Patent Application
20240352540
A computer readable form of the Sequence Listing “3244-P71841US01_SequenceListing” (90,757 bytes), submitted via Patent Center and created on Apr. 22, 2024, is herein incorporated by reference.
The present disclosure relates to the field of functional nucleic acids, and in particular, to DNAzymes for detecting Clostridium difficile and methods of use thereof.
Clostridium difficile (C. difficile) is the bacterial pathogen responsible for an infectious disease known as C. difficile infection (CDI), a widespread healthcare-associated infection. Major symptoms of CDI include diarrhea, inflammation, abdominal pain, colitis and tissue necrosis with a mortality rate ranging from 2%-42%.[1-3] CDI represents a major health threat around the world, including North America, Europe, Asia, Western Pacific, Latin America, and Africa.[4-6] In the United States, this pathogen causes almost half a million infections every year, resulting in about ten thousand deaths.[7] In Canada, the number of CDI cases has been increasing dramatically since 2000 and CDI has become a frequent cause for hospital-associated diarrhea.[8] In Europe, healthcare-associated CDI cases are estimated to be around 125,500 annually with a financial burden estimated to be around €300 million.[9,10]
Early detection of pathogenic bacteria is very important for outbreak control and disease management. For diagnosing CDI, toxigenic culture and cell cytotoxicity assay are gold standard methods. However, these tests are labour-intensive and time-consuming, as they have to be conducted in diagnostic labs by skilled professionals and the time to produce reliable results can take up to 5 days.[11] To overcome some of these limitations, polymerase chain reaction (PCR) methods have also been adopted to achieve rapid diagnosis of CDI by identifying the presence of toxin-coding genes, tcdA and tcdB. Despite their high sensitivity,[12] PCR methods fail to distinguish active toxin production from asymptomatic carriers.[13] Alternatively, enzyme immunoassays (EIA) against toxin A or toxin B have been developed as rapid tests. However, the low sensitivity of these more rapid tests limits their clinical utility.[14,15] Another alternative and relatively rapid test involves the use of EIA to detect glutamate dehydrogenase (GDH) of C. difficile.[16] This test is rapid and highly sensitive, but cannot distinguish toxigenic strains of C. difficile from non-toxigenic strains.[15] Therefore, a positive GDH result requires a follow-up toxin assay to confirm the toxin expression.
There is interest in developing alternative assays for CDI based on functional nucleic acids, including DNA aptamers and DNAzymes.[17-21] DNA aptamers are artificial single-stranded DNA sequences that can be isolated from a synthetic random-sequence DNA pool to bind a specific target of interest through the use of a technique called in vitro selection.[22,23] DNAzymes are also artificial single-stranded DNA molecules isolated from a DNA pool but they are engineered to possess catalytic functions.[24-27] They can also be combined with aptamers for the creation of aptazymes that can be activated by a specific target. Many aptamers and DNAzymes have been reported for diverse target molecules and have been used as molecular recognition elements for the design of biosensors and bioassays.[28-31]
RNA-cleaving DNAzymes have been developed as biosensors for bacterial detection.[32,33] These DNAzymes are selected from a random-sequence DNA pool to cleave an RNA site embedded in a DNA substrate in the presence of a complex molecular mixture from a specific bacterial species.[34] The RNA site is flanked by a pair of nucleotides modified with a fluorophore and a matching quencher, and therefore the derived RNA-cleaving DNAzymes are inherently fluorogenic, capable of emitting high levels of fluorescence upon RNA cleavage.[35′36] To date, RNA-cleaving fluorogenic DNAzymes (RFDs) have been developed for a few different bacterial pathogens, including Escherichia coli,[37] Helicobacter pylori,[38] Legionella pneumophila,[39] Staphylococcus aureus,[40]Klebsiella pneumoniae,[41], and C. difficile.[21] U.S. Pat. No. 9,624,551 discloses an RNA-cleaving DNAzyme-based probe for detecting an unidentified protein target from a microorganism.
In the case of C. difficile, a previously described RFD, termed RFD-CD1 hereinafter, was selected to recognize a strain of C. difficile named BI/027-H (Hamilton), a locally isolated hypervirulent strain.[21] This DNAzyme possessed remarkable specificity as it can only be activated by the specific BI/027-H strain and shows no cleavage activity in the presence of eleven other C. difficile strains. This profound selectivity is attributed to the recognition of a uniquely mutated version of a protein named TcdC by RFD-CD1.[21] Unfortunately, this high specificity presents a problem for CDI diagnosis: RFD-CD1 cannot be used as a universal DNAzyme probe to diagnose CDI caused by other strains of C. difficile.
The background herein is included solely to explain the context of the disclosure. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge as of the priority date.
In accordance with an aspect of the present disclosure, provided herein is a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-16, 19-21, 23, 29-32, 36, 37, 39-44, and 47, a functional fragment thereof, or a functional variant thereof, for detecting Clostridium difficile (C. difficile).
In some embodiments, the catalytic nucleic acid comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-15, 19, 30, 36, 37, 39-43, and 47.
In some embodiments, the catalytic nucleic acid comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 11, 36, 40-42, and 47.
In some embodiments, the catalytic nucleic acid has a limit-of-detection of about 100 CFU/mL C. difficile.
In some embodiments, the catalytic nucleic acid is for cleavage of a nucleic acid substrate.
In accordance with another aspect of the present disclosure, provided herein is a catalytic nucleic acid probe comprising the catalytic nucleic acid disclosed herein and a detectable substrate.
In some embodiments, the detectable substrate comprises a ribonucleotide flanked by a fluorophore modified nucleic acid residue and a quencher modified nucleic acid residue.
In some embodiments, the catalytic nucleic acid probe is configured to generate a fluorogenic signal upon contacting C. difficile.
In some embodiments, the detectable substrate comprises the nucleotide sequence of SEQ ID NO: 1 or 76.
In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 48-53 and 70-75.
In accordance with another aspect of the present disclosure, provided herein is a biosensor for detecting C. difficile comprising the catalytic nucleic acid disclosed herein, or the catalytic nucleic acid probe disclosed herein, functionalized on and/or in a material.
In accordance with another aspect of the present disclosure, provided herein is a method for detecting the presence of C. difficile in a sample, the method comprising:
In some embodiments, b) comprises incubating the mixture at about 37° C.
