to the unique polarity (electronegativity) of the carbon-fluorine bond. In tightly structured Langmuir-Blodgett type films, surface tension of a layer can be primarily determined by the percent of fluorine in the terminus of the alkyl chains. For tightly ordered films, a single terminal trifluoromethyl group can render a surface nearly as lipophobic as a perfluoroalkyl layer. When fluorocarbons are covalently attached to an underlying derivatized solid (e.g. a highly crosslinked polymeric) support, the density of reactive sites can be lower than Langmuir-Blodgett and group density. For example, surface tension of a methyltrimethoxysilane surface can be about 22.5 mN/m and aminopropyltriethoxysilane surface can be about 35 mN/m. Briefly, hydrophilic behavior of surfaces is generally considered to occur when critical surface tensions are greater than 45 mN/m. As the critical surface tension increases, the expected decrease in contact angle is accompanied with stronger adsorptive behavior. Hydrophobic behavior of surfaces is generally considered to occur when critical surface tensions are less than 35 mN/m. At first, the decrease in critical surface tension is associated with oleophilic behavior, i.e. the wetting of the surfaces by hydrocarbon oils. As the critical surface tensions decrease below 20 mN/m, the surfaces resist wetting by hydrocarbon oils and are considered both oleophobic as well as hydrophobic. For example, silane surface modification can be used to generate a broad range of critical surface tensions. Accordingly, the methods and compositions of the invention may use surface coatings, e.g. those involving silanes, to achieve surface tensions of less than 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 115, 120 mN/m, or higher. Further, the methods and compositions of the invention may use surface coatings, e.g. those involving silanes, to achieve surface tensions of more than 115, 110, 100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 12, 10, 9, 8, 7, 6 mN/m or less. The water contact angle and the surface tension of non-limiting examples of surface coatings, e.g., those involving silanes, are described in Table 1 and Table 2 of Arkles et al. (Silanes and Other Coupling Agents, Vol. 5v: The Role of Polarity in the Structure of Silanes Employed in Surface Modification. 2009), which is incorporated herein by reference in its entirety. The tables are replicated below.









TABLE 1





Contact angles of water (degrees) on smooth surfaces


















Heptadecafluorodecyltrimethoxysilane
113-115



Poly(tetrafluoroethylene)
108-112



Polypropylene
108 



Octadecyldimethylchlorosilane
110 



Octadecyltrichlorosilane
102-109



Tris(trimethylsiloxy)silylethyldimethylchlorosilane
103-104



Octyldimethylchlorosilane
104 



Butyldimethylchlorosilane
100 



Trimethylchlorosilane
 90-100



Polyethylene
 88-103



Polystyrene
94



Poly(chlorotrifluoroethylene)
90



Human skin
75-90



Diamond
87



Graphite
86



Silicon (etched)
86-88



Talc
82-90



Chitosan
80-81



Steel
70-75



Methoxyethoxyundecyltrichlorosilane
73-74



Methacryloxypropyltrimethoxysilane
70



Gold, typical (see gold, clean)
66



Intestinal mucosa
50-60



Kaolin
42-46



Platinum
40



Silicon nitride
28-30



Silver iodide
17



[Methoxy(polyethyleneoxy)propyl]trimethoxysilane
15-16



Sodalime glass
<15 



Gold, clean
<10 



Trimethoxysilylpropyl substituted poly(ethyleneimine),
<10 



hydrochloride

















TABLE 2





Critical surface tensions (mN/m)


















Heptadecafluorodecyltrichlorosilane
12



Poly(tetrafluoroethylene)
18.5



Octadecyltrichlorosilane
20-24



Methyltrimethoxysilane
22.5



Nonafluorohexyltrimethoxysilane
23



Vinyltriethoxysilane
25



Paraffin wax
25.5



Ethyltrimethoxysilane
27.0



Propyltrimethoxysilane
28.5



Glass, sodalime (wet)
30.0



Poly(chlorotrifluoroethylene)
31.0



Polypropylene
31.0



Poly(propylene oxide)
32



Polyethylene
33.0



Trifluoropropyltrimethoxysilane
33.5



3-(2-Aminoethyl)aminopropyltrimethoxysilane
33.5



Polystyrene
34



p-Tolyltrimethoxysilane
34



Cyanoethyltrimethoxysilane
34



Aminopropyltriethoxysilane
35



Acetoxypropyltrimethoxysilane
37.5



Poly(methyl methacrylate)
39



Poly(vinyl chloride)
39



Phenyltrimethoxysilane
40.0



Chloropropyltrimethoxysilane
40.5



Mercaptopropyltrimethoxysilane
41



Glycidoxypropyltrimethoxysilane
42.5



Poly(ethylene terephthalate)
43



Copper (dry)
44



Poly(ethylene oxide)
43-45



Aluminum (dry)
45



Nylon 6/6
45-46



Iron (dry)
46



Glass, sodalime (dry)
47



Titanium oxide (anatase)
91



Ferric oxide
107



Tin oxide
111










The surface of the substrate or a portion of the surface of the substrate can be functionalized or modified to be more hydrophilic or hydrophobic as compared to the surface or the portion of the surface prior to the functionalization or modification. In some cases, one or more surfaces can be modified to have a difference in water contact angle of greater than 90°, 85°, 80°, 75°, 70°, 65°, 60°, 55°, 50°, 45°, 40°, 35°, 30°, 25°, 20°, 15° or 10° as measured on one or more uncurved, smooth or planar equivalent surfaces. In some cases, the surface of the microstructures, channels, resolved loci, resolved reactor caps or other parts of the substrate may be modified to have a differential hydrophobicity corresponding to a difference in water contact angle that is greater than 90°, 85°, 80°, 75°, 70°, 65°, 60°, 55°, 50°, 45°, 40°, 35°, 30°, 25°, 20°, 15° or 10° as measured on uncurved, smooth or planar equivalent surfaces of such structures. Unless otherwise stated, water contact angles mentioned herein correspond to measurements that would be taken on uncurved, smooth or planar equivalents of the surfaces in question.


In some cases, hydrophilic resolved loci can be generated by first applying a protectant, or resist, over each loci within the substrate. The unprotected area can be then coated with a hydrophobic agent to yield an unreactive surface. For example, a hydrophobic coating can be created by chemical vapor deposition of (tridecafluorotetrahydrooctyl)-triethoxysilane onto the exposed oxide surrounding the protected channels or wells. Finally, the protectant, or resist, can be removed exposing the loci regions of the substrate for further modification and oligonucleotide synthesis. In some instances, the initial modification of such unprotected regions may resist further modification and retain their surface functionalization, while newly unprotected areas can be subjected to subsequent modification steps.


Substrate Etching


A process for carving features out of a substrate (e.g., a silicon plate) may include providing a substrate having a device layer and a handle layer, wherein the device layer is optionally separated from the handle layer by an electrical insulator layer, e.g., a layer of silicon dioxide—an exemplary substrate is a SOI wafer. In some instances, the provided substrate is oxidized on both surfaces. Photolithography may be applied to the device side of the substrate to create a mask of photoresist. In a subsequent step, a deep reactive-ion etching (DRIE) step may be used to etch vertical side-walls (e.g., until an insulator layer in a substrate comprising an insulator layer) at locations devoid of the photoresist. In a following step, the photoresist may be stripped. In some instances, photolithography, DRIE and photoresist strip steps are repeated on the substrate handle side. In cases wherein the substrate comprises an insulator layer such as silicon dioxide, buried oxide (BOX) may be removed using an etching process. Thermal oxidation can then be applied to remove contaminating polymers that may have been deposited on the side walls during the method. In a subsequent step, the thermal oxidation may be stripped using a wet etching process. In some instances, this method is used to generate a substrate having the features of a substrate exemplified in FIGS. 4A-4B. As another example, the process for manufacturing a substrate comprises a front-end process method comprising providing a starting material substrate, oxidizing both the device and handle sides; performing photolithography, DRIE and stripping of photoresist on the handle side; performing photolithography, DRIE and stripping of photoresist on the device side; removal of the oxide layer (e.g., BOX); and oxide growth (e.g., oxide is coated on one or more surfaces of the substrate to create a silicon substrate having a plurality of features).


In some instances, the substrate starting material comprises silicon. In some instances, the substrate is oxidized on one or more surfaces. In some instances, photolithography is applied to the front-side, back-side or both the front and back sides of the substrate, for example, to the back-side, to create a mask of photoresist. As a next step, the substrate is etched at locations devoid of photoresist, in many cases, beyond the oxidized layer, to create wells. As an example, the back-side is etched. In a subsequent step, the photoresist is stripped. In some instances, wherein photolithography was first applied to one side of the substrate, following photoresist stripping, a second side of the substrate is subjected to photolithography. For example, the back-side was first subjected to photolithography followed by photolithography of the front-side of the substrate. In some examples, a deep reactive-ion etching (DRIE) is used to etch vertical side walls to a prescribed depth, for example, about 450 um. In some cases, DRIE is used on the front-side, back-side or both the front and back sides during photolithography. In some instances, only one side of a substrate is etched to create three-dimensional features. In some instances, two sides, e.g., device and handle sides, of a substrate is etched to create three-dimensional features. In some processes, as an alternative or supplement to etching by DRIE, a SOI substrate (silicon on insulator silicon wafer) is used and the handle layer is etched down to the buried oxide, wherein the buried oxide can serve as an etch stop. Following photolithography on a second side of a substrate, the photoresist is stripped to generate a desired pattern. For example, the front-end is resist stripped to generate three dimensional features. In some cases, contaminates of the process (e.g., fluoropolymers) are removed by thermal oxidation followed by stripping of the thermal oxidation by a wet etching process. The substrate processed may comprise a plurality of wells, where the distance from the center of one main channel to the center of another main channel is about 1.69 mm and the total height of the main channel/microchannel is about 450 um.


Fiducial Marks


A substrate described herein may comprise fiducial marks to facilitate alignment with other components of a system. In some cases, substrates have one or more fiducial marks, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, or more fiducial marks. A fiducial mark may be located near the origin, where the fiducial mark is closer to the origin than any one cluster. In some instances, a fiducial mark is located near an edge of the substrate portion. The fiducial mark may be located from about 0.1 mm to about 10 mm from the edge of the substrate portion, e.g., about 0.5 mm from the edge. The fiducial mark may be located close to or distant to a cluster. For example, a fiducial is located from about 1 mm to about 10 mm form a cluster, e.g., 1.69 mm. In some instances, a distance from the center of a fiducial mark and a nearest corner of a substrate in one dimension is from about 0.5 mm to about 10 mm, e.g., about 1 mm. In some instances, a length of a fiducial mark in one dimension is from about 0.5 mm to about 5 mm, e.g., about 1 mm. In some instances, the width of a fiducial mark is from about 0.01 mm to about 2 mm, e.g., 0.05 mm. The substrates described herein, in some instances, comprise one or more regions for annotation. In some instances, a substrate may have a label or serial number which is located a distance (e.g., 4 mm) from the edge of the substrate with a length (e.g., 9 mm) and width (e.g., 1.5 mm).


Oligonucleic Acid Synthesis


Structures having modified surfaces described herein may be used for de novo synthesis processes. An exemplary workflow for one such process is divided generally into phases: (1) de novo synthesis of a single stranded oligonucleic acid library, (2) joining oligonucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) shipment, FIG. 12. Prior to de novo synthesis, an intended nucleic acid sequence or group of nucleic acid sequences is preselected. For example, a group of genes is preselected for generation.


Once preselected nucleic acids for generation are selected, a predetermined library of oligonucleic acids is designed for de novo synthesis. Various suitable methods are known for generating high density oligonucleic acid arrays. In the workflow example, a surface layer 1201 is provided. In the example, chemistry of the surface is altered in order to improve the oligonucleic acid synthesis process. Areas of low surface energy are generated to repel liquid while areas of high surface energy are generated to attract liquids. The surface itself may be in the form of a planar surface or contain variations in shape, such as protrusions, microwells, or microchannels which increase surface area. In the workflow example, high surface energy molecules selected serve a dual function of supporting DNA chemistry, as described in International Patent Application Publication WO/2015/021280, which is herein incorporated by reference in its entirety.


In situ preparation of oligonucleic acid arrays is generated on a solid support and utilizes single nucleotide extension process to extend multiple oligomers in parallel. A device, such as an oligonucleic acid synthesizer, is designed to release reagents in a step wise fashion such that multiple oligonucleic acids extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence 1202. In some cases, oligonucleic acids are cleaved from the surface at this stage. Cleavage may include gas cleavage, e.g., with ammonia or methylamine.


The generated oligonucleic acid libraries are placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also referred to as “nanoreactor”) is a silicon coated main channel, containing PCR reagents and lowered onto the oligonucleic acid library 1203. Prior to or after the sealing 1204 of the oligonucleic acids, a reagent is added to release the oligonucleic acids from the surface. In the exemplary workflow, the oligonucleic acids are released subsequent to sealing of the nanoreactor 1205. Once released, fragments of single stranded oligonucleic acids hybridize in order to span an entire long range sequence of DNA. Partial hybridization 1205 is possible because each synthesized oligonucleic acid is designed to have a small portion overlapping with at least one other oligonucleic acid in the pool.


After hybridization, a PCA reaction is commenced. During the polymerase cycles, the oligonucleic acids anneal to complementary fragments and gaps are filled in by a polymerase. Each cycle increases the length of various fragments randomly depending on which oligonucleic acids find each other. Complementarity amongst the fragments allows for forming a complete large span of double stranded DNA 1206.


After PCA is complete, the nanoreactor is separated from the surface 1207 and positioned for interaction with a polymerase 1208. After sealing, the nanoreactor is subject to PCR 1209 and the larger nucleic acids are formed. After PCR 1210, the nanochamber is opened 1211, error correction reagents are added 1212, the chamber is sealed 1213 and an error correction reaction occurs to remove mismatched base pairs and/or strands with poor complementarity from the double stranded PCR amplification products 1214. The nanoreactor is opened and separated 1215. Error corrected product is next subject to additional processing steps, such as PCR and molecular bar coding, and then packaged 1222 for shipment 1223.


In some cases, quality control measures are taken. After error correction, quality control steps include for example interaction with a wafer having sequencing primers for amplification of the error corrected product 1216, sealing the wafer to a chamber containing error corrected amplification product 1217, and performing an additional round of amplification 1218. The nanoreactor is opened 1219 and the products are pooled 1220 and sequenced 1221. After an acceptable quality control determination is made, the packaged product 1222 is approved for shipment 1223.


Oligonucleic acids may be synthesized on a substrate described herein using a system comprising an oligonucleic acid synthesizer that deposits reagents necessary for synthesis. Reagents for oligonucleic acid synthesis include, for example, reagents for oligonucleic acid extension and wash buffers. As non-limiting examples, the oligonucleic acid synthesizer deposits coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile and gases such as nitrogen gas. In addition, the oligonucleic acid synthesizer optionally deposits reagents for the preparation and/or maintenance of substrate integrity. An oligonucleic acid synthesizer may comprise material deposition devices that can move in the X-Y direction to align with the location of the substrate. The oligonucleic acid synthesizer can also move in the Z direction to seal with the substrate, forming a resolved reactor. In some instances, a substrate having a plurality of clusters is configured to seal with a capping element having a plurality of caps, wherein when the substrate and capping element are sealed, each cluster is separate from another cluster to form separate resolved reactors for each cluster. In some instances, the capping element is not present in the system or is present and stationary. A resolved reactor is configured to allow for the transfer of fluid, including oligonucleic acids and/or reagents, from the substrate to the capping element and/or vice versa. Fluid may pass through either or both the substrate and the capping element and includes, without limitation, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile and nitrogen gas. The oligonucleic acid synthesizer of an oligonucleic acid synthesis system may comprise a plurality of material deposition devices, for example from about 1 to about 50 material deposition devices. Each material deposition device, in various instances, deposits a reagent component that is different from another material deposition device. In some cases, each material deposition device has a plurality of nozzles, where each nozzle is optionally configured to correspond to a cluster on a substrate. For example, for a substrate having 256 clusters, a material deposition device has 256 nozzles and 100 μm fly height. In some cases, each nozzle deposits a reagent component that is different from another nozzle.


The substrates described herein comprise actively functionalized surfaces configured to support the attachment and synthesis of oligonucleic acids. Synthesized oligonucleic acids include oligonucleic acids comprising modified and/or non-canonical bases and/or modified backbones. In various methods, a library of oligonucleic acids having pre-selected sequences is synthesized on a substrate. In some cases, one or more of the oligonucleic acids has a different sequence and/or length than another oligonucleic acid in the library. In some instances, the stoichiometry of each oligonucleic acid synthesized on a substrate is controlled and tunable by varying one or more features of the substrate (e.g., functionalized surface) and/or oligonucleic acid sequence to be synthesized; one or more methods for substrate functionalization and/or oligonucleic acid synthesis; or a combination thereof. In many instances, controlling the density of a growing oligonucleic acid on a resolved locus of a substrate allows for oligonucleic acids to be synthesized with a low error rate.


An example of a synthesis method that is useful with the substrates provided herein is one based on phosphoramidite chemistry. In some instances, oligonucleic acid synthesis methods comprise coupling a linker to a surface of a substrate, for example, to an actively functionalized surface of a substrate. In some instances, a linker separates a synthesized oligonucleic acid from a surface of the substrate. A linker includes a cleavable linker, such as a photocleavable linker. In some instances, a synthesized oligonucleic acid comprises a cleavable moiety that is introduced during synthesis. In some cases, a synthesized oligonucleic acid does not comprise a linker. For example, the synthesized oligonucleic acid is separated from the linker by one or more cleavable moieties. In some instances, the synthesized oligonucleic acid comprises a primer and/or adapter sequence that connects to a linker.


Without wishing to be bound by theory, the distance between extending oligonucleic acids is a factor correlating to error rate occurrence in synthesis of an oligonucleic acid library. One way to reduce the frequency of error is to minimize chain interaction during extension. Polymer “wobble” is controlled by altering the length of the tethering group at the base of the extending polymeric structure. In some instances, regulating “wobble” reduces error rate of polymer over the course of the synthesis process. In some instances, a linker comprises one or more bases coupled to the surface of a substrate and a cleavable moiety, wherein the cleavable moiety is configured to connect to the synthesized oligonucleic acid. In some cases, a linker is referred to as a tether or a tether region. In some instances, a linker comprises about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more bases located between a surface of a substrate and a synthesized oligonucleic acid. In some instances, a linker is synthesized and extends 12 to 25 bases from a device surface.


In some instances, a linker comprises a cleavable moiety, wherein the cleavable moiety is a modified or non-canonical base. When a plurality of synthesized oligonucleic acids of a library are connected to a substrate surface by a plurality of linkers having the same cleavable moiety, the cleavable moiety is referred to as a universal moiety. Examples of cleavable moieties include, without limitation, thymidine-succinyl hexamide CED phosphoramidite and DMMA. In some instances, a cleavable moiety is gas cleavable. In some instances, the linker comprises thymidine-succinyl hexamide CED phosphoramidite or DMMA. In some instances, the linker comprises a photocleavable primer. In an example, a photocleavable linker allows for the synthesized oligonucleic acid to be removed from the substrate without cleaving the protecting groups on the nitrogenous functionalities of each base, for example, by irradiation with light at about 350 nm.


Oligonucleic acids synthesized using the methods and/or substrates described herein comprise, in various instances, at least about 50, 60, 70, 75, 80, 90, 100, 120, 150, 200, 300, 400, 500, 600, 700, 800 or more bases. In some instances, a library of oligonucleic acids is synthesized, wherein a population of distinct oligonucleic acids are assembled to generate a larger nucleic acid comprising at least about 500; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; 11,000; 12,000; 13,000; 14,000; 15,000; 16,000; 17,000; 18,000; 19,000; 20,000; 25,000; 30,000; 40,000; or 50,000 bases. In some instances, oligonucleic acid synthesis methods described herein are useful for the generation of an oligonucleic acid library comprising at least 500; 1,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 2,200,000; 2,400,000; 2,600,000; 2,800,000; 3,000,000; 3,500,000; 4,000,000; or 5,000,000 distinct oligonucleic acids. In some instances, at least about 1 pmol, 10 pmol, 20 pmol, 30 pmol, 40 pmol, 50 pmol, 60 pmol, 70 pmol, 80 pmol, 90 pmol, 100 pmol, 150 pmol, 200 pmol, 300 pmol, 400 pmol, 500 pmol, 600 pmol, 700 pmol, 800 pmol, 900 pmol, 1 nmol, 5 nmol, 10 nmol, 100 nmol or more of an oligonucleic acid is synthesized within a locus.


Methods for oligonucleic acid synthesis on a surface provided herein allow for synthesis at a fast rate. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are synthesized. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs/modified versions thereof. In some instances, libraries of oligonucleic acids are synthesized in parallel on substrate. For example, a substrate comprising about or at least about 100; 1,000; 10,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 resolved loci is able to support the synthesis of at least the same number of distinct oligonucleic acids, wherein oligonucleic acid encoding a distinct sequence is synthesized on a resolved locus. In some instances, a library of oligonucleic acids are synthesized on a substrate with low error rates described herein in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, 18 hours, 12 hours or less. In some instances, larger nucleic acids assembled from an oligonucleic acid library synthesized with low error rate using the substrates and methods described herein are prepared in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, 18 hours, 12 hours or less. In some instances, up to about 800,000 distinct oligonucleic acids having sizes up to about 130 base pairs in length each are synthesized with an error rate below 1:1000, 1:2000, 1:3000 or less on a substrate described herein and using a method described herein in a span of less than about 24 hours.


In some instances, oligonucleic acid error rate is dependent on the efficiency of one or more chemical steps of oligonucleic acid synthesis. In some cases, oligonucleic acid synthesis comprises a phosphoramidite method, wherein a base of a growing oligonucleic acid chain is coupled to phosphoramidite. In some instances, coupling efficiency of the base is related to error rate. For example, higher coupling efficiency correlates to lower error rates. In some cases, the substrates and/or synthesis methods described herein allow for a coupling efficiency greater than 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.96%, 99.97%, 99.98%, or 99.99%. In some cases, an oligonucleic acid synthesis method comprises a double coupling process, wherein a base of a growing oligonucleic acid chain is coupled with a phosphoramidite, the oligonucleic acid is washed and dried, and then treated a second time with a phosphoramidite. In some instances, efficiency of deblocking in a phosphoramidite oligonucleic acid synthesis method contributes to error rate. In some cases, the substrates and/or synthesis methods described herein allow for removal of 5′-hydroxyl protecting groups at efficiencies greater than 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.96%, 99.97%, 99.98%, or 99.99%. In some instances, error rate is reduced by minimization of depurination side reactions.


Oligonucleic acids synthesized using the methods and/or substrates described herein encode for, in various instances, at least about 50, 60, 70, 75, 80, 90, 100, 120, 150, 200, 240, 300, 400, 500, 600, 700, 800, 900, 1,000, 6000, 6144, 10,000, or more genes. In some instances, a library of oligonucleic acids encode for at least 200 genes. In some instances, a library of oligonucleic acids encode for genes at least 500 bases, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length.


Methods for oligonucleic acid synthesis, in various instances, include processes involving phosphoramidite chemistry. In some instances, oligonucleic acid synthesis comprises coupling a base with phosphoramidite. In some instances, oligonucleic acid synthesis comprises coupling a base by deposition of phosphoramidite under coupling conditions, wherein the same base is optionally deposited with phosphoramidite more than once, i.e., double coupling. In some instances, oligonucleic acid synthesis comprises capping of unreacted sites. In some cases, capping is optional. In some instances, oligonucleic acid synthesis comprises oxidation. In some instances, oligonucleic acid synthesis comprises deblocking or detritylation. In some instances, oligonucleic acid synthesis comprises sulfurization. In some cases, oligonucleic acid synthesis comprises either oxidation or sulfurization. In some instances, between one or each step during an oligonucleic acid synthesis reaction, the substrate is washed, for example, using tetrazole or acetonitrile. Time frames for any one step in a phosphoramidite synthesis method include less than about 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec and 10 sec.


Oligonucleic acid synthesis using a phosphoramidite method comprises the subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing oligonucleic acid chain for the formation of a phosphite triester linkage. Phosphoramidite oligonucleic acid synthesis proceeds in the 3′ to 5′ direction. Phosphoramidite oligonucleic acid synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle comprises a coupling step. Phosphoramidite coupling involves the formation of a phosphite triester linkage between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate, for example, via a linker. In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition of a nucleoside phosphoramidite, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, an oligonucleic acid synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).


Following coupling, phosphoramidite oligonucleic acid synthesis methods optionally comprise a capping step. In a capping step, the growing oligonucleic acid is treated with a capping agent. A capping step is useful to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of oligonucleic acids with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole may react, to a small extent, with the O6 position of guanosine. Without being bound by theory, upon oxidation with I2/water, this side product, possibly via O6-N7 migration, may undergo depurination. The apurinic sites may end up being cleaved in the course of the final deprotection of the oligonucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I2/water. In some instances, inclusion of a capping step during oligonucleic acid synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound oligonucleic acid with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.


In some instances, following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid is oxidized. The oxidation step comprises the phosphite triester is oxidized into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some cases, oxidation of the growing oligonucleic acid is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be carried out under anhydrous conditions. Oxidation may be carried out using, for example, tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing oligonucleic acid is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain oligonucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including but not limited to, 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-tetraethylthiuram disulfide (TETD).


In order for a subsequent cycle of nucleoside incorporation to occur through coupling, the protected 5′ end of the substrate bound growing oligonucleic acid must be removed so that the primary hydroxyl group can react with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound oligonucleotide and thus reduces the yield of the desired full-length product. Methods and compositions of the invention described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some cases, the substrate bound oligonucleic acid is washed after deblocking. In some cases, efficient washing after deblocking contributes to synthesized oligonucleic acids having a low error rate.


Methods for the synthesis of oligonucleic acids typically involve an iterating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., locus) to link with either the activated surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it can react with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation or sulfurization. In some cases, one or more wash steps precede or follow one or all of the steps.


Methods for phosphoramidite based oligonucleic acid synthesis comprise a series of chemical steps. In some instances, one or more steps of a synthesis method involve reagent cycling, where one or more steps of the method comprise application to the substrate of a reagent useful for the step. For example, reagents are cycled by a series of liquid deposition and vacuum drying steps. For substrates comprising three-dimensional features such as wells, microwells, channels, microchannels and the like, reagents are optionally passed through one or more regions of the substrate via the wells and/or channels. In some instances, reagents are passed through the substrate during synthesis. In some cases, reagents are passed horizontally through the substrate. In some cases, reagents are passed vertically through the substrate. In some instances, reagents are passed over a substrate having curved features to enhance flow. In some cases, reagents are delivered to the substrate through the use of photoresist. In some instances, reagents are delivered to the substrate without moving the substrate. For example, reagents are passed over resolved loci within the substrate by flowing them through the substrate from one surface to an opposite surface of the substrate. In some instances, the substrate is moved, for example, to a flow cell, for reagent application, where it is then optionally repositioned. In an example, the substrate is deposited with a nucleoside using an oligonucleic acid synthesizer, moved to a flow cell for treating the substrate to one or more select reagents, and then repositioned back to the oligonucleic acid synthesizer for deposition of a subsequent monomer. Reagent delivery approaches suitable for the synthesis methods of the disclosure include manual and automatic, including use of robotic devices and pulse jets. Reagents include any component of an oligonucleic acid synthesis method, including chemical moieties such as nucleosides, washing solutions, and gases such as nitrogen.


In some instances, one or more reagents applied to the surface of a substrate during oligonucleic acid synthesis comprise a solvent. In some cases, a solvent comprises propylene carbonate. In some cases, a solvent comprises 2-methylglutaronitrile and/or 3-methoxypropionitrile. In some cases, a solvent comprises glutaronitrile. In some cases, a solvent comprises adiponitrile. In some instances, the solvent allows for high surface tension for reagent deposition. In some instances, the solvent allows for low surface tension for reagent deposition.


In some instances, the volume of reagents applied to a surface of substrate during oligonucleic acid synthesis is selected on the size, location and/or density of the surface to which the reagent is applied (e.g., an actively functionalized locus). In some instances, the volume of a drop of reagent applied to a surface during oligonucleic acid synthesis (e.g., deposition of a nucleoside) is less than about 0.5 picoliters (pL), 1 pL, 5 pL, 10 pL, 50 pL, 100 pL, 500 pL, 1000 pL, 5000 pL, 10000 pL, 100000 pL, 1000000 pL or 10000000 pL. In some instances, the reagents are delivered in droplets that have a total volume of about 47 pL or less. In some instances, the reagents are delivered in droplets that have a total volume of about 30 to 50 pL. In some instances, the reagents are delivered in droplets that have a total volume of about 50, 49, 48, 47, 46, 44, 45, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 pL. In some instances, the rate at which a drop of reagent is applied is at least about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 50 or 100 m/sec.


