Patent Application
20140242609
The Sequence Listing, which is a part of the present disclosure, includes a computer readable form and a written sequence listing comprising nucleotide and/or amino acid sequences. The sequence listing information recorded in computer readable form is identical to the written sequence listing. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.
Nephrolithiasis is a common condition and difficult to cure. For many years, the only therapies for hypercalciuria were diuretics such as thiazide and amiloride. The physiological mechanism of diuretic-induced hypocalciuria is considered secondary to extracellular volume (ECV) depletion and reduced GFR, which increase paracellular Ca++ reabsorption in the proximal tubules. (Nijenhuis, T., et al., 2005)
Three tight junction genes in the kidney, claudin-14, 16 and 19, play a role in calcium imbalance diseases including kidney stones. (Simon, D. B., et al., 1999, Konrad, M., et al., 2006, and Thorleifsson, G., et al., 2009) Autosomal recessive familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC: OMIM #248250), is caused by mutations in the genes claudin-16 (Simon, D. B., et al., 1999) and claudin-19. (Konrad, M., et al., 2006)
The calcimimetic cinacalcet, which reduces serum Ca2+ levels and PTH levels, has been used to treat secondary hyperparathyroidism in chronic kidney disease (CKD) and dialysis patients (Lindberg et al., 2005).
NPS2143 is a Ca++ sensing receptor (CaSR) antagonist (calcilytic) that increases serum Ca2+ level independent of PTH secretion. It is used as a treatment for restoring extracellular Ca2+ levels in primary hypoparathyroidism (Loupy et al., 2012). Renal CaSR in extracellular Ca2+ metabolism has been demonstrated in a kidney specific CaSR KO mouse model (Toka et al., 2012). The kidney CaSR is predominantly expressed in the TALH, co-localizing with claudin-14 (Loupy et al., 2012).
Claudin-14 (CLDN14) plays a role in the physiology of cochlear hair cells in the inner ear (Ben-Yosef et al., 2003). Mutations in CLDN14 have been linked to autosomal recessive nonsyndromic deafness (DFNB29) (Wilcox et al., 2001). Nevertheless, neither hypercalciuria nor nephrolithiasis has been found in human or transgenic knockout animals with these mutations (Wilcox et al., 2001. Ben-Yosef et al., 2003).
Dimke, H., et al., Am J Physiol Renal Physiol. 2013 Mar. 15; 304(6):F761-9 discloses that activation of CaSR increases CLDN14 expression, which in turn blocks the paracellular reabsorption of Ca2+. These authors hypothesize that dysregulation of the CaSR-Cldn14 axis likely contributes to the development of hypercalciuria and kidney stones. While Dimke et al., measures excretion of Ca2+ in urine, there is no mention of measuring CLDN14 in urine.
U.S. Pat. No. 7,426,441 “Methods for Determining Renal Toxins” of Mendrick, D., et al., lists CLDN16 as a marker for kidney injury/malfunction. U.S. Pat. No. 7,186,802, “Claudin Polypeptides” of Youakim, A., et al., discloses claudin polypeptides for ion transport disorders in the kidney, in particularly Claudin-19. Neither U.S. Pat. No. 7,426,441 nor U.S. Pat. No. 7,186,802 mentions CLDN14.
Hou, J., et al., Annu. Rev. Physiol. 75: 16.1-16.23, 2013 describes all claudins-14, -16, and -19 in relation to hyper/hypocalciuria. Toka, H. R., et al., J. Am. Soc. Nephrol. 23:1879-1890, 2012, indicates that loss-of-function mutations in Claudin-16 and Claudin-19 can cause hypercalciuria and nephrocalcinosis in humans. Toka, H. R., et al., states that renal Casr has a PTH-independent role for renal Ca2+ reabsorption that occurs in the TAL accompanied by Claudin14 downregulation, increasing paracellular Ca2+ reabsorption without significantly affecting Mg2+ reabsorption. Additionally, that they did not know if the effects of CaSR on Claudin 14 expression are independently regulated phenomena or if they are biochemically related. Neither Hou, J., et al., nor Toka, H. R., et al., mention measuring CLDN14 in urine or administering a drug to treat kidney stones.
In various embodiments, the present teachings include methods of treating hypercalciuria, nephrolithiasis, and other related disorders in a subject in need thereof. In various embodiments, these methods comprise administering to a subject a therapeutically effective amount of at least one inhibitor of histone deacetylase (HDAC).
Animal studies by the inventors show that HDAC inhibitors only affect the microRNA-CLDN14 pathway in the kidney. In various embodiments, these epigenetic inhibitors can promote positive Ca++ homeostasis at a low dose. In various embodiments, curbing CLDN14 expression can be beneficial to kidney stone patients as an independent factor apart from CLDN14's role in reducing renal Ca++ excretion.
In various embodiments, the present teachings include methods of treating hypercalciuria, nephrolithiasis, and other related disorders in a subject in need thereof. These methods can comprise administering to a subject a therapeutically effective amount of at least one HDAC inhibitor such as trichostatin A (TsA) or suberanilohydroxanmic acid (SAHA; approved by FDA as Vorinostat®) (Marks, P. A. et al., 2007). In some configurations. SAHA can downregulate CLDN14 mRNA levels by 38% at 0.1 μM (p<0.01, n=3 versus vehicle;
In various embodiments, the present teachings include methods of treating, ameliorating, and/or preventing kidney stones. In various embodiments, these methods can comprise, consist essentially of, or consist of administering an antagonist (calcilytic) of Ca++ sensing receptor (CaSR). In some embodiments, the CaSR antagonist can be NPS2143 of structure
Methods of treating a disease such as hyper/hypoparathyroidism, kidney stone, osteoporosis, Alzheimer's disease or epilepsy are also disclosed. In various embodiments, these methods comprise administering an agonist of CaSR or an antagonist of CaSR. In various embodiments, an agonist of CaSR can be a calcimimetic. In some configurations, an agonist of CaSR can be cinacalcet. In various embodiments, an antagonist of CaSR can be NPS2143.
In some embodiments, the present teachings include an antibody against CLDN14, or an antigen-binding portion thereof. In various configurations, the antibody can be a monoclonal antibody, a polyclonal antibody, a single chain antibody such as a camelid antibody, or an antigen binding fragment of an antibody. In some embodiments, the antibody can be directed against the first extracellular loop of CLDN14.
In some embodiments, the present teachings include a method for diagnosing kidney stones. These methods comprise obtaining a sample comprising exosomes, such as urine sample comprising exosomes, from a subject. In various configurations, the subject can have, or can be suspected of having, kidney and/or bladder stones. In these embodiments, the sample can be contacted with an antibody against CLDN14. The presence, absence, and/or quantity of CLDN14-antibody complex can then be determined by routine detection methods such as, without limitation, ELISA or Western blot assay. A subject can be diagnosed with kidney stones if the amount of an immune complex that forms between the antibody and the CLDN14 exceeds that of healthy volunteers by a statistically significant amount. In various configurations, the subject can be a mammal such as, without limitation, a human, a rodent, a canine, a feline, a bovine, an ovine, or a porcine, or an avian such as a chicken.
The present teachings include the following non-limiting aspects.
1. A method of detecting, diagnosing or monitoring kidney stone disease in a subject, comprising:
providing a urine sample from a subject having or suspected of having kidney stone disease;
contacting the sample with an antibody that binds Claudin-14 polypeptide, under conditions sufficient for formation of a primary complex comprising the antibody and the Claudin-14 polypeptide if present:
measuring quantity of the primary complex;
comparing the quantity of the primary complex to that of a control complex formed from the antibody and a urine sample of an individual who does not have kidney stone disease; and
detecting kidney stone disease if the quantity of the primary complex from the subject is statistically significantly greater than that of an individual who does not have kidney stone disease.
2. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the antibody is a monoclonal antibody.
3. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the antibody is a polyclonal antibody.
4. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the antibody is a single chain antibody.
5. A method in accordance with aspect 1, wherein the antibody is directed against the first extracellular loop of CLDN14.
6. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the measuring comprises an immunoprecipitation assay, an ELISA, a radioimmunoassay, a Western blot assay, a dip stick assay, a microarray, or a bead assay.
7. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 6, wherein the measuring comprises an ELISA or a Western blot assay.
8. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the antibody comprises a label, and the measuring quantity of the complex comprises quantifying the label.
9. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 8, wherein the label is selected from the group consisting of an enzyme, a radioisotope, a fluorogen, fluorophore, a chromogen and a chromophore.
10. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 9, wherein the enzyme is selected from the group consisting of a peroxidase, a phosphatase, a galactosidase and a luciferase.
11. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 9, wherein the radioisotope is selected from the group consisting of a 32P, a 33P, 35S, a 14C, an 125I, an 131I and a 3H.
12. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 9, wherein the fluorophore is selected from the group consisting of a fluorescein, a rhodamine, an Alexa Fluor®, an IRDye®, a coumarin, an indocyanine and a quantum dot.
13. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 11, wherein the label is selected from the group consisting of a biotin, a digoxygenin, and a peptide comprising an epitope.
14. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, wherein the measuring quantity of the primary complex comprises contacting the complex with at least one secondary probe that binds the antibody that binds Claudin-14 polypeptide under conditions sufficient for formation of a second complex comprising the at least one secondary probe, the antibody and the Claudin-14 polypeptide if present; and
measuring quantity of the second complex.
15. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 14, wherein the at least one secondary probe is selected from the group consisting of an antibody directed against the antibody that binds Clauin-14 polypeptide, an aptamer that binds the antibody that binds Clauin-14 polypeptide, an avimer that binds the antibody that binds Clauin-14 polypeptide, an avidin and a streptavidin.
16. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 11, wherein the at least one secondary probe comprises a label, and the measuring quantity of the second complex comprises quantifying the label.
17. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 16, wherein the label is selected from the group consisting of an enzyme, a radioisotope, a fluorogen, fluorophore, a chromogen and a chromophore.
18. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 17, wherein the enzyme is selected from the group consisting of a peroxidase, a phosphatase, a galactosidase and a luciferase.
19. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 17, wherein the radioisotope is selected from the group consisting of a 32P, a 33P, 35S, a 14C. an 125I, an 131I and a 3H.
20. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 17, wherein the fluorophore is selected from the group consisting of a fluorescein, a rhodamine, an Alexa Fluor®, an IRDye®, a coumarin, an indocyanine and a quantum dot.
21. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 16, wherein the label is selected from the group consisting of a biotin, a digoxygenin, and a peptide comprising an epitope.
22. A method in accordance with aspect 1, wherein the subject is selected from the group consisting of a human, a rodent, a canine, a feline, a bovine, an ovine, a porcine, and an avian such as a chicken.
23. A method in accordance with aspect 1, wherein the subject is a mammal.
24. A method in accordance with aspect 1, wherein the subject is a human.
25. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 1, further comprising administering a kidney stone treatment.
26. A method in accordance with aspect 25, wherein the kidney stone treatment is selected from the group consisting of an miR-9 mimic, an miR-374 mimic, an agent that inhibits signaling through the CaSR pathway, an antibody against Claudin-14, an antagonist of CaSR, NPS2143, at least one HDAC inhibitor, suberanilohydroxamic acid (SAHA), trichostatin A (TsA), and a combination thereof.
27. A method of monitoring kidney stone disease in a subject, comprising:
providing a first urine sample from a subject at a first time point;
contacting the sample with an antibody that binds Claudin-14 polypeptide, under conditions sufficient for formation of a first primary complex comprising the first antibody and Claudin-14 polypeptide if present;
measuring quantity of the first primary complex;
providing a second sample from the subject at a second time point;
contacting the sample with the antibody that binds Claudin-14 polypeptide, under conditions sufficient for formation of a second primary complex comprising the second antibody and Claudin-14 polypeptide if present; and
measuring quantity of the second primary complex wherein an increase compared to the first sample is diagnostic for increased kidney stone disease.
28. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 27, further comprising administering a kidney stone treatment.
29. A method of detecting, diagnosing or monitoring kidney stone disease in accordance with aspect 28, wherein the kidney stone treatment is selected from the group consisting of an miR-9 mimic, an miR-374 mimic, an agent that inhibits signaling through the CaSR pathway, an antibody against Claudin-14, an antagonist of CaSR, NPS2143, at least one HDAC inhibitor, suberanilohydroxamic acid (SAHA), trichostatin A (TsA), and a combination thereof.
30. A method of treating kidney stone disease in a subject in need thereof, comprising;
administering to a subject a therapeutically effective amount of an miR-9 mimic, an miR-374 mimic or a combination thereof.
31. A method in accordance with aspect 30, wherein the administering is intravenous administering.
32. A method of treating kidney stone disease in a subject in need thereof, comprising;
administering to a subject a therapeutically effective amount of an agent that inhibits signaling through the CaSR pathway.
33. A method in accordance with aspect 32, wherein the agent is an antibody against Claudin-14.
34. A method in accordance with aspect 32, wherein the agent is an miR-9 mimic, an miR-374 mimic or a combination thereof.
35. A method of treating a disease associated with hypocalcemia comprising:
administering to a subject in need of treatment thereof a therapeutically effective anount of an antagonist of CaSR.
36. A method in accordance with claim 35, wherein the disease is selected from the group consisting of nephrolithiasis, osteoporosis, hypoparathyroidism, Alzheimer's disease, and epilepsy.
37. A method of treating kidney stone disease comprising:
administering to a subject in need of treatment thereof a therapeutically effective amount of an antagonist of CaSR.
38. A method in accordance with aspect 35 or 37, wherein the CaSR antagonist is a calcilytic compound.
39. A method in accordance with aspect 35 or 37, wherein the CaSR antagonist is NPS2143.
40. A method in accordance with aspect 35 or 37, wherein administering is by oral administration.
41. A method in accordance with aspect 35 or 37, wherein the therapeutically effective amount of NPS2143 is about 15 mg/kg BW−1, about 15 mg/kg BW−1-45 mg/kg BW−1, or about 45 mg/kg BW−1.
42. A method in accordance with aspect 35 or 37, wherein the therapeutically effective amount of NPS2143 is 15 mg/kg BW−1.
43. A method in accordance with aspect 35 or 37, wherein the therapeutically effective amount of NPS2143 is 30 mg/kg BW−1.
44. A method in accordance with aspect 35 or 37, wherein the therapeutically effective amount of NPS2143 is 45 mg/kg BW−1.
45. A method of treating a disease selected from the group consisting of hyperparathyroidism and hypercalcemia, comprising:
administering an agonist of CaSR.