In some embodiments, the liquid is a buffer.
In some embodiments, the buffer comprises about 50 mM Mg2+.
In some embodiments, the buffer is about pH 8.0.
In some embodiments, quenching of the cleavage reaction comprises adding a quenching buffer to the mixture.
In some embodiments, the quenching buffer comprises EDTA and/or urea.
In some embodiments, detecting the fluorogenic signal comprises analysis via denaturing polyacrylamide gel electrophoresis.
In some embodiments, the method detects C. difficile infection in a subject.
In some embodiments, the sample is a stool sample.
In accordance with another aspect of the present disclosure, provided herein is a kit for detecting C. difficile in a sample, wherein the kit comprises the catalytic nucleic acid disclosed herein, the catalytic nucleic acid probe disclosed herein, the biosensor disclosed herein, or components required for the method disclosed herein, and instructions for use of the kit.
Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating embodiments of the disclosure, are given by way of illustration only and the scope of the claims should not be limited by these embodiments, but should be given the broadest interpretation consistent with the description as a whole.
Certain embodiments of the disclosure will now be described in greater detail with reference to the attached drawings in which:
Further aspects and features of the example embodiments described herein will appear from the following description taken together with the accompanying drawings.
Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.
In understanding the scope of the present disclosure, the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term “consisting essentially of”, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.
Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies. The modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (e.g., it includes the degree of error associated with measurement of the particular quantity). In addition, all ranges disclosed herein are inclusive of the endpoints and also any intermediate range points, whether explicitly stated or not, and the endpoints are independently combinable with each other. Further, the recitation of ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g. 1 to 5 includes for example 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term “about”.
As used in this disclosure, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise.
In embodiments comprising an “additional” or “second” component, the second component as used herein is chemically different from the other components or first component. A “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.
The term “and/or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of” or “one or more” of the listed items is used or present.
The abbreviation, “e.g.” is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The word “or” is intended to include “and” unless the context clearly indicates otherwise.
The term “sample” or “test sample” as used herein refers to any material in which the presence or amount of a target analyte is unknown and can be determined in an assay. The sample can be from any source, for example, any biological (e.g. human or animal samples, including clinical samples), environmental (e.g. water, soil or air) or natural (e.g. plants) source, or from any manufactured or synthetic source (e.g. food or drinks). The sample can be comprised or is suspected of comprising one or more analytes. The sample can be a “biological sample” comprising cellular and non-cellular material, including, but not limited to, tissue samples, saliva, sputum, urine, feces, blood, serum, other bodily fluids and/or secretions.
The term “target”, “analyte” or “target analyte” as used herein refer to any agent, including, but not limited to, a small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer (such as a nucleic acid, carbohydrate, lipid, peptide, protein), cell, tissue, microorganism and virus, for which one would like to sense or detect. The analyte can be either isolated from a natural source or synthetic. The analyte can be a single compound or a class of compounds, such as a class of compounds that share structural or functional features. The term analyte also includes combinations (e.g. mixtures) of compounds or agents such as, but not limited, to combinatorial libraries and samples from an organism or a natural environment. In some embodiments, the target is from Clostridium difficile. In some embodiments, the target is a protein target. In some embodiments, the protein target is a protein target of greater than about 30 kDa. In some embodiments, the protein target is a protein target of greater than about 100 kDa. In some embodiments, the protein target is a protein target of between about 30 kDa and about 100 kDa.
The term “subject” as used herein includes all members of the animal kingdom including mammals such as a mouse, a rat, a dog and a human.
The term “nucleic acid” as used herein refers to a biopolymer comprising monomers of nucleotides, such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and other polynucleotides of modified nucleotides and/or nucleotide derivatives, and can be either double stranded (ds) or single stranded (ss). In some embodiments, modified nucleotides contain one or more modified bases (e.g. unusual bases such as inosine, and functional modifications to the bases such as amino), modified backbones (e.g. peptide nucleic acid, PNA) and/or other chemically, enzymatically, or metabolically modified forms. Examples of modified nucleotides which can be used to generate the nucleic acids disclosed herein include xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8 amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. Alternatively, the nucleic acid molecules can be produced biologically using an expression vector. The term “functional fragment” as used herein refers to a fragment of the nucleic acid that retains the functional property of the full-length nucleic acid, for example, the ability of the fragment to act as a DNAzyme for detecting a particular analyte, for example, Clostridium difficile.
The term “catalytic nucleic acid”, “catalytic DNA”, “deoxyribozyme”, “DNA enzyme”, or “DNAzyme” as used herein can refer to a nucleic acid molecule or oligonucleotide sequence that can catalyze or initiate a reaction. DNAzymes may be single-stranded DNA and can include RNA, modified nucleotides and/or nucleotide derivatives. In some embodiments, the DNAzyme is “RNA-cleaving” and catalyzes the cleavage of a particular substrate, for example a nucleic acid sequence comprising one or more ribonucleotides, at a defined cleavage site. In some embodiments, the DNAzyme cleaves a single ribonucleotide linkage. In some embodiments, the single ribonucleotide linkage is in a nucleic acid sequence wherein the remaining nucleotides are ribonucleotides. In some embodiments, the single ribonucleotide linkage is in a nucleic acid sequence wherein the remaining nucleotides are deoxyribonucleotides. In some embodiments, the DNAzyme cleaves a nucleic acid sequence at a single ribonucleotide linkage thereby producing a nucleic acid cleavage fragment.
The term “hybridizes”, “hybridized” or “hybridization” as used herein refers to the sequence specific non-covalent binding interaction with a complementary, or partially complementary, nucleic acid sequence. When, for example, the 5′-end region of a DNAzyme hybridizes to the 3′-end region, it can form a duplex DNA element.
The term “biosensor” as used herein refers to a device that incorporates a biological entity as a molecular recognition element and is capable of producing a measurable signal upon binding of a target analyte to the molecular recognition element. The biosensor can also be part of a larger device.
The term “functionalizing” or “functionalized on” as used herein refers to various common approaches for functionalizing a material, which can be classified as mechanical, physical, chemical and biological. Any suitable form of coupling can be utilized (e.g. coating, binding, etc.). The functionalized material, for example, a nucleic acid or a blocking species, is also immobilized.
