The present disclosure relates to the field of biotechnology, and particularly, to a droplet microfluidics-based single-cell sequencing and applications.
Single-cell sequencing technology is one of the most popular technologies in the past decade, and has shown a wide range of application prospects in development, tumor-related scientific research, and disease diagnosis. At present, single-cell sequencing technology has been realized at different levels such as genome, transcriptome, epiome and proteome, and it has played an important role in the research of many scientific issues. However, the current single-cell sequencing technology faces many challenges in terms of data quality, throughput, cost, and operability, and there are still many technical barriers to real large-scale applications.
Omics sequencing technology based on a microfluidic system is one of the most concerned fields in recent years. Compared with traditional technologies, the micro-scale droplet field in microfluidics is characterized by its extremely small consumption of reagents, which can greatly reduce the consumption cost of expensive reagents. Each droplet with stable morphology can be regarded as an independent microreactor, which reduces cross-contamination and is easy to manipulate. The droplet's large specific surface area can also accelerate various reactions and heat transfer, which is ideal in the field of single-cell research. Compared with other microfluidic technologies, droplet microfluidics has gradually become a popular method for biochemical analysis. However, at present, most of the single-cell library construction and sequencing technologies based on droplet microfluidic platforms require an investment of 100,000 cells, but only a few thousand single cells can be recovered, resulting in a large amount of waste of cells. The invention and use of new biochemical strategies to reduce cell input and increase cell recovery is one of the most important research hotspots at present.
The present disclosure aims to solve at least one of the technical problems in the related art to a certain extent. When the single-cell sequencing is performed by using the droplet microfluidic technology, the input amount of cells is reduced, and the recovery rate and utilization rate of cells can be improved, to avoid the waste of cells, which is more suitable for the purpose of sequencing a small input amount of cells.
Single-cell sequencing based on droplet microfluidic technology has become an ideal method for single-cell research due to a microscale reagents and simple manipulation. Referring to the literature published on Cell Resource (Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets, Evan Z. Macosko et al., Cell 161, 1202-1214, May 21, 2015), the droplet microfluidic technology uses a water-in-oil droplet to encapsulate cells and microbeads, so as to obtain a droplet containing one cell and one microbead. The other components of the droplet include a lysate. The micro-particle contains a large number of identical barcodes (cell index sequences, i.e., cell barcodes, which are used as identifiers of reads from the same cell). During the continuous generation of droplets, the cell in the droplet is lysed by the lysate, releasing a large number of mRNAs, and at the same time, the mRNA can be captured by the microbead. After all the droplets are generated, the droplets are broken. The mRNA is reverse transcribed into cDNA, which is further amplified. Then, the cDNA is fragmented by a fragment enzyme and sequencing adapters are added to both ends thereof. Further, the cDNA with the adapters is sequenced.
However, the droplet microfluidic technology also has an obvious disadvantage, that is, the initial input number of cells is too high (usually more than 100,000), and the finally obtained cells only account for a very low proportion of the input cells (about 4%). One main reason is that the distribution of the two phases, cell and microbead, in the droplet is a random event, which conforms to the Poisson distribution. Single-cell sequencing is required to ensure that the droplet contains only one cell and one microbead, and there can be no more than 2 different cells or 2 different microbeads in one droplet. In order to meet this requirement, both the cells and microbeads need to be prepared at a very low concentration, so that a large number of droplets do not simultaneously encapsulate the cells or microbeads, or there is only one cell or only one microbead. In the end, a lot of cells were wasted, and the number of cells that meet the sequencing requirements only accounted for about 4% of the input cells, which results in a large amount of waste of cells. A focus of the present disclosure is about how to reduce the input number of cells and increase the proportion of obtained cells to avoid a large waste of cells, especially to be suitable for the single-cell sequencing of a small input amount of cells.
In the process of research, Applicant creatively thought about whether it is possible to encapsulate multiple microbeads in one droplet, and then recognize these microbeads of one droplet to increase the proportion of cells that meet the sequencing requirements. For example, a droplet index sequence can be added to each distinct droplet as a marker to identify reads from different droplets. A cell index sequence may also be present in the droplet as a marker to identify reads from different cells. The sequencing library constructed in this manner contains both the cell index sequence and the droplet index sequence. During sequencing, by identifying these index sequences, different reads can be attributed to different cells, thereby realizing single-cell sequencing. According to embodiments of the present disclosure, the microbeads in one droplet carries the cell index sequence on the surface thereof and contains capture sequences used for capturing insert fragments from cells (i.e., fragments whose sequencing information is to be obtained through sequencing), and nucleic acid molecules carrying the insert fragments and cell index sequences can be obtained in the finally formed sequencing library. At the same time, the insert fragments from the same cell may be captured by more than one microbeads carrying different cell index sequences, and they cannot be distinguished effectively after de-emulsification. Therefore, by adding the droplet index sequence to the droplet, since the droplet index sequence can be captured by the capture sequence on the surface of the microbead in the droplet at the same time, the nucleic acid molecules carrying both the cell index sequence and the droplet index sequence can be obtained in the finally formed sequencing library. Thereby, by sequencing the nucleic acid molecules carrying the insert fragments and the cell index sequences, and by sequencing the nucleic acid molecules carrying the cell index sequences and the droplet index sequences, the sequencing results are mutually verified to confirm the reads from the same cell, thereby obtaining the single-cell sequencing result.
Such an approach for constructing the sequencing library and performing the single-cell sequencing does not require that one droplet encapsulate only one microbead, and thus a very low concentration of microbeads is no longer needed. As a result, more cells can be captured by the microbeads, thereby reducing the input amount of cells. Specifically, the input amount of cells can be reduced to be less than 10,000 from more than 100,000, and the recovery rate of cells is also increased from 4% to more than 50%. A single experiment obtains 4,000 to 6,000 available cells, which can greatly reduce the cost of single-cell library construction and sequencing, and is conducive to various large-scale researches or tests carried out through single-cell sequencing. In addition, those skilled in the art understand that any other available vector having the same functions as the microbead may also fall within the protection scope of the present disclosure.
Specifically, the present disclosure provides the following technical solutions.
In a first aspect of the present disclosure, the present disclosure provides a sequencing library including: a first nucleic acid molecule carrying a cell index sequence and a droplet index sequence; and a second nucleic acid molecule carrying an insert fragment and the cell index sequence. As described above, the present disclosure confirms reads from the same cell by sequencing the nucleic acid molecule carrying the insert fragment and the cell index sequence, and sequencing the nucleic acid molecule carrying the cell index sequence and the droplet index sequence, according to the droplet index and cell index, to obtain the single-cell sequencing result.
According to embodiments of the present disclosure, the sequencing library described above may further include the following technical features.
According to an embodiment of the present disclosure, the second nucleic acid molecule further includes a Unique Molecular Identifier. The second nucleic acid molecule further carries the Unique Molecular Identifier, which can indicate reads from different genes to achieve accurate determination of different genes in cells.
According to an embodiment of the present disclosure, the Unique Molecular Identifier has a length ranging from 6 nt to 15 nt, preferably from 8 nt to 12 nt, and more preferably 10 nt. The Unique Molecular Identifier having length from 6 to 15 bases may from 46 to 415 different sequences. For example, the length of Unique Molecular Identifiers may be 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt or 15 nt, etc., which can be used to indicate reads from different genes without occupying too much sequencing information or causing unnecessary waste.
According to an embodiment of the present disclosure, the insert fragment is formed based on an mRNA molecule or a DNA molecule. The insert fragment carried on the second nucleic acid molecule can be an mRNA molecule from a lysed cell, or a DNA molecule. As an example, the mRNA molecule usually carries a polyA sequence. In this way, when a microbead or any other vector is used for capture, a polyT sequence can serve as the corresponding capture sequence to realize the capture of the insert.
According to an embodiment of the present disclosure, the cell index sequence has a length ranging from 10 nt to 16 nt. The cell index sequence having a length of 10 to 16 bases may from 410 to 416 different sequences, which can be used to indicate different cells without occupying too much sequencing information or causing unnecessary waste.
According to an embodiment of the present disclosure, the droplet index sequence has a length ranging from 6 nt to 15 nt, preferably from 8 nt to 12 nt, and more preferably 10 nt. The droplet index sequence having a length of 6 to 15 bases may from 46 to 415 different sequences. For example, the length of the droplet index sequences can be 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt or 15 nt, etc., which can be used to indicate sequencing reads from the one droplet without occupying too much sequencing information or causing unnecessary waste.
In a second aspect of the present disclosure, the present disclosure provides a droplet including a biological material containing a nucleic acid molecule; a droplet identification molecule carrying a droplet index sequence; and a first vector carrying a capture sequence and a cell index sequence. The capture sequence is configured to capture at least one of the nucleic acid molecule and the droplet identification molecule. According to an embodiment of the present disclosure, the first vector may further contain an amplification recognition sequence. As described above, the present disclosure provides a droplet containing both the droplet identification molecule and the vector, which can be used to indicate sequencing reads from the same cell. In addition, since one droplet contains only one cell, the amount of cells used can be reduced, thereby improving the utilization rate of cells during single-cell sequencing. Thus, the droplet is especially suitable for single-cell sequencing of a small input amount of cells.
