DNA sequence encoding sterol .DELTA.14 reductase

TECHNICAL FIELD OF THE INVENTION
This invention relates to the identification of a Saccharomyces cerevisiae gene encoding sterol .DELTA.14 reductase.
BACKGROUND OF THE INVENTION
Sterols are steroid alcohols of vegetable and animal origin. Ergosterol is the principal membrane sterol of fungi. It is structurally similar to its animal counterpart, cholesterol, and its higher plant counterparts, stigmasterol and sitosterol. Though the biosynthesis of ergosterol in fungi involves steps distinct from the other sterols, the pathways in different organisms share several common steps. The lanosterol 14.alpha.-demethylation steps in cholesterol and ergosterol formation in animals and fungi, as well as the obtusifoliol 14.DELTA.-demethylation in stigmasterol and sitosterol biosynthesis in plants, both lead to the formation of a double bond between carbons 14 and 15 of the sterol ring. This double bond is then reduced by sterol .DELTA.14 reductase activity. The enzyme is located in the microsomal fraction in pig liver, yeast and Zea mays, and requires NADPH as an electron donor (Marcireau, C., et al., Curt. Genet. 22: 267-272 (1992)).
Genetic studies of ergosterol biosynthesis mainly have been carried out in Saccharomyces cerevisiae (Paltauf, F., et al., in Jones, E. W., et al., eds., The Molecular and Cellular Biology of the Yeast Saccharomyces, Gene Expression, Cold Spring Harbor Laboratory Press, 1992, pages 434-437). In yeast, ergosterol affects membrane fluidity and permeability and plays an essential role in the yeast cell cycle.
A number of mutations in the yeast ergosterol biosynthetic pathway have been isolated either by reverse genetic approaches or by selection for mutations producing polyene resistance, and many of the genes have been identified. Toward the end of the pathway, sterol .DELTA.14 reductase, .DELTA.8-.DELTA.7 isomerase, and C-24(28) reductase catalyze steps in the conversion of lanosterol to ergosterol. After ignosterol is reduced by sterol .DELTA.14 reductase, which eliminates a double bond in the D ring of the molecule, the sterol is demethylated and rearranged to fecosterol, which is then isomerized by sterol .DELTA.8-.DELTA.7 isomerase. The sterol is then desaturated in two positions and its side chain is reduced by C-24(28) reductase. Some of the genes encoding the enzymes have been identified and named as follows (Paultauf, et al., cited above, Lorenz, T., and Parks, L. W., DNA and Cell Biol. 11: 685-692 (1992), and Example 1 below):
______________________________________Enzyme Gene______________________________________.DELTA.14 reductase ERG24C-24 methyl transferase ERG6.DELTA.8 - .DELTA.7 isomerase ERG2C-24(28) reductase ERG4______________________________________
Based on the accumulation of intermediates following fungicide treatment, morpholine fungicidal compounds such as tridemorph and fenpropimorph have been reported to be inhibitors of sterol 14 reductase and sterol .DELTA.8-.DELTA.7 isomerase (Baloch, R. and Mercer, I., Phytochemistry 26: 663-668 (1987)). However, it recently has been found that the sterol .DELTA.8-.DELTA.7 isomerase gene is not essential for viability in S. cerevisiae (Ashman, W. H., et al., Lipids 26: 628-632 (1991)), suggesting that the killing effect of morpholine fungicides may be primarily the result of sterol .DELTA.14 reductase inhibition.
It has also been shown that the C-24 methyl transferase gene (ERG6) is not essential for viability in S. cerevisiae (Gaber, R. F., et al., Mol. Cell. Biol. 9: 3447-3456 (1989)). Mutant cells exhibit normal vegetative growth, but they differ from the wildtype in a number of respects, including drug supersensitivity, presumably due to alterations in membrane function (ibid.). Drug super-sensitivity has been observed in other yeast mutants, including one denoted YGL022 which encodes a putative transport protein (Chen, W., et al., Yeast 7: 305-308 (1991)).
SUMMARY OF THE INVENTION
The objects of the invention are to identify a gene encoding sterol .DELTA.14 reductase, to elucidate the primary structure of the enzyme encoded by the gene, and to investigate the relationship of the structure to other polypeptides, especially other enzymes in the sterol biosynthetic pathway. The sterol .DELTA.14 reductase gene and enzyme are useful in devising screening tests to identify sterol biosynthesis inhibitors that are potential fungicides for a wide variety of agricultural, medical, and veterinary applications.
These and other objects are accomplished by the present invention, which provides a gene encoding sterol .DELTA.14 reductase, the polypeptide primary structure it encodes, and the relationship of the structure to other polypeptides. Also provided are RNA sequences corresponding to the DNA sequence of the gene, biologically functional plasmids or vectors comprising the DNA or RNA sequence, and procaryotic or eucaryotic host cells transformed or transfected with the plasmid or vector in a manner allowing the host cell to express the polypeptide.
A DNA sequence encoding Saccharomyces cerevisiae sterol .DELTA.14 reductase is cloned by selecting strains carrying sequences on a 2.mu. based vector for resistance to a morpholine fungicide such as fenpropimorph, fenpropidin, or tridimorph. Fenpropimorph is preferred. When fenpropimorph is employed, four distinct plasmid inserts which produce morpholine resistance are obtained, denoted pML99, pML100, pML101 and pML103, which are useful in screens of sterol biosynthesis inhibition. One of these, pML100, is characterized and sequenced, and the putative amino acid sequence of the polypeptide encoded by the open reading frame is determined (SEQ ID NO 1).

DESCRIPTION OF THE FIGURES
FIG. 1 shows restriction maps of four plasmid inserts recovered via selection for fenpropimorph resistance in Saccharomyces cerevisiae as described in Example 1. Selected restriction enzyme digestion sites are shown for each insert.
FIG. 2 shows fenpropimorph resistance of subclones of pML100, a plasmid containing the cloned sterol .DELTA.14 reductase gene.
FIG. 3 depicts a comparison of the amino acid sequence derived from the major open reading frame of the pML100 sequence encoding S. cerevisiae sterol .DELTA.14 reductase (SEQ ID NO 1) with three homologous sequences: the chicken nuclear lamin B receptor (SEQ ID NO 2, Worman, H. J., et al., J. Cell Biology 111: 1535-1542 (1990)), the Saccharomyces cerevisiae YGL022 sequence (SEQ ID NO 3, Chen, et al., cited above), and the Schizosaccharomyces pombe stsl gene (SEQ ID NO 4, Shimanuki, M., et al., Mol. Biol. Cell 3: 263-273 (1992)). The figure employs standard one-letter nomenclature for the amino acids: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.

DETAILED DESCRIPTION OF THE INVENTION
The Saccharomyces cerevisiae gene encoding sterol .DELTA.14 reductase is cloned by selecting strains carrying sequences on a 2.mu. based vector for resistance to a morpholine fungicide. One of the plasmids so obtained is characterized and sequenced to obtain the primary structure of sterol .DELTA.14 reductase.
By "morpholine fungicide" is meant any morpholine and structurally related piperidine compound having large ring N-substituents such as dodemorph, tridemorph, aldimorph, fenpropimorph, amorolfine, and fenpropidin which are employed as fungicides. Mixtures of morpholine fungicides may also be employed. Fenpropimorph is employed in one embodiment.
In morpholine screenings of S. cerevisiae strains carrying DNA sequences on a 2.mu. vector, plasmid inserts which produce morpholine resistance are recovered. For example, where fenpropimorph is the morpholine employed, four plasmids denoted pML99, pML100, pML101 and pML103 are recovered. Although fenpropimorph is reported to inhibit the enzymes sterol .DELTA.14 reductase and .DELTA.8-.DELTA.7 isomerase, none of the inserts exhibit restriction maps resembling ERG2, the gene encoding .DELTA.8-.DELTA.7 isomerase. In addition, a 2.mu. plasmid carrying the ERG2 sequence does not produce fenpropimorph resistance.