It will be understood that any component defined herein as being included can be explicitly excluded by way of proviso or negative limitation, such as any specific compounds or method steps, whether implicitly or explicitly defined herein.
Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below.
Disclosed herein is an RNA-cleaving DNAzyme and corresponding RNA-cleaving fluorogenic DNAzyme (RFD) probe that is not only highly specific to C. difficile but also capable of recognizing diverse pathogenic C. difficile strains. Extensive sequence and structure characterization established a pseudoknot structure and a significantly minimized sequence for this RFD for detecting pathogenic C. difficile strains, termed RFD-CD2 hereinafter. As a fluorescent sensor, RFD-CD2 can detect C. difficile at a concentration as low as 100 CFU/mL, making this DNAzyme an attractive molecular probe for rapid diagnosis of CDI caused by diverse strains of C. difficile.
Accordingly, provided herein is a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-16, 19-21, 23, 29-32, 36, 37, 39-44, and 47, a functional fragment thereof, or a functional variant thereof, for detecting Clostridium difficile (C. difficile).
In some embodiments, the catalytic nucleic acid comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-15, 19, 30, 36, 37, 39-43, and 47, a functional fragment thereof, or a functional variant thereof.
In some embodiments, the catalytic nucleic acid comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 11, 36, 40-42, and 47, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 10, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 11, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 12, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 13, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 14, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 15, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 16, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 19, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 20, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 21, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 23, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 29, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 30, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 31, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 32, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 36, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 37, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 39, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 40, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 41, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 42, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 43, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 44, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 47, a functional fragment thereof, or a functional variant thereof.
The catalytic nucleic acid described herein possess high sensitivity and specificity. In some embodiments, the catalytic nucleic acid has a limit-of-detection of about 100 CFU/mL C. difficile. In some embodiments, the catalytic nucleic acid has a limit-of-detection of about 104 CFU/mL C. difficile. In some embodiments, the catalytic nucleic acid does not detect and/or contact Actinomyces orientalis, Bacillus subtilis, Bacteroid fragilis, Enterobacter aerogenes, Escherichia coli, Pseudomonas aeruginosa, Shigella sonnei, Klebsiella pneumoniae.
In some embodiments, the catalytic nucleic acid is for cleavage of a nucleic acid substrate.
Provided herein is also a catalytic nucleic acid probe comprising the catalytic nucleic acid disclosed herein and a detectable substrate.
In some embodiments, the detectable substrate comprises a ribonucleotide flanked by a fluorophore modified nucleic acid residue and a quencher modified nucleic acid residue.
In some embodiments, the catalytic nucleic acid probe is configured to generate a fluorogenic signal upon contacting C. difficile.
In some embodiments, the detectable substrate comprises the nucleotide sequence of SEQ ID NO: 1 or 76. In some embodiments, the detectable substrate comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the detectable substrate comprises the nucleotide sequence of SEQ ID NO: 76.
In some embodiments, the detectable substrate is at the 5′ end of the catalytic nucleic acid.
In some embodiments, the catalytic nucleic acid probe comprises a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-16, 19-21, 23, 29-32, 36, 37, 39-44, and 47, a functional fragment thereof, or a functional variant thereof, and a detectable substrate comprising the nucleotide sequence of SEQ ID NO: 1 or 76 at the 5′ end of the catalytic nucleic acid. In some embodiments, the catalytic nucleic acid probe comprises a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10-15, 19, 30, 36, 37, 39-43, and 47, a functional fragment thereof, or a functional variant thereof, and a detectable substrate comprising the nucleotide sequence of SEQ ID NO: 1 or 76 at the 5′ end of the catalytic nucleic acid. In some embodiments, the catalytic nucleic acid probe comprises a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11, 36, 40-42, and 47, a functional fragment thereof, or a functional variant thereof, and a detectable substrate comprising the nucleotide sequence of SEQ ID NO: 1 or 76 at the 5′ end of the catalytic nucleic acid. In some embodiments, the catalytic nucleic acid probe comprises a catalytic nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11 and 47, a functional fragment thereof, or a functional variant thereof, and a detectable substrate comprising the nucleotide sequence of SEQ ID NO: 1 or 76 at the 5′ end of the catalytic nucleic acid.
In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 48-53 and 70-75, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 48, 49, and 53. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 48 and 53, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 70, 71, and 75. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 70 and 75, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 48, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 49, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 50, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 51, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 52, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 53, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 70, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 71, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 72, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 73, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 74, a functional fragment thereof, or a functional variant thereof. In some embodiments, the catalytic nucleic acid probe comprises the nucleotide sequence of SEQ ID NO: 75, a functional fragment thereof, or a functional variant thereof.
In some embodiments, the catalytic nucleic acid probe is for use in screening and/or diagnostics, environmental monitoring, health monitoring, and/or pharmaceutical development. In some embodiments, the catalytic nucleic acid probe is for use in screening, diagnostics, and/or health monitoring of C. difficile infection.
The catalytic nucleic acid and the catalytic nucleic acid probe described herein can be incorporated into a biosensor useful for detecting C. difficile. Also provided herein is a biosensor for detecting C. difficile comprising the catalytic nucleic acid disclosed herein, or the catalytic nucleic acid probe disclosed herein, functionalized on and/or in a material.
In some embodiments, the biosensor is a fluorogenic biosensor, a colorimetric biosensor, or an electrochemical biosensor. In some embodiments, the biosensor is a lateral flow device.
Also provided herein is a method for detecting the presence of C. difficile in a sample, the method comprising:
In some embodiments, b) comprises incubating the mixture at about 37° C. In some embodiments, the liquid is a buffer. In some embodiments, the buffer comprises a divalent ion. In some embodiments, the divalent ion is Mg2+. In some embodiments, the buffer comprises from about 5 mM to about 100 mM, about 5 mM to about 100 mM, about 10 mM to about 90 mM, about 20 mM to about 80 mM, about 30 mM to about 70 mM, about 40 mM to about 60 mM, or about 45 mM to about 55 mM Mg2+. In some embodiments, the buffer comprises about 50 mM Mg2+.
In some embodiments, the buffer is from about pH 5.0 to about pH 9.0, about pH 6.0 to about pH 9.0, about pH 7.0 to about pH 9.0, about pH 7.5 to about pH 9.0, about pH 7.5 to about pH 8.5, or about pH 7.8 to about pH 8.2. In some embodiments, the buffer is about pH 8.0.