According to an embodiment of the present disclosure, the above-mentioned droplet may further include the following technical features.
According to an embodiment of the present disclosure, the nucleic acid molecule is mRNA or DNA.
According to an embodiment of the present disclosure, the biological material is provided in a form of cell.
According to an embodiment of the present disclosure, each droplet includes one cell, and each droplet includes at least one vector.
According to an embodiment of the present disclosure, the droplet further contains a cell lysate. The biological material in the droplet, such as the cell, can be lysed by using the cell lysis reagent, thereby facilitating the capture of the nucleic acid molecule on the biological material by the capture sequence on the vector.
According to an embodiment of the present disclosure, the droplet identification molecule further includes the captured sequence, and the captured sequence is connected to the droplet index sequence. The droplet identification molecule further includes the captured sequence, and the captured sequence can be identified by the capture sequence on the vector, thereby facilitating the capture of the droplet identification molecule by the vector.
According to an embodiment of the present disclosure, the droplet identification molecule is in a form of a long-chain molecule, and the long-chain molecule includes a many copies of droplet identification molecules in tandem; and the many copies of droplet index sequences on the same long-chain molecule has an identical nucleic acid sequence. The droplet identification molecule is provided in the form of a long-chain molecule. The long-chain molecule contains multiple droplet identification molecules in tandem. By processing the long-chain molecule, for example, by inserting an endonuclease recognition sequence between the droplet identification molecules, followed by enzymatic digestion with endonucleases, the multiple droplet identification molecules can be obtained and used in different droplets to indicate sequencing reads from different droplets. The multiple droplet identification molecules can also be obtained in other ways. For example, some oligonucleotides carrying cell index sequences immobilized on beads as the first vector can be released, bonded to long-chain molecules, and then extended or amplified to obtain the droplet identification molecules.
According to an embodiment of the present disclosure, the long-chain molecule further includes an endonuclease recognition sequence disposed between two adjacent droplet identification sequences, and the droplet further includes an endonuclease configured to cleave the endonuclease recognition sequence. The droplet may further contain the endonuclease to identify the endonuclease recognition sequence, so as to easily process the long-chain molecule. In this way, a large number of droplet identification molecules can be quickly obtained and applied in different droplets.
According to an embodiment of the present disclosure, the endonuclease recognition sequence is a double-stranded sequence, and the droplet identification molecule is a single-stranded sequence.
According to an embodiment of the present disclosure, the droplet identification molecule is provided by a form of a second vector, the second vector carrying many copies of droplet identification molecules. According to an embodiment of the present disclosure, the plurality of droplet identification molecules is connected to the second vector through a covalent bond or any other connection manner. For example, it can be connected to the vector through a disulfide bond, which facilitates subsequent use of some covalent bond cleavage reagents, such as DTT, to break the covalent bond and release the droplet identification molecule, thereby facilitating the capture by the capture sequence carried on the first vector. Alternatively, the second vector can be a hydrogel microbead, in which the plurality of droplet identification molecules can be embedded, and the hydrogel can be melted under suitable reaction conditions to release the droplet identification molecules. The other connection manners mentioned can be those similar to covalent bonding, but do not break hydrogen bonds.
According to an embodiment of the present disclosure, the plurality of droplet identification molecules each further includes the captured sequence, and the captured sequence is connected to the droplet index sequence and reverse complementary with the capture sequence of the first vector. This facilitates the specific binding of the capture sequence carried on the first vector to the capture sequence, thereby capturing the droplet index sequence.
According to an embodiment of the present disclosure, the covalent bond is a disulfide bond.
According to an embodiment of the present disclosure, the droplet further includes: a cleavage reagent capable of cleaving connections between the plurality of droplet identification molecules and the second vector. The cleavage reagent mentioned herein can break the covalent bond or other modification connection between the above-mentioned droplet identification molecule and the second vector.
According to an embodiment of the present disclosure, the cleavage reagent is DTT.
According to an embodiment of the present disclosure, the droplet has a water-in-oil structure.
In a third aspect of the present disclosure, the present disclosure provides a suspension including a plurality of droplets described in any embodiment of the second aspect of the present disclosure, and the droplet index sequences of at least two droplets of the plurality of droplets have different nucleic acid sequences. By preparing the suspension containing a plurality of droplets, the suspension can be sequenced and analyzed for a desired sequencing result.
In a fourth aspect of the present disclosure, the present disclosure provides a cell dispersion including: a cell; and a long-chain molecule comprising a plurality of droplet index sequences in tandem. The plurality of droplet index sequences on a same long-chain molecule has an identical nucleic acid sequence. The provided cell dispersion can be combined with a vector, such as microbead, to prepare droplets by means of a microfluidic chip, followed by performing demulsification, library construction, sequencing, etc. on the droplets, so as to obtain the sequencing result of single cell in the cell dispersion.
According to an embodiment of the present disclosure, the cell dispersion described above may further include the following technical features.
According to an embodiment of the present disclosure, the cell is present in a form of single cell.
According to an embodiment of the present disclosure, the cell dispersion includes a plurality of long-chain molecules. The plurality of droplet index sequences on at least two long-chain molecules of the plurality of long chain molecules has different nucleic acid sequences.
According to an embodiment of the present disclosure, the long-chain molecule further includes an endonuclease recognition sequence located between two adjacent droplet identification molecules of the plurality of identification molecules.
According to an embodiment of the present disclosure, the endonuclease recognition sequence is a double-stranded sequence, and each droplet index sequence is a single-stranded sequence.
According to an embodiment of the present disclosure, the long-chain molecule is in a form of DNA nanoball.
In a fifth aspect of the present disclosure, the present disclosure provides a cell dispersion including a cell; and a second vector carrying a plurality of droplet identification molecules. Each droplet identification molecule can be connected to the second vector by a covalent bond or any other connection manner, and each droplet identification molecule carries a droplet index sequence.
According to embodiments of the present disclosure, the cell dispersion provided in the fifth aspect may further include the following technical features.
According to an embodiment of the present disclosure, the cell is in a form of single cell.
According to an embodiment of the present disclosure, each droplet identification molecule further includes a captured sequence, and the captured sequence is connected to the droplet index sequence.
According to an embodiment of the present disclosure, the covalent bond is a disulfide bond.
In a sixth aspect of the present disclosure, the present disclosure provides a sequencing method. The sequencing method includes: sequencing the sequencing library described in any embodiment of the first aspect of the present disclosure to obtain a sequencing result composed of a plurality of sequencing reads; and classifying sources of the plurality of sequencing reads based on at least one of the cell index sequence, the droplet index sequence, or the Unique Molecular Identifier.
In a seventh aspect of the present disclosure, the present disclosure provides a cyclic nucleic acid molecule. The cyclic nucleic acid molecule includes a replication-initiating sequence, a captured sequence, and a droplet index sequence. The replication-initiating sequence, which is included in the cyclic nucleic acid molecule provided by the present disclosure, can be used for replication and amplification. In addition, the cyclic nucleic acid molecule provided by the present disclosure further contains the captured sequence to be identified by the capture sequence from the first vector, and the droplet index sequence to be used in droplets as markers indicating sequencing reads from one droplet.
According to an embodiment of the present disclosure, the cyclic nucleic acid molecule further includes an endonuclease recognition sequence. The endonuclease recognition sequence can be identified by the endonuclease, thereby facilitating the subsequent obtaining of a large number of identical chain nucleic acid molecules.
In an eighth aspect of the present disclosure, the present disclosure provides a method for preparing a long-chain molecule. The method includes: performing a rolling circle replication amplification on the cyclic nucleic acid molecule described in the sixth aspect of the present disclosure to obtain the long-chain molecule. Thus, long-chain molecules can be easily and quickly obtained.
In a ninth aspect of the present disclosure, the present disclosure provides a linear nucleic acid molecule. The linear nucleic acid molecule includes a 5′-end sequence and a 3′-end sequence, a replication-initiating sequence, a captured sequence, and a droplet index sequence. The 5′-end sequence and the 3′-end sequence constitute an endonuclease recognition sequence.
In a tenth aspect of the present disclosure, the present disclosure provides a method for analyzing single-cell nucleic acids. The method includes: providing a single-cell suspension containing dispersed single cells, and mixing the single-cell suspension with droplet identification molecules to obtain a cell suspension, each of the droplet identification molecules carrying a droplet index sequence; and placing the cell suspension, a first vector, and an oil at different positions of a microfluidic chip in such a manner that the cell suspension, the first vectors, and the oil pass through channel to obtain the droplet as defined in any embodiment of the second aspect of the present disclosure; performing demulsification and library construction on the droplet to obtain a sequencing library; and sequencing and analyzing the sequencing library to obtain nucleic acid information of the single cell.