Plasmid pML100 produces fenpropimorph resistance consistently when tested in a number of different genetic backgrounds. Tests with a panel of fungicides indicate that pML100 produces significant resistance only to the morpholine fungicides fenpropimorph, tridemorph, fenpropidin, and azasterol, compounds which have a shared site of action, the enzyme sterol .DELTA.14 reductase. No increase in resistance is seen to a variety of other fungicides which are not sterol .DELTA.14 reductase inhibitors, suggesting that pML100 encodes a function specific to sterol .DELTA.14 reductase activity. Other investigators report that selection for fenpropidin or fenpropimorph resistance in other S. cerevisiae strains produce plasmids exhibiting properties similar to pML100 (Lorenz and Parks, cited above, and Marcireau, C., et al., cited above).
A chromosomal disruption of the sequence producing morpholine resistance results in ergosterol auxotrophy and the build-up of ignosterol, the sterol .DELTA.14 reductase substrate. The DNA sequence which produces this activity is obtained (SEQ ID 1), which contains an open reading frame encoding an integral membrane protein, consistent with an enzyme catalyzing a reaction in the ergosterol biosynthesis pathway.
Thus, this invention provides a purified and isolated DNA sequence encoding Saccharomyces cerevisiae sterol .DELTA.14 reductase. Because of the degeneracy of the genetic code, a variety of codon change combinations can be selected to form DNA that encodes sterol .DELTA.14 reductase, so that any nucleotide deletion(s), addition(s), or point mutation(s) that result in a DNA encoding sterol .DELTA.14 reductase are encompassed by this invention. Since certain codons are more efficient for polypeptide expression in certain types of organisms, the selection of gene alterations to yield DNA material that codes for the enzyme are preferably those that yield the most efficient expression in the type of organism which is to serve as the host of the recombinant vector. Altered codon selection may also depend upon vector construction considerations.
DNA which encodes .DELTA.14 reductase may be natural, recombinant or synthetic. Thus, DNA of the invention may be isolated from yeast strains or constructed from oligonucleotides using conventional methods. Also encompassed are DNA sequences homologous or closely related to complementary DNA described herein, namely DNA sequences which hybridize, particularly under stringent conditions that result in pairing only between nucleic acid fragments that have a high frequency of complementary base sequences, to DNA encoding sterol .DELTA.14 reductase particularly described herein, and RNA corresponding thereto. In addition to these sequences, DNA encompassed by this invention may contain additional sequences, depending upon vector construction sequences, that facilitate expression of the gene.
As described above, DNA encoding the sterol .DELTA.14 reductase of this invention, or RNA corresponding thereto, are useful when introduced into a vector or plasmid, and the recombinant plasmid used to transform microbial host organisms such as S. cerevisiae. Other host cells such as E. coli may be employed in some embodiments. Especially useful in some embodiments are S. cerevisiae cells into which the gene has been introduced at high copy. This invention thus also provides novel, biologically functional RNA and DNA vectors and plasmids incorporating RNA and DNA sequences describing the reductase generated by standard means. Culture of host organisms stably transformed or transfected with such vectors or plasmids under conditions facilitative of large scale expression of the exogenous, vector-borne DNA or RNA sequences and isolation of the desired polypeptides from the growth medium, cellular lysates, or cellular membrane fractions are also provided.
The present invention provides for the total and/or partial manufacture of DNA sequences coding for sterol .DELTA.14 reductase, and including such advantageous characteristics as incorporation of codons preferred for expression by selected hosts, provision of sites of cleavage by restriction by endonuclease enzymes, and provision of additional initial, terminal or intermediate DNA sequences which facilitate construction of readily expressed vectors.
DNA (and RNA) sequences of this invention code for all sequences useful in securing expression in procaryotic or eucaryotic host cells of polypeptide products having at least a part of the primary structural conformation, and one or more of the biological properties of sterol .DELTA.14 reductase which are comprehended by: (a) the DNA sequence encoding sterol .DELTA.14 reductase; (b) DNA sequences which hybridize to DNA sequences defined in (a) or fragments thereof; and (c) DNA sequences which, but for the degeneracy of the genetic code, would hybridize to the DNA sequences defined in (a) and (b) above. Specifically comprehended are genomic DNA sequences encoding allelic variant forms of the enzyme, and sequences encoding RNA, fragments thereof, and analogues wherein RNA or DNA sequences may incorporate codons facilitating transcription or RNA replication host cells.
Particularly useful are S. cerevisiae strains into which has been introduced a DNA sequence of this invention, particularly those having multiple copies of the gene. Such strains are useful in screens for sterol .DELTA.14 reductase inhibition such as those described in copending U.S. application Ser. No. 08/107,348 filed concurrently with this application and incorporated in its entirety by reference. In an example screen, test samples are added to a yeast culture of a transformed strain such as a strain transformed with pML100, and to a corresponding control culture which does not have the introduced gene. Positive samples are identified after incubation by observation that growth inhibition in the culture having no introduced reductase gene exceeds growth in the corresponding culture having the introduced gene. In preferred embodiments, a known inhibitor of sterol .DELTA.14 reductase is employed for comparison purposes in both cultures of the screen.
Other plasmids that produce morpholine resistance such as pML99, pML101, and pML103 described above are also useful in other screens for compounds that affect sterol biosynthesis, including screens for sterol .DELTA.14 reductase inhibitors such as those described above. As set out more fully hereinafter, in initial genetic analyses, these plasmids show differences from pML100 in their interactions with ergosterol biosynthesis mutations. Hence, these plasmids are useful with screens such as those described above except that different yeast strains are employed. Alternatively, screening results with these plasmids can be used in combination with screening tests using pML100.
This invention also provides the polypeptide encoded by the sterol .DELTA.14 reductase sequences of this invention, e.g., the polypeptide encoded by the open reading frame set out in SEQ ID NO 1. Correspondingly, the invention provides for manufacture (and development by site specific mutagenesis of cDNA and genomic DNA) of DNA sequences coding for microbial expression of sterol .DELTA.14 reductase which differ from the forms specifically described herein in terms of identity or location of one or more amino acid residues (i.e., deletion and/or substitution analogues wherein one or more residues are added to a terminal or medial portion of the polypeptide), and which share the biological properties of the enzyme. In embodiments involving the microbial expression of polypeptides provided by the invention, isolation and purification employ standard methodology including, for example, preparative chromatographic separations and immunological separations, including monoclonal and/or polyclonal antibody preparations.
The sequence of pML100 exhibits partial homology to three other previously reported genes as follows (see FIG. 3): the chicken nuclear lamin B receptor (SEQ ID NO 2, Worman, H. J., et al., cited above; 101 out of 419 amino acids), the S. cerevisiae YGL022 sequence (SEQ ID NO 3, Chen, et al., cited above; 95 out of 473 amino acids), and the Schizosaccharomyces pombe stsl gene (SEQ ID NO 4, Shimanuki, M., et al., cited above; 92 out of 453 amino acids). The phenotypes of strains carrying stsl and YGL022 mutations are consistent with the hypothesis that these mutations produce lesions in erogsterol biosynthesis. The S. pombe stsl.sup.+ gene and the S. cerevisiae YGL022 sequence have been reported to encode putative transport proteins which produce drug resistance by pumping compounds out of the cell. Mutations in these genes produce super-sensitivity to a wide variety of compounds. Drug super-sensitivity is also a phenotype associated with ergosterol biosynthesis mutations such as erg6 (Gaber, R. F., et al., Mol. Cell. Biol. 9: 3447-3456 (1989)), erg2 and erg3, presumably due to alterations in membrane function.
