DNA encoding the 15kD outer membrane protein of Haemophilus influenzae

Abstract

Murine monoclonal antibodies directed against a novel outer membrane protein (OMP) of Haemophilus influenzae have been isolated and characterized. The gene encoding of the outer membrane protein has also been isolated and characterized. Portions of the DNA sequence of the 15 kD OMP gene are useful as probes to diagnose the presence of Haemophilus influenzae in samples. These DNA's also make available polypeptide sequences of immunoreactive epitopes encoded within the gene, thus permitting the production of polypeptides which are useful as standards or reagents in diagnostic tests and/or as components of vaccines. Monoclonal antibodies directed against epitopes of the 15 kD OMP are also useful for diagnostic tests and as therapeutic agents for passive immunization.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates to the 15 kD outer membrane protein of Haemophilus influenzae type b and nontypable Haemophilus influenzae.

For the sake of simplicity, Haemophilus influenzae is hereinafter referred to as H. influenzae.

2. Discussion of the Prior Art

Haemophilus influenzae type b is a major cause of meningitis and other invasive bacterial diseases in children under the age of five. Efficacious vaccines have been produced. The vaccines contain the type b capsular polysaccharide conjugated to a carrier protein. Nontypable H. influenzae cause surface mucosal infections in children and adults. Such organisms also cause invasive disease in children in the developing world and immunocompromised patients. The vaccines which have been developed to prevent disease due to type b organisms are not effective against nontypable H. influenzae.

SUMMARY OF THE INVENTION

Outer membrane proteins elicit antibodies which are protective in animal models and therefore should be considered as components in the next generation of vaccines designed to prevent both serotype b and nontypable Haemophilus disease.

The object of the invention is to clone the gene for this H. influenzae protein, and to determine the DNA sequence thereof.

Accordingly, the present invention relates to a recombinant polynucleotide comprising a nucleotide sequence for the 15 kD protein of Haemophilus influenzae type b and nontypable Haemophilus influenzae, said protein having the amino acid sequence as follows: ##STR1##

Nucleotide Sequence Coding for a Common Outer Membrane Protein from H. influenzae and Monoclonal Antibodies

The 15 kD outer membrane protein described herein is conserved among type b and nontypable H. influenzae. Epitopes on the native protein are recognized by the murine monoclonal antibodies 6B11, 1A6, and 5E6. The epitopes are present on the surface of intact H. influenzae cells. The gene for the 15 kD protein has been cloned and the DNA sequence thereof has been determined. The gene, when expressed in an appropriate host/vector system, produces a recombinant protein which is reactive with the monoclonal antibodies. Since the protein is antigenically highly conserved, it should receive serious consideration for inclusion in a vaccine to prevent H. influenzae disease. Moreover monoclonal antibodies and DNA probes may be used as a diagnostic tool to detect the presence of H. influenzae.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a Western blot analysis of H. influenzae with monoclonal antibodies;

FIG. 2 is a partial restriction map of plasmid pRSM1255 which contains the gene for the 15 kD outer membrane protein from H. influenzae type b strain 1613;

FIG. 3 is a Western blot analysis of the expression of the recombinant 15 kD protein;

FIG. 4 is a dot blot immunoassay of extracts of E. coli strains LE392/pGD103 and LE392/pRSM1311; and

FIG. 5 is the amino acid sequence for the polynucleotide of the present invention.

DESCRIPTION OF THE PREFERRED EMBODIMENT GENERATION OF MONOCLONAL ANTIBODIES

Monoclonal antibodies (Mabs) were obtained from two independent fusion experiments. Mab 1A6 was generated from Balb/c mice immunized with sarcosyl-insoluble proteins of nontypable H. influenzae MTL6 as described by Hamel et al see Journal of General Microbiology (1992), 138, 161-168! and monoclonal antibodies 6B11 and 5E6, were produced from mice immunized with outer membranes extracted from nontypable H. influenzae 12085 by the lithium chloride method described by Hamel et al see J. Med. Microbiology, (1987) 23 163-170!. Isotype analysis revealed that the 1A6, 6B11 and 5E6 hybridomas secreted immunoglobulin IG2a, IG1 and IG3 respectively.