According to an embodiment of the present disclosure, the above-described method for analyzing single-cell nucleic acids may further include the following technical features.
According to an embodiment of the present disclosure, a concentration of the single-cell suspension ranges from 100 to 200 cells per microliter, and wherein a concentration of the droplet identification molecules ranges from 105 to 108 copies per microliter.
According to an embodiment of the present disclosure, a concentration of the first vectors ranges from 2,000 to 3,000 per microliter.
Through the technical solutions provided by the present disclosure, the input amount of cells for droplet microfluidic single-cell library construction can be reduced to 10,000, and the cell recovery rate can reach 50% or greater. One single experiment obtains 4,000 to 6,000 available cells, which greatly reduces the cost of single-cell library construction and sequencing, and is conducive to the development of large-scale single-cell research projects.
Additional aspects and advantages of the present disclosure will be set forth, in part, from the following description, and will become apparent in part from the following description, or may be learned by practice of the present disclosure.
The above and/or additional aspects and advantages of the present disclosure will become apparent and readily understood from the following description of embodiments taken in conjunction with the accompanying drawings, in which:
The embodiments of the present disclosure are described in detail below, and examples of the embodiments are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are illustrative and are intended to explain the present disclosure, and they should not be construed as limiting the present disclosure.
In the description of the present disclosure, the relevant terms herein are explained and illustrated, and these explanations and illustrations are only for the convenience of understanding the solutions, and should not be regarded as a limitation on the claimed solutions of the present disclosure.
Herein, a nucleic acid molecule may refer to an RNA molecule, a DNA molecule, or a modified DNA molecule and/or RNA molecule, or an unmodified DNA molecule and/or RNA molecule. Those skilled in the art can specifically determine, based on the context, whether it is an RNA molecule, or a DNA molecule, or both an RNA molecule and a DNA molecule. In addition, the connection of nucleic acid molecules, unless otherwise specified, refers to one of the most common connection through a 3-5′ phosphodiester bond. Unless otherwise specified, when these different nucleic acid molecules are connected, it is not required that the nucleic acid molecules are connected directly, and they may be connected through other nucleic acid molecules, as long as they are on the same nucleic acid chain or on the same ring.
Herein, “cell index sequence”, “droplet index sequence” or “captured sequence”, etc., is a fragment of nucleic acid molecule. As mentioned above, these nucleic acid molecules may be RNA or DNA molecules. The different expressions are only intended to indicate the different functions of these nucleic acid sequences. Those skilled in the art can understand the effects of the sequences represented by the various expressions according to the context.
For example, herein, the cell index sequence (cell barcode) can be used to indicate that the sequencing reads are from the same cell. The droplet index sequence (droplet barcode) can indicate that the sequencing reads are from one droplet. The capture sequence refers to a sequence used to pair with and thus capture other nucleic acid molecules. The captured sequence refers to a sequence capable recognizing the capture sequence, and usually, the captured sequence is reverse complementary with the capture sequence to capture nucleic acid molecules.
It is required to input a large input amount of cells when performing single-cell library construction and sequencing based on a droplet microfluidic platform. In order to solve such a problem, in the present disclosure, a plurality of microbeads can be encapsulated in one droplet during the preparation of droplets, and sequencing reads in these microbeads from one droplet are then determined to improve the utilization of cells.
According to an embodiment of the present disclosure, the droplet may contain a biological material, a droplet identification molecule, and a first vector. The biological material contains the nucleic acid molecules. The droplet identification molecule carries a droplet index sequence. The first vector carries a capture sequence and a cell index sequence. The capture sequence is configured to capture at least one of the nucleic acid molecule and the droplet identification molecule. The first vector may further carry an amplification recognition sequence.
According to an embodiment of the present disclosure, the droplet identification molecule in the droplet can be obtained by means of DNB technology, as illustrated in
The droplet identification molecule obtained by means of DNB technology is provided in the form of single strand, but the endonucleases recognize a double-stranded nucleic acid molecule. In this regard, the oligo-stranded nucleotide capable of anchoring to the endonuclease recognition sequence can then be hybridized with the above endonuclease recognition sequence, which is convenient for subsequent digestion with the endonuclease, thereby obtaining a large number of identical droplet identification molecules.
In addition, the DNA nanoball and the biological material can be pre-mixed, the vector and the endonuclease can be pre-mixed, and then droplet encapsulation can be performed using a conventional droplet microfluidic platform. The DNA nanoball is fragmented into small fragments under the action of restriction endonuclease. The small fragments are captured by the vectors (such as microbeads) with polyT, and the vectors from one droplet will capture the same droplet index sequences. As illustrated in
According to an embodiment of the present disclosure, the concentration of DNA nanoballs is 105 to 108 copies per microliter in such a manner that a single droplet contains at least one DNA nanoball. Under this concentration condition, most of the single droplets contain one DNA nanoball; and a few of the single droplets contain two or more DNA nanoballs. In this case, multiple magnetic beads present in one droplet can capture two types of droplet index sequences, and multiple magnetic beads present in other droplets can capture other droplet index sequences. In combination with the correlation between encapsulation of multiple nanoballs and capture of multiple magnetic beads in the droplet, it is possible to calculate which magnetic beads are from one droplet.
According to an embodiment of the present disclosure, the droplet identification molecule in the droplet may be provided in a form of a vector, which is referred to as a second vector in order to be distinguished from the first vector carrying the cell index sequence. That is, the droplet identification molecule may be provided in the form of the second vector, and the second vector carries a plurality of droplet identification molecules. Each of the plurality of droplet identification molecules may be connected to the second vector by a covalent bond or other means. Each droplet identification molecule, in addition to carrying the droplet index sequence, may further contain the captured sequence, and the molecule captured sequence is connected to the droplet index sequence. The droplet identification molecule can be connected to the vector through a covalent bond, for example, a disulfide bond. Thus, some covalent bond cleavage reagents, such as DTT, may be subsequently used to break the covalent bond and release the droplet identification molecule, thereby facilitating capture by the capture sequence carried on the first vector. Alternatively, the second vector can be a hydrogel microparticle, and the plurality of droplet identification molecules can be embedded in the hydrogel microparticle, and the hydrogel can be melted under suitable reaction conditions to release the droplet identification molecules.
According to an embodiment of the present disclosure, generally speaking, the applicant second vector may be a magnetic bead, and the size of the magnetic bead may generally be smaller than that of the first vector. The second vector carries a plurality of identical droplet index sequences. When droplets are formed subsequently, the covalent bond cleavage reagent in the droplet can destroy the covalent connections between the droplet index sequences and the second vector, without affecting the hydrogen bond connections between nucleic acid molecules, thereby releasing a large number of droplet index sequences in the droplet. The large number of droplet index sequences released can be captured by the first vector, and thus the vectors from one droplet will capture the same droplet index sequences. As illustrated in
Then, the conventional droplet microfluidic technology is used to perform demulsification, followed by reverse transcription reaction, enzyme digestion of empty oligonucleotides on the surface of the vector, cDNA amplification, library construction, sequencing and analysis, thereby completing single-cell sequencing.
The solutions of the present disclosure will be explained below in conjunction with examples. Those skilled in the art can understand that the following examples are only used to illustrate the present disclosure, but they should not be construed as limiting the scope of the present disclosure. The specific technique or condition indicated in the examples shall be that described in the literature in the related art or in the specification of used product, unless specifically indicated. The reagents or instruments used without indication of the manufacturers are the conventional products that can be purchased.
Example 1 provides a method for preparing a sequencing library and performing high-throughput sequencing. The provided method is implemented through several steps, including: DNA nanoball preparation, single cell suspension preparation, microbead preparation, droplet generation, demulsification, reverse transcription RT reaction, enzyme digestion, cDNA amplification, fragmentase library construction, high-throughput sequencing, etc.
1. Preparation of DNA Nanoballs
Referring to
1.1 Primer Sequence Synthesis
Artificial synthesis of the following sequence:
DNB oligo sequence:
AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA
GGTCT
-3′
Explanation: UMI digestion site separated and located at two ends of the sequence (which will be connected after cyclization)+a number of protecting bases for restriction digestion at the two ends of the digestion site+PolyT sequence (forming PolyA sequence after forming the DNB)+fixed sequence+DNB UMI+PCR adapter sequence (because it cannot be interrupted for library construction, the adapter can be identified and amplified during Sample index amplification).