46. A method in accordance with aspect 45, wherein the agonist of CaSR is a calcimimetic or a cinacalcet.
47. A method in accordance with aspect 45, wherein administering is by oral administration.
48. A method in accordance with aspect 45, wherein the therapeutically effective amount of cinacalcet is 30 mg/kg BW−1 or about 30 mg/kg BW−1.
49. A method of abrogating CaSR mediated regulation of claudin-14, microRNAs and urinary Ca++ excretion in a subject in need thereof, comprising:
administering to a subject a therapeutically effective amount of a calcineurin inhibitor.
50. A method in accordance with aspect 49, wherein the calcineurin inhibitor is cyclosporine-A.
51. A method of treating kidney stone disease in a subject in need thereof, comprising;
administering to a subject a therapeutically effective amount of at least one HDAC inhibitor.
52. A method in accordance with aspect 51, wherein the HDAC inhibitor is selected from the group consisting of suberanilohydroxamic acid (SAHA) and trichostatin A (TsA).
53. A method in accordance with aspect 52, wherein the therapeutically effective amount of SAHA is about 5 mg/kg, 5 mg/kg-25 mg/kg, or about 25 mg/kg.
54. A method in accordance with aspect 52, wherein the therapeutically effective amount of SAHA is at least 5 mg/kg or about 5 mg/kg.
55. A method in accordance with aspect 52, wherein the therapeutically effective amount of TsA is at least 1 mg/kg or about 1 mg/kg.
ANOVA: Analysis of variance
CaSR: Ca++ sensing receptor
ChIP: Chromatin immunoprecipitation
CKD: Chronic kidney disease
Ct: Cycle threshold
DMSO: Dimethyl sulfoxide
ECV: Extracellular volume
FBS: Fetal bovine serum
FE: Fractional excretion
FITC: Fluorescein isothiocyanate
FHH: Familial hypocalciuric hypercalcemia
FHHNC: Familial hypomagnesemia with hypercalciuria and nephrocalcinosis
GFR: Glomerular filtration rate
GPCR: G protein-coupled receptors
GWAS: Genome-wide association study
HDAC: Histone deacetylases
HEK293: Human Embryonic Kidney 293 cells
HV: Healthy volunteers
IP injection or I.P. injection: Intraperitoneal injection
LNA: Locked nucleic acid
ncRNA: Non-coding RNA
NFAT: Nuclear factor of activated T-cells
NSHPT: Neonatal severe hyperparathyroidism
PBS: Phosphate buffered saline
Pca: Plasma calcium concentration
PCR: Polymerase chain reaction
PMg: Plasma magnesium concentration
PTH: Parathyroid hormone
SAHA: Suberanilohydroxamic acid
SEM: Standard error of the mean
SF: Stone formers
TALH: Thick ascending limb of Henle's loop
THP: Tamm-Horsfall protein
TJ: Tight junction
UTR: Untranslated region
UV: Urine volume
WT: Wild type
Y2H: Yeast two-hybrid
The inventors demonstrated that claudin-14 fulfills the transport role for Ca2+ in the kidney. The mRNA, protein and TJ localization levels of claudin-14 in the kidney can be regulated within hours by systemic administration of calcimimnetic and calcilytic compounds.
Using a knockout (KO) strategy and time-controlled renal clearance measurements, the inventors have demonstrated a functional role of claudin-14 in CaSR-induced calciuretic and magnesiuretic responses. The experiments were carried out in intact animals and PTH levels were simultaneously monitored and found similar in WT and claudin-14 KO following calcimimetic and calcilytic administration, arguing against the role of PTH in CaSR mediated renal function. PTH appeared to set a “floor” level defending against hypocalcemia, mindful that KO of claudin-14 could not correct the hypocalcemia induced by cinacalcet. This phenomenon has also been observed by Kantham et al., 2009 showing that the presence of CaSR in the setting of PTH KO could not rescue the CaSR/PTH double KO from hypocalcemia.
The inventors discovered a transcriptional program in the TALH of the kidney that comprises NFATc 1-microRNA and plays a functional role through the regulation of claudin-14. Our data can explain how calcineurin inhibitor cyclosporine can abolish the NPS2143 effect both on the levels of claudin-14 gene regulation and calciuretic response. Consistent with NPS2143 eliciting profound decreases in claudin-14 gene expression, NFATc1 binding to miR-9-1 and miR-374 promoters was concomitantly increased, inducing local histone H3 acetylation and stimulating microRNA transcription. Since claudin-14 transcripts are already present intracellularly, alteration of microRNA transcription allows rapid translational regulation of its target protein, claudin-14, ensuring timely functional regulation for the signaling pathway. The cinacalcet effect can be attenuated but not abolished by cyclosporine. There was not a significant change in NFATc 1 binding to microRNA promoter or histone acetylation.
The inventors demonstrate that claudin-14 inhibits claudin-16 permeability and integrates into the claudin-16/-19 channel complex using several biochemical, biophysical and cellular approaches. The inventors present in vivo evidence that overexpression of claudin-14 in the TALH of the kidney generates a renal phenotype characteristic with hypomagnesemia and hypercalciuria, and characteristic with claudin-16 KO phenotype (Hou et al., 2007). The inventors discovered that claudin-14 is a regulatory molecule for CaSR. Accumulating data demonstrated that paracellular Ca2+ reabsorption in the TALH can be directly regulated by CaSR during hypercalcemia (Desfleurs et al., 1998; Motoyama and Friedman, 2002). Through physical interactions, claudin-14 blocks the paracellular channel made of claudin-16 and -19, suggesting a mechanism for its role in nephrolithiasis. Tight junction (TJ) proteins were previously considered to be constitutive and structural molecules. Claudin-14 is the first TJ molecule of which the expression can be rapidly regulated in response to physiological changes.
In this study, The inventors demonstrate that extracellular Ca2+, through activation of CaSR, regulates the expression levels of two microRNAs: miR-9 and miR-374, which in turn transduce the extracellular signal to CLDN14 through microRNA mediated gene silencing. CLDN14 relays the extracellular Ca2+ signal to CLDN16-19, the final effector of Ca 2, transport in the kidney, through direct functional modulation of their permeabilities.
Under normal physiological conditions, miR-9 and miR-374 tightly regulate the gene expression level of CLDN14 and protect CLDN16-19 channel function. The observed association between CLDN14 and hypercalciuric nephrolithiasis (Thorleifsson et al., 2009) can be explained by CLDN14 deregulation that escapes microRNA suppression, inhibits CLDN16-19 channel permeabilities, and phenocopies FHHNC to variable degrees. FHHNC patients (Konrad et al., 2006; Weber et al., 2001) and animal models (Hou et al., 2007: 2009) with CLDN16 or CLDN19 mutations are known to have hypercalciuria, nephrocalcinosis and nephrolithiasis. CLDN14 deregulation has two distinct origins: cis- or trans-acting. Cis-acting variants include changes in promoters, splicing sites and microRNA target sites. The miR-9 and miR-374 target sites in the CLDN14 gene are surrounded by four synonymous SNPs that associate with hypercalciuric nephrolithiasis (Thorleifsson et al., 2009), suggesting the linkage disequilibrium (LD) block may contain susceptible genetic variations related to microRNA regulation. Allelic variation in mRNA levels presents another explanation for association of exonic SNPs. Two of the four identified SNPs are located in the last exon of CLDN14 gene, which may be associated with abnormally higher levels of CLDN14 mRNA in the kidney (Yan et al., 2002). Trans-acting variants are located in distant genes that alter the transcript levels of a target gene. miR-9 and miR-374 are trans-acting effectors of the CLDN14 gene. The gene transcription level of miR-9 itself is regulated by the myc and ras oncoproteins (Ma et al., 2010), implicating a potential tumorigenic role for CLDN14 as reported for CLDN2 (Buchert et al., 2010) and CLDN7 (Nilbel et al., 2009).
A role of CaSR in the kidney is the regulation of Ca2+ reabsorption in the thick ascending limb (TAL). While mostly found in the luminal membrane elsewhere of the nephron, CaSR is located in the basolateral membrane of the TAL, where it senses peritubular Ca2+ changes and regulates both transcelhdlar and paracelular electrolyte transports (Riccardi and Brown, 2010). An extensive literature testifies to the suppression of paracellular Ca2+ reabsorption by CaSR activation during hypercalcemia (Desfleurs et al., 1998; Motoyama et al, 2002). CaSR activation also inhibits ROMK channels (Wang et al., 1996; 1997), diminishes transcellular NaCl reabsorption and produces a “Bartter-like” phenotype (Vargas-Poussou et al., 2002). Several signaling pathways have been revealed underpinning CaSR regulation of transcellular channels, including P-450 metabolites and prostaglandins (Hebert et al., 2007). Owing to the short seed sequence (nucleotides: 2-7) of microRNA, a cognate microRNA regulates multiple target genes.
Although this study reported miR-9 and miR-374 convergence onto CLDN14, they could extend CaSR signaling to cellular functions beyond the paracellular channel and organ functions beyond the kidney. The regulation of microRNA by CaSR signaling may occur on several layers: microRNA transcription, processing or degradation (Krol et al., 2010). The promoters of both miR-9 (miR-9-3 locus) and miR-374 genes contain a canonical myc-binding site (E-box: CACGTG). The transcription of miR-9-3 is upregulated by myc in human breast cancer cells (Ma et al., 2010); miR-421/-374 cluster is upregulated by myc in Hela cells although miR-374 itself has not been measured (Hu et al., 2010). Genetic ablation of Dicer, a nuclease required for microRNA processing, in the proximal tubule (Wei et al., 2010) and the glomerular podocyte (Harvey et al., 2008) demonstrated a role for microRNA processing in renal pathophysiology. It is not known whether myc or Dicer is directly involved in CaSR signaling.
CLDN14 physically interacts with CLDN16 and directly blocks its cation permeability. Our data is consistent with a previous finding of CLDN14 as a non-selective cation blocker in kidney MDCK cells (Ben-Yosef et al., 2003). The paracellular barrier function of CLDN14 also underlies its physiological role in the inner ear (Ben-Yosef et al., 2003). CLDN14 showed strong homomeric interaction on our yeast 2-hybrid reporter assays (
Although CLDN14 does not physically interact with CLDN19, our biochemical data suggest that CLDN14 integrates into CLDN16-19 channel to form a higher oligomeric complex with novel physiological signature. Using Brownian dynamics simulations, a single-pore model has been suggested for claudin channel structure (Yu et al., 2009). The channel pore is formed by two hemi-channels located in the TJ of adjacent cells which has a 6.5-Å diameter cylindrical shape and charged side chain on the conserved residue-65. The channel conductance varies with the effective charge valence on the side chain of residue-65 (Yu et al., 2009). CLDN14 has a non-charged residue-glutamine at position-65, which will reduce the effective charge density of CLDN16 channel pore (D65: −1e→0) once CLDN14 cis-associates with CLDN16, leading to decreases in cation permeation.
Gene regulation has two distinct origins: cis- or trans-acting. Cis-acting elements include promoter, splicing sites, ribosome entry sites and microRNA target sites. Trans-acting components include transcriptional factors, epigenetic modulators and non-coding RNAs (ncRNAs). MicroRNAs are single-stranded, ncRNA molecules of 19-25 nt in length, which are generated from endogenous hairpin-shaped transcripts. (Krol J, et al., 2010) base pair with their target mRNAs and induce either translational repression or mRNA destabilization. (Berezikov E. 2011) Our previous work identified two microRNA molecules from the kidney that target the 3′-UTR of claudin-14 gene: miR-9 and miR-374. (Gong Y, et al., 2009) Here, The inventors show that the transcriptional levels of both microRNAs are directly regulated by CaSR in the kidney, while the promoter activity of claudin-14 itself is not affected. A bioinformatic search found strong NFAT binding sites within the proximal promoter region of both miR-9 and miR-374 genes. Using ChIP analyses, the inventors demonstrated direct binding of NFATc1 to miR-9 and miR-374 promoters. The calcineurin inhibitor—cyclosporine abrogates CaSR mediated regulation of claudin-14, microRNAs and urinary Ca++ excretion in the kidney. The promoter binding of NFATc1 is regulated by CaSR and found to induce local histone acetylation, providing a mechanism to integrate CaSR based extracellular Ca++ signaling with calcineurin based intracellular Ca++ signaling pathways.
Using CaSR-specific pharmacological reagents, the inventors demonstrated that CaSR regulates the gene expression of claudin-14 in the kidney transiently. Using a transgenic approach, the inventors show that gain of claudin-14 function in the kidney induces renal Mg++ and Ca4+ losses, demonstrating a physiological origin of kidney stone disease. The mRNA, protein and TJ localization of claudin-14 peaked at 2-4 hrs that coincided with maximal Ca++ transport levels. Knockout of claudin-14 abolished the renal Ca++ transport induced by CaSR.
Claudins form a class of channels oriented perpendicular to the membrane plane and serving to join two extracellular compartments, known as the paracellular channel. (Hou, J., et al., 2013) The paracellular Ca++ transport in the TALH of the kidney involves the functional interplay of three claudin genes: claudin-14, -16 and -19, all of which are associated with human kidney diseases of hypercalciuria, nephrolithiasis and bone mineral loss. (Hou, J. 2012) In a previous report, the inventors demonstrated that claudin-14 inhibits claudin-16 permeability and integrates into the claudin-16/-19 channel complex in vitro. (Gong, Y., et al., 2012)
The inventors now present in vivo evidence that overexpression of claudin-14 in the TALH of the kidney generates a renal phenotype characteristic with hypomagnesemia and hypercalciuria, an exact phenocopy of claudin-16 KO. (Hou, J. et al., 2007) Our data have demonstrated that paracellular Ca++ reabsorption in the TALH can be directly regulated by CaSR during hypercalcemia. (Desfleurs, E., et al., 1998: Motoyama, H. I., et al., 2002) Through physical interactions, claudin-14 inhibits the paracellular channel made of claudin-16 and -19. Also, tight junction proteins were previously considered to be static and structural molecules. Claudin-14 is the first TJ molecule the expression level of which can be regulated within hours in response to physiological changes. The changes in its mRNA levels can be captured as early as 1 hrs following NPS2143 or cinacalcet treatment, while the changes in protein levels slightly lagged behind and became apparent by 2 hrs.