Oligonucleic acid synthesis methods include methods for the application of reagents during one or more steps during synthesis. Controlled application of reagents, such as nucleoside monomers to distinct regions of a substrate is important to achieve low error rates. In some instances, a reagent is deposited directly into a microchannel, with little or no contamination to an adjacent microchannel. In some cases, the volume of a reagent to be deposited within a three-dimensional feature such as a well or channel is adjusted to a small enough size to minimize cross-contamination. In some instances, the reagents are delivered in droplets that have a diameter of less than about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 um. A non-limiting method to reduce cross-contamination includes bringing the device that deposits the reagent sufficiently close to the surface such the deposited droplet falls substantially within the selected feature.


In some instances, efficient washing to remove unincorporated nucleosides contributes to low error rate. In some instances, the composition of the wash contributes to low error rate. As described herein, washing during oligonucleic acid synthesis includes one or all wash steps performed during oligonucleic acid synthesis. In some cases, a wash step is performed wherein at least or about 60%, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% of unincorporated nucleosides or extension reaction reagent are removed from the surface of the substrate. In some cases, a wash step is performed wherein at least or about 95.0, 95.1, 95.2, 95.3, 95.4, 95.5, 95.6, 95.7, 95.8, 95.9, 96.0, 96.1, 96.2, 96.3, 96.4, 96.5, 96.6, 96.7, 96.8, 96.9, 97.0, 97.1, 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% of unincorporated nucleosides or extension reaction reagent are removed from the surface of the substrate. In some cases, the configuration of a substrate such as one with narrow microchannels, contributes to wash efficiency and error rate. In some cases, substrates having channels are washed by passage of a wash solution through the substrate, minimizing fluid contact of the growing oligonucleic acids. In some cases, the geometry of fluid flow during washing controls interfacial instability. For example, a substrate that is substantial planar, or two-dimensional, may have a curved surface to enhance wash efficiency and therefore error rate. In some instances, optimized wash conditions include those that minimize contact time between the wash reagent and the growing oligonucleic acid. For example, the passage of a wash solution through three-dimensional features allows for the effect washing of all surfaces in a short period of time. A water contact angle for the substrate, in particular, for regions of synthesis and/or surrounding areas, may be chosen in order to reduce depurination and/or speed of synthesis. In some instances, lower amount of depurination may be achieved on surfaces of higher surface energy, i.e. lower contact angle. For example, depurination occurs at a rate less than 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, 0.0005%, or 0.0001%.


In some instances, the surface properties of the substrate change during oligonucleic acid synthesis. Typically, the substrate at the beginning of synthesis can be relatively hydrophobic and while synthesis proceeds, may become increasingly hydrophilic. Oligonucleic acid features can gain substantial surface energy with increasing oligonucleotide length. Generally, these sites or features consisting of protected oligonucleotide acquire enough surface energy to become spontaneously wet to high surface tension organic solvents commonly used in phosphoramidite synthesis, such as acetonitrile or propylene carbonate, after about 10-20 synthesis cycles. The methods and compositions described allow for varying parameters, such as time, flow rate, temperature, volume, viscosity, and/or reagent concentration, during the synthesis of a growing oligonucleic acid as a function of length to account for the changing surface properties on loci of the surface. Such a variation may be applied by changing parameters in constant or varying increments at repeating cycles of the synthesis. Alternatively, parameters may be changed at only selected cycles of the synthesis and can optionally follow a pattern, such as every other cycle, every third, fourth, fifth, sixth, seventh, eighth, ninth, tenth cycle etc.


Oligonucleic acid synthesis methods described herein are suitable for the spatial control of oligonucleic acid synthesis within a small area of a substrate, e.g., a locus. In some instances, oligonucleic acid methods comprise phosphoramidite chemistry. In some instances, spatial control of oligonucleic acid synthesis is achieved using an oligonucleic acid synthesizer. In some instances, spatial control of oligonucleic acid synthesis is achieved using physical masks. In some instances, spatial control of oligonucleic acid synthesis is achieved by modulation of a 5′ hydroxyl deblocking during phosphoramidite synthesis. In some instances, spatial control of oligonucleic acid synthesis is achieved by photolithographic deprotection of photolabile monomers. In some instances, spatial control of oligonucleic acid synthesis is achieved by digital activation of photogenerated acids to carry out standard detritylation.


In some instances, the surface of the substrate that provides support for oligonucleic acid synthesis is chemically modified to allow for the synthesized oligonucleic acid chain to be cleaved from the surface. In some cases, the oligonucleic acid chain is cleaved at the same time as the oligonucleic acid is deprotected. In some cases, the oligonucleic acid chain is cleaved after the oligonucleic acid is deprotected. In an exemplary scheme, a trialkoxysilyl amine (e.g., (CH3CH2O)3Si—(CH2)2—NH2) is reacted with surface SiOH groups of a substrate, followed by reaction with succinic anhydride with the amine to create and amide linkage and a free OH on which the nucleic acid chain growth is supported.


In some instances, oligonucleic acids are synthesized with photolabile protecting groups, where the hydroxyl groups generated on the surface are blocked by photolabile-protecting groups. When the surface is exposed to UV light, e.g., through a photolithographic mask, a pattern of free hydroxyl groups on the surface may be generated. These hydroxyl groups can react with photoprotected nucleoside phosphoramidites, according to phosphoramidite chemistry. A second photolithographic mask can be applied and the surface can be exposed to UV light to generate second pattern of hydroxyl groups, followed by coupling with 5′-photoprotected nucleoside phosphoramidite. Likewise, patterns can be generated and oligomer chains can be extended. Without being bound by theory, the lability of a photocleavable group depends on the wavelength and polarity of a solvent employed and the rate of photocleavage may be affected by the duration of exposure and the intensity of light. This method can leverage a number of factors, e.g., accuracy in alignment of the masks, efficiency of removal of photo-protecting groups, and the yields of the phosphoramidite coupling step. Further, unintended leakage of light into neighboring sites can be minimized. The density of synthesized oligomer per spot can be monitored by adjusting loading of the leader nucleoside on the surface of synthesis.


Oligonucleotide Libraries with Low Error Rates


The term “error rate” may also be referred to herein as a comparison of the collective sequence encoded by oligonucleic acids generated compared to the aggregate sequence of a predetermined longer nucleic acid, e.g., a gene. Oligonucleic acids are synthesized on a substrate described herein in a process that minimizes the error rate. For example, error rate is less than 1 in 500 bases, 1 in 1000 bases, 1 in 1500 bases, 1 in 2000 bases, 1 in 2500 bases, 1 in 3000, 1 in 5000 bases or less. In some instances, low error rates are achieved for synthesized oligonucleic acid libraries having at least 20,000; 40,000; 60,000; 80,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 1,000,000; or 2,000,000 or more oligonucleic acids. In some cases, a subset of oligonucleic acids in the library has the same sequence. In some cases, one or more of the oligonucleic acids in the library comprises a different sequence. Error rates include mismatch error rate, deletion error rate, insertion error rate, indel error rate, and any combination thereof.


In some instances, low overall error rate or low error rates for individual types of errors are achieved. Individual types of error rates include deletions, insertions, or substitutions for an oligonucleic acid library synthesized on the substrate. In some instances, oligonucleic acids synthesized on the substrate have an average error rate of about 1:500, 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, 1:10000, 1:20000, 1:30000, 1:40000, 1:50000 or less. In some instances, these error rates are for at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleic acids synthesized. In some instances, these error rates are for 100% of the oligonucleic acids synthesized.


In some instances, oligonucleic acids synthesized on the substrate have an average deletion error rate of about 1:500, 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, 1:10000, 1:20000, 1:30000, 1:40000, 1:50000 or less. In some instances, oligonucleic acids synthesized on the substrate have an average insertion error rate of about 1:500, 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, 1:10000, 1:20000, 1:30000, 1:40000, 1:50000 or less. In some instances, oligonucleic acids synthesized on the substrate have an average substitution error rate of about 1:500, 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, 1:10000, 1:20000, 1:30000, 1:40000, 1:50000 or less. In some instances, overall error rate or error rates for individual types of errors such as deletions, insertions, or substitutions for each oligonucleotide synthesized on the substrate, for at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleotides synthesized on the substrate, or the substrate average may fall between about 1:500 and 1:50000, 1:500 and 1:40000; 1:500 and 1:30000; 1:500 and 1:20000; 1:500 and 1:10000; 1:500 and 1:9000; 1:500 and 1:8000; 1:500 and 1:7000; 1:500 and 1:6000; or 1:500 and 1:5000.


In some instances, the methods and systems described herein for oligonucleic acid synthesis results in minimal synthesis of truncation products that are less than the full length of the predetermined oligonucleic acid sequence. In some cases, a library of oligonucleic acids are synthesized with less than 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, or 0.0001% comprising truncation products. In some instances, the methods and systems described herein for oligonucleic acid synthesis result in minimal synthesis of products that are greater than predetermined oligonucleic acid sequence length. In some cases, a library of oligonucleic acids are synthesized with less than 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, or 0.0001% comprising greater than predetermined sequence length.


The oligonucleic acids synthesized using the systems and methods described herein are optionally evaluated for sequence accuracy prior to subsequent applications, for example, larger nucleic acid assembly. A common method for oligonucleic acid quality control comprises next generation sequencing.


Oligonucleic Acid Release and Assembly


Oligonucleic acids synthesized using the methods and substrates described herein, are optionally released from the surface from which they were synthesized. In some cases, oligonucleic acids are cleaved from the surface at this stage. Cleavage may include gas cleavage, e.g., with ammonia or methylamine. In some instances, all the loci in a single cluster collectively correspond to sequence encoding for a single gene, and optionally, when cleaved, remain on the surface of the loci. In some instances, the application of ammonia gas simultaneous deprotects phosphates groups protected during the synthesis steps, i.e., removal of electron-withdrawing cyano group. In some instances, once released from the surface, oligonucleic acids are assembled into larger nucleic acids. Synthesized oligonucleic acids are useful, for example, as components for gene assembly/synthesis, site-directed mutagenesis, nucleic acid amplification, microarrays, and sequencing libraries.


In some instances, oligonucleic acids of predetermined sequence are designed to collectively span a large region of a target sequence, such as a gene. In some instances, larger oligonucleic acids are generated through ligation reactions to join the synthesized oligonucleic acids. One example of a ligation reaction is polymerase chain assembly (PCA). In some cases, at least of a portion of the oligonucleic acids are designed to include an appended region that is a substrate for universal primer binding. For PCA reactions, the presynthesized oligonucleic acids include overlaps with each other (e.g., 4, 20, 40 or more bases with overlapping sequence). During the polymerase cycles, the oligonucleic acids anneal to complementary fragments and then are filled in by polymerase. Each cycle thus increases the length of various fragments randomly depending on which oligonucleic acids find each other. Complementarity amongst the fragments allows for forming a complete large span of double stranded DNA. In some cases, after the PCA reaction is complete, an error correction step is conducted using mismatch repair detecting enzymes to remove mismatches in the sequence. Once larger fragments of a target sequence are generated, they can be amplified. For example, in some cases, a target sequence comprising 5′ and 3′ terminal adaptor sequences is amplified in a polymerase chain reaction (PCR) which includes modified primers, e.g., uracil containing primers the hybridize to the adaptor sequences. The use of modified primers allows for removal of the primers through enzymatic reactions centered on targeting the modified base and/or gaps left by enzymes which cleave the modified base pair from the fragment. What remains is a double stranded amplification product that lacks remnants of adapter sequence. In this way, multiple amplification products can be generated in parallel with the same set of primers to generate different fragments of double stranded DNA.


In some instances, error correction is performed on synthesized oligonucleic acids and/or assembled products. An example strategy for error correction involves site-directed mutagenesis by overlap extension PCR to correct errors, which is optionally coupled with two or more rounds of cloning and sequencing. In certain instances, double-stranded nucleic acids with mismatches, bulges and small loops, chemically altered bases and/or other heteroduplexes are selectively removed from populations of correctly synthesized nucleic acids by affinity purification. In some instances, error correction is performed using proteins/enzymes that recognize and bind to or next to mismatched or unpaired bases within double stranded nucleic acids to create a single or double strand break or to initiate a strand transfer transposition event. Non-limiting examples of proteins/enzymes for error correction include endonucleases (T7 Endonuclease I, E. coli Endonuclease V, T4 Endonuclease VII, mung bean nuclease, Cell, E. coli Endonuclease IV, UVDE), restriction enzymes, glycosylases, ribonucleases, mismatch repair enzymes, resolvases, helicases, ligases, antibodies specific for mismatches, and their variants. Examples of specific error correction enzymes include T4 endonuclease 7, T7 endonuclease 1, S1, mung bean endonuclease, MutY, MutS, MutH, MutL, cleavase, CELI, and HINF1. In some cases, DNA mismatch-binding protein MutS (Thermus aquaticus) is used to remove failure products from a population of synthesized products. In some instances, error correction is performed using the enzyme Correctase. In some cases, error correction is performed using SURVEYOR endonuclease (Transgenomic), a mismatch-specific DNA endonuclease that scans for known and unknown mutations and polymorphisms for heteroduplex DNA.


In various instances, a synthesized oligonucleic acid as described herein is amplified in an amplification reaction. In various instances, a nucleic acid assembled from an oligonucleic acid synthesized by the methods and systems described herein is amplified in an amplification reaction. As used herein, at least in some instances, an amplification reaction includes any method known in the art to amplify one or more nucleic acids. Provided herein, in various cases, are instances exemplifying polymerase chain reaction (PCR) as an amplification reaction.


In some instances, an amplification reaction, such as PCR, is based on repeated cycles of denaturation, oligonucleic acid primer annealing, and primer extension by thermophilic template dependent polynucleotide polymerase, resulting in the exponential increase in copies of a target nucleic acid sequence flanked by the primers. The two different PCR primers, which anneal to opposite strands of the DNA, are positioned so that the polymerase catalyzed extension product of one primer can serve as a template strand for the other, leading to the accumulation of a discrete double stranded fragment whose length is defined by the distance between the 5′ ends of the oligonucleic acid primers.


Systems for Oligonucleic Acid Synthesis


Provided herein are systems for the synthesis of oligonucleic acid libraries on a substrate. In some instances, the system comprises the substrate for synthesis support, as described elsewhere herein. In some instances, the system comprises a device for application of one or more reagents of a synthesis method, for example, an oligonucleic acid synthesizer. In some instances, the system comprises a device for treating the substrate with a fluid, for example, a flow cell. In some instances, the system comprises a device for moving the substrate between the application device and the treatment device.


In one aspect, provided is an automated system for use with an oligonucleic acid synthesis method described herein that is capable of processing one or more substrates, comprising: a material deposition device for spraying a microdroplet comprising a reagent on a substrate; a scanning transport for scanning the substrate adjacent to the material deposition device to selectively deposit the microdroplet at specified sites; a flow cell for treating the substrate on which the microdroplet is deposited by exposing the substrate to one or more selected fluids; an alignment unit for aligning the substrate correctly relative to the material deposition device each time when the substrate is positioned adjacent to the material deposition device for deposition. In some instances, the system optionally comprises a treating transport for moving the substrate between the material deposition device and the flow cell for treatment in the flow cell, where the treating transport and said scanning transport are different elements. In other instances, the system does not comprise a treating transport.


In some instances, a device for application of one or more reagents during a synthesis reagent is an oligonucleic acid synthesizer comprising a plurality of material deposition devices. In some instances, each material deposition device is configured to deposit nucleotide monomers, for example, for phosphoramidite synthesis. In some instances, the oligonucleic acid synthesizer deposits reagents to the resolved loci, wells, and/or microchannels of a substrate. In some cases, the oligonucleic acid synthesizer deposits a drop having a diameter less than about 200 um, 100 um, or 50 um in a volume less than about 1000, 500, 100, 50, or 20 pl. In some cases, the oligonucleic acid synthesizer deposits between about 1 and 10000, 1 and 5000, 100 and 5000, or 1000 and 5000 droplets per second. In some instances, the oligonucleic acid synthesizer uses organic solvents.


In some instances, during oligonucleic acid synthesis, the substrate is positioned within or sealed within a flow cell. In some instances, the flow cell provides continuous or discontinuous flow of liquids such as those comprising reagents necessary for reactions within the substrate, for example, oxidizers and/or solvents. In some instances, the flow cell provides continuous or discontinuous flow of a gas, such as nitrogen, for drying the substrate typically through enhanced evaporation of a volatile substrate. A variety of auxiliary devices are useful to improve drying and reduce residual moisture on the surface of the substrate. Examples of such auxiliary drying devices include, without limitation, a vacuum source, depressurizing pump and a vacuum tank. In some cases, an oligonucleic acid synthesis system comprises one or more flow cells, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 and one or more substrates, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or 20. In some cases, a flow cell is configured to hold and provide reagents to the substrate during one or more steps in a synthesis reaction. In some instances, a flowcell comprises a lid that slides over the top of a substrate and can be clamped into place to form a pressure tight seal around the edge of the substrate. An adequate seal, includes, without limitation, a seal that allows for about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 atmospheres of pressure. In some cases, the lid of the flow cell is opened to allow for access to an application device such as an oligonucleic acid synthesizer. In some cases, one or more steps of an oligonucleic acid synthesis method are performed on a substrate within a flow cell, without the transport of the substrate.


In some instances, during oligonucleic acid synthesis, a capping element seals with the substrate, to form a resolved reactor. In some instances, a substrate having a plurality of clusters is configured to seal with a capping element having a plurality of caps, wherein when the substrate and capping element are sealed, each cluster is separate from another cluster to form separate resolved reactors for each cluster. In some instances, the capping element is not present in the system or is present and stationary. A resolved reactor is configured to allow for the transfer of fluid, including oligonucleic acids and/or reagents, from the substrate to the capping element and/or vice versa. In some instances, reactors are interconnected or in fluid communication. Fluid communication of reactors allows for washing and perfusion of new reagents for different steps of a synthesis reaction. In some cases, the resolved reactors comprise inlets and/or outlets. In some cases, the inlets and/or outlets are configured for use with a flow cell. As an example, a substrate is sealed within a flow cell where reagents can be introduced and flowed through the substrate, after which the reagents are collected. In some cases, the substrate is drained of fluid and purged with an inert gas such as nitrogen. The flow cell chamber can then be vacuum dried to reduce residual liquids or moisture to less than 1%, 0.1%, 0.01%, 0.001%, 0.0001%, or 0.00001% by volume of the chamber. In some instances, a vacuum chuck is in fluid communication with the substrate for removing gas.


In some instances, an oligonucleic acid synthesis system comprises one or more elements useful for downstream processing of the synthesized oligonucleic acids. As an example, the system comprises a temperature control element such as a thermal cycling device. In some instances, the temperature control element is used with a plurality of resolved reactors to perform nucleic acid assembly such as PCA and/or nucleic acid amplification such as PCR.


Computer Systems


Any of the systems described herein, may be operably linked to a computer and may be automated through a computer either locally or remotely. In various instances, the methods and systems of the invention may further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the invention. The computer systems may be programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.


The computer system 1300 illustrated in FIG. 13 may be understood as a logical apparatus that can read instructions from media 1311 and/or a network port 1305, which can optionally be connected to server 1309 having fixed media 1312. The system, such as shown in FIG. 13 can include a CPU 1301, disk drives 1303, optional input devices such as keyboard 1315 and/or mouse 1316 and optional monitor 1307. Data communication can be achieved through the indicated communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 1322 as illustrated in FIG. 13.



FIG. 14 is a block diagram illustrating a first example architecture of a computer system 1400 that can be used in connection with example instances of the present invention. As depicted in FIG. 14, the example computer system can include a processor 1402 for processing instructions. Non-limiting examples of processors include: Intel Xeon™ processor, AMD Opteron™ processor, Samsung 14-bit RISC ARM 1176JZ(F)-S v1.0™ processor, ARM Cortex-A8 Samsung S5PC100™ processor, ARM Cortex-A8 Apple A4™ processor, Marvell PXA 930™ processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing. In some instances, multiple processors or processors with multiple cores can also be used, whether in a single computer system, in a cluster, or distributed across systems over a network comprising a plurality of computers, cell phones, and/or personal data assistant devices.


As illustrated in FIG. 14, a high speed cache 1404 can be connected to, or incorporated in, the processor 1402 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by processor 1402. The processor 1402 is connected to a north bridge 1406 by a processor bus 1408. The north bridge 1406 is connected to random access memory (RAM) 1410 by a memory bus 1412 and manages access to the RAM 1410 by the processor 1402. The north bridge 1406 is also connected to a south bridge 1414 by a chipset bus 1416. The south bridge 1414 is, in turn, connected to a peripheral bus 1418. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 1418. In some alternative architectures, the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip. In some instances, system 1400 can include an accelerator card 1422 attached to the peripheral bus 1418. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.


Software and data are stored in external storage 1424 and can be loaded into RAM 1410 and/or cache 1404 for use by the processor. The system 1400 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example instances of the present invention. In this example, system 1400 also includes network interface cards (NICs) 1420 and 1421 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.



FIG. 15 is a diagram showing a network 1500 with a plurality of computer systems 1502a, and 1502b, a plurality of cell phones and personal data assistants 1502c, and Network Attached Storage (NAS) 1504a, and 1504b. In example instances, systems 1502a, 1502b, and 1502c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 1504a and 1504b. A mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 1502a, and 1502b, and cell phone and personal data assistant systems 1502c. Computer systems 1502a, and 1502b, and cell phone and personal data assistant systems 1502c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 1504a and 1504b. FIG. 15 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various instances of the present invention. For example, a blade server can be used to provide parallel processing. Processor blades can be connected through a back plane to provide parallel processing. Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface.


In some example instances, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In other instances, some or all of the processors can use a shared virtual address memory space.



FIG. 16 is a block diagram of a multiprocessor computer system 1600 using a shared virtual address memory space in accordance with an example embodiment. The system includes a plurality of processors 1602a-f that can access a shared memory subsystem 1604. The system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 1606a-f in the memory subsystem 1604. Each MAP 1606a-f can comprise a memory 1608a-f and one or more field programmable gate arrays (FPGAs) 1610a-f The MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 1610a-f for processing in close coordination with a respective processor. For example, the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example instances. In this example, each MAP is globally accessible by all of the processors for these purposes. In one configuration, each MAP can use Direct Memory Access (DMA) to access an associated memory 1608a-f, allowing it to execute tasks independently of, and asynchronously from the respective microprocessor 1602a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.


The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example instances, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some instances, all or part of the computer system can be implemented in software or hardware. Any variety of data storage media can be used in connection with example instances, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.


In example instances, the computer system can be implemented using software modules executing on any of the above or other computer architectures and systems. In other instances, the functions of the system can be implemented partially or completely in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in FIG. 16, system on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements. For example, the Set Processor and Optimizer can be implemented with hardware acceleration through the use of a hardware accelerator card, such as accelerator card 1322 illustrated in FIG. 13.


The following examples are set forth to illustrate more clearly the principle and practice of instances disclosed herein to those skilled in the art and are not to be construed as limiting the scope of any claimed instances. Unless otherwise stated, all parts and percentages are on a weight basis.


EXAMPLES
Example 1: Functionalization of a Substrate Surface

A substrate was functionalized to support the attachment and synthesis of a library of oligonucleic acids. The substrate surface was first wet cleaned using a piranha solution comprising 90% H2SO4 and 10% H2O2 for 20 minutes. The substrate was rinsed in several beakers with DI water, held under a DI water gooseneck faucet for 5 min, and dried with N2. The substrate was subsequently soaked in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with DI water for 1 min each, and then rinsed again with DI water using the handgun. The substrate was then plasma cleaned by exposing the substrate surface to O2. A SAMCO PC-300 instrument was used to plasma etch O2 at 250 watts for 1 min in downstream mode.


The cleaned substrate surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 Torr, 60 min, 70° C., 135° C. vaporizer.


The substrate surface was resist coated using a Brewer Science 200×spin coater. SPR™ 3612 photoresist was spin coated on the substrate at 2500 rpm for 40 sec. The substrate was pre-baked for 30 min at 90° C. on a Brewer hot plate. The substrate was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The substrate was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the substrate soaked in water for 5 min. The substrate was baked for 30 min at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A plasma cleaning process was used to remove residual resist using the SAMCO PC-300 instrument to O2 plasma etch at 250 watts for 1 min.


The substrate surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The substrate was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air. The substrate was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The substrate was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The substrate was dipped in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to serve as a support for oligonucleic acid synthesis.


Example 2: Preparation of Substrates Having Distinct Loci Configurations

Substrates were manufactured to comprise a plurality of clusters each comprising a plurality of distinct loci configured to provide structural support for oligonucleic acid synthesis. Substrate starting material was a 200 mm standard, double-sided polished silicon wafer having a 725 um thickness. Substrates were processed by a method comprising thermal oxidation at 1000 Å, photolithography using a Karl Suss MA6 mask aligner to generate fiducial structures; oxide etching down to the silicon; and resist stripping. Prepared substrates have 6,144 clusters, with each cluster having 121 reaction sites or loci for oligonucleic acid synthesis. The clusters are organized into 24 sub-fields, which each comprise a 16×16 array of clusters. A schematic of a substrate produced is shown in FIGS. 1-3. As shown in FIG. 1, the substrate has a dimension of 140.000 mm by 90.000 mm. As shown in FIG. 2, the vertical distance between the centers of two adjacent clusters in one substrate is 1079.210 um and in another substrate 1142.694 um. The horizontal distance between the centers of two adjacent clusters in the substrate is 1125.0 um. An expanded view of a cluster of the substrate is shown in FIG. 3. Each cluster has 121 loci, which are separated so that the horizontal distance between two adjacent loci is 75.000 um and the vertical distance between two loci is 63.483 um. The horizontal distance between the edges of two adjacent loci is 24.0 um.


Example 3: Maximization of Microchannel Surface Area

Substrates manufactured in this example were processed to generate three-dimensional loci having shapes configured to increase surface area to volume. Examples of locus shapes prepared using the methods described in this example are shown in FIG. 5. A Silicon on Insulator (SOI) silicon wafer (sub-field size of 32.00×32.00 mm) was oxidized, and the device side processed by photolithography, deep RIE and photoresist stripping. The handle side of the substrate was processed by photolithography, deep RIE, photoresist stripping, and etching by removal of oxide layer (BOX etch). The processed substrate has a plurality of wells or holes within the handle layer, each having a width of 1.150 mm, wherein each channel has a plurality of microchannels having shapes that allow for an increase in surface area to volume. The smallest etch size for a feature of a shape of a microchannel within a substrate prepared in this example was 5 um. The distance between the centers of two adjacent clusters (wells) is 1.693 mm in all directions. The distance between the centers of two adjacent loci (microchannels) is 97.765 in a horizontal direction and 84.667 um in a vertical direction. The prepared substrate has a set of markings or fiducials of 0.5 mm diameter. The width of the main channel is 1.150 mm and the width of the microchannel is 5 um. Detailed features of substrates prepared using these methods are shown in FIGS. 5-8.


A cluster of a processed substrate having double comb shaped loci is shown in a bird's eye view in FIG. 6. The combined height of the two longest teeth is 57 um. The distance between two teeth of the comb is 14.0 um. The width of the comb handle is 5 um. The combined height of the two shortest teeth is 38.0 um. The width of the comb in the horizontal direction is 47.0 um.


A cluster of a processed substrate having single comb shaped loci is shown in a bird's eye view in FIG. 7. The height of the longest tooth is 49.0 um. The distance between two teeth of the comb is 14.0 um. The width of the comb handle is 5 um. The height of the shortest tooth is 39.0 um. The width of the comb in the horizontal direction is 47.0 um.


A cluster of a processed substrate having serpentine shaped loci is shown in a bird's eye view in FIG. 8. The height of the loci shape is 54 um. The distance between two lines of the shape is 14 urn. The width of a line of the shape is 5 urn.


Detailed measurements for prepared substrates are shown in Table 3.
















TABLE 3





Device depth (um)
30








Width of segments
5








(um)












Top surface

Total
Total
Total




Internal area
growth area
Volume
projected
Area
Volume


Segments
No.
(um2)
(um2)
(um3)
area (um2)
(um2)
(um3)






















Double comb









Lateral segments
3
540
45
1350
135
1620
4050


End segments
2
1890
170
5100
340
3780
10200


Middle segments
2
2850
263
7875
525
5700
15750


Rounded ends
4
471
20
589
79
1885
2356






Total
1079
12985
32356


Total growth area





15225



including top surface









(um2)









Single comb









Lateral segments
1
2456
210
7050
210
2456
7050


End segments
2
2070
173
5175
345
4140
10350


Middle segments
2
2490
208
6225
415
4980
12450


Rounded ends
2
471
20
589
39
942
1178






Total
1009
12518
31028


Total growth area





14827



including top surface









(um2)









Serpentine









Vertical segments
4
2100
175
5250
700
8400
21000


Annulus segments
1.5
2639
220
6597
330
3958
9896


(whole)









Rounded ends
1
471
20
589
20
471
589






Total
1050
12830
31485


Total growth area





15098



including top surface









(um2)









The surface and volume parameters of loci having high surface area shapes (double comb, single comb, and serpentine) prepared using these methods were compared with the parameters of a locus having a revolver shape (barrel comprising 5 channels). The comparison is shown in Table 4. The loci having a comb or serpentine shape had a lower substrate volume than a substrate having revolver loci. The loci having a comb or serpentine shape had a greater surface area than a substrate having revolver loci. The loci having a comb or serpentine shape had a greater surface area to volume ratio than a substrate having revolver loci.














