DNA encoding retinoid receptor X (RXR) alpha and gamma; corresponding vectors and host cells

TECHNICAL FIELD
The present invention concerns novel, steroid hormone-like receptor proteins and methods of making and using same.
More particularly, the invention relates to steroid hormone-like receptor proteins with transcription-modulating effects. Such proteins are responsive to the presence of retinoic acid and other vitamin A metabolites.
BACKGROUND OF THE INVENTION
The retinoids comprise a group of compounds including retinoic acid, retinol (vitamin A), and a series of natural and synthetic derivatives that together exert profound effects on development and differentiation in a wide variety of systems. Although early studies focused on the effects of retinoids on growth and differentiation of epithelial cells, their actions have been shown to be widespread. Many recent studies have examined the effects of these molecules on a variety of cultured neoplastic cell types, including the human promyelocytic leukemia cell line, HL60, where retinoic acid appears to be a potent inducer of granulocyte differentiation. In F9 embryonal carcinoma cells, retinoic acid will induce the differentiation of parietal endoderm, characteristic of a late mouse blastocyst. Retinoic acid also appears to play an important role in defining spatio-temporal axes in the developing avian limb and the regenerating amphibian limb.
Retinoic acid has been shown to induce the transcription of several cDNAs whose gene products have been isolated by differential screening. This observation supports the hypothesis that retinoic acid exerts its action via modulation of gene expression, in a manner analogous to the way in which steroid and thyroid hormones influence their target genes.
The ability to identify compounds which affect transcription of genes which are responsive to retinoic acid or other metabolites of vitamin A, would be of significant value, e.g., for therapeutic applications. Further, systems useful for monitoring solutions, body fluids and the like for the presence of retinoic acid, vitamin A or metabolites of the latter would be of value in various analytical biochemical applications and, potentially, medical diagnosis.
Through molecular cloning studies it has been possible to demonstrate that receptors for steroid, retinoid and thyroid hormones are all structurally related. These receptors comprise a superfamily of regulatory proteins that are capable of modulating specific gene expression in response to hormone stimulation by binding directly to cis-acting elements (Evans, Science 240, 889 (1988); Green and Chambon, Trends genet. 4, 309 (1988)). Structural comparisons and functional studies with mutant receptors have established that these molecules are composed of discrete functional domains, most notably, a DNA-binding domain that is composed typically of 66-68 amino acids (including two zinc fingers), and an associated carboxy terminal stretch of approximately 250 amino acids which comprises the ligand-binding domain (reviewed in Evans, supra).
Low-stringency hybridization has permitted the isolation and subsequent delineation of a growing list of gene products which possess the structural features of hormone receptors.
Recently, a retinoic acid dependent transcription factor, referred to as RAR-alpha (retinoic acid receptor-alpha), has been identified. Subsequently, two additional RAR-related genes have been isolated; thus there are now at least three different RAR subtypes (alpha, beta and gamma) known to exist in mice and humans. These retinoic acid receptors (RARs) share homology with the superfamily of steroid hormone and thyroid hormone receptors and have been shown to regulate specific gene expression by a similar ligand-dependent mechanism (Umesono et al., Nature 336, 262 (1988)). These RAR subtypes are expressed in distinct patterns throughout development and in the mature organism.
Other information helpful in the understanding and practice of the present invention can be found in commonly assigned, co-pending U.S. patent application Ser. Nos. 108,471, filed Oct. 20, 1987, now issued as U.S. Pat. No. 5,071,773; 276,536, filed Nov. 30, 1988, now issued as U.S. Pat. No. 4,981,784; 325,240, filed Mar. 17, 1989, now abandoned; 370,407, filed Jun. 22, 1989, now U.S. Pat. No. 5,260,432; and 438,757, filed Nov. 16, 1989, now issued as U.S. Pat. No. 5,091,518, all of which are hereby incorporated herein by reference in their entirety.
SUMMARY OF THE INVENTION
We have discovered novel receptors which are activated to modulate transcription of certain genes in animal cells, when the cells are exposed to retinoids, such as retinoic acid and retinal. The novel receptors differ significantly from known retinoic acid receptors, both in terms of the primary protein sequence and responsiveness to various retinoids.
The novel receptors have several isoforms located at genetically distinct loci. They are capable of transactivating through cis elements similar to retinoic acid receptors, but show a different rank potency and dose dependency to retinoids. Northern analyses of the novel receptors of the present invention indicate that each isoform has a unique pattern of expression in adult tissue and is temporally and spatially expressed in the embryo. Binding experiments demonstrate that the novel receptor proteins have a low affinity for �.sup.3 H!retinoic acid. These results, taken together with results from transactivation studies, suggest the ligand(s) for the novel receptors is a metabolite(s) or structural analog(s) of retinoic acid. The invention provides DNAs encoding novel receptors, expression vectors for expression of the receptors, cells transformed with such expression vectors, cells co-transformed with such expression vectors and reporter vectors to monitor modulation of transcription by the receptors, and methods of using such co-transformed cells in screening for compounds which are capable, directly or indirectly, of activating the receptors.
The invention also provides single-stranded nucleic acid probes for identifying DNAs encoding additional retinoid receptors.
The invention also provides a method for making the receptors of the invention by expressing DNAs which encode the receptors in suitable host organisms.
Animal cells in which receptors of the invention are present can be employed to assay fluids for the presence of retinoids. Animal cells of the invention can also be employed to screen compounds of potential therapeutic value for their ability to bind and/or promote transactivation (i.e., trans-acting transcriptional activation) by the receptors of the invention.
As will be described in greater detail below, the receptors of the invention modulate transcription of genes. This occurs upon binding of receptor to hormone response elements, which are positioned operatively, with respect to promoters for such genes, for such modulation to occur. Among hormone response elements contemplated for use in the practice of the present invention are TRE.sub.p, the beta-retinoic acid response element, and the estrogen response element, as well as closely related elements which are disclosed, for example, in application Ser. No. 438,757, filed Nov. 16, 1989, now issued as U.S. Pat. No. 5,091,518, and application Ser. No. 325,240, filed Mar. 17, 1989, now abandoned.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the extent of amino acid identity (i.e., "homology") between the DNA binding domain ("DNA") and ligand binding domain ("RX") of mouse RXR-alpha (mRXR.alpha.), relative to the corresponding domains of human retinoic acid receptor-alpha (hRAR.alpha.), human estrogen receptor (hER), human thyroid hormone receptor-beta (hTR.beta.) and human glucocorticoid receptor (hGR).
FIG. 2 shows the extent of amino acid identity (i.e., "homology") between the DNA binding domain ("DNA") and ligand binding domain ("LIGAND") of human RAR-alpha (hRAR.alpha.), relative to the corresponding domains of human retinoic acid receptor-beta (hRAR.beta.), human retinoic acid receptor-gamma (hRAR.gamma.), hTR.beta. and hRXR.alpha..
FIG. 3 shows the extent of amino acid identity (i.e., "homology") between the DNA binding domain ("DNA") and ligand binding domain ("RX") of mRXR.alpha., relative to the corresponding domains of mouse RXR-beta (mRXR.beta.), mouse RXR-gamma (mRXR.gamma.) and hRXR.alpha..
FIG. 4 illustrates the production of CAT from the reporter vector (ADH-TREp-CAT) in Drosophila melanogaster Schneider line 2 cells, which are co-transformed with receptor expression vector A5C-RXR-alpha and are in a medium containing various concentrations of retinoic acid.
FIG. 5 illustrates the differences in transcription-activating activities of hRXR-alpha and hRAR-alpha, in mammalian cells in culture containing different vitamin A metabolites.
FIG. 6, like FIG. 5, illustrates the differences in transcription-activating activities of hRXR-alpha and hRAR-alpha in mammalian cells in culture containing retinoic acid or different synthetic retinoids.
FIG. 7 illustrates the differences between hRXR-alpha and hRAR-alpha in dose-response to retinoic acid in media bathing mammalian cells in which the receptors occur.
FIG. 8 illustrates the differences between mouse RXR-alpha (mRXR.alpha.), mouse RXR-beta (mRXR.beta.) and mouse RXR-gamma (mRXR.gamma.) in dose response to retinoic acid (RA) in media bathing mammalian cells expressing such receptors.
FIG. 9 illustrates the differences between mRXR.alpha., mRXR.beta. and mRXR.gamma. in dose response to 3,4-didehydroretinoic acid (ddRA) in media bathing mammalian cells expressing such receptors.

DETAILED DESCRIPTION OF THE INVENTION
The invention concerns novel polypeptides, which are characterized by:
(1) being responsive to the presence of retinoid(s) to regulate transcription of associated gene(s);
(2) having a DNA binding domain of about 66 amino acids with 9 Cys residues, wherein said DNA binding domain has:
(a) less than about 65% amino acid identity with the DNA binding domain of hRAR-alpha,
(b) less than about 55% amino acid identity with the DNA binding domain of hTR-beta, and
(c) less than about 55% amino acid identity with the DNA binding domain of hGR; and
(3) not including the sequence set forth in Sequence ID No 7.
The novel polypeptide receptors of the present invention can be further characterized in a variety of ways, e.g., by increasing the rate of transcription of a target gene in a construct comprising a promoter operatively linked to a hormone response element for transcriptional activation by said receptors, relative to the rate of transcription in the absence of said receptor and/or in the absence of retinoic acid and retinal. Transcription of said target gene is measured in an animal cell in culture, the medium of which comprises retinoic acid or retinal at a concentration greater than about 5.times.10.sup.-7 M.