Evidence supports that claudins are regulatory molecules with particularly fast protein turnover rate of less than 60 min in the colon (Buzza, M. S., et al., 2010) and the blood vessel. (Mandel, I., et al., 2012) Additional mechanisms such as phosphorylation, palmitoylation and trafficking may also exist for claudin-14, -16 and -19 that allow explaining more transient changes (within minutes) in paracellular Ca++ transport during some in vitro recordings in perfised TALH tubules. (Loupy, A., et al., 2012; Mandel, I., et al., 2012)
CaSR is a G protein-coupled receptor (GPCR) that can be activated by an extracellular ion—Ca++. Its function has been demonstrated to play a role in many physiological processes—including sperm generation, embryonic development, Ca++ metabolism, neuronal excitability etc.; underlying various diseases, such as hyper/hypoparathyroidism, kidney stone, osteoporosis, Alzheimer's disease, epilepsy etc. (Riccardi, D., et al., 2012) The classic CaSR signaling pathway involves its binding to the G proteins—Gq/11, Gi and G12/13 that in turn stimulate the phospholipase C (PLC), producing diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) and increasing intracellular Ca++ levels (Cai++). (Riccardi, D., et al., 2010) The calcineurin-NFAT pathway, a canonical intracellular Ca++ signaling mechanism, responds to changes in Cai++ by turning on or off a variety of genes in different tissues. (Crabtree, G. R., et al., 2002) In the TALH of the kidney, there have been reports showing a generic increase in calcineurin activity upon CaSR activation that played a role in the production of tumor necrosis factor (TNF) and prostaglandins. (Abdullah, H. I., et al., 2008; Herbert, S. C., et al., 2007)
The inventors discovered a transcriptional program in the TALH of the kidney that comprises NFATc1-microRNA and plays a functional role through the regulation of claudin-14. Our data explained how calcineurin inhibitor—cyclosporine abolished the NPS2143 effect both on the levels of claudin-14 gene regulation and calciuretic response. Consistent with NPS2143 eliciting profound decreases in claudin-14 gene expression, NFATc1 binding to miR-9-1 and miR-374 promoters was concomitantly increased, inducing local histone H3 acetylation and therefore stimulating microRNA transcription. Because claudin-14 transcripts were already present intracellularly, alteration of microRNA transcription allowed rapid regulation of the transcript stability and the translational efficiency of its target gene—claudin-14, ensuring timely functional regulation for the signaling pathway. The cinacalcet effect was attenuated but not abolished by cyclosporine, nor was there a significant change in NFATc1 binding to microRNA promoter or histone acetylation. It is not known what underlies the binary signal of CaSR regulation. Notably, the resetting mechanism for CaSR signaling appears to be quite different between the kidney and the parathyroid glands. The renal CaSR signaling was reset within 8 hrs, leading to rapid recovery in the levels of claudin-14 gene expression and calciuretic response, by which time the calcialytic/calcimimetic effects on serum PTH levels persist (
The renal role of CaSR in calcium metabolism has been difficult to delineate owing to its effects on PTH secretion. A constitutive KO of CaSR in the mouse has failed to provide further insight, largely owing to early lethality and its association with hyperparathyroidism. (Ho, C., et al., 1995) Kos, C. H., et al., 2003 and Tu, Q., et al., 2003 have bred CaSR−/− mice with mice lacking the parathyroid hormone (PT−/−). These mice demonstrated that suppression of PTH is not required for robust defense against various hypercalcemic challenges. (Kanthanr L., et al., 2009) Instead, the kidney plays a primary role in this regard. CaSR+PTH− and CaSR+PTH+ mice showed similar increases in urinary Ca excretion levels when fed with high Ca++ diet, while CaSR−PTH− mice were unable to excrete excess Ca++ in face of hypercalcemia. (Kantham, L., et al., 2009) With a kidney specific CaSR KO mouse model, authors have elegantly shown that the KO mice excrete less Ca++ in face of hypercalcemia even though their PTH secretion was intact (Toka, H. R., et al., 2012). Loupy, A., et al., have studied the renal role of CaSR in cases of hypercalcemia induced by the calcilytic compound—NPS2143. (Loupy, A., et al., 2012) In TPTX rats supplemented with a constant PTH level, NPS2143 administration elicited a decrease in urinary Ca++ excretion without affecting net Ca++ release from the bone or intestinal Ca++ absorption. These earlier efforts fell short of providing a molecular mechanism underlying the renal function of CaSR.
The inventors discovered a molecule, claudin-14, that fulfills the transport role for Ca++ in the kidney. The mRNA, protein and TJ localization levels of claudin-14 in the kidney can all be rapidly regulated within hours by systemic administration of calcimimetic and calcilytic compounds. Without being limited by theory, these findings fulfill a signaling role for CaSR. Aided by KO strategy and time-controlled renal clearance measurements, the inventors demonstrated the functional role of claudin-14 in CaSR induced calciuretic and magnesiuretic responses. Because the experiments were carried out in intact animals, PTH levels were simultaneously monitored and found similar in WT and claudin-14 KO following calcimimetic and calcilytic administration, arguing against the role of PTH in CaSR mediated renal function. Nevertheless, PTH appeared to set a “floor” level defending against hypocalcemia, mindful that KO of claudin-14 could not correct the hypocalcemia induced by cinacalcet. This phenomenon has also been observed by Kantham et al. showing that the presence of CaSR in the setting of PTH KO could not rescue the CaSR/PTH double KO from hypocalcemia. (Kantham, L., et al., 2009)
The methods and compositions described herein utilize laboratory techniques well known to skilled artisans, and can be found in laboratory manuals such as Sambrook. J., et al., Molecular Cloning: A Laboratory Manual, 3rd et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001; Spector, D. L. et al., Cells: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998: Nagy, A., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor, N.Y., 2003 and Harlow, E., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1999. Methods of administration of pharmaceuticals and dosage regimes, can be determined according to standard principles of pharmacology well known skilled artisans, using methods provided by standard reference texts such as Remington: the Science and Practice of Pharmacy (Alfonso R. Gennaro ed. 19th ed. 1995); Hardman, J. G., et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ninth Edition, McGraw-Hill, 1996; and Rowe, R. C., et al., Handbook of Pharmaceutical Excipients, Fourth Edition, Pharmaceutical Press, 2003. As used in the present description and the appended claims, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context indicates otherwise.
The present teachings include descriptions provided in the examples that are not intended to limit the scope of any aspect or claim. Unless specifically presented in the past tense, an example can be a prophetic or an actual example. The following non-limiting examples are provided to further illustrate the present teachings. Those of skill in the art, in light of the present disclosure, will appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present teachings.
Reagents, kits, and antibodies are listed in Table 1. The following antibodies were used in this study rabbit polyclonal anti-Tamm-Horsfall protein (THP) (Biomedical Technologies), rabbit polyclonal anti-Thiazide-sensitive NaCl cotransporter (NCC) (Chemicon); rabbit polyclonal anti-CLDN1 (Zymed Laboratories); rabbit polyclonal anti-CLDN14; rabbit polyclonal anti-CLDN16 (against SYSAPRTETAKMYAVDTRV) (SEQ ID NO: 5); rabbit polyclonal anti-CLDN19 (against NSIPQPYRSGPSTAAREYV) (SEQ ID NO: 6); goat polyclonal anti-aquaporin-2 (AQP2) (Santa Cruz Biotech): and mouse monoclonal anti-occludin antibodies (Zymed Laboratories). Mouse MKTAL cells and human HEK293 cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate. WT C57BL6 mice were from Charles River Laboratory. The CLDN14+/lacZ reporter/knockout mice were back-crossed to C57BL/6 background for 7 generations.
NPS2143 and cinacalcet (Table 1) were dissolved in vehicle—20% (w/v) (2-Hydroxypropyl)-β-cyclodextrin solution and fed to mice with gavage syringe. Cyclosporin-A (Sandimmune; Table 1) was diluted in 0.9% saline and I.P. injected to animals. Control animals received vehicle injection (13% wiv Cremophor EL and 32.9% ethanol). For dietary Ca2+ manipulation, animals were fed with the following diets for six consecutive days: basal diet: 0.61% Ca2+ (TestDiet #5755); low Ca2+ diet: 0 Ca++ (TestDiet #5855); high Ca2+ diet: 5% Ca2+ (TestDiet #5AVB). All animals had free access to water and were housed under a 12 hr light cycle. Blood samples were taken by cardiac puncture rapidly after initiation of terminal anesthesia and centrifuged at 4° C. for 10 min. Kidney were dissected out and immediately frozen at −80° C.
The method for performing renal clearance measurements in the mouse has been described by Hou et al., (2007; 2009). Mice were anesthetized by i.p. injection of Inactin (Sigma; 100 mg/kg). The jugular vein was catheterized for i.v. infusion of 0.9% saline at 2 μL/min, with 1% FITC-inulin included in the infusate. After an equilibration period of 60 min, renal clearance measurements were carried out for a 60 min period. Urine was collected under mineral oil, and 30 μL blood sample was taken at hourly intervals. Urine and plasma Ca2+ and Mg2+ concentrations were measured by atomic flame absorption spectrophotometer (PerkinElmer). Urine and plasma FITC-inulin levels were measured in 100 mM HEPES buffer (pH7.0) with fluorescence spectrophotometer (BioTek). The fractional excretion of electrolytes was calculated using the following equation FEion=V×Uion/(GFR×Pion), where GFR was calculated according to the clearance rate of FITC-inulin (GFR=V×Uinulin/Pinulin).
Age (9-10 weeks old) and sex (male) matched wild-type and CLDN14 KO mice were housed individually in metabolic cages (Harvard Apparatus) with free access to water and food for 24 hr. Urine was collected under mineral oil. The plasma and urine Ca++ and Mg2+ levels were determined with atomic flame absorption spectrophotometer (PerkinElmer). The plasma (P) and urine (U) electrolyte levels were determined with the Roche Cobas clinical analyzer (Roche Diagnostics). Creatinine levels were measured with an enzymatic method independent of plasma chromogens (Himnerkus et al., 2008). The fractional excretion of electrolytes was calculated using the following equation: FEion=V×Uion/(GFR×Pion), where GFR was calculated according to the clearance rate of creatinine (GFR=V×Ucreatinine/Pcreatinine).
The coding sequence of mouse claudin-14 gene was cloned into a bicistronic pIRES-GFP vector (Clontech). A 3.7 kb mouse Tamm-Horsfall protein (THP) promoter (kindly provided by Dr Donald Kohan: Stricklett et al., 2003) was cloned into the pIRES-GFP vector to replace the CMV promoter. Inclusion of GFP allowed rapid screening of transgene expression in the kidney. To generate claudin-14 overexpression transgenic (TG) mice, female donor mice (C57BL/6×CBA hybrid strain) were superovulated with a combination of pregnant mare serum (5 units) and human CG (5 units). The transgenic vector was injected into the pronucleus of single-cell mouse embryos and allowed to develop to two-cell embryo stage. Injected embryos were implanted into pseudopregnant females and carried to term. The transgenic founder mice were crossed to WT C57BL/6 mice, and F1 progeny were analyzed. Littermate WT mice were used as controls. Out of 41 transgenic founders, 9 had germ-line transmission of transgene; 4 had detectable transgene expression in the kidney.
An immunomagnetic separation method was used to isolate the TAL cells from the mouse kidney (Hou et al., 2009). Antibodies against the TAL cell specific surface antigen, Tamm-Horsfall protein (THP), were coated onto the paramagnetic polystyrene beads (Dynabeads M-280; Dynal), allowing immunoprecipitation of the TAL cells from collagenase digested mouse kidneys. The isolated cells were plated in DMEM medium supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate for 16 hours, followed by immediate transfection with NFAT or antagomirs.
Earle's Balanced Salt Solution (EBSS; Invitrogen) containing (117.24 mM NaCl, 5.33 mM KCl, 26.19 mM NaHCO3, 1.01 mM NaH2PO4, 0.70 mM MgCl2 and 5.56 mM glucose) was supplemented with the MEM Amino Acids solution, the MEM Non-Essential Amino Acids solution, the MEM Vitamin solution, L-Glutamine, 1 mM Sodium Pyruvate, penicillin/streptomycin and 1% FBS. For determining Ca2+ effects on gene expression, MKTAL cells were cultured in EBSS supplemented with the indicated concentrations of Ca2+ for 16 hrs. For examining PTH effects, MKTAL cells were cultured in EBSS supplemented with the indicated concentrations of human recombinant PTH (1-84; Sigma) for 16 hrs.
Bioinformatical Analyses of mRNA and miRNA
Transcripts of CLDN14 gene are alternatively spliced, generating 5 mRNA variants in human: 1—NM—144492, 2—NM—012130, 3—NM—001146077, 4—NM—001146078 and 5—NM—001146079; 3 variants in mouse: 1—NM—019500, 2—NM—001165925 and 3—NM—001165926; and 1 variant in rat: NM—001013429. For predictions of miRNAs targeting CLDN14:3′-UTR (mouse: 171 bp [AF314089](SEQ ID NO: 1); human: 183 bp [AF314090](SEQ ID NO: 2) based on sequence complementarities and cross-species conservation, four algorithms were used: TargetScan, miRanda. Diana microT and MirTarget2.
MicroRNA and mRNA Quantification
Total RNA including microRNA was extracted using Trizol (Invitrogen). Reverse transcription was performed on 1 μg of total RNA using miRNA specific RT primer and TaqMan miRNA reverse transcription kit (Invitrogen). Real-time PCR amplification was performed on reverse transcribed miRNA using TaqMan Universal PCR Master Mix, No AmpErase UNG (Invitrogen) and Eppendorf Realplex 2S real-time PCR system. Results were expressed as 2−ΔCt values with ΔCT=CtmRNA−CtU6snRNA. Cellular mRNA was reverse transcribed using the Superscript-III kit (Invitrogen), followed by real-time PCR amplification using SYBR Green PCR Master Mix (Bio-Rad) with the primer pairs: CLDN14, ACCCTGCTCTGCTTATCC (SEQ ID NO: 7) and GCACGGTTGTCCTGTAG (SEQ ID NO: 8); CLDN16. CAAACGCTTTTIGATGGGATTC (SEQ ID NO: 9) and TTTGTGGGTCATCAGGTAGG (SEQ ID NO: 10); β-actin, CGTTGACATCCGTAAAGAC (SEQ ID NO: 11) and TGGAAGGTGGACAGTGAG (SEQ ID NO: 12). Results were expressed as 2−ΔCt values with ΔCT=CtCLDN−Ctβ-actin.