Specifically, “CTAATA” and “GGTCT” shown in bold with single underline in the above sequence represent the digestion site of BsaI restriction endonuclease, which is separated and located the two ends of the sequence (to be connected with each other after cyclization). “ATACAATA” and “AGATA” denoted with the dotted line in the above sequence are protecting bases for restriction digestion, and for improving the efficiency of restriction digestion. In the above sequence, “TTTTTTTTTTTTTTTTTTTTTV” is synthesized into the PolyA sequence after making DNB, and the PolyA sequence can be complementary to and thus be captured by the oligonucleotide sequence on the magnetic bead. The 10 nt bases “N” in the sequence represent a random sequence for labeling the droplet (i.e., the droplet index sequence as mentioned above), and each DNB carries a different index sequence. The “AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA” denoted with double-underline in the above sequence is a PCR adapter, which is complementary to the library adapter PCR primer for amplification during library construction.
Splint oligo: 5′-GTATTATTAGAGACCTATCT-3′. The Splint oligo is a cyclization complementary primer.
Digestion site complementary sequence (Digestion site complementary oligo):
Explanation: 5′-end and 3′-end of the synthesized DNB-oligo sequence contain the digestion site sequences to be cyclized and spliced together to form a complete digestion site, thereby forming a DNB-oligo ring. Then, the formed DNB-oligo ring is used for rolling circle replication and amplification to form DNBs, the synthesized single strand is a complementary strand of the DNB-oligo ring, and then the complementary sequence of the digestion site is added. Therefore, the complementary sequence is consistent with the sequences at the two ends of the original oligo.
1.2 Single-Stranded DNB Oligo Cyclization
a. 200 to 400 ng of DNB oligo sequences was placed into a new 0.2 ml PCR tube and the tube was added with TE Buffer (Cat. No. AM9849) to a total volume of 47 μl.
b. 3.0 μl of 20 μM Splint oligo was added, mixed and centrifuged briefly to precipitate to the bottom of the tube.
c. The tube was placed in a PCR amplifier and incubated at 95° C. for 3 minutes.
d. Immediately after the reaction, the PCR tube was transferred to ice and stood for 5 minutes.
e. A single-strand cyclization reaction solution was prepared on ice: 3.2 μl of TE Buffer, 6 μl of 10×TA buffer (Cat. No. Y038), 0.6 μl of 100 mM ATP (Cat. No. R1441), and 0.2 μl of 600 U/μl T4 DNA Ligase (Cat. No.: BGE004).
f. 10 μl of the prepared single-strand cyclization reaction solution was pipetted into the above PCR tube, mixed by vortex, and centrifuged briefly to precipitate the reaction solution to the bottom of the tube.
g. The PCR tube was placed on the PCR amplifier, incubated at 37° C. for 30 minutes, and thermally covered at 75° C.
h. A digestion reaction solution was prepared on ice: 1.0 μl of TE Buffer, 0.4 μl of 10×TA buffer, 1.95 μl of 20 U/μl EXO I (Cat. No. 01E00MS), and 0.65 μl of 100 U/μl EXO III (Cat. No. 01E011HS).
i. 4 μl of the digestion reaction solution was pipetted into the single-stand cyclization product, mixed by vortex, and centrifuged briefly to precipitate the reaction solution to the bottom of the tube.
j. The tube was placed in the PCR amplifier, incubated at 37° C. for 30 minutes, and thermally covered at 75° C. The single-stranded oligonucleotide strands, which were not cyclized, were digested and degraded by the digestion reaction solution.
k. After completion of the reaction, 3 μl of 0.5M EDTA (Cat. No.: AM9260) was added, mixed well and centrifuged.
l. 90 μl of PEG32 (Cat. No.: Y041) magnetic beads was used to recover the above digestion products, 32 μl of TE Buffer was used to elute the DNAs, and the concentration of single-stranded product was detected with Qubit® ssDNA Assay Kit (Cat. No.: Q10212).
1.3 RCA and digestion site hybridization reaction
a. The following reaction system was prepared with make DNB kit (Cat. No. 1000012552) on ice: 4 μl of single-stranded product ssDNA (10 ng), 4 μl of 10× Phi29 Buffer, 1.0 μl of 20 μM Splint oligo, 16 μl of TE Buffer, and 15 μl of H2O.
b. 40 μl of the above reaction mixture was evenly mixed with a vortex shaker and centrifuged in a mini centrifuge for 5 s.
c. The tube was placed in the PCR amplifier, incubated 95° C. for 1 min, 65° C. for 1 min, and 40° C. for 1 min, the thermal cover at 105° C.
d. DNB polymerase mixture solution II (LC) was taken, centrifuged briefly for 5 s, and stored in an ice box for later use.
e. After completion of the reaction in step c, the PCR tube was taken out and added with 40 μl of make DNB enzyme Mix and 4 μl of make DNB enzyme Mix II to the tubes while being placed on ice.
f. The mixture was evenly mixed with a vortex shaker, and centrifuged for 5 s in a mini centrifuge.
g. The tube was placed in the PCR amplifier, incubated at 30° C. for 20 minutes, the task was terminated immediately when the temperature dropped to 4° C.; the PCR tube was transferred to the ice box, added with 20 μl of DNB stop buffer, and slowly mixed 5-8 times with a flaring pipette, without shaking or centrifuging.
h. The DNB concentration was measured using the Qubit® ssDNA Assay Kit.
i. 20 μl of the above reaction product, DNBs, was added into a new PCR tube, and 10 μl of 10 μM Digestion site complementary oligo, 10 μl of 10× Cutsmart buffer (Cat. No.: B7204S), and 60 μl of H2O were added and gently pipetted 5-8 times, without shaking and centrifuging.
j. The tube was placed in the PCR amplifier, incubated at 55° C. for 2 minutes, 40° C. for 2 minutes, 30° C. for 2 minutes, 20° C. for 2 minutes, 10° C. for 2 minutes, and 4° C. for 2 minutes.
Explanation: this process is the annealing binding of primers complementary to the digestion sites. Generally, the complementary primers on the DNB are at 55° C. during sequencing by the sequencer, and thus 55° C. gradient annealing strategy was adopted.
k. 10 μl of the above product was added into a new PCR tube, and 90 μl of EB buffer was added for quantitative dilution, and the mixture was placed on ice for later use.
2. Preparation of Single Cell Suspension
2.1 Single cell suspensions for 293T cell line and NIH3T3 cell line were prepared by trypsin digestion, washed with PBS (Cat. No.: 10010031) (containing 0.04% BSA) 1-2 times, and filtrated with 40 μm cell sieve.
2.2 The cell concentration was detected with a cell counting plate or counter.
2.3 Based on the cell concentration, 20,000 cells were taken through pipette each time, and the cell pellet was collected after centrifugation at 300-500 g, and 100 μl of Cell Resuspension Buffer was added to resuspend the cells.
2.4 Before loading the sample, 10 μl of the DNB product obtained in step k was added in the above step 1.3 to the Cell Resuspension Buffer, mixed evenly with a flaring pipette tip, and placed on ice for later sample loading.
3. Preparation of Microbeads
3. Microbead Preparation
3.1 With reference to the article published by BGI about stLFR magnetic bead preparation method (Efficient and unique co-barcoding of second-generation sequencing reads from long DNA molecules enabling cost effective and accurate sequencing, haplotyping, and de novo assembly, https://genome.cshlp.org/content/early/2019/04/02/gr.245126.118), magnetic beads (purchased from Spherotech, USA, Cat. No.: SVM-200-4, https://www.spherotech.com/coa_mag_par.htm) were subjected to surface oligonucleotide coating to obtain magnetic beads with oligonucleotides on the surface. 200 μl of the magnetic beads (220,000) were pipetted and added into 0.2 ml PCR tube, placed on a magnetic stand for 2 min, and the supernatant was removed.
3.2 The PCR tube was removed from the magnetic stand, and added with 200 μl of 1× Buffer D (1 mM EDTA, 9 mg/ml 85% KOH) to suspend the magnetic beads.
3.3 The tube was incubated at room temperature for 5 min.
3.4 The tube was placed on the magnetic stand for 2 min, and the supernatant was removed.
3.5 The PCR tube was kept on the magnetic stand, added with 200 μl of 1× Buffer D, stood for 30 s, and the supernatant was removed.
3.6 200 μl of LSWB was added and stood for 30 s, and then the supernatant was removed.
3.7 The previous step repeated.
3.8 200 μl of Lysis Buffer (6% Ficoll PM-400 (Cat. No.: 17-0300-10), 0.2% Sarkosyl (Cat. No.: L7414), 20 mM EDTA, 200 mM Tris pH 7.5 (Cat. No.: T2944-1L), H2O) was added and stood for 30 s, and then the supernatant was removed. The PCR tube was removed from the magnetic stand, added with 100 μl of Lysis Buffer and 5.5 μl of 1M DTT, and finally added with 4.5 μl of BsaI (Cat. No.: R0535S) restriction endonuclease. The magnetic beads were suspended with a low adsorption pipette tip on ice.
