DROUGHT TOLERANT PLANTS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING PHOSPHATIDIC ACID PHOSPHATASE (PAP), DTP25 and DTP46 POLYPEPTIDES

Information

  • Patent Application
  • 20160060647
  • Publication Number
    20160060647
  • Date Filed
    October 16, 2013
    11 years ago
  • Date Published
    March 03, 2016
    9 years ago
Abstract
Isolated polynucleotides, polypeptides and recombinant DNA constructs useful for conferring drought tolerance are disclosed. The recombinant DNA construct comprises a promoter that is functional in a plant operably linked to a polynucleotide that encodes a PAP, a DTP25 or a DTP46 polypeptide. Also disclosed are methods of utilizing the recombinant DNA construct and compositions (such as plants or seeds) comprising the recombinant DNA construct.
Description
FIELD OF THE INVENTION

The field of invention relates to plant breeding and genetics and, in particular, relates to recombinant DNA constructs useful in plants for conferring tolerance to drought.


BACKGROUND OF THE INVENTION

Abiotic stress is the primary cause of crop loss worldwide, causing average yield losses of more than 50% for major crops (Boyer, J. S. (1982) Science 218:443-448; Bray, E. A. et al. (2000) In Biochemistry and Molecular Biology of Plants, Edited by Buchannan, B. B. et al., Amer. Soc. Plant Biol., pp. 1158-1203). Among the various abiotic stresses, drought is the major factor that limits crop productivity worldwide. Exposure of plants to a water-limiting environment during various developmental stages appears to activate various physiological and developmental changes. Understanding of the basic biochemical and molecular mechanism for drought stress perception, transduction and tolerance is a major challenge in biology. Reviews on the molecular mechanisms of abiotic stress responses and the genetic regulatory networks of drought stress tolerance have been published (Valliyodan, B., and Nguyen, H. T., (2006) Curr. Opin. Plant Biol. 9:189-195; Wang, W., et al. (2003) Planta 218:1-14); Vinocur, B., and Altman, A. (2005) Curr. Opin. Biotechnol. 16:123-132; Chaves, M. M., and Oliveira, M. M. (2004) J. Exp. Bot. 55:2365-2384; Shinozaki, K., et al. (2003) Curr. Opin. Plant Biol. 6:410-417; Yamaguchi-Shinozaki, K., and Shinozaki, K. (2005) Trends Plant Sci. 10:88-94).


Earlier work on molecular aspects of abiotic stress responses was accomplished by differential and/or subtractive analysis (Bray, E. A. (1993) Plant Physiol. 103:1035-1040; Shinozaki, K., and Yamaguchi-Shinozaki, K. (1997) Plant Physiol. 115:327-334; Zhu, J.-K. et al. (1997) Crit. Rev. Plant Sci. 16:253-277; Thomashow, M. F. (1999) Annu. Rev. Plant Physiol. Plant Mol. Biol. 50:571-599). Other methods include selection of candidate genes and analyzing expression of such a gene or its active product under stresses, or by functional complementation in a stressor system that is well defined (Xiong, L., and Zhu, J.-K. (2001) Physiologia Plantarum 112:152-166). Additionally, forward and reverse genetic studies involving the identification and isolation of mutations in regulatory genes have also been used to provide evidence for observed changes in gene expression under stress or exposure (Xiong, L., and Zhu, J.-K. (2001) Physiologia Plantarum 112:152-166).


Activation tagging can be utilized to identify genes with the ability to affect a trait. This approach has been used in the model plant species Arabidopsis thaliana (Weigel, D., et al. (2000) Plant Physiol. 122:1003-1013). Insertions of transcriptional enhancer elements can dominantly activate and/or elevate the expression of nearby endogenous genes. This method can be used to select genes involved in agronomically important phenotypes, including stress tolerance.


SUMMARY OF THE INVENTION

The present invention includes:


In one embodiment, a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.


In another embodiment, a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct. Optionally, the plant exhibits said alteration of said at least one agronomic characteristic when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.


In another embodiment, the present invention includes any of the plants of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


In another embodiment, the present invention includes seed of any of the plants of the present invention, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein a plant produced from said seed exhibits either an increased drought tolerance, or an alteration of at least one agronomic characteristic, or both, when compared to a control plant not comprising said recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.


In another embodiment, a method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) obtaining a progeny plant derived from the transgenic plant of step (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.