Total RNA including microRNA was extracted using Trizol (Invitrogen). Cellular mRNA was reverse transcribed using the Superscript-III kit (Invitrogen), followed by real-time PCR amplification using SYBR Green PCR Master Mix (Bio-Rad) and Eppendorf Realplex2S system. The design of claudin-14 primers was described above. The design of pri-miRNA primers was according to Ma et al., (2010). The PCR primers are listed in Table 2. Results were expressed as 2−ΔCt values with ΔCT=Ctgene−Ctβ-actin.
Pre-validated Silencer Select siRNAs were designed and synthesized by Ambion. A pool of 3 target-specific 21 nt siRNA duplexes was designed against the coding region of mouse NFATc 1-c4 genes. A scrambled siRNA duplex was used as negative control. The NFATc1nuc expression vector (in pcDNA3.1 backbone) was generated by the Crabtree lab and obtained through Dr. Feng Chen. Transfection of siRNAs or NFATc1nuc was carried out with Lipofectamine LTX & Plus Reagent for primary cultures.
The pMir-Reporter construct was generated by inserting the mouse CLDN14:3′-UTR sequence (AF314089: 171 bp from the stop codon to the first polyA site) (SEQ ID NO: 1) or human CLDN14:3′-UTR sequence (AF314090: 183 bp from the stop codon to the first polyA site) (SEQ ID NO: 2) into the pMIR-REPORT-Luciferase vector (Clontech) downstream of the luciferase gene using Spe1 and Sac1. Deletions of miR-9 (CCAAAG) and miR-374 (AUUAUA) binding sites in human CLDN14:3′-UTR were generated using site-directed nmtagenesis (Stratagene). The pMir-Reporter (500 ng), the pGL4.74 Renilla luciferase control vector (500 ng; Promega) and 30 pmol of either scrambled miRNA, miR-9 or miR-374 precursor (Invitrogen) were co-transfected to HEK293 cells in 12-well culture dishes using Lipofectamine-2000 (Invitrogen). The miR-9-1 and miR-374 gene promoters were cloned into pGL4.10 luciferase reporter (Promega) with Sfi1 sites. Deletion of the NFAT binding sites (AGGAAAAT) in miR-9-1 and miR-374 promoters were generated using site-directed mutagenesis (Stratagene). The pGL4.10 reporter (500 ng), the pGL4.74 Renilla luciferase control vector (500 ng; Promega) and pcDNA3.1-NFATc1nuc vector were co-transfected to HEK293 cells in 12-well culture dishes using Lipofectamine-2000 (Invitrogen). Twenty-four hours after transfection, firefly and renilla luciferase activities were measured with a chemilhunminescence reporter assay system-Dual Glo (Promega) in a GLOMAX Luminometer (Promega).
Antagomirs for miR-9, miR-374 and scrambled control miRNA were designed and synthesized by Exiqon using locked nucleic acids (LNA). 60 pmol of each antagomir (or 30 pmol anti-miR-9+30 pmol anti-miR-374 in synergistic assays) were transfected to MKTAL cells in 12-well culture dishes using Lipofectamine-2000 (Invitrogen). Twenty-four hours after transfection, total cellular RNAs or membrane proteins were collected.
CaSR Knockdown by siRNA
Pre-validated Silencer Select siRNAs were designed and synthesized by Ambion. A pool of 3 target-specific 21 nt siRNA duplexes were designed against the coding region of mouse CaSR gene (AF110178). A scrambled siRNA duplex was used as negative control. Twenty-four hours prior to Ca2+ activation, 50 pmol of either CaSR siRNA or scrambled siRNA was transfected to MKTAL cells in 12-well culture dishes with Lipofectmine-2000. To improve transfection efficiency, DMEM medium was used during transfection. At the end of transfection, cells were washed for three times in PBS and switched to the low Ca2+ medium (EBSS) followed by Ca2+ activation.
HEK293 cells expressing CLDN14 with CLDN16 or CLDN19 were lysed in 50 mM Tris (pH 8.0) by 25-30 repeated passages through a 25-gauge needle, followed by centrifugation at 5,000 g. The membranes of lysed cells were extracted using CSK buffer (150 mM NaCl; 1% Triton X-100; 50 mM Tris, pH 8.0; and protease inhibitors). The membrane extract was precleared by incubation with protein A/G-sepharose (Sigma-Aldrich) prior to coimmunoprecipitation. The precleared membrane extract was incubated for 16 h at 4° C. with anti-CLDN14, anti-CLDN16, anti-CLDN19, anti-CLDN1 and anti-occludin antibodies. Antibody-bound material was pelleted with protein A/G-sepharose, washed 3 times with CSK buffer, and detected by immunoblotting.
CLDN14+/lacZ mouse kidneys were fixed with 4% paraformaldehyde at 4° C. overnight, washed three times in PBS, cryoprotected for 24 h in 30% sucrose in PBS, and embedded in OCT prior to cryostat sectioning. Cryostat sections (10 μm) were stained for β-galactosidase activity using the β-Gal staining kit (Invitrogen), followed by incubation with anti-THP antibody (diluted 1:200) and FITC-labeled secondary antibody (diluted 1:200). Epifluorescence images were taken with a Nikon 80i photomicroscope equipped with a DS-Qi1Mc digital camera. All images were converted to JPEG format and arranged using Photoshop CS4 (Adobe).
The Y2H membrane protein interaction assay (MoBiTec Molecular Biotechnology) for analyzing the specific claudin interactions [mouse CLDN14 (AF314089) (SEQ ID NO: 1), human CLDN16 (AF152101) (SEQ ID NO: 3) and human CLDN19 (BC030524) (SEQ ID NO: 4) has been described by Hou, J. et al., (2008). The assay was performed by transforming the yeast strain NMY51 with 1.5 μg of bait and prey vectors. Transformed yeast cells were plated on drop-out media lacking leucine and tryptophan (SD-LW) and incubated for growth of positive transformants. Three to six independent positive transformants were then selected and resuspended in 50 ml of 0.9% NaCl buffer: 5 μl of each suspension was spotted on SD-LWHA media. Growth of colonies on the selective medium was scored as positive for interaction. To further verify the positive interactions, β-galactosidase activity was performed using a filter lift assay (MoBiTec GmbH).
The following full-length mammalian claudins were cloned into the retroviral vector pQCXIN (Clontech): mouse CLDN14 (AF314089) (SEQ ID NO: 1), human CLDN16 (AF152101) (SEQ ID NO: 3) and human CLDN19 (BC030524) (SEQ ID NO: 4). VSV-G pseudotyped retroviruses were produced in HEK293 cells and used to infect LLC-PK1 cells at a fixed titer of 1×106 CFU/ml, as described previously (Hou et al., 2008). Cells co-expressing CLDN14, 16 and 19 were generated with sequential viral infections. Infected LLC-PK1 cells were seeded onto Transwell plates to allow polarization. On day 9 post polarization, cell monolayers were subjected to electrophysiological measurements and immunostained to visualize claudin localization.
Electrophysiological recordings were performed on epithelial monolayers in an Ussing chamber (Harvard Apparatus #U9926/T) that had been modified to adapt Transwells (Hou et al., 2005; 2008). Voltage and current clamps were performed using the EC-800 epithelial amplifier (Warner Instruments) with Ag/AgCl electrodes and an Agarose bridge containing 3M KCl. The transepithelial resistance (TER) was measured under the “Resistance” mode by passing a constant bipolar current pulse (Io) of 10 μA (<2 kΩ) or 1 μA (>2 kΩ) through the epithelium and recording voltage deflection (Vo). Ohm's law was used to calculate TER from Vo and Io. The series resistance (Rs) was measured in absence of the epithelium and subtracted from TER. Dilution potentials (PD) were measured under the “Current Clamp” mode by clamping the transepithelial current to zero and recording the equilibrium voltage generated by NaCl diffusion. All experiments were conducted at 37° C. Electrical potentials obtained from blank inserts were subtracted from those obtained from inserts with epithelial monolayers. 1 mM ouabain was included in the basolateral perfusant to inhibit transcellular ion conductance. The ion permeability ratio (η) for the monolayer was calculated from the dilution potential using the Goldman-Hodgkin-Katz equation. The absolute permeabilities of Na++ (PNa) and Cl− (PCl) were calculated by using the Kimizuka-Koketsu equation. The relative permeability of other cations (M+) to Na++ (γ=PM/PNa) was then calculated from the bi-ionic potential, according to the following equation,
P
Li
/P
Na=1/eψ.
P
Ca
/P
Na=(1+eψ)/(2e2ψ),
where ψ=eΨ/kT (Ψ is the bionic potential).
Freshly isolated TALH cells or primary TALH cell cultures were cross-linked in 1% paraformaldehyde (pH7.0) for 10 min at room temperature. The cross-linked cells were lysed following to instruction of MAGnify ChIP system (Invitrogen). Chromatin was sonicated into 500 bp fragments with Bioruptor UCD-200 (High power, 15 cycles of 30 seconds ON, 30 seconds OFF; Diagenode). Sheared chromatin was precipitated with antibody-bound Dynabeads (Invitrogen). Following reverse crosslink and DNA extraction, antibody-bound DNA was eluted and analyzed with real-time PCR. The primers for ChIP analyses were listed in Table 2. Two criteria for normalization were applied: fold enrichment over anti-IgG background signal and input control over chromatin input signal.
For viewing claudin localization in the kidney, fresh cryostat sections (10 μm) were fixed with cold methanol at −20° C., followed by blocking with PBS containing 10% FBS, incubation with primary antibody (1:300) and FITC-labeled secondary antibody (1:200). After washing with PBS, slides were mounted with Mowiol (Calbiochem). Epifluorescence images were taken with a Nikon 80i photomicroscope equipped with a DS-QilMc digital camera. All images were converted to TIFF format and arranged using Photoshop CS4 (Adobe).
The significance of differences between groups was tested by ANOVA (Statistica 6.0; Statsoft). When the all-effect F value was significant (p<0.05), post hoc analysis of differences between individual groups was made with the Newman-Keuls test. Values were expressed as mean±SEM, unless otherwise stated.
This example illustrates renal localization of CLDN14 promoter, mRNA and protein.
To demonstrate CLDN14 gene expression in the kidney, regardless of regulatory mechanisms that may affect its mRNA or protein level (vide infra), the inventors determined CLDN14 promoter activities in the mouse kidney. The CLDN14 promoter activity was assessed in vivo with a CLDN14-lacZ reporter mouse line (Ben-Yosef et al., 2003) in which the lacZ reporter gene replaced the CLDN14 gene under control of the endogenous CLDN14 promoter. Through colocalization analyses, the inventors found that in CLDN14+/lacZ mouse kidneys, the β-galactosidase activity was detected in tubules that co-expressed the Tamm-Horsfall protein (THP: a TAL marker) (
To determine CLDN14 mRNA levels in the kidney, the inventors microdissected each nephron segment from the mouse kidney (
This example illustrates CLDN14 gene expression can be suppressed by miR-9 and miR-374 in the kidney.
The apparent suppression of CLDN14 proteins in the kidney prompted us to look for underlying regulatory mechanisms. The strong CLDN14 promoter activity in the kidney suggested post-transcriptional mechanisms for CLDN14 gene regulation. The CLDN14 gene produces alternatively spliced transcripts in the human (5 variants), the mouse (3 variants) and the rat (1 variant) (see Methods). The splicing variants differ in their 5′-UTR sequences while the coding region and 3′-UTR sequences are conserved in all variants. For predictions of microRNAs targeting CLDN14:3′-UTR based on sequence complementarities and cross-species conservation, four algorithms were used: TargetScan, miRanda, Diana microT, and MirTarget2 (Methods). Because CLDN14:3′-UTR is short, 183 bp in human (#AF314090) (SEQ ID NO: 2), a total of 11 microRNAs were identified targeting the human sequence. MiR-9 consistently appeared in all four algorithms and miR-374 was reported by two independent algorithms. A cross-species search of the 11 microRNA binding sites in mouse CLDN14:3′-UTR (171 bp; AF314089) (SEQ ID NO: 1) reported only the miR-374 binding site conserved in human and mouse sequences. Human miR-374 has two isoforms, a and b, both sharing the same seed sequence. Mature human miR-374b (hsa-miR-374b) is identical to mouse and rat miR-374 (mmu-miR-374 and rno-miR-374 respectively). The miR-374 binding site (AUUAUA matching the seed sequence of miR-374) within CLDN14:3′-UTR was conserved across species. Three pre-miR-9 genes (miR-9-1, -2 and -3) encode the same mature miR-9. Sequence alignment identified a conserved miR-9 binding site within human CLDN14:3′-UTR (CCAAAG), which was however mutated in mouse and rat. A second miR-9 binding site was found in mouse and rat CLDN14:3′-UTRs, located 69 bp upstream of the conserved site.
To determine whether miR-9 or miR-374 targets CLDN14:3′-UTR directly, the inventors generated the reporter constructs (pMir-Reporter; Methods) that had the mouse CLDN14:3′-UTR sequence (171 bp) or human CLDN14:3′-UTR sequence (183 bp) cloned downstream of the firefly luciferase gene, termed as pMir-Reporter-CLDN14:3′-UTRmouse or pMir-Reporter-CLDN14:3′-UTRhuman respectively. The pMir-Reporter was transfected with either scrambled miRNA, miR-9 or miR-374 precursor to HEK293 cells. A 25% decrease in firefly luciferase activity (p<0.01, n=4; normalized to Renilla luciferase activity,
To demonstrate whether microRNAs are required for CLDN14 regulation in vivo, the inventors adapted the antagomir method (Kruntzfeldt et al., 2005) to repress mature microRNA function in a cultured TAL cell model—MKTAL. The MKTAL cells derived from microdissected mouse TAL tubules and expressed the TAL specific genes, THP and NKCC2 (Bourgeois et al., 2003). The inventors assessed the efficacy of antagomir knockdown of microRNAs by the pMir-Reporter assay. Transfection with anti-miR-9 or anti-miR-374 but not scrambled antagomir increased pMir-Reporter-CLDN14:3′-UTRmouse activity by 1.38-fold (p<0.05, n=4;
Concomitant CLDN14 translation assays demonstrated more pronounced microRNA effects. The repression of CLDN14 protein levels was relieved by co-transfection with anti-miR-9 and anti-miR-374, reflected by a 3.86-fold (p<0.05, n=3; normalized to O-actin protein;
To determine whether microRNAs regulated CLDN14 gene expression in the mouse kidney, the inventors isolated mouse TAL cells with an immunomagnetic separation method described before (Methods) (Hou et al., 2009). The isolated cells were viable and express the TAL specific genes, THP and CLDN16 (Hou et al., 2009). Once isolated, they were plated in culture medium for less than 16 hrs followed by immediate antagomir transfection. Antagomir transfection into freshly isolated mouse TAL cells increased pMir-Reporter-CLDN14:3′-UTRmouse activity by 1.71-fold (anti-miR-9+ anti-miR-374 versus scrambled antagomir: p<0.05, n=3;
This example illustrates that CLDN14 interacts with CLDN16 in the kidney.