4. Droplet Generation
4.1 A protective film on a surface of a chip was teared off, and the chip was placed in a chip slot region of a droplet generator. The chip has a structure as illustrated in
4.2 An A-end of a connection tube on a collection cap (contacting the connection tube at the bottom of the collection tube) was placed into an outlet hole of the chip.
4.3 A 50 ml syringe was placed on a fixing holder and the push rod was pushed to an initial position. A blunt-end syringe needle was used to connect the syringe with the B-end of the connecting tube on the cap of the collection tube (without contacting the connecting tube at the bottom of the collection tube).
4.4 200 μl of droplet generation oil was added to the collection tube, the collection cap was tightened, and the collection tube was placed upright on the fixing holder.
4.5 The cells were evenly mixed through gentle pipetting, and 100 μl of the single cell suspension (obtained in step 2 above) was added to the cell well of the chip, under the premise that the pipette tip touched the bottom of the well.
4.6 The magnetic beads were evenly mixed through gentle pipetting, and 100 μl of magnetic beads (obtained in step 3 above) were added to the bead well of the chip, under the premise that the pipette tip touched the bottom of the well.
4.7 350 μl of the droplet generation oil was immediately added to the oil well of the chip.
4.8 The push rod of the syringe was quickly pulled to the slot position, and the push rod was clamped at the slot.
4.9 A timer was activated for 8 min and the droplets were collected.
4.10 After 8 minutes, the collection cap on the collection tube was immediately unscrewed. The connection tube of the outlet hole of the chip was pulled out, and the connection tube was stretched vertically. The droplets in the tube flow into the collection tube, and then an ordinary collection tube cap was used for replacement.
4.11 The collection tube stood still at room temperature for 20 min to fully bind mRNA molecules to the magnetic beads.
5. Demulsification
5.1 In order to prepare demulsification reagent, 10 ml of 6×SSC (Cat. No. 15557-036) and 200 μl of PFO (Cat. No. 370533-25G) were added to a 15 ml centrifuge tube.
5.2 The filter device and the vacuum pump were connected, the pressure parameter was adjusted to 0.01 MPa or 100 mbar, and the vacuum pump was turned on.
5.3 20 ml of 6×SSC was added to pretreat the device.
5.4 When no liquid remained on the filter membrane, all the liquids in the collection tube were evenly poured on the surface of the filter membrane, the collection tube was washed twice with 2 ml of 6×SSC, and the cleaning solutions were together poured into the filter device.
5.5 10 ml of demulsification reagent was vigorously inverted and mixed and then poured into the filter device quickly.
5.6 When no liquid remained on the filter membrane, 30 ml of 6×SSC was continuously added to wash the magnetic beads.
5.7 When no liquid remained on the filter membrane, the vacuum pump was turned off and the vacuum pump from the filter device were disconnected.
5.8 The filter port of the filter device was closed with a syringe or rubber stopper.
5.9 1.0 ml of collection buffer was added with a pipette, and the entire surface of the filter membrane was subjected to about 20 times of gentle pipetting to suspend the magnetic beads.
5.10 The collection solution containing the magnetic beads was transferred to a 1.5 ml low adsorption centrifuge tube.
5.11 1.0 ml of collection buffer was added with a pipette, and the entire surface of the filter membrane was subjected about 10 times of gentle pipetting to suspend the remaining magnetic beads.
5.12 The collection solution containing magnetic beads was transferred to a 1.5 ml low-adsorption centrifuge tube, and the tube was placed on a magnetic stand and stood still for 2 min, and the supernatant was slowly removed.
5.13 The centrifuge tube was removed from the magnetic stand. 100 μl of collection buffer was used to suspend the magnetic beads adsorbed on one side of the two centrifuge tubes in turn, and the liquid was transferred to 0.2 ml low adsorption PCR tube.
5.14 100 μl of collection buffer was used to suspend the magnetic beads adsorbed on one side of the two centrifuge tubes again, and the liquid was transferred to the above-mentioned 0.2 ml low adsorption PCR tube.
5.15 The PCR tube with magnetic beads was placed on the magnetic stand and stood still for 2 min, and then the supernatant was removed.
5.16 The magnetic beads were kept in the adsorbed state, 200 μl of 6×SSC was added and stood still for 30 s, and then the supernatant was removed.
5.17 200 μl of 5×FS Buffer was added and stood still for 30 s, and the supernatant was slowly removed to avoid attracting magnetic beads.
6. Reverse Transcription Reaction
6.1 Reverse transcription reaction system was prepared on ice: 5 μl of H2O, 20 μl of 5× First-Strand Buffer (Cat. No.: 01E022MS), 20 μl of 5M Betaine (Cat. No.: B0300-1VL), 10 μl of 10 mM dNTPs (Cat. No.: N0447L), 7.5 μl of 100 mM MgCl2 (Cat. No. 20-303), 5 μl of 50 μM Template switch oligo, 5 μl of 100 mM DTT (Cat. No. 01E022MS), 5 μl of 200 U/μl Alpha reverse transcriptase (Cat. No. 01E022MS), and 2.5 μl of 40 U/μl RNase inhibitor (Cat. No. 01E019MS).
The above-mentioned Alpha reverse transcriptase is an engineered MMLV reverse transcriptase, which can recognize ssDNA as a template for complementary synthesis.
6.2 100 μl of the reverse transcription reaction system was pipetted and added to the PCR tube containing magnetic beads, and mixed by repeatedly pipetting.
6.3 Reverse transcription reaction was performed according to the following conditions: 42° C., 90 min; and 10 cycles (50° C., 2 min; 42° C., 2 min), with thermal cover at 75° C. Due to the sedimentation of the magnetic beads, the magnetic beads were evenly mixed through gentle pipetting every 20 min, and the reaction continued after a brief centrifugation.
6.4 After completion of the reaction, the tube was centrifuged briefly, placed on the magnetic stand, stood still for 2 min, and the reaction solution was removed.
6.5 The PCR tube was removed from the magnetic stand, 200 μl of TE-SDS was added and shaken to evenly mix, and the reaction was terminated.
6.6 After a brief centrifugation, the tube was placed on the magnetic stand, stood still for 2 min, and then the liquid was removed.
6.7 The magnetic beads were kept in the adsorbed state, 200 μl of TE-TW was added, and the mixture stood still for 30 s, and then the supernatant was removed.
6.8 The previous step repeated.
6.9 The magnetic beads were kept in the adsorbed state, 200 μl of 10 mM Tris (pH8.0) was added, and the mixture stood still for 30 s, and then the supernatant was removed.
7. Digestion of Empty Oligos Failing to Capture mRNA Molecules on Surfaces of Microbeads
7.1 Digestion reaction system: 170 μl of H2O, 20μl of 10×EXO I Buffer, and 10p of EXO I enzyme.
7.2 200 μl of the digestion reaction system was pipetted and added to the PCR tube containing magnetic beads, and evenly mixed by vortex.
7.3 After brief centrifugation, the tube was placed in a PCR amplifier, and incubated at 37° C. for 45 min, with thermal cover at 75° C. The magnetic beads were evenly mixed through gentle pipetting every 15 min, and the reaction continued after brief centrifugation.
7.4 After completion of the reaction, the tube was centrifuged briefly, placed on the magnetic stand, stood still for 2 min, and the reaction solution was removed.
7.5 The PCR tube was removed from the magnetic stand, 200 μl of TE-SDS was added and shaken to evenly mix, and the reaction was terminated
7.6 After brief centrifugation, the tube was placed on a magnetic stand, stood still for 2 min, and then the liquid was removed.
7.7 The magnetic beads were kept in the adsorbed state, 200 μl of TE-TW was added, and the mixture stood still for 30 s, and then the supernatant was removed.
7.8 The PCR tube was removed from the magnetic stand, 200 μl of TE-TW was added to suspend the magnetic beads.
7.9 After brief centrifugation, the tube was placed on the magnetic stand, stood still for 2 min, and then the liquid was removed.
7.10 The magnetic beads were kept in the adsorbed state, 200 μl of H2O was added, and the mixture stood still for 30 s, and then the supernatant was removed.
8. cDNA Amplification
8.1 A PCR reaction system was prepared: 41 μl of H2O, 8 μl of 10 μM Tn Primer, 2 μl of 1 μM reverse primer, 50 μl of 2×KAPA HiFi Hotstart Ready mix (Cat. No.: KK2602).
8.2 PCR reaction was performed according to the following conditions: 95° C., 3 min; 13 to 20 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 3 min).
8.3 After the completion of PCR, the PCR product was purified and recovered by using 60 μl of (0.6×) AMPure XP Beads (Cat. No.: A63881) (pre-equilibrated at room temperature for 30 minutes), the oligo small fragment product was recovered in the supernatant by using 200 μl of (2×) AMPure XP beads, and the concentration was detected by using Qubit dsDNA HS Kit (Cat. No. Q32854).