TABLE 4







Revolver
Double comb
Single come
Serpentine




















Total volume
47
32
31
31


(pL)


Total surface
9425
12985
12518
12830


area (um)


Surface area to
0.20
0.40
0.40
0.41


volume ratio


(1/um)


Total volume
1.00
0.69
0.66
0.67


relative to


revolver


Total surface
1.00
1.38
1.33
1.36


area relative to


revolver


Surface area to
1.00
2.01
2.02
2.04


volume ratio


relative revolver









Example 4: Synthesis of a 100-Mer Oligonucleic Acid on a Substantially Planar Substrate

A substantially planar substrate functionalized for oligonucleic acid synthesis was assembled into a flow cell and connected to an Applied Biosystems ABI394 DNA Synthesizer. In one experiment, the substrate was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. In another experiment, the substrate was functionalized with a 5/95 mix of 11-acetoxyundecyltriethoxysilane and N-decyltriethoxysilane. Synthesis of 100-mer oligonucleic acids (“100-mer oligonucleotide”; 5′: CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGT CATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTT T 3′ (SEQ ID NO: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)) were performed using the methods of Table 5.











TABLE 5





General DNA Synthesis




Process Name
Process Step
Time (sec)

















WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
23



N2 System Flush
4



Acetonitrile System Flush
4


DNA BASE ADDITION
Activator Manifold Flush
2


(Phosphoramidite +
Activator to Flowcell
6


Activator Flow)
Activator +
6



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Incubate for 25 sec
25


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4


DNA BASE ADDITION
Activator Manifold Flush
2


(Phosphoramidite +
Activator to Flowcell
5


Activator Flow)
Activator +
18



Phosphoramidite to



Flowcell



Incubate for 25 sec
25


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4


CAPPING (CapA + B, 1:1,
CapA + B to Flowcell
15


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



Acetonitrile System Flush
4


OXIDATION (Oxidizer
Oxidizer to Flowcell
18


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
15



Acetonitrile System Flush
4



Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
23



N2 System Flush
4



Acetonitrile System Flush
4


DEBLOCKING (Deblock
Deblock to Flowcell
36


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
18



N2 System Flush
4.13



Acetonitrile System Flush
4.13



Acetonitrile to Flowcell
15









Synthesized oligonucleic acids were extracted from the substrate surface and analyzed on a BioAnalyzer chip. Oligonucleic acid products were PCR amplified, cloned and Sanger sequenced. Table 6 summarizes the Sanger sequencing results for samples taken from spots 1-5 from one chip and spots 6-10 from a second chip.











TABLE 6





Spot
Error rate
Cycle efficiency

















1
1/763 bp
99.87%


2
1/824 bp
99.88%


3
1/780 bp
99.87%


4
1/429 bp
99.77%


5
1/1525 bp 
99.93%


6
1/1615 bp 
99.94%


7
1/531 bp
99.81%


8
1/1769 bp 
99.94%


9
1/854 bp
99.88%


10
1/1451 bp 
99.93%









Overall, 89% (233/262) of the 100-mers that were sequenced had sequences without errors. Table 7 summarizes key error characteristics for the sequences obtained from the oligonucleic acid samples from spots 1-10.



















TABLE 7





Sample ID/
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0
OSA_0


Spot No.
046/1
047/2
048/3
049/4
050/5
051/6
052/7
053/8
054/9
055/10

























Total
32
32
32
32
32
32
32
32
32
32


Sequences












Sequencing
25 of
27 of
26 of
21 of
25 of
29 of
27 of
29 of
28 of
25 of


Quality
28
27
30
23
26
30
31
31
29
28


Oligo
23 of
25 of
22 of
18 of
24 of
25 of
22 of
28 of
26 of
20 of


Quality
25
27
26
21
25
29
27
29
28
25


ROI Match
2500
2698
2561
2122
2499
2666
2625
2899
2798
2348


Count












ROI
2
2
1
3
1
0
2
1
2
1


Mutation












ROI Multi
0
0
0
0
0
0
0
0
0
0


Base












Deletion












ROI Small
1
0
0
0
0
0
0
0
0
0


Insertion












ROI Single
0
0
0
0
0
0
0
0
0
0


Base












Deletion












Large
0
0
1
0
0
1
1
0
0
0


Deletion












Count












Mutation:
2
2
1
2
1
0
2
1
2
1


G > A












Mutation:
0
0
0
1
0
0
0
0
0
0


T > C












ROI Error
3
2
2
3
1
1
3
1
2
1


Count












ROI Error
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1


Rate
in 834
in 1350
in 1282
in 708
in 2500
in 2667
in 876
in 2900
in 1400
in 2349


ROI Minus
MP
MP
MP
MP
MP
MP
MP
MP
MP
MP


Primer
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1


Error Rate
in 763
in 824
in 780
in 429
in 1525
in 1615
in 531
in 1769
in 854
in 1451









Example 5: Gene Assembly in Reactors Using PCA

Gene assembly within nanoreactors created using a three-dimensional substrate was performed. PCA reactions were performed using oligonucleic acids described in Table 8 (SEQ ID NOS: 2-61) to assemble the 3075 base LacZ gene (SEQ ID NO.: 62) using the reaction mixture of Table 9 within individual nanoreactors.










TABLE 8





Sequence Name
Sequence 







Oligo_1,
5′ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACA


SEQ ID NO.: 2
ACGTCGTGACTGGGAAAACCCTGG3′





Oligo_2,
5′GCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT


SEQ ID NO.: 3
AAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGAC3′





Oligo_3,
5′CCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCC


SEQ ID NO.: 4
GCACCGATCGCCCTTCCCAACAGTTGCGCAGCC3′





Oligo_4,
5′CGGCACCGCTTCTGGTGCCGGAAACCAGGCAAAGCG


SEQ ID NO.: 5
CCATTCGCCATTCAGGCTGCGCAACTGTTGGGA3′





Oligo_5
5′CACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCG


SEQ ID NO.: 6
ATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTC3′





Oligo_6,
5′GATAGGTCACGTTGGTGTAGATGGGCGCATCGTAACCG


SEQ ID NO.: 7
TGCATCTGCCAGTrrGAGGGGACGACGACAGTATCGG3′





Oligo_7,
5′CCCATCTACACCAACGTGACCTATCCCATTACGGTCAA


SEQ ID NO.: 8
TCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTG3′





Oligo_8,
5′GTCTGGCCTTCCTGTAGCCAGCTTTCATCAACATTAAA


SEQ ID NO.: 9
TGTGAGCGAGTAACAACCCGTCGGATTCTCCGTG3′





Oligo_9,
5′GCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGAT


SEQ ID NO.: 10
GGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGG3′





Oligo_10,
5′CAGGTCAAATTCAGACGGCAAACGACTGTCCTGGCCG


SEQ ID NO.: 11
TAACCGACCCAGCGCCCGTTGCACCACAGATGAAACG3′





Oligo_11,
5′CGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACG


SEQ ID NO.: 12
CGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTG3′





Oligo_12,
5′GCCGCTCATCCGCCACATATCCTGATCTTCCAGATAAC


SEQ ID NO.: 13
TGCCGTCACTCCAGCGCAGCACCATCACCGCGAG3′





Oligo_13,
5′AGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTC


SEQ ID NO.: 14
TCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTC3′





Oligo_14,
5′CTCCAGTACAGCGCGGCTGAAATCATCATTAAAGCGA


SEQ ID NO.: 15
GTGGCAACATGGAAATCGCTGATTTGTGTAGTCGGTTTATG3′





Oligo_15,
5′ATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGAT


SEQ ID NO.: 16
GTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTT3′





Oligo_16,
5′AAAGGCGCGGTGCCGCTGGCGACCTGCGTTTCACCCT


SEQ ID NO.: 17
GCCATAAAGAAACTGTTACCCGTAGGTAGTCACG3′





Oligo_17,
5′GCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGA


SEQ ID NO.: 18
GCGTGGTGGTTATGCCGATCGCGTCACACTACG3′





Oligo_18,
5′GATAGAGATTCGGGATTTCGGCGCTCCACAGTTTCGGG


SEQ ID NO.: 19
TTTTCGACGTTCAGACGTAGTGTGACGCGATCGGCA3′





Oligo_19,
5′GAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTG


SEQ ID NO.: 20
AACTGCACACCGCCGACGGCACGCTGATTGAAGCAG3′





Oligo_20,
5′CAGCAGCAGACCATTTTCAATCCGCACCTCGCGGAAA


SEQ ID NO.: 21
CCGACATCGCAGGCTTCTGCTTCAATCAGCGTGCCG3′





Oligo_21,
5′CGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGC


SEQ ID NO.: 22
CGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCA3′





Oligo_22,
5′GCAGGATATCCTGCACCATCGTCTGCTCATCCATGACC


SEQ ID NO.: 23
TGACCATGCAGAGGATGATGCTCGTGACGGTTAACGC3′





Oligo_23,
5′CAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGA


SEQ ID NO.: 24
ACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAAC3′





Oligo_24,
5′TCCACCACATACAGGCCGTAGCGGTCGCACAGCGTGT


SEQ ID NO.: 25
ACCACAGCGGATGGTTCGGATAATGCGAACAGCGCAC3′





Oligo_25,
5′GCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAA


SEQ ID NO.: 26
ACCCACGGCATGGTGCCAATGAATCGTCTGACCGATG3′





Oligo_26,
5′GCACCATTCGCGTTACGCGTTCGCTCATCGCCGGTAGC


SEQ ID NO.: 27
CAGCGCGGATCATCGGTCAGACGATTCATTGGCAC3′





Oligo_27,
5′CGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACC


SEQ ID NO.: 28
CGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAG3′





Oligo_28,
5′GGATCGACAGATTTGATCCAGCGATACAGCGCGTCGT


SEQ ID NO.: 29
GATTAGCGCCGTGGCCTGATTCATTCCCCAGCGACCAGATG3′





Oligo_29,
5′GTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGG


SEQ ID NO.: 30
TGCAGTATGAAGGCGGCGGAGCCGACACCACGGC3′





Oligo_30,
5′CGGGAAGGGCTGGTCTTCATCCACGCGCGCGTACATC


SEQ ID NO.: 31
GGGCAAATAATATCGGTGGCCGTGGTGTCGGCTC3′





Oligo_31,
5′TGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATG


SEQ ID NO.: 32
GTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGAC3′





Oligo_32,
5′CCAAGACTGTTACCCATCGCGTGGGCGTATTCGCAAA


SEQ ID NO.: 33
GGATCAGCGGGCGCGTCTCTCCAGGTAGCGAAAGCC3′





Oligo_33,
5′CGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACT


SEQ ID NO.: 34
GGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGC3′





Oligo_34,
5′GCCGTTTTCATCATATTTAATCAGCGACTGATCCACCCA


SEQ ID NO.: 35
GTCCCAGACGAAGCCGCCCTGTAAACGGGGATACTGACG3′





Oligo_35,
5′CAGTCGCTGATTAAATATGATGAAAACGGCAACCCGT


SEQ ID NO.: 36
GGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACG3′





Oligo_36,
5′GCGGCGTGCGGTCGGCAAAGACCAGACCGTTCATACA


SEQ ID NO.: 31
GAACTGGCGATCGTTCGGCGTATCGCCAAA3′





Oligo_37,
5′CGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAA


SEQ ID NO.: 38
ACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCG3′





Oligo_38,
5′CTCGTTATCGCTATGACGGAACAGGTATTCGCTGGTCA


SEQ ID NO.: 39
CTTCGATGGTTTGCCCGGATAAACGGAACTGGAAAAACTGC3′





Oligo_39,
5′AATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCAC


SEQ ID NO.: 40
TGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCG3′





Oligo_40,
5′GTTCAGGCAGTTCAATCAACTGTTTACCTTGTGGAGCG


SEQ ID NO.: 41
ACATCCAGAGGCACTTCACCGCTTGCCAGCGGCTTACC3





Oligo_41,
5′CAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGC


SEQ ID NO.: 42
AGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTA3′





Oligo_42,
5′GCGCTGATGTGCCCGGCTTCTGACCATGCGGTCGCGTT


SEQ ID NO.: 43
CGGTTGCACTACGCGTACTGTGAGCCAGAGTTG3′





Oligo_43,
5′CCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGC


SEQ ID NO.: 44
GGAAAACCTCAGTGTGACGCTCCCCGCCGC3′





Oligo_44,
5′CCAGCTCGATGCAAAAATCCATTTCGCTGGTGGTCAGA


SEQ ID NO.: 45
TGCGGGATGGCGTGGGACGCGGCGGGGAGCGTC3′





Oligo_45,
5′CGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTT


SEQ ID NO.: 46
GGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTG3′ 





Oligo_46,
5′TGAACTGATCGCGCAGCGGCGTCAGCAGTTGTTTTTTA


SEQ ID NO.: 47
TCGCCAATCCACATCTGTGAAAGAAAGCCTGACTGG3′





Oligo_47,
5′GCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGAT


SEQ ID NO.: 48
AACGACATTGGCGTAAGTGAAGCGACCCGCATTGAC3′





Oligo_48,
5′GGCCTGGTAATGGCCCGCCGCCTTCCAGCGTTCGACC


SEQ ID NO.: 49
CAGGCGTTAGGGTCAATGCGGGTCGCTTCACTTA3′





Oligo_49,
5′CGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTG


SEQ ID NO.: 50
CACGGCAGATACACTTGCTGATGCGGTGCTGAT3′





Oligo_50,
5′TCCGGCTGATAAATAAGGTTTTCCCCTGATGCTGCCAC


SEQ ID NO.: 51
GCGTGAGCGGTCGTAATCAGCACCGCATCAGCAAGTG3′





Oligo_51,
5′GGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGG


SEQ ID NO.: 52
ATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGA3′ 





Oligo_52,
5′GGCAGTTCAGGCCAATCCGCGCCGGATGCGGTGTATC


SEQ ID NO.: 53
GCTCGCCACTTCAACATCAACGGTAATCGCCATTTGAC3′





Oligo_53,
5′GCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCA


SEQ ID NO.: 54
GAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAG3′





Oligo_54,
5′GGCAGATCCCAGCGGTCAAAACAGGCGGCAGTAAGG


SEQ ID NO.: 55
CGGTCGGGATAGTTTTCTTGCGGCCCTAATCCGAGC3′





Oligo_55,
5′GTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTAT


SEQ ID NO.: 56
ACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGC3′





Oligo_56,
5′GTCGCCGCGCCACTGGTGTGGGCCATAATTCAATTCGC


SEQ ID NO.: 57
GCGTCCCGCAGCGCAGACCGTTTTCGCTCGG3′





Oligo_57,
5′ACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCG


SEQ ID NO.: 58
CTACAGTCAACAGCAACTGATGGAAACCAGCCATC3′





Oligo_58,
5′GAAACCGTCGATATTCAGCCATGTGCCTTCTTCCGCGT


SEQ ID NO.: 59
GCAGCAGATGGCGATGGCTGGTTTCCATCAGTTGCTG3′





Oligo_59,
5′CATGGCTGAATATCGACGGTTTCCATATGGGGATTGGT


SEQ ID NO.: 60
GGCGACGACTCCTGGAGCCCGTCAGTATCGGCG3′





Oligo_60,
5′TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGAC


SEQ ID NO.: 61
CGGCGCTCAGCTGGAATTCCGCCGATACTGACGGGC3′





LacZ gene-
5′ATGACCATGATTACGGATTCACTGGCCGTCGTTTTAC


SEQ ID NO.: 62
AACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT



AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCG



TAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAAC



AGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGG



TTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGG



AGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCC



TCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTA



CACCAACGTGACCTATCCCATTACGGTCAATCCGCCGT



TTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTC



ACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCA



GACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTC



ATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAG



GACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATT



TTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGC



TGCGCTGGAGTGACGGCAGTTATCTGGAAGATCAGGAT



ATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTT



GCTGCATAAACCGACTACACAAATCAGCGATTTCCATG



TTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTAC



TGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGAC



TACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAAC



GCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAA



TTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACA



CTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGC



CGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGC



ACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTG



CGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTC



TGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGC



GTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGT



CATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGA



TGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCAT



TATCCGAACCATCCGCTGTGGTACACGCTGTGCGACCG



CTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAA



CCCACGGCATGGTGCCAATGAATCGTCTGACCGATGAT



CCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGC



GAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATC



ATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAA



TCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATC



CTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGAC



ACCACGGCCACCGATATTATTTGCCCGATGTACGCGCG



CGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAAT



GGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACG



CGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGG



TAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGT



TTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGG



GACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAA



CGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCG



ATACGCCGAACGATCGCCAGTTCTGTATGAACGGTCTG



GTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGA



AGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTAT



CCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTC



CGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGC



GCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCT



TGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTG



CCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCT



GGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGC



ATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAG



TGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGC



CGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAA



TGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAA



TTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTGGAT



TGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATC



AGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTA



AGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGA



ACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCA



GCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGC



GGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGG



GGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATT



GATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGA



AGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGC



CTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAA



ACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGAC



CGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCA



TTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGA



AAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATG



GCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATC



AGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCC



ATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTG



AATATCGACGGTTTCCATATGGGGATTGGTGGCGACGA



CTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGA



GCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAA



AAATAA3′ 


















TABLE 9





PCA reaction mixture
1 (x100 ul)
Final conc.


















H2O
62.00











5x Q5 buffer
20.00
1x










10 mM dNTP
1.00
100
uM


BSA 20 mg/ml
5.00
1
mg/ml


Oligonucleic acid mix (50 nM each)
10.00
5
nM









Q5 polymerase 2 U/ul
2.00
2 U/50 ul









PCA reaction mixture drops of about 400 nL were dispensed using a Mantis dispenser (Formulatrix, MA) on the top of channels of a device side of a three-dimensional substrate having a plurality of loci microchannels in fluid communication with a single main channel of a cluster. A nanoreactor chip was manually mated with the substrate to pick up the droplets having the PCA reaction mixture and oligonucleic acids from each channel. The droplets were picked up into individual nanoreactors in the nanoreactor chip by releasing the nanoreactor from the substrate immediately after pick up. The nanoreactors were sealed with a heat sealing film, placed in a thermocycler for PCA. PCA thermocycling conditions are shown in Table 10. An aliquot of 0.5 ul was collected from 1-10 individual wells and the aliquots were amplified in plastic PCR tubes using forward primer (5′ATGACCATGATTACGGATTCACTGGCC3′ SEQ ID NO.: 63) and reverse primer (5′TTATTTTTGACACCAGACCAACTGGTAATGG3′ SEQ ID NO.: 64). Thermocycling conditions for PCR are shown in Table 11 and PCR reaction components are shown in Table 12. The amplification products were ran on a BioAnalyzer instrument and on a gel. The gel showed products 1-10 having a size slightly larger than 3000 bp (data not shown). A PCA reaction performed in plastic tube was also ran on the gel as a positive control (panel 11), which shows a product having a similar size to the products from wells 1-10. A negative control (panel 12) was also run on the gel, which corresponds to a PCR reaction ran without a PCA template. The BioAnalyzer data is not shown.











TABLE 10





No. of cycles
Temperature (° C.)
Time


















1
98
45
seconds


40
98
15
seconds



63
45
seconds



72
60
seconds


1
72
5
minutes









1
4
Hold


















TABLE 11





No. of cycles
Temperature (° C.)
Time


















1
98
30
seconds


30
98
7
seconds



63
30
seconds



72
90
seconds


1
72
5
minutes









1
4
Hold




















TABLE 12







PCR
1 (x25 ul)
Final conc.




















H2O
17.50




5x Q5 buffer
5.00
1x



10 mM dNTP
0.50
200 uM



F-primer 20 uM
0.63
 0.5 uM



R-primer 20 uM
0.63
 0.5 uM



BSA 20 mg/ml
0.00



Q5 pol 2 U/ul
0.25
1 U/50 ul   



Template (PCA assembly)
0.50
1 ul/50 ul rxn










Example 6: Error Correction of Assembled Nucleic Acids

A gene of about 1 kbp (SEQ ID.: 67; Table 13) was assembled using 6 purchased Ultramer oligonucleotides (SEQ ID NO.: 68-73; Table 13) and assembled in a PCA reaction. Ultramer oligonucleotides are expected to have error rates of at least 1 in 500 to 1 in 200 nucleotides. The assembled gene was amplified by PCR using a forward primer (5′ ATGACCATGATTACGGATTCACTGGCC3′ SEQ ID NO.: 65) and a reverse primer (5′GATAGAGATTCGGGATTTCGGCGCTCC3′ SEQ ID NO.: 66). The amplified assembled gene was analyzed in a BioAnalyzer and cloned. DNA preparations from 24 colonies were Sanger sequenced. The BioAnalyzer analysis provided a broad peak and a tail for the uncorrected gene, indicating a high error rate. The sequencing indicated an error rate of 1/789 bases. Two rounds of error correction were followed using CorectASE (Life Technologies) according to the manufacturer's instructions. The resulting gene samples were analyzed in a BioAnalyzer after round one and round two and cloned. Twenty-four colonies were picked for sequencing. The sequencing results indicated an error rate of 1/5190 bases and 1/6315 bases after the first and second rounds of error correction, respectively.










TABLE 13





Nucleic Acid 
Sequence 







Assembled Gene, 
5′ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCG 


SEQ ID NO.: 67 
TGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAG 



CACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGC 



ACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATG 



GCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCT 



GGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCT 



CAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAAC 



GTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAG 



AATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGC 



TGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAA 



CTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACG 



GCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTT 



TACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGG 



AGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAG 



CGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACA 



AATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAG 



CCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGC 



GTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACG 



CAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGA 



TGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACG 



TCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATC3′ 





Assembly 
5′ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCG 


Oligonucleotide 1, 
TGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAG 


SEQ ID NO.: 68 
CACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGC 



ACCGATCGCCCTTCCCAACAGTTGCGCAGCC3′ 





Assembly 
5′GATAGGTCACGTTGGTGTAGATGGGCGCATCGTAACCGTGCAT 


Oligonucleotide 2,
CTGCCAGTTTGAGGGGACGACGACAGTATCGGCCTCAGGAAGAT 


SEQ ID NO : 69 
CGCACTCCAGCCAGCTTTCCGGCACCGCTTCTGGTGCCGGAAAC 



CAGGCAAAGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGA3′ 





Assembly 
5′CCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCC 


Oligonucleotide 3,  
GTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATT 


SEQ ID NO.: 70 
TAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTA 



TTTTTGATGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGG3′ 





Assembly 
5′GCCGCTCATCCGCCACATATCCTGATCTTCCAGATAACTGCCGTC 


Oligonucleotide 4,  
ACTCCAGCGCAGCACCATCACCGCGAGGCGGTTTTCTCCGGCGC 


SEQ ID NO.: 71 
GTAAAAATGCGCTCAGGTCAAATTCAGACGGCAAACGACTGTCC 



TGGCCGTAACCGACCCAGCGCCCGTTGCACCACAGATGAAACG3′ 





Assembly 
5′AGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTT 


Oligonucleotide 5,  
GCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCA 


SEQ ID NO.: 72 
CTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAA 



GTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTT3′ 





Assembly 
5′GATAGAGATTCGGGATTTCGGCGCTCCACAGTTTCGGGTTTTCG 


Oligonucleotide 6,  
ACGTTCAGACGTAGTGTGACGCGATCGGCATAACCACCACGCTC 


SEQ ID NO.: 73 
ATCGATAATTTCACCGCCGAAAGGCGCGGTGCCGCTGGCGACCT 



GCGTTTCACCCTGCCATAAAGAAACTGTTACCCGTAGGTAGTCA 



CG3′ 









Example 7: Parallel Assembly of 240 Genes on Flat Plate

A substrate 1700 comprising 256 clusters each comprising 121 loci on a flat silicon plate was manufactured as shown in FIG. 17. An expanded view of a cluster is shown in 1705 with 121 loci. Loci from 240 of the 256 clusters provided an attachment and support for the synthesis of oligonucleic acids having distinct sequences. Oligonucleic acid synthesis was performed by phosphoramidite chemistry using general methods from Table 5 in Example 4. Loci from 16 of the 256 clusters were control clusters. The distribution of the 29,040 unique oligonucleic acids synthesized (240×121) is shown in FIG. 18. The distribution of unique oligonucleic acids synthesized in 4 representative clusters is shown in FIG. 19. The error rate for each oligonucleic acid was determined using an Illumina MiSeq gene sequencer. The error rate distribution for the 29,040 unique oligonucleic acids is shown in FIG. 20 and averages around 1 in 500 bases, with some error rates as low as 1 in 800 bases. The error rate distribution for unique oligonucleic acids in four representative clusters is shown in FIG. 21. The library of 29,040 unique oligonucleic acids was synthesized in less than 20 hours.


Oligonucleic acids synthesized within the loci of a cluster had overlapping sequences with one another so that when all oligonucleic acids synthesized within one cluster are pooled, they are ready for assembly into a larger nucleic acid or gene using PCA. Oligonucleic acids within a cluster were pooled and assembled using PCA reaction conditions similar to those described in Example 5. The 240 unique genes were synthesized in 3 business days, however, with 24 hour a day operation, the 240 unique genes could be synthesized in less time. The assembled genes from each of the 240 clusters were sequenced using an Illumina MiSeq gene sequencer. The read counts for the assembled genes are represented in FIG. 22. The assembled gene products were visualized on a DNA gel as shown in FIGS. 23-26. The genes synthesized ranged in size from 838 base pairs to 1470 base pairs. All 240 gene products were generated with their expected size. An output from the sequencing run is shown in FIG. 27.


Example 8: Oligonucleic Acid Library Synthesis with Low Error Rate

A substrate comprising three-dimensional features with high surface area loci was manufactured according to the methods similar to that of Example 3. Each locus was manufactured to have a single comb shape. The substrate has a plurality of clusters corresponding to a plurality of wells, wherein each channel is 1.150 mm in diameter and includes 109 loci in the form of microchannels. FIG. 10C provides a depiction for a collection of microchannels/loci extending from a main channel. Microchannels of the substrate were functionalized and used as an attachment and support for the synthesis of distinct oligonucleic acids. A library of oligonucleic acids was synthesized on the substrate and subsequently gas cleaved from the surface for sequence analysis using an Illumina MiSeq.


Error mismatch rates for oligonucleic acids synthesized within each cluster were calculated (data not shown). Error rates were from 1 in 7,000 bases to as high as 1 in 100 bases. The average mismatch error rate was 1 in 586.82 bases.


Error deletion rates for oligonucleic acids synthesized within each cluster were calculated (data not shown). Error rates were from around 1 in 1,000 bases to around 1 in 2,000 bases. The average deletion error rate was 1 in 1,966.86 bases.


Insertion rates for oligonucleic acids synthesized within each cluster were calculated (data not shown). Error rates were from 1 in 2,700 bases to around 1 in 10,000 bases. The average insertion error rate was 1 in 4,740.03 bases.


The percentage of perfect oligonucleic acids synthesized (a perfect sequence being 100% identical to a preselected nucleic acid sequence) within each cluster were calculated (data not shown). The percentage of perfect sequences ranged from about 70% to about 93.54% perfect sequences. Overall more than 90% of the oligonucleic acids had perfect sequences.


Example 9: Linker Length Analysis

An oligonucleic acid library was synthesized as described in Example 8. Each oligonucleic acid synthesized on a locus of a cluster was tethered to the locus by a linker. Error rate as a function of base distance from substrate surface was analyzed and graphed as depicted in FIG. 28. The lowest error rates correspond to oligonucleic acids with tether between about 12 and 25 bases from the surface.


Example 10: Parallel Synthesis of Distinct Oligonucleic Acids

Oligonucleic acids of various sequences and lengths were synthesized by phosphoramidite chemistry using methods as generally described in Table 5 of Example 4. Oligonucleic acids having lengths from 25 bases to 200 bases were synthesized within different clusters of a substrate. The synthesized oligonucleic acids were released from the surface, collected, and visualized by gel electrophoresis. FIG. 29 provides a captured image of the electrophoresis gel loaded with representative synthesized oligonucleic acids having lengths of 25, 50, 75, 100, 125, 150, 175 and 200 nucleotides.