Physiological studies with an stsl mutant strain and a YGL022 disruption strain more particularly described hereafter and complementation studies with YGL022 provide direct proof that stsl.sup.+ and YGL022 encode a function in sterol biosynthesis identified as ERG4, sterol C-24(28) reductase, in S. cerevisiae. Thus, the enzymes sterol .DELTA.14 reductase and sterol C-24(28) reductase are related enzymes, with the former catalyzing the reduction of a double bond in the D ring and the latter catalyzing the reduction of a double bond in the side chain of the sterol.
The following examples are presented to further illustrate and explain the present invention and should not be taken as limiting in any regard. Fenpropimorph, fenpropidin and tridemorph are purchased from Crescent Chemical Company, Inc., Hauppauge, N.Y. Synthetic dextrose (SD) media contains 0.7% yeast nitrogen base without amino acids, 2% dextrose and 2% agar. Yeast extract, peptone and dextrose (YEPD) media contains 1% yeast extract, 2% peptone, 2% dextrose and 2% agar.
EXAMPLE 1
This example describes the cloning and sequencing of the Saccharomyces cerevisiae gene encoding sterol .DELTA. 14 reductase. The gene is isolated and cloned by selecting strains carrying sequences on a 2.mu. based vector for resistance to the morpholine fungicide, fenpropimorph, to obtain a plasmid which is shown to carry the structural gene based upon the phenotype of gene disruption strains.
Isolation and characterization of morpholine resistance plasmids. Morpholine and structurally related piperidine fungicides reportedly inhibit sterol .DELTA.14 reductase and sterol .DELTA.8 to .DELTA.7 isomerase (Baloch and Mercer, cited above). The growth of S. cerevisiae strain Y294, genotype MAT.alpha., leu2-3,112, ura3-52, his3.DELTA., trpl, Gal.sup.+ (Brugge, J. S., et al., Mol. Cell. Biol. 7: 2180-2187 (1987)), in SD medium supplemented with leucine, tryptophan, uracil and histidine is inhibited by 20 .mu.g/ml of the morpholine fungicide fenpropimorph and 50 .mu.g/ml of the morpholine fungicide tridemorph. Fenpropimorph is used for subsequent selection experiments because of its slightly greater potency.
When Y294 cells are plated onto 20 .mu.g/ml of fenpropimorph in SD media supplemented with leucine, tryptophan, uracil and histidine, spontaneous mutants are recovered at the rate of .about.1 per 2.5.times.10.sup.6 plated cells. When a library of S. cerevisiae sequences in the multicopy vector YEp13 (Nasmyth, K. A., and Tatchell, K., cell 19: 753-764 (1980)) is introduced into strain Y294 and cells are plated on SD media supplemented with tryptophan, uracil, histidine and fenpropimorph, resistant colonies appeared at the rate of .about.1 per 10.sup.4, suggesting that resistance is produced by library plasmids in some of the colonies. Plasmids are cured from randomly selected resistant colonies by growing the cells in non-selective rich YEPD media and retesting for fenpropimorph resistance. In 13 strains, the plasmid-cured derivative shows sensitivity to 20 .mu.g/ml fenpropimorph while the original plasmid carrying strain retested as fenpropimorph-resistant.
DNA is isolated from these 13 strains and plasmid DNA is recovered by E. coli transformation. Five different types of plasmid DNA are identified following an examination of restriction enzyme digestion patterns using standard methods (FIG. 1). Seven strains carry one plasmid type, pML99, which has an insert of approximately 5.5 kb. Two additional strains carry a second plasmid type, pML100, which has an insert of approximately 5.6 kb. A third plasmid type, pML101, is found in two strains and carries an insert of approximately 5.5 kb. Two additional plasmid types are each recovered from a single strain and named pML102 (.about.7.5 kb insert) and pML103 (.about.5.1 kb insert). One representative plasmid of each type is selected and subjected to extensive restriction enzyme analysis, which indicates that the insert from plasmid pML101 is contained within the insert from pML102 so that a total of four unique sequences are recovered in this selection. Restriction enzyme digestion maps of the four different insert sequences are shown in FIG. 1.
A panel of fungicides representing a variety of chemical structures and mechanisms of action listed in Table 1 is tested by disk diffusion assay against strains carrying each of these plasmids in a YEp13 vector control. All five strains show similar levels of sensitivity to all of the tested compounds with the exception of the morpholines, fenpropidin, fenpropimorph and tridemorph, and azasterol. These compounds are less active on the strains carrying the four plasmids recovered by selection for fenpropimorph resistance. Consistent with agar dilution sensitivity results, fenpropimorph is more active by disk diffusion than tridemorph. These results suggest that the cloned sequences encode functions specific to the activity of morpholines and related compounds and do not carry genes which produce general fungicide resistance, e.g., by altering cell permeability.
TABLE 1______________________________________Fungicides Used For Plasmid CharacterizationCompound Target______________________________________amphotericin B plasma membrance (polyene)cerulenin fatty acid biosynthesishaloprogin respirationketoconazole ergosterol biosynthesis (lanosterol 14.alpha.- demethylase)miconazole ergosterol biosynthesis (lanosterol 14.alpha.- demethylase)dinaconazole ergosterol biosynthesis (lanosterol 14.alpha.- demethylase)econazole ergosterol biosynthesis (lanosterol 14.alpha.- demethylase)fepropimorph ergosterol biosynthesis (sterol .DELTA.14 reductase/ .DELTA.8 - .DELTA.7 isomerase)tridemorph ergosterol biosynthesis (sterol .DELTA.14 reductase/ .DELTA.8 - .DELTA.7 isomerase)azasterol ergosterol biosynthesis (sterol .DELTA.14 reductase)tolnaftate ergosterol biosynthesis (squalene mono- oxygenase)U18666A ergosterol biosynthesis (squalene cyclase)cycloheximide protein biosynthesispolyoxin D chitin biosynthesis (cell wall)nikkomycin chitin biosynthesis (cell wall)nocodazole microtubule assemblybenomyl microtubule assemblymaneb multi-targetmetalaxyl rRNA biosynthesisvinclozoline lipid peroxidationkanamycin mitochondriatunicamycin glycoprotein biosynthesiscarboxin succinate dehydrogenaseantimycin respiration5-fluorocytosine nucleotide metabolismcyanobutarate microtubule assembly (herbicide)glyphosate aromatic amino acid biosynthesis (herbicide)phosphinothricin glutamine biosynthesis (herbicide)aminotriazole histidine biosynthesis (herbicide)sulfometuron branched chain amino acid biosynthesismethyl (herbicide)pendimethalin microtubule assembly (herbicide)______________________________________
The library employed for the selection is prepared using DNA isolated from strain AB320 (genotype HO, ade2-1, lys2-1, trp5-2, leu2-1, canl-100, ura3-1 and/or ural-1, met4-1, Nasmyth and Tatchell, cited above). When tested, strain AB320 is found to be slightly more sensitive to fenpropimorph than strain Y294, suggesting that the cloned sequences are likely to be producing resistance as the result of gene dosage effects.
Morpholine resistance in strains transformed with multi-copy ERG2 (sterol .DELTA.8-.DELTA.7 isomerase) plasmids. One gene that would be expected to produce morpholine resistance at high copy is ERG2, which encodes a reported morpholine target, .DELTA.8-.DELTA.7 isomerase. This gene was recently cloned by the complementation of a polyene resistance mutation (Ashman, cited above). The published ERG2 restriction map is different from the restriction maps of the four sequences recovered by morpholine resistance selection. Since it is possible that the ERG2 sequence is missed in the morpholine resistance screen, this gene is introduced into S. cerevisiae strain Y294 on the 2.mu. based plasmid, pML104, constructed by subcloning the ERG2 gene on a 2.1 kb HindIII fragment from plasmid PIU406 (Ashman, et al., cited above) into the HindIII site of plasmid YEp351. This strain shows no increase in fenpropimorph resistance relative to YEp351-transformed control strain. Plasmid pML104 does, however, produce nystatin sensitivity when introduced into the erg2 mutant strain WAO (Ashman, et al., cited above), demonstrating that plasmid pML104 carries a functional ERG2 gene. Sterol .DELTA.8-.DELTA.7 isomerase may not over-express when present on a 2.mu. based, multi-copy plasmid, or the enzyme may not be a morpholine target in S. cerevisiae.