8.4 A DNB-Oligo purified product secondary amplification PCR reaction system was prepared: 141 μl of H2O, 2 μl of 10 μM V4-Phos-Tn-C Primer, 2 μl of 10 μM V2-N7-index-n Primer, 25 μl of 2×KAPA HiFi Hotstart Ready mix, and 10 μl of DNB-Oligo purified product obtained in step 8.3.
8.5 PCR reaction was performed according to the following conditions: 95° C., 3 min; 6 to 10 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 15 s).
8.6 The oligo secondary amplification product was recovered by using 200 μl of (2×) AMPure XP beads, and the concentration was detected using the Qubit dsDNA HS Kit.
9. Fragmentase Library Construction
9.1 The fragmentase was taken and evenly mixed by shaking for 5 s, and the tube was centrifuged briefly and placed on ice for later use.
9.2 50 to 300 ng of cDNAs to be interrupted was added into a new 0.2 ml PCR tube, a volume thereof ≤16 μl, and added with H2O to 16 μl.
9.3 4.0 μl of the prepared fragmentation reaction solution (2 μl fragmentase (Cat. No.: M0348L) and 2 μl of 10× fragmentase buffer (Cat. No.: B0349) were pipetted and added into the cDNA tube, and mixed by vortex for 3 times, 3 s each time, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.4 The PCR tube was placed on the PCR amplifier and incubated at 37° C. for 10 min.
9.5 30 μl of 0.1M EDTA was added to the PCR tube, evenly mixed by vortex, and the reaction was terminated.
9.6 The reaction solution was collected to the bottom of the tube through a brief centrifugation, and placed on ice.
9.7 Fragment selection was performed on the fragmentation product by using 0.6×+0.4× (i.e., 30 μl+20 μl) AMPure XP beads, and the DNAs were eluted with 42 μl of H2O.
9.8 End repair reaction solution was prepared on ice: 2.3 μl of H2O, 5 μl of 10×PNK buffer (Cat. No. B9040L), 1.2 μl of 5:1 dATP: dNTP mix, 0.6 μl of 10 U/μl T4 Polynucleotide Kinase (Cat. No. Y9040L), 0.6 μl of 3 U/μl T4 DNA polymerase (Cat. No. P7080L), 0.2 μl of 5 U/μl rTaq (Cat. No. R500Z), and 0.1 μl of 5 U/μl Klenow fragment (Cat. No. P7060L).
9.9 10 μl of the end repair reaction solution was pipetted and added into the selected fragmentation product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.10 The PCR tube was incubated on the PCR amplifier at 37° C. for 30 min, and at 65° C. for 15 min.
9.11 After completion of the reaction, the reaction solution was placed on ice.
9.12 An adapter ligation reaction solution was prepared on ice: 3.6 μl of H2O, 3 μl of 10×PNK buffer, 5 μl of 10 μM Adapters mix, 0.8 μl of 100 mM ATP (Cat. No. R1441), 16 μl of 50% PEG 8000 (Cat. No. EB-0.5P8K-250), and 1.6 μl of 600 U/μl T4 DNA Ligase (Cat. No. BGE004).
9.13 30 μl of the prepared adapter ligation reaction solution was slowly pipetted and added to the end repair product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.14 The PCR tube was placed on the PCR amplifier and incubated at 23° C. for 60 min.
9.15 After completion of the reaction, 20 μl of TE Buffer was added to make the total sample volume to reach 100p.
9.16 The ligation product was purified and recovered by using 50p of AMPure XP Beads, and the ligation product was eluted by using 48 μl of H2O.
9.17 2 μl of 10 μM PCR Primer and 50 μl of 2×KAPA HiFi Hotstart Ready mix were added and evenly mixed by shaking.
9.18 PCR reaction was performed according to the following conditions: 95° C., 3 min; 11 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 30 s).
9.19 After completion of PCR, the PCR product was screened by using 0.6x+0.2× (i.e., 60 μl+20 μl) AMPure XP Beads, DNAs were eluted using 42 μl of TE Buffer, and the concentration was detected using Qubit dsDNA HS Kit.
10. High-Throughput Sequencing
10.1 A total of 200 to 400 ng of the library was added into a new 0.2 ml PCR tube, where a pooling ratio of the PCR product of cDNAs of the same sample after fragmentation and the oligo secondary PCR product was 9:1 (or, separate cyclization and then pooling). TE Buffer was added to reach a total volume of 47 μl.
10.2 3.0 μl of 20 μM Splint Oligo primer was added and evenly mixed, and centrifuged briefly to precipitate to the bottom of the tube.
10.3 The tube was placed in a PCR amplifier and incubated at 95° C. for 3 min.
10.4 Immediately after completion of the reaction, the PCR tube was transferred onto ice and stood still for 5 min.
10.5 A single strand cyclization reaction solution was prepared on ice: 3.241 of TE Buffer, 6 μl of 10× TA buffer, 0.6 μl of 100 mM ATP, and 0.241 of 600 U/μl T4 DNA Ligase.
10.6 10 μl of the prepared single strand cyclization reaction solution was pipetted and added into the above PCR tube, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
10.7 The PCR tube was placed on the PCR amplifier and incubated at 37° C. for 30 min.
10.8 The digestion reaction solution was prepared on ice: 1.0 μl of TE Buffer, 0.4 μl of 10×TA buffer, 1.95 μl of 20 U/μl EXO I, and 0.65 μl of 100 U/μl EXO III.
10.9 4 μl of the digestion reaction solution was pipetted and added to the single strand cyclization product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
10.10 The tube was placed on the PCR amplifier and incubated at 37° C. for 30 min.
10.11 After completion of the reaction, 3 μl of 0.5M EDTA was added and mixed, and the mixture was centrifuged.
10.12 The above digestion product was recovered by using 90 μl of PEG32 magnetic beads, DNAs were eluted with 3241 of TE Buffer, and the concentration of single-stranded cyclic library was detected by using the Qubit® ssDNAAssay Kit.
10.13 The qualified library was sequenced. The sequencing parameters: 41+100+10.
The experimental product and library quality inspection result are as follows:
After sequencing analysis, the results are shown in Table 1 below and
Table 1 and
Example 2 provides a method for preparing a sequencing library and performing high-throughput sequencing. The provided method is implemented through several steps, including: barcode vector microbead preparation, single cell suspension preparation, microbead preparation, droplet generation, demulsification, reverse transcription RT reaction, enzyme digestion, cDNA amplification, fragmentase library construction, high-throughput sequencing, etc.
1. Preparation of Microbead Vectors Carrying Droplet Index Sequences
1.1 Coupling incubation of microbead vector oligonucleotides carrying droplet index sequences:
For each group, 200 pmol of modified droplet index sequence oligonucleotides were taken and incubated with 1 mg of Dynabeads™ M-280 Streptavidin magnetic beads at room temperature for 2 hours. After incubation, the magnetic beads were attracted to the magnetic stand and washed 3 times, and the magnetic beads were stored in low salt buffer. Buffer for incubation and washing of magnetic beads: (B&W) Buffer (1×) (5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 1M NaCl).
The used droplet index sequence oligonucleotides:
GCCTCCGACTT
[Tag2]
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′
The sequence denoted with single line represents a PCR adapter sequence, and the following 10 bases represent the droplet index sequence. A total of 12 types were used in this example, and the following sequence denoted with a wavy line represents random bases for optimizing a sequencing quality of the barcode region. The base B immediately following the random bases is a degenerate base, which may be G, C or T. The sequence denoted with double lines represents a polyA sequence, which is used to be captured by an oligonucleotide on another magnetic bead (i.e., the magnetic bead carrying the cell index sequence) in the droplet. The 5′-end of this oligonucleotide strand has Biotin medication and disulfide bond modification.
1.2 Mixing and Counting of Droplet Barcode Vector Microbeads
After 12 groups of barcode vector microbeads were prepared through incubation according to the above step, each group was mixed with an equal amount of magnetic beads, and the mixed barcode vector microbeads were counted for the last time to obtain the microbead concentration.
2. Preparation of Single Cell Suspension
2.1 Single cell suspension for 293T cell line was prepared by trypsin digestion, washed with PBS (Cat. No.: 10010031) (containing 0.04% BSA) 1-2 times, and filtrated with 40 μm cell sieve.
2.2 The cell concentration was detected with a cell counting plate or counter.
2.3 Based on the cell concentration, 20,000 cells were taken through pipette each time, and the cell pellet was collected after centrifugation at 300-500 g, and 100 μl of Cell Resuspension Buffer was added to resuspend the cells.
2.4 2.2 million mixed barcode vector microbeads obtained in the above step 1.2 were added to the Cell Resuspension Buffer before sample loading. The specific volume was determined according to the concentration. The mixture was placed on ice for sample loading.