Alternatively, the polypeptide receptors of the present invention can be further characterized as being encoded by a continuous nucleotide sequence which encodes substantially the same amino acid sequence as that of amino acids 1-462 shown in Sequence ID No. 2 �hRXR.alpha.!, amino acids 1-467 shown in Sequence ID No. 4 �mRXR.alpha.!, or amino acids 1-463 shown in Sequence ID No. 6 �mRXR.gamma.!.
As yet another alternative, the polypeptide receptors of the present invention can be characterized as being encoded by a continuous nucleotide sequence which encodes substantially the same amino acid sequence as that of amino acids 135-200 shown in Sequence ID No. 2 �DNA binding domain of hRXR.alpha.!, amino acids 140-205 shown in Sequence ID No. 4 �DNA binding domain of mRXR.alpha.!, or amino acids 139-204 shown in Sequence ID No. 6 �DNA binding domain of mRXR.gamma.!.
As still another alternative, the polypeptide receptor of the present invention can be characterized as being encoded by a continuous nucleotide sequence which is substantially the same as nucleotides 76-1464 shown in Sequence ID No. 1 �hRXR.alpha.!, nucleotides 181-1581 shown in Sequence ID No. 3 �mRXR.alpha.!, or nucleotides 123-1514 shown in Sequence ID No. 5 �mRXR.gamma.!.
Chimeric receptors of the steroid/thyroid hormone receptor superfamily, as described generally in the above-referenced U.S. Pat. No. 4,981,784, may also be constructed using the sequences of the present invention. Such chimeras comprise an N-terminal domain, a ligand-binding domain, and a DNA-binding domain independently selected from two or more receptors of the superfamily. The chimeric receptors are useful, for example, in trans-activation assays, as are well known in the art.
As employed herein, the term "retinoids" refers to naturally occurring compounds with vitamin A activity synthetic analogs and various metabolites thereof. The retinoids are a class of compounds consisting of four isoprenoid units joined in head-to-tail manner. Numerous retinoids have been identified, as described, for example, by Sporn, Roberts and Goodman in the two volume treatise entitled The Retinoids (Academic Press, NY, 1984), to which the reader is directed for further detail. Exemplary retinoids include retinol, retinyl acetate, retinyl hexadecanoate, .alpha.-retinyl, 4,14-retroretinol, deoxyretinol, anhydroretinol, 3,4-didehydroretinol, 15,15-dimethyl retinol, retinyl methyl ether, retinyl phosphate, mannosyl retinyl phosphate, retinol thioacetate, retinal (retinaldehyde), 3,4-didehydroretinal, retinylidene acetylacetone, retinylidene-1,3-cyclopentanedione, retinal oxime, retinaldehyde acetylhydrazone, retinoic acid, 4-hydroxyretinoic acid, 4-oxoretinoic acid, 5,6-dihydroretinoic acid, 5,6-epoxyretinoic acid, 5,8-epoxyretinoic acid, the open-chain C.sub.20 analog of retinoic acid (i.e., (all-E-3,7,11,15-tetramethyl-2,4,6, 8,10, 2,14-hexadecaheptaenoic acid), 7,8-didehydroretinoic acid, 7,8-dihydroretinoic acid, "C.sub.15 Acid" (E, E)-3-methyl-5-(2,6,6-trimethyl-2-cyclohexen-1-yl)-2,4-pentanedioic acid), "C.sub.17 Acid" ((E,E,E)-5-methyl-7-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6-hepatrienoic acid), "C.sub.22 Acid" (14'-apo-.beta., .psi.-carotenoic acid), retinoic acid esters (e.g., methyl ester, ethyl ester, etc.), retinoic acid ethylamide, retinoic acid 2-hydroxyethylamide, methyl retinone, "C.sub.18 " Ketone" ((E,E, E)-6-methyl-8-(2,6,6-trimethyl-1-cyclohexen-1-yl)-3,5,7-ocatrien-2-one), and the like.
In addition, according to the present invention, there are provided DNA sequences which encode novel polypeptides as described above.
Further in accordance with the present invention, there are provided DNA constructs which are operative in animal cells in culture to make said polypeptides.
According to a still further embodiment of the present invention, there are provided animal cells in culture which are transformed with DNA constructs (as described above), which are operative in said cells to make receptor polypeptides, by expression of DNA segments which encode the above described polypeptides.
Among the animal cells contemplated for use in the practice of the present invention are those which are further transformed with a reporter vector which comprises:
(a) a promoter that is operable in the cell,
(b) a hormone response element, and
(c) a DNA segment encoding a reporter protein, wherein said reporter protein-encoding DNA segment is operatively linked to said promoter for transcription of said DNA segment, and
wherein said hormone response element is operatively linked to said promoter for activation thereof.
Promoters contemplated for use in the above-described reporter vectors include the delta-MTV, delta-TK, delta-SV, ADH and TK promoter; hormone response elements contemplated for use in the above-described reporter vectors include the palindromic thyroid hormone response element (TRE.sub.p) and the beta-retinoic acid response element (.beta.-RARE); and reporter genes contemplated for use in the above-described reporter vectors include chloramphenicol acetyltransferase (CAT), luciferase (LUC) and beta-galactosidase (.beta.-GAL).
Exemplary reporter vectors are well known in the art and include delta-MTV-TRE.sub.p -CAT, delta-TK-TRE.sub.p -CAT, delta-SV-TRE.sub.p -CAT, delta-MTV-TRE.sub.p -LUC, delta-TK-TRE.sub.p -LUC, delta-SV-TRE.sub.p -LUC, ADH-TRE.sub.p -CAT, ADH-TRE.sub.p -LUC, TK-TRE.sub.p -CAT, TK-TRE.sub.p -LUC, and the like.
In accordance with the present invention, there is also provided a method of testing a compound for its ability to regulate the transcription-activating properties of the above-described receptor polypeptides, which method comprises assaying for the presence or absence of reporter protein upon contacting of cells containing a reporter vector and receptor polypeptide with said compound; wherein said reporter vector and said receptor polypeptide are as described above.
In accordance with a still further embodiment of the present invention, there are provided various probes, which can be used to identify genes encoding receptors related to those of the present invention. In this regard, particular reference is made to Examples V and VI below. More particularly, the invention provides labeled, single-stranded nucleic acids comprising sequences of at least 20 contiguous bases having substantially the same sequence as any 20 or more contiguous bases selected from:
(i) bases 2-1861, inclusive, of the DNA illustrated in Sequence ID No. 1 �hRXR-.alpha.!, or
(ii) bases 20-2095, inclusive, of the DNA illustrated in Sequence ID No. 3 �mRXR-.alpha.!, or
(iii) bases 15-1653, inclusive, of the DNA illustrated in Sequence ID No. 5 �mRXR-.gamma.!, or
(iv) the complement of any one of the sequences according to (i), (ii), or (iii).
As employed herein, the term "labeled single-stranded nucleic acid sequences" refers to single-stranded DNA or RNA sequences which have been modified by the addition thereto of a species which renders the "labeled" sequence readily detectable from among other unmodified sequences. Exemplary labels include radioactive label (e.g., .sup.32 P, .sup.35 S), enzymatic label (e.g., biotin), and the like.
Preferred probes contemplated for use in the practice of the present invention are those having at least about 100 contiguous bases selected from the above-described sequences. Especially preferred are probes having in the range of about 198 up to several hundred nucleotides, because greater selectivity is afforded by longer sequences.
The invention also encompasses a method of making the above-described receptor polypeptides, which method comprises culturing suitable host cells which are transformed with an expression vector operable in said cells to express DNA which encodes receptor polypeptide. Suitable hosts contemplated for use in the practice of the present invention include yeast, bacteria, mammalian cells, insect cells, and the like. E. coli is the presently preferred bacterial species. Any of a number of expression vectors are well known to those skilled in the art that could be employed in the method of the invention. Among these are the prokaryotic expression vectors pNH8A, pNH16A and pNH18A available from Stratagene, La Jolla, Calif. USA.
Further information on the invention is provided in the following non-limiting examples and description of an exemplary deposit.
EXAMPLES
Example I
The KpnI/SacI restriction fragment (503 bp) including the DNA-binding domain of hRAR-alpha-encoding DNA �See Giguere et al., Nature 330, 624 (1987); and commonly assigned U.S. patent application Ser. No. 276,536, filed Nov. 30, 1988, now issued as U.S. Pat. No. 4,981,784; and European Patent Application Publication No. 0 325 849, all incorporated herein by reference! was nick-translated and used to screen a lambda-gt11 human liver cDNA library (Kwok et al.,Biochem. 24, 556 (1985)) at low stringency. The hybridization mixture contained 35% formamide, 1X Denhardt's, 5X SSPE (1X SSPE=0.15M NaCl, 10 mM Na.sub.2 HPO.sub.4 1 mM EDTA), 0.1% SDS, 10% dextran sulfate, 100 mg/ml denatured salmon sperm DNA and 10.sup.6 cpm of �.sup.32 P!-labelled probe. Duplicate nitrocellulose filters were hybridized for 16 h at 42.degree. C., washed once at 25.degree. C. for 15 min with 2X SSC (1X SSC=0.15M NaCl, 0.015M sodium citrate), 0.1% SDS and then washed twice at 55.degree. C. for 30 min. in 2X SSC, 0.1% SDS. The filters were autoradiographed for 3 days at -70.degree. C. using an intensifying screen.
Positive clones were isolated, subcloned into pGEM vectors (Promega, Madison, Wis., USA), restriction mapped, and re-subcloned in various sized restriction fragments into M13mp18 and M13mp19 sequencing vectors. DNA sequence was determined by the dideoxy method with Sequenase.TM. sequencing kit (United States Biochemical, Cleveland, Ohio, USA) and analyzed by University of Wisconsin Genetics Computer Group programs (Devereux et al., Nucl. Acids Res. 12, 387 (1984)). A unique receptor-like sequence was identified and designated lambda-HL3-1.