In another embodiment, a method of selecting for drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.


In another embodiment, a method of selecting for an alteration of at least one agronomic characteristic in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting the plant of part (b) that exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct. Optionally, said selecting step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.


In another embodiment, the present invention includes any of the methods of the present invention wherein the plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


In another embodiment, the present invention includes an isolated polynucleotide comprising: (a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, or (b) a full complement of the nucleotide sequence, wherein the full complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. The polypeptide may comprise the amino acid sequence of SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208. The nucleotide sequence may comprise the nucleotide sequence of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186.


In another embodiment, the present invention concerns a recombinant DNA construct comprising any of the isolated polynucleotides of the present invention operably linked to at least one regulatory sequence, and a cell, a plant, and a seed comprising the recombinant DNA construct. The cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.


In another embodiment, a plant comprising in its genome a polynucleotide operably linked to at least one recombinant regulatory element (e.g., at least one enhancer element), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element.





BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING

The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application.



FIGS. 1A-1H show the multiple alignment of the amino acid sequences of the PAP polypeptides of SEQ ID NOs:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 43, 65-77, 89, 91, 93 and 94. Residues that are identical to the residue of SEQ ID NO:17 at a given position are enclosed in a box. A consensus sequence is presented where a residue is shown if identical in all sequences, otherwise, a period is shown.



FIG. 2 shows the percent sequence identity and the divergence values for each pair of amino acids sequences of PAP polypeptides displayed in FIGS. 1A-1H.



FIG. 3 shows the treatment schedule for screening plants with enhanced drought tolerance.



FIG. 4 shows the yield analysis of maize lines transformed with PHP42968 encoding the Arabidopsis lead gene At5g03080.



FIGS. 5 and 6 show the second year yield analysis of maize lines transformed with PHP42968 encoding the Arabidopsis lead gene At5g03080, in two inbred lines, Tester 1 and Tester 2.



FIGS. 7A-7F show the multiple alignment of the amino acid sequences of the DTP25 polypeptides of SEQ ID NOS: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 149, 155-169, 172-178. Residues that are identical to the residue of SEQ ID NO:98 at a given position are enclosed in a box. A consensus sequence (consensus #1) is presented where a residue is shown if identical in all sequences, otherwise, a period is shown.



FIG. 8 shows the percent sequence identity and the divergence values for each pair of amino acids sequences of DTP25 polypeptides displayed in FIGS. 7A-7F.



FIG. 9 shows the yield analysis of maize lines transformed with PHP42955 encoding the Arabidopsis lead gene At3g02640.



FIGS. 10 and 11 show the second year yield analysis of maize lines transformed with PHP42955 encoding the Arabidopsis lead gene At3g02640, in two tester lines, tester 1 and tester 2.



FIGS. 12A-12E show the multiple alignment of the amino acid sequences of the DTP46 polypeptides of SEQ ID NOs: 182, 184, 187-189, 205-209. Residues that are identical to the residue of SEQ ID NO:182 at a given position are enclosed in a box. A consensus sequence (consensus #2) is presented where a residue is shown if identical in all sequences, otherwise, a period is shown.



FIG. 13 shows the percent sequence identity and the divergence values for each pair of amino acids sequences of DTP46 polypeptides displayed in FIGS. 12A-12E.



FIG. 14 shows the yield analysis of maize lines transformed with the construct PHP37480, encoding the Arabidopsis lead gene AT-DTP46. The analysis was by ASREML and the values are BLUPs, as explained in Example 19.





SEQ ID NO:1 is the sequence of the 4×35S enhancer element from the pHSbarENDs2 activation tagging vector.


SEQ ID NO:2 is the sequence of the attP1 site.


SEQ ID NO:3 is the sequence of the attP2 site.


SEQ ID NO:4 is the sequence of the attL1 site.


SEQ ID NO:5 is the sequence of the attL2 site.


SEQ ID NO:6 is the sequence of the ubiquitin promoter with 5′ UTR and intron (Zea mays).


SEQ ID NO:7 is the sequence of the PinII terminator (Solanum tuberosum).


SEQ ID NO:8 is the sequence of the attR1 site.


SEQ ID NO:9 is the sequence of the attR2 site.


SEQ ID NO:10 is the nucleotide sequence of the attB1 site.


SEQ ID NO:11 is the nucleotide sequence of the attB2 site.