Characterization of fenpropimorph resistance plasmid pML100. The four fenpropimorph-resistance plasmids pML99, pML100, pML101, and pML103 are transformed into three ergosterol pathway mutant strains, erg2 (denoted WAO, genotype MATa, his7-2, leu2-3,112, ura3-52, erg2-3, Ashman, et al., cited above); erg3 (denoted XML39-1d, geno-type MATa, leu2-3,112, erg3-2); and erg6 (denoted XML40-1c, genotype MATa, leu2-3,112, ga12, erg6-5). Morpholine sensitivity is determined by disk diffusion assay on appropriately supplemented SD medium using tridemorph and fenpropimorph. A zone size difference of greater than 3 mm performed in duplicate is recorded as resistance. The ergosterol pathway mutant strains vary in absolute level of morpholine sensitivity, and all resistance and sensitivity determinations are reported relative to vector (YEp13)-transformed control strains. The results are tabulated in Table 2. Only plasmid pML100 transformants are consistently fenpropimorph-resistant in all genetic backgrounds.
TABLE 2______________________________________Plasmid Phenotype in Ergosterol Pathway Mutant Strains ErgosterolStrain Genotype Plasmid Morpholine Resistance______________________________________Y294 ERG+ YEp13 -Y294 ERG+ pML99 +Y294 ERG+ pML100 +Y294 ERG+ pML101 +Y294 ERG+ pML103 +WAO erg2 YEp13 -WAO erg2 pML99 -WAO erg2 pML100 +WAO erg2 pML101 -WAO erg2 pML103 -XML39-1d erg3 YEp13 -XML39-1d erg3 pML99 +XML39-1d erg3 pML100 +XML39-1d erg3 pML101 -XML39-1d erg3 pML103 +/-*XML40-1c erg6 YEp13 -XML40-1c erg6 pML99 +XML40-1c erg6 pML100 +XML40-1c erg6 pML101 -XML40-1c erg6 pML103 +/-*______________________________________ *-Resistance was observed with fenpropimorph but not tridemorph.
Resistance is also seen with other morpholine anti-fungals (tridemorph and fenpropidin) and azasterol, all of which are reported to be inhibitors of sterol .DELTA.14 reductase. However, no increase is seen to a variety of other fungicides which are not sterol .DELTA.14 reductase inhibitors. Since resistance occurs only to sterol .DELTA.14 reductase inhibitors and is seen for such inhibitors from two different chemical classes, it is likely that pML100 encodes a function specific to sterol .DELTA.14 reductase activity.
Subclones of the pML100 insert are prepared in the yeast shuttle vector YEp352, transformed into yeast strain Y294, and tested for fenpropimorph resistance. As shown in FIG. 2, the fenpropimorph resistance region is limited to a 2.5 kb SphI/XbaI fragment located near one side of the insert/vector border.
Plasmid pML106, which contains this fragment in vector YEp352, is cleaved with BglII, which cuts once at a site near the middle of the SphI/XbaI fragment. A 3.0 kb BglII fragment containing the S. cerevisiae LEU2 gene is isolated from plasmid YEp13 and ligated into this BglII cite, producing plasmid pML108. The disrupted 5.5 kb SphI/XbaI fragment containing the LEU2 gene is isolated from plasmid pML108 and used to transform S. cerevisiae strain YPH501 to leucine prototrophy. Transformants in which the 5.5 kb SphI/XbaI fragment replaced the 2.5 kb SphI/XbaI fragment in one chromosomal homologue are identified by Southern analysis.
Tetrads from one such transformant (strain YPH501-2-1) are dissected and the spores germinated under anaerobic conditions on YEPD medium supplemented with Tween.RTM. 80 (500 .mu.g/ml) and ergosterol (20 .mu.g/ml). Strain YPH501-2-1 shows low (approximately 50%) spore viability, and no tetrads are recovered. This is found to be a property of strain YPH501 which showed a similar low level of spore viability when spores from the host strain are germinated anaerobically. By random spore analysis, 15 of 32 segregants are both Leu.sup.+ and obligate anaerobes, suggesting that the disruption has produced a genetic lesion in sterol biosynthesis. (The remaining 17 segregants are Leu.sup.- and grow aerobically.)
One such obligate anaerobe segregant, denoted YPH501-2-1-3C, is analyzed for sterol content. The strain is grown anaerobically on YEPD medium containing ergosterol (5 .mu.g/ml) to facilitate sterol uptake. After one day, the cells are harvested, washed in saline, resuspended in YEPD medium with no added sterol and grown for an additional 2 days to deplete cellular sterol. After 3 days, sterols are extracted from stationary phase yeast cells into n-heptane and analyzed by ultraviolet (UV) between 200 and 300 nm, gas chromatography (GC) and gas chromatographymass spectrometry (GC-MS). GC-MC analyses are performed on a Hewlett Packard (HP) 5980 instrument using a 30 meter.times.0.25 mm HP-5 column with a 25 micron film thickness. The column temperature is programmed from 280.degree. C. to 300.degree. C. with the initial temperature maintained for 2 minutes and increased at 3.degree. C./minute. The final temperature is held for 6 minutes. The mass spectrometer is operated in the electron impact ionization mode at 70 eV. High pressure liquid chromatography (HPLC) analyses are performed using a reverse phase column (2.1.times.100 mm) packed with 5 micron spherical C18 bonded silica. Sterol samples are dissolved in a methanol:ethyl acetate (1:1) mixture and eluted from HPLC with 95% acetonitrile in water at 1 ml/minute. The detection wavelength is 270 nm.
UV analysis demonstrates a 250 nm broad peak indicative of a sterol containing a conjugated double bond system involving C-8(9) and C-14(15). GC analyses indicate a major peak with the relative retention time of 1.30 consistent with ignosterol (ergosta-8,14-dien-3.beta.-ol, molecular weight 398), the sterol .DELTA.14 reductase substrate. GC-MS analysis confirms that the major sterol accumulating in this disrupted strain is ignosterol. Small amounts of lanosterol, approximately 5%, are also observed, consistent with a block in the sterol pathway downstream of lanosterol and affecting the reduction of the C-14 double bond. The accumulation of ignosterol indicates a genetic lesion in sterol .DELTA.14 reductase activity.
DNA sequence analysis of plasmid pML100. DNA sequences are performed using an Applied Biosystems automatic DNA sequencer from Applied Biosystems, Inc., Foster City, Calif. 94404, following the manufacturer's directions. Dye primers and dye terminators are used as appropriate for the insert to be sequenced. Oligonucleotides used for sequencing with dye terminators are synthesized using an Applied Biosystems oligonucleotide synthesizer according to the manufacturer's directions.
The DNA sequence of the 2.5 kb SphI/XbaI fragment of plasmid pML100 is set out in the Sequence Listing section hereinafter as SEQ ID NO 1. An open reading frame of 1314 base pairs is identified starting at an ATG codon at position 419 within the sequence. No other open reading frame of significant size is present within this fragment. Upstream of this ATG codon is an AT-rich sequence (66%), typical of many functionally expressed S. cerevisiae genes. This open reading frame encodes a 438 amino acid, 50.5 kilo-dalton basic (pI=9.2), presumptive integral membrane protein which, based upon hydropathy analysis using a computer program that progressively evaluates the hydrophilicity and hydrophobicity of a protein along its amino acid sequence (Kyte, J., and Doolittle, R. F., J. Mol. Biol. 157: 105-132 (1982)), contains 8 or 9 putative transmembrane domains.