As exemplified in FIG. 29, the methods and substrates described herein allow for the simultaneous synthesis of a plurality of oligonucleic acids each having different sequences and, in some cases, different sequence lengths. In particular, oligonucleic acids having 200 bases were synthesized on, and removed from a substrate. These synthesized oligonucleic acids were released from the substrate and used in downstream processes, such as visualization by gel electrophoresis. Representative quantities of synthesized oligonucleic acids extracted from each cluster in this example ranged from 113 fmol to 344 fmol. Representative yields from each cluster ranged from 48 pmol/cm2 to 145 pmol/cm2.


While specific instances have been shown and described herein, it will be apparent to those skilled in the art that such instances are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosed instances. It should be understood that various alternatives to the instances described herein may be employed in practicing the invention.

Claims
  • 1. A method for de novo oligonucleotide synthesis, comprising: (a) providing predetermined sequences for a plurality of non-identical oligonucleotides;(b) providing a device for synthesizing oligonucleotides, comprising: (i) a solid substrate;(ii) a main channel, wherein the main channel extends vertically into the solid substrate from an opening on a top side of the solid substrate; and(iii) a plurality of microchannels, wherein each microchannel of the plurality of microchannels extends vertically from an opening on a bottom side of the solid substrate into the main channel, and wherein each microchannel of the plurality of microchannels comprises a fluid path having at least one turn of 45 degrees to 180 degrees in total, when viewed from a top view, and wherein the device comprises more than 20,000 of the microchannels in total;(c) adding a droplet of fluid comprising an extension reaction reagent specific to a microchannel;(d) allowing sufficient time for an extension reaction step to occur; and(e) repeating steps (c) and (d) until the plurality of non-identical oligonucleotides are synthesized.
  • 2. The method of claim 1, wherein the fluid path comprises up to 10 turns in total.
  • 3. The method of claim 1, wherein the at least one turn is 45, 90 or 180 degrees in total.
  • 4. The method of claim 1, wherein the device comprises a total of at least 700,000 microchannels.
  • 5. The method of claim 1, wherein a ratio of width to depth of a narrowest segment of each microchannel is from 0.5 to 0.01.
  • 6. The method of claim 1, wherein each microchannel of the plurality of microchannels has a width of 30 um to 100 um.
  • 7. The method of claim 1, wherein each microchannel of the plurality of microchannels has a depth of 10 um to 500 um.
  • 8. The method of claim 1, wherein the plurality of microchannels has a higher surface energy than the main channel.
  • 9. The method of claim 1, wherein the plurality of microchannels has a higher hydrophobicity than the main channel.
  • 10. The method of claim 1, wherein the main channel has a width of 0.5 to 2 mm.
  • 11. The method of claim 1, wherein the device comprises at least 50 main channels.
  • 12. The method of claim 1, wherein the device comprises at least 500 main channels.
  • 13. The method of claim 1, wherein the device comprises at least 5000 main channels.
  • 14. The method of claim 1, wherein the solid substrate is in a form of a plate or a tape.
  • 15. The method of claim 1, wherein the solid substrate comprises silicon, silicon dioxide, silicon nitride, nylon, nitrocellulose, polypropylene, or polydimethylsiloxane (PDMS).
CROSS REFERENCE

This application is a continuation of U.S. patent application Ser. No. 15/960,319, filed on Apr. 23, 2018, now U.S. Pat. No. 10,744,477 issued Aug. 18, 2020, which is a continuation of U.S. patent application Ser. No. 15/135,434 filed Apr. 21, 2016, now U.S. Pat. No. 9,981,239 issued May 29, 2018, which claims the benefit of U.S. Provisional Application No. 62/150,795 filed Apr. 21, 2015, and U.S. Provisional Application No. 62/220,856 filed Sep. 18, 2015, each of which are herein incorporated by reference in their entirety.