In some embodiments, the mixture is incubated at about 37° C. for about 1 hour to about 4 hours to allow a ribonucleotide linkage cleavage reaction to occur.
In some embodiments, quenching of the cleavage reaction comprises adding a quenching buffer to the mixture. In some embodiments, the quenching buffer comprises EDTA and/or urea. In some embodiments, the EDTA concentration is from about 5 mM to about 200 mM, about 10 mM to about 150 mM, about 10 mM to about 100 mM, about 10 mM to about 80 mM, about 10 mM to about 60 mM, about 15 mM to about 50 mM, about 20 mM to about 40 mM, about 20 mM to about 35 mM, or about 25 mM to about 35 mM. In some embodiments, the EDTA concentration is about 30 mM. In some embodiments, the quenching buffer comprises EDTA, urea, and loading buffer. In some embodiments, the loading buffer comprises HEPES.
In some embodiments, the cleavage reaction is quenched by heating the mixture. In some embodiments, the heating is at about 90° C. or more. In some embodiments, the heating is at about 90° C. or more for about 3 minutes.
The fluorogenic signal can be detected by a fluorescence assay, which allows for quantitative or qualitative analysis. One method is fluorescence spectroscopy, which involves exciting a sample with a specific wavelength of light, causing the molecules within to emit light at a longer wavelength, which is then captured and analyzed. Another method is flow cytometry, which involves analysis of the physical and chemical characteristics of particles in a fluid as they pass through at least one laser. Each particle passes through the laser beam individually, and both the light scattered from each particle and any fluorescent light emitted are collected and analyzed. A fluorescence assay can also employ a fluorimeter, which detects and measures the fluorescence emitted by samples when excited by light. This device typically incorporates a light source and a detector, often a photodiode or a photomultiplier tube, to excite fluorescent dyes within the sample and then record the intensity of the light emitted. Those skilled in the art can readily recognize a fluorescence assay, along with any associated instruments and separation techniques, such as denaturing polyacrylamide gel electrophoresis, which are useful for detecting the fluorogenic signal and cleaved fragments generated by the catalytic nucleic acid described herein. In some embodiments, detecting the fluorogenic signal comprises analysis via a fluorescence assay. In some embodiments, detecting the fluorogenic signal comprises analysis via fluorescence spectroscopy. In some embodiments, detecting the fluorogenic signal comprises analysis via flow cytometry. In some embodiments, detecting a fluorogenic signal comprises analysis using a fluorimeter. In some embodiments, detecting the fluorogenic signal comprises analysis via denaturing polyacrylamide gel electrophoresis.
In some embodiments, the method detects C. difficile infection in a subject.
In some embodiments, the sample is a stool sample. In some embodiments, the stool sample is a fresh stool sample. In some embodiments, the stool samples is a refrigerated stool sample. In some embodiments, the sample comprises feces.
Also provided herein is a kit for detecting C. difficile in a sample, wherein the kit comprises the catalytic nucleic acid probe disclosed herein, the biosensor disclosed herein, or components required for the method disclosed herein, and instructions for use of the kit. In some embodiments, the kit further comprises reagents and/or solutions, such as at least one buffer, to provide conditions for cleavage by the catalytic nucleic acid described herein. In some embodiments, the buffer comprises a reaction buffer. In some embodiments, the reaction buffer is a HEPES buffer. In some embodiments, the reaction buffer comprises a divalent cation. In some embodiments, the divalent cation is Mg2+. In some embodiments, the buffer comprises a quenching buffer. In some embodiments, the quenching buffer comprises a chelator or a denaturant. In some embodiments, the chelator is EDTA. In some embodiments, the denaturant is urea. In some embodiments, the kit further comprises a test sample collection device. In some embodiments, the sample collection device is a swab or a container. In some embodiments, the kit comprises a label for identifying a sample. In some embodiments, the kit comprises a package for the kit.
Also provided herein is an isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-76, a nucleotide sequence shown in Tables 2, 4, 5, 7, 9, and 10, or a functional fragment thereof, or a functional variant thereof.
Also provided herein is use of the catalytic nucleic acid, the catalytic nucleic acid probe, the biosensor, or the kit disclosed herein, to determine the presence of Clostridium difficile.
The following non-limiting Examples are illustrative of the present disclosure:
Materials and Reagents. Substrate sequence QRF30, libraries for selection and reselection were synthesized by Yale University Keck Facilities. All other oligonucleotides listed in Table 2, 4, and 7 were synthesized by IDT (Integrated DNA Technologies, Coralville, IA, USA). Oligo sequences were purified by 10% denaturing (8 M urea) polyacrylamide gel electrophoresis (dPAGE) before use. T4 polynucleotide kinase (PNK), T4 DNA ligase, and proteinase K were purchased from Thermo Scientific (Ottawa, ON, Canada). Thermus aquaticus (Taq) DNA polymerase and standard Taq reaction buffer were from New England BioLabs (Ipswich, Massachusetts, United States). Urea (ultrapure) and 40% polyacrylamide solution (29:1) were acquired from BioShop Canada (Burlington, ON, Canada). The water used was purified via Milli-Q Synthesis A10 water purifier. All other chemicals were purchased from Bioshop Canada and used without further purification. Centrifugal devices were purchased from Amicon with nominal molecular weight limit (NMWL) from 3K (3000 Daltons), 10K, 30 K, 50K, and 100K.
Bacterial strains and culture conditions. C. difficile strains, BAA-1870 (NAPi), BAA-1803 (NAP1), BAA-1871 (NAP2), BAA-1872 (NAP4), BAA-1875 (NAP7), BAA-1814, 51695 and 43594 were obtained from the American Type Culture Collection (ATCC; Manassas, Va.); 20309 was purchased from CCUG (Culture Collection University of Gothenburg). E. coli strain was E. coli K12. K. aerogenes was a gift from Professor Gerard Wright (Michael G. DeGroote Institute for Infectious Disease Research, McMaster University). Other bacteria used in this study were routinely cultured and maintained in-laboratory. C. difficile strains were streaked on cooked meat broth (CMB) agar plate from a frozen glycerol stock and anaerobically cultured at 37° C. for 2 days. A single colony was then inoculated into 5 mL liquid CMB for 48-hour anerobic culture at 37° C. Other anaerobic bacteria were cultured in the same way. Aerobic bacteria were cultured in lysogeny broth (LB) media at 37° C. until OD600 reached ˜1.0.