SEQ ID NO:12 is the nucleotide sequence of the At5g03080-5′attB forward primer, containing the attB1 sequence, used to amplify the At5g03080 protein-coding region.


SEQ ID NO:13 is the nucleotide sequence of the At5g03080-3′attB reverse primer, containing the attB2 sequence, used to amplify the At5g03080 protein-coding region.


SEQ ID NO:14 is the nucleotide sequence of the VC062 primer, containing the T3 promoter and attB1 site, useful to amplify cDNA inserts cloned into a BLUESCRIPT® II SK(+) vector (Stratagene).


SEQ ID NO:15 is the nucleotide sequence of the VC063 primer, containing the T7 promoter and attB2 site, useful to amplify cDNA inserts cloned into a BLUESCRIPT® II SK(+) vector (Stratagene).


SEQ ID NO:16 corresponds to NCBI GI No. 42567603, which is the cDNA nucleotide sequence from locus At5g03080 encoding an Arabidopsis Phosphatidic acid phosphatase (PAP) polypeptide.


SEQ ID NO:17 corresponds to the amino acid sequence of At5g03080, corresponds to NCBI GI No. 15242619, and is encoded by SEQ ID NO:16.


Table 1 presents SEQ ID NOs for the nucleotide sequences obtained from cDNA clones from maize, scented hay fern, resurrection grass, bahia grass, pearl millet, chickling vetch, Artemesia tridentate, Amaranthus hypochondriacus and Sesbania bispinosa. The SEQ ID NOs for the corresponding amino acid sequences encoded by the cDNAs are also presented.









TABLE 1







cDNAs Encoding PAP Polypeptides












SEQ ID NO:
SEQ ID NO:


Plant
Clone Designation*
(Nucleotide)
(Amino Acid)













Corn
dpzm01g019960
18
19


Corn
dpzm04g043730.1.1
20
21


Corn
dpzm04g43730.1.2
22
23


Corn
dpzm05g064280.1.1
24
25


Corn
dpzm05g064280.1.2
26
27


scented hay fern
ehsf2n.pk008.o17
28
29


Resurrection
En_NODE_41174
30
31


grass





Bahia grass
epn2n.pk047.a14
32
33


Chickling vetch
gcvf3c.pk003.a24
34
35


Pearl millet
pgfp1n.pk009.k20
36
37



Artemesia

arttr1n.pk093.f13
88
89



tridentata







Amaranthus

ahgr1c.pk165.p4
90
91



hypochondriacus







Sesbania

sesgr1n.pk158.n19
92
93



bispinosa






The “Full-Insert Sequence” (“FIS”) is the sequence of the entire cDNA insert.






SEQ ID NO:38 is the amino acid sequence corresponding to NCBI GI No. 225439908 (Vitis vinifera).


SEQ ID NO:39 is the amino acid sequence corresponding to NCBI GI No. 147865849 (Vitis vinifera).


SEQ ID NO:40 is the amino acid sequence corresponding to NCBI GI No. 224068673 (Populus trichocarpa).


SEQ ID NO:41 is the amino acid sequence corresponding to NCBI GI No.


224140171 (Populus trichocarpa).


SEQ ID NO:42 is the amino acid sequence corresponding to NCBI GI No. 255568396 (Ricinus communis).


SEQ ID NO:43 is the amino acid sequence corresponding to NCBI GI No. 116778929 (Picea sitchensis).


SEQ ID NO:44 is the amino acid sequence corresponding to NCBI GI No. 168004435 (Physcomitrella patens).


SEQ ID NO:45 is the amino acid sequence corresponding to NCBI GI No. 168054149 (Physcomitrella patens).


SEQ ID NO:46 is the amino acid sequence corresponding to Glyma10g05750.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of energy Joint Genome Institute.


SEQ ID NO:47 is the amino acid sequence corresponding to Glyma13g20100.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of energy Joint Genome Institute.


SEQ ID NO:48 is the amino acid sequence corresponding to the locus LOC_Os03g17940.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:49 is the amino acid sequence corresponding to Sb01g038580.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of energy Joint Genome Institute.


SEQ ID NO:50 is the amino acid sequence corresponding to GSVIVT01018921001 from Phytozome database (Vitis vinifera).


SEQ ID NO:51 is the amino acid sequence corresponding to 0005s12240.1 from Phytozome database (Populus trichocarpa).


SEQ ID NO:52 is the amino acid sequence corresponding to 0007s13230.1 from Phytozome database (Populus trichocarpa).