US Referenced Citations (1068)
Number Name Date Kind
3549368 Robert et al. Dec 1970 A
3920714 Streck Nov 1975 A
4123661 Wolf et al. Oct 1978 A
4415732 Caruthers et al. Nov 1983 A
4613398 Chiong et al. Sep 1986 A
4726877 Fryd et al. Feb 1988 A
4808511 Holmes Feb 1989 A
4837401 Hirose et al. Jun 1989 A
4863557 Kokaku et al. Sep 1989 A
4981797 Jessee et al. Jan 1991 A
4988617 Landegren et al. Jan 1991 A
5102797 Tucker et al. Apr 1992 A
5118605 Urdea Jun 1992 A
5137814 Rashtchian et al. Aug 1992 A
5143854 Pirrung et al. Sep 1992 A
5242794 Whiteley et al. Sep 1993 A
5242974 Holmes Sep 1993 A
5288514 Ellman Feb 1994 A
5291897 Gastrin et al. Mar 1994 A
5299491 Kawada Apr 1994 A
5368823 McGraw et al. Nov 1994 A
5384261 Winkler et al. Jan 1995 A
5387541 Hodge et al. Feb 1995 A
5395753 Prakash Mar 1995 A
5431720 Nagai et al. Jul 1995 A
5445934 Fodor et al. Aug 1995 A
5449754 Nishioka Sep 1995 A
5459039 Modrich et al. Oct 1995 A
5474796 Brennan Dec 1995 A
5476930 Letsinger et al. Dec 1995 A
5487993 Herrnstadt et al. Jan 1996 A
5494810 Barany et al. Feb 1996 A
5501893 Laermer et al. Mar 1996 A
5508169 Deugau et al. Apr 1996 A
5510270 Fodor et al. Apr 1996 A
5514789 Kempe May 1996 A
5527681 Holmes Jun 1996 A
5530516 Sheets Jun 1996 A
5534507 Cama et al. Jul 1996 A
5556750 Modrich et al. Sep 1996 A
5586211 Dumitrou et al. Dec 1996 A
5641658 Adams et al. Jun 1997 A
5677195 Winkler et al. Oct 1997 A
5679522 Modrich et al. Oct 1997 A
5683879 Laney et al. Nov 1997 A
5688642 Chrisey et al. Nov 1997 A
5700637 Southern Dec 1997 A
5700642 Monforte et al. Dec 1997 A
5702894 Modrich et al. Dec 1997 A
5707806 Shuber Jan 1998 A
5712124 Walker Jan 1998 A
5712126 Weissman et al. Jan 1998 A
5739386 Holmes Apr 1998 A
5750672 Kempe May 1998 A
5780613 Letsinger et al. Jul 1998 A
5830643 Yamamoto et al. Nov 1998 A
5830655 Monforte et al. Nov 1998 A
5830662 Soares et al. Nov 1998 A
5834252 Stemmer et al. Nov 1998 A
5843669 Kaiser et al. Dec 1998 A
5843767 Beattie Dec 1998 A
5846717 Brow et al. Dec 1998 A
5854033 Lizardi Dec 1998 A
5858754 Modrich et al. Jan 1999 A
5861482 Modrich et al. Jan 1999 A
5863801 Southgate et al. Jan 1999 A
5869245 Yeung Feb 1999 A
5877280 Wetmur Mar 1999 A
5882496 Northrup et al. Mar 1999 A
5922539 Modrich et al. Jul 1999 A
5922593 Livingston Jul 1999 A
5928907 Woudenberg et al. Jul 1999 A
5962272 Chenchik et al. Oct 1999 A
5976842 Wurst Nov 1999 A
5976846 Passmore et al. Nov 1999 A
5989872 Luo et al. Nov 1999 A
5994069 Hall et al. Nov 1999 A
6001567 Brow et al. Dec 1999 A
6008031 Modrich et al. Dec 1999 A
6013440 Lipshutz et al. Jan 2000 A
6015674 Woudenberg et al. Jan 2000 A
6017434 Simpson et al. Jan 2000 A
6020481 Benson et al. Feb 2000 A
6027898 Gjerde et al. Feb 2000 A
6028189 Blanchard Feb 2000 A
6028198 Liu et al. Feb 2000 A
6040138 Lockhart et al. Mar 2000 A
6077674 Schleifer et al. Jun 2000 A
6087482 Teng et al. Jul 2000 A
6090543 Prudent et al. Jul 2000 A
6090606 Kaiser et al. Jul 2000 A
6103474 Dellinger et al. Aug 2000 A
6107038 Choudhary et al. Aug 2000 A
6110682 Dellinger et al. Aug 2000 A
6114115 Wagner, Jr. Sep 2000 A
6130045 Wurst et al. Oct 2000 A
6132997 Shannon Oct 2000 A
6136568 Hiatt et al. Oct 2000 A
6171797 Perbost Jan 2001 B1
6180351 Cattell Jan 2001 B1
6201112 Ach Mar 2001 B1
6218118 Sampson et al. Apr 2001 B1
6221653 Caren et al. Apr 2001 B1
6222030 Dellinger et al. Apr 2001 B1
6232072 Fisher May 2001 B1
6235483 Wolber et al. May 2001 B1
6242266 Schleifer et al. Jun 2001 B1
6251588 Shannon et al. Jun 2001 B1
6251595 Gordon et al. Jun 2001 B1
6251685 Dorsel et al. Jun 2001 B1
6258454 Lefkowitz et al. Jul 2001 B1
6262490 Hsu et al. Jul 2001 B1
6274725 Sanghvi et al. Aug 2001 B1
6284465 Wolber Sep 2001 B1
6287776 Hefti Sep 2001 B1
6287824 Lizardi Sep 2001 B1
6297017 Schmidt et al. Oct 2001 B1
6300137 Earhart et al. Oct 2001 B1
6306599 Perbost Oct 2001 B1
6309822 Fodor et al. Oct 2001 B1
6309828 Schleifer et al. Oct 2001 B1
6312911 Bancroft et al. Nov 2001 B1
6319674 Fulcrand et al. Nov 2001 B1
6323043 Caren et al. Nov 2001 B1
6329210 Schleifer Dec 2001 B1
6346423 Schembri Feb 2002 B1
6365355 McCutchen-Maloney Apr 2002 B1
6372483 Schleifer et al. Apr 2002 B2
6375903 Cerrina et al. Apr 2002 B1
6376285 Joyner et al. Apr 2002 B1
6384210 Blanchard May 2002 B1
6387636 Perbost et al. May 2002 B1
6399394 Dahm et al. Jun 2002 B1
6399516 Ayon Jun 2002 B1
6403314 Lange et al. Jun 2002 B1
6406849 Dorsel et al. Jun 2002 B1
6406851 Bass Jun 2002 B1
6408308 Maslyn et al. Jun 2002 B1
6419883 Blanchard Jul 2002 B1
6428957 Delenstarr Aug 2002 B1
6440669 Bass et al. Aug 2002 B1
6444268 Lefkowitz et al. Sep 2002 B2
6446642 Caren et al. Sep 2002 B1
6446682 Viken Sep 2002 B1
6451998 Perbost Sep 2002 B1
6458526 Schembri et al. Oct 2002 B1
6458535 Hall et al. Oct 2002 B1
6458583 Bruhn et al. Oct 2002 B1
6461812 Barth et al. Oct 2002 B2
6461816 Wolber et al. Oct 2002 B1
6469156 Schafer et al. Oct 2002 B1
6472147 Janda et al. Oct 2002 B1
6492107 Kauffman et al. Dec 2002 B1
6518056 Schembri et al. Feb 2003 B2
6521427 Evans Feb 2003 B1
6521453 Crameri et al. Feb 2003 B1
6555357 Kaiser et al. Apr 2003 B1
6558908 Wolber et al. May 2003 B2
6562611 Kaiser et al. May 2003 B1
6566495 Fodor et al. May 2003 B1
6582908 Fodor et al. Jun 2003 B2
6582938 Su et al. Jun 2003 B1
6586211 Staehler et al. Jul 2003 B1
6587579 Bass Jul 2003 B1
6589739 Fisher Jul 2003 B2
6599693 Webb Jul 2003 B1
6602472 Zimmermann et al. Aug 2003 B1
6610978 Yin et al. Aug 2003 B2
6613513 Parce et al. Sep 2003 B1
6613523 Fischer Sep 2003 B2
6613560 Tso et al. Sep 2003 B1
6613893 Webb Sep 2003 B1
6621076 Van et al. Sep 2003 B1
6630581 Dellinger et al. Oct 2003 B2
6632641 Brennan et al. Oct 2003 B1
6635226 Tso et al. Oct 2003 B1
6642373 Manoharan et al. Nov 2003 B2
6649348 Bass et al. Nov 2003 B2
6660338 Hargreaves Dec 2003 B1
6664112 Mulligan et al. Dec 2003 B2
6670127 Evans Dec 2003 B2
6670461 Wengel et al. Dec 2003 B1
6673552 Frey Jan 2004 B2
6682702 Barth et al. Jan 2004 B2
6689319 Fisher et al. Feb 2004 B1
6692917 Neri et al. Feb 2004 B2
6702256 Killeen et al. Mar 2004 B2
6706471 Brow et al. Mar 2004 B1
6706875 Goldberg et al. Mar 2004 B1
6709841 Short Mar 2004 B2
6709852 Bloom et al. Mar 2004 B1
6709854 Donahue et al. Mar 2004 B2
6713262 Gillibolian et al. Mar 2004 B2
6716629 Hess et al. Apr 2004 B2
6716634 Myerson Apr 2004 B1
6723509 Ach Apr 2004 B2
6728129 Lindsey et al. Apr 2004 B2
6743585 Dellinger et al. Jun 2004 B2
6753145 Holcomb et al. Jun 2004 B2
6768005 Mellor et al. Jul 2004 B2
6770748 Imanishi et al. Aug 2004 B2
6770892 Corson et al. Aug 2004 B2
6773676 Schembri Aug 2004 B2
6773888 Li et al. Aug 2004 B2
6780982 Lyamichev et al. Aug 2004 B2
6787308 Balasubramanian et al. Sep 2004 B2
6789965 Barth et al. Sep 2004 B2
6790620 Bass et al. Sep 2004 B2
6794499 Wengel et al. Sep 2004 B2
6796634 Caren et al. Sep 2004 B2
6800439 McGall et al. Oct 2004 B1
6814846 Berndt Nov 2004 B1
6815218 Jacobson et al. Nov 2004 B1
6824866 Glazer et al. Nov 2004 B1
6830890 Lockhart et al. Dec 2004 B2
6833246 Balasubramanian Dec 2004 B2
6833450 McGall et al. Dec 2004 B1
6835938 Ghosh et al. Dec 2004 B2
6838888 Peck Jan 2005 B2
6841131 Zimmermann et al. Jan 2005 B2
6845968 Killeen et al. Jan 2005 B2
6846454 Peck Jan 2005 B2
6846922 Manoharan et al. Jan 2005 B1
6852850 Myerson et al. Feb 2005 B2
6858720 Myerson et al. Feb 2005 B2
6879915 Cattell Apr 2005 B2
6880576 Karp et al. Apr 2005 B2
6884580 Caren et al. Apr 2005 B2
6887715 Schembri May 2005 B2
6890723 Perbost et al. May 2005 B2
6890760 Webb May 2005 B1
6893816 Beattie May 2005 B1
6897023 Fu et al. May 2005 B2
6900047 Bass May 2005 B2
6900048 Perbost May 2005 B2
6911611 Wong et al. Jun 2005 B2
6914229 Corson et al. Jul 2005 B2
6916113 De et al. Jul 2005 B2
6916633 Shannon Jul 2005 B1
6919181 Hargreaves Jul 2005 B2
6927029 Lefkowitz et al. Aug 2005 B2
6929951 Corson et al. Aug 2005 B2
6936472 Earhart et al. Aug 2005 B2
6938476 Chesk Sep 2005 B2
6939673 Bass et al. Sep 2005 B2
6943036 Bass Sep 2005 B2
6946285 Bass Sep 2005 B2
6950756 Kincaid Sep 2005 B2
6951719 Dupret et al. Oct 2005 B1
6958119 Yin et al. Oct 2005 B2
6960464 Jessee et al. Nov 2005 B2
6969449 Maher et al. Nov 2005 B2
6969488 Bridgham et al. Nov 2005 B2
6976384 Hobbs et al. Dec 2005 B2
6977223 George et al. Dec 2005 B2
6987263 Hobbs et al. Jan 2006 B2
6989267 Kim et al. Jan 2006 B2
6991922 Dupret et al. Jan 2006 B2
7008037 Caren et al. Mar 2006 B2
7025324 Slocum et al. Apr 2006 B1
7026124 Barth et al. Apr 2006 B2
7027930 Cattell Apr 2006 B2
7028536 Karp et al. Apr 2006 B2
7029854 Collins et al. Apr 2006 B2
7034290 Lu et al. Apr 2006 B2
7041445 Chenchik et al. May 2006 B2
7045289 Allawi et al. May 2006 B2
7051574 Peck May 2006 B2
7052841 Delenstarr May 2006 B2
7062385 White et al. Jun 2006 B2
7064197 Rabbani et al. Jun 2006 B1
7070932 Leproust et al. Jul 2006 B2
7075161 Barth Jul 2006 B2
7078167 Delenstarr et al. Jul 2006 B2
7078505 Bass et al. Jul 2006 B2
7094537 Leproust et al. Aug 2006 B2
7097974 Stahler et al. Aug 2006 B1
7101508 Thompson et al. Sep 2006 B2
7101986 Dellinger et al. Sep 2006 B2
7105295 Bass et al. Sep 2006 B2
7115423 Mitchell Oct 2006 B1
7122303 Delenstarr et al. Oct 2006 B2
7122364 Lyamichev et al. Oct 2006 B1
7125488 Li Oct 2006 B2
7125523 Sillman Oct 2006 B2
7128876 Yin et al. Oct 2006 B2
7129075 Gerard et al. Oct 2006 B2
7135565 Dellinger et al. Nov 2006 B2
7138062 Yin et al. Nov 2006 B2
7141368 Fisher et al. Nov 2006 B2
7141807 Joyce et al. Nov 2006 B2
7147362 Caren et al. Dec 2006 B2
7150982 Allawi et al. Dec 2006 B2
7153689 Tolosko et al. Dec 2006 B2
7163660 Lehmann Jan 2007 B2
7166258 Bass et al. Jan 2007 B2
7179659 Stolowitz et al. Feb 2007 B2
7183406 Belshaw et al. Feb 2007 B2
7192710 Gellibolian et al. Mar 2007 B2
7193077 Dellinger et al. Mar 2007 B2
7195872 Agrawal et al. Mar 2007 B2
7198939 Dorsel et al. Apr 2007 B2
7202264 Ravikumar et al. Apr 2007 B2
7202358 Hargreaves Apr 2007 B2
7205128 Ilsley et al. Apr 2007 B2
7205399 Vargeese et al. Apr 2007 B1
7205400 Webb Apr 2007 B2
7206439 Zhou et al. Apr 2007 B2
7208322 Stolowitz et al. Apr 2007 B2
7217522 Brenner May 2007 B2
7220573 Shea et al. May 2007 B2
7221785 Curry et al. May 2007 B2
7226862 Staehler et al. Jun 2007 B2
7227017 Mellor et al. Jun 2007 B2
7229497 Stott et al. Jun 2007 B2
7247337 Leproust et al. Jul 2007 B1
7247497 Dahm et al. Jul 2007 B2
7252938 Leproust et al. Aug 2007 B2
7269518 Corson Sep 2007 B2
7271258 Dellinger et al. Sep 2007 B2
7276336 Webb et al. Oct 2007 B1
7276378 Myerson Oct 2007 B2
7276599 Moore et al. Oct 2007 B2
7282183 Peck Oct 2007 B2
7282332 Caren et al. Oct 2007 B2
7282705 Brennen Oct 2007 B2
7291471 Sampson et al. Nov 2007 B2
7302348 Ghosh et al. Nov 2007 B2
7306917 Prudent et al. Dec 2007 B2
7314599 Roitman et al. Jan 2008 B2
7323320 Oleinikov Jan 2008 B2
7344831 Wolber et al. Mar 2008 B2
7348144 Minor Mar 2008 B2
7351379 Schleifer Apr 2008 B2
7353116 Webb et al. Apr 2008 B2
7361906 Ghosh et al. Apr 2008 B2
7364896 Schembri Apr 2008 B2
7368550 Dellinger et al. May 2008 B2
7371348 Schleifer et al. May 2008 B2
7371519 Wolber et al. May 2008 B2
7371580 Yakhini et al. May 2008 B2
7372982 Le May 2008 B2
7384746 Lyamichev et al. Jun 2008 B2
7385050 Dellinger et al. Jun 2008 B2
7390457 Schembri Jun 2008 B2
7393665 Brenner Jul 2008 B2
7396676 Robotti et al. Jul 2008 B2
7399844 Sampson et al. Jul 2008 B2
7402279 Schembri Jul 2008 B2
7411061 Myerson et al. Aug 2008 B2
7413709 Roitman et al. Aug 2008 B2
7417139 Dellinger et al. Aug 2008 B2
7422911 Schembri Sep 2008 B2
7427679 Dellinger et al. Sep 2008 B2
7432048 Neri et al. Oct 2008 B2
7435810 Myerson et al. Oct 2008 B2
7439272 Xu Oct 2008 B2
7476709 Moody et al. Jan 2009 B2
7482118 Allawi et al. Jan 2009 B2
7488607 Tom-Moy et al. Feb 2009 B2
7504213 Sana et al. Mar 2009 B2
7514369 Li et al. Apr 2009 B2
7517979 Wolber Apr 2009 B2
7524942 Wang et al. Apr 2009 B2
7524950 Dellinger et al. Apr 2009 B2
7527928 Neri et al. May 2009 B2
7531303 Dorsel et al. May 2009 B2
7534561 Sana et al. May 2009 B2
7534563 Hargreaves May 2009 B2
7537936 Dahm et al. May 2009 B2
7541145 Prudent et al. Jun 2009 B2
7544473 Brenner Jun 2009 B2
7556919 Chenchik et al. Jul 2009 B2
7563600 Oleinikov Jul 2009 B2
7572585 Wang Aug 2009 B2
7572907 Dellinger et al. Aug 2009 B2
7572908 Dellinger et al. Aug 2009 B2
7585970 Dellinger et al. Sep 2009 B2
7588889 Wolber et al. Sep 2009 B2
7595350 Xu Sep 2009 B2
7604941 Jacobson Oct 2009 B2
7604996 Stuelpnagel et al. Oct 2009 B1
7608396 Delenstarr Oct 2009 B2
7618777 Myerson et al. Nov 2009 B2
7629120 Bennett et al. Dec 2009 B2
7635772 McCormac Dec 2009 B2
7648832 Jessee et al. Jan 2010 B2
7651762 Xu et al. Jan 2010 B2
7659069 Belyaev et al. Feb 2010 B2
7678542 Lyamichev et al. Mar 2010 B2
7682809 Sampson Mar 2010 B2
7709197 Drmanac May 2010 B2
7718365 Wang May 2010 B2
7718786 Dupret et al. May 2010 B2
7723077 Young et al. May 2010 B2
7737088 Stahler et al. Jun 2010 B1
7737089 Guimil et al. Jun 2010 B2
7741463 Gormley et al. Jun 2010 B2
7749701 Leproust et al. Jul 2010 B2
7759471 Dellinger et al. Jul 2010 B2
7776021 Borenstein et al. Aug 2010 B2
7776532 Gibson et al. Aug 2010 B2
7790369 Stahler et al. Sep 2010 B2
7790387 Dellinger et al. Sep 2010 B2
7807356 Sampson et al. Oct 2010 B2
7807806 Allawi et al. Oct 2010 B2
7811753 Eshoo Oct 2010 B2
7816079 Fischer Oct 2010 B2
7820387 Neri et al. Oct 2010 B2
7829314 Prudent et al. Nov 2010 B2
7855281 Dellinger et al. Dec 2010 B2
7862999 Zheng et al. Jan 2011 B2
7867782 Barth Jan 2011 B2
7875463 Adaskin et al. Jan 2011 B2
7879541 Kincaid Feb 2011 B2
7879580 Carr et al. Feb 2011 B2
7894998 Kincaid Feb 2011 B2
7919239 Wang Apr 2011 B2
7919308 Schleifer Apr 2011 B2
7927797 Nobile et al. Apr 2011 B2
7927838 Shannon Apr 2011 B2
7932025 Carr et al. Apr 2011 B2
7932070 Hogrefe et al. Apr 2011 B2
7935800 Allawi et al. May 2011 B2
7939645 Borns May 2011 B2
7943046 Martosella et al. May 2011 B2
7943358 Hogrefe et al. May 2011 B2
7960157 Borns Jun 2011 B2
7977119 Kronick et al. Jul 2011 B2
7979215 Sampas Jul 2011 B2
7998437 Berndt et al. Aug 2011 B2
7999087 Dellinger et al. Aug 2011 B2
8021842 Brenner Sep 2011 B2
8021844 Wang Sep 2011 B2
8034917 Yamada Oct 2011 B2
8036835 Sampas et al. Oct 2011 B2
8048664 Guan et al. Nov 2011 B2
8053191 Blake Nov 2011 B2
8058001 Crameri et al. Nov 2011 B2
8058004 Oleinikov Nov 2011 B2
8058055 Barrett et al. Nov 2011 B2
8063184 Allawi et al. Nov 2011 B2
8067556 Hogrefe et al. Nov 2011 B2
8073626 Troup et al. Dec 2011 B2
8076064 Wang Dec 2011 B2
8076152 Robotti Dec 2011 B2
8097711 Timar et al. Jan 2012 B2
8137936 Macevicz Mar 2012 B2
8148068 Brenner Apr 2012 B2
8154729 Baldo et al. Apr 2012 B2
8168385 Brenner May 2012 B2
8168388 Gormley et al. May 2012 B2
8173368 Staehler et al. May 2012 B2
8182991 Kaiser et al. May 2012 B1
8194244 Wang et al. Jun 2012 B2
8198071 Goshoo et al. Jun 2012 B2
8202983 Dellinger et al. Jun 2012 B2
8202985 Dellinger et al. Jun 2012 B2
8206952 Carr et al. Jun 2012 B2
8213015 Kraiczek et al. Jul 2012 B2
8242258 Dellinger et al. Aug 2012 B2
8247221 Fawcett et al. Aug 2012 B2
8263335 Carr et al. Sep 2012 B2
8268605 Sorge et al. Sep 2012 B2
8283148 Sorge et al. Oct 2012 B2
8288093 Hall et al. Oct 2012 B2
8298767 Brenner et al. Oct 2012 B2
8304273 Stellacci et al. Nov 2012 B2
8309307 Barrett et al. Nov 2012 B2
8309706 Dellinger et al. Nov 2012 B2
8309710 Sierzchala et al. Nov 2012 B2
8314220 Mullinax et al. Nov 2012 B2
8318433 Brenner Nov 2012 B2
8318479 Domansky et al. Nov 2012 B2
8357489 Chua et al. Jan 2013 B2
8357490 Froehlich et al. Jan 2013 B2
8367016 Quan et al. Feb 2013 B2
8367335 Staehler et al. Feb 2013 B2
8380441 Webb et al. Feb 2013 B2
8383338 Kitzman et al. Feb 2013 B2
8415138 Leproust Apr 2013 B2
8435736 Gibson et al. May 2013 B2
8445205 Brenner May 2013 B2
8445206 Bergmann et al. May 2013 B2
8470996 Brenner Jun 2013 B2
8476018 Brenner Jul 2013 B2
8476598 Pralle et al. Jul 2013 B1
8481292 Casbon et al. Jul 2013 B2
8481309 Zhang et al. Jul 2013 B2
8491561 Borenstein et al. Jul 2013 B2
8497069 Hutchison et al. Jul 2013 B2
8500979 Elibol et al. Aug 2013 B2
8501454 Liu et al. Aug 2013 B2
8507226 Carr et al. Aug 2013 B2
8507239 Lubys et al. Aug 2013 B2
8507272 Zhang et al. Aug 2013 B2
8530197 Li et al. Sep 2013 B2
8552174 Dellinger et al. Oct 2013 B2
8563478 Gormley et al. Oct 2013 B2
8569046 Love et al. Oct 2013 B2
8577621 Troup et al. Nov 2013 B2
8586310 Mitra et al. Nov 2013 B2
8614092 Zhang et al. Dec 2013 B2
8642755 Sierzchala et al. Feb 2014 B2
8664164 Ericsson et al. Mar 2014 B2
8669053 Stuelpnagel et al. Mar 2014 B2
8679756 Brenner et al. Mar 2014 B1
8685642 Sampas Apr 2014 B2
8685676 Hogrefe et al. Apr 2014 B2
8685678 Casbon et al. Apr 2014 B2
8715933 Oliver May 2014 B2
8715967 Casbon et al. May 2014 B2
8716467 Jacobson May 2014 B2
8722368 Casbon et al. May 2014 B2
8722585 Wang May 2014 B2
8728766 Casbon et al. May 2014 B2
8741606 Casbon et al. Jun 2014 B2
8808896 Choo et al. Aug 2014 B2
8808986 Jacobson et al. Aug 2014 B2
8815600 Liu et al. Aug 2014 B2
8889851 Leproust et al. Nov 2014 B2
8932994 Gormley et al. Jan 2015 B2
8962532 Shapiro et al. Feb 2015 B2
8968999 Gibson et al. Mar 2015 B2
8980563 Zheng et al. Mar 2015 B2
9018365 Brenner Apr 2015 B2
9023601 Oleinikov May 2015 B2
9051666 Oleinikov Jun 2015 B2
9073962 Fracchia et al. Jul 2015 B2
9074204 Anderson et al. Jul 2015 B2
9085797 Gebeyehu et al. Jul 2015 B2
9102731 Boone et al. Aug 2015 B2
9133510 Andersen et al. Sep 2015 B2
9139874 Myers et al. Sep 2015 B2
9150853 Hudson et al. Oct 2015 B2
9187777 Jacobson et al. Nov 2015 B2
9194001 Brenner Nov 2015 B2
9216414 Chu Dec 2015 B2
9217144 Jacobson et al. Dec 2015 B2
9279149 Efcavitch et al. Mar 2016 B2
9286439 Shapiro et al. Mar 2016 B2
9295965 Jacobson et al. Mar 2016 B2
9315861 Hendricks et al. Apr 2016 B2
9328378 Earnshaw et al. May 2016 B2
9347091 Bergmann et al. May 2016 B2
9375748 Harumoto et al. Jun 2016 B2
9376677 Mir Jun 2016 B2
9376678 Gormley et al. Jun 2016 B2
9384320 Church Jul 2016 B2
9384920 Bakulich Jul 2016 B1
9388407 Jacobson Jul 2016 B2
9394333 Wada et al. Jul 2016 B2
9403141 Banyai et al. Aug 2016 B2
9409139 Banyai et al. Aug 2016 B2
9410149 Brenner et al. Aug 2016 B2
9410173 Betts et al. Aug 2016 B2
9416411 Stuelpnagel et al. Aug 2016 B2
9422600 Ramu et al. Aug 2016 B2
9487824 Kutyavin Nov 2016 B2
9499848 Carr et al. Nov 2016 B2
9523122 Zheng et al. Dec 2016 B2
9528148 Zheng et al. Dec 2016 B2
9534251 Young et al. Jan 2017 B2
9555388 Banyai et al. Jan 2017 B2
9568839 Stahler et al. Feb 2017 B2
9580746 Leproust et al. Feb 2017 B2
9670529 Osborne et al. Jun 2017 B2
9670536 Casbon et al. Jun 2017 B2
9677067 Toro et al. Jun 2017 B2
9695211 Wada et al. Jul 2017 B2
9718060 Venter et al. Aug 2017 B2
9745573 Stuelpnagel et al. Aug 2017 B2
9745619 Rabbani et al. Aug 2017 B2
9765387 Rabbani et al. Sep 2017 B2
9771576 Gibson et al. Sep 2017 B2
9833761 Banyai et al. Dec 2017 B2
9834774 Carstens Dec 2017 B2
9839894 Banyai et al. Dec 2017 B2
9879283 Ravinder et al. Jan 2018 B2
9889423 Banyai et al. Feb 2018 B2
9895673 Peck et al. Feb 2018 B2
9925510 Jacobson et al. Mar 2018 B2
9932576 Raymond et al. Apr 2018 B2
9981239 Banyai et al. May 2018 B2
10053688 Cox Aug 2018 B2
10251611 Marsh et al. Apr 2019 B2
10272410 Banyai et al. Apr 2019 B2
10384188 Banyai et al. Aug 2019 B2
10384189 Peck Aug 2019 B2
10417457 Peck Sep 2019 B2
10583415 Banyai et al. Mar 2020 B2
10632445 Banyai et al. Apr 2020 B2
10639609 Banyai et al. May 2020 B2
10669304 Indermuhle et al. Jun 2020 B2
10963953 Sweeder et al. Mar 2021 B2
10969965 Malina et al. Apr 2021 B2
11214798 Brown Jan 2022 B2
11236393 Dubinsky et al. Feb 2022 B2
11263354 Peck Mar 2022 B2
11268149 Targan et al. Mar 2022 B2
11332738 Nugent et al. May 2022 B2
11492727 Tabibiazar et al. Nov 2022 B2
11492728 Sato Nov 2022 B2
20010018512 Blanchard Aug 2001 A1
20010039014 Bass et al. Nov 2001 A1
20010055761 Kanemoto et al. Dec 2001 A1
20020012930 Rothberg et al. Jan 2002 A1
20020025561 Hodgson Feb 2002 A1
20020058802 Dellinger et al. May 2002 A1
20020076716 Sabanayagam et al. Jun 2002 A1
20020081582 Gao et al. Jun 2002 A1
20020094533 Hess et al. Jul 2002 A1
20020095073 Jacobs et al. Jul 2002 A1
20020119459 Griffiths Aug 2002 A1
20020132308 Liu et al. Sep 2002 A1
20020155439 Rodriguez et al. Oct 2002 A1
20020160536 Regnier et al. Oct 2002 A1
20020164824 Xiao et al. Nov 2002 A1
20030008411 Van et al. Jan 2003 A1
20030022207 Balasubramanian et al. Jan 2003 A1
20030022240 Luo et al. Jan 2003 A1
20030022317 Jack et al. Jan 2003 A1
20030044781 Korlach et al. Mar 2003 A1
20030058629 Hirai et al. Mar 2003 A1
20030064398 Barnes Apr 2003 A1
20030068633 Belshaw et al. Apr 2003 A1
20030082618 Li et al. May 2003 A1
20030082719 Schumacher et al. May 2003 A1
20030100102 Rothberg et al. May 2003 A1
20030108903 Wang et al. Jun 2003 A1
20030120035 Gao et al. Jun 2003 A1
20030130827 Bentzien et al. Jul 2003 A1
20030138782 Evans Jul 2003 A1
20030143605 Lok et al. Jul 2003 A1
20030148291 Robotti Aug 2003 A1
20030148344 Rothberg et al. Aug 2003 A1
20030148401 Agrawal et al. Aug 2003 A1
20030171325 Gascoyne et al. Sep 2003 A1
20030186226 Brennan et al. Oct 2003 A1
20030228602 Parker et al. Dec 2003 A1
20030228620 Du Dec 2003 A1
20040009498 Short Jan 2004 A1
20040043509 Stahler et al. Mar 2004 A1
20040053362 De et al. Mar 2004 A1
20040086892 Crothers et al. May 2004 A1
20040087008 Schembri May 2004 A1
20040106130 Besemer et al. Jun 2004 A1
20040106728 McGall et al. Jun 2004 A1
20040110133 Xu et al. Jun 2004 A1
20040175710 Haushalter Sep 2004 A1
20040175734 Stahler et al. Sep 2004 A1
20040191810 Yamamoto Sep 2004 A1
20040213795 Collins et al. Oct 2004 A1
20040219663 Page et al. Nov 2004 A1
20040236027 Maeji et al. Nov 2004 A1
20040248161 Rothberg et al. Dec 2004 A1
20040253242 Bowdish et al. Dec 2004 A1
20040259146 Friend et al. Dec 2004 A1
20050022895 Barth et al. Feb 2005 A1
20050049402 Babcook et al. Mar 2005 A1
20050049796 Webb et al. Mar 2005 A1
20050053968 Bharadwaj et al. Mar 2005 A1
20050079510 Berka et al. Apr 2005 A1
20050100932 Lapidus et al. May 2005 A1
20050112608 Grossman et al. May 2005 A1
20050112636 Hurt et al. May 2005 A1
20050112679 Myerson et al. May 2005 A1
20050118706 Pirrung et al. Jun 2005 A1
20050124022 Srinivasan et al. Jun 2005 A1
20050137805 Lewin et al. Jun 2005 A1
20050208513 Agbo et al. Sep 2005 A1
20050214778 Peck et al. Sep 2005 A1
20050214779 Peck et al. Sep 2005 A1
20050227235 Carr et al. Oct 2005 A1
20050255477 Carr et al. Nov 2005 A1
20050266045 Canham et al. Dec 2005 A1
20050277125 Benn et al. Dec 2005 A1
20050282158 Landegren Dec 2005 A1
20050287585 Oleinikov Dec 2005 A1
20060003381 Gilmore et al. Jan 2006 A1
20060003958 Melville et al. Jan 2006 A1
20060012784 Ulmer Jan 2006 A1
20060012793 Harris Jan 2006 A1
20060019084 Pearson Jan 2006 A1
20060024678 Buzby Feb 2006 A1
20060024711 Lapidus et al. Feb 2006 A1
20060024721 Pedersen Feb 2006 A1
20060076482 Hobbs et al. Apr 2006 A1
20060078909 Srinivasan et al. Apr 2006 A1
20060078927 Peck et al. Apr 2006 A1
20060078937 Korlach et al. Apr 2006 A1
20060127920 Church et al. Jun 2006 A1
20060134638 Mulligan et al. Jun 2006 A1
20060160138 Church Jul 2006 A1
20060171855 Yin et al. Aug 2006 A1
20060202330 Reinhardt et al. Sep 2006 A1
20060203236 Ji et al. Sep 2006 A1
20060203237 Ji et al. Sep 2006 A1
20060207923 Li Sep 2006 A1
20060219637 Killeen et al. Oct 2006 A1
20060286569 Bar-Or et al. Dec 2006 A1
20070031857 Makarov et al. Feb 2007 A1
20070031877 Stahler et al. Feb 2007 A1
20070043516 Gustafsson et al. Feb 2007 A1
20070054127 Hergenrother et al. Mar 2007 A1
20070059692 Gao et al. Mar 2007 A1
20070087349 Staehler et al. Apr 2007 A1
20070099196 Kauppinen et al. May 2007 A1
20070099208 Drmanac et al. May 2007 A1
20070122817 Church et al. May 2007 A1
20070128635 Macevicz Jun 2007 A1
20070141557 Raab et al. Jun 2007 A1
20070196834 Cerrina et al. Aug 2007 A1
20070196854 Stahler et al. Aug 2007 A1
20070207482 Church et al. Sep 2007 A1
20070207487 Emig et al. Sep 2007 A1
20070231800 Roberts et al. Oct 2007 A1
20070233403 Alwan et al. Oct 2007 A1
20070238104 Barrett et al. Oct 2007 A1
20070238106 Barrett et al. Oct 2007 A1
20070238108 Barrett et al. Oct 2007 A1
20070259344 Leproust et al. Nov 2007 A1
20070259345 Sampas Nov 2007 A1
20070259346 Gordon et al. Nov 2007 A1
20070259347 Gordon et al. Nov 2007 A1
20070269870 Church et al. Nov 2007 A1
20080085511 Peck et al. Apr 2008 A1
20080085514 Peck et al. Apr 2008 A1
20080087545 Jensen et al. Apr 2008 A1
20080161200 Yu et al. Jul 2008 A1
20080182296 Chanda et al. Jul 2008 A1
20080214412 Stahler et al. Sep 2008 A1
20080227160 Kool Sep 2008 A1
20080233616 Liss Sep 2008 A1
20080287320 Baynes et al. Nov 2008 A1
20080300842 Govindarajan et al. Dec 2008 A1
20080308884 Kalvesten Dec 2008 A1
20080311628 Shoemaker Dec 2008 A1
20090036664 Peter Feb 2009 A1
20090053704 Novoradovskaya et al. Feb 2009 A1
20090062129 McKernan et al. Mar 2009 A1
20090074771 Koenig et al. Mar 2009 A1
20090087840 Baynes et al. Apr 2009 A1
20090088679 Wood et al. Apr 2009 A1
20090105094 Heiner et al. Apr 2009 A1
20090170802 Stahler et al. Jul 2009 A1
20090176280 Hutchison, III et al. Jul 2009 A1
20090181861 Li et al. Jul 2009 A1
20090194483 Robotti et al. Aug 2009 A1
20090230044 Bek Sep 2009 A1
20090238722 Mora-Fillat et al. Sep 2009 A1
20090239759 Balch Sep 2009 A1
20090246788 Albert et al. Oct 2009 A1
20090263802 Drmanac Oct 2009 A1
20090285825 Kini et al. Nov 2009 A1
20090324546 Notka et al. Dec 2009 A1
20100004143 Shibahara Jan 2010 A1
20100008851 Nicolaides et al. Jan 2010 A1
20100009872 Eid et al. Jan 2010 A1
20100047805 Wang Feb 2010 A1
20100051967 Bradley et al. Mar 2010 A1
20100069250 White, III et al. Mar 2010 A1
20100090341 Wan et al. Apr 2010 A1
20100099103 Hsieh et al. Apr 2010 A1
20100111768 Banerjee et al. May 2010 A1
20100160463 Wang et al. Jun 2010 A1
20100167950 Juang et al. Jul 2010 A1
20100173364 Evans et al. Jul 2010 A1
20100216648 Staehler et al. Aug 2010 A1
20100256017 Larman et al. Oct 2010 A1
20100258487 Zelechonok et al. Oct 2010 A1
20100272711 Feldman et al. Oct 2010 A1
20100286290 Lohmann et al. Nov 2010 A1
20100292102 Nouri Nov 2010 A1
20100300882 Zhang et al. Dec 2010 A1
20100311960 Dellinger Dec 2010 A1
20100323404 Lathrop Dec 2010 A1
20110009607 Komiyama et al. Jan 2011 A1
20110082055 Fox et al. Apr 2011 A1
20110114244 Yoo et al. May 2011 A1
20110114549 Yin et al. May 2011 A1
20110124049 Li et al. May 2011 A1
20110124055 Carr et al. May 2011 A1
20110126929 Velasquez-Garcia et al. Jun 2011 A1
20110171651 Richmond Jul 2011 A1
20110172127 Jacobson et al. Jul 2011 A1
20110201057 Carr et al. Aug 2011 A1
20110201528 Baek et al. Aug 2011 A1
20110217738 Jacobson Sep 2011 A1
20110229975 Matthiesen et al. Sep 2011 A1
20110230653 Novoradovskaya et al. Sep 2011 A1
20110254107 Bulovic et al. Oct 2011 A1
20110287435 Grunenwald et al. Nov 2011 A1
20120003713 Hansen et al. Jan 2012 A1
20120021932 Mershin et al. Jan 2012 A1
20120027786 Gupta et al. Feb 2012 A1
20120028843 Ramu et al. Feb 2012 A1
20120032366 Ivniski et al. Feb 2012 A1
20120046175 Rodesch et al. Feb 2012 A1
20120050411 Mabritto et al. Mar 2012 A1
20120094847 Warthmann et al. Apr 2012 A1
20120128548 West et al. May 2012 A1
20120129704 Gunderson et al. May 2012 A1
20120149602 Friend et al. Jun 2012 A1
20120164127 Short et al. Jun 2012 A1
20120164633 Laffler Jun 2012 A1
20120164691 Eshoo et al. Jun 2012 A1
20120184724 Sierzchala et al. Jul 2012 A1
20120220497 Jacobson et al. Aug 2012 A1
20120231968 Bruhn et al. Sep 2012 A1
20120238737 Dellinger et al. Sep 2012 A1
20120258487 Chang et al. Oct 2012 A1
20120264653 Carr et al. Oct 2012 A1
20120270750 Oleinikov Oct 2012 A1
20120270754 Blake Oct 2012 A1
20120283140 Chu Nov 2012 A1
20120288476 Hartmann et al. Nov 2012 A1
20120289691 Dellinger et al. Nov 2012 A1
20120315670 Jacobson et al. Dec 2012 A1
20120322681 Kung et al. Dec 2012 A1
20130005585 Anderson et al. Jan 2013 A1
20130005612 Carr et al. Jan 2013 A1
20130014790 Van Gerpen Jan 2013 A1
20130017642 Milgrew et al. Jan 2013 A1
20130017977 Oleinikov Jan 2013 A1
20130017978 Kavanagh et al. Jan 2013 A1
20130035261 Sierzchala et al. Feb 2013 A1
20130040836 Himmler et al. Feb 2013 A1
20130045483 Treusch et al. Feb 2013 A1
20130053252 Xie et al. Feb 2013 A1
20130059296 Jacobson et al. Mar 2013 A1
20130059761 Jacobson et al. Mar 2013 A1
20130065017 Sieber Mar 2013 A1
20130109595 Routenberg May 2013 A1
20130109596 Peterson et al. May 2013 A1
20130123129 Zeiner et al. May 2013 A1
20130130321 Staehler et al. May 2013 A1
20130137161 Zhang et al. May 2013 A1
20130137173 Zhang et al. May 2013 A1
20130137174 Zhang et al. May 2013 A1
20130137861 Leproust et al. May 2013 A1
20130164308 Foletti et al. Jun 2013 A1
20130165328 Previte et al. Jun 2013 A1
20130196864 Govindarajan et al. Aug 2013 A1
20130217071 Montesclaros et al. Aug 2013 A1
20130225421 Li et al. Aug 2013 A1
20130244884 Jacobson et al. Sep 2013 A1
20130252849 Hudson et al. Sep 2013 A1
20130261027 Li et al. Oct 2013 A1
20130281308 Kung et al. Oct 2013 A1
20130289246 Crowe et al. Oct 2013 A1