Lambda-HL3-1 was used as a hybridization probe to rescreen a lambda-gt10 human kidney cDNA library (Arriza et al., Science 237, 268 (1987)) which produced several clones, the longest of which was sequenced and designated lambda-XR3-1. The DNA sequence obtained as an EcoRI-fragment from lambda-XR3-1 has the sequence indicated in Sequence ID No. 1 �hRXR.alpha.!.
Similar screening of a mouse whole embryo library with the full-length hRXR-alpha clone described above provided additional sequences which encode different isoforms of the RXR-alpha receptor. In addition, the mouse homolog (mouse RXR-alpha) was also identified in this way.
Thus, mRNA was isolated from 14.5 day post-coitus (p.c.) mouse embryos, translated into cDNA, linked with EcoRI/NotI linkers, then inserted into the unique EcoRI site of the cloning vector .lambda.-ZAP (Stratogene). The resulting library was screened at reduced stringency with .sup.32 P-labeled, full length hRXR-alpha as the probe.
The DNA sequences of the resulting clones are set forth as Sequence ID No. 3 �mRXR.alpha.! and Sequence ID No. 5 �mRXR.gamma.!.
Example II
Amino acid sequences of mRXR-alpha, hRAR-alpha (human retinoic acid receptor-alpha), hER (human estrogen receptor) hTR-beta (human thyroid hormone receptor-beta) and hGR (human glucocorticoid receptor) were aligned using the University of Wisconsin Genetics Computer Group program "Bestfit" (Devereux et al., supra). Regions of significant similarity between mRXR-alpha and the other receptors, i.e., the 66-68 amino acid DNA binding domains and the ligand-binding domains, are presented schematically in FIG. 1 as percent amino acid identity.
Similarly, the amino acid sequences of human RAR-alpha (hRAR.alpha.), human RAR-beta (hRAR.beta.), human RAR-gamma (hRAR.gamma.), human TR-beta (hTR.beta.) and human RXR-alpha (hRXR.alpha.) were aligned. As done in FIG. 1, regions of significant similarity between hRAR-alpha and the other receptors are presented schematically in FIG. 2 as percent amino acid identity.
A further comparison of receptors is set forth in FIG. 3. Thus, the amino acid sequences of mouse RXR-alpha (mRXR.alpha.), mouse RXR-beta (mRXR.beta.), mouse RXR-gamma (mRXR.gamma.) and human RXR-alpha (hRXR.alpha.) were aligned, and the percent amino acid identity presented schematically in FIG. 3.
Although the DNA-binding domains of both mRXR-alpha and hRXR-alpha are conserved relatively well with respect to other receptors (such as hRAR-alpha and hTR-beta), the ligand binding domain is poorly conserved. (See FIGS. 1 and 3). A comparison between the retinoic acid receptor subfamily of receptors and hRXR-alpha reveals nothing to suggest that hRXR-alpha is related to any of the known retinoid receptors (FIG. 2).
Example III
Drosophila melanogaster Schneider line 2 ("S2") cells (Schneider, Embryol. Exp. Morphol. 27, 353 (1972), which are readily available, were seeded at 2.times.10.sup.6 per 35 mm.sup.2 culture dish and maintained in Schneider medium (GIBCO/Life Technologies, Inc., Grand Island, N.Y., USA) supplemented with penicillin, streptomycin and 12% heat-inactivated fetal bovine serum (Irvine Scientific, Santa Ana, Calif., USA). The cells were transiently co-transfected with 10 .mu.g/dish of plasmid DNA by calcium phosphate precipitation (Krasnow et al., Cell 57, 1031 (1989): 4.5 .mu.g/dish of receptor expression vector or control construct (producing no hRXR-alpha); 0.5 .mu.g/dish of reporter plasmid or control reporter plasmid; 0.5 .mu.g/dish of reference plasmid; and 4.5 .mu.g inert plasmid DNA.
In the receptor expression vector, A5C-RXR-alpha (4.5 .mu.g/dish), receptor hRXR-alpha is constitutively expressed in the S2 cells under the control of the Drosophila actin 5C promoter (A5C; Thummel et al., Gene 74: 445 (1988)) driving transcription of the EcoRI-site-bounded insert of lambda-XR3-1. In the control vector, A5C-RXR.sub.rev (also 4.5 .mu.g/ml), the EcoRI-site-bounded insert from lambda-XR3-1 is inserted in the reverse (i.e., non-coding or non-sense-coding) orientation.
A5C-RXR-alpha was made by first inserting at the unique BamHI site of A5C a linker of sequence:
5'-GATCCGATATCCATATGGAATTCGGTACCA,
and then inserting, at the EcoRI site of the linker (underlined above), the EcoRI-site-bounded insert of lambda-XR3-1 (See Example I).
The reporter plasmid ADH-TRE.sub.p -CAT (at 0.5 .mu.g/dish) contains the palindromic thyroid hormone response element TREp, having the sequence:
5'-AGGTCATGACCT
�(Glass et al. Cell 54, 313 (1988); Thompson and Evans, Proc. Natl. Acad. Sci. (USA) 86, 3494 (1989)!, inserted into position -33 (with respect to the transcription start site) of a pD33-ADH-CAT background (Krasnow et al., Cell 57, 1031 (1989)).
pD33-ADH-CAT is a plasmid with the distal promoter of the Drosophila melanogaster alcohol dehydrogenase gene linked operably for transcription to the bacterial (E. coli) chloramphenicol acetyltransferase ("CAT") gene, a gene for the indicator protein CAT. ADH-TREp-CAT was made by inserting the oligonucleotide of sequence: ##STR1## into the XbaI site at position -33 in pD33-ADH-CAT. pD33-ADH-CAT, without TREp, served as a control reporter (i.e., background) plasmid.
A reference plasmid encoding beta-galactosidase driven by the actin 5C promoter also was transfected (0.5 .mu.g/dish) along with pGEM DNA (4.5 .mu.g/dish) (Promega, Madison, Wis.) to make up the final DNA concentration to 10 .mu.g/dish. The reference plasmid was made by inserting a BamHI-site bounded, beta-galactosidase-encoding segment into the unique BamHI site of A5C. The purpose of the reference plasmid was to normalize results for transfection efficiency.
Twenty-four hours post-transfection, various retinoids were added to the cultures. The retinoids were dissolved in dimethyl-sulfoxide and/or ethanol and the resulting solution was added to 0.1% v/v of culture medium. Initial concentration of the retinoids in the culture media was 10.sup.-6 M, except for the experiments underlying the data displayed in FIG. 4, for which varying concentrations of retinoic acid were used.
In control runs, ethanol, at 0.1% v/v in the medium, was used in place of a solution of retinoid.
Cultures were maintained in the dark for 36 hr after addition of retinoid and then harvested. All other parts of the experiments, involving retinoids, were carried out in subdued light.
Cell lysates were centrifuged. Supernatants were assayed for beta-galactosidase, following Herbomel et al., Cell 39, 653-662 (1984), and units/ml of beta-galactosidase activity was calculated. CAT assays (normalized to beta-galactosidase activity) of supernatants were incubated for 75 unit-hours ("units" referring to units of beta-galactosidase activity), as described by Gorman et al., Mol. Cell. Biol. 2, 1044 (1982), usually 150 units for 30 minutes.
No hRXR-alpha dependent activation of CAT expression was noted in any experiment in which control reporter was used in place of ADH-TREp-CAT. Similarly, essentially no activation was observed for runs where control plasmid, A5C-hRXR.sub.rev, was used in place of A5C-hRXR.
The induction of CAT activity in retinoid-treated cells was compared with induction in untreated (i.e., only ethanol-treated) cells. Induction was measured in the presence of retinoic acid (RA), retinal (RAL), retinol acetate (RAC), retinol (ROH), and retinol palmitate (RP). The production of chloramphenicol acetyltransferase (CAT) from the reporter vector (ADH-TREp-CAT) was measured in Drosophila melanogaster Schneider line 2 cells, co-transformed with the hRXR-alpha expression vector A5C-RXR-alpha, and exposed to a medium to which retinoic acid (RA), retinal (RAL), retinol acetate (RAC), retinol (ROH), or retinol palmitate (RP) has been added to a concentration of 10.sup.-6 M. The relative induction observed was RA>RAL>RAC>ROH>RH.
In FIG. 4 are displayed the results, also expressed in terms of "fold-induction" of CAT activity, as described in the previous paragraph, with retinoic acid at a number of different concentrations, to show the "dose response" of hRXR-alpha (in trans-activation at TREp in insect cells) to retinoic acid in the medium of the cells.
Example IV
This example, describing experiments similar to those described in Example III, shows that hRAR-alpha and hRXR-alpha differ significantly in their properties, specifically with respect to trans-activation of transcription from promoters.
The mammalian receptor-expression vector RS-hRAR-alpha, from which hRAR-alpha is produced under control of the 5'-LTR promoter of the rous sarcoma virus proviral DNA, is described in Giguere et al., Nature 330, 624 (1987); commonly asigned U.S. patent application Ser. No. 276,536, filed Nov. 30, 1988, now issued as U.S. Pat. No. 4,981,784; and European Patent Application Publication No. 0 325 849, all incorporated herein by reference.
The receptor-expression vector RS-hRXR-alpha is constructed similarly to RS-hRAR-alpha, by inserting the EcoRI-site-bounded, hRXR-alpha-encoding segment of lambda-XR3-1 into plasmid pRS (Giguere et al., Cell 46, 645 (1986)).