Preparation of bacteria crude extracellular mixture (CEM). For anaerobic bacteria, liquid culture was collected after 48-hour culture; for aerobic bacteria culture, the liquid culture was collected at OD600˜1.0. The collected liquid culture was centrifuged at 11,000 g for 5 minutes. CEM was obtained by passing the supernatant through 0.22 μm filter. CEM aliquots were stored at −80° C.
In vitro selection. In vitro selection was performed as previously introduced. Briefly 1 nmol of purified library was phosphorylated by 20 units of PNK in the presence of ATP in 1×PNK buffer at 37° C. for 20 minutes. The reaction was quenched by heating the reaction mixture at 90° C. for 5 minutes. After cooling down to room temperature, 1.1×molar substrate and splint sequence were added and properly mixed. The mixture was heated at 90° C. for 2 minutes and cooled to room temperature. 20 units of T4 DNA ligase and 10×T4 ligase buffer were added to the mixture, which was incubated for 2 hours. The resulting reaction mixture was then quenched by heating at 90° C. for 5 minutes. The ligated sequence was separated by 10% dPAGE gel. The purified library was then incubated with unintended targets in 1×selection buffer (1×SB) (50 mM HEPES, pH 7.5, 150 mM NaCl, 15 mM MgCl2, and 0.01% Tween 20) in the counter selection step. After ethanol precipitation, the uncleaved sequence was purified by 10% dPAGE gel and dissolved in ddH2O for position selection. The DNA library was then incubated with CEM-NAP1 at room temperature in 1×SB. The reaction was quenched by a stop solution with 100 mM EDTA and 8 M urea. After ethanol precipitation, the cleavage products were separated by 10% dPAGE, dissolved in 10 μL of ddH2O, and stored at −20° C. The PCR1 mixture (50 μL) contained 4 μL of the template prepared above, 0.5 μM each of forward primer FP1 and reverse primer RP1, 200 μM each of dNTPs (dATP, dCTP, dGTP and dTTP), 1×PCR buffer (10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl) and 2.5 units of Taq DNA polymerase. The DNA was amplified using the following thermocycling steps: 94° C. for 1 minute; 11-13 (dependent on the amount of cleavage of the DNA pool) cycles of 94° C. for 45 seconds, 53° C. for 45 seconds and 72° C. for 45 seconds; 72° C. for 1 minute. For the PCR2 reaction, 1 μL of the PCR1 product was diluted with ddH2O to 20 μL, 2-5 μL of which was used as the template for PCR2. The PCR 2 mixture (50 μL×8 to generate enough DNA) used the same recipe, but the reverse primer RP1 was replaced with RP2. The amplified sense strand was purified by 10% dPAGE and used for the next round of selection. Sequence details are provided in Table 1.
High-throughput sequencing. The cleaved product from round 7 in selection was amplified by PCR with Illumina sequencing primers. PCR products were purified by 2% agarose gel electrophoresis and extracted from gel with GenElute Gel Extraction Kit (Sigma Aldrich). Purified samples were sequenced with paired-end next-generation sequencing (NGS) with an Illumina MiSeq system. Sequence data was processed with Geneious after primer trimming. PrinSeq v0.20.4 was used to obtain high-quality reads of top candidate sequences.[42] Only sequences with base-call probability >=99% were recorded. A clustering algorithm CD-HIT-EST was applied to group the obtained sequences into clusters (also known as classes) with the following input parameter: identity threshold (-c), 0.9; word length (-n), 7; (-d), 0; (-g), 1.[43] Grouped classes were ranked by their reads from highest to lowest in the pool. The round-6 cleavage product in reselection was sequenced as previously published.[44]
Cleavage reactions. Before reaction condition improvement, a typical cleavage reaction was composed of 1 μL of 1 μM RFD-CD2, 4 μL of CEM-NAP1, and 5 μL of 2×selection buffer (SB) (100 mM HEPES, pH 7.5, 300 mM NaCl, 30 mM MgCl2 and 0.02% Tween 20). After incubation at room temperature (22° C.) for 4 hours, the reaction was quenched by 2×quenching buffer (QB), a solution with 60 mM EDTA, 14 M urea and loading dye. The quenched reaction mixture was heated at 90° C. for 3 minutes and then loaded onto 10% dPAGE gel. The gel image was obtained with a Typhoon Amersham imager (GE Healthcare) at Centre for Microbial Chemical Biology (CMCB) McMaster University with the following imaging parameters: emission filter: 526 SP Fluorescein, Cy2, AlexaFluor488; laser: blue (488 nm); PMT: 400; Focal plane: +3; 200 pixels. The images were quantified using ImageJ software. The percent cleavage of RFD-CD2 was calculated with the following formulas: % Clv=(FIClv/6)/[(FIClv/6)+FIUnclv]. FIClv: fluorescence intensity of cleaved band; FIUnclv: fluorescence intensity of uncleaved band.
After reaction condition improvement, the cleavage reaction was typically composed of 1 μL of 1 μM RFD-CD2, 4 μL of CEM-NAP1, and 5 μL of 2×improved Reaction Buffer 2 (RB2) (100 mM HEPES, pH 8.0, 300 mM NaCl, 100 mM MgCl2 and 0.02% Tween 20). The cleavage reaction was incubated at 37° C. for 4 hours and then quenched by QB. The cleavage reaction mixture was then analyzed by 10% dPAGE, and quantified with Typhoon 9200 and ImageJ.