20130296192 Jacobson et al. Nov 2013 A1
20130296194 Jacobson et al. Nov 2013 A1
20130298265 Cunnac et al. Nov 2013 A1
20130309725 Jacobson et al. Nov 2013 A1
20130323725 Peter et al. Dec 2013 A1
20130330778 Zeiner et al. Dec 2013 A1
20140011226 Bernick et al. Jan 2014 A1
20140018441 Fracchia et al. Jan 2014 A1
20140031240 Behlke et al. Jan 2014 A1
20140038240 Temme et al. Feb 2014 A1
20140106394 Ko et al. Apr 2014 A1
20140141982 Jacobson et al. May 2014 A1
20140170665 Hiddessen et al. Jun 2014 A1
20140178992 Nakashima et al. Jun 2014 A1
20140221250 Vasquez et al. Aug 2014 A1
20140274729 Kurn et al. Sep 2014 A1
20140274741 Hunter et al. Sep 2014 A1
20140303000 Armour et al. Oct 2014 A1
20140309119 Jacobson et al. Oct 2014 A1
20140309142 Tian Oct 2014 A1
20150010953 Lindstrom et al. Jan 2015 A1
20150012723 Park et al. Jan 2015 A1
20150031089 Lindstrom Jan 2015 A1
20150038373 Banyai et al. Feb 2015 A1
20150056609 Daum et al. Feb 2015 A1
20150057625 Coulthard Feb 2015 A1
20150065357 Fox Mar 2015 A1
20150065393 Jacobson Mar 2015 A1
20150099870 Bennett et al. Apr 2015 A1
20150119293 Short Apr 2015 A1
20150120265 Amirav-Drory et al. Apr 2015 A1
20150159152 Allen et al. Jun 2015 A1
20150183853 Sharma et al. Jul 2015 A1
20150191524 Smith et al. Jul 2015 A1
20150191624 Scheibel et al. Jul 2015 A1
20150191719 Hudson et al. Jul 2015 A1
20150196917 Kay et al. Jul 2015 A1
20150203839 Jacobson et al. Jul 2015 A1
20150211047 Borns Jul 2015 A1
20150225782 Walder et al. Aug 2015 A1
20150240232 Zamore et al. Aug 2015 A1
20150240280 Gibson et al. Aug 2015 A1
20150261664 Goldman et al. Sep 2015 A1
20150269313 Church Sep 2015 A1
20150293102 Shim Oct 2015 A1
20150307875 Happe et al. Oct 2015 A1
20150321191 Kendall et al. Nov 2015 A1
20150322504 Lao et al. Nov 2015 A1
20150344927 Sampson et al. Dec 2015 A1
20150353921 Tian Dec 2015 A9
20150353994 Myers et al. Dec 2015 A1
20150361420 Hudson et al. Dec 2015 A1
20150361422 Sampson et al. Dec 2015 A1
20150361423 Sampson et al. Dec 2015 A1
20150368687 Saaem et al. Dec 2015 A1
20150376602 Jacobson et al. Dec 2015 A1
20160001247 Oleinikov Jan 2016 A1
20160002621 Nelson et al. Jan 2016 A1
20160002622 Nelson et al. Jan 2016 A1
20160010045 Cohen et al. Jan 2016 A1
20160017394 Liang et al. Jan 2016 A1
20160017425 Ruvolo et al. Jan 2016 A1
20160019341 Harris et al. Jan 2016 A1
20160024138 Gebeyehu et al. Jan 2016 A1
20160024576 Chee Jan 2016 A1
20160026753 Krishnaswami et al. Jan 2016 A1
20160026758 Jabara et al. Jan 2016 A1
20160032396 Diehn et al. Feb 2016 A1
20160046973 Efcavitch et al. Feb 2016 A1
20160046974 Efcavitch et al. Feb 2016 A1
20160082472 Perego et al. Mar 2016 A1
20160089651 Banyai Mar 2016 A1
20160090422 Reif et al. Mar 2016 A1
20160090592 Banyai et al. Mar 2016 A1
20160096160 Banyai et al. Apr 2016 A1
20160097051 Jacobson et al. Apr 2016 A1
20160102322 Ravinder et al. Apr 2016 A1
20160108466 Nazarenko et al. Apr 2016 A1
20160122755 Hall et al. May 2016 A1
20160122800 Bernick et al. May 2016 A1
20160152972 Stapleton et al. Jun 2016 A1
20160168611 Efcavitch et al. Jun 2016 A1
20160184788 Hall et al. Jun 2016 A1
20160200759 Srivastava et al. Jul 2016 A1
20160215283 Braman et al. Jul 2016 A1
20160229884 Indermuhle et al. Aug 2016 A1
20160230175 Carstens Aug 2016 A1
20160230221 Bergmann et al. Aug 2016 A1
20160251651 Banyai et al. Sep 2016 A1
20160253890 Rabinowitz et al. Sep 2016 A1
20160256846 Smith et al. Sep 2016 A1
20160264958 Toro et al. Sep 2016 A1
20160289758 Akeson et al. Oct 2016 A1
20160289839 Harumoto et al. Oct 2016 A1
20160297883 Gallo et al. Oct 2016 A1
20160303535 Banyai et al. Oct 2016 A1
20160304862 Igawa et al. Oct 2016 A1
20160304946 Betts et al. Oct 2016 A1
20160310426 Wu Oct 2016 A1
20160310927 Banyai et al. Oct 2016 A1
20160318016 Hou et al. Nov 2016 A1
20160333340 Wu Nov 2016 A1
20160339409 Banyai et al. Nov 2016 A1
20160340672 Banyai et al. Nov 2016 A1
20160348098 Stuelpnagel et al. Dec 2016 A1
20160354752 Banyai et al. Dec 2016 A1
20160355880 Gormley et al. Dec 2016 A1
20170017436 Church Jan 2017 A1
20170066844 Glanville Mar 2017 A1
20170067047 Link et al. Mar 2017 A1
20170067099 Zheng et al. Mar 2017 A1
20170073664 McCafferty et al. Mar 2017 A1
20170073731 Zheng et al. Mar 2017 A1
20170081660 Cox et al. Mar 2017 A1
20170081716 Peck Mar 2017 A1
20170088887 Makarov et al. Mar 2017 A1
20170095785 Banyai et al. Apr 2017 A1
20170096706 Behlke et al. Apr 2017 A1
20170114404 Behlke et al. Apr 2017 A1
20170141793 Strauss et al. May 2017 A1
20170147748 Staehler et al. May 2017 A1
20170151546 Peck et al. Jun 2017 A1
20170159044 Toro et al. Jun 2017 A1
20170175110 Jacobson et al. Jun 2017 A1
20170218537 Olivares Aug 2017 A1
20170233764 Young et al. Aug 2017 A1
20170247473 Short Aug 2017 A1
20170249345 Malik et al. Aug 2017 A1
20170253644 Steyaert et al. Sep 2017 A1
20170298432 Holt Oct 2017 A1
20170320061 Venter et al. Nov 2017 A1
20170327819 Banyai et al. Nov 2017 A1
20170355984 Evans et al. Dec 2017 A1
20170357752 Diggans Dec 2017 A1
20170362589 Banyai et al. Dec 2017 A1
20180029001 Banyai et al. Feb 2018 A1
20180051278 Cox et al. Feb 2018 A1
20180051280 Gibson et al. Feb 2018 A1
20180068060 Ceze et al. Mar 2018 A1
20180104664 Fernandez Apr 2018 A1
20180126355 Peck et al. May 2018 A1
20180142289 Zeitoun et al. May 2018 A1
20180171509 Cox Jun 2018 A1
20180236425 Banyai et al. Aug 2018 A1
20180253563 Peck et al. Sep 2018 A1
20180264428 Banyai et al. Sep 2018 A1
20180273936 Cox et al. Sep 2018 A1
20180282721 Cox et al. Oct 2018 A1
20180291445 Be, I et al. Oct 2018 A1
20180312834 Cox et al. Nov 2018 A1
20180326388 Banyai et al. Nov 2018 A1
20180334712 Singer et al. Nov 2018 A1
20180346585 Zhang et al. Dec 2018 A1
20180355351 Nugent et al. Dec 2018 A1
20190060345 Harrison et al. Feb 2019 A1
20190083596 Orentas et al. Mar 2019 A1
20190118154 Marsh et al. Apr 2019 A1
20190135926 Glanville May 2019 A1
20190224711 Demeris, Jr. Jul 2019 A1
20190240636 Peck et al. Aug 2019 A1
20190244109 Bramlett et al. Aug 2019 A1
20190314783 Banyai et al. Oct 2019 A1
20190318132 Peck Oct 2019 A1
20190352635 Toro et al. Nov 2019 A1
20190366293 Banyai et al. Dec 2019 A1
20190366294 Banyai et al. Dec 2019 A1
20200017907 Zeitoun et al. Jan 2020 A1
20200056229 Mir Feb 2020 A1
20200102611 Zeitoun et al. Apr 2020 A1
20200156037 Banyai et al. May 2020 A1
20200181667 Wu et al. Jun 2020 A1
20200222875 Peck et al. Jul 2020 A1
20200283760 Nugent et al. Sep 2020 A1
20200299322 Indermuhle et al. Sep 2020 A1
20200299684 Toro et al. Sep 2020 A1
20210002710 Gantt et al. Jan 2021 A1
20210040476 Cox et al. Feb 2021 A1
20210071168 Nugent et al. Mar 2021 A1
20210102192 Tabibiazar et al. Apr 2021 A1
20210102195 Sato et al. Apr 2021 A1
20210102198 Cox et al. Apr 2021 A1
20210115594 Cox et al. Apr 2021 A1
20210129108 Marsh et al. May 2021 A1
20210142182 Bramlett et al. May 2021 A1
20210147830 Liss May 2021 A1
20210170356 Peck et al. Jun 2021 A1
20210179724 Sato et al. Jun 2021 A1
20210207197 Gantt et al. Jul 2021 A1
20210332078 Wu Oct 2021 A1
20210348220 Zeitoun et al. Nov 2021 A1
20210355194 Sato et al. Nov 2021 A1
20210395344 Sato et al. Dec 2021 A1
20220032256 Lackey et al. Feb 2022 A1
20220064206 Fernandez et al. Mar 2022 A1
20220064313 Sato et al. Mar 2022 A1
20220064628 Toro et al. Mar 2022 A1
20220106586 Nugent et al. Apr 2022 A1
20220106590 Arbiza et al. Apr 2022 A1
20220135690 Sato et al. May 2022 A1
20220135965 Gantt et al. May 2022 A1
20220138354 Peck May 2022 A1
20220145289 Lackey et al. May 2022 A1
20220206001 Sato Jun 2022 A1
20220243195 Nugent et al. Aug 2022 A1
20220246236 Amirav-Drory Aug 2022 A1
20220259319 Sato et al. Aug 2022 A1
20220259638 Brown Aug 2022 A1
20220277808 Arbiza et al. Sep 2022 A1
20220281989 Glanville Sep 2022 A1
20220307010 Sato et al. Sep 2022 A1
20220315971 Wu et al. Oct 2022 A1
20220323924 Lackey et al. Oct 2022 A1
20220325276 Banyai et al. Oct 2022 A2
20220325278 Nugent et al. Oct 2022 A1
20220348659 Sato et al. Nov 2022 A1
20220356463 Shen et al. Nov 2022 A1
20220356468 Sato et al. Nov 2022 A1
Foreign Referenced Citations (258)
Number Date Country
3157000 Sep 2000 AU
2362939 Aug 2000 CA
2720587 Oct 2009 CA
2792676 Sep 2011 CA
1771336 May 2006 CN
101277758 Oct 2008 CN
102159726 Aug 2011 CN
103003431 Mar 2013 CN
103907117 Jul 2014 CN
104520864 Apr 2015 CN
104562213 Apr 2015 CN
104734848 Jun 2015 CN
104974929 Oct 2015 CN
204714802 Oct 2015 CN
105637097 Jun 2016 CN
10260805 Jul 2004 DE
201890763 Aug 2018 EA
0090789 Oct 1983 EP
0126621 Aug 1990 EP
0753057 Jan 1997 EP
1314783 May 2003 EP
1363125 Nov 2003 EP
1546387 Jun 2005 EP
1153127 Jul 2006 EP
1728860 Dec 2006 EP
1072010 Apr 2010 EP
2175021 Apr 2010 EP
2330216 Jun 2011 EP
1343802 May 2012 EP
2504449 Oct 2012 EP
2751729 Jul 2014 EP
2872629 May 2015 EP
2928500 Oct 2015 EP
2971034 Jan 2016 EP
3030682 Jun 2016 EP
3044228 Apr 2017 EP
2994509 Jun 2017 EP
3204518 Aug 2017 EP
H07505530 Jun 1995 JP
2001518086 Oct 2001 JP
2002511276 Apr 2002 JP
2002536977 Nov 2002 JP
2002538790 Nov 2002 JP
2003522119 Jul 2003 JP
2004521628 Jul 2004 JP
2004268394 Sep 2004 JP
2006503586 Feb 2006 JP
2006238724 Sep 2006 JP
2008505642 Feb 2008 JP
2008097189 Apr 2008 JP
2008523786 Jul 2008 JP
2008214343 Sep 2008 JP
2009294195 Dec 2009 JP
2015521472 Jul 2015 JP
2016527313 Sep 2016 JP
101339064 Jan 2014 KR
WO-9015070 Dec 1990 WO
WO-9210092 Jun 1992 WO
WO-9210588 Jun 1992 WO
WO-9309668 May 1993 WO
WO-9320242 Oct 1993 WO
WO-9525116 Sep 1995 WO
WO-9526397 Oct 1995 WO
WO-9615861 May 1996 WO
WO-9710365 Mar 1997 WO
WO-9822541 May 1998 WO
WO-9841531 Sep 1998 WO
WO-9942813 Aug 1999 WO
WO-9953101 Oct 1999 WO
WO-0013017 Mar 2000 WO
WO-0018957 Apr 2000 WO
WO-0042559 Jul 2000 WO
WO-0042560 Jul 2000 WO
WO-0042561 Jul 2000 WO
WO-0049142 Aug 2000 WO
WO-0053617 Sep 2000 WO
WO-0156216 Aug 2001 WO
WO-0210443 Feb 2002 WO
WO-0156216 Mar 2002 WO
WO-0220537 Mar 2002 WO
WO-0224597 Mar 2002 WO
WO-0227638 Apr 2002 WO
WO-0233669 Apr 2002 WO
WO-02072791 Sep 2002 WO
WO-02072864 Sep 2002 WO
WO-03040410 May 2003 WO
WO-03046223 Jun 2003 WO
WO-03054232 Jul 2003 WO
WO-03060084 Jul 2003 WO
WO-03064026 Aug 2003 WO
WO-03064027 Aug 2003 WO
WO-03064699 Aug 2003 WO
WO-03065038 Aug 2003 WO
WO-03066212 Aug 2003 WO
WO-03089605 Oct 2003 WO
WO-03093504 Nov 2003 WO
WO-03100012 Dec 2003 WO
WO-2004024886 Mar 2004 WO
WO-2004029220 Apr 2004 WO
WO-2004029586 Apr 2004 WO
WO-2004031351 Apr 2004 WO
WO-2004031399 Apr 2004 WO
WO-2004059556 Jul 2004 WO
WO-03060084 Aug 2004 WO
WO-2005014850 Feb 2005 WO
WO-2005051970 Jun 2005 WO
WO-2005059096 Jun 2005 WO
WO-2005059097 Jun 2005 WO
WO-2005093092 Oct 2005 WO
WO-2006023144 Mar 2006 WO
WO-2006044956 Apr 2006 WO
WO-2006076679 Jul 2006 WO
WO-2006116476 Nov 2006 WO
WO-2007073171 Jun 2007 WO
WO-2007109221 Sep 2007 WO
WO-2007118214 Oct 2007 WO
WO-2007120627 Oct 2007 WO
WO-2007137242 Nov 2007 WO
WO-2008003116 Jan 2008 WO
WO-2008006078 Jan 2008 WO
WO-2008027558 Mar 2008 WO
WO-2008045380 Apr 2008 WO
WO-2008054543 May 2008 WO
WO-2008063134 May 2008 WO
WO-2008063135 May 2008 WO
WO-2008068280 Jun 2008 WO
WO-2008103474 Aug 2008 WO
WO-2008109176 Sep 2008 WO
WO-2009132876 Nov 2009 WO
WO-2009126290 Dec 2009 WO
WO-2010001251 Jan 2010 WO
WO-2010025310 Mar 2010 WO
WO-2010025566 Mar 2010 WO
WO-2010027512 Mar 2010 WO
WO-2010089412 Aug 2010 WO
WO-2010141249 Dec 2010 WO
WO-2010141433 Dec 2010 WO
WO-2011020529 Feb 2011 WO
WO-2010141433 Apr 2011 WO
WO-2011053957 May 2011 WO
WO-2011056644 May 2011 WO
WO-2011056872 May 2011 WO
WO-2011066185 Jun 2011 WO
WO-2011066186 Jun 2011 WO
WO-2011085075 Jul 2011 WO
WO-2011103468 Aug 2011 WO
WO-2011109031 Sep 2011 WO
WO-2011143556 Nov 2011 WO
WO-2011150168 Dec 2011 WO
WO-2011161413 Dec 2011 WO
WO-2012013913 Feb 2012 WO
WO-2012061832 May 2012 WO
WO-2012078312 Jun 2012 WO
WO-2012149171 Nov 2012 WO
WO-2012154201 Nov 2012 WO
WO-2013010062 Jan 2013 WO
WO-2013030827 Mar 2013 WO
WO-2013032850 Mar 2013 WO
WO-2013036668 Mar 2013 WO
WO-2013049227 Apr 2013 WO
WO-2013101896 Jul 2013 WO
WO-2013134881 Sep 2013 WO
WO-2013154770 Oct 2013 WO
WO-2013170168 Nov 2013 WO
WO-2013177220 Nov 2013 WO
WO-2014004393 Jan 2014 WO
WO-2014008447 Jan 2014 WO
WO-2014021938 Feb 2014 WO
WO-2014035693 Mar 2014 WO
WO-2014088693 Jun 2014 WO
WO-2014089160 Jun 2014 WO
WO-2014093330 Jun 2014 WO
WO-2014093694 Jun 2014 WO
WO-2014151117 Sep 2014 WO
WO-2014151696 Sep 2014 WO
WO-2014160004 Oct 2014 WO
WO-2014160059 Oct 2014 WO
WO-2014206304 Dec 2014 WO
WO-2015017527 Feb 2015 WO
WO-2015021080 Feb 2015 WO
WO-2015021280 Feb 2015 WO
WO-2015031689 Mar 2015 WO
WO-2015040075 Mar 2015 WO
WO-2015054292 Apr 2015 WO
WO-2015066174 May 2015 WO
WO-2015081114 Jun 2015 WO
WO-2015081142 Jun 2015 WO
WO-2015081440 Jun 2015 WO
WO-2015090879 Jun 2015 WO
WO-2015095404 Jun 2015 WO
WO-2015120403 Aug 2015 WO
WO-2015136072 Sep 2015 WO
WO-2015160004 Oct 2015 WO
WO-2015175832 Nov 2015 WO
WO-2016007604 Jan 2016 WO
WO-2016011080 Jan 2016 WO
WO-2016022557 Feb 2016 WO
WO-2016053883 Apr 2016 WO
WO-2016055956 Apr 2016 WO
WO-2016065056 Apr 2016 WO
WO-2016126882 Aug 2016 WO
WO-2016126987 Aug 2016 WO
WO-2016130868 Aug 2016 WO
WO-2016161244 Oct 2016 WO
WO-2016162127 Oct 2016 WO
WO-2016164779 Oct 2016 WO
WO-2016172377 Oct 2016 WO
WO-2016173719 Nov 2016 WO
WO-2016183100 Nov 2016 WO
WO-2017017423 Feb 2017 WO
WO-2017049231 Mar 2017 WO
WO-2017053450 Mar 2017 WO
WO-2017059399 Apr 2017 WO
WO-2017095958 Jun 2017 WO
WO-2017100441 Jun 2017 WO
WO-2017118761 Jul 2017 WO
WO-2017158103 Sep 2017 WO
WO-2017214574 Dec 2017 WO
WO-2018026920 Feb 2018 WO
WO-2018038772 Mar 2018 WO
WO-2018057526 Mar 2018 WO
WO-2018094263 May 2018 WO
WO-2018112426 Jun 2018 WO
WO-2018119246 Jun 2018 WO
WO-2018156792 Aug 2018 WO
WO-2018170164 Sep 2018 WO
WO-2018170169 Sep 2018 WO
WO-2018170559 Sep 2018 WO
WO-2018200380 Nov 2018 WO
WO-2018231872 Dec 2018 WO
WO-2019014781 Jan 2019 WO
WO-2019051501 Mar 2019 WO
WO-2019079769 Apr 2019 WO
WO-2019084500 May 2019 WO
WO-2019136175 Jul 2019 WO
WO-2019222706 Nov 2019 WO
WO-2020139871 Jul 2020 WO
WO-2020176362 Sep 2020 WO
WO-2020176678 Sep 2020 WO
WO-2020176680 Sep 2020 WO
WO-2020257612 Dec 2020 WO
WO-2021046655 Mar 2021 WO
WO-2021119193 Jun 2021 WO
WO-2022010934 Jan 2022 WO
WO-2022046797 Mar 2022 WO
WO-2022046944 Mar 2022 WO
WO-2022047076 Mar 2022 WO
WO-2022076326 Apr 2022 WO
WO-2022086866 Apr 2022 WO
WO-2022087293 Apr 2022 WO
WO-2022098662 May 2022 WO
WO-2022159620 Jul 2022 WO
WO-2022178137 Aug 2022 WO
WO-2022204309 Sep 2022 WO
WO-2022204316 Sep 2022 WO
WO-2022217004 Oct 2022 WO
WO-2022235579 Nov 2022 WO
WO-2022235584 Nov 2022 WO
Non-Patent Literature Citations (641)
Entry
Abudayyeh et al.: C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science, available on line, Jun. 13, 2016, at: http://zlab.mit.edu/assets/reprints/Abudayyeh_OO_Science_2016.pdf, 17 pages.
Acevedo-Rocha et al.: Directed evolution of stereoselective enzymes based on genetic selection as opposed to screening systems. J. Biotechnol. 191:3-10 (2014).
Adessi et al.: Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms. Nucleic Acids Res. 28(20):E87, 2000.
Alberts et al.: Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. The Generation of Antibody Diversity. https://www.ncbi.nlm.nih.gov/books/NBK26860/.
Alexeyev et al.: Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase, Biochimica et Biophysics Acta, 1419:299-306, 1999.
Al-Housseiny et al.: Control of interfacial instabilities using flow geometry Nature Physics, 8:747-750, 2012.
Almagro et al.: Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Frontiers in immunology; 8, 1751 (2018) doi:10.3389/fimmu.2017.01751 https://www.frontiersin.org/articles/10.3389/fimmu.2017.01751/full.
Amblard et al.: A magnetic manipulator for studying local rheology and micromechanical properties of biological systems, Rev. Sci. Instrum., 67(3):18-827, 1996.
Andoni and Indyk. Near-Optimal Hashing Algorithms for Approximate Nearest Neighbor in High Dimensions, Communications of the ACM, 51(1):117-122, 2008.
Arand et al.: Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22:2583-2592 (2003).
Arkles et al.: The Role of Polarity in the Structure of Silanes Employed in Surface Modification. Silanes and Other Coupling Agents. 5:51-64, 2009.
Arkles. Hydrophobicity, Hydrophilicity Reprinted with permission from the Oct. 2006 issue of Paint & Coatings Industry magazine, Retrieved on Mar. 19, 2016, 10 pages.
Assembly manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, The Institute for Systems Biology, May 28, 2004 (50 pages).
Assi et al.: Massive-parallel adhesion and reactivity—measurements using simple and inexpensive magnetic tweezers. J. Appl. Phys. 92(9):5584-5586 (2002).
ATDBio. Nucleic Acid Structure, Nucleic Acids Book, 9 pages, published on Jan. 22, 2005. from: http://www.atdbio.eom/content/5/Nucleic-acid-structure.
ATDBio. Solid-Phase Oligonucleotide Synthesis, Nucleic Acids Book, 20 pages, Published on Jul. 31, 2011. from: http://www.atdbio.com/content/17/Solid-phase-oligonucleotide-synthesis.
Au et al.: Gene synthesis by a LCR-based approach: high level production of Leptin-L54 using synthetic gene in Escherichia coli. Biochemical and Biophysical Research Communications 248:200-203 (1998).
Baedeker et al.: Overexpression of a designed 2.2kb gene of eukaryotic phenylalanine ammonialyase in Escherichia coli-. FEBS Letters, 457:57- 60, 1999.
Barbee et al.: Magnetic Assembly of High-Density DNA Arrays for Genomic Analyses. Anal Chem. 80(6):2149-2154, 2008.
Barton et al.: A desk electrohydrodynamic jet printing system. Mechatronics, 20:611-616, 2010.
Beaucage et al.: Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron. 48:2223-2311, 1992.
Beaucage et al.: Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 22(20):1859-1862, 1981.
Beaucage et al.: The Chemical synthesis of DNA/RNA Chapter 2 in: Encyclopedia of Cell Biology, 1:36-53, 2016.
Beaulieu et al.: PCR candidate region mismatch scanning adaptation to quantitative, high-throughput genotyping, Nucleic Acids Research, 29(5):1114-1124, 2001.
Beigelman et al.: Base-modified phosphoramidite analogs of pyrimidine ribonucleosides for RNA structure-activity studies. Methods Enzymol. 317:39-65, 2000.
Bethge et al.: Reverse synthesis and 3′-modification of RNA. Jan. 1, 2011, pp. 64-64, XP055353420. Retrieved from the Internet: URL:http://www.is3na.org/assets/events/Category%202-Medicinal %20Chemistry%20of%2001igonucleotides%20%2864-108%29.pdf.
Binkowski et al.: Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Research, 33(6):e55, 8 pages, 2005.
Biswas et al.: Identification and characterization of a thermostable MutS homolog from Thennus aquaticus, The Journal of Biological Chemistry, 271(9):5040-5048, 1996.
Biswas et al.: Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA, The Journal of Biological Chemistry, 272(20):13355-13364, 1997.
Bjornson et al.: Differential and simultaneous adenosine Di- and Triphosphate binding by MutS, The Journal of Biological Chemistry, 278(20):18557-18562, 2003.
Blanchard et al.: High-Density Oligonucleotide Arrays, Biosensors & Bioelectronics, 11(6/7):687-690, 1996.
Blanchard: Genetic Engineering, Principles and Methods, vol. 20, Ed. J. Sedlow, New York: Plenum Press, p. 111-124, 1979.
Blawat et al.: Forward error correction for DNA data storage. Procedia Computer Science, 80:1011-1022, 2016.
Bonini and Mondino. Adoptive T-cell therapy for cancer: The era of engineered T cells. European Journal of Immunology, 45:2457-2469, 2015.
Bornholt et al.: A DNA-Based Archival Storage System, in International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Apr. 2-6, 2016, Atlanta, GA, 2016, 637-649.
Borovkov et al.: High-quality gene assembly directly from unpurified mixtures of microassay-synthesized oligonucleotides. Nucleic Acid Research, 38(19):e180, 10 pages, 2010.
Brunet: Aims and methods of biosteganography. Journal of Biotechnology, 226:56-64, 2016.
Buermans et al.: Next Generation sequencing technology: Advances and applications, Biochimica et Biophysica Acta (BBA)—Molecular Basis of Disease, 1842:1931-1941, 2014.
Butler et al.: In situ synthesis of oligonucleotide arrays by using surface tension. J Am Chem Soc. 123(37):8887-94, 2001.
Calvert. Lithographically patterned self-assembled films. In: Organic Thin Films and Surfaces: Directions for The Nineties, vol. 20, p. 109, ed. By Abraham Ulman, San Diego: Academic Press, 1995.
Cardelli. Two-Domain DNA Strand Displacement, Electron. Proc. Theor. Comput. Sci., 26:47-61, 2010.
Carlson. Time for New DNA Synthesis and Sequencing Cost Curves, 2014. [Online]. Available: http://www.synthesis.cc/synthesis/2014/02/time_for_new_cost_curves_2014. 10 pages.
Carr et al.: Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Res. 32(20):e162, 9 pages, 2004.
Carter and Friedman. DNA synthesis and Biosecurity: Lessons learned and options for the future. J. Craig Venter Institute, La Jolla, CA, 28 pages, Oct. 2015.
Caruthers. Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. In Methods in Enzymology, Chapter 15, 154:287-313, 1987.
Caruthers. The Chemical Synthesis of DNA/RNA: Our Gift to Science. J. Biol. Chem., 288(2):1420-1427, 2013.
Caruthers. Gene synthesis machines: DNA chemistry and its uses. Science 230(4723):281-285 (1985).
Casmiro et al.: PCR-based gene synthesis and protein NMR spectroscopy, Structure, 5(11):1407-1412, 1997.
CeGaT. Tech Note available at https://www.cegat.de/web/wp-content/uploads/2018/06/Twist-Exome-Tech-Note.pdf (4 pgs.) (2018).
Cello et al.: Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science. 297(5583):1016-8, 2000.
Chalmers et al.: Scaling up the ligase chain reaction-based approach to gene synthesis. Biotechniques. 30(2):249-52, 2001.
Chan et al.: Natural and engineered nicking endonucleases—from cleavage mechanism to engineering of strand-specificity. Nucleic Acids Res. 39(1):1-18, 2011.
Chen et al.: Programmable chemical controllers made from DNA, Nat. Nanotechnol., 8(10):755-762, 2013.
Chen et al.: Chemical modification of gene silencing oligonucleotides fordrug discovery and development. Drug Discov Today. 10(8):587-93 2005.
Cheng et al.: High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer. Nucleic Acids Res. 30(18):e93, 2002.
Chervin et al.: Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Therapy. 20(6):634-644 (2012).
Chilamakuri et al.: Performance comparison of four exome capture systems for deep sequencing. BMC Genomics 15(1):449 (2014).
Cho et al.: Capillary passive valve in microfluidic systems. NSTI-Nanotech. 2004; 1:263-266.
Chrisey et al.: Fabrication of patterned DNA surfaces Nucleic Acids Research, 24(15):3040-3047 (1996).
Chung et al.: One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci USA. Apr. 1989;86(7):2172-2175.
Church et al.: Next-generation digital information storage in DNA. Science, 337:6102, 1628-1629, 2012.
Cleary et al.: Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nat Methods 1(3):241-248 (2004).
Cohen et al.: Human population: The next half century. Science, 302:1172-1175, 2003.
Crick. On protein synthesis. Symp Soc Exp Biol12:138-163, 1958.
Cruse et al.: Atlas of Immunology, Third Edition. Boca Raton:CRC Press (pp. 282-283) (2010).
Cutler et al.: High-throughput variation detection and genotyping using microarrays, Genome Research, vol. 11, 1913-19 (2001).
Dahl et al.: Circle-to-circle amplification for precise and sensitive DNA analysis. Proc Natl Acad Sci USA. Mar. 30, 2004;101(13):4548-53. Epub Mar. 15, 2004.
De Mesmaeker et al.: Backbone modifications in oligonucleotides and peptide nucleic acid systems. CurrOpin Struct Biol. Jun. 1995;5(3):343-55.
De Silva et al.: New Trends of Digital Data Storage in DNA. BioMed Res Int. 2016:8072463 (2016).
Deamer et al.: Characterization of nucleic acids by nanopore analysis, Ace. Cham. Res., vol. 35, No. 10, 817-825 (2002).
Deaven. The Human Genome Project: Recombinant clones for mapping and sequencing DNA. Los Alamos Science, 20:218-249, 1992.
Deng et al.: Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming Nature Biotechnology, 27:352-360 (2009).
Dietrich et al.: Gene assembly based on blunt-ended double-stranded DNA-modules, Biotechnology Techniques, vol. 12, No. 1, 49-54 (Jan. 1998).
Dillon et al.: Exome sequencing has higher diagnostic yield compared to simulated diseasespecific panels in children with suspected monogenic disorders. Eur J Hum Genet 26(5):644-651 (2018).
Dormitzer et al.: Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Translational Medicine, 5(185):185ra68, 14 pages, 2013.
Doudna et al.: Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346(6213):1258096-1-1258096-9, 2014.
Douthwaite et al.: Affinity maturation of a novel antagonistic human monoclonal antibody with a long VH CDR3 targeting the Class A GPCR formyl-peptide receptor 1; mAbs, vol. 7, Iss. 1, pp. 152-166 (Jan. 1, 2015).
Dower et al.: High efficiency transformation of E.coli by high voltage electroporation. Nucleic Acids Res. 16(13):6127-45 (1988).
Dressman et al.: Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc Natl Acad Sci USA. Jul. 22, 2003;100(15):8817-22. Epub Jul. 11, 2003.
Drmanac et al.: Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays. Science. Jan. 1, 2010;327(5961):78-81. doi: 10.1126/science.1181498. Epub Nov. 5, 2009.
Droege and Hill. The Genome Sequencer FLXTM System-Longer reads, more applications, straight forward bioinformatics and more complete data sets Journal of Biotechnology, 136:3-10, 2008.
Duffy et al.: Rapid Prototyping of Microfluidic Systems in Poly(dimethylsiloxane). Anal Chem. Dec. 1, 1998;70(23):4974-84. doi: 10.1021/ac980656z.
Duggan et al.: Expression profiling using cDNA microarrays. Nat Genet. Jan. 1999; 21(1 Suppl):10-4.
Dvorsky. Living Bacteria Can Now Store Data. GIZMODO internet publication. Retrieved from https://gizmodo.com/living-bacteria-can-now-store-data-1781773517 (4 pgs) (Jun. 10, 2016).
Eadie et al.: Guanine modification during chemical DNA synthesis. Nucleic Acids Res. Oct. 26, 1987;15(20):8333-49.
Eisen. A phylogenomic study of the MutS family of proteins, Nucleic Acids Research, vol. 26, No. 18, 4291-4300 (1998).
Ellis et al.: DNA assembly for synthetic biology: from parts to pathways and beyond. Integr Biol (Camb). Feb. 2011;3(2):109-18. doi: 10.1039/c0ib00070a. Epub Jan. 19, 2011.
El-Sagheer et al.: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli. Proc Natl Acad Sci USA. Jul. 12, 2011;108(28):11338-43. doi: 10.1073/pnas.1101519108. Epub Jun. 27, 2011.
Elsik et al.: The Genome sequence of taurine cattle: A window of ruminant biology and evolution. Science, 324:522-528, 2009.
Elsner et al.: 172 nm excimer VUV-triggered photodegradation and micropatterning of aminosilane films, Thin Solid Films, 517:6772-6776 (2009).
Engler et al.: A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3(11):e3647. doi: 10.1371/journal.pone.0003647. Epub Nov. 5, 2008.
Engler et al.: Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One. 2009;4(5):e5553. doi: 10.1371/journal.pone.0005553. Epub May 14, 2009.
Erlich and Zielinski. DNA fountain enables a robust and efficient storage architecture. Science, 355(6328):950-054, 2017.
Eroshenko et al.: Gene Assembly from Chip-Synthesized Oligonucleotides; Current Protocols in Chemical biology 4: 1-17 (2012).
European Patent Application No. 12827479.2 Extended European Search Report dated May 18, 2015.
European Patent Application No. 12827479.2 Partial European Search Report dated Jan. 29, 2015.
European Patent Application No. 14834665.3 Communication dated Jan. 16, 2018.
European Patent Application No. 14834665.3 extended European Search Report dated Apr. 28, 2017.
European Patent Application No. 14834665.3 Further Examination Report dated Nov. 28, 2018.
European Patent Application No. 14834665.3 Office Action dated May 2, 2018.
European Patent Application No. 16847497.1 Extended European Search Report dated Jan. 9, 2019.
European Patent Application No. 16871446.7 European Search Report dated Apr. 10, 2019.
European Patent Application No. 16871446.7 First Official Action dated Nov. 13, 2019.
European Patent Application No. 17844060.8 Extended Search Report dated Apr. 20, 2020.
European Patent Application No. 17881617.9 European Search Report and Written Opinion dated Jul. 2, 2020.
European Patent Application No. 17872347.4 Extended European Search Report dated Jun. 30, 2020.
Evans et al.: DNA Repair Enzymes. Current Protocols in Molecular Biology 84:III:3.9:3.9.1-3.9.12 http://www.ncbi.nlm.nih.gov/pubmed/18972391 (Published online Oct. 1, 2008 Abstract only provided).
Fahy et al.: Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. Aug. 1991;1(1):25-33.
Fedoryak et al.: Brominated hydroxyquinoline as a photolabile protecting group with sensitivity to multiphoton excitation, Org. Lett., vol. 4, No. 2, 3419-3422 (2002).
Ferretti et al.: Total synthesis of a gene for bovine rhodopsin. PNAS, 83:599-603 (1986).
Finger et al.: The wonders of Flap Endonucleases: Structure, function, mechanism and regulation. Subcell Biochem., 62:301-326, 2012.
Fodor et al.: Light-directed, spatially addressable parallel chemical synthesis. Science. 251(4995):767-773 (1991).