Since CLDN16 and CLDN19 are colocalized in the TAL (Hou et al., 2008) and the colocalization requires their interaction (Hou et al., 2009), the TAL localization of CLDN14 prompted us to seek for evidence of CLDN14 interaction with CLDN16 or CLDN19. Claudins cis interact within the plane of the membrane to form dimers, or higher oligomeric state, followed by trans interactions between claudins in adjacent cells and additional cis interactions to assemble claudin oligomers into intramembrane tight junction (TJ) strands (Futuse et al., 1999). Because the oligomeric nature of the TJ structure denies an unambiguous study of any selected claudin interaction within the TJ matrix (Stevenson and Goodenough, 1984), cell systems with no TJ (e.g. yeast and embryonic HEK293 cells) were used to probe direct claudin interactions. To determine the cis interactions of CLDN14 with CLDN16 or 19, the inventors used the split-ubiquitin yeast 2-hybrid (Y2H) membrane protein interaction assay (Hou et al., 2008).
Our data show that CLDN14 interacted with itself and with CLDN16, as assayed with all three reporters (HIS3, lacZ, and ADE2) in the yeast NMY51 strain (
To directly document CLDN14-CLDN16 interaction in epithelial cells, the inventors performed coimmunoprecipitation of CLDN14 and CLDN16 in doubly transfected HEK293 cells, an embryonic cell line with no endogenous claudin or transepithelial resistance (TER). At low cell density, which minimizes cell-cell contacts and trans interactions, interactions between CLDN14 and CLDN16 will be mostly cis. Imnmunoblotting showed that anti-CLDN 4 antibody coprecipitated CLDN16, whereas anti-CLDN16 antibody reciprocally precipitated CLDN14 (
This example illustrates that CLDN14 abolishes the cation selectivity of CLDN16-19 heteromeric channel through repression of CLDN16.
To determine the functional role of CLDN14 in the kidney, the inventors stably expressed CLDN14 in the well-established epithelial cell model LLC-PK1 cells (Hou et al., 2005) that lack the endogenous expression of CLDN14, 16 or 19. As the inventors aimed to have cells expressing CLDN14 over a prolonged period so that they could become fully polarized and form tight junctions (TJ), the inventors used a previously described retroviral expression system (Methods) to drive exogenous CLDN14 expression (Hou et al., 2005; 2008). In LLC-PK1 cells, transfected CLDN16 permeated cations (Hou et al., 2005) while CLDN19 blocked anion permeation (Hou et al., 2008). Coexpression of CLDN16 and CLDN19 generated cation selectivity of the TJ in a synergistic manner (Hou et al., 2008) and resembling the recorded levels in perfused TAL tubules (Hou et al., 2007). With a modified Ussing chamber recording method, the inventors found CLDN14 expression alone in LLC-PK1 cells was without any significant effect on ion selectivity (PNa/PCl; Table 3). Coexpression of CLDN14 with CLDN16 and CLDN19 abolished their cation selectivity (PNa/PCl; from 4.486±0.087 in CLDN16+19 reduced to 1.336±0.006 in CLDN14+16+19; Table 3), reflected by a significant decrease in junctional diffusion potential (PD) (
†p < 0.01 relative to LLC-PK1 + CLDN16 + CLDN19 cells, n = 3.
‡PLi/PNa: 1.086 ± 0.008 in LLC-PK1 + CLDN16 cells versus 1.102 ± 0.011 in LLC-PK1 + CLDN14 + CLDN16, n = 3, not significant;
This example illustrates regulation of CLDN14 gene expression by extracellular Ca2+ in the kidney.
The inventors investigated whether CLDN14 played a physiological role in renal Ca2+ homeostasis. If CLDN14 is required for renal excretion of Ca2+, manipulating the dietary intake would induce changes in its expression, compatible with its role in regulating CLDN16 and 19 functions. To manipulate dietary calcium intakes in animals, age (7-8 weeks old) and sex (female) matched mice were segregated into three groups (I-III) and fed with the basal diet (I; Ca2+: 0.61%), low Ca2+ diet (II; Ca2+: 0) or high Ca2+ diet (III; Ca2+: 5%) respectively for six consecutive days (Methods). While the circulating Ca2 level was well defended under low Ca2+ diet, high Ca2+ diet induced significant hypercalcemia in animal group III (plasma Ca2+: 2.72 mM versus 2.53 mM in basal group I; p<0.01, n=5;
To determine the gene expression levels of CLDN14 in mouse kidneys receiving dietary treatments, the inventors isolated kidney TAL cells at the end of each treatment with the immunomagnetic separation method described elsewhere in this study and quantified CLDN14 mRNA levels (normalized to 13-actin mRNA) with real-time RT-PCR. While low Ca2 diet (II) significantly downregulated CLDN14 mRNA levels to 37% of the basal level (I) (p<0.01, n=5;
Strongly correlated with the elevation of extracellular Ca2+ concentration (supplemented to an EBSS based low Ca2+ culture medium; Methods), there was a progressive induction of CLDN14 mRNA level (
This example illustrates that CLDN14 is required for regulating Ca2+ excretion in the kidney.
While targeted deletion of CLDN14 in animals initially focused on its role in the inner ear, subsequent physiological studies showed normal renal function in CLDN14 knockout (KO) mice under basal dietary condition (Ben-Yosef et al., 2003: Elkouby-Naor et al., 2008). The rare loss-of-function mutations (398delT and T254A) associated with recessive deafness DFNB29 caused no renal abnormality in affected homozygous individuals (Wilcox et al., 2001). The lack of renal phenotype in CLDN14 KO animal or DFNB29 patient was compatible with our findings that CLDN14 gene expression was endogenously suppressed in absence of high Ca2+ intakes. The inventors previously described a CLDN16 knockdown (KD) and CLDN19 KD animal model that both recapitulated human autosomal recessive familial hypomagnesenia with hypercalciuria and nephrocalcinosis (FHHNC) phenotypes (Hou et al., 2007; 2009). Because CLDN14 inhibited the CLDN16-19 channel, knockout of CLDN14 generates a renal phenotype opposite to that in CLDN16 KD and CLDN19 KD.
To demonstrate in vive role of CLDN14 in the kidney, the inventors performed 24 hr urinalysis on CLDN14 KO mice and their littermate WT controls (Methods). Age and sex matched animals from each group were fed with high Ca2+ diet (III; Ca2+: 5%) for six consecutive days. The plasma Mg2+ level in CLDN14 KO mice was significantly higher (by 15%: p<0.05, n=6; Table 4) than in WT, whereas the circulating Ca2+ level was not significantly altered. CLDN14 KO mice showed defects in adjusting renal tubular absorption rate to excrete excess quantities of filtered Ca2+ and Mg2+. The fractional excretion rate for Ca2+ (FECa) in CLDN14 KO animals was 32% of the level in WT (p<0.01, n=6; Table 4); FEMg in CLDN14 KO was 45% of WT (p<0.05, n=6: Table 4). The glomerular filtration rate (GFR) was increased by 1.84-fold in CLDN14 KO animals (p<0.01, n=6: Table 4) compared to WT; whereas the urinary volume (UV) was not significantly different between CLDN14 KO and WT. A plausible explanation for GFR increases in CLDN14 KO mice would be stimulation of the tubuloglomerular feedback (TGF) owing to higher Na+ absorption through the CLDN16-19 channel in the TAL. The paracellular Na+ absorption accounts for one half of total Na+ absorption in the TAL (Hebert and Andreoli, 1986). These data demonstrate that CLDN14 regulates renal Ca2+ excretion to counterbalance dietary changes.
This example illustrates regulation of miR-9 and miR-374 gene expression by extracellular Ca2+ in the kidney.
The inventors investigated whether microRNAs themselves were regulated by extracellular Ca2+, which may suggest a physiological role for microRNAs in renal handling of Ca2+. Because CLDN14 gene expression was exclusively localized in the TAL, the inventors investigated where miR-9 and miR-374 were expressed in the kidney. Quantitative PCR measurements (normalized to U6 snRNA transcript) from micro-dissected nephron segments (
In the TAL of mouse kidneys receiving dietary Ca2+ variations, low Ca2+ diet (II) significantly upregulated miR-9 and miR-374 transcript levels by 1.76-fold and 1.29-fold respectively (p<0.05, n=5; relative to basal diet I;
This example illustrates that CaSR is required for extracellular Ca2+ regulation of CLDN14 and microRNAs.
CaSR is a molecule that plays a role in the TAL that senses circulating Ca2+ changes and regulates urinary excretion. To provide direct evidence that CaSR was required for Ca2+ regulation of CLDN14 and microRNAs in the TAL, the inventors knocked down endogenous CaSR expression in MKTAL cells by RNA interference and sought for deregulation of CLDN14 and microRNAs. A pre-validated siRNA reagent, containing a pool of 3 target-specific 21 nt siRNA duplexes designed against the mouse CaSR gene (Methods), was transfected into MKTAL cells prior to Ca2+ activation. A scrambled siRNA duplex was transfected as negative control. While extracellular Ca2+ (3 mM) increased CLDN14 mRNA levels (
The transcript levels of miR-9 and miR-374 were significantly decreased by Ca2+ treatments in scrb1-siRNA cells (miR-9: by 36%,
This example illustrates that pharmacological manipulation with calcimimetic and calcilytic compounds demonstrates CaSR dependent regulation of claudin-14 gene expression in the kidney.
To investigate how CaSR regulated claudin-14 in vivo in the kidney, age (8-10 weeks old) and sex (male) matched mice (strain: C57BL/6) were treated with NPS2143 and cinacalcet over a range of doses and durations, isolated kidneys at the end of each treatment and quantified claudin-14 mRNA and protein levels with real-time PCR and western blot respectively. Both NPS2143 and cinacalcet rapidly regulated the mRNA and protein levels of claudin-14 in the kidney. A single oral dose of NPS2143 at 30 mg/kg BW−1 significantly downregulated the mRNA level of claudin-14 by 80% (normalized to β-actin mRNA) at 2 hrs (p<0.01, n=3 versus vehicle level at 2 hrs:
Cinacalcet at a single oral dose of 30 mg/kg BW−1, on the other hand, significantly upregulated the mRNA level of claudin-14 by 3.3-fold at 2 hrs (p<0.01, n=3 versus vehicle level at 2 hrs:
Because of the low abundance of claudin-14 proteins in the whole kidney, an immunomagnetic separation method was adapted to freshly isolate the TALH tubular cells from the kidneys of each treated mouse, pooled the TALH cells from all animals (N=5) within each treatment group and quantified claudin-14 protein levels by western blot. While NPS2143 downregulated claudin-14 protein levels to 32% of the vehicle treatment on densitometric scale (
To determine the long-term effects of NPS2143 and cinacalcet on claudin-14 gene expression and knowing that a first dose of NPS2143 or cinacalcet (30 mg/kg BW−1) generated the most pronounced gene regulation of claudin-14 at 2 hrs that dissipated completely by 12 hrs, animals were given a second dose of NPS2143 or cinacalcet (30 mg/kg BW−1) at 12 hrs and measured claudin-14 gene expression at 14 hrs. The second dose of NPS2143 reduced claudin-14 mRNA levels by 77% (p<0.01, n=3 versus vehicle,
To distinguish from the observed short-term effects, animals were given an oral dose of NPS2143 or cinacalcet (30 mg/kg BW−1) per day for 6 days and measured claudin-14 gene expression 24 hrs following the last treatment. Neither NPS2143 nor cinacalcet caused changes in claudin-14 mRNA (
This example illustrates the gene regulation of claudin-14 by CASR is independent of the parathyroid hormone.
The inventors investigated whether CaSR regulation of claudin-14 depended upon the PTH secretion. In a previous report showed that, PTH, when supplemented to a cultured TALH cell model, had no effect on claudin-14 gene expression in vitro (see above). To test the PTH dependence of renal CaSR effects in vivo, the inventors applied the following three criteria.
(1) Changes in PTH alone did not induce claudin-14 gene regulation. In intact mice, there was no significant change in claudin-14 gene expression 8 hrs following a single dose of NPS2143 or cinacalcet (
(2) Hypocalcemia regulated claudin-14 gene expression independent of plasma PTH levels. Mice fed with low Ca2+ diet for 6 days (see Methods) showed hypocalcemia (p<0.05, n=5:
(3) PTH was not required for CaSR regulation of claudin-14 in the kidney. In TPTX treated mice with nominal presence of circulating PTH, cinacalcet at a single dose of 30 mg/kg BW−1 significantly upregulated claudin-14 expression levels by 3.41-fold at 2 hrs (p<0.05, n=5 versus vehicle:
These data suggest that the renal regulation of claudin-14 by CaSR will not require its endocrine role in the parathyroid gland.
This example illustrates that the renal calcium excretion response to calcimimetic and calcilytic treatment is abolished in claudin-14 knockout animals.
The inventors investigated whether claudin-14 underlays the renal role of CaSR in urinary Ca2+ handling. The claudin-14 KO mouse model that showed hypomagnesiuria and hypocalciuria under high Ca2+ dietary condition (described above). To investigate the functional role of claudin-14 in CaSR signaling, the inventors treated age (10-12 weeks old) and sex (male) matched claudin-14 KO mice (established on C57BL/6 strain: see Methods) and their littermate WT controls with NPS2143 or cinacalcet at a single dose of 30 mg/kg BW−1 (N=5-7 for each treatment group). The temporal phase of CaSR mediated claudin-14 gene regulation (
To capture the time sensitive changes in renal function, the inventors performed 1 hr renal clearance measurements on mice infused with FITC-inulin (see Methods) starting at 2 hrs and 8 hrs respectively. At 2 hrs, NPS2143 treatment significantly increased the plasma Ca2+ level (PCa) to 11.15±0.21 mg/dL in WT mice (versus 10.18±0.08 mg/dL in vehicle treated animals; p<0.05;
Plasma PTH levels were significantly affected by NPS2143 or cinacalcet at both 2 hrs and 8 hrs (p<0.05 versus vehicle;
The baseline plasma Mg2+ level was significantly higher in KO animals compared to that in WT animals (vehicle group; PMg: 2.71-0.05 mg/dL in KO versus 2.34±0.04 mg/dL in WT; p<0.01;
Both NPS2143 and cinacalcet dependent regulation of Pus (
This example illustrates transgenic overexpression of claudin-14 in the kidney induces hypercalciuria and hypermagnesiuria.