Reaction condition improvement. For magnesium concentration test, 2×selection buffer′ (SB′) (100 mM HEPES, pH 7.5, 300 mM NaCl, 0.02% Tween 20 with various magnesium concentrations) were prepared. The reaction was composed of 1 μL of 1 μM RFD-CD2, 4 μL of CEM-NAP1 and 5 μL of 2×SB′. Tested magnesium final concentrations were 0, 0.125, 0.25, 0.5, 0.75, 1, 5, 7.5, 10, 15, 20, 25, 50, 100, and 200 mM. Reactions were carried out at 22° C. for 24 hours and then quenched by QB. For reaction temperature test, the reaction system was composed of 1 μL of 1 μM RFD-CD2, 4 μL of CEM-NAP1 and 5 μL of 2×RB1 (100 mM MgCl2, 300 mM NaCl, 100 mM HEPES, pH 7.5, and 0.02% Tween 20). Cleavage reactions were performed at 4° C., 22° C., 37° C., 50° C. and 65° C. separately for 24 hours and quenched by QB. For pH test, the reaction mixture was composed of 1 μL of 1 μM RFD-CD2, 4 μL of CEM-NAP1 and 5 μL of 2×pH buffer′ (100 mM buffering agent, 300 mM NaCl, 100 mM MgCl2 and 0.02% Tween 20). The buffering agents used were MES at pH 5.0, 5.5, 6.0, HEPES at pH 6.5, 7.0, 7.5, 8.0 and Tris at pH 7.5, 8.0, 8.5, 9.0. Cleavage reactions were at 22° C. for 24 hours and quenched by QB.
Kinetic analysis of DNAzymes. One cleavage reaction master mixture (120 μL) was prepared with 12 μL of 1 μM RFD-CD2, 48 μL of CEM-NAP1, and 60 μL of 2×SB or 2×RB2. The cleavage reaction under the original selection conditions was performed at room temperature (22° C.); all other reactions were done at 37° C. The timepoints were 30, 60, 90, 120, 150, 180, 240, 360, 480, 960, 1440, 1800 minutes or 0.5, 1, 2.5, 5, 10, 15, 20, 30, 60, 120 minutes. A 10-μL aliquot was taken from the master reaction mixture at a time point and quenched with QB. The quenched reaction mixture was then heated at 90° C. for 3 minutes for 10% dPAGE analysis. The gel imaging and quantification process was the same as described above. Percent cleavage of RFD-CD2 versus reaction time was plotted, and non-linear fitting (one phase exponential association) was applied to the data using the equation of Y=Ymax [1−e−kt] in Prism (GraphPad, 4.03). Ymax represents the maximal cleavage yield and k is the observed first-order rate constant (kobs).
Target identification. To investigate the nature of the target of RFD-CD2, 1 μL of 20 mg/mL proteinase K was mixed with 4 μL of CEM-NAP1 and 5 μL of 2×RB2. The mixture was incubated at room temperature for 1 hour. After the incubation, 1 μL of 1 μM RFD-CD2 was added to the solution, which was further incubated at 37° C. for 4 hours. The reaction was quenched by QB and the mixture was subjected to 10% dPAGE analysis. To examine the thermostability of the target molecule, CEM-NAP1 was heated at 90° C. for 5 and 10 minutes. After cooling down to room temperature, 4 μL of heated and non-heated CEM-NAP1 were incubated with 1 μL of 1 μM RFD-CD2 and 5 μL of 2×RB2. Aliquots of 0.4 mL CEM-NAP1 was filled into Amicon Ultra-0.5 mL Centrifugal Filters and centrifuged at 14,000 g. The filtrate (the liquid that passed through the filter) and the concentrate of each column were separately collected and incubated with RFD-CD2 as described above.
Specificity test. CEMs from relevant bacteria were prepared in the same way as described above for the preparation of CEM-NAP1. 4 μL of each bacterial CEM was incubated with 1 μL of 1 μM RFD-CD2 and 5 μL of 2×RB2 at 37° C. for 4 hours. The reaction was quenched by QB and the reaction mixture was analyzed by 10% dPAGE.
Sensitivity test. A single colony of NAP1 on CMB agar plate was inoculated into 5 mL of liquid CMB. After 48-hour growth, C. difficile culture was serially diluted 10 times. 100 μL of each dilution was streaked out on a CMB agar plate with triplicate. Plates with 30-300 colonies were counted and triplicates were averaged for concentration calculation (CFU/mL). Based on this diluted concentration, the concentration at other dilutions was calculated. CEMs at each dilution were prepared from their corresponding culture. The fluorescence assay was performed on infinite 200Pro and the fluorescence intensity was read by Tecan i-control (2.0.10.0). The excitation wavelength was 488 nm and the emission wavelength was 520 nm. The fluorescence intensity was recorded every 15 minutes for 4 hours. For each dilution, the fluorescence intensity of the CEM was measured as Fb. The fluorescence intensity of the DNAzyme cleavage reaction mixture at a given timepoint was measured as F. The fluorescence intensity of the DNAzyme cleavage reaction mixture at the starting point (0 min) was measured as F0. The relative fluorescence intensity was calculated using the equation of (F−Fb)/(F0−Fb).
Reselection. The reselection protocol was similar to the original selection protocol except for the use of a different starting pool and a different set of reverse primers (see Table 5).
RFD-CD2 isolation via in vitro selection. An in vitro selection was performed to isolate DNAzymes specifically targeting C. difficile from a random-sequence DNA pool (a simplified selection strategy is illustrated in
A total of 7 rounds of selection was conducted with an original goal of isolating RFDs that can be activated by a hypervirulent C. difficile strain BAA-1870 (also known as BI/NAP1/027 or simply NAP1). The progress of the selection is provided in
Several candidate DNAzymes were discovered from pool 7 (Table 2). These sequences were assessed for RNA-cleaving activities in SB with and without CEM-NAP1 (
Reaction condition improvement. RFD-CD2 was active in SB containing CEM-NAP1, but it was only able to achieve ˜40% cleavage in 24 hours. One way to improve its performance is to establish its reaction conditions. For this reason, its dependence on metal ions, reaction temperature, and pH was examined. The data from these experiments are presented in
Divalent metal ions are often an essential cofactor for RNA-cleaving DNAzymes.[24] Various divalent metal ions can have a significant effect on the catalytic performance of a DNAzyme. Different metal ions were tested to find the one that best supports the activity of RFD-CD2 in the presence of CEM-NAP1. Nine tested metal ions were: Mg2+, Co2+, Mn2+, Cd2+, Zn2+, Cu2+, Ni2+, Ba2+, and Ca2+ (15 mM;
RFD-CD2 was then examined for activity in SB containing Mg2+ concentrations ranging from 0 to 200 mM (
The improved reaction temperature of RFD-CD2 was next examined by incubating RFD-CD2 with CEM-NAP1 at 4° C., 22° C., 37° C., 50° C., and 65° C. in RB1 (
The cleavage activity of RFD-CD2 at different pH conditions was examined next (
The kinetic profile RFD-CD2 was then compared in SB and RB2 (
Target identification for RFD-CD2. RFD-CD2 was isolated using CEM-NAP1 as the complex target based on the assumption that one or more molecules in CEM-NAP1 would function as the binding partner to induce the cleavage activities of the DNAzymes to be isolated. As a mixture, CEM-NAP1 contains a large variety of molecules secreted by bacteria. Previous experiments with other RFDs have revealed that the activating targets for bacteria-responding RFDs have been protein molecules.[21,37-41,45] Based on this knowledge, further studies focused on investigating if the activating molecule for RFD-CD2 was also a protein molecule.