Fogg et al.: Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology, 9(12):922-927, 2002.
Foldesi et al.: The synthesis of deuterionucleosides. Nucleosides Nucleotides Nucleic Acids. Oct.-Dec. 2000;19(10-12):1615-56.
Frandsen et al.: Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Molecular Biology 2008, 9:70.
Frandsen. Experimental setup. Dec. 7, 2010, 3 pages. http://www.rasmusfrandsen.dk/experimental_setup.htm.
Frandsen. The USER Friendly technology. USER cloning. Oct. 7, 2010, 2 pages. http://www.rasmusfrandsen.dk/user_cloning.htm.
Fullwood et al.: Next-generation DNA sequencing of paired-end tags [PET] fortranscriptome and genome analysis Genome Research, 19:521-532, 2009.
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS ONE, 12, e0175146:1-9 (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS ONE, 12, e0175146:S1 figure (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS ONE, 12, e0175146:S1 Table (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS ONE, 12, e0175146:S2 figure (2017).
Galneder et al.: Microelectrophoresis of a bilayer-coated silica bead in an optical trap: application to enzymology. Biophysical Journal, vol. 80, No. 5, 2298-2309 (May 2001).
Gao et al.: A method for the generation of combinatorial antibody libraries using pIX phage display. PNAS 99(20):12612-12616 (2002).
Gao et al.: A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids. Nucleic Acids Res. Nov. 15, 2001;29(22):4744-50.
Gao et al.: Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res. Nov. 15, 2003;31(22):e143.
Garaj et al.: Graphene as a subnanometre trans-electrode membrane. Nature. Sep. 9, 2010;467(7312):190-3. doi: 10.1038/nature09379.
Garbow et al.: Optical tweezing electrophoresisof isolated, highly charged colloidal spheres, Colloids and Surfaces A: Physiochem. Eng. Aspects, vol. 195, 227-241 (2001).
GeneArt Seamless Cloning and Assembly Kits. Life Technologies Synthetic Biology. 8 pages, available online Jun. 15, 2012.
Genomics 101. An Introduction to the Genomic Workflow. 2016 edition, 64 pages. Available at: http://www.frontlinegenomics.com/magazine/6757/genomics-101/.
Geu-Flores et al.: USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 2007;35(7):e55. Epub Mar. 27, 2007.
Gibson Assembly. Product Listing. Application Overview. 2 pages, available online Dec. 16, 2014.
Gibson et al.: Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome. Science 329(5989):52-56 (2010).
Gibson et al.: Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. Feb. 29, 2008;319(5867):1215-20. doi: 10.1126/science.1151721. Epub Jan. 24, 2008.
Goldfeder et al.: Medical implications of technical accuracy in genome sequencing. Genome Med 8(1):24 (2016).
Goldman et al.: Towards practical, high-capacity, low-maintenance information storage in synthesized DNA, Nature, 494(7435):77-80, 2013.
Gosse et al.: Magnetic tweezers: micromanipulation and force measurement at the molecular level, Biophysical Journal, vol. 8, 3314-3329 (Jun. 2002).
Grass et al.: Robust chemical preservation of digital information on DNA in silica with errorcorrecting codes, Angew. Chemie—Int. Ed., 54(8):2552-2555, 2015.
Greagg et al.: A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil. Proc. Nat. Acad. Sci. USA, 96:9045-9050, 1999.
Grovenor. Microelectronic materials. Graduate Student Series in Materials Science and Engineering. Bristol, England: Adam Hilger, 1989; p. 113-123.
Gu et al.: Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biology, 17:41, 13 pages, 2016.
Haber et al.: Magnetic tweezers for DNA micromanipulation, Rev. Sci. Instrum., vol. 71, No. 12, 4561-4570 (Dec. 2000).
Han et al.: Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32(7):684-692 (2014).
Hanahan and Cold Spring Harbor Laboratory. Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557-580 (1983).
Hanahan et al.: Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol, vol. 204, p. 63-113 (1991).
Harada et al.: Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection. Nucleic Acids Res. May 25, 1993;21(10):2287-91.
Hauser et al.: Trends in GPCR drug discovery: new agents, targets and indications. Nature Reviews Drug Discovery, 16, 829-842 (2017). doi:10.1038/nrd.2017.178 https://www.nature.com/articles/nrd.2017.178.
Heckers et al.: Error analysis of chemically synthesized polynucleotides, BioTechniques, vol. 24, No. 2, 256-260 (1998).
Herzer et al.: Fabrication of patterned silane based self-assembled monolayers by photolithography and surface reactions on silicon-oxide substrates Chem. Commun., 46:5634-5652 (2010).
Hoover et al.: DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis, Nucleic Acids Research, vol. 30, No. 10, e43, 7 pages (2002).
Hosu et al.: Magnetic tweezers for intracellular applications*, Rev. Sci. Instrum., vol. 74, No. 9, 4158-4163 (Sep. 2003).
Hötzel et al.: A strategy for risk mitigation of antibodies with fast clearance. mAbs, 4(6), 753-760 (2012). doi:10.4161/mabs.22189 https://www.ncbi.nlm.nih.gov/pubmed/23778268.
Huang et al.: Three-dimensional cellular deformation analysis with a two-photon magnetic manipulator workstation, Biophysical Journal, vol. 82, No. 4, 2211-2223 (Apr. 2002).
Hughes et al.: Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer Nat Biotech 4:342-347 (2001).
Hughes et al.: Principles of early drug discovery. Br J Pharmacol 162(2):1239-1249, 2011.
Hutchison et al.: Cell-free cloning using phi29 DNA polymerase. Proc Natl Acad Sci USA. Nov. 29, 2005;102(48):17332-6. Epub Nov. 14, 2005.
IMGUR: The magic of the internet. Uploaded May 10, 2012, 2 pages, retrieved from: https://imgur.com/mEWuW.
In-Fusion Cloning: Accuracy, Not Background. Cloning & Competent Cells, ClonTech Laboratories, 3 pages, available online Jul. 6, 2014.
International Application No. PCT/US2017/026232 International Preliminary Report on Patentability dated Feb. 26, 2019.
International Application No. PCT/US2017/045105 International Preliminary Report on Patentability dated Feb. 5, 2019.
International Application No. PCT/US2017/052305 International Preliminary Report on Patentability dated Apr. 30, 2019.
International Application No. PCT/US2017/062391 International Preliminary Report on Patentability dated May 21, 2019.
International Application No. PCT/US2018/019268 International Preliminary Report on Patentability dated Sep. 6, 2019.
International Application No. PCT/US2018/050511 International Search Report and Written Opinion dated Jan. 11, 2019.
International Application No. PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019.
International Application No. PCT/US2019/012218 International Search Report and Written Opinion dated Mar. 21, 2019.
International Application No. PCT/US2019/032992 International Search Report and Written Opinion dated Oct. 28, 2019.
International Application No. PCT/US2019/032992 Invitation to Pay Additional Fees dated Sep. 6, 2019.
Jackson et al.: Recognition of DNA base mismatches by a rhodium intercalator, J. Am. Chem. Soc., vol. 19, 12986-12987 (1997).
Jacobs et al.: DNA glycosylases: In DNA repairand beyond. Chromosoma 121:1-20 (2012)—http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3260424/.
Jacobus et al.: Optimal cloning of PCR fragments by homologous recombination in Escherichia soli. PLoS One 10(3):e0119221 (2015).
Jager et al.: Simultaneous Humoral and Cellular: Immune Response against Cancer—Testis Antigen NY-ES0-1: Definition of Human Histocompatibility Leukocyte Antigen (HLA)-A2—binding Peptide Epitopes. J. Exp. Med. 187(2):265-270 (1998).
Jinek et al.: A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337:816-821, 2012.
Jo et al.: Engineering therapeutic antibodies targeting G-protein-coupled receptors; Experimental & Molecular Medicine; 48; 9 pages (2016).
Karagiannis and El-Osta. RNA interference and potential therapeutic applications of short interfering RNAs Cancer Gene Therapy, 12:787-795, 2005.
Ke et al.: Influence of neighboring base pairs on the stability of single base bulges and base pairs in a DNA fragment, Biochemistry, vol. 34, 4593-4600 (1995).
Kelley et al.: Single-base mismatch detection based on charge transduction through DNA, Nucleic Acids Research, vol. 27, No. 24, 4830-4837 (1999).
Kim et al.: High-resolution patterns of quantum dots formed by electrohydrodynamic jet printing for light-emitting diodes. Nano Letters, 15:969-973, 2015.
Kim et al.: Site specific cleavage of DNA-RNA hybrids by zinc finger/Fok I cleavage domain fusions Gene, vol. 203, 43-49 (1997).
Kim et al.: Chimeric restriction endonuclease, Proc. Natl. Acad. Sci. USA, vol. 91, 883-887 (Feb. 1994).
Kim. The interaction between Z-ONA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases, The Journal of Biological Chemistry, vol. 274, No. 27, 19081-19086 (1999).
Kinde et al.: Detection and quantification of rare mutations with massively parallel sequencing. Proc Natl Acad Sci USA. Jun. 7, 2011;108(23):9530-5. Epub May 17, 2011.
Kodumal et al.: Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc Natl Acad Sci USA. Nov. 2, 2004;101 (44):15573-8. Epub Oct. 20, 2004.
Koike-Yusa et al.: Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology, 32:267-273, 2014 (with three pages of supplemental Online Methods).
Kong et al.: Parallel gene synthesis in a microfluidic device. Nucleic Acids Res., 35(8):e61 (2007).
Kong. Microfluidic Gene Synthesis. MIT Thesis. Submitted to the program in Media Arts and Sciences, School of Architecture and Planning, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Media Arts and Sciences at the Massachusetts Institute of Technology. 143 pages Jun. 2008.
Kopp et al.: Chemical amplification: continuous-flow PCR on a chip, Science, vol. 280, 1046-1048 (May 15, 1998).
Kosuri and Church. Large-scale de novo DNA synthesis: technologies and applications, Nature Methods, 11:499-507, 2014. Available at: http://www.nature.com/nmeth/journal/v11/n5/full/nmeth.2918.html.
Kosuri et al.: A scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 2010; 28:1295-1299.
Krayden, Inc.: A Guide to Silane Solutions. Silane coupling agents. 7 pages. Published on May 31, 2005 at: http://krayden.com/pdf/xia_silane_chemistry.pdf.
Lagally et al.: Single-Molecule DNA Amplification and Analysis in an Integrated Microfluidic Device. Analytical Chemistry. 2001;73(3): 565-570.
Lahue et al.: DNA mismatch correction in a defined system, Science, vol. 425; No. 4914, 160-164 (Jul. 14, 1989).
Lambrinakos et al.: Reactivity of potassium permanganate and tetraethylammonium chloride with mismatched bases and a simple mutation detection protocol,Nucleic Acids Research, vol. 27, No. 8, 1866-1874 (1999).
Landegren et al.: A ligase-mediated gene detection technique. Science. Aug. 26, 1988;241(4869):1077-80.
Lang et al.: An automated two-dimensional optical force clamp for single molecule studies, Biophysical Journal, vol. 83, 491-501 (Jul. 2002).
Lashkari et al.: An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis. Proc Natl Acad Sci USA. Aug. 15, 1995;92(17):7912-5.
Lausted et al.: POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer, Genome Biology, 5:R58, 17 pages, 2004. available at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC507883/.
Leamon et al.: A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions. Electrophoresis. Nov. 2003;24(21):3769-77.
Lee et al.: Microelectromagnets for the control of magnetic nanoparticles, Appl. Phys. Lett., vol. 79, No. 20, 3308-3310 (Nov. 12, 2001).
Lee et al.: A microfluidic oligonucleotide synthesizer. Nucleic Acids Research 2010 vol. 38(8):2514-2521. DOI: 10.1093/nar/gkq092.
Lee: Covalent End-Immobilization of Oligonucleotides onto Solid Surfaces; Thesis, Massachusetts Institute of Technology, Aug. 2001 (315 pages).
Leproust et al.: Agilent's Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements. 2008; 1-12. http://www.miltenyibiotec.com/˜/media/Files/Navigation/Genomic%20Services/Agilent_DNA_Microarray_Platform.ashx.
Leproust et al.: Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 2010; 38(8):2522-2540.
Lesnikowski et al.: Nucleic acids and nucleosides containing carboranes. J. Organometallic Chem. 1999; 581:156-169.
Leumann. DNA analogues: from supramolecular principles to biological properties. Bioorg Med Chem. Apr. 2002;10(4):841-54.
Levene et al.: Zero-mode waveguides for single-molecule analysis at high concentrations. Science. Jan. 31, 2003;299(5607):682-6.
Lewontin and Harti. Population genetics in forensic DNA typing. Science, 254:1745-1750, 1991.
Li et al.: Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction. ChemBioChem 19:221-228 (2018).
Li et al.: Beating bias in the directed evolution of proteins: Combining high-fidelity on-chip solidphase gene synthesis with efficient gene assembly for combinatorial library construction. First published Nov. 24, 2017, 2 pages, retrieved from: https://doi.org/10.1002/cbic.201700540.
Light source unit for printable patterning VUV-Aligner / USHIO Inc., Link here: https://www.ushio.co.jp/en/products/1005.html, published Apr. 25, 2016, printed from the internet on Aug. 2, 2016, 3 pages.
Limbachiya et al.: Natural data storage: A review on sending information from now to then via Nature. ACM Journal on Emerging Technologies in Computing Systems, V(N):Article A, May 19, 2015, 17 pages.
Link Technologies. Product Guide 2010. Nov. 27, 2009, 136 pages. XP055353191. Retrieved from the Internet: URL:http://www.linktech.co.uk/documents/517/517.pdf.
Lipshutz et al.: High density synthetic oligonucleotide arrays, Nature Genetics Supplement, vol. 21, 20-24 (Jan. 1999).
Lishanski et al.: Mutation detection by mismatch binding protein, MutS, in amplified DNA: application to the cystic fibrosis gene, Proc. Natl. Acad. Sci. USA, vol. 91, 2674-2678 (Mar. 1994).
Liu et al.: Comparison of Next-Generation Sequencing Systems. J Biomed Biotechnol 2012: 251364(2012).
Liu et al.: Rational design of CXCR4 specific antibodies with elongated CDRs. JACS, 136:10557-10560, 2014.
Liu et al.: Enhanced Signals and Fast Nucleic Acid Hybridization By Microfluidic Chaotic Mixing. Angew. Chem. Int. Ed. 2006; 45:3618-3623.
Lizardi et al.: Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. Jul. 1998;19(3):225-32.
Li et al.: Functional domains in Fok I restriction endonuclease, Proc. Natl. Acad. Sci. USA, 89:4275-4279, 1992.
Lu et al.: Methyl-directed repair of DNA base-pair mismatches in vitro, Proc. Natl. Acad. Sci. USA, 80:4639-4643, 1983.
Lund et al.: A validated system for ligation-free uracilexcision based assembly of expression vectors for mammalian cell engineering. DTU Systems of Biology. 2011. 1 page. http://www.lepublicsystemepco.com/files/modules/gestion_rubriques/REF-B036-Lund_Anne%20Mathilde.pdf.
Ma et al.: Versatile surface functionalization of cyclic olefin copolymer (COC) with sputtered SiO2 thin film for potential BioMEMS applications. Journal of Materials Chemistry, 11 pages, 2009.
Ma et al.: DNA synthesis, assembly and application in synthetic biology. Current Opinion in Chemical Biology. 16:260-267, 2012.
Mahato et al.: Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA Expert Opin. Drug Delivery, 2(1):3-28, 2005.
Malecek et al.: Engineering improved T cell receptors using an alanine-scan guided T cell display selection system. Journal of Immunological Methods. Elsevier Science Publishers. 392(1):1-11 (2013).
Margulies et al.: Genome sequencing in open microfabricated high-density picolitre reactors. Nature. 437(7057):376-80, 2005.
Martinez-Torrecuadrada et al.: Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies Inhibits Bladder Carcinoma Cell Line Proliferation; Clinical Cancer Research; vol. 11; pp. 6282-6290 (2005).
Matteucci et al.: Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103(11):3185-3191, 1981.
Matzas et al.: Next generation gene synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device. Nat. Biotechnol., 28(12):1291-1294, 2010.
Mazor et al.: Isolation of Full-Length IgG Antibodies from Combinatorial Libraries Expressed in Escherichia coli; Antony S. Dimitrov (ed.), Therapeutic Antibodies: Methods and Protocols, vol. 525, Chapter 11, pp. 217-239 (2009).
McBride & Caruthers. An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides. Tetrahedron Lett. 24: 245-248, 1983.
McGall et al.: Light-directed synthesis of high-density oligonucleotide arrays using semiconductor photoresists. Proc Natl Acad Sci USA. 93(24):13555-60, 1996.
McGall et al.: The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 119(22):5081-5090, 1997.
Mei et al.: Cell-free protein synthesis in microfluidic array devices Biotechnol. Prog., 23(6):1305-1311, 2007.
Mendel-Hartvig. Padlock probes and rolling circle amplification. New possibilities for sensitive gene detection. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1175. Uppsala University. 2002, 39 pages, http://www.diva-portal.org/smash/get/diva2:161926/FULLTEXT01.pdf.
Meyers and Friedland. Knowledge-based simulation of genetic regulation in bacteriophage lambda. Nucl. Acids Research, 12(1):1-16, 1984.
Meynert et al.: Quantifying single nucleotide variant detection sensitivity in exome sequencing. BMC Bioinformatics 14:195 (2013).
Meynert et al.: Variant detection sensitivity and biases in whole genome and exome sequencing. BMC Bioinformatics 15:247 (2014).
Milo and Phillips. Numbers here reflect the number of protein coding genes and excludes tRNA and non-coding RNA. Cell Biology by the Numbers, p. 286, 2015.
Mitra et al.: In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. 27(24):e34, 1999.
Morin et al.: Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques, 45:81-94, 2008.
Morris and Stauss. Optimizing T-cell receptor gene therapy for hematologic malignancies. Blood, 127(26):3305-3311, 2016.
Muller et al.: Protection and labelling of thymidine by a fluorescent photolabile group, Helvetica Chimica Acta, vol. 84, 3735-3741 (2001).
Mulligan. Commercial Gene Synthesis Technology PowerPoint presentation. BlueHeron® Biotechnology. Apr. 5, 2006 (48 pgs).
Nakatani et al.: Recognition of a single guanine bulge by 2-Acylamino-1 ,8-naphthyridine, J. Am. Chem. Soc., vol. 122, 2172-2177 (2000).
Neiman M.S.: Negentropy principle in information processing systems. Radiotekhnika, 1966, No. 11, p. 2-9.
Neiman M.S.: On the bases of the theory of information retrieval. Radiotekhnika, 1967, No. 5, p. 2-10.
Neiman M.S.: On the molecular memory systems and the directed mutations. Radiotekhnika, 1965, No. 6, pp. 1-8.
Neiman M.S.: On the relationships between the reliability, performance and degree of microminiaturization at the molecular-atomic level. Radiotekhnika, 1965, No. 1, pp. 1-9.
Neiman M.S.: Some fundamental issues of microminiaturization. Radiotekhnika, 1964, No. 1, pp. 3-12.
Nishikura. A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst Cell, 107:415-418, 2001.
Nour-Eldin et al.: USER Cloning and USER Fusion: The Ideal Cloning Techniques for Small and Big Laboratories. Plant Secondary Metabolism Engineering. Methods in Molecular Biology vol. 643, 2010, pp. 185-200.
Ochman et al.: Genetic applications of an inverse polymerase chain reaction. Genetics. Nov. 1988;120(3):621-3.
Organick et al.: Random access in large-scale DNA data storage. Nature Biotechnology, Advance Online Publication, 8 pages, 2018.
Organick et al.: Scaling up DNA data storage and random access retrieval, bioRxiv, preprint first posted online Mar. 7, 2017, 14 pages.
Pan et al.: An approach for global scanning of single nucleotide variations. Proc Natl Acad Sci USA. Jul. 9, 2002;99(14):9346-51.
Pankiewicz. Fluorinated nucleosides. Carbohydr Res. Jul. 10, 2000;327(1-2):87-105.
Paul et al.: Acid binding and detritylation during oligonucleotide synthesis. Nucleic Acids Research. 15. pp. 3048-3052 (1996).
PCT/IL2012/000326 International Preliminary Report on Patentability dated Dec. 5, 2013.
PCT/IL2012/000326 International Search Report dated Jan. 29, 2013.
PCT/US2014/049834 International Preliminary Report on Patentability dated Feb. 18, 2016.
PCT/US2014/049834 International Search Report and Written Opinion dated Mar. 19, 2015.
PCT/US2014/049834, Invitation to Pay Additional Fees and, where applicable, protest fee, dated Jan. 5, 2015.
PCT/US2015/043605 International Preliminary Report on Patentability dated Feb. 16, 2017.
PCT/US2015/043605 International Search Report and Written Opinion dated Jan. 6, 2016.
PCT/US2015/043605 Invitation To Pay Additional Fees dated Oct. 28, 2015.
PCT/US2016/016459 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016459 International Search Report and Written Opinion dated Apr. 13, 2016.
PCT/US2016/016636 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016636 International Search Report and Written Opinion dated May 2, 2016.
PCT/US2016/028699 International Preliminary Report on Patentability dated Nov. 2, 2017.
PCT/US2016/028699 International Search Report and Written Opinion dated Jul. 29, 2016.
PCT/US2016/031674 International Preliminary Report on Patentability dated Nov. 23, 2017.
PCT/US2016/031674 International Search Report and Written Opinion dated Aug. 11, 2016.
PCT/US2016/052336 International Preliminary Report on Patentability dated Mar. 29, 2018.
PCT/US2016/052336 International Search Report and Written Opinion dated Dec. 7, 2016.
PCT/US2016/052916 International Preliminary Report on Patentability dated Apr. 5, 2018.
PCT/US2016/052916 International Search Report and Written Opinion dated Dec. 30, 2016.
PCT/US2016/064270 International Preliminary Report on Patentability dated Jun. 14, 2018.
PCT/US2016/064270 International Search Report and Written Opinion dated Apr. 28, 2017.
PCT/US2017/026232 International Search Report and Written Opinion dated Aug. 28, 2017.
PCT/US2017/036868 International Search Report and Written Opinion dated Aug. 11, 2017.
PCT/US2017/045105 International Search Report and Written Opinion dated Oct. 20, 2017.
PCT/US2017/052305 International Search Report and Written Opinion dated Feb. 2, 2018.
PCT/US2017/062391 International Search Report and Written Opinion dated Mar. 28, 2018.
PCT/US2017/066847 International Search Report and Written Opinion dated May 4, 2018.
PCT/US2018/022487 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/022493 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/037152 International Preliminary Report on Patentability dated Dec. 26, 2019.
PCT/US2018/037152 International Search Report and Written Opinion dated Aug. 28, 2018.
PCT/US2018/037161 International Preliminary Report on Patentability dated Dec. 17, 2019.
PCT/US2018/037161 International Search Report and Written Opinion dated Oct. 22, 2018.
PCT/US2018/037161 Invitation to Pay Additional Fees dated Aug. 27, 2018.
PCT/US2018/050511 International Preliminary Report on Patentability dated Mar. 26, 2020.
PCT/US2018/056783 International Preliminary Report on Patentability dated Apr. 30, 2020.
PCT/US2018/056783 International Search Report and Written Opinion of the International Searching Authority dated Dec. 20, 2018.
PCT/US2018/057857 International Preliminary Report on Patentability dated Apr. 28, 2020.
PCT/US2018/19268 International Search Report and Written Opinion dated Jun. 26, 2018.
PCT/US2018/19268 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 2, 2018.
PCT/US2018/22487 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
PCT/US2018/22493 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
PCT/US2019/012218 International Preliminary Report on Patentability dated Jul. 16, 2020.
PCT/US2019/068435 International International Search Report and Written Opinion dated Apr. 23, 2020.
PCT/US2020/019371 Search Report and Written Opinion dated Jun. 25, 2020.
PCT/US2020/019986 Invitation to Pay Additional Fees dated Jun. 5, 2020.
PCT/US2020/019988 Invitation to Pay Additional Fees dated Jun. 8, 2020.
Pease et al.: Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad Sci USA. May 24, 1994;91(11):5022-6.
Peisajovich et al.: BBF RFC 28: A method for combinatorial multi-part assembly based on the type-lis restriction enzyme aarl. Sep. 16, 2009, 7 pages.
Pellois et al.: Individually addressable parallel peptide synthesis on microchips, Nature Biotechnology, vol. 20, 922-926 (Sep. 2002).
Petersen et al.: LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. Feb. 2003;21(2):74-81.
Pierce and Wangh. Linear-after-the-exponential polymerase chain reaction and allied technologies Real-time detection strategies for rapid, reliable diagnosis from single cells Methods Mol. Med. 132:65-85 (2007) (Abstract only).
Pierce et al.: Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. Methods Mol Med. 2007;132:65-85.
Pirrung. How to make a DNA chip. Angew. Chem. Int. Ed., 41:1276-1289, 2002.
Plesa et al.: Multiplexed gene synthesis in emulsions for exploring protein functional landscapes. Science, 10.1126/science.aao5167, 10 pages, 2018.
Pon. Solid-phase supports for oligonucleotide synthesis. Methods Mol Biol. 1993;20:465-96.
Poster. Reimagine Genome Scale Research. 2016, 1 page. Available at http://www2.twistbioscience.com/Oligo_Pools_CRISPR_poster.
Powers et al.: Optimal strategies for the chemical and enzymatic synthesis of bihelical deoxyribonucleic acids. J Am Chem Soc., 97(4):875-884, 1975.
Pray. Discovery of DNA Structure and Function: Watson and Crick, Nature Education, 2008, 6 pages, available at: http://www.nature.com/scitable/topicpage/discovery-of-dna-structure-and-function-watson-397.
Prodromou et al.: Recursive PCR: a novel technique for total gene synthesis. Protein Eng. Dec. 1992;5(8):827-9.
PubChem Data Sheet Acetonitrile. Printed from website https://pubchem.ncbi.nlm.nig.gov/ pp. 1-124(2020).
PubChem Data Sheet Methylene Chloride. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-140 (2020).
Puigbo. Optimizer: a web server for optimizing the codon usage of DNA sequences. Nucleic Acid Research, 35(14):126-131, 2007.
Qian and Winfree. Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332(6034):196-1201, 2011.
Qian, et al.: Neural network computation with DNA strand displacement cascades, Nature, 475(7356):368-372, 2011.
Quan et al.: Parallel on-chip gene synthesis and application to optimization of protein expression, Nature Biotechnology, 29(5):449-452, 2011.
Rafalski and Morgante. Corn and humans: recombination and linkage disequilibrium in two genomes of similar size. Trends in Genetics, 20(2):103-111, 2004.
Raje and Murma. A Review of electrohydrodynamic-inkjet printing technology. International Journal of Emerging Technology and Advanced Engineering, 4(5):174-183, 2014.
Rajpal et al.: A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc. Natl. Acad. Sci. 102(24):8466-8471 (2005).
Rastegari et al.: XNOR-Net: ImageNet Classification Using Binary Convolutional Neural Networks, in ECCV 2016, Part IV, LNCS 9908, p. 525-542, 2016.
Reimagine SequenceSpace, Reimagine Research, Twist Bioscience, Product Brochure, Published Apr. 6, 2016 online at: www2.twistbioscience.com/TB_Product_Brochure_04.2016, 8 pages.
RF Electric discharge type excimer lamp. Products Catalog. Excimer lamp light source flat excimer, 16 pages dated Jan. 2016. From: http://www.hamamatsu.com/jp/en/product/category/1001/3026/index.html.
Richmond et al.: Amplification and assembly ofchip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Res. Sep. 24, 2004;32(17):5011-8. Print 2004.
Roche. Restriction Enzymes from Roche Applied Science—A Tradition of Premium Quality and Scientific Support. FAQS and Ordering Guide. Roche Applied Science. Accessed Jan. 12, 2015, 37 pages.
Rogozin et al.: Origin and evolution of spliceosomal introns. Biology Direct, 7:11, 2012.
Ruminy et al.: Long-range identification of hepatocyte nuclear factor-3 (FoxA) high and low-affinity binding Sites with a chimeric nuclease, J. Mol. Bioi., vol. 310, 523-535 (2001).
Saaem et al.: In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate ACS Applied Materials & Interfaces, 2(2):491-497, 2010.
Saboulard et al.: High-throughput site-directed mutagenesis using oligonucleotides synthesized on DNA chips. Biotechniques. Sep. 2005;39(3):363-8.
Sacconi et al.: Three-dimensional magneto-optic trap for micro-object manipulation, Optics Letters, vol. 26, No. 17, 1359-1361 (Sep. 1, 2001).
Saiki et al.: Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allelespecific oligonucleotide probes. Nature 324:163-166 (1986).
Sandhu et al.: Dual asymmetric PCR: one-step construction of synthetic genes. Biotechniques. Jan. 1992;12(1):14-6.
Sargolzaei et al.: Extent of linkage disequilibrium in Holstein cattle in North America. J.Dairy Science, 91:2106-2117, 2007.
Schaller et al.: Studies on Polynucleotides. XXV.1 The Stepwise Synthesis of Specific Deoxyribopolynucleotides (5). Further Studies on the Synthesis of Internucleotide Bond by the Carbodiimide Method. The Synthesis of Suitably Protected Dinucleotides as Intermediates in the Synthesis of Higher Oligonucleotides. J. Am. Chem. Soc. 1963; 85(23):3828-3835.