To provide in vivo evidence that manipulation of claudin-14 gene expression in the kidney per se is sufficient to cause calciuretic phenotypes, the inventors generated transgenic mouse models (established on C57BL/6x CBA hybrid background) to overexpress the claudin-14 gene selectively in the TALH epithelia of the kidney. The mouse claudin-14 gene was cloned downstream of a proven TALH-specific gene promoter—Tamm-Horsfall protein (THP; Stricklett et al., 2003) (
Because the transgene contained only the open reading frame (ORF) but no 5″- or 3″-untranslated region (UTR) of the claudin-14 gene, the inventors designed two pairs of primers to differentiate the transgenic from endogenous claudin-14 expression (
In WT mouse kidneys, claudin-14 was faintly immunostained in the TALH tubules showing interdigitated TJ pattern (arrow;
The glomerular filtration rate (GFR) based on creatinine clearance (Table S2) was not significantly different between TG and WT animals, nor was the urinary volume (UV) (Table S2). The phenotypes of plasma and urine electrolyte abnormalities of TG line #7 were recapitulated in a second transgenic line TG #24, whose total claudin-14 transcript level was 5.68-fold higher than WT (p<0.05, n=6).
These results have established the in vivo function of claudin-14 in the kidney that negatively regulates the paracellular divalent reabsorption, sharing characteristics with the renal phenotypes of claudin-16 KO and claudin-19 KO animals.
This example illustrates that microRNA transcription but not the claudin-14 promoter is directly regulated by CaSR.
MiR-9 is transcribed from 3 genomic loci in both human and mouse: miR-9-1, miR-9-2 and miR-9-3 (Ma et al., 2010). Human miR-374 has two isoforms—a and b, both sharing the same seed sequence and each having its own genomic locus. Mature human miR-374b is identical to mouse miR-374 that is transcribed from a single genomic locus, while human miR-374a has no mouse homologue.
To measure the transcriptional level for microRNA gene in vivo in the kidney, the inventors designed primers (see Methods; Table 2) to amplify the pri-miRNA molecule, the original transcript for microRNA gene that had not yet been subjected to any nuclear or cellular processing. Because both miR-9 and miR-374 had broader localization profiles along the nephron, the inventors isolated the TALH tubular cells for pri-miRNA analyses from the mouse kidney described elsewhere in this study. WT mice (strain: C57BL/6) were treated with NPS2143 or cinacalcet as described for claudin-14 analyses and assayed for pri-miRNA levels in isolated TALH cells at 2 hrs and 8 hrs respectively. Among the three miR-9 genes, miR-9-1 was the most sensitive to CaSR modulation: showing a 7.65-fold increase in its pri-miRNA transcript level 2 hrs after single-dose 30 mg/kg BW−1 NPS2143 treatment (p<0.01, n=4 versus vehicle;
The inventors investigated whether CaSR regulation of pri-miRNA depended upon PTH secretion. In TPTX treated mice (Methods), cinacalcet at a single dose of 30 mg/kg BW−1 significantly reduced pri-miR-9-1 and pri-miR-374 levels by 55% and 53% respectively at 2 hrs (p<0.01, n=5 versus vehicle;
The inventors also sought for alternative mechanisms for claudin-14 gene regulation. Because the claudin-14 KO mouse was generated with a lacZ reporter gene replacing the last exon of claudin-14 gene (including the coding region and 3″-UTR) (Ben-Yosef et al., 2003), the expression of lacZ gene would provide a faithful measurement for endogenous claudin-14 promoter activity regardless of any microRNA based regulation. The claudin-14+/lacZ mice were treated with cinacalcet or NPS2143 as described for WT mice. At 2 hrs after single-dose 30 mg/kg BW−1 treatment, cinacalcet caused no change in lacZ mRNA levels (normalized to β-actin mRNA; n=4:
This example illustrates that a calcineurin inhibitor abrogates CaSR mediated regulation of claudin-14, microRNAs and urinary Ca2+ excretion.
The calcineurin inhibitor cyclosporine-A induces hypomagnesemia and hypercalciuria in laboratory animals, previously thought to occur because of disturbed TRPV5 and TRPM6 channel expression in the kidney (Nijenhuis et al., 2004). A recent study has found that cyclosporine-A reduced the paracellular but not transcellular divalent cation transport in cultured mouse TALH cells in vitro (Chang et al., 2007). To determine how cyclosporine-A affected claudin-14 gene expression and renal Ca2+ handling in vivo, the inventors pre-treated WT mice (strain: C57BL/6) with cyclosporine-A (Sandimmune) at a single I.P. dose of 25 mg/kg BW−1 per day for 6 consecutive days followed by NPS2143 or cinacalcet treatment on the 6th day (Methods).
Cyclosporine-A pre-treatment did not affect the basal level of claudin-14, pri-miR-9-1 or pri-miR-374 in the TALH of the kidney. Calcimimetic and calcilytic effects were, however, significantly attenuated by cyclosporine-A pre-treatments. At 2 hrs after single-dose 30 mg/kg BW−1 treatment, NPS2143 failed to elicit any significant change in claudin-14 (n=5 versus vehicle:
The inventors investigated whether the calciuretic response to CaSR modulation was also attenuated by cyclosporine-A. Because the control animals for cyclosporine-A treatment (injected with Sandimmune solvent; see Methods) showed no difference in their plasma and urinary electrolyte levels from WT animals, their physiological data were not shown, instead the WT animal data presented in
This example illustrates that CaSR signaling involves NFAT dependent regulation of microRNA promoters.
Calcineurin is a protein phosphatase that regulates a class of transcriptional factors known as NFATs. NFATs transduce the calcineurin signals to gene regulation in the nucleus (Crabtree and Olson, 2002). The TALH cell is sensitive to calcineurin signaling. Cyclosporine regulates the gene expression of NKCC2 and prostaglandin E2 in the mouse and rat TALH cells (Chang et al., 2005; Esteva-Font et al., 2007). The inventors investigated which isoform of NFATs was expressed in the TALH of the kidney. With primers designed against the four cellular isoforms of NFATs (NFATc 1-4; Table 2), the inventors detected predominant gene expression of NFATc1, c2 and c3 but not c4 in immuno-isolated mouse TALH cells (
The inventors transfected a constitutively active mutant of NFATc 1 (with 21 Serine to Alanine mutations; named NFATc1nuc; see Methods; Winslow et al., 2006) into primary TALH cells. Transfection with NFATc1nuc significantly decreased the transcriptional level of claudin-14 by 48% (p<0.01, n=3 versus vector control;
The inventors sought for evidence of NFATc1 regulating endogenous miR-9-1 and miR-374 promoters in native TALH cells and in presence of intact chromatin. Chromatin immunoprecipitation (ChIP) was carried out in mouse primary TALH cells transfected with NFATc1nuc or its vector control. ChIP primers were designed to span the NFAT binding sites (
The inventors questioned if CaSR signaling induces NFATc1 dependent regulation of microRNA in vivo. To manipulate CaSR signaling in vivo in the kidney, the inventors treated WT mice with NPS2143 or cinacalcet at a single dose of 30 mg/kg BW−1 as described elsewhere in this study, isolated the TALH cells at 2 hrs following each drug treatment and performed ChIP analyses on isolated TALH cells from each mouse. NPS2143 treatment significantly increased the fold enrichment of NFATc 1 over the promoter regions of miR-9-1 and miR-374 containing NFAT binding sites, by 3.55-fold (p<0.01, n=5 versus vehicle:
This example illustrates that anti-microRNAs can treat hypercalcemia.
Anti-miR-9 and anti-miR-374 were tested in freshly isolated mouse TALH tubular cells. Transfection of 50 pmol anti-miR-9 or anti-miR-374 significantly increased the expression level of claudin-14 in mouse TALH cells by 3.07-fold and 5.31-fold respectively (p<0.01, n=5 versus control: (
These data have provided evidence that manipulation at the level of microRNA can affect renal handling of calcium metabolism, in line with the signaling cascade of CaSR-NFAT-microRNA-claudin-14 the inventors discovered from hypercalcemic animals. An immediate clinic application of this technology will be to treat hypercalcemic patients without inducing unwanted changes in circulating PTH levels.
The following antibodies were used in this study: rabbit polyclonal anti-THP (Biomedical Technologies): rabbit polyclonal anti-CLDN14 (against RAPSVTSAAHSGYRLNDYV) (SEQ ID NO: 39); rabbit polyclonal anti-CLDN16 (against SYSAPRTETAKMYAVDTRV) (SEQ ID NO: 5); rabbit polyclonal anti-CLDN19 (against NSIPQPYRSGPSTAAREYV) (SEQ ID NO: 6). Human HEK293 cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate. WT C57BL/6 mice were from Charles River Laboratory. The CLDN14+/lacZ reporter/knockout mice were back-crossed to C57BL/6 background for 7 generations.
SAHA and TsA were dissolved in 5% (w/v) ethanol/0.9% saline solution and fed to mice with gavage syringe. Furosemide was dissolved in 50% (w/v) DMSO/0.9% saline solution and I.P. injected to animals. All animals had free access to water and were housed under a 12 hr light cycle. Blood samples were taken by cardiac puncture rapidly after initiation of terminal anesthesia and centrifuged at 4° C. for 10 min. Kidney were dissected out and immediately frozen at −80° C.
Mice were housed individually in metabolic cages (Harvard Apparatus) with free access to water and food for 24 hr. Urine was collected under mineral oil. The plasma and urine Ca++ and Mg++ levels were determined with atomic flame absorption spectrophotometer (PerkinElmer). The creatinine levels were measured with an enzymatic method that was independent of plasma chromogens. (Gong Y, et al., 2013) The fractional excretion of electrolytes was calculated using the following equation FEion=V×Uion/(GFR×Pion), where GFR was calculated according to the clearance rate of creatinine (GFR=V×Ucreatinine/Pcreatinine).
An immunomagnetic separation method was used to isolate the TALH cells from the mouse kidney. (Gong Y, et al. 2012 and Gong Y, et al. 2013) Antibodies against the TALH cell specific surface antigen, Tamm-Horsfall protein, were coated onto the paramagnetic polystyrene beads (Dynabeads M-280; Dynal), allowing immunoprecipitation of the TALH cells from collagenase digested mouse kidneys. The isolated cells were plated in DMEM medium supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate for 16 hours, followed by immediate treatment.
Total RNA including microRNA was extracted using Trizol (Invitrogen). Cellular mRNA was reverse transcribed using the Superscript-III kit (Invitrogen), followed by real-time PCR amplification using SYBR Green PCR Master Mix (Bio-Rad) and Eppendorf Realplex2S system. The design of claudin-14 primers was described before by Gong et al., 2012. The design of pri-miRNA primers and ChIP primers was according to Gong et al., 2013. Results were expressed as 2−ΔCt values with ΔCT=Ctgene−Ctβ-actin.
Freshly isolated TALH cells or primary TALH cell cultures were cross-linked in 1% paraformaldehyde (pH7.0) for 10 min at room temperature. The cross-linked cells were lysed following to instruction of MAGnify ChIP system (Invitrogen). Chromatin was sonicated into 500 bp fragments with Bioruptor UCD-200 (High power, 15 cycles of 30 seconds ON, 30 seconds OFF; Diagenode). Sheared chromatin was precipitated with antibody-bound Dynabeads (Invitrogen). Following reverse crosslink and DNA extraction, antibody-bound DNA was eluted and analyzed with real-time PCR. Two criteria for normalization were applied: fold enrichment over anti-IgG background signal and input control over chromatin input signal.
For viewing claudin localization in the kidney, fresh cryostat sections (10 μm) were fixed with cold methanol at −20° C., followed by blocking with PBS containing 10% FBS, incubation with primary antibody (1:300) and FITC-labeled secondary antibody (1:200). After washing with PBS, slides were mounted with Mowiol (Calbiochem). Epifluorescence images were taken with a Nikon 80i photomicroscope equipped with a DS-Qi1Mc digital camera. All images were converted to TIFF format and arranged using Photoshop CS4 (Adobe).
Antagomirs for miR-9, miR-374, and scrambled control miRNA were synthesized by Exiqon using locked nucleic acids (LNAs) using the following sequences: Anti-miR-9: A*T*+A*C*A*+G*C*T*+A*G*A*+T*A*A*+C*C*A*+A*A*G; Anti-miR-374: A*C*+T*T*A*+G*C*A*+G*G*T*+T*G*T*+A*T*T*+A*T*A; where DNA base: G, A, T, C: LNA™ base: +G, +A, +T, +C; Phosphorothioated DNA base: G*, A*, T*, C*. In vitro, 30 pmol of each antagomir was transfected to the primary cultures of TALH in 12-well culture dishes using Lipofectamine 2000 (Invitrogen). In vivo, each antagomir was mixed with the in vivo-jetPEI™ Delivery Reagent (VWR) according to the manufacturer's guideline, followed by I.P. injection to animals at the dose of 2.5 mg/kg BW−1.
Eight idiopathic calcium stone formers and seven healthy controls were studied. Stone formers and controls were enrolled in the year of 2013 in the Outpatient clinics of the Italian Centers participating to the GENIAL Network. All patients had idiopathic kidney stones that were radio-opaque and/or composed of calcium-oxalate at the chemical or infrared spectrometric analysis. They were not taking drugs affecting electrolyte handling. Serum and urinary concentrations of calcium were measured. Urinary pH was lower than 5.5 in spot morning collections. Controls had negative personal and familial history of kidney stones, normal serum creatinine and calcium and no evidence of diseases at physical examination.
Urine (50 ml) was collected from kidney stone patients and healthy controls from spot afternoon collections. The urinary exosomes were isolated from each urine sample using the Total Urine Exosome Isolation kit (Invitrogen) according to manufacturer's guideline. Following ultracentrifugation, the pellet was resuspended in SDS lysis buffer containing 150 mM NaCl; 1% SDS; 50 mM Tris, pH 8.0; and protease inhibitors, and then subjected to western blotting. A novel antibody against the human CLDN14 sequence (aa. 29-81 corresponding to the first extracellular loop) was raised to detect the CLDN14 protein in urinary exosomes.