EXAMPLE 2
The open reading frame of the plasmid pML100 DNA sequence of Example 1 is compared to other sequences in this example.
The sequence is compared with sequences deposited in the Genbank.RTM. DNA sequence data base. Three sequences show partial homology: the chicken nuclear lamin B receptor (SEQ ID NO 2, Worman, H. J., et al., cited above; 101 out of 419 amino acids), the S. cerevisiae YGL022 sequence (SEQ ID NO 3, Chen, et al., cited above; 95 out of 473 amino acids) and the S. pombe stsl gene (SEQ ID NO 4, Shimanuki, M., et al., cited above; 92 out of 453 amino acids). A comparison of the amino acid sequences of the three yeast genes is shown in FIG. 3. A certain amount of sequence similarity is seen along the entire length of the three sequences and is particularly pronounced at the carboxy termini of these polypeptides.
EXAMPLE 3
The physiological characteristics of mutant phenotypes Schizosaccharomyces pombe stsl and Saccharomyces cerevisiae YGL022 found to be somewhat homologous to the pML100 sequence as described in Example 2 are characterized in this example.
S. pombe strains HM123 and JY6(stsl.sup.+) and 111-1A (stsl) are obtained and analyzed for their sterol profiles. UV, GC-MC and HPLC analyses are carried out as described in Example 1 above; proton nuclear magnetic resonance (NMR) analysis on samples dissolved in d.sub.6 -acetone is obtained on a Brunker AMX300 MHz spectrometer, Brunker Instruments, Inc., Billerica, Mass. 01821. As set out in the data summarized in Table 3 below, while the wild-type strains accumulate ergosterol and small amounts of lanosterol and perhaps 24-methylene-dihydrolanosterol (molecular weight 440), the mutant strain acccumulated principally the tetraene, ergosta-5,7,22,24(28)-tetraen-3-.beta.-ol.
The conversion of the tetraene to ergosterol is considered to be the last step in ergosterol biosynthesis and the gene encoding this enzymatic step has been designated ERG4 in S. cerevisiae as discussed above. Whereas ergosterol gives absorption maxima at 262, 271, 282 and 293 nm, the precursor 24(28)-ergosterol gives absorption maxima at 232 nm reflecting the presence of a conjugated double bond system in the sterol side chain. The identity of the tetraene is confirmed by GC-MS and NMR.
GC-MS analysis shows a molecular ion at M/Z 394, 2 atomic mass units less than ergosterol. An ion is present at M/Z 123 which has no counterpart in the spectrum of ergosterol. This ion is proposed to represent the side chain fragment C.sub.9 H.sub.15 indicating the presence of two unsaturations. Consistent with the UV and GC-MS analyses, the structure of the conjugated side chain is substantiated by proton NMR signals indicative of the exomethylene protons (chemical shift 4.71 and 4.73, broad singlets) and signals for H22 (chemical shift 5.52, J.sub.21,22= 8.8 Hz, J.sub.22,23= 15.8 Hz) and H23 (chemical shift 5.87, J.sub.23,22= 15.8 Hz). The chemical shift values for the latter two protons are considerably downfield from their position in ergosterol, which has a chemical shift of about 5.25, reflecting the deshielding effects of the conjugation with the C-24(28) double bond. This provides further evidence that an additional double bond is present in the sterol side chain.
Upon transformation of strain TP111-1A with a plasmid pST2SC which contains the wild-type C-24(28) reductase gene, an ergosterol profile is observed. However, when selection pressure is removed such that the plasmid is lost, the tetraene profile is restored, indicating that ergosterol synthesis requires the presence of the plasmid containing the wild-type gene (Table 3). Thus, stsl.sup.+ appears to encode a protein in the ergosterol biosynthesis pathway.
YGL022 is then characterized. A leaky, S. cerevisiae erg4 mutant strain (Molzahn, S. W., and Woods, R. A., J. Gen Microbiol. 72: 339-348 (1972)) is subjected to sterol analysis as described above. Approximately 35% ergosterol and 60% ergosta-5,7,22,24(28)-tetraen-3.beta.-ol accumulates. When this strain is transformed with plasmid pA-B6.5 carrying the YGL022 sequence (Balzi, E., et al., J. Biol. Chem. 262: 16871-16879 (1987)) and retested, mostly ergosterol is detected (Table 3).
To confirm these findings, the open reading frame in YGL022 (in plasmid pA-B6.5) is disrupted by deleting an approximately 0.6 kb SmaI/AccI fragment internal to the open reading frame and replacing this with an approximately 2.2 kb HpaI fragment carrying the LEU2 gene (in a gene disruption construction similar to that described by Chen, et al., cited above). This sequence is released from the plasmid by XhoI and BamHI digestion, and the linear sequence is transformed into a diploid strain XML25 which is then sporulated. Integration of the construction into the YGL022 sequence is confirmed by Southern analysis.
Forty-seven tetrads are studied and all show 2:2 segration for leucine prototrophy. Leucine auxotrophic segregants are all wild-type for drug sensitivity while leucine prototrophic segregants show increased sensitivity to cycloheximide. One tetrad is analyzed for ergosterol content. The leucine auxotrophic segregants synthesize ergosterol while the leucine prototrophic segretants do not synthesize ergosterol and accumulate ergosta-5,7,22,-4(28)-tetraen-3.beta.-ol (Table 3). This indicates that the YGL022 sequence is required for sterol C-24(28) reductase activity (ERG4) in S. cerevisiae.
TABLE 3______________________________________Sterol Accumulation Patternsin Wild-Type and erg4 Yeast Strains % Sterol Content Geno- Ergo- 24(28) OtherSpecies Strain type sterol Tetraene Sterol______________________________________S. pombe HM123 erg4+ 86 0 14S. pombe JY-6 erg4+ 94 0 6S. pombe TP111-1A erg4 0 94 6S. pombe TP111-1A erg4+ 100 0 0 (pST2Sc)S. pombe TP111-1A erg4 0 100 0 curedS. cere- erg4-1A erg4+/- 29 68 3visiaeS. cere- erg4-1A ERG4 83 5 12visiae (pA-B6.5)S. cere- erg4-1A erg+/- 37 57 6visiae curedS. cere- XML25-2-1A erg4.DELTA. 0 97 3visiaeS. cere- XML25-2-1B ERG4 91 0 9visiaeS. cere- XML25-2-1C erg4.DELTA. 0 98 2visiaeS. cere- XML25-2-1D ERG4 88 0 12visiae______________________________________
The above description is for the purpose of teaching the person of ordinary skill in the art how to practice the present invention, and it is not intended to detail all those obvious modifications and variations of it which will become apparent to the skilled worker upon reading the description. It is intended, however, that all such obvious modifications and variations be included within the scope of the present invention, which is defined by the following claims. The claims are intended to cover the claimed components and steps in any sequence which is effective to meet the objectives there intended, unless the context specifically indicates the contrary.
BIBLIOGRAPHY
Ashman, W. H., et al., Lipids 26: 628-632 (1991).
Baloch, R. and Mercer, I., Phytochemistry 26: 663-668 (1987v).
Balzi, E., et al., J. Biol. Chem. 262: 16871-16879 (1987).
Brugge, J. S., et al., Mol. Cell. Biol. 7: 2180-2187 (1987).
Chen, W., et al., Yeast 7: 305-308 (1991).
Gaber, R. F., et al., Mol. Cell. Biol. 9: 3447-3456 (1989).
Kyte, J., and Doolittle, R. F., J. Mol. Biol. 157: 105-132 (1982).