Proteinase K was used to degrade protein molecules in CEM-NAP1. The proteinase K-treated CEM was not able to induce the cleavage activity of RFD-CD2 (
Spin columns with membrane filters of varying molecule-weight cut-offs were applied next to estimate the molecular weight of the target protein, an approach that was previously applied to estimate molecular weights of RFD-activating protein targets.[21,37-41,45] Molecules larger than the pore size of the membrane-based filter were expected to remain on top of the membrane upon centrifugation (which was collected as the concentrate fraction or “C” fraction), while other molecules would pass through the membrane (which was collected as the filtrate fraction or “F” fraction). Multiple F and C fractions were produced by subjecting CEM-NAP1 through centrifugation with membranes with pore sizes of 3, 10, 30, 50 and 100 kDa (kilo Dalton). For example, upon centrifugation of CEM-NAP1 with a membrane cut-off of 50 kDa, two fractions would be generated: the F fraction denoted 50 KF and the C fraction denoted 50 KC.
All of the F and C fractions were then tested for the induction of the cleavage activity of RFD-CD2. All the C fractions induced the cleavage; however, only 50 KF and 100 KF fractions produced cleavage (
Another interesting observation is that even 100 KC was still able to induce robust cleavage of RFD-CD2. These results show that the molecular weight range of the DNAzyme-activating target (or targets) is quite broad: it is surely bigger than 30 kDa but it can also be bigger than 100 kDa.
The data show that (1) the target (or targets) is proteinaceous in nature; and (2) RFD-CD2 can have recruited a single protein binding partner, which could be present in CEM-NAP1 in multiple forms, including (1) a full-length form and a partially degraded but still active form; or (2) a full-length form and a complex form with another protein or other proteins. Alternatively, RFD-CD2 can have recruited two or more protein binding partners with different molecular weights.
Species specificity and strain selectivity of RFD-CD2. The recognition specificity of RFD-CD2 was next investigated using CEM samples prepared from nine different bacteria species: three gram-positive bacteria and six gram-negative bacteria. The reaction was conducted in RB2 at 37° C. for 4 hours. No detectable cleavage was observed in non-targeted bacteria (
The selectivity of RFD-CD2 towards diverse strains of C. difficile was also assessed. Nine different strains purchased from ATCC (American Type Culture Collection) and CCUG (Culture Collection University of Gothenburg) were tested. These strains include BAA-1870 (NAP1), BAA-1803 (also NAP1 but with a different toxin type, see Table 3), BAA-1871 (NAP2), BAA-1872 (NAP4), BAA-1875 (NAP7), BAA-1814, 51695, 43594, and CCUG 20309. These strains were selected for their toxigenicity as toxin A and toxin B are the major virulence factors for C. difficile.[46-47] All tested strains produced both toxin A and toxin B other than CCUG 20309, which only produced toxin B (Table 3). As TcdA−TcdB+C. difficile strain was previously documented for infection outbreaks,[48] including this special strain, it is important to examine the response of RFD-CD2 towards diverse pathogenic C. difficile strains. Other tested strains are relevant to historic C. difficile outbreaks. For example, NAPi strain caused an outbreak around the world in early 2000, which was reported to be responsible for 51% CDI cases in the US and 84% in Canada in early 2000.[49,50] NAP2 was another predominant strains across the world,[51-53] while NAP4 was the second most prevalent strain in Canada during 2009-2015.[54] NAP7, a hypervirulent strain associated with severe diarrhea and a high mortality rate, has caused outbreaks in the United Kingdom and the Netherlands.[55-57] Other tested strains have the ribotype that has caused multiple outbreaks around the world.[58-60]
Cleavage activity was detected in all tested C. difficile strains, although percent cleavage varied noticeably among these strains (
Detection sensitivity of RFD-CD2 as a fluorescent sensor. The RFD-CD2 was next examined as a fluorescent sensor in four different ways: fluorescence reading and dPAGE-based analysis of reactions of RFD-CD2 with either whole cell culture of NAP1 or CEM-NAP1. The fluorescence assay was conducted by incubating a gradually increased concentration of a target sample with RFD-CD2 and the fluorescence intensity of the reaction was recorded every 15 minutes. The limit of detection (LOD) for this fluorescence assay is defined as 3σ+mean negative control, with a being the standard deviation of the negative control samples. As C. difficile whole cells were recovered from patients' fecal samples for culturing detection, both whole cell culture and CEM are interesting target forms to examine for RFD-CD2. The LOD was determined to be 104 CFU/mL towards both target forms (
As a detection method comparison, the cleavage reaction mixtures were also analyzed by 10% dPAGE after incubating RFD-CD2 with a target sample for 4 hours at 37° C. The LOD for dPAGE analysis is defined as the lowest concentration of target that was capable of producing an observable cleavage band on gel. An LOD of 103 CFU/mL for whole cell culture and an LOD of 102 CFU/mL for CEM-NAP1 were achieved (
Identification of functionally important sequence elements of RFD-CD2 via nucleotide truncations. A shorter but active version of RFD-CD2 was then derived by nucleotide truncation as a shorter sequence costs less to synthesize and is simpler for biosensor engineering. The truncation of non-essential nucleotides is expected to have a neutral or even positive effect on the performance of a DNAzyme; however, the removal of functionally important nucleotides will have a significant impact on the catalytic activity.