Schmalzing et al.: Microchip electrophoresis: a method for high-speed SNP detection. Nucleic Acids Res 28(9):E43 (2000).
Schmitt et al.: New strategies in engineering T-cell receptor gene-modified T cells to more effectively target malignancies. Clinical Cancer Research, 21(23):5191-5197, 2015.
Seelig et al.: Enzyme-Free Nucleic Acid Logic Circuits, Science 314(5805):1585-1588, 2006.
Sharan et al.: Recombineering: a homologous recombination-based method of genetic engineering. Nat Profile 4(2):1-37 (originally pp. 206-223) (2009).
Sharpe and Mount. Genetically modified T cells in cancer therapy: opportunities and challenges. Disease Models and Mechanisms, 8:337-350, 2015.
Sierzchala et al.: Solid-phase oligodeoxynucleotide synthesis : a two-step cycle using peroxy anion deprotection, J. Am. Chem. Soc., vol. 125, No. 44, 13427-13441 (2003).
Simonyan and Zisserman. Very Deep Convolutional Networks for Large-Scale Image Recognition, Published as a conference paper at Int. Conf. Learn. Represent., pp. 1-14, 2015.
Singh-Gasson et al.: Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array, Nature Biotechnology, vol. 17, 974-978 (Oct. 1999).
Skerra. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. Jul. 25, 1992; 20(14):3551-4.
Smith et al.: Removal of Polymerase-Produced mutant sequences from PCR products, Proc. Natl. Acad. Sci. USA, vol. 94, 6847-6850 (Jun. 1997).
Smith et al.: Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci USA. Dec. 23, 2003;100(26):15440-5. Epub Dec. 2, 2003.
Smith et al.: Generation of cohesive ends on PCR products by UDG-mediated excision of dU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl. May 1993;2(4):328-32.
Smith et al.: Mutation detection with MutH, MutL, and MutS mismatch repair proteins, Proc. Natl. Acad. Sci. USA, vol. 93, 4374-4379 (Apr. 1996).
Smith et al.: Direct mechanical measurements of the elasticity of single DNA molecules using magnetic beads, Science, vol. 258, 1122-1126 (Nov. 13, 1992).
Solomon et al.: Genomics at Agilent: Driving Value in DNA Sequencing.https://www.agilent.com/labs/features/2010_genomics.html, 8 pages (Aug. 5, 2010).
Soni et al.: Progress toward ultrafast DNA sequencing using solid-state nanopores. Clin Chem. Nov. 2007;53(11):1996-2001. Epub Sep. 21, 2007.
Southern et al.: Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics. Aug. 1992;13(4):1008-17.
Sproat et al.: An efficient method for the isolation and purification of oligoribonucleotides. Nucleosides & Nucleotides. 1995; 14(1&2):255-273.
Srivannavit et al.: Design and fabrication of microwell array chips for a solution-based, photogenerated acid-catalyzed parallel oligonuclotide DNA synthesis. Sensors and Actuators A, 116:150-160, 2004.
Srivastava et al.: RNA synthesis: phosphoramidites for RNA synthesis in the reverse direction. Highly efficient synthesis and application to convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end, Nucleic Acids Symposium Series, 52(1):103-104, 2008.
Steel. The Flow-Thru Chip A Three-dimensional biochip platform. In: Schena, Microarray Biochip Technology, Chapter 5, Natick, MA: Eaton Publishing, 2000, 33 pages.
Stemmer et al.: Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. Oct. 16, 1995;164(1):49-53.
Stryer. DNA Probes and genes can be synthesized by automated solid-phase methods. Biochemistry, 3rd edition, New York: W.H. Freeman and Company, 1988; 123-125.
Stutz et al.: Novel fluoride-labile nucleobase-protecting groups for the synthesis of 3′(2′)-0-amino-acylated RNA sequences. Helv. Chim. Acta. 2000; 83(9):2477-2503.
Sullivan et al.: Library construction and evaluation for site saturation mutagenesis. Enzyme Microb. Technol. 53:70-77 (2013).
Sun et al.: Structure-Guided Triple-Code Saturation Mutagenesis: Efficient Tuning of the Stereoselectivity of an Epoxide Hydrolase. ACS Catal. 6:1590-1597 (2016).
Takahashi. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers. Biotechniques. Jul. 2009;47(1):609-15. doi: 10.2144/000113155.
Tanase et al.: Magnetic trapping of multicomponent nanowires, The Johns Hopkins University, Baltimore, Maryland, p. 1-3 (Jun. 25, 2001).
Taylor et al.: Impact of surface chemistry and blocking strategies on DNA microarrays. Nucleic Acids Research, 31(16):e87, 19 pages, 2003.
The Hood Laboratory, Beta Group. Assembly Manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, Inkjet Microarrayer Manual Version 1.2, 50 pages, May 28, 2004.
The SLIC. Gibson, CPEC and SLiCE assembly methods (and GeneArt Seamless, In-Fusion Cloning). 5 pages, available online Sep. 2, 2010.
Tian et al.: Accurate multiplex gene synthesis from programmable DNA microchips. Nature. Dec. 23, 2004;432(7020):1050-4.
Tsai et al.: Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing Nat. Biotechnol., 32(6):569-576, 2014.
Twist Bioscience | White Paper. DNA-Based Digital Storage. Retrieved from the internet, Twistbioscience.com, Mar. 27, 2018, 5 pages.
U.S. Appl. No. 14/241,874 Final Office Action dated Jan. 28, 2019.
U.S. Appl. No. 14/241,874 Office Action dated Feb. 27, 2017.
U.S. Appl. No. 14/241,874 Office Action dated Jul. 14, 2016.
U.S. Appl. No. 14/241,874 Office Action dated May 4, 2018.
U.S. Appl. No. 14/452,429 Notice of Allowance dated Jun. 7, 2016.
U.S. Appl. No. 14/452,429 Office Action dated Oct. 21, 2015.
U.S. Appl. No. 14/452,429 Restriction Requirement dated Dec. 12, 2014.
U.S. Appl. No. 14/885,962 Notice of Allowance dated Nov. 8, 2017 and Sep. 29, 2017.
U.S. Appl. No. 14/885,962 Office Action dated Dec. 16, 2016.
U.S. Appl. No. 14/885,962 Office Action dated Sep. 8, 2016.
U.S. Appl. No. 14/885,962 Restriction Requirement dated Mar. 1, 2016.
U.S. Appl. No. 14/885,963 Notice of Allowance dated May 24, 2016.
U.S. Appl. No. 14/885,963 Office Action dated Feb. 5, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 28, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 30, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 10, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 18, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Jan. 4, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Jul. 7, 2016.
U.S. Appl. No. 15/015,059 Final Office Action dated Jul. 17, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Aug. 19, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Feb. 7, 2019.
U.S. Appl. No. 15/135,434 Notice of Allowance dated Feb. 9, 2018.
U.S. Appl. No. 15/135,434 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/135,434 Restriction Requirement dated Jul. 12, 2017.
U.S. Appl. No. 15/151,316 Final Office Action dated Jul. 9, 2020.
U.S. Appl. No. 15/151,316 Office Action dated Jun. 7, 2018.
U.S. Appl. No. 15/151,316 Office Action dated Oct. 4, 2019.
U.S. Appl. No. 15/151,316 Final Office Action dated Feb. 21, 2019.
U.S. Appl. No. 15/154,879 Notice of Allowance dated Feb. 1, 2017.
U.S. Appl. No. 15/156,134 Final Office Action dated Jan. 3, 2020.
U.S. Appl. No. 15/156,134 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/187,714 Final Office Action dated Sep. 17, 2019.
U.S. Appl. No. 15/187,714 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/187,714 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/187,721 Notice of Allowance dated Dec. 7, 2016.
U.S. Appl. No. 15/187,721 Office Action dated Oct. 14, 2016.
U.S. Appl. No. 15/233,835 Notice of Allowance dated Oct. 4, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Feb. 8, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Jul. 26, 2017.
U.S. Appl. No. 15/233,835 Restriction Requirement dated Nov. 4, 2016.
U.S. Appl. No. 15/245,054 Office Action dated Mar. 21, 2017.
U.S. Appl. No. 15/245,054 Office Action dated Oct. 19, 2016.
U.S. Appl. No. 15/268,422 Final Office Action dated Oct. 3, 2019.
U.S. Appl. No. 15/268,422 Office Action dated Mar. 1, 2019.
U.S. Appl. No. 15/268,422 Restriction Requirement dated Oct. 4, 2018.
U.S. Appl. No. 15/272,004 Office Action dated Jun. 12, 2020.
U.S. Appl. No. 15/377,547 Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/377,547 Office Action dated Jul. 27, 2018.
U.S. Appl. No. 15/377,547 Office Action dated Mar. 24, 2017.
U.S. Appl. No. 15/377,547 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/433,909 Non-Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/433,909 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/602,991 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/602,991 Notice of Allowance dated Oct. 25, 2017.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2018.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2019.
U.S. Appl. No. 15/602,991 Office Action dated Sep. 21, 2017.
U.S. Appl. No. 15/603,013 Final Office Action dated Nov. 6, 2019.
U.S. Appl. No. 15/603,013 Office Action dated Jan. 30, 2018.
U.S. Appl. No. 15/603,013 Office Action dated Jul. 10, 2018.
U.S. Appl. No. 15/603,013 Office Action dated Oct. 20, 2017.
U.S. Appl. No. 15/619,322 Final Office Action dated Mar. 30, 2020.
U.S. Appl. No. 15/619,322 Office Action dated Aug. 14, 2019.
U.S. Appl. No. 15/682,100 Office Action dated Jan. 2, 2018.
U.S. Appl. No. 15/682,100 Restriction Requirement dated Nov. 8, 2017.
U.S. Appl. No. 15/709,274 Notice of Allowance dated Apr. 3, 2019.
U.S. Appl. No. 15/729,564 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jan. 8, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jun. 6, 2018.
U.S. Appl. No. 15/729,564 Office Action dated May 30, 2019.
U.S. Appl. No. 15/816,995 Office Action dated May 19, 2020.
U.S. Appl. No. 15/816,995 Office Action dated Sep. 20, 2019.
U.S. Appl. No. 15/816,995 Restriction Requirement dated Apr. 4, 2019.
U.S. Appl. No. 15/835,342 Office Action dated Dec. 2, 2019.
U.S. Appl. No. 15/835,342 Restriction Requirement dated Sep. 10, 2019.
U.S. Appl. No. 15/844,395 Office Action dated Jan. 24, 2020.
U.S. Appl. No. 15/844,395 Restriction Requirement dated May 17, 2019.
U.S. Appl. No. 15/860,445 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/860,445 Office Action dated May 30, 2018.
U.S. Appl. No. 15/921,479 Final Office Action dated Jun. 15, 2020.
U.S. Appl. No. 15/921,479 Office Action dated Nov. 12, 2019.
U.S. Appl. No. 15/921,479 Restriction Requirement dated May 24, 2019.
U.S. Appl. No. 15/921,537 Office Action dated Apr. 1, 2020.
U.S. Appl. No. 15/960,319 Office Action dated Aug. 16, 2019.
U.S. Appl. No. 15/991,992 Office Action dated May 21, 2020.
U.S. Appl. No. 15/991,992 Restriction Requirement dated Mar. 10, 2020.
U.S. Appl. No. 16/006,581 Office Action dated Sep. 25, 2019.
U.S. Appl. No. 16/031,784 Office Action dated May 12, 2020.
U.S. Appl. No. 16/039,256 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/128,372 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/165,952 Office Action dated Mar. 12, 2020.
U.S. Appl. No. 16/239,453 Office Action dated May 11, 2020.
U.S. Appl. No. 16/239,453 Office Action dated Nov. 7, 2019.
U.S. Appl. No. 16/384,678 Office Action dated Jan. 21, 2020.
U.S. Appl. No. 16/409,608 Office Action dated Sep. 9, 2019.
U.S. Appl. No. 16/530,717 Final Office Action dated Apr. 15, 2020.
U.S. Appl. No. 16/530,717 Office Action dated Sep. 6, 2019.
U.S. Appl. No. 16/535,777 Office Action dated Jan. 23, 2020.
U.S. Appl. No. 16/535,779 First Action Interview dated Feb. 10, 2020.
U.S. Appl. No. 14/452,429 Office Action dated Apr. 9, 2015.
U.S. Appl. No. 15/603,013 Office Action dated Jun. 26, 2019.
Unger et al.: Monolithic microfabricated valves and pumps by multilayer soft lithography. Science. Apr. 7, 2000;288(5463):113-6.
Vaijayanthi et al.: Recent advances in oligonucleotide synthesis and their applications. Indian J Biochem Biophys. Dec. 2003;40(6):377-91.
Van Den Brulle et al.: A novel solid phase technology for high-throughput gene synthesis. Biotechniques. 2008; 45(3):340-343.
Van Der Werf et al.: Limonene-1,2-epoxide hydrolase from Rhodococcus erythropolis DCL14 belongs to a novel class of epoxide hydrolases. J. Bacteriol. 180:5052-5057 (1998).
Van Tassell et al.: SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries. Nature Methods, 5:247-252, 2008.
Vargeese et al.: Efficient activation of nucleoside phosphoramidites with 4,5-dicyanoimidazole during oligonucleotide synthesis. Nucleic Acids Res. Feb. 15, 1998;26(4):1046-50.
Verma et al.: Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem 67:99-134 (1998).
Vincent et al.: Helicase-dependent isothermal DNA amplification. EMBO Rep. Aug. 2004;5(8):795-800.
Visscher et al.: Construction of multiple-beam optical traps with nanometer-resolution position sensing, IEEE Journal of Selected Topics in Quantum Electronics, vol. 2, No. 4, 1066-1076 (Dec. 1996).
Voldmans et al.: Holding forces of single-particle dielectrophoretic traps. Biophysical Journal, vol. 80, No. 1, 531-541 (Jan. 2001).
Vos et al.: AFLP:A new technique for DNA fingerprinting. Nucleic Acids Res. Nov. 11, 1995;23(21):4407-14.
Wagner et al.: Nucleotides, Part LXV, Synthesis of 2′-Deoxyribonucleoside 5′-Phosphoramidites: New Building Blocks for the Inverse (5′-3′)-Oligonucleotide Approach. Helvetica Chimica Acta, 83(8):2023-2035, 2000.
Wah et al.: Structure of Fok I has implications for DNA cleavage, Proc. Natl. Acad. Sci. USA, vol. 95, 10564-10569 (Sep. 1998).
Wah et al.: Structure of the multimodular endonuclease Fok I bound to DNA, Nature, vol. 388, 97-100 (Jul. 1997).
Walker et al.: Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res. Apr. 11, 1992;20(7):1691-6.
Wan et al.: Deep Learning for Content-Based Image Retrieval: A comprehensive study, in Proceedings of the 22nd ACM International Conference on Multimedia—Nov. 3-7, 2014, Orlando, FL, p. 157-166, 2014.
Warr et al.: Exome Sequencing: current and future perspectives. G3: (Bethesda) 5(8):1543-1550 (2015).
Weber et al.: A modular cloning system for standardized assembly of multigene constructs. PLoS One. Feb. 18, 2011;6(2):e16765. doi: 10.1371/journal.pone.0016765.
Welz et al.: 5-(Benzylmercapto)-1H-tetrazole as activator for 2′-O-TBDMS phosphoramidite building blocks in RNA synthesis. Tetrahedron Lett. 2002; 43(5):795-797.
Westin et al.: Anchored multiplex amplification on a microelectronic chip array Nature Biotechnology, 18:199-202 (2000) (abstract only).
Whitehouse et al.: Analysis of the mismatch and insertion/deletion binding properties of Thermus thermophilus, HB8, MutS, Biochemical and Biophysical Research Communications, vol. 233, 834-837 (1997).
Wiedenheft et al.: RNA-guided genetic silencing systems in bacteria and archaea. Nature 482:331-338 (2012).
Wijshoff. Structure and fluid-dynamics in Piezo inkjet printheads. Thesis. Venio, The Netherlands, published 2008, p. 1-185.
Wirtz. Direct measurement of the transport properties of a single DNA molecule, Physical Review Letters, vol. 75, No. 12, 2436-2439 (Sep. 18, 1995).
Withers-Martinez et al.: PCR-based gene synthesis as an efficient approach for expression of the A+ T-rich malaria genome, Protein Engineering, vol. 12, No. 12, 1113-1120 (1999).
Wood et al.: Human DNA repair genes, Science, vol. 291, 1284-1289 (Feb. 16, 2001).
Wosnick et al.: Rapid construction of large synthetic genes: total chemical synthesis of two different versions of the bovine prochymosin gene. Gene. 1987;60(1):115-27.
Wright and Church. An open-source oligomicroarray standard for human and mouse. Nature Biotechnology, 20:1082-1083, 2002.
Wu et al.: RNA-mediated gene assembly from DNA arrays. Angew Chem Int Ed Engl. May 7, 2012;51 (19):4628-32. doi: 10.1002/anie.201109058.
Wu et al.: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification PLoS ONE. Oct. 20, 2011, vol. 6, No. 10.
Wu et al.: Specificity of the nick-closing activity of bacteriophage T4 DNA ligase. Gene. 1989;76(2):245-54.
Wu et al.: An improvement of the on-line electrophoretic concentration method for capillary electrophoresis of proteins an experimental factors affecting he concentration effect, Analytical Sciences, vol. 16, 329-331 (Mar. 2000).
Xiong et al.: Chemical gene synthesis: Strategies, softwares, error corrections, and applications. FEMS Microbiol. Rev., 32:522-540, 2008.
Xiong et al.: A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucleic Acids Res. 2004, 32(12):e98.
Xiong et al.: Non-polymerase-cycling-assembly-based chemical gene synthesis: Strategies, methods, and progress. Biotechnology Advances. 26(2):121-134, 2008.
Xu et al.: Design of 240,000 orthogonal 25mer DNA barcode probes. PNAS, 106(7):2289-2294, 2009.
Yang et al.: Purification, cloning, and characterization of the CEL I nuclease, Biochemistry, 39(13):3533-35, 2000.
Yazdi et al.: A Rewritable, Random-Access DNA-Based Storage System, Scientific Reports, 5, Article No. 14138, 27 pages, 2015.
Yehezkel et al.: De novo DNA synthesis using single molecule PCR Nucleic Acids Research, 36(17):e107, 2008.
Yes HMDS vapor prime process application note Prepared by UC Berkeley and University of Texas at Dallas and re-printed by Yield Engineering Systems, Inc., 6 pages (http://www.yieldengineering.eom/Portals/0/HMDS%20Application%20Note.pdf (Published online Aug. 23, 2013).
Youil et al.: Detection of 81 of 81 known mouse Beta-Globin promoter mutations with T4 Endonuclease VII⋅ The EMC Method. Genomics, 32:431-435, 1996.
Young et al.: Two-step total gene synthesis method. Nucleic Acids Res. 32(7):e59, 2004.
Zhang and Seelig. Dynamic DNA nanotechnology using strand-displacement reactions, Nat. Chem., 3(2):103-113, 2011.
Zheleznaya et al.: Nicking endonucleases. Biochemistry (Mosc). 74(13):1457-66, 2009.
Zheng et al.: Manipulating the Stereoselectivity of Limonene Epoxide Hydrolase by Directed Evolution Based on Iterative Saturation Mutagenesis. J. Am. Chem. Soc. 132:15744-15751 (2010).
Zhirnov et al.: Nucleic acid memory. Nature Materials, 15:366, 2016.
Zhou et al.: Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences Nucleic Acids Research, 32(18):5409-5417, 2004.
Zhou et al.: Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane Scientific Reports May 9, 2014, vol. 4, No. 4912.
Cui et al.: Information Security Technology Based on DNA Computing. International Workshop on Anti-Counterfeiting, Security and Identification (ASID); IEEE Xplore 4 pages (2007).
Goodwin et al.: immunoglobulin heavy chain variable region, partial [Homo sapiens], Genbank entry (online). National Institute of Biotechnology Information. (2018) https://www.ncbi.nim.nih.gov/protein/AXA12486.1.
Hopcroft et al.: What is the Young's Modulus of Silicon?. Journal of Microelectromechanical Systems. 19(2):229-238 (2010).
Jaiswal et al.: An architecture for creating collaborative semantically capable scientific data sharing infrastructures. Proceeding WIDM '06 Proceedings of the 8th annual ACM international workshop on Web information and data management. ACM Digital Library pp. 75-82 (2006).
(Novartis Institutes for Biomedical Research) Immunoglobulin Heavy Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1ttps://https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1.
(Novartis Institutes for Biomedical Research) Immunoglobulin Lambda Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1.
PCT/US2020/019986 International Search Report and Written Opinion dated Jul. 29, 2020.
PCT/US2020/019988 International Search Report and Written Opinion dated Jul. 29, 2020.
U.S. Appl. No. 15/835,342 Final Office Action dated Sep. 8, 2020.
U.S. Appl. No. 16/039,256 Office Action dated Aug. 20, 2020.
van der Velde: Thesis. Finding the Strength of Glass. Delft University of Technology. 1-16 (2015).
Agbavwe et al.: Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. Journal of Nanobiotechnology. 9(57):1-17 (2011).
Altshuler et al.: Generation of Recombinant Antibodies and Means for Increasing Their Affinity. Biochemistry (Moscow). 75(13:1584-1605 (2010).
Bai. A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity. PLoS One. 10(10):1-18(2015).
BERG: Biochemistry. 5th ED. New York (2002) 148-149.
Borda et al.: Secret writing by DNA hybridization. Acta Technica Napocensis Electronics and Telecommunications. 50(2):21-24 (2009).
Damha et al.: An improved procedure forderivatization of controlled-pore glass beads for solidphase oligonucleotide synthesis. Nucleic Acids Research. 18(13):3813-3821 (1990).
De Graff et al.: Glucagon-Like Peptide-1 and its Class B G Protein-Coupled Receptors: A Long March to Therapeutic Successes. Pharmacol Rev. 68(4):954-1013 (2016).
Diehl et al.: BEAMING: single-molecule PCR on microparticles in water-in-oil emulsions. Nature Methods. 3(7):551-559 (2006).
Fernández-Quintero et al.: Characterizing the Diversity of the CDR-H3 Loop Conformational Ensembles in Relationship to Antibody Binding Properties. Front. Immunol. 9:1-11 (2019).
GE Healthcare. AKTA oligopilot plus. Data File 18-114-66 ADC. 8 pages (2006).
GE Healthcare. Robust and cost-efficient oligonucleotide synthesis. Application Note 28-4058-08 AA. 4 pages (2005).
Geetha et al.: Survey on Security Mechanisms for Public Cloud Data. 2016 International Conference on Emerging Trends in Engineering, Technology and Science (ICETETS). 8 pages (2016).
Hood et al.: The digital code of DNA. Nature 421.6921:444-448 (2003).
Hudson: Matrix Assisted Synthetic Transformations: A Mosaic of Diverse Contributions. Journal of Combinatorial Chemistry. 1(6):403-457 (1999).
Jang et al.: Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing. Oncoimmunology, 4(11):e1030561:1-10 (2015).
Kalva et al.: Gibson Deletion: a novel application of isothermal in vitro recombination. Biological Procedures Online. 20(1):1-10 (2018).
Kosuri et al.: A scalable gene synthesis platform using high-fidelity DNA microchips Nat.Biotechnol. 28(12):1295-1299 (2010).
Lebl et al.: Economical Parallel Oligonucleotide and Peptide Synthesizer—Pet Oligator. Int. J. Peptide Res. Ther. 13(1-2):367-376 (2007).
Legault-Demare et al.: Studies on Hybrid Molecules of Nucleic Acids. Biochemical and Biophysical Research Communications. 28(4):1-16 (1967).
MLAB 2321 Molecular Diagnostics for Clinical Laboratory Science. Mar. 6, 2015.
MOMENTIV. Technical Data Sheet. Silquest A-1100. Momentiv. 1-6 (2020).
Nucleic acid thermodynamics. Wikipedia. Feb. 4, 2021.
O'Driscoll et al.: Synthetic DNA: The next generation of big data storage. Bioengineered. 4(3):123-125 (2013).
Opposition to European Patent No. 3030682 filed Mar. 3, 2021.
PCT/US2019/032992 International Preliminary Report on Patentability dated Nov. 24, 2020.
PCT/US2019/068435 International Preliminary Report on Patentability dated Jul. 8, 2021.
PCT/US2020/019371 International Preliminary Report on Patentability dated Sep. 2, 2021.
PCT/US2020/019986 International Preliminary Report on Patentability dated Sep. 10, 2021.
PCT/US2020/019988 International Preliminary Report on Patentability dated Sep. 10, 2021.
PCT/US2020/038679 International Search Report and Written Opinion dated Oct. 28, 2020.
PCT/US2020/052291 International Preliminary Report on Patentability dated Apr. 7, 2022.
PCT/US2020/052291 International Search Report and Written Opinion dated Mar. 10, 2021.
PCT/US2020/052291 Invitation to Pay Additional Fees dated Dec. 31, 2020.
PCT/US2020/052306 International Preliminary Report on Patentability dated Mar. 15, 2022.
PCT/US2020/052306 International Search Report and Written Opinion dated Mar. 2, 2021.
PCT/US2020/052306 Invitation to Pay Additional Fees dated Dec. 18, 2020.
PCT/US2020/064106 International Preliminary Report on Patentability dated Jun. 23, 2022.
PCT/US2020/064106 International Search Report and Written Opinion dated Jun. 3, 2021.
PCT/US2020/064106 Invitation to Pay Additional Fees dated Apr. 9, 2021.
PCT/US2022/023936 International Search Report and Written Opinion dated Jul. 14, 2022.
Pigott et al.: The Use of a Novel Discovery Platform to Identify Peptide-Grafted Antibodies that Activate GLP-1 Receptor Signaling. Innovative Targeting Solutions Inc. (2013) XP055327428 retrieved from the internet: http://www.innovativetargeting.com/wo-content/uploads/2013/12/Pigott-et-al-Antibody-Engineering-2013.pdf.
Ponsel. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules. 16:3675-3700 (2011).
PubChem Data Sheet Dichloromethane. Printed from website https://pubchem.ncbi.nlm.nih.gov/compound/Dichloromethane (2020).
Regep et al.: The H3 loop of antibodies shows unique structural characteristics. Proteins. 85(7):1311-1318 (2017).
Shipman et al.: Molecular recordings by directed CRISPR spacer acquisition. Science. 353(6298):1-16 (2016).
Smith et al.: Changing the peptide specificity of a human T-cell receptor by directed evolution. Nature Communications. 5:1-13 (2014).
Sommermeyer et al.: Minimal Amino Acid Exchange in Human TCR Constant Regions Fosters Improved Function of TCR Gene-Modified T Cells. Journal of Immunology. 184:6223-6231 (2010).
U.S. Appl. No. 16/737,401 Final Office Action dated Jun. 13, 2022.
U.S. Appl. No. 15/156,134 Final Office Action dated Aug. 18, 2021.
U.S. Appl. No. 15/156,134 Office Action dated Nov. 25, 2020.
U.S. Appl. No. 15/156,134 Office Action dated Dec. 8, 2022.
U.S. Appl. No. 15/245,054 Notice of Allowance dated Dec. 14, 2017.
U.S. Appl. No. 15/272,004 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 15/272,004 Office Action dated Apr. 13, 2022.
U.S. Appl. No. 15/619,322 Final Office Action dated Jul. 9, 2021.
U.S. Appl. No. 15/619,322 Office Action dated Nov. 10, 2022.
U.S. Appl. No. 15/619,322 Office Action dated Nov. 4, 2020.
U.S. Appl. No. 15/835,342 Office Action dated Apr. 16, 2021.
U.S. Appl. No. 15/835,342 Office Action dated Jun. 17, 2022.
U.S. Appl. No. 15/902,855 Final Office Action dated Aug. 11, 2022.
U.S. Appl. No. 15/902,855 Office Action dated Dec. 9, 2021.
U.S. Appl. No. 15/902,855 Office Action dated Oct. 5, 2022.
U.S. Appl. No. 15/902,855 Restriction Requirement dated Apr. 6, 2021.
U.S. Appl. No. 15/921,479 Final Office Action dated Dec. 20, 2021.
U.S. Appl. No. 15/921,479 Office Action dated Apr. 27, 2021.
U.S. Appl. No. 15/921,479 Office Action dated Apr. 28, 2022.
U.S. Appl. No. 16/039,256 Final Office Action dated Mar. 30, 2021.
U.S. Appl. No. 16/039,256 Office Action dated May 10, 2022.
U.S. Appl. No. 16/128,372 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 16/128,372 Office Action dated Dec. 13, 2021.
U.S. Appl. No. 16/128,372 Office Action dated Oct. 8, 2020.
U.S. Appl. No. 16/384,678 Final Office Action dated Oct. 15, 2020.
U.S. Appl. No. 16/417,023 Final Office Action dated Aug. 2, 2022.
U.S. Appl. No. 16/417,023 Office Action dated Feb. 22, 2022.
U.S. Appl. No. 16/535,777 Final Office Action dated Oct. 20, 2020.
U.S. Appl. No. 16/535,777 Office Action dated Feb. 8, 2021.
U.S. Appl. No. 16/590,301 Office Action dated Dec. 5, 2022.
U.S. Appl. No. 16/590,301 Office Action dated Jul. 20, 2022.
U.S. Appl. No. 16/590,301 Restriction Requirement dated Apr. 28, 2022.
U.S. Appl. No. 16/712,678 Office Action dated Nov. 26, 2021.
U.S. Appl. No. 16/712,678 Restriction Requirement dated Aug. 25, 2021.
U.S. Appl. No. 16/726,073 Office Action dated Jun. 30, 2022.
U.S. Appl. No. 16/737,401 Office Action dated Jan. 5, 2022.
U.S. Appl. No. 16/737,401 Restriction Requirement dated Nov. 15, 2021.
U.S. Appl. No. 16/798,275 Final Office Action dated Aug. 30, 2021.
U.S. Appl. No. 16/798,275 Office Action dated Feb. 10, 2021.
U.S. Appl. No. 16/802,423 Notice of Allowance dated Jul. 25, 2022.
U.S. Appl. No. 16/802,423 Restriction Requirement dated Dec. 29, 2021.
U.S. Appl. No. 16/802,439 Office Action dated Mar. 17, 2022.
U.S. Appl. No. 16/802,439 Restriction Requirement dated Oct. 1, 2021.
U.S. Appl. No. 16/854,719 Office Action dated Jun. 2, 2022.
U.S. Appl. No. 16/854,719 Office Action dated Nov. 24, 2021.
U.S. Appl. No. 16/854,719 Restriction Requirement dated Jul. 28, 2021.
U.S. Appl. No. 16/879,705 Office Action dated Sep. 9, 2021.
U.S. Appl. No. 16/906,555 Office Action dated Aug. 17, 2021.
U.S. Appl. No. 17/154,906 Office Action dated May 17, 2022.
U.S. Appl. No. 17/154,906 Office Action dated Nov. 10, 2021.
U.S. Appl. No. 17/154,906 Restriction Requirement dated Jul. 26, 2021.
U.S. Appl. No. 17/180,614 Office Action dated Oct. 5, 2022.
U.S. Appl. No. 17/578,356 Notice of Allowance dated Dec. 5, 2022.
Wikipedia. Central dogma of molecular biology. URL: https://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology. 9 pages (2021).
Williams et al.: Amplification of complex gene libraries by emulsion PCR. Nature Methods. 3(7):545-550(2006).
Xu et al.: Coordination between the Polymerase and 5 ′-Nuclease Components of DNA Polymerase I of Escherichia coli. The Journal of Biological Chemistry. 275(27):20949-20955 (2000).
Yazdi et al.: DNA-Based Storage: Trends and Methods. IEEE Transactions on Molecular, Biological and Multi-Scale Communications. IEEE. 1(3):230-248 (2016).
Related Publications (1)
Number Date Country
20200330953 A1 Oct 2020 US
Provisional Applications (2)
Number Date Country
62220856 Sep 2015 US
62150795 Apr 2015 US
Continuations (2)
Number Date Country
Parent 15960319 Apr 2018 US
Child 16921712 US
Parent 15135434 Apr 2016 US
Child 15960319 US