Lorenz, T., and Parks, L. W., DNA and Cell Biol. 11: 685-692 (1992).
Marcireau, C., et al., Curr. Genet. 22: 267-272 (1992).
Molzahn, S. W., and Woods, R. A., J. Gen Microbiol. 72: 339-348 (1972).
Nasmyth, K. A., and Tatchell, K., Cell 19: 753-764 (1980).
Paltauf, F., et al., in Jones, E. W., et al., eds., The Molecular and Cellular Biology of the Yeast Saccharomyces, Gene Expression, Cold Spring Harbor Laboratory Press, 1992, pages 415, 418-420, 424-428, and 434-437.
Shimanuki, M., et al., Mol. Biol. Cell 3:263-273 (1992).
Worman, H. J., et al., J. Cell Biology 111: 1535-1542 (1990).
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 5(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2528 bases and 438 amino acids(B) TYPE: nucleic acid and amino acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: (A) DESCRIPTION: DNA encoding a polypeptide(v) FRAGMENT TYPE: entire sequence(vi) IMMEDIATE SOURCE: Saccharomyces cerevisiaeclone(ix) FEATURE:(D) OTHER INFORMATION: sterol .DELTA.14 reductase gene,translatedpolypeptide and flanking DNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:ATATATATATACCTCTTGCCAGCAACAGGCCAGTTAT AAGTTAAAATTAA50TATGTGACGCACTTCTGAAACAGTATTGAAACAGTATTGAAACATATGTA100TTACCCGGACTCTGCATGCTCTGTCGTTCATTTTATTTTCACCTAAACGA150AAATCCCGTGAAAAAAATTTAT ATCGCCTTTCGCTCTTTTGTATGTAGGC200ATCATCGGAAATTTGCATTGTGTGAAGGTTGTGCATATAAAGGGTTTTGC250ATAACGGACGTTTTTCACGTACTCCGTCTGAGCATCAAGTGAGGCTTGAG300TTTACGTT TGTTTTTAATAATCAGTTTTCATTCTACTATTTTCTTGCGCA350ATTGCTTATCAGATAGACCTTGTAAACAGCATAGGAGTAAAGACAAATTC400GGTGTAGAGAATAAAAGGATGGTATCAGCTTTGAATCCCAGAACTACAGAG 451MetValSerAlaLeuAsnProArgThrThrGlu510TTTGAATTTGGTGGGCTGATTGGTGCCTTAGGCATCAGCATAGGG 496PheGluPheGlyGlyLeuIleGlyAlaLeuGlyIleSerIleGly152025CTGCCTGTTTTCACTATCATCTTGAATCAAATGATAAGGCCCGAT541LeuProValPheThrIleIleLeuAsnGlnMetIleArgProAsp303540TATTTTATTAAGGGATTTTTCCAGAATTTCGATATAGTTGAGCTT586TyrP heIleLysGlyPhePheGlnAsnPheAspIleValGluLeu455055TGGAACGGTATCAAGCCATTGCGCTACTATCTGGGCAATCGTGAA631TrpAsnGlyI leLysProLeuArgTyrTyrLeuGlyAsnArgGlu606570TTATGGACTGTCTATTGCCTGTGGTATGGAATACTGGCAGTTTTG676LeuTrpThrValTyrC ysLeuTrpTyrGlyIleLeuAlaValLeu758085GACGTCATTTTACCGGGCAGAGTCATGAAGGGTGTTCAGTTAAGG721AspValIleLeuProGlyArgV alMetLysGlyValGlnLeuArg9095100GATGGTTCGAAGCTTTCGTATAAGATCAATGGAATTGCCATGTCT766AspGlySerLysLeuSerTyrLysIleA snGlyIleAlaMetSer105110115ACAACTTTGGTCTTAGTTTTGGCTATCAGATGGAAATTGACTGAT811ThrThrLeuValLeuValLeuAlaIleArgTrpL ysLeuThrAsp120125130GGACAATTGCCTGAATTGCAATATCTGTATGAAAATCACGTTAGT856GlyGlnLeuProGluLeuGlnTyrLeuTyrGluAsnHisV alSer135140145TTATGCATAATATCTATTTTGTTTTCGTTCTTTTTGGCGACGTAC901LeuCysIleIleSerIleLeuPheSerPhePheLeuAlaThrTyr 150155160TGCTATGTTGCCAGCTTCATACCATTGATCTTCAAGAAAAATGGT946CysTyrValAlaSerPheIleProLeuIlePheLysLysAsnGly 165170175AATGGCAAAAGGGAAAAGATCTTAGCACTAGGTGGAAATTCAGGA991AsnGlyLysArgGluLysIleLeuAlaLeuGlyGlyAsnSerGly180 185190AACATCATTTACGATTGGTTTATTGGTAGAGAACTGAACCCTCGT1036AsnIleIleTyrAspTrpPheIleGlyArgGluLeuAsnProArg195 200205CTCGGCCCATTAGATATCAAGATGTTTTCAGAGTTGAGACCCGGC1081LeuGlyProLeuAspIleLysMetPheSerGluLeuArgProGly210 215220ATGTTGTTATGGTTACTGATCAATCTTTCCTGTCTGCATCACCAT1126MetLeuLeuTrpLeuLeuIleAsnLeuSerCysLeuHisHisHis225230 235TACCTGAAGACTGGTAAAATCAACGATGCATTGGTCTTGGTTAAT1171TyrLeuLysThrGlyLysIleAsnAspAlaLeuValLeuValAsn240245 250TTCTCGCAAGGATTTTACATTTTCGATGGAGTACTAAACGAGGAA1216PheSerGlnGlyPheTyrIlePheAspGlyValLeuAsnGluGlu25526026 5GGTGTATTAACCATGATGGATATCACTACAGATGGGTTTGGTTTC1261GlyValLeuThrMetMetAspIleThrThrAspGlyPheGlyPhe270275280AT GCTAGCGTTTGGTGACTTAAGTTTAGTTCCATTCACCTACTCA1306MetLeuAlaPheGlyAspLeuSerLeuValProPheThrTyrSer285290295TTACAAG CGCGTTACTTGAGTGTTTCCCCTGTGGAATTGGGATGG1351LeuGlnAlaArgTyrLeuSerValSerProValGluLeuGlyTrp300305310GTGAAAGTTGTC GGTATATTAGCCATAATGTTTTTGGGTTTCCAC1396ValLysValValGlyIleLeuAlaIleMetPheLeuGlyPheHis315320325ATCTTCCACTCGGCAAAT AAGCAAAAATCTGAGTTTAGACAAGGT1441IlePheHisSerAlaAsnLysGlnLysSerGluPheArgGlnGly330335340AAATTAGAAAATCTAAAAAGTAT TCAGACAAAGCGTGGTACAAAG1486LysLeuGluAsnLeuLysSerIleGlnThrLysArgGlyThrLys345350355TTATTATGTGACGGGTGGTGGGCTAAAT CACAGCATATCAATTAC1531LeuLeuCysAspGlyTrpTrpAlaLysSerGlnHisIleAsnTyr360365370TTTGGCGATTGGCTGATTTCATTAAGTTGGTGT TTGGCCACCTGG1576PheGlyAspTrpLeuIleSerLeuSerTrpCysLeuAlaThrTrp375380385TTCCAAACTCCCTTGACATATTACTACTCGTTGTACTTC GCCACG1621PheGlnThrProLeuThrTyrTyrTyrSerLeuTyrPheAlaThr390395400TTGTTATTACACCGTCAACAACGTGATGAGCACAAGTGCCGCCT G1666LeuLeuLeuHisArgGlnGlnArgAspGluHisLysCysArgLeu405410415AAATATGGCGAAAATTGGGAAGAATACGAAAGAAAAGTTCCTTAC 1711LysTyrGlyGluAsnTrpGluGluTyrGluArgLysValProTyr420425430AAGATCATTCCATATGTTTATTAAGTTTTTCTACCACTGCTATTTTCTTCA1762 LysIleIleProTyrValTyr435TTATCTATGTATGTGTGTATACATGTTATGTATTGGGTGAGTATGAGGAA1812GAAGAAGAATAACAATTGAAAACGCTGGAAAAATTAAAAGGGGTGGCGGT1862CTATC