Control plasmid pRSns is pRS with a non-sense-coding sequence inserted in place of receptor-coding sequence.
Reporter plasmid delta-MTV-TREp-CAT, also known as TREp1MCAT, has also been described (Umesono et al., Nature 336, 262 (1988), Thompson and Evans, supra., see also Umesono and Evans, Cell 57, 1139 (1989). When a control reporter, designated delta-MTV-CAT, which is substantially delta-MTV-TREp-CAT with TREp removed, was used in place of delta-MTV-TREp-CAT, no CAT activity was found with either receptor with any of the retinoids or retinoid analogs.
Reference plasmid, RS-beta-galactosidase, is also known and is substantially the same as RS-hRAR-alpha and RS-hRXR-alpha but has a beta-galactosidase-encoding segment in place of the receptor-encoding segment.
Culture of CV-1 cells, co-transfections (with reporter plasmid, receptor-expression-plasmid or control plasmid, reference plasmid and inert plasmid DNA) and CAT assays were performed as described in Umesono et al., Nature 336, 262 (1988). Co-transfections and CAT assays were carried out by methods similar to those described in Example III. Similar to the experiments in Example III, subdued light was used.
When CV-1 cells co-transformed with reporter plasmid (delta-MTV-TREp-CAT), reference plasmid, control plasmid (i.e., expressing no receptor), and receptor plasmid (RS-hRAR-alpha or RS-hRXR-alpha), were exposed to retinoids RA, RAL, RAC, ROH, RP, (which are naturally occurring vitamin A metabolites), or retinoid-free ethanol, the results shown in FIG. 5 were obtained. The Figure illustrates production of CAT from reporter plasmid in monkey kidney cells of the CV-1 line, which are co-transformed with hRXR-alpha-producing expression vector RS-hRXR-alpha or hRAR-alpha-producing expression vector RS-hRAR. Experiments are carried out in a medium to which RA, RAL, RAC, ROH, or RP has been added to a concentration of 10.sup.-6 M. The bars over the "-" sign indicate the levels of CAT production when the cells are exposed to no retinoid (i.e., retinoid-free ethanol). The hatched bars indicate the level of CAT production when a control expression vector, from which no receptor is expressed, is employed in place of the receptor expression vector. The open bars indicate the level of CAT production when receptor-producing expression vector is employed. In each case, the retinoids were added as ethanolic solutions, with the volume of solution 0.1% (v/v) in the medium. Retinoid-free ethanol was added to 0.1% v/v. Results are plotted as percentages of the maximal response observed in the experiments, i.e., hRXR-alpha with RA.
In FIG. 6, the results are provided for experiments carried out as described in the previous paragraph but with, in place of RAL, RAC, ROH and RP, the synthetic retinoids 4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-4-iodo-2-antrhracenyl)-benzoic acid ("R1"), ethyl-P-�(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthyl) -1-propenyl!-benzoic acid ("R2"), ethyl-all trans-9-(4-methoxy-2,3,6-trimethyl)-3,7-dimethyl-2,4,6,8-nonatetranoate ("R3"), and ethyl-all trans-9-(4-methoxy-2,3,6-trimethyl)-3,7-dimethyl-2,4,6,8-nonatetraenoic acid ("R4") initially at a concentration of 10.sup.-6 M. The Figure illustrates production of CAT from the reporter plasmid (delta-MTV-TREp-CAT), CV-1 cells, which are co-transformed with hRXR-alpha-producing expression vector RS-hRXR-alpha or the constitutive hRAR-alpha-producing expression vector RS-hRAR. Experiments are carried out in a medium to which RA, R1, R2, R3, or R4 has been added to a concentration of 10.sup.-6 M. The bars over the "-" sign indicate the levels of CAT production when the cells are exposed to no retinoid. The hatched bars indicate the level of CAT production when a control expression vector, from which no receptor is expressed, is employed in place of the receptor expression vector. The open bars indicate the level of CAT production when receptor-producing expression vector is employed.
In FIG. 7, results are presented for experiments carried out as described in this Example using various concentrations of retinoic acid. The Figure illustrates production of CAT from the reporter plasmid (delta-MTV-TRE.sub.p -CAT), in CV-1 cells, which are co-transformed with the receptor-producing expression vector RS-RXR-alpha or RS-RAR-alpha. Experiments are carried out in a medium to which RA has been added to various concentrations. In the Figure, the results are in terms of fold-induction observed with cells exposed to RA, and control cells (exposed to only RA-free ethanol).
In FIG. 8, results are presented for experiments carried out as described above, using various concentrations of retinoic acid with expression vectors encoding mRXR-alpha, mRXR-beta and mRXR-gamma.
In FIG. 9, results are presented for experiments carried out as described above, using various concentrations of 3, 4-didehydroretinoic acid (ddRA) with expression vectors encoding mRXR-alpha, mRXR-beta and mRXR-gamma.
Example V
To determine the distribution of hRXR-alpha gene expression, poly A.sup.+ RNAs isolated from a variety of adult rat tissues were size fractionated, transferred to a nylon filter, and hybridized with hRXR-alpha cDNA.
Thus, for each tissue of adult male rat that was analyzed, total RNA was prepared from the tissue (see Chomczynski and Sacchi, Anal. Biochem. 162, 156 (1987)) and poly A.sup.+ selected by oligo(dT)-cellulose chromatography. Ten micrograms of poly A.sup.+ RNA were separated by 1% agarose-formaldehyde gel electrophoresis, transferred to a Nytran filter (Schleicher and Schuell) (see McDonnell et al., Science 235, 1214 (1987)), and hybridized under stringent conditions with the hRXR-alpha-encoding, EcoRI insert of lambda-XR3-1. Hybridization was performed at 42.degree. C. in a buffer containing 50% formamide, 5X Denhardt's, 5X SSPE, 0.1% SDS, 100mg/ml salmon sperm DNA, 200mg/ml yeast RNA, and �.sup.32 P!-labelled probe. The filter was then washed twice with 2X SSC, 0.1% SDS at 22.degree. C. and twice at 50.degree. C. Autoradiography was for 24 h at -70.degree. C. with an intensifying screen. RNA ladder size markers from Bethesda Research Laboratories (Gaithersburg, Md., USA)
The distribution of RXR-alpha mRNA in the rat reveals a pattern of expression distinct from that of the retinoic acid receptors (Giguere et al., Nature 330, 624 (1987); Zelent et al., Nature 339, 714 (1989); Benbrook, Nature 333,669 (1988)). The rat RXR-alpha message appears to be a single species of about 4.8 kbp (kilobase pairs) which is expressed in many tissues, but most abundantly in the liver, muscle, lung, and kidney and somewhat less abundantly in adrenal, heart, intestine, and spleen.
Example VI
Molecular cloning analyses of the thyroid hormone and retinoic acid receptor genes indicate that each of these receptors belongs to a discrete gene subfamily which encodes several receptor isoforms. To determine if this was also true of RXR, a series of Southern blot analyses were carried out. High stringency hybridization of restriction endonuclease-digested human DNA with a labelled DNA fragment derived from lambda-XR3-1 produced a similar number of bands in every digestion, consistent with a single genetic locus. When the hybridization conditions were relaxed, however, many additional bands were observed in the products of each enzyme digestion. Careful inspection of this hybridization pattern demonstrated that it is unrelated to a similar analysis described for hRAR-alpha (Giguere et al., Nature 330, 624 (1987). These observations indicate the presence of at least one other locus in the human genome related to the hRXR-alpha gene. Further, a genomic DNA zooblot representing mammalian, avian, yeast, and Drosophila species was obtained. Thus far, the RXR gene family appears to be present in all species tested except yeast, which to date has not been shown to contain any members of the steroid receptor superfamily.
For the analyses of human DNA, two human placenta genomic DNA Southern blots were prepared in parallel with identical DNA samples. The blots were hybridized at high or low stringency with a .sup.- 1200 bp �.sup.32 P!-labelled fragment of lambda-XR3-1 which included the coding portions of the DNA and ligand binding domains (Sequence ID No. 1, nucleotides 459-1631).
For the zooblot, genomic DNA from human, monkey, rat, mouse, dog, cow, rabbit, chicken, S. cerevisiae and Drosophila melanogaster were hybridized at low stringency with a .sup.- 330 bp �.sup.32 P!-labelled fragment of lambda-XR3-1 which included the DNA-binding domain (Sequence ID No. 1, nucleotides 459-776). Differently sized bands (in comparison with HindIII-digested lambda DNA for sizing) were found for the various species. The blots for all of the species (including both for D. melanogaster), except yeast, mouse and rabbit appeared to have more than one band.
For the analysis of human DNA, the placental DNA was restricted with BamHI, BglII, EcoRI, HindIII, PstI and PvuII, separated in a 0.8% agarose gel (10 .mu.g per lane) and transferred to nitrocellulose (see McDonnell et al., supra) and hybridized as described below.
For the zooblot, EcoRI-digested DNA from the several species (Clontech, Palo Alto, Calif., USA), other than D. melanogaster, was used for Southern blot analysis. EcoRI- and XhoI-digested D. melanogaster DNA was included also.
Blots were hybridized at 42.degree. C. in the low stringency buffer described in Example I or at high stringency in the same buffer modified by addition of formamide to 50%. Low stringency blots were washed twice at room temperature and twice at 50.degree. C. in 2X SSC, 0.1% SDS. The high stringency blot was washed twice at room temperature in 2X SSC, 0.1% SDS and twice at 65.degree. C. in 0.5X SSC, 0.1% SDS.
Example VII
Northern analysis were carried out on the mouse RXR isoforms alpha, beta and gamma, to determine the tissue distribution of these receptors in adult tissues and in developing embryos.