3. Microbead Preparation
3.1 With reference to the literature published by BGI about a stLFR magnetic bead preparation method (Efficient and unique co-barcoding of second-generation sequencing reads from long DNA molecules enabling cost effective and accurate sequencing, haplotyping, and de novo assembly, https://genome.cshlp.org/content/early/2019/04/02/gr.245126.118), magnetic beads (purchased from Spherotech, USA, Cat. No.: SVM-200-4, https://www.spherotech.com/coa_mag_par.htm) were subjected to surface oligonucleotide coating to obtain magnetic beads with oligonucleotides on the surfaces thereof 200 μl of magnetic beads (220,000) were pipetted and added to into 0.2 ml PCR tube, placed on a magnetic stand for 2 min, and then the supernatant was removed.
3.2 The PCR tube was removed from the magnetic stand, and added with 200 μl of 1× Buffer D (1 mM EDTA, 9 mg/ml 85% KOH) to suspend the magnetic beads.
3.3 The tube was incubated at room temperature for 5 min.
3.4 The tube was placed on the magnetic stand for 2 min, and then the supernatant was removed.
3.5 The PCR tube was kept on the magnetic stand, added with 200 μl of 1× Buffer D, and stood still for 30 s to remove the supernatant.
3.6 200 μl of LSWB was added and stood for 30 s, and then the supernatant was removed.
3.7 The previous step repeated.
3.8 200 μl of Lysis Buffer (6% Ficoll PM-400 (Cat. No.: 17-0300-10), 0.2% Sarkosyl (Cat. No.: L7414), 20 mM EDTA, 200 mM Tris pH 7.5 (Cat. No.: T2944-1L), H2O) was added and stood for 30 s, and then the supernatant was removed. The PCR tube was removed from the magnetic stand, added with 99 μl of Lysis Buffer and 11 μl of 1M DTT to obtain a final concentration of 100 mM DTT in this buffer. The magnetic beads were suspended with a low adsorption pipette tip on ice.
4. Droplet Generation
4.1 A protective film on a surface of a chip was teared off, and the chip was placed in a chip slot region of a droplet generator. The chip has a structure as illustrated in
4.2 An A-end of a connection tube on a collection cap (contacting the connection tube at the bottom of the collection tube) was placed into an outlet hole of the chip.
4.3 A 50 ml syringe was placed on a fixing holder and the push rod was pushed to an initial position. A blunt-end syringe needle was used to connect the syringe with the B-end of the connecting tube on the cap of the collection tube (without contacting the connecting tube at the bottom of the collection tube).
4.4 200 μl of droplet generation oil was added to the collection tube, the collection cap was tightened, and the collection tube was placed upright on the fixing holder.
4.5 The cells were evenly mixed through gentle pipetting, and 100 μl of the single cell suspension (obtained in step 2 above) was added to the cell well of the chip, under the premise that the pipette tip touched the bottom of the well.
4.6 The magnetic beads were evenly mixed through gentle pipetting, and 100 μl of magnetic beads (obtained in step 3 above) were added to the bead well of the chip, under the premise that the pipette tip touched the bottom of the well.
4.7 350 μl of the droplet generation oil was immediately added to the oil well of the chip.
4.8 The push rod of the syringe was quickly pulled to the slot position, and the push rod was clamped at the slot.
4.9 A timer was activated for 8 min and the droplets were collected.
4.10 After 8 minutes, the collection cap on the collection tube was immediately unscrewed. The connection tube of the outlet hole of the chip was pulled out, and the connection tube was stretched vertically. The droplets in the tube flow into the collection tube, and then an ordinary collection tube cap was used for replacement.
4.11 The collection tube stood still at room temperature for 20 min to fully bind mRNA molecules to the magnetic beads.
5. Demulsification
5.1 In order to prepare demulsification reagent, 10 ml of 6×SSC (Cat. No. 15557-036) and 200 μl of PFO (Cat. No. 370533-25G) were added to a 15 ml centrifuge tube.
5.2 The filter device and the vacuum pump were connected, the pressure parameter was adjusted to 0.01 Mpa or 100 mbar, and the vacuum pump was turned on.
5.3 20 ml of 6×SSC was added to pretreat the device.
5.4 When no liquid remained on the filter membrane, all the liquids in the collection tube were evenly poured on the surface of the filter membrane, the collection tube was washed twice with 2 ml of 6×SSC, and the cleaning solutions were together poured into the filter device.
5.5 10 ml of demulsification reagent was vigorously inverted and mixed and then poured into the filter device quickly.
5.6 When no liquid remained on the filter membrane, 30 ml of 6×SSC was continuously added to wash the magnetic beads.
5.7 When no liquid remained on the filter membrane, the vacuum pump was turned off and the vacuum pump from the filter device were disconnected.
5.8 The filter port of the filter device was closed with a syringe or rubber stopper.
5.9 1.0 ml of collection buffer was added with a pipette, and the entire surface of the filter membrane was subjected to about 20 times of gentle pipetting to suspend the magnetic beads.
5.10 The collection solution containing the magnetic beads was transferred to a 1.5 ml low adsorption centrifuge tube.
5.11 1.0 ml of collection buffer was added with a pipette, and the entire surface of the filter membrane was subjected about 10 times of gentle pipetting to suspend the remaining magnetic beads.
5.12 The collection solution containing magnetic beads was transferred to a 1.5 ml low-adsorption centrifuge tube, and the tube was placed on a magnetic stand and stood still for 2 min, and the supernatant was slowly removed.
5.13 The centrifuge tube was removed from the magnetic stand. 100 μl of collection buffer was used to suspend the magnetic beads adsorbed on one side of the two centrifuge tubes in turn, and the liquid was transferred to 0.2 ml low adsorption PCR tube.
5.14 100 μl of collection buffer was used to suspend the magnetic beads adsorbed on one side of the two centrifuge tubes again, and the liquid was transferred to the above-mentioned 0.2 ml low adsorption PCR tube.
5.15 The PCR tube with magnetic beads was placed on the magnetic stand and stood still for 2 min, and then the supernatant was removed.
5.16 The magnetic beads were kept in the adsorbed state, 200 μl of 6×SSC was added and stood still for 30 s, and then the supernatant was removed.
5.17 200 μl of 5×FS Buffer was added and stood still for 30 s, and the supernatant was slowly removed to avoid attracting magnetic beads.
6. Reverse Transcription Reaction
6.1 Reverse transcription reaction system was prepared on ice: 5 μl of H2O, 20 μl of 5× First-Strand Buffer (Cat. No.: 01E022MS), 20 μl of 5M Betaine (Cat. No.: B0300-1VL), 10 μl of 10 mM dNTPs (Cat. No.: N0447L), 7.5 μl of 100 mM MgCl2 (Cat. No. 20-303), 5 μl of 50 μM Template switch oligo, 5 μl of 100 mM DTT (Cat. No. 01E022MS), 5 μl of 200 U/μl Alpha reverse transcriptase (Cat. No. 01E022MS), and 2.5 μl of 40 U/μl RNase inhibitor (Cat. No. 01E019MS).
The above-mentioned Alpha reverse transcriptase is an engineered MMLV reverse transcriptase, which can recognize ssDNA as a template for complementary synthesis.
6.2 100 μl of the reverse transcription reaction system was pipetted and added to the PCR tube containing magnetic beads, and mixed by repeatedly pipetting.
6.3 Reverse transcription reaction was performed according to the following conditions: 42° C., 90 min; and 10 cycles (50° C., 2 min; 42° C., 2 min), with thermal cover at 75° C. Due to the sedimentation of the magnetic beads, the magnetic beads were evenly mixed through gentle pipetting every 20 min, and the reaction continued after a brief centrifugation.
6.4 After completion of the reaction, the tube was centrifuged briefly, placed on the magnetic stand, stood still for 2 min, and the reaction solution was removed.
6.5 The PCR tube was removed from the magnetic stand, 200 μl of TE-SDS was added and shaken to evenly mix, and the reaction was terminated.
6.6 After a brief centrifugation, the tube was placed on the magnetic stand, stood still for 2 min, and then the liquid was removed.
6.7 The magnetic beads were kept in the adsorbed state, 200 μl of TE-TW was added, and the mixture stood still for 30 s, and then the supernatant was removed.
6.8 The previous step repeated.
6.9 The magnetic beads were kept in the adsorbed state, 200 μl of 10 mM Tris (pH8.0) was added, and the mixture stood still for 30 s, and then the supernatant was removed.
7. Digestion of Empty Oligos Failing to Capture mRNA Molecules on Surfaces of Microbeads
7.1 Digestion reaction system: 170 μl of H2O, 20 μl of 10×EXO I Buffer, and 10 μl of EXO I enzyme.
7.2 200 μl of the digestion reaction system was pipetted and added to the PCR tube containing magnetic beads, and evenly mixed by vortex.
7.3 After brief centrifugation, the tube was placed in a PCR amplifier, and incubated at 37° C. for 45 min, with thermal cover at 75° C. The magnetic beads were evenly mixed through gentle pipetting every 15 min, and the reaction continued after brief centrifugation.