TATGCAACGCTCCCCTTTTCGTTACATGAACACATCAAACTTGTA1912TATCCTTTGAGTGTTCTTTAATCAAGTCATCTTGGTATTTTAGTAGCGTT1962TCCACTACTTTAGGGACAAATTCAGACCTAACCAATCCATCAAAAGCATC 2012AAACCCTTGCGACAAAATCGGAATATCAGACTCGCCATGCATAAACTCTG2062GAATTTCTAGTTTCCCGTCCGCAAGTATGCCGTCATCATCCTCGTCGTCC2112TTATTAGTATCCAAATTTGTCACTTTGACGTTCATCG ACAACTGTAAGTC2162AAAGTAGCAAATCGCCTTGCCCTTCCTTTGAGATACGTTGGAGTCACCGG2212TGATGCTACTCACCTGGGTTAACTCAATTTTGCTCTTCCCATCAGAGGAA2262ACAGTGGACAAACTCGTTAA TTTACCGTTCAAGTAGTCCTTAGACCAAGG2312TAAGGTGTTTTTATCCACCCAATGCCAGTTATTTGGATTCAAGACAACCA2362TATTTTATCGTAAATGTGTTGTAACTTTCCGATCGTTTCAAACTTTAGTA2412GT AGTTTGATGATTTTGTCCAAAAAGTATTTGCTTAAATTTCAGCTTTTT2462TCTTCTTCATATGTATTTCTTTTTTTCCTCGCTTTCTCTGCCCACTTTTT2512TCTTCTGTCTTCTAGA 2528(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 419 residues(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: polypeptide(ix) FEATURE:(A) NAME/KEY: chickennuclear lamin B receptor(x) PUBLICATION INFORMATION:(A) AUTHORS: H.J. Worman, C.D. Evans, and G.Blobel(B) TITLE: (excerpt): The Lamin B Receptor of theNuclear Envelope Inner Membrane(C) JOURNAL: Journal of Cell Biology(D) VOLUME: 111(F) PAGES: 1535-1542Sequence set out in Figure 5, page 1539( G) DATE: 1990(K) RELEVANT RESIDUES IN SEQ ID NO: 190 to 608(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:ProGluLysProSerSerLysThrLysGluLeuGluPheGlyGly51015ArgPheGlyThrPheMet LeuMetPhePheLeuProAlaThrVal202530LeuTyrLeuValLeuMetCysLysGlnAspAspProSerLeuMet35 4045AsnPheProProLeuProAlaLeuGluSerLeuTrpGluThrLys505560ValPheGlyValPheLeuLeuTrpPhePhePheGlnA laLeuPhe657075TyrLeuLeuProIleGlyLysValValGluGlyLeuProLeuSer808590 AsnProArgLysProGlnTyrArgIleAsnGlyPheTyrAlaPhe95100105LeuLeuThrAlaAlaAlaIleGlnThrLeuLeuTyrPheGlnPhe 110115120GluLeuHisTyrLeuTyrAspHisPheValGlnPheAlaValSer125130135AlaAlaAlaPheSerMet AlaLeuSerIleTyrLeuTyrIleArg140145150SerLeuLysAlaProGluGluAspLeuAlaProGlyGlyAsnSer1551 60165GlyTyrLeuValTyrAsnPhePheThrGlyHisGluLeuAsnPro170175180ArgIleGlySerPheAspLeuLysTyrPheCysGluL euArgPro185190195GlyLeuIleGlyTrpValValIleAsnLeuAlaMetLeuLeuAla200205210 GluMetLysIleHisAsnGlnSerMetProSerLeuSerMetIle215220225LeuValAsnSerPheGlnLeuLeuTyrValValAspAlaLeuTrp 230235240AsnGluGluAlaValLeuThrThrMetAspIleThrHisAspGly245250255PheGlyPheMetLeuAla PheGlyAspLeuValTrpValProPhe260265270ValTyrSerLeuGlnAlaPheTyrIleValGlyHisProIleAla2752 80285IleSerTrpProValAlaAlaAlaIleThrIleLeuAsnCysIle290295300GlyTyrTyrIlePheArgSerAlaAsnSerGlnLysA snAsnPhe305310315ArgArgAsnProAlaAspProLysLeuSerTyrLeuLysValIle320325330 ProThrAlaThrGlyLysGlyLeuLeuValThrGlyTrpTrpGly335340345PheValArgHisProAsnTyrLeuGlyAspIleIleMetAlaLeu 350355360AlaTrpSerLeuProCysGlyPheAsnHisIleLeuProTyrPhe365370375TyrValIleTyrPheIle CysLeuLeuValHisArgGluAlaArg380385390AspGluHisHisCysLysLysLysTyrGlyLeuAlaTrpGluArg3954 00405TyrCysGlnArgValProTyrThrHisIleSerLeuHisLeu410415(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 473 residues(B) TYPE: amino acid (C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: polypeptide(ix) FEATURE:(A) NAME/KEY: Saccharomyces cerevisiaeYGL022(x) PUBLICATION INFORMATION:(A) AUTHORS: W. Chen, E. Capieaux, E. Balzi, and A.Goffeau(B) TITLE: The YGL022 Gene Encodes aPutative Transport Protein (C) JOURNAL: Yeast(D) VOLUME: 7(F) PAGES: 305-308Sequence set out in Figure 1, pages 306-307(G) DATE: 1991(K) RELEVANT RESIDUES IN SEQ ID NO: open reading frame(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:MetAlaLysAspAsnSerGluLysLeuGlnValGlnGlyGluGlu 51015LysLysSerLysGlnProValAsnPheLeuProGlnGlyLysTrp202530LeuLysProAs nGluIleGluTyrGluPheGlyGlyThrThrGly354045ValIleGlyMetLeuIleGlyPheProLeuLeuMetTyrTyrMet50 5560TrpIleCysAlaGluPheTyrHisGlyLysValAlaLeuProLys657075AlaGlyGluSerTrpMetHisPheIleLys HisLeuTyrGlnLeu808590ValLeuGluAsnGlyIleProGluLysTyrAspTrpThrIlePhe95100 105LeuThrPheTrpValPheGlnIleIlePheTyrTyrThrLeuPro110115120GlyIleTrpThrLysGlyGlnProLeuSerHisLeuLysGlyLys 125130135GlnLeuProTyrPheCysAsnAlaMetTrpThrLeuTyrValThr140145150ThrThrLeuVa lLeuValLeuHisPheThrAsnLeuPheArgLeu155160165TyrValIleIleAspArgPheGlyArgIleMetThrCysAlaIle170 175180IleSerGlyPheAlaPheSerIleIleLeuTyrLeuTrpThrLeu185190195PheIleSerHisAspTyrHisArgMetThr GlyAsnHisLeuTyr200205210AspPhePheMetGlyAlaProLeuAsnProArgTrpGlyIleLeu215220 225AspLeuLysMetPhePheGluValArgLeuProTrpPheThrLeu230235240TyrPheIleThrLeuGlyAlaCysLeuLysGlnTrpGluThrTyr 245250255GlyTyrValThrProGlnLeuGlyValValMetLeuAlaHisTrp260265270LeuTyrAlaAs nAlaCysAlaLysGlyGluGluLeuIleValPro275280285ThrTrpAspMetAlaTyrGluLysPheGlyPheMetLeuIlePhe290 295300TrpAsnIleAlaGlyValProTyrThrTyrCysHisCysThrLeu305310315TyrLeuTyrTyrHisAspProSerGluTyr HisTrpSerThrLeu320325330TyrAsnValSerLeuTyrValValLeuLeuCysAlaTyrTyrPhe335340 345PheAspThrAlaAsnAlaGlnLysAsnAlaPheArgLysGlnMet350355360SerGlyAspLysThrValArgLysThrPheProPheLeuProTyr 365370375GlnIleLeuLysAsnProLysTyrMetValThrSerAsnGlySer380385390TyrLeuLeuIl