Thus, mRNA (10 .mu.g) was isolated from various adult rat tissues of from day 10.5-day 18.5 p.c. whole mouse embryos. These samples were subjected to Northern analysis using .sup.32 P-labeled cDNA probes derived from regions specific to mRXR.alpha., mRXR.beta., or mRXR.gamma..
In the adult, the various RXR isoforms are seen to be expressed in both a specific and overlapping distribution pattern.
In the embryo, the various isoforms are highly expressed in what appears to be a specific temporal pattern.
The invention has been described in detail with particular reference to preferred embodiments thereof, but it will be understood that variations and modifications can be effected within the spirit and scope of the invention.
Deposit
On Jan. 31, 1990, a sample of replicable phagescript SK double-stranded DNA (Stratagene, La Jolla, Calif., USA), with the 1860 base-pair, EcoRI-site-bounded DNA, the sequence of which is illustrated in
FIG. 1, inserted at the unique EcoRI site, was deposited under the terms of the Budapest Treaty on the International Recognition of the Deposit of microorganisms for the Purposes of Patent Procedure at the American Type Culture Collection, Rockville, Md., USA ("ATCC"). The accession number assigned to this deposit is ATCC 40741. The deposited DNA is designated pSK(hRXR-alpha).
Phagescript SK double-stranded DNA is a modified M13mp18 bacteriophage DNA (double-stranded). Derivatives, such as pSK(hRXR-alpha), pSK(mRXR-alpha) and pSK(mRXR-gamma) of phagescript SK double-stranded DNA can be cloned in the same way as M13mp18 and its derivatives.
Samples of pSK(hRXR-alpha) will be publicly available from the ATCC without restriction, except as provided in 37 CFR 1.801 et seq., at the latest on the date an United States Patent first issues on this application or a continuing application thereof. Otherwise, in accordance with the Budapest Treaty and the regulations promulgated thereunder, samples will be available from the ATCC to all persons legally entitled to receive them under the law and regulations of any country or international organization in which an application, claiming priority of this application, is filed or in which a patent based on any such application is granted.
SUMMARY OF SEQUENCES
Sequence ID No. 1 is the coding sequence of an EcoRI-site-bounded DNA segment which encodes the novel receptor disclosed herein, referred to as human RXR-alpha �hRXR.alpha.!.
Sequence ID No. 2 is the amino acid sequence of the novel receptor referred to herein as hRXR.alpha..
Sequence ID No. 3 is the nucleotide (and amino acid) sequence of the novel receptor disclosed herein, referred to as mouse RXR-alpha �mRXR.alpha.!.
Sequence ID No. 4 is the amino acid sequence of the novel receptor referred to herein as mRXR.alpha..
Sequence ID No. 5 is the nucleotide (and amino acid) sequence of the novel receptor disclosed herein, referred to as mouse RXR-gamma �mRXR.gamma.!.
Sequence ID No. 6 is the amino acid sequence of the novel receptor referred to herein as mRXR.gamma..
Sequence ID No. 7 is the nucleotide sequence of the receptor disclosed by Hamada, et al in PNAS 86:8298-8293 (1989). This receptor is similar to the receptor referred to herein as mRXR.beta..
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 7(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1866 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 76..1464(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GAATTCCGGCGCCGGGGGCCGCCCGCCCGCCGCCCGCTGCCTGCGCCGCCGGCCGGGCAT60GAGTTAGTCGCAGACATGGACACCAAACATTTCCTGCCGCTCGATTTCTCC111MetAspThrLysHisPheLeuProLeuAspPheSer1510ACCCAGGTGAACTCCTCCCTCACCTCCCCGACGGGGCGAGGCTCCATG159ThrGlnValAsnSerSerLeuThrSerProThrGlyArgGlySerMet152025GCTGCCCCCTCGCTGCACCCGTCCCTGGGGCCTGGCATCGGCTCCCCG207AlaAlaProSerLeuHisProSerLeuGlyProGlyIleGlySerPro303540GGACAGCTGCATTCTCCCATCAGCACCCTGAGCTCCCCCATCAACGGC255GlyGlnLeuHisSerProIleSerThrLeuSerSerProIleAsnGly45505560ATGGGCCCGCCTTTCTCGGTCATCAGCTCCCCCATGGGCCCCCACTCC303MetGlyProProPheSerValIleSerSerProMetGlyProHisSer657075ATGTCGGTGCCCACCACACCCACCCTGGGCTTCAGCACTGGCAGCCCC351MetSerValProThrThrProThrLeuGlyPheSerThrGlySerPro808590CAGCTCAGCTCACCTATGAACCCCGTCAGCAGCAGCGAGGACATCAAG399GlnLeuSerSerProMetAsnProValSerSerSerGluAspIleLys95100105CCCCCCCTGGGCCTCAATGGCGTCCTCAAGGTCCCCGCCCACCCCTCA447ProProLeuGlyLeuAsnGlyValLeuLysValProAlaHisProSer110115120GGAAACATGGCTTCCTTCACCAAGCACATCTGCGCCATCTGCGGGGAC495GlyAsnMetAlaSerPheThrLysHisIleCysAlaIleCysGlyAsp125130135140CGCTCCTCAGGCAAGCACTATGGAGTGTACAGCTGCGAGGGGTGCAAG543ArgSerSerGlyLysHisTyrGlyValTyrSerCysGluGlyCysLys145150155GGCTTCTTCAAGCGGACGGTGCGCAAGGACCTGACCTACACCTGCCGC591GlyPhePheLysArgThrValArgLysAspLeuThrTyrThrCysArg160165170GACAACAAGGACTGCCTGATTGACAAGCGGCAGCGGAACCGGTGCCAG639AspAsnLysAspCysLeuIleAspLysArgGlnArgAsnArgCysGln175180185TACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCC687TyrCysArgTyrGlnLysCysLeuAlaMetGlyMetLysArgGluAla190195200GTGCAGGAGGAGCGGCAGCGTGGCAAGGACCGGAACGAGAATGAGGTG735ValGlnGluGluArgGlnArgGlyLysAspArgAsnGluAsnGluVal205210215220GAGTCGACCAGCAGCGCCAACGAGGACATGCCGGTGGAGAGGATCCTG783GluSerThrSerSerAlaAsnGluAspMetProValGluArgIleLeu225230235GAGGCTGAGCTGGCCGTGGAGCCCAAGACCGAGACCTACGTGGAGGCA831GluAlaGluLeuAlaValGluProLysThrGluThrTyrValGluAla240245250AACATGGGGCTGAACCCCAGCTCGCCGAACGACCCTGTCACCAACATT879AsnMetGlyLeuAsnProSerSerProAsnAspProValThrAsnIle255260265TGCCAAGCAGCCGACAAACAGCTTTTCACCCTGGTGGAGTGGGCCAAG927CysGlnAlaAlaAspLysGlnLeuPheThrLeuValGluTrpAlaLys270275280CGGATCCCACACTTCTCAGAGCTGCCCCTGGACGACCAGGTCATCCTG975ArgIleProHisPheSerGluLeuProLeuAspAspGlnValIleLeu285290295300CTGCGGGCAGGCTGGAATGAGCTGCTCATCGCCTCCTTCTCCCACCGC1023LeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArg305310315TCCATCGCCGTGAAGGACGGGATCCTCCTGGCCACCGGGCTGCACGTC1071SerIleAlaValLysAspGlyIleLeuLeuAlaThrGlyLeuHisVal320325330CACCGGAACAGCGCCCACAGCGCAGGGGTGGGCGCCATCTTTGACAGG1119HisArgAsnSerAlaHisSerAlaGlyValGlyAlaIlePheAspArg335340345GTGCTGACGGAGCTTGTGTCCAAGATGCGGGACATGCAGATGGACAAG1167ValLeuThrGluLeuValSerLysMetArgAspMetGlnMetAspLys350355360ACGGAGCTGGGCTGCCTGCGCGCCATCGTCCTCTTTAACCCTGACTCC1215ThrGluLeuGlyCysLeuArgAlaIleValLeuPheAsnProAspSer365370375380AAGGGGCTCTCGAACCCGGCCGAGGTGGAGGCGCTGAGGGAGAAGGTC1263LysGlyLeuSerAsnProAlaGluValGluAlaLeuArgGluLysVal385390395TATGCGTCCTTGGAGGCCTACTGCAAGCACAAGTACCCAGAGCAGCCG1311TyrAlaSerLeuGluAlaTyrCysLysHisLysTyrProGluGlnPro400405410GGAAGGTTCGCTAAGCTCTTGCTCCGCCTGCCGGCTCTGCGCTCCATC1359GlyArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIle415420425GGGCTCAAATGCCTGGAACATCTCTTCTTCTTCAAGCTCATCGGGGAC1407GlyLeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAsp430435440ACACCCATTGACACCTTCCTTATGGAGATGCTGGAGGCGCCGCACCAA1455ThrProIleAspThrPheLeuMetGluMetLeuGluAlaProHisGln445450455460ATGACTTAGGCCTGCGGGCCCATCCTTTGTGCCCACCCGTTCTGGCCACCCTGCCT1511MetThrGGACGCCAGCTGTTCTTCTCAGCCTGAGCCCTGTCCCTGCCCTTCTCTGCCTGGCCTGTT1571TGGACTTTGGGGCACAGCCTGTCACTGCTCTGCCTAAGAGATGTGTTGTCACCCTCCTTA1631TTTCTGTTACTACTTGTCTGTGGCCCAGGGCAGTGGCTTTCCTGAGCAGCAGCCTTCGTG1691GCAAGAACTAGCGTGAGCCCAGCCAGGCGCCTCCCCACCGGGCTCTCAGGACGCCCTGCC1751ACACCCACGGGGCTTGGGCGACTACAGGGTCTTCGGCCCCAGCCCTGGAGCTGCAGGAGT1811TGGGAACGGGGCTTTTGTTTCCGTTGCTGTTTATCGATGCTGGTTTTCAGAATTC1866(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 