7.4 After completion of the reaction, the tube was centrifuged briefly, placed on the magnetic stand, stood still for 2 min, and the reaction solution was removed.
7.5 The PCR tube was removed from the magnetic stand, 200 μl of TE-SDS was added and shaken to evenly mix, and the reaction was terminated
7.6 After brief centrifugation, the tube was placed on a magnetic stand, stood still for 2 min, and then the liquid was removed.
7.7 The magnetic beads were kept in the adsorbed state, 200 μl of TE-TW was added, and the mixture stood still for 30 s, and then the supernatant was removed.
7.8 The PCR tube was removed from the magnetic stand, 200 μl of TE-TW was added to suspend the magnetic beads.
7.9 After brief centrifugation, the tube was placed on the magnetic stand, stood still for 2 min, and then the liquid was removed.
7.10 The magnetic beads were kept in the adsorbed state, 200 μl of H2O was added, and the mixture stood still for 30 s, and then the supernatant was removed.
8. cDNA Amplification
8.1 A PCR reaction system was prepared: 46 μl of H2O, 4 μl of 10 μM Tn Primer, and 50 μl of 2×KAPA HiFi Hotstart Ready mix (Cat. No.: KK2602).
8.2 PCR reaction was performed according to the following conditions: 95° C., 3 min; 13 to 20 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 3 min).
8.3 After the completion of PCR, the PCR product was purified and recovered by using 60 μl of (0.6×) AMPure XP Beads (Cat. No.: A63881) (pre-equilibrated at room temperature for 30 minutes), the oligo small fragment product was recovered in the supernatant by using 200 μl of (2×) AMPure XP beads, and the concentration was detected by using Qubit dsDNA HS Kit (Cat. No. Q32854).
8.4 A droplet molecular barcode purification product secondary amplification PCR reaction system was prepared: 11 μl of H2O, 2μl of 10 μM V4-Phos-Tn-C Primer, 2 μl of 10 μM V2-N7-index-n Primer, 25 μl of 2×KAPA HiFi Hotstart Ready mix, and 10 μl of oligo small fragment purification product of step 8.3.
8.5 PCR reaction was performed according to the following conditions: 95° C., 3 min; 6 to 10 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 15 s).
8.6 The oligo secondary amplification product was recovered by using 200 μl of (2×) AMPure XP Microbeads, and the concentration was detected using the Qubit dsDNA HS Kit.
9. Fragmentase Library Construction
9.1 The cDNA product was subjected to the following library construction procedures: taking out the fragmentase, shaking and mixing for 5 s, centrifuging briefly, and placing on ice for later use.
9.2 50 to 300 ng of cDNAs to be interrupted was added into a new 0.2 ml PCR tube, a volume thereof ≤16 μl, and added with H2O to 16 μl.
9.3 4.0 μl of the prepared fragmentation reaction solution (2 μl fragmentase (Cat. No.: M0348L) and 2 μl of 10× fragmentase buffer (Cat. No.: B0349) were pipetted and added into the cDNA tube, and mixed by vortex for 3 times, 3 s each time, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.4 The PCR tube was placed on the PCR amplifier and incubated at 37° C. for 10 min.
9.5 30 μl of 0.1M EDTA was added to the PCR tube, evenly mixed by vortex, and the reaction was terminated.
9.6 The reaction solution was collected to the bottom of the tube through a brief centrifugation, and placed on ice.
9.7 Fragment selection was performed on the fragmentation product by using 0.6×+0.4× (i.e., 30 μl+20 μl) AMPure XP beads, and the DNAs were eluted with 42 μl of H2O.
9.8 End repair reaction solution was prepared on ice: 2.3 μl of H2O, 5 μl of 10×PNK buffer (Cat. No. B9040L), 1.2 μl of 5:1 dATP: dNTP mix, 0.6 μl of 10 U/pI T4 Polynucleotide Kinase (Cat. No. Y9040L), 0.6 μl of 3 U/μl T4 DNA polymerase (Cat. No. P7080L), 0.2 μl of 5 U/μl rTaq (Cat. No. R500Z), and 0.1 μl of 5 U/μl Klenow fragment (Cat. No. P7060L).
9.9 10 μl of the end repair reaction solution was pipetted and added to the selected fragmentation product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.10 The PCR tube was incubated on the PCR amplifier at 37° C. for 30 min, and at 65° C. for 15 min.
9.11 After completion of the reaction, the reaction solution was placed on ice.
9.12 An adapter ligation reaction solution was prepared on ice: 3.6 μl of H2O, 3 μl of 10×PNK buffer, 5 μl of 10 μM Adapters mix, 0.8 μl of 100 mM ATP (Cat. No. R1441), 16 μl of 50% PEG 8000 (Cat. No. EB-0.5P8K-250), and 1.6 μl of 600 U/μl T4 DNA Ligase (Cat. No. BGE004).
9.13 30 μl of the prepared adapter ligation reaction solution was slowly pipetted and added to the end repair product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
9.14 The PCR tube was placed on the PCR amplifier and incubated at 23° C. for 60 min.
9.15 After completion of the reaction, 20 μl of TE Buffer was added to make the total sample volume reach 100p.
9.16 The ligation product was purified and recovered by using 50 μl of AMPure XP Beads, and the ligation product was eluted by using 48 μl of H2O.
9.17 2 μl of 10 μM PCR Primer and 50 μl of 2×KAPA HiFi Hotstart Ready mix were added and evenly mixed by shaking.
9.18 PCR reaction was performed according to the following conditions: 95° C., 3 min; 11 cycles (98° C., 20 s; 58° C., 20 s; 72° C., 30 s).
9.19 After completion of PCR, the PCR product was screened by using 0.6x+0.2× (i.e., 60 μl+20 μl) AMPure XP Beads, DNAs were eluted using 42 μl of TE Buffer, and the concentration was detected using Qubit dsDNA HS Kit.
10. High-Throughput Sequencing
10.1 A total of 200 to 400 ng of the library was added into a new 0.2 ml PCR tube, where a pooling ratio of the PCR product of cDNAs of the same sample after fragmentation and the oligo secondary PCR product was 9:1 (or, separate cyclization and then pooling). TE Buffer was added to reach a total volume of 471.
10.2 3.0 μl of 20 μM Splint Oligo primer was added and evenly mixed, and centrifuged briefly to precipitate to the bottom of the tube.
10.3 The tube was placed in a PCR amplifier and incubated at 95° C. for 3 min.
10.4 Immediately after completion of the reaction, the PCR tube was transferred onto ice and stood still for 5 min.
10.5 A single strand cyclization reaction solution was prepared on ice: 3.2 μl of TE Buffer, 6 μl of 10×TA buffer, 0.6 μl of 100 mM ATP, and 0.2 μl of 600 U/μl T4 DNA Ligase.
10.6 10 μl of the prepared single strand cyclization reaction solution was pipetted and added into the above PCR tube, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
10.7 The PCR tube was placed on the PCR amplifier and incubated at 37° C. for 30 min.
10.8 The digestion reaction solution was prepared on ice: 1.0 μl of TE Buffer, 0.4 μl of 10×TA buffer, 1.95 μl of 20 U/μl EXO I, and 0.65 μl of 100 U/μl EXO III.
10.9 4 μl of the digestion reaction solution was pipetted and added to the single strand cyclization product, evenly mixed by vortex, and centrifuged briefly to collect the reaction solution to the bottom of the tube.
10.10 The tube was placed on the PCR amplifier and incubated at 37° C. for 30 min.
10.11 After completion of the reaction, 3 μl of 0.5M EDTA was added and mixed, and the mixture was centrifuged.
10.12 The above digestion product was recovered by using 90 μl of PEG32 magnetic beads, DNAs were eluted with 32 μl of TE Buffer, and the concentration of single-stranded cyclic library was detected by using the Qubit® ssDNAAssay Kit.
10.13 The qualified library was sequenced. The sequencing parameters: 41+100+10.
The experimental product and library quality inspection result are as follows:
After sequencing analysis, the results are shown in Table 2 below and
Table 2 and
In the specification, description with reference to the terms “an embodiment,” “some embodiments,” “example”, “specific example” or “some examples”, etc., mean that specific features, structures, materials, or characteristics described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, those skilled in the art may combine the different embodiments or examples described in this specification, as well as the features of the different embodiments or examples, as long as they do not conflict each other.
Although the embodiments of the present disclosure have been illustrated and described above, it should be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present disclosure. Those skilled in the art may make changes, modifications, replacements and variations to the above embodiments within the scope of the present disclosure.
This application is a continuation of International Application No. PCT/CN2020/073968, filed on Jan. 23, 2020, the entire disclosure of which is hereby incorporated by reference in its entirety.
Number | Date | Country | |
---|---|---|---|
Parent | PCT/CN2020/073968 | Jan 2020 | US |
Child | 17814147 | US |