eAspGlyTrpTyrThrLeuAlaArgLysIleHis395400405TyrThrAlaAspTrpThrGlnSerLeuValTrpAlaLeuSerCys410 415420GlyPheAsnSerValPheProTrpPhePheProValPhePheLeu425430435ValValLeuIleHisArgAlaPheArgAsp GlnAlaLysCysLys440445450ArgLysTyrGlyLysAspTrpAspGluTyrCysLysHisCysPro455460 465TyrValPheIleProTyrValPhe470(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 453 residues(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: polypeptide (ix) FEATURE:(A) NAME/KEY: Schizosaccharomyces pombe sts gene(x) PUBLICATION INFORMATION:(A) AUTHORS: M. Shimanuki, M. Goebl, M. Yanagida,and T.Toda(B) TITLE: Fission Yeast sts1+GeneEncodes aProtein Similar to the Chicken Lamin B Receptor(C) JOURNAL: Molecu- lar Biology of the Cell(D) VOLUME: 3(F) PAGES: 263-273Sequence set out in Figure 1, page 264(G) DATE: 1992(K) RELEVANT RESIDUES IN SEQ ID NO: open reading frame(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:MetLysSerThrValLysLysSerAlaProArgGluPhe GlyGly51015AlaLysGlyAlaLeuAlaIleMetThrGlyPheProCysLeuMet202530Ty rTyrLeuTrpAlaCysSerLysPheAsnAspSerGlnPheIle354045LysProGluSerPheThrIleAlaGlyPheGlnAsnPhePheArg 505560ThrLeuGlyHisTyrIleTyrValGlyAlaTyrProThrArgTyr657075AlaPheLeuValPheTrpSer PheCysIleValGlnAlaValMet808590TyrLeuThrLeuProGlyValArgThrGlnGlyLeuProLeuLys95100 105HisArgAsnAsnGluArgLeuProTyrLeuCysAsnAlaIleTrp110115120SerPheTyrThrThrIleValIleLeuAlaValLeuHis ValThr125130135HisValPheProIleThrThrPheIleAspMetPheGlyProLeu140145150Me tSerValAlaIleIleThrAlaPheValCysThrPheValLeu155160165TyrThrGlyThrLeuLeuPheGlyAspArgLeuPheAspLysPro 170175180HisArgLeuSerGlyAsnProIleTyrAspAlaPheMetGlyAla185190195CysLeuAsnProArgLeuGly LysLeuLeuAspPheLysMetPhe200205210PheGluValArgIleProTrpPheIleLeuPhePheIleSerVal215220 225GlyAlaAlaValArgGlnTyrGluThrTyrGlyThrValSerPro230235240GlnValLeuPheValCysLeuGlyHisTyrLeuTyrAla AsnAla245250255CysSerLysGlyGluGlnLeuIleValProThrTrpAspMetAla260265270Ty rGluLysPheGlyPheMetLeuIlePheTrpAsnMetAlaGly275280285ValProPheThrTyrSerHisCysThrLeuTyrLeuPheSerHis 290295300AspProSerValTyrAsnTrpSerThrGlnTyrThrThrGlyIle305310315TyrValLeuLeuLeuCysCys TyrTyrIlePheAspThrCysAsn320325330GlyGlnLysAsnHisPheArgAsnGlnIleTyrGlyThrGluVal335340 345HisArgLysThrPheProGlnLeuProTrpLeuIleIleLysAsn350355360ProThrPheIleArgCysAlaAsnGlyGlyThrLeuLeu ThrSer365370375GlyTrpTyrArgTyrAlaArgLysIleHisTyrThrAlaAspPhe380385390Ph eGlnSerLeuSerTrpAlaLeuIleThrGlyPheGlnSerPro395400405LeuProTyrPheTyrProSerPhePhePheValValLeuValHis 410415420ArgValSerArgAspIleLysLysCysLysAlaLysTyrGlyAla425430435AspPheAspGluTyrAspArg IleCysProTyrLeuPheIlePro440445450TyrIlePhe(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 438 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single (D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: polypeptide(v) FRAGMENT TYPE: entire sequence(vi) IMMEDIATE SOURCE: Saccharomyces cerevisiaeclone(ix) FEATURE:(D) OTHER INFORMATION: translated polypeptide ofsterol "14reductase gene(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:MetVal SerAlaLeuAsnProArgThrThrGluPheGluPheGly51015GlyLeuIleGlyAlaLeuGlyIleSerIleGlyLeuProValPhe2 02530ThrIleIleLeuAsnGlnMetIleArgProAspTyrPheIleLys354045GlyPhePheGlnAsnPheAs pIleValGluLeuTrpAsnGlyIle505560LysProLeuArgTyrTyrLeuGlyAsnArgGluLeuTrpThrVal65 7075TyrCysLeuTrpTyrGlyIleLeuAlaValLeuAspValIleLeu808590ProGlyArgValMetLysGlyValGlnLeuArgA spGlySerLys95100105LeuSerTyrLysIleAsnGlyIleAlaMetSerThrThrLeuVal110115 120LeuValLeuAlaIleArgTrpLysLeuThrAspGlyGlnLeuPro125130135GluLeuGlnTyrLeuTyrGluAsnHisValSerLeuCysIleIle 140145150SerIleLeuPheSerPhePheLeuAlaThrTyrCysTyrValAla155160165SerPheIl eProLeuIlePheLysLysAsnGlyAsnGlyLysArg170175180GluLysIleLeuAlaLeuGlyGlyAsnSerGlyAsnIleIleTyr185 190195AspTrpPheIleGlyArgGluLeuAsnProArgLeuGlyProLeu200205215AspIleLysMetPheSerGluL euArgProGlyMetLeuLeuTrp215220225LeuLeuIleAsnLeuSerCysLeuHisHisHisTyrLeuLysThr230235 240GlyLysIleAsnAspAlaLeuValLeuValAsnPheSerGlnGly245250255PheTyrIlePheAspGlyValLeuAsnGluGluGly ValLeuThr260265270MetMetAspIleThrThrAspGlyPheGlyPheMetLeuAlaPhe275280285GlyAspLeuSerLeuValProPheThrTyrSerLeuGlnAlaArg290295300TyrLeuSerValSerProValGluLeuGlyTrpValLysValVal 305310315GlyIleLeuAlaIleMetPheLeuGlyPheHisIlePheHisSer320325330AlaAsnLysGln LysSerGluPheArgGlnGlyLysLeuGluAsn335340345LeuLysSerIleGlnThrLysArgGlyThrLysLeuLeuCysAsp350 355360GlyTrpTrpAlaLysSerGlnHisIleAsnTyrPheGlyAspTrp365370375LeuIleSerLeuSerTrpCysLeuAl aThrTrpPheGlnThrPro380385390LeuThrTyrTyrTyrSerLeuTyrPheAlaThrLeuLeuLeuHis395400 405ArgGlnGlnArgAspGluHisLysCysArgLeuLysTyrGlyGlu410415420AsnTrpGluGluTyrGluArgLysValProTyrLysIleI lePro425430435TyrValTyr__________________________________________________________________________

DNA sequence encoding sterol .DELTA.14 reductase

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Non-Patent Literature Citations (14)

Divisions (1)