462 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAspThrLysHisPheLeuProLeuAspPheSerThrGlnValAsn151015SerSerLeuThrSerProThrGlyArgGlySerMetAlaAlaProSer202530LeuHisProSerLeuGlyProGlyIleGlySerProGlyGlnLeuHis354045SerProIleSerThrLeuSerSerProIleAsnGlyMetGlyProPro505560PheSerValIleSerSerProMetGlyProHisSerMetSerValPro65707580ThrThrProThrLeuGlyPheSerThrGlySerProGlnLeuSerSer859095ProMetAsnProValSerSerSerGluAspIleLysProProLeuGly100105110LeuAsnGlyValLeuLysValProAlaHisProSerGlyAsnMetAla115120125SerPheThrLysHisIleCysAlaIleCysGlyAspArgSerSerGly130135140LysHisTyrGlyValTyrSerCysGluGlyCysLysGlyPhePheLys145150155160ArgThrValArgLysAspLeuThrTyrThrCysArgAspAsnLysAsp165170175CysLeuIleAspLysArgGlnArgAsnArgCysGlnTyrCysArgTyr180185190GlnLysCysLeuAlaMetGlyMetLysArgGluAlaValGlnGluGlu195200205ArgGlnArgGlyLysAspArgAsnGluAsnGluValGluSerThrSer210215220SerAlaAsnGluAspMetProValGluArgIleLeuGluAlaGluLeu225230235240AlaValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeu245250255AsnProSerSerProAsnAspProValThrAsnIleCysGlnAlaAla260265270AspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHis275280285PheSerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGly290295300TrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaVal305310315320LysAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSer325330335AlaHisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGlu340345350LeuValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGly355360365CysLeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSer370375380AsnProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeu385390395400GluAlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAla405410415LysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCys420425430LeuGluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAsp435440445ThrPheLeuMetGluMetLeuGluAlaProHisGlnMetThr450455460(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2095 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 178..1581(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GAATTCGCGGCCGCGGCGACTTTTGCAACAACTCGCCGCGCCGCGGCCTCCGCGCGCCGC60CGCCGCCGCTGCCGCCGCCGGCTCCCCGCCGCCCGGGCCCCGGGCGGGCCGCGCCGGGGG120CCGCCGCGCTGCCGCCCTGCTGCTCCGCCGCCGGCTGGGCATGAGTTAGTCGCAGAC177ATGGACACCAAACATTTCCTGCCGCTCGACTTCTCTACCCAGGTGAAC225MetAspThrLysHisPheLeuProLeuAspPheSerThrGlnValAsn151015TCTTCGTCCCTCAACTCTCCAACGGGTCGAGGCTCCATGGCTGTCCCC273SerSerSerLeuAsnSerProThrGlyArgGlySerMetAlaValPro202530TCGCTGCACCCCTCCTTGGGTCCGGGAATCGGCTCTCCACTGGGCTCG321SerLeuHisProSerLeuGlyProGlyIleGlySerProLeuGlySer354045CCTGGGCAGCTGCACTCTCCTATCAGCACCCTGAGCTCCCCCATCAAT369ProGlyGlnLeuHisSerProIleSerThrLeuSerSerProIleAsn505560GGCATGGGTCCGCCCTTCTCTGTCATCAGCTCCCCCATGGGCCCGCAC417GlyMetGlyProProPheSerValIleSerSerProMetGlyProHis65707580TCCATGTCGGTACCCACCACACCCACATTGGGCTTCGGGACTGGTAGC465SerMetSerValProThrThrProThrLeuGlyPheGlyThrGlySer859095CCCCAGCTCAATTCACCCATGAACCCTGTGAGCAGCACTGAGGATATC513ProGlnLeuAsnSerProMetAsnProValSerSerThrGluAspIle100105110AAGCCGCCACTAGGCCTCAATGGCGTCCTCAAGGTTCCTGCCCATCCC561LysProProLeuGlyLeuAsnGlyValLeuLysValProAlaHisPro115120125TCAGGAAATATGGCCTCCTTCACCAAGCACATCTGTGCTATCTGTGGG609SerGlyAsnMetAlaSerPheThrLysHisIleCysAlaIleCysGly130135140GACCGCTCCTCAGGCAAACACTATGGGGTATACAGTTGTGAGGGCTGC657AspArgSerSerGlyLysHisTyrGlyValTyrSerCysGluGlyCys145150155160AAGGGCTTCTTCAAGAGGACAGTACGCAAAGACCTGACCTACACCTGC705LysGlyPhePheLysArgThrValArgLysAspLeuThrTyrThrCys165170175CGAGACAACAAGGACTGCCTGATCGACAAGAGACAGCGGAACCGGTGT753ArgAspAsnLysAspCysLeuIleAspLysArgGlnArgAsnArgCys180185190CAGTACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAA801GlnTyrCysArgTyrGlnLysCysLeuAlaMetGlyMetLysArgGlu195200205GCTGTGCAGGAGGAGCGGCAGCGGGGCAAGGACCGGAATGAGAACGAG849AlaValGlnGluGluArgGlnArgGlyLysAspArgAsnGluAsnGlu210215220GTGGAGTCCACCAGCAGTGCCAACGAGGACATGCCTGTAGAGAAGATT897ValGluSerThrSerSerAlaAsnGluAspMetProValGluLysIle225230235240CTGGAAGCCGAGCTTGCTGTCGAGCCCAAGACTGAGACATACGTGGAG945LeuGluAlaGluLeuAlaValGluProLysThrGluThrTyrValGlu245250255GCAAACATGGGGCTGAACCCCAGCTCACCAAATGACCCTGTTACCAAC993AlaAsnMetGlyLeuAsnProSerSerProAsnAspProValThrAsn260265270ATCTGTCAAGCAGCAGACAAGCAGCTCTTCACTCTTGTGGAGTGGGCC1041IleCysGlnAlaAlaAspLysGlnLeuPheThrLeuValGluTrpAla275280285AAGAGGATCCCACACTTTTCTGAGCTGCCCCTAGACGACCAGGTCATC1089LysArgIleProHisPheSerGluLeuProLeuAspAspGlnValIle290295300CTGCTACGGGCAGGCTGGAACGAGCTGCTGATCGCCTCCTTCTCCCAC1137LeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHis305310315320CGCTCCATAGCTGTGAAAGATGGGATTCTCCTGGCCACCGGGCTGCAC1185ArgSerIleAlaValLysAspGlyIleLeuLeuAlaThrGlyLeuHis325330335GTACACCGGAACAGCGCTCACAGTGCTGGGGTGGGCGCCATCTTTGAC1233ValHisArgAsnSerAlaHisSerAlaGlyValGlyAlaIlePheAsp340345350AGGGTGCTAACAGAGCTGGTGTCTAAGATGCGTGACATGCAGATGGAC1281ArgValLeuThrGluLeuValSerLysMetArgAspMetGlnMetAsp355360365AAGACGGAGCTGGGCTGCCTGCGAGCCATTGTCCTGTTCAACCCTGAC1329LysThrGluLeuGlyCysLeuArgAlaIleValLeuPheAsnProAsp370375380TCTAAGGGGCTCTCAAACCCTGCTGAGGTGGAGGCGTTGAGGGAGAAG1377SerLysGlyLeuSerAsnProAlaGluValGluAlaLeuArgGluLys385390395400GTGTATGCGTCACTAGAAGCGTACTGCAAACACAAGTACCCTGAGCAG1425ValTyrAlaSerLeuGluAlaTyrCysLysHisLysTyrProGluGln405410415CCGGGCAGGTTTGCCAAGCTGCTGCTCCGCCTGCCTGCACTGCGTTCC1473ProGlyArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSer420425430ATCGGGCTCAAGTGCCTGGAGCACCTGTTCTTCTTCAAGCTCATCGGG1521IleGlyLeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGly435440445GACACGCCCATCGACACCTTCCTCATGGAGATGCTGGAGGCACCACAT1569AspThrProIleAspThrPheLeuMetGluMetLeuGluAlaProHis450455460CAAGCCACCTAGGCCCCCGCCGCCGTGTGCCGGTCCCGTGCCCTGCCTG1618GlnAlaThr465GACACAGCTGCTCAGCTCCAGCCCTGCCCCTGCCCTTTCTGATGGCCCGTGTGGATCTTT1678GGGGTGCAGTGTCCTTATGGGCCCAAAAGATGCATCACCATCCTCGCCATCTTTACTCAT1738GCTTGCCTTTGGCCCAGGGCATAGCAGAGCTGGTGTGACACCTGGCCAGCTCCTGCCCTA1798CATCAGGCTCTAAGGCTATGCTGCTGTCACCCCGAGGGTCGTGGGGTTCGTCATGGGGCC1858TTCAGCACCTGGAGCTGCAAGAGCTGGGAAAAGGGCTTGTTCTGGTTGCTGGTTGCTGGT1918CGCTGGTTCTCGACATCCCACATGGCACCTCTGTTTGGAGTGCCCCATCTTGGCCTGTTC1978AGAGTCCTGGTACCCAGTTAGGGTGGGAATCCACCTGGGATCAAGAAGGAGCAGGTGGGG2038CAGGCCGTATCCTCCTGGGTCATAGCTAACCTATAAAGGCGCCGCGAATTCCTCGAG2095(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 