Referring to FIG. 1, Western Immunoblotting analysis of outer membrane preparations was performed. Outer membrane preparations were fractionated on 16% SDS-PAGE, transferred to nitrocellulose, and probed with Mab 1A6 (lane 1), 6B11 (lane 2), 5E6 (lane 3) and porin-specific Mab P2-18 (lane 4). The analysis indicated that the monoclonal antibodies were directed against a protein with an apparent mass of 15 kD. Antibody accessibility radioimmunoassay see Proulx et al, Infection and Immunity (1991)59, 963-970! indicated that monoclonal antibodies bound to surface-exposed epitopes on both type b and nontypable H. influenzae isolates.

CONSERVATION OF 15 KD-EPITOPES

A total of 193 H. influenzae isolates were tested by dot blot immunoassay for their reactivity with monoclonal antibodies 1A6, 6B11 and 5E6.

TABLE 1______________________________________Characteristics of H. influenzae strains tested formonoclonal antibody reactivities Number Reactive/Strains Total Number.sup.a______________________________________H. influenzae serotype b;Division 1; Clonal group A1.sup.b 27/27Clonal group A2 59/59Clonal group B1 5/5Division 2; Clonal group J 1/1H. influenzae serotype a;Division 1 2/2Division 2 2/2H. influenzae serotype d; 2/2Division 1H. influenzae nontypable 95/95Other gram-negative species.sup.c 0/19______________________________________ .sup.a Reactivity of MAb 6B11, and 5E6 was tested individually by blot immunoassay. .sup.b The chromosomal genotypes of H. influenzae expressing serotype a, and d capsule were previously characterized by Dr. James Musser (see J. Musser et al "Global Genetic STructure and Molecular Epidemiology of Encopsulated Haemophilus Influenzae, Reviews of Infectious Diseases 12, 75-111). .sup.c Nineteen isolates representing 19 other gramnegative species were tested. These are listed in Table 2. TABLE 2______________________________________Non-H. influenzae isolates tested______________________________________ Alcaligenes odorans Citrobacter freundii Flavobacterium odoratum Edwardsiella tarda Enterobacter cloaca Enterobacter aerogenes Klebsiella pneumoniae Moraxella catharrhalis Neisseria lactamica Neisseria perflava Neisseria subflava Pseudomonas aeruginaosa Proteus vulgaris Providencia rettgeri Serratia marcescens Salmonella thyphimurium Shigella flexneri Shigella sonnei Xanthomonas maltophilia______________________________________

MOLECULAR CLONING OF THE GENE FOR THE 15 KD OUTER MEMBRANE PROTEIN

A lambda EMBL3 genomic library of DNA from H. influenzae strain 1613 was immunologically screened with murine monoclonal antibody 6B11 as described by Munson and Grass see Infection and Immunity (1988) 561 2235-2242!. An immunologically reactive clone was isolated by plaque purification. A liquid lysate was prepared and DNA was purified from a Promega lambda DNA kit according to the manufacturer's directions. The Haemophilus insert was identified as a SalI fragment of approximately 16 kb. DNA from the lambda clone was partially digested with Sau3A and fragments of approximately 3-6 kb were isolated by preparative agarose gel electrophoresis. The 3-6 kb fragments were ligated into the low copy number vector pGD103 see Deich et al, Journal of Bacteriology (1988) 489-498! which had been digested sequentially with BamHI and alkaline phosphatase. The ligation mixture was transformed into E. coli strain LE392 and the cells were plated on LB agar containing 35 .mu.g/ml of kanamycin. Immunologically reactive colonies were identified by screening with murine Mab 6B11. Strain LE392/pRSM1255 was saved for further study. As shown in FIG. 2 plasmid pRSM1255 has an insert of approximately 3.8 kb. Strain LE392/pRSM1255 produces the full size protein as determined by Western blot (see FIG. 3). Membrane preparations were fractionated by SDS-PAGE, transferred to nitrocellulose and probed with murine monoclonal antibody 6B11. Lane 1 is the total membrane preparation of H. influenzae strain 1613; lane 2 is the total membrane preparation of E. coli strain LE392/pGD103 and lane 3 is the total membrane preparation of E. coli strain LE392/pRSM1255. The full size 15 Kd protein is produced by E. coli strain LE392/pRSM1255.