The significance of differences between groups was tested by ANOVA (Statistica 6.0; Statsoft). When the all-effect F value was significant (p<0.05), post hoc analysis of differences between individual groups was made with the Newman-Keuls test. Values were expressed as mean±SEM, unless otherwise stated.
□p < 0.05,
□□p < 0.01 versus Veh treatment in the same group;
This example illustrates in vivo effects of histone deacetylase inhibitors on CLDN114.
To examine the in vivo effects of histone deacetylase inhibitors on CLDN14, the inventors gave wild-type C57BL/U6 mice systemic treatments of SAHA or TsA over a range of doses and durations. A single dose of SAHA at 25 mg/kg BW−1 reduced CLDN14 mRNA levels in the kidney by 56% (p<0.01, n=5 versus vehicle:
The inventors varied the SAHA treatment doses from 5 mg/kg to 25 mg/kg; and found downregulation of CLDN14 at dosage as low as 5 mg/kg (p<0.05, n=5 versus vehicle) and through 10 mg/kg to 25 mg/kg at 4 hrs (
The CLDN14 protein levels were measured in freshly isolated TALH cells pooled from SAHA or vehicle treated mouse kidneys (n=5). SAHA treatment of 25 mg/kg BW−1 reduced the CLDN14 protein levels by 60% when assayed at 4 hr. TsA was more effective in suppressing CLDN14 expression. At 1 mg/kg BW−1 and 4 hr time point, TsA decreased CLDN14 mRNA levels in the kidney significantly, by 71% (p<0.001, n=5 versus vehicle:
Because the inventors had a claudin-14 KO/Reporter mouse line that was generated with a lacZ reporter gene replacing the last exon of claudin-14 gene (including the entire coding region and the 3′-UTR), (Ben-Yosef, T., et al., 2003) the inventors used the expression levels of lacZ gene as a faithful measurement for endogenous CLDN14 promoter activity regardless of any microRNA based regulation. The lacZ mRNA levels in the KO mouse kidneys were with no significant change 4 hrs after receiving 25 mg/kg BW−1 SAHA treatment (
The inventors determined if SAHA caused direct histone acetylation on the microRNA promoters. The inventors previously discovered a NFAT binding site (AGGAAAAT) located 1-2 kb upstream of the miR-9-1 or miR-374 hairpin sequence (Gong Y, et al., 2013) where the histone acetylation was vividly regulated through CaSR signaling. The inventors found that the same promoter region experienced significant increases in histone H3 Lysine-9 (H3K9) and Lysine-14 (H3K14) acetylation 4 hrs after receiving SAHA at 25 mg/kg BW−1, by 2.40-fold for miR-9-1 (p<0.05, n=5;
This example illustrates that curbing CLDN14 expression lowers urinary Ca++ excretion.
In these experiments, the inventors gave wild-type C57BL/6 mice SAHA treatments at 5 mg/kg BW−1 and traced urinary Ca++ and Mg++ levels (as ratios to creatinine) from 4 hr to 12 hr in spot urine collections. Consistent with the downregulation of CLDN14 gene expression at 4 hrs, the urinary excretion of Ca++ and Mg++ was reduced by 47% and 40% respectively (p<0.01, n=5 versus vehicle,
To investigate the renal transport function over a chronic phase, the inventors performed 24 hr urinalysis on age- and sex-matched wild-type mice receiving SAHA at 10 mg/kg BW−1 per day. The plasma levels for Ca++ (PCa) and Mg++ (PMg) in SAHA-treated animals were both significantly higher than the vehicle group (p<0.05, n=9; Table 5), compatible with the observation of significantly reduced fractional excretion rates for Ca++ (FECa;
To elucidate the genetic origin of SAHA effects, the inventors took used the CLDN14 KO mice (previously backcrossed to C57BL/6 background; Gong Y, et al., 2012) and treated them with the same SAHA regimen. In contrast to the wild-type mice, the CLDN14 KO animals were refractory towards SAHA induced hypocalciuria and hypomagnesiuria (
This example illustrates the effects of an HDAC inhibitor on other Ca++ related hormonal or genetic pathways in the kidney.
Chronic SAHA treatment can induce mild hypercalcemia, therefore the inventors measured the circulating PTH, 1,25-(OH)2-vitD3 and FGF23 levels to determine if hypercalcemia originated from changes in these hormonal systems. None of these hormones changed during SAHA treatments (
This example illustrates effects of microRNAs on renal calcium metabolism.
To investigate whether manipulation of microRNAs per se was sufficient to induce changes in renal calcium metabolism, the inventors screened for LNA sequences ranging from 8 nt to 23 nt long (Obad, S. et al., 2011; Elmén, J., et al., 2008; and Castoldi, M., et al., 2011) and found the most effective sequences for miR-9 and miR-374 (see Method). In the primary TALH cultures in vitro, transfection with anti-miR-9 or anti-miR-374 but not scrambled antagomir induced significant increases in CLDN14 gene expression by 3.07-fold and 5.31-fold respectively (p<0.001, n=−4;
Wild-type C57BL/6 mice were given anti-miR-374 injections at 2.5 mg/kg BW−1 per day and measured CLDN14 protein abundance, localization, and plasma and urinary electrolytes levels. In freshly isolated TALH cells pooled from antagomir treated mouse kidneys (n=5), the CLDN14 protein level was 3.25-fold higher with anti-miR-374 than scrambled antagomir treatment (
The anti-miR-374 knockdown animals phenocopied the CLDN14 transgenic overexpression animals described by us (Gong Y., et al., 2013) establishing a therapeutic principle for using microRNAs to manipulate CLDN14 expression and urinary calcium excretion.
This example illustrates that the renal expression levels of CLDN14 can serve as a reporter for a range of Ca++ related pathophysiological abnormalities, including kidney stone diseases.
The inventors used an antibody against the first extracellular loop of CLDN14 (see Methods) to detect the CLDN14 protein from human urine exosomes. The inventors recruited 8 calcium oxalate stone formers (SF: n=3 hypercalciuric patients [37.5%]) and 7 healthy volunteers (HV) with no history of kidney stone. All stone formers had recurring kidney stones with the latest episode occurring in year 2013. Their 24 hr urinary Ca++ excretion levels were 236.8±34.4 mg, serum Ca++ 9.48±0.08 mg/dL; and blood pressure normal. The CLDN14 proteins levels from isolated urinary exosomes were consistently higher in SF than HV (
The reagents, kits, and antibodies were listed in Table 9. Human HEK293 cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate. WT C57BL/6 mice were from Charles River Laboratory. The CLDN14+/lacZ reporter/knockout mice were back-crossed to C57BL/6 background for 7 generations. Thyroparathyroidectomy (TPTX) was performed by Charles River Lab surgeons.
NPS2143 and cinacalcet (Table 9) were dissolved in vehicle −20% (w/v) (2-Hydroxypropyl)-β-cyclodextrin solution and fed to mice with gavage syringe. Cyclosporin-A (Sandimmune; Table 9) was diluted in 0.9% saline and I.P. injected to animals. Control animals received CNI vehicle injection (13% wiv Cremophor EL and 32.9% ethanol). FK506 was dissolved in CNI vehicle, diluted in 0.9% saline and I.P. injected to animals. For dietary Ca+ manipulation, animals were fed with the following diets for six consecutive days: basal diet: 0.610% Ca++ (TestDiet #5755); low Ca++ diet: 0 Ca++ (TestDiet #5855); high Ca++ diet: 5% Ca+ (TestDiet #5AVB). All animals had free access to water and were housed under a 12 hr light cycle. Blood samples were taken by cardiac puncture rapidly after initiation of terminal anesthesia and centrifuged at 4° C. for 10 min. Kidney were dissected out and immediately frozen at −80° C.
The method for performing renal clearance measurements in the mouse has been described by Hou, J., et al., 2007 and Hou, J., et al., 2009. Mice were anesthetized by i.p. injection of Inactin (Sigma: 100 mg/kg). The jugular vein was catheterized for i.v. infusion of 0.9% saline at 2 μL/min, with 1% FITC-inulin included in the infusate. After an equilibration period of 60 min, renal clearance measurements were carried out for a 60 min period. Urine was collected under mineral oil, and 30 μL blood sample was taken at hourly intervals. Urine and plasma Ca++ and Mg++ concentrations were measured by atomic flame absorption spectrophotometer (PerkinEhner). Urine and plasma FITC-inulin levels were measured in 100 mM HEPES buffer (pH7.0) with fluorescence spectrophotometer (BioTek). The fractional excretion of electrolytes was calculated using the following equation FEion=V×Uion/(GFR×Pion), where GFR was calculated according to the clearance rate of FITC-inulin (GFR=V×Uinulin/Pinulin).
Mice were housed individually in metabolic cages (Harvard Apparatus) with free access to water and food for 24 hr. Urine was collected under mineral oil. The plasma and urine Ca++ and Mg++ levels were determined with atomic flame absorption spectrophotometer (PerkinElmer). The creatinine levels were measured with an enzymatic method that was independent of plasma chromogens. (Himmerkus, N., et al., 2008) The fractional excretion of electrolytes was calculated using the following equation FEion=V×Uion/(GFR×Pion), where GFR was calculated according to the clearance rate of creatinine (GFR=V×Ucreatinine/Pcreatinine).
The coding sequence of mouse claudin-14 gene was cloned into a bicistronic pIRES-GFP vector (Clontech). A 3.7 kb mouse Tamm-Horsfall protein (THP) promoter (Stricklett, P. K., et al., 2003) was cloned into the pIRES-GFP vector to replace the CMV promoter. Inclusion of GFP allowed rapid screening of transgene expression in the kidney. To generate claudin-14 overexpression transgenic (TG) mice, female donor mice (C57BL/6x CBA hybrid strain) were superovulated with a combination of pregnant mare serum (5 units) and human CG (5 units). The transgenic vector was injected into the pronucleus of single-cell mouse embryos and allowed to develop to two-cell embryo stage. Injected embryos were implanted into pseudopregnant females and carried to term. The transgenic founder mice were crossed to WT C57BL/6 mice, and F1 progeny were analyzed. Littermate WT mice were used as controls. Out of 41 transgenic founders, 9 had germ-line transmission of transgene; 4 had detectable transgene expression in the kidney.
An immunomagnetic separation method was used to isolate the TALH cells from the mouse kidney. (Gong, Y., et al., 2012; Hou, J., et al., 2009) Antibodies against the TALH cell specific surface antigen, Tamm-Horsfall protein (THP; a GPI-anchored protein that is exclusively expressed in the TALH and the early part of the DCT,) (Stricklett, P. K., et al., 2003; Bernascone, I., et al., 2010) were coated onto the paramagnetic polystyrene beads (Dynabeads M-280; Dynal), allowing immunoprecipitation of the TALH cells from collagenase digested mouse kidneys. The isolated cells were plated in DMEM medium supplemented with 10% FBS, penicillin/streptomycin, and 1 mM sodium pyruvate for 16 hours, followed by immediate transfection with NFAT.
Total RNA including microRNA was extracted using Trizol (Invitrogen). Cellular mRNA was reverse transcribed using the Superscript-III kit (Invitrogen), followed by real-time PCR amplification using SYBR Green PCR Master Mix (Bio-Rad) and Eppendorf Realplex2S system. The design of claudin-14 primers was described before by Gong. Y., et al., 2012. The design of pri-miRNA primers was according to Ma. L., et al., 2010. The PCR primers are listed in Table 2. Results were expressed as 2−ΔCt values with ΔCT=Ctgene−Ctβ-actin.
Pre-validated Silencer Select siRNAs were designed and synthesized by Ambion. A pool of 3 target-specific 21 nt siRNA duplexes was designed against the coding region of mouse NFATc1-c4 genes. A scrambled siRNA duplex was used as negative control. Transfection of siRNAs or NFATc1nuc was carried out with Lipofectamine LTX & Plus Reagent for primary cultures.
The miR-9-1 and miR-374 gene promoters were cloned into pGL4.10 luciferase reporter (Promega) with Sfi1 sites. Deletion of the NFAT binding sites (AGGAAAAT) in miR-9-1 and miR-374 promoters were generated using site-directed mutagenesis (Stratagene). The pGL4.10 reporter (500 ng), the pGL4.74 Renilla luciferase control vector (500 ng; Promega) and pcDNA3.1-NFATc1nuc vector were co-transfected to HEK293 cells in 12-well culture dishes using Lipofectamine-2000 (Invitrogen). Twenty-four hours after transfection, firefly and renilla luciferase activities were measured with a chemiluminescence reporter assay system—Dual Glo (Promega) in a GLOMAX Luminometer (Promega).
Freshly isolated TALH cells or primary TALH cell cultures were cross-linked in 1% paraformaldehyde (pH7.0) for 10 min at room temperature. The cross-linked cells were lysed following to instruction of MAGnify ChIP system (Invitrogen). Chromatin was sonicated into 500 bp fragments with Bioruptor UCD-200 (High power, 15 cycles of 30 seconds ON, 30 seconds OFF, Diagenode). Sheared chromatin was precipitated with antibody-bound Dynabeads (Invitrogen). Following reverse crosslink and DNA extraction, antibody-bound DNA was eluted and analyzed with real-time PCR. The primers for ChIP analyses are listed in Table 2. Two criteria for normalization were applied: fold enrichment over anti-IgG background signal and input control over chromatin input signal.
For viewing claudin localization in the kidney, fresh cryostat sections (10 μm) were fixed with cold methanol at −20° C., followed by blocking with PBS containing 10% FBS, incubation with primary antibody (1:300) and FITC-labeled secondary antibody (1:200). After washing with PBS, slides were mounted with Mowiol (Calbiochem). Epifluorescence images were taken with a Nikon 80i photomicroscope equipped with a DS-Qi1Mc digital camera. All images were converted to TIFF format and arranged using Photoshop CS4 (Adobe).
The significance of differences between groups was tested by ANOVA (Statistica 6.0; Statsoft). When the all-effect F value was significant (p<0.05), post hoc analysis of differences between individual groups was made with the Newman-Keuls test. Values were expressed as mean±SEM, unless otherwise stated.
This example illustrates pharmacological manipulation with calcimimetic and calcilytic compounds demonstrating CaSR dependent regulation of claudin-14 gene expression in the kidney.