467 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetAspThrLysHisPheLeuProLeuAspPheSerThrGlnValAsn151015SerSerSerLeuAsnSerProThrGlyArgGlySerMetAlaValPro202530SerLeuHisProSerLeuGlyProGlyIleGlySerProLeuGlySer354045ProGlyGlnLeuHisSerProIleSerThrLeuSerSerProIleAsn505560GlyMetGlyProProPheSerValIleSerSerProMetGlyProHis65707580SerMetSerValProThrThrProThrLeuGlyPheGlyThrGlySer859095ProGlnLeuAsnSerProMetAsnProValSerSerThrGluAspIle100105110LysProProLeuGlyLeuAsnGlyValLeuLysValProAlaHisPro115120125SerGlyAsnMetAlaSerPheThrLysHisIleCysAlaIleCysGly130135140AspArgSerSerGlyLysHisTyrGlyValTyrSerCysGluGlyCys145150155160LysGlyPhePheLysArgThrValArgLysAspLeuThrTyrThrCys165170175ArgAspAsnLysAspCysLeuIleAspLysArgGlnArgAsnArgCys180185190GlnTyrCysArgTyrGlnLysCysLeuAlaMetGlyMetLysArgGlu195200205AlaValGlnGluGluArgGlnArgGlyLysAspArgAsnGluAsnGlu210215220ValGluSerThrSerSerAlaAsnGluAspMetProValGluLysIle225230235240LeuGluAlaGluLeuAlaValGluProLysThrGluThrTyrValGlu245250255AlaAsnMetGlyLeuAsnProSerSerProAsnAspProValThrAsn260265270IleCysGlnAlaAlaAspLysGlnLeuPheThrLeuValGluTrpAla275280285LysArgIleProHisPheSerGluLeuProLeuAspAspGlnValIle290295300LeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHis305310315320ArgSerIleAlaValLysAspGlyIleLeuLeuAlaThrGlyLeuHis325330335ValHisArgAsnSerAlaHisSerAlaGlyValGlyAlaIlePheAsp340345350ArgValLeuThrGluLeuValSerLysMetArgAspMetGlnMetAsp355360365LysThrGluLeuGlyCysLeuArgAlaIleValLeuPheAsnProAsp370375380SerLysGlyLeuSerAsnProAlaGluValGluAlaLeuArgGluLys385390395400ValTyrAlaSerLeuGluAlaTyrCysLysHisLysTyrProGluGln405410415ProGlyArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSer420425430IleGlyLeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGly435440445AspThrProIleAspThrPheLeuMetGluMetLeuGluAlaProHis450455460GlnAlaThr465(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1662 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 123..1514(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GAATTCGCGGCCGCGCTGTGCCTGGGAGCCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA60GAGAGAGAGAGAGAGGCTGTACTCTTCAGAAGCGCACGAGAGGAATGAACTGAGCAGCCA120ACATGTATGGAAATTATTCCCACTTCATGAAGTTTCCCACCGGCTTT167MetTyrGlyAsnTyrSerHisPheMetLysPheProThrGlyPhe151015GGTGGCTCCCCTGGTCACACTGGCTCGACGTCCATGAGCCCTTCAGTA215GlyGlySerProGlyHisThrGlySerThrSerMetSerProSerVal202530GCCTTGCCCACGGGGAAGCCAATGGACAGCCACCCCAGCTACACAGAC263AlaLeuProThrGlyLysProMetAspSerHisProSerTyrThrAsp354045ACCCCAGTGAGTGCCCCTCGGACGCTGAGTGCTGTGGGAACCCCCCTC311ThrProValSerAlaProArgThrLeuSerAlaValGlyThrProLeu505560AATGCTCTTGGCTCTCCGTATAGAGTCATCACTTCTGCCATGGGTCCA359AsnAlaLeuGlySerProTyrArgValIleThrSerAlaMetGlyPro657075CCCTCAGGAGCACTGGCAGCTCCTCCAGGAATCAACTTGGTGGCTCCA407ProSerGlyAlaLeuAlaAlaProProGlyIleAsnLeuValAlaPro80859095CCCAGCTCCCAGCTAAATGTGGTCAACAGTGTCAGCAGCTCTGAGGAC455ProSerSerGlnLeuAsnValValAsnSerValSerSerSerGluAsp100105110ATCAAGCCCTTACCAGGTCTGCCTGGGATTGGAAATATGAACTACCCA503IleLysProLeuProGlyLeuProGlyIleGlyAsnMetAsnTyrPro115120125TCCACCAGCCCTGGGTCTCTGGTGAAACACATCTGTGCCATCTGTGGG551SerThrSerProGlySerLeuValLysHisIleCysAlaIleCysGly130135140GACAGATCCTCAGGGAAGCACTACGGTGTGTACAGCTGTGAAGGTTGC599AspArgSerSerGlyLysHisTyrGlyValTyrSerCysGluGlyCys145150155AAAGGCTTCTTCAAAAGGACCATCAGGAAAGATCTCATCTACACCTGT647LysGlyPhePheLysArgThrIleArgLysAspLeuIleTyrThrCys160165170175CGGGATAACAAAGATTGTCTCATCGACAAGCGCCAGCGCAACCGCTGC695ArgAspAsnLysAspCysLeuIleAspLysArgGlnArgAsnArgCys180185190CAGTACTGTCGCTACCAGAAGTGCCTGGTCATGGGCATGAAGCGGGAA743GlnTyrCysArgTyrGlnLysCysLeuValMetGlyMetLysArgGlu195200205GCTGTGCAAGAAGAAAGGCAGAGGAGCCGAGAGCGAGCAGAGAGTGAG791AlaValGlnGluGluArgGlnArgSerArgGluArgAlaGluSerGlu210215220GCAGAATGTGCCAGTAGTAGCCACGAAGACATGCCCGTGGAGAGGATT839AlaGluCysAlaSerSerSerHisGluAspMetProValGluArgIle225230235CTAGAAGCCGAACTTGCTGTGGAACCAAAGACAGAATCCTACGGTGAC887LeuGluAlaGluLeuAlaValGluProLysThrGluSerTyrGlyAsp240245250255ATGAACGTGGAGAACTCAACAAATGACCCTGTTACCAACATATGCCAT935MetAsnValGluAsnSerThrAsnAspProValThrAsnIleCysHis260265270GCTGCAGATAAGCAACTTTTCACCCTCGTTGAGTGGGCCAAACGCATC983AlaAlaAspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIle275280285CCCCACTTCTCAGATCTCACCTTGGAGGACCAGGTCATTCTACTCCGG1031ProHisPheSerAspLeuThrLeuGluAspGlnValIleLeuLeuArg290295300GCAGGGTGGAATGAACTGCTCATTGCCTCCTTCTCCCACCGCTCGGTT1079AlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerVal305310315TCCGTCCAGGATGGCATCCTGCTGGCCACGGGCCTCCACGTGCACAGG1127SerValGlnAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArg320325330335AGCAGCGCTCACAGCCGGGGAGTCGGCTCCATCTTCGACAGAGTCCTT1175SerSerAlaHisSerArgGlyValGlySerIlePheAspArgValLeu340345350ACAGAGTTGGTGTCCAAGATGAAAGACATGCAGATGGATAAGTCAGAG1223ThrGluLeuValSerLysMetLysAspMetGlnMetAspLysSerGlu355360365CTGGGGTGCCTACGGGCCATCGTGCTGTTTAACCCAGATGCCAAGGGT1271LeuGlyCysLeuArgAlaIleValLeuPheAsnProAspAlaLysGly370375380TTATCCAACCCCTCTGAGGTGGAGACTCTTCGAGAGAAGGTTTATGCC1319LeuSerAsnProSerGluValGluThrLeuArgGluLysValTyrAla385390395ACCCTGGAGGCCTATACCAAGCAGAAGTATCCGGAACAGCCAGGCAGG1367ThrLeuGluAlaTyrThrLysGlnLysTyrProGluGlnProGlyArg400405410415TTTGCCAAGCTTCTGCTGCGTCTCCCTGCTCTGCGCTCCATCGGCTTG1415PheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeu420425430AAATGCCTGGAACACCTCTTCTTCTTCAAGCTCATTGGAGACACTCCC1463LysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrPro435440445ATCGACAGCTTCCTCATGGAGATGTTGGAGACCCCACTGCAGATCACC1511IleAspSerPheLeuMetGluMetLeuGluThrProLeuGlnIleThr450455460TGAACCTCCTCAGCTGCAGCTTCCCCACCCAGGGTGACCCTTGGGCGGGTGTGTGTGTGT1571GGCCCTACCCTGCACACTCTCCCCCATCTTCCACTCTGGCCTCCCTTCCTGTCCCCAAAA1631TGTGATGCTTGTAATAAGCGGCCGCGAATTC1662(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 463 