In order to further subclone the gene for sequencing, pRSM1255 was partially digested with Sau3A, fragments of approximately 0.5 to 1.5 kb were isolated, ligated into BamHI-treated pGD103 and transformed into E. coli strain LE392. An immunologically positive clone, designated LE392/pRSM1311 was saved for further analysis. Western blot analysis employing Mab 6B11 indicated that the full size protein was produced by this strain (data not shown). The Haemophilus insert in pRSM1311 is approximately 0.6 kb in size. Extracts of E. coli strain LE392/pRSM1311 react with all three murine Mabs (FIG. 4). 5 .mu.g of cell extracts were applied to the nitrocellulose and probed with Mabs 3B11, 1A6, and 5E6.

SEQUENCE ANALYSIS

The insert was cloned into M13mp18 and M13mp19 as a SalI to EcoRI fragment and sequenced in both directions. A 369 codon open reading frame was identified encoding a protein composed of 123 amino acids and having a molecular weight of 13,460. The open reading frame is notable for a lysine at position 3 and a cysteine at position 26 suggesting that the protein is a lipoprotein with a 25 amino acid leader peptide.

DNA and protein sequence analysis were done using Gen Bank (a trademark of NIH) and EMBL (from European Molecular Biology Organization) data bases. The nucleotide and derived amino acid sequence of the 15 kD outer membrane protein of H. influenzae type b, strain 1613 is set out in Table 3.

TABLE 3__________________________________________________________________________MW for gene product = 13460.Number of amino acids = 123__________________________________________________________________________ ##STR2## ##STR3## ##STR4## ##STR5## ##STR6## ##STR7## ##STR8## ##STR9## ##STR10## ##STR11##__________________________________________________________________________

The sequence was found to have no significant homology to any known proteins including two previously described Haemophilus outer membrane lipoproteins of similar size.

The research described herein was supported in part by United States Public Health Service grant R01AI17572 from the National Institutes of Health.

The sequence for the polynucleotide claimed in this application is as follows:

__________________________________________________________________________SEQUENCE DESCRIPTION: SEQ ID NO: 1:__________________________________________________________________________GATCCCACCTTGTTTATTCCAATAATGGAACTTTATTTTATTAAAGGTATCTAAGTAGCA60CCCTATATAG GGATTAATTAACGAGGTTTAATAATGAACTTTAACTAAAATTTTACCAGC120ATTTGCTGCTGTAGTCTGTATTATCTGCTTGTGCAAAGGATGCACCTGAAATGACAAAAT180CATCTGCGCAAATAGCTGAAATGCAA ACACTTCCAACAATCACTGATAAAACAGTTGTAT240ATTCCTGCAATAAACAAACG GTGACTGCTG TGTATCAATTTGAAAACCAAGAACCAGTTG300CTGCAATGGTAAGTGTGGGCGATGGCATTATTGCCAAAGATTTTACTCGTGATAAATCAC360AAAATGACTTTACAAGTTTCGTTTCTGGGG ATTATGTTTG GAATGTAGATAGTGGCTTAA420CGTTAGATAAA TTTGATTCTGTTGTGCCTG TCAATTTAATTCAAAAAGGTAAATCTAGCG480ATAATATCATCGTCAAAAATTGTGATGTAAACGTAAAAGCAACTAAAAAAGCAAATTTAT540AATTAATCCCAAATGACCAG CATAATTGCTGGTTATTTATCTTCCTCGAG GGGAGATTTT600TTCTTGA607__________________________________________________________________________