SEQ ID NO:53 is the amino acid sequence corresponding to Glyma01g37710.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of energy Joint Genome Institute.


SEQ ID NO:54 is the amino acid sequence corresponding to Glyma11g07590.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of energy Joint Genome Institute.


SEQ ID NO:55 is the amino acid sequence corresponding to the locus LOC_Os02g47570.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:56 is the amino acid sequence corresponding to the locus LOC_Os02g47570.2, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:57 is the amino acid sequence corresponding to Bradi1g65657.1 from Phytozome database (Brachypodium distachyon).


SEQ ID NO:58 is the amino acid sequence corresponding to Bradi3g52697.1 from Phytozome database (Brachypodium distachyon).


SEQ ID NO:59 is the amino acid sequence corresponding to Bradi3g52710.1 from Phytozome database (Brachypodium distachyon).


SEQ ID NO:60 is the amino acid sequence corresponding to Bradi3g52710.2 from Phytozome database (Brachypodium distachyon).


SEQ ID NO:61 is the amino acid sequence corresponding to Sb04g030620.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of energy Joint Genome Institute.


SEQ ID NO:62 is the amino acid sequence corresponding to 71455 from Phytozome database (Selaginella moellendorffii).


SEQ ID NO:63 is the amino acid sequence corresponding to 73772 from Phytozome database (Selaginella moellendorffii).


SEQ ID NO:64 is the amino acid sequence corresponding to Cre06.g272400.t1.1 from Phytozome database (Chlamydomonas reinhardtii).


SEQ ID NO:65 is the amino acid sequence presented in SEQ ID NO:1376 of U.S. Pat. No. 7,569,389 (Arabidopsis thaliana).


SEQ ID NO:66 is the amino acid sequence corresponding to NCBI GI No. 195654141 (Zea mays).


SEQ ID NO:67 is the amino acid sequence presented in SEQ ID NO:298683 of US Patent Publication No. US20110214206 (Zea mays).


SEQ ID NO:68 is the amino acid sequence corresponding to NCBI GI No. 194707170 (Zea mays).


SEQ ID NO:69 is the amino acid sequence presented in SEQ ID NO:358618 of US Patent Publication No. US20110214206 (Zea mays).


SEQ ID NO:70 is the amino acid sequence presented in SEQ ID NO:66003 of US Patent Publication No. US20110277178 (Zea mays).


SEQ ID NO:71 is the amino acid sequence presented in SEQ ID NO:184398 of US Patent Publication No. US20110131679 (Zea mays).


SEQ ID NO:72 is the amino acid sequence corresponding to NCBI GI No. 215766799 (Oryza sativa).


SEQ ID NO:73 is the amino acid sequence presented in SEQ ID NO:101048 of US Patent Publication No. US20110214205 (Setaria italica).


SEQ ID NO:74 is the amino acid sequence presented in SEQ ID NO:23235 of US Patent Publication No. US20110167514 (Panicum vigratum).


SEQ ID NO:75 is the amino acid sequence corresponding to NCBI GI No. 110737805 (Arabidopsis thaliana).


SEQ ID NO:76 is the amino acid sequence presented in SEQ ID NO:260063 of US Patent Publication No. US20040031072 (Glycine max).


SEQ ID NO:77 is the amino acid sequence corresponding to NCBI GI No. 219888527 (Zea mays).


SEQ ID NO:78 corresponds to the amino acid sequence of At3g50920.1, corresponds to NCBI GI No. 42565815.


SEQ ID NO:79 corresponds to the amino acid sequence of At3g50920.2, corresponds to NCBI GI No. 79314709.


SEQ ID NO:80 corresponds to the amino acid sequence of At4g22550, corresponds to NCBI GI No. 332659223.


SEQ ID NO:81 corresponds to the amino acid sequence of At3g58490.1, corresponds to NCBI GI No. 15231046.


SEQ ID NO:82 corresponds to the amino acid sequence of At3g58490.2, corresponds to NCBI GI No. 145332885.


SEQ ID NO:83 corresponds to the amino acid sequence of At5g66450.1, corresponds to NCBI GI No. 30698229.


SEQ ID NO:84 corresponds to the amino acid sequence of At5g66450.2, corresponds to NCBI GI No. 145334923.


SEQ ID NO:85 is the sequence of a conserved active site motif (motif 1) present in the PAP polypeptides of the present invention.