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetTyrGlyAsnTyrSerHisPheMetLysPheProThrGlyPheGly151015GlySerProGlyHisThrGlySerThrSerMetSerProSerValAla202530LeuProThrGlyLysProMetAspSerHisProSerTyrThrAspThr354045ProValSerAlaProArgThrLeuSerAlaValGlyThrProLeuAsn505560AlaLeuGlySerProTyrArgValIleThrSerAlaMetGlyProPro65707580SerGlyAlaLeuAlaAlaProProGlyIleAsnLeuValAlaProPro859095SerSerGlnLeuAsnValValAsnSerValSerSerSerGluAspIle100105110LysProLeuProGlyLeuProGlyIleGlyAsnMetAsnTyrProSer115120125ThrSerProGlySerLeuValLysHisIleCysAlaIleCysGlyAsp130135140ArgSerSerGlyLysHisTyrGlyValTyrSerCysGluGlyCysLys145150155160GlyPhePheLysArgThrIleArgLysAspLeuIleTyrThrCysArg165170175AspAsnLysAspCysLeuIleAspLysArgGlnArgAsnArgCysGln180185190TyrCysArgTyrGlnLysCysLeuValMetGlyMetLysArgGluAla195200205ValGlnGluGluArgGlnArgSerArgGluArgAlaGluSerGluAla210215220GluCysAlaSerSerSerHisGluAspMetProValGluArgIleLeu225230235240GluAlaGluLeuAlaValGluProLysThrGluSerTyrGlyAspMet245250255AsnValGluAsnSerThrAsnAspProValThrAsnIleCysHisAla260265270AlaAspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIlePro275280285HisPheSerAspLeuThrLeuGluAspGlnValIleLeuLeuArgAla290295300GlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerValSer305310315320ValGlnAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgSer325330335SerAlaHisSerArgGlyValGlySerIlePheAspArgValLeuThr340345350GluLeuValSerLysMetLysAspMetGlnMetAspLysSerGluLeu355360365GlyCysLeuArgAlaIleValLeuPheAsnProAspAlaLysGlyLeu370375380SerAsnProSerGluValGluThrLeuArgGluLysValTyrAlaThr385390395400LeuGluAlaTyrThrLysGlnLysTyrProGluGlnProGlyArgPhe405410415AlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLys420425430CysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrProIle435440445AspSerPheLeuMetGluMetLeuGluThrProLeuGlnIleThr450455460(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2219 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 109..1341(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GAATTCCCCCGAAGCCCAGACAGCTCCTCCCCAAATCCCCTTTCTCAGGGGATCCGTCCG60TCTTCTCCTCCTGGCCCACCTCTTACCCCTTCAGCACCTCCACCTCCAATGCCACCC117MetProProCCGCCACTGGGCTCCCCCTTCCCAGTCATCAGTTCTTCCATGGGGTCC165ProProLeuGlySerProPheProValIleSerSerSerMetGlySer51015CCTGGTCTGCCCCCTCCGGCTCCCCCAGGATTCTCCGGGCCTGTCAGC213ProGlyLeuProProProAlaProProGlyPheSerGlyProValSer20253035AGCCCTCAGATCAACTCCACAGTGTCGCTCCCTGGGGGTGGGTCTGGC261SerProGlnIleAsnSerThrValSerLeuProGlyGlyGlySerGly404550CCCCCTGAAGATGTGAAGCCACCGGTCTTAGGGGTCCGGGGCCTGCAC309ProProGluAspValLysProProValLeuGlyValArgGlyLeuHis556065TGTCCACCCCCTCCAGGTGGTCCTGGGGCTGGCAAACGGCTCTGTGCA357CysProProProProGlyGlyProGlyAlaGlyLysArgLeuCysAla707580ATCTGCGGGGACCGAAGCTCAGGCAAGCACTATGGGGTTTACAGCTGC405IleCysGlyAspArgSerSerGlyLysHisTyrGlyValTyrSerCys859095GAGGGCTGCAAGGGTTTCTTCAAGCGCACCATTCGGAAGGACCTGACC453GluGlyCysLysGlyPhePheLysArgThrIleArgLysAspLeuThr100105110115TACTCGTGTCGTGATAACAAAGACTGTACAGTGGACAAGCGCCAGCGG501TyrSerCysArgAspAsnLysAspCysThrValAspLysArgGlnArg120125130AATCGCTGTCAGTACTGTCGCTATCAGAAGTGCCTGGCCACTGGCATG549AsnArgCysGlnTyrCysArgTyrGlnLysCysLeuAlaThrGlyMet135140145AAAAGGGAGGCGGTTCAGGAGGAGCGTCAACGGGGGAAGGACAAAGAC597LysArgGluAlaValGlnGluGluArgGlnArgGlyLysAspLysAsp150155160GGGGATGGAGATGGGGCTGGGGGAGCCCCTGAGGAGATGCCTGTGGAC645GlyAspGlyAspGlyAlaGlyGlyAlaProGluGluMetProValAsp165170175AGGATCCTGGAGGCAGAGCTTGCTGTGGAGCAGAAGAGTGACCAAGGC693ArgIleLeuGluAlaGluLeuAlaValGluGlnLysSerAspGlnGly180185190195GTTGAGGGTCCTGGGGCCACCGGGGGTGGTGGCAGCAGCCCAAATGAC741ValGluGlyProGlyAlaThrGlyGlyGlyGlySerSerProAsnAsp200205210CCAGTGACTAACATCTGCCAGGCAGCTGACAAACAGCTGTTCACACTC789ProValThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThrLeu215220225GTTGAGTGGGCAAAGAGGATCCCGCACTTCTCCTCCCTACCTCTGGAC837ValGluTrpAlaLysArgIleProHisPheSerSerLeuProLeuAsp230235240GATCAGGTCATACTGCTGCGGGCAGGCTGGAACGAGCTCCTCATTGCG885AspGlnValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAla245250255TCCTTCTCCCATCGGTCCATTGATGTCCGAGATGGCATCCTCCTGGCC933SerPheSerHisArgSerIleAspValArgAspGlyIleLeuLeuAla260265270275ACGGGTCTTCATGTGCACAGAAACTCAGCCCATTCCGCAGGCGTGGGA981ThrGlyLeuHisValHisArgAsnSerAlaHisSerAlaGlyValGly280285290GCCATCTTTGATCGGGTGCTGACAGAGCTAGTGTCCAAAATGCGTGAC1029AlaIlePheAspArgValLeuThrGluLeuValSerLysMetArgAsp295300305ATGAGGATGGACAAGACAGAGCTTGGCTGCCTGCGGGCAATCATACTG1077MetArgMetAspLysThrGluLeuGlyCysLeuArgAlaIleIleLeu310315320TTTAATCCAGACGCCAAGGGCCTCTCCAACCCTGGAGAGGTGGAGATC1125PheAsnProAspAlaLysGlyLeuSerAsnProGlyGluValGluIle325330335CTTCGGGAGAAGGTGTACGCCTCACTGGAGACCTATTGCAAGCAGAAG1173LeuArgGluLysValTyrAlaSerLeuGluThrTyrCysLysGlnLys340345350355TACCCTGAGCAGCAGGGCCGGTTTGCCAAGCTGCTGTTACGTCTTCCT1221TyrProGluGlnGlnGlyArgPheAlaLysLeuLeuLeuArgLeuPro360365370GCCCTCCGCTCCATCGGCCTCAAGTGTCTGGAGCACCTGTTCTTCTTC1269AlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePhe375380385AAGCTCATTGGCGACACCCCCATTGACACCTTCCTCATGGAGATGCTT1317LysLeuIleGlyAspThrProIleAspThrPheLeuMetGluMetLeu390395400GAGGCTCCCCACCAGCTAGCCTGAGCCCAGATGCACACCGAGTGTCACTGA1368GluAlaProHisGlnLeuAla405410GGAGGACTTGAGCCTGGGCAGGGGGCAGAGCCATGGGACAGGTGCAGAGCAGGAGGGGAC1428TTGCCCAGCCTGCCAGGGATCTGGCAACACTTAGCAGGGTTCGCTTGGTCTCCAAGTCGA1488AGGGGACCCCAGATCCCTGTGAGGACTTTATGTCTACCTTCAGTGGCCTTGAGTCTCTGA1548ATTTGTCGGGGTCTCCCATGGTGCAGGTGATTCTTCATCCTGGCTCCCCAGCACAAAGCA1608CTGCCCTGCTTCCTTCTCATTTGGCCTCACTCCCTTCTGAAGAGTGGAACAGAGCTCCCC1668CAGAAAGGGGTGTTGTGGGGCAGGCCCCCCAAGCTGATGATCATGGGAGCAGGGCTCTGA1728CAGCCTTTATCCTCTCAGACTTGACAGATGGGGGCAGAGGAGGGACCTGCCTCTGTCTCC1788TGTCAGCCCCATTTCCACAGTCCCTCCTGCAGTCAGACTGAAGAATAAAGGGGTAGTGAA1848GGGGCTGCTGGAGGTGGAGGAACCCATTGCTCTTTTAATTTCCTGTGAGGAGAGACTGGG1908AGTTAGACTCAAAGAAGTACTGTACATCCCCAGGTTGACTTAAATGTCAGGGCTGGAGAT1968GGCATGTGGGCAAGGAGGCCCCTCAGGTGGGCTGTCCCAAAGCTCCCTGGGCTCTGCCTC2028GGGTGGCCCTACAGCTCTTCCCTAGTCTTAAGCACAGCTAGGCTGGGAGCAAGTGGGGAC2088ATTGATGGGGGTGGCCAGCCTGCAGAGTTGGGTGCTGGGCTGCATGGTTTTTGCCCTGGA2148CCTCTTTTGGGGGTTCCCTCCCATCTTTCACTTGCACATAAAGTTGCTTTCCAGTTAAAA2208AAAAAAAAAAA2219__________________________________________________________________________

Number	Name	Date
4981784	Evans et al.	Jan 1991
5171671	Evans et al.	Dec 1992
5274077	Evans et al.	Dec 1993
5403925	Ozato	Apr 1995

	Number	Date	Country
Parent	933453	Aug 1992
Parent	478071	Jan 1991

DNA encoding retinoid receptor X (RXR) alpha and gamma; corresponding vectors and host cells

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

RELATED APPLICATIONS

US Referenced Citations (4)

Non-Patent Literature Citations (7)

Continuations (2)