The CaSR agonist cinacalcet (calcimimetic) has been used for the treatment of secondary hyperparathyroidism in chronic kidney disease (CKD) and dialysis patients. (Lindberg. J. S., et al., 2005) NPS2143 is a novel CaSR antagonist that has been previously demonstrated to increase serum Ca++ level independent of PTH secretion. (Loupy, A., et al., 2012) The kidney CaSR is predominantly expressed in the TALH, (Loupy, A., et al., 2012) co-localizing with claudin-14. To investigate how CaSR regulated claudin-14 in vive in the kidney, the inventors treated age (8-10 weeks old) and sex (male) matched mice (strain: C57BL/6) with NPS2143 and cinacalcet over a range of doses and durations, isolated kidneys at the end of each treatment and quantified claudin-14 mRNA and protein levels with real-time PCR and western blot respectively.
Both NPS2143 and cinacalcet rapidly regulated the mRNA and protein levels of claudin-14 in the kidney. A single oral dose of NPS2143 at 30 mg/kg BW−1 downregulated the mRNA level of claudin-14 by 80% (normalized to β-actin mRNA) at 2 hrs (p<0.01, n=3 versus vehicle;
To determine the dosage effect of NPS2143 and cinacalcet, the inventors selected the time point for both drugs at 2 hrs. Across the doses of 15, 30 and 45 mg/kg BW−1, NPS2143 treatments generated progressive reduction of claudin-14 mRNA levels, by 45%, 82% and 89% respectively (p<0.05, n=4 versus vehicle;
Changes in claudin-14 protein levels were captured as early as 2 hrs following a single oral dose of NPS2143 or cinacalcet (30 mg/kg BW−1) treatment. Because of the low abundance of claudin-14 proteins in the whole kidney, the inventors adapted an immunomagnetic separation method to freshly isolate the TALH tubular cells from the kidneys of each treated mouse (described in Gong, Y., et al., 2012 and Hou, J., et al. 2009; see Methods), pooled the TALH cells from all animals (N=5) within each treatment group, isolated plasma membrane proteins and quantified claudin-14 protein levels by western blot. While NPS2143 down-regulated claudin-14 protein levels to 32% of the vehicle treatment on densitometric scale (
Using antibody methods (see Methods) the inventors detected claudin-14 proteins in tight junctions of vehicle treated mice that showed an interdigitated pattern characteristic of the TALH tubule (
To determine the long-term effects of NPS2143 and cinacalcet on claudin-14 gene expression, the inventors explored whether pretreatment of NPS2143 or cinacalcet for 12 hrs would interfere with their short-term effects. Since the inventors determined that a first dose of NPS2143 or cinacalcet (30 mg/kg BW−1) generated the most pronounced gene regulation of claudin-14 at 2 hrs that dissipated completely by 12 hrs, the inventors gave animals a second dose of NPS2143 or cinacalcet (30 mg/kg BW−1) at 12 hrs and measured claudin-14 gene expression at 14 hrs. The second dose of NPS2143 reduced claudin-14 mRNA levels by 77% (p<0.01, n=3 versus vehicle;
The inventors explored whether continuous treatments with NPS2143 or cinacalcet for 6 days would pre-program claudin-14 gene expression. To distinguish from the observed short-term effects, the inventors gave animals an oral dose of NPS2143 or cinacalcet (30 mg/kg BW−1) per day for 6 days and measured claudin-14 gene expression 24 hrs following the last treatment. Neither NPS2143 nor cinacalcet caused changes in claudin-14 mRNA (
The inventors explored whether CaSR regulation of claudin-14 depended upon the PTH secretion. In thyroparathyroidectomy (TPTX) mice with nominal absence of circulating PTH, cinacalcet at a single dose of 30 mg/kg BW−1 significantly upregulated claudin-14 expression levels by 3.41-fold at 2 hrs (p<0.05, n=5 versus vehicle;
This example illustrates physiological Ca++ regulation abolished in claudin-14 knockout animals
The inventors explored whether claudin-14 underlay the physiological role of CaSR in renal Ca++ transport. The inventors previously described a claudin-14 KO mouse model that showed hypomagnesiuria and hypocalciuria under high Ca++ dietary condition. (Gong, Y., et al. 2012) To investigate the functional role of claudin-14 in CaSR signaling, the inventors treated age (10-12 weeks old) and sex (male) matched claudin-14 KO mice (established on C57BL/6 strain; Methods) and their littermate WT controls with NPS2143 or cinacalcet at a single dose of 30 mg/kg BW−1 (N=5-7 for each treatment group). The time dependent change in CaSR mediated claudin-14 gene regulation (
To capture these changes in renal excretion function, the inventors performed 1 hr renal clearance measurements on mice infused with FITC-inulin (Methods) starting at 2 hrs and 8 hrs respectively. At 2 hrs, NPS2143 treatment significantly increased the plasma Ca++ level (PCa) to 11.15±0.21 mg/dL in WT mice (versus 10.18±0.08 mg/dL in vehicle treated animals; p<0.05;
Renal handling of Mg++ was similar to that of Ca++ in WT mice. The plasma Mg++ level (PMg) was significantly altered by NPS2143 and cinacalcet at 2 hrs but returned to baseline at 8 hrs (
Plasma PTH levels were significantly affected by NPS2143 or cinacalcet at both 2 hrs and 8 hrs (p<0.05 versus vehicle:
The baseline plasma Mg++ level was significantly higher in KO animals compared to that in WT animals (vehicle group; PMg: 2.71±0.05 mg/dL in KO versus 2.34±0.04 mg/dL in WT: p<0.01;
This example illustrates transgenic overexpression of claudin-14 in the kidney induces hypercalciuria and hypermagnesiuria
In a previous report, the inventors demonstrated that claudin-14 interacts with and inhibits claudin-16 channel permeability using several in vitro biochemical, biophysical and cellular criteria. (Gong, Y., et al., 2012) To provide in vivo evidence that manipulation of claudin-14 gene expression in the kidney per se is sufficient to disrupt Ca++ transport, the inventors generated transgenic mouse models (established on C57BL/6x CBA hybrid background) to overexpress the claudin-14 gene selectively in the TALH epithelia of the kidney. The mouse claudin-14 gene was cloned downstream of a proven TALH-specific gene promoter—Tamm-Horsfall protein (THP) (Hou, J., et al., 2009) (
After transgenesis (see Methods), the TALH tubules were immuno-isolated from mature hemizygous transgenic mouse kidneys for quantitative analyses of claudin-14 gene expression. Because the transgene contained the open reading frame (ORF) but no 5′- or 3′-untranslated region (UTR) of the claudin-14 gene, the inventors designed two pairs of primers to differentiate the transgenic from endogenous claudin-14 expression (
The total claudin-14 mRNA level (normalized to j3-actin mRNA) was increased by 4.73-fold (p<0.05, n=6;
In WT mouse kidneys, claudin-14 was faintly inmumostained in the TALH tubules showing interdigitated TJ pattern (arrow;
This example illustrates that microRNA transcription but not the claudin-14 promoter is directly regulated by CaSR
The inventors identified a microRNA-based mechanism involving two microRNA molecules—miR-9 and miR-374 in the TALH of the kidney to regulate claudin-14 mRNA decay and translational repression through reciprocal changes of their own cellular abundance in response to CaSR signals. (Gong, Y., et al., 2012) MiR-9 is transcribed from 3 genomic loci in both human and mouse: miR-9-1, miR-9-2 and miR-9-3. (Ma, L., et al., 2010) Human miR-374 has two isoforms—a and b, both sharing the same seed sequence and each having its own genomic locus. Mature human miR-374b is identical to mouse miR-374 that is transcribed from a single genomic locus, while human miR-374a has no mouse homologue. To measure the transcriptional level for microRNA gene in vivo in the kidney, the inventors designed primers (Methods; Table 2) to amplify the pri-miRNA molecule, the original transcript for microRNA gene that had not yet been subjected to any nuclear or cellular processing.
Because both miR-9 and miR-374 had broad localization profiles along the nephron (Gong, Y., et al., 2012), the inventors isolated the TALH tubular cells for pri-miRNA analyses from the mouse kidney described elsewhere in this study. WT mice (strain: C57BL/6) were treated with NPS2143 or cinacalcet as described for claudin-14 analyses and assayed for pri-miRNA levels in isolated TALH cells at 2 hrs and 8 hrs respectively. Among the three miR-9 genes, miR-9-1 was the most sensitive to CaSR modulation: showing a 7.65-fold increase in its pri-miRNA transcript level 2 hrs after single-dose 30 mg/kg BW−1 NPS2143 treatment (p<0.01, n=4 versus vehicle;
The inventors investigated whether CaSR regulation of pri-miRNA depended upon PTH secretion. In TPTX treated mice (described above), cinacalcet at a single dose of 30 mg/kg BW−1 significantly reduced pri-miR-9-1 and pri-miR-374 levels by 55% and 53% respectively at 2 hrs (p<0.01, n=5 versus vehicle;
The inventors explored alternative mechanisms for claudin-14 gene regulation. Because the claudin-14 KO mouse was generated with a lacZ reporter gene replacing the last exon of claudin-14 gene (including the coding region and 3′-UTR; Ben-Yosef, T., et al., 2003) the expression of lacZ gene would provide a faithful measurement for endogenous claudin-14 promoter activity regardless of any microRNA based regulation. The claudin-14+/lacZ mice were treated with cinacalcet or NPS2143 as described for WT mice. At 2 hrs after single-dose 30 mg/kg BW−1 treatment, cinacalcet caused no change in lacZ mRNA levels (normalized to β-actin mRNA: n=4;
This example illustrates a calcineurin inhibitor abrogating CaSR mediated regulation of claudin-14, microRNAs and urinary Ca++ excretion.
The calcineurin inhibitor cyclosporine-A induces hypomagnesemia and hypercalciuria in laboratory animals, previously thought to occur because of disturbed TRPV5 and TRPM6 channel expression in the kidney. (Nijenhuis, T., et al., 2004) Cyclosporine-A reduces the paracellular but not transcellular divalent cation transport in cultured mouse TALH cells in vitro. (Chang, C. T., et al., 2007) To investigate how cyclosporine-A affects claudin-14 gene expression and renal Ca++ handling in vivo, the inventors pre-treated WT mice (strain: C57BL/6) with cyclosporine-A (Sandimmune) at a single I.P. dose of 25 mg/kg BW−1 per day for 6 consecutive days followed by NPS2143 or cinacalcet treatment on the 6th day (as described above). Cyclosporine-A pre-treatment did not affect the basal level of claudin-14, pri-miR-9-1 or pri-miR-374 in the TALH of the kidney.
Calcimimetic and calcilytic effects were, however, significantly attenuated by cyclosporine-A pre-treatments. At 2 hrs after single-dose 30 mg/kg BW−1 treatment, NPS2143 failed to elicit any significant change in claudin-14 (n=5 versus vehicle;
Pre-treatment with FK506 (Tacrolimus) at a single I.P. dose of 3 mg/kg BW−1 per day for 6 consecutive days also attenuated the calcimimetic and calcilytic effects on claudin-14 gene expression (
These results demonstrate a role for calcineurin inhibitor that antagonizes the extracellular Ca++ signaling in the kidney causing deranged claudin-14 expression and urinary Ca++ excretion.
This example illustrates CaSR signaling involving NFAT dependent regulation of microRNA promoters.
The inventors investigated how calcineurin transduced its signal. Calcineurin is a protein phosphatase that employs a class of transcriptional factors known as NFATs to regulate target gene transcription. (Crabtree, G. R., et al., 2002) The inventors investigated which isoform of NFATs was expressed in the TALH of the kidney. Using primers designed against the four cellular isoforms of NFATs (NFATc1-4; Table 2), the inventors detected predominant gene expression of NFATc1, c2 and c3 but not c4 in immuno-isolated mouse TALH cells (
The inventors investigated which NFAT was functionally required for claudin-14 gene regulation in the TALH cells. To selectively knock down NFAT gene expression, the inventors transfected a pre-validated siRNA reagent (Methods) that contained a pool of three target-specific 21 nt siRNA duplexes designed against each mouse NFAT gene into the primary cultures of freshly isolated mouse TALH cells. A scrambled siRNA duplex was transfected as negative control. The efficacy of siRNA mediated NFAT knockdown was shown in
The inventors transfected a constitutively active mutant of NFATc1 (with 21 Serine to Alanine mutations (Winslow, M. M., et al., 2006); named NFATc1nuc; Methods) into primary TALH cells. Transfection with NFATc1nuc significantly decreased the transcriptional level of claudin-14 by 48% (p<0.01, n=3 versus vector control;
The inventors searched the miR-9-1 and miR-374 gene promoters for presence of NFAT consensus-binding sites ([A/T]GGAAA[A/N][A/T/C]N). (Kuwahara, K., et al., 2006) In the mouse miR-9-1 promoter, there was a NFAT binding site (AGGAAAAT) 1440 bp upstream of the miR-9-1 hairpin sequence (
The inventors investigated whether NFATc1 regulates endogenous miR-9-1 and miR-374 promoters in native TALH cells and in presence of intact chromatin. Chromatin immunoprecipitation (ChIP) was carried out in mouse primary TALH cells transfected with NFATc1nuc or its vector control. ChIP primers were designed to span the NFAT binding sites (
Having established a direct regulatory role for NFATc1 in microRNA transcription, the inventors investigated whether CaSR signaling induces NFATc1 dependent regulation of microRNA in vivo. To manipulate CaSR signaling in vivo in the kidney, the inventors treated WT mice with NPS2143 or cinacalcet at a single dose of 30 mg/kg BW−1 as described above, isolated the TALH cells at 2 hrs following each drug treatment and performed Chip analyses on isolated TALH cells from each mouse. NPS2143 treatment significantly increased the fold enrichment of NFATc1 over the promoter regions of miR-9-1 and miR-374 containing NFAT binding sites, by 3.55-fold (p<0.01, n=5 versus vehicle:
These data identified a transcriptional factor, NFATc1 that mediates CaSR signaling to transcriptional regulation of miR-9-1 and miR-374 genes through epigenetic mechanism.
All publications cited in this application are herein incorporated by reference in their entirety as if each individual publication, patent, patent application or other reference were specifically and individually indicated to be incorporated by reference.
This application claims the benefit of priority to U.S. Provisional Patent Application 61/769,499 filed Feb. 26, 2013 and U.S. Provisional Patent Application 61/914,895 filed Dec. 11, 2013, each of which is incorporated herein by reference in its entirety.
This work received support from National Institute of Diabetes and Digestive and Kidney Diseases grants 1ROI1DK084059-01 and 5P30DK079333, National Institutes of Health Grants RO1DK084059 and P30 DK07933. The government may have certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61914895 | Dec 2013 | US | |
| 61769499 | Feb 2013 | US |