The activity of a series of shortened sequences of RFD-CD2—with a block of nucleotides removed from the 3′ end, from the 5′ or internally—was tested. Each truncated sequence was assessed for its relative cleavage activity at 4-hour incubation with CEM-NAP1 at 37° C., with the percent cleavage observed for the full-length RFD-CD2 taken as 100. In total, 22 sequences were tested in this experiment and the data is provide in Table 4. The normalized activities of these truncation variants vary significantly, ranging from 3.4 for RFD-CD2-TV14 to 106.4 for RFD-CD2-TV22 (Table 4). Most importantly, the results obtained with these truncation variants clearly identified two sequence elements as functionally important, which are denoted as “important sequence element 1” (covering T41 to C71) and “important sequence element 2” (covering G81 to G108) in
Examination of sequence conservation of RFD-CD2 via reselection. Next, reselection was performed to identify functionally important nucleotides. The reselection experiment used a partially randomized library based on the original sequence of RFD-CD2 with a degeneracy of 0.24 at each of the original random-sequence positions (i.e., the A51-A110 element shown in
Concentrated CEM-NAP1 was used as the positive-selection target in each round. The selection pressure was increased during the reselection process by reducing the concentrations of both the DNA pool and CEM-NAP1 as well as reducing the incubation time—these measures were implemented in order to isolate the most active sequence. Specifically, for the first three rounds, 23× concentrated CEM-NAP1 was used as the positive target, the reaction time was set at 30 minutes, while the concentration of the DNA pool was reduced from 1 μM in round 1 to 0.5 μM in round 2 and then to 0.25 μM in round 3.
By round 3, strong cleavage (16.2%) was observed (
Counter-selection steps were conducted in round 4 (with SB; reaction time: 18 hours) and round 6 (with CMB; reaction time: 24 hours), which were intended to remove self-cleaving RFDs and RFDs that could be activated by background molecules in the culture media. The cleavage was not observed in SB only in round 4 and the cleavage level observed with CMB in round 6 was small (2.1%) even with an incubation times of 24 hours, showing that the DNA pool was dominated by RFDs responsive to CEM-NAP1.
Deep sequencing was performed with the round-6 cleavage product. Nucleotide mutation and conservation pattern observed with the top 450 sequences was organized into “variation index (VI)” chart shown in
The first highly conserved sequence element from reselection overlaps well with the important sequence element identified by the sequence truncation experiment. Specifically, the important sequence element 1 established by the truncation analysis covers T41-C71, while the conserved sequence element 1 from reselection covers A51-C71. However, T41-C50 is part of the forward primer binding site for reselection and thus was not subjected to mutagenesis.
The important sequence element 2 by the truncation analysis covers G81-C108, which only partially overlaps with G91-G108, the conserved sequence element 2 from reselection. In other words, the truncation experiment identified G81-G90 as “functionally important” while the reselection showed a portion the nucleotides in this region can tolerate mutations. The apparent contradictory findings will be rationalized in the next section where the secondary structure of RFD-CD2 is elucidated: it turns out that G81-G90 merely acts as a structural linker and the identities of the nucleotides in this region are unimportant.
Elucidation of secondary structure of RFD-CD2. To further investigate the apparent contradictory findings in functionally important sequence elements, the secondary structure of RFD-CD2 was elucidated. A proposed secondary structure model of RFD-CD2 is provided in
P1 involves the pairing of the G12-C21 element (10 nucleotides) within the substrate domain with the G62-C71 element (10 nucleotides) within the random-sequence domain (also indicated by the grey lines in
P2 involves the pairing of the A57-A61 element (5 nucleotides) with the T97-T101 element (5 nucleotides), both of which are located within the random-sequence domain (indicated by black lines in
Three RFD-CD2 mutants were also designed and activities tested to further verify the importance of P2 to the DNAzyme function (
The proposed secondary structure of RFD-CD2 was also consistent with nucleotide truncation data. Specifically, the minimized but fully active sequence RFD-CD2-TV22 maintained the key pseudoknot structural arrangement, as shown in
The truncation data given in Table 4 indicates the G81-G90 element cannot be truncated, and yet the reselection data shows these ten nucleotides are highly mutated (
Finally, based on the reselection data and mutagenesis analysis, a new variant of RFD-CD2 was designed, termed RFD-CD2M10 hereinafter, which incorporates the 9T linker and the A50-T79 base pair. RFD-CD2-M10 has the smallest sequence but showed highest activity: it contains 88 nucleotides and had a relative activity of 121. Moreover, the specificity of RFD-CD2-M10 was minimally impacted by the truncation and mutation, as RFD-CD2-M10 still exhibited high specificity towards C. difficile species and still responded to multiple clinical strains of C. difficile (
In summary, an RNA-cleaving fluorogenic DNAzyme named RFD-CD2 that is responsive to diverse C. difficile strains was developed. Under improved reaction conditions and a saturating target concentration, RFD-CD2 exhibited a catalytic rate constant (kobs) of 0.09 min1 and thus qualifies as one of the most active bacteria-responding RFD reported to date. The target molecule for RFD-CD2 is a heat-sensitive, proteinaceous molecule (or molecules) with a molecular weight greater than 30 kDa. Comprehensive sequence and structure characterization revealed a pseudoknot in the structure of RFD-CD2 and a significantly minimized but more active sequence RFD-CD2-M10 (88 nt) was established. RFD-CD2 not only exhibited high species-specificity towards C. difficile but is also reactive towards diverse clinically relevant C. difficile strains investigated in this disclosure. This specificity pattern renders RFD-CD2 a potential universal sensing probe for CDI diagnosis. As a fluorescent sensor, RFD-CD2 is able to achieve an LOD of 100 CFU/mL with 4-hour incubation using dPAGE analysis and an LOD of 104 CFU/mL within 1-hour incubation using a fluorimeter. Note that the C. difficile count in CDI clinical feces was at 106 CFU/g (feces wet weight); [76] if 1 g of wet fecal sample is dissolved in 1 mL solution, the concentration of C. difficile in the test sample would be 106 CFU/mL. Given the LOD of RFD-CD2 from 1-hour assay using a fluorimeter was 104 CFU/mL, the DNAzyme assay is sensitive enough to identify CDI.
While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
CAACCTAAACTCCCTACACCACATTAAGA
CGGAGGCTTAG
This application claims the benefit of U.S. Provisional Patent Application No. 63/460,799 filed Apr. 20, 2023, herein incorporated by reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 63460799 | Apr 2023 | US |