The amino acid sequence for the outer membrane protein of haemophilus influenzae claimed in this application is as follows:

__________________________________________________________________________SEQUENCE DESCRIPTION: SEQ ID NO: 2:__________________________________________________________________________ ##STR12## ##STR13## ##STR14## ##STR15## ##STR16## ##STR17## ##STR18## ##STR19##__________________________________________________________________________ __________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 607 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: misc-feature(B) LOCATION: 171..539(D) OTHER INFORMATION: /note="Nucleotides 171 through 539encode the outer membrane protein of HaemophilusInfluenzae of Sequence ID No. 2."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GATCCCACCTTGTTTATTCCAATAATGGAACTTTATTTTATTA AAGGTATCTAAGTAGCA60CCCTATATAGGGATTAATTAACGAGGTTTAATAATGAACTTTAACTAAAATTTTACCAGC120ATTTGCTGCTGTAGTCTGTATTATCTGCTTGTGCAAAGGATGCACCTGAAATGACAAAAT180CATCTGCGCAAATAGCTG AAATGCAAACACTTCCAACAATCACTGATAAAACAGTTGTAT240ATTCCTGCAATAAACAAACGGTGACTGCTGTGTATCAATTTGAAAACCAAGAACCAGTTG300CTGCAATGGTAAGTGTGGGCGATGGCATTATTGCCAAAGATTTTACTCGTGATAAATCAC 360AAAATGACTTTACAAGTTTCGTTTCTGGGGATTATGTTTGGAATGTAGATAGTGGCTTAA420CGTTAGATAAATTTGATTCTGTTGTGCCTGTCAATTTAATTCAAAAAGGTAAATCTAGCG480ATAATATCATCGTCAAAAATTGTGATGTAAACGTAA AAGCAACTAAAAAAGCAAATTTAT540AATTAATCCCAAATGACCAGCATAATTGCTGGTTATTTATCTTCCTCGAGGGGAGATTTT600TTCTTGA607(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 123 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: misc-feature(B) LOCATION: 1..123(D) OTHER INFORMATION: /note="Nucleotides 171 through 539encode the outer membrane protein of Haemophilus Influenzae of Sequence ID No. 2."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetThrLysSerSerAlaGlnIleAlaGluMetGlnThrLeuProThr151015IleThrAspLysT hrValValTyrSerCysAsnLysGlnThrValThr202530AlaValTyrGlnPheGluAsnGlnGluProValAlaAlaMetValSer35 4045ValGlyAspGlyIleIleAlaLysAspPheThrArgAspLysSerGln505560AsnAspPheThrSerPheVal SerGlyAspTyrValTrpAsnValAsp65707580SerGlyLeuThrLeuAspLysPheAspSerValValProValAsnLeu 859095IleGlnLysGlyLysSerSerAspAsnIleIleValLysAsnCysAsp100105110ValAsnVal LysAlaThrLysLysAlaAsnLeu115120

Claims

1. The recombinant polynucleotide having the sequence ##STR20## encoding a polypeptide comprising immunoreactive epitopes of the 15 kD outer membrane protein of Haemophilus influenzae.

2. A vector comprising a recombinant polynucleotide, wherein the recombinant polynucleotide is the recombinant polynucleotide of claim 1.

3. A host cell transformed with the vector of claim 2.

4. A recombinant expression system comprising a polynucleotide encoding a polypeptide comprising one or more immunoreactive epitopes of the 15 kD outer membrane protein of claim 1, wherein the polynucleotide is operably linked to a control sequence compatible with a desired host.

5. A cell transformed with a recombinant expression system, wherein the expression system is the recombinant expression system of claim 4.