SEQ ID NO:86 is the sequence of a conserved active site motif (motif 2) present in PAP polypeptides of the present invention.


SEQ ID NO:87 is the sequence of a conserved active site motif (motif 3) present in PAP polypeptides of the present invention.


SEQ ID NO:94 is the amino acid sequence presented in SEQ ID NO:1376 of US Patent Publication No. US20100083407 (Arabidopsis thaliana).


SEQ ID NO:95 is the nucleotide sequence of the At3g02640-5′attB forward primer, containing the attB1 sequence, used to amplify the At3g02640 protein-coding region.


SEQ ID NO:96 is the nucleotide sequence of the At3g02640-3′attB reverse primer, containing the attB2 sequence, used to amplify the At3g02640 protein-coding region.


SEQ ID NO:97 corresponds to NCBI GI No. 30678629, which is the cDNA sequence from locus At3g02640 encoding an Arabidopsis DTP25 polypeptide.


SEQ ID NO:98 corresponds to the amino acid sequence of At3g02640 encoded by SEQ ID NO:97.


Table 2 presents SEQ ID NOS for the nucleotide sequences obtained from cDNA clones from maize, Bahia grass, Resurrection grass, Sesbania bispinosa, Amaranthus hypochondriacus and Lamium amplexicaule. The SEQ ID NOs for the corresponding amino acid sequences encoded by the cDNAs are also presented.









TABLE 2







cDNAs Encoding DTP25 Polypeptides












SEQ ID NO:
SEQ ID NO:


Plant
Clone Designation*
(Nucleotide)
(Amino Acid)













Corn
pco521600 (CGS)
99
100


Corn
pco591575
101
102


Corn
pco612806 (FIS)
103
104


Corn
pco521599
105
106


Corn
pco521598 (FIS)
107
108


Resurrection
En_NODE_159114
109
110


grass





Resurrection
En_NODE_140096_60940
111
112


grass





Bahia grass
Pn_NODE_337969
113
114


Bahia grass
Pn_NODE_86349
115
116


Bahia grass
Pn_NODE_301475
117
118



Sesbania

sesgr1n.pk051.b9
119
120



bispinosa







Amaranthus

ahgr1c.pk148.d21
121
122



hypochondriacus







Amaranthus

ahgr1c.pk081.j23
123
124



hypochondriacus







Amaranthus

ahgr1c.pk066.n24
125
126



hypochondriacus







Lamium

hengr1n.pk110.p6
127
128



amplexicaule






*“Full-Insert Sequence” (“FIS”) is the sequence of the entire cDNA insert; “Complete Gene Sequence” (“CGS”) is the sequence encoding an entire or functional protein






SEQ ID NO:129 is the amino acid sequence corresponding to the locus LOC_Os04g41900.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:130 is the amino acid sequence corresponding to the locus LOC_Os01g67110.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:131 is the amino acid sequence corresponding to the locus LOC_Os05g43140.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:132 is the amino acid sequence corresponding to NCBI GI NO. 116310690 (Oryza sativa).


SEQ ID NO:133 is the amino acid sequence corresponding to NCBI GI NO. 226502234 (Zea mays).


SEQ ID NO:134 is the amino acid sequence corresponding to NCBI GI NO. 15237310, corresponding to the locus At5g16250.1 (Arabidopsis thaliana).


SEQ ID NO:135 is the amino acid sequence corresponding to NCBI GI NO. 15239407, corresponding to the locus At5g36710 (Arabidopsis thaliana).


SEQ ID NO:136 is the amino acid sequence corresponding to NCBI GI NO. At5g36800 (Arabidopsis thaliana).


SEQ ID NO:137 is the amino acid sequence corresponding to NCBI GI NO. 351724021 (Glycine max).


SEQ ID NO:138 is the amino acid sequence corresponding to NCBI GI NO. 225467749 (Vitis vinifera).


SEQ ID NO:139 is the amino acid sequence corresponding to Glyma09g38320.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of Energy Joint Genome Institute.


SEQ ID NO:140 is the amino acid sequence corresponding to Glyma18g48030.1, a soybean (Glycine max) predicted protein from predicted coding sequences from Soybean JGI Glyma1.01 genomic sequence from the US Department of Energy Joint Genome Institute.


SEQ ID NO:141 is the amino acid sequence corresponding to Sb06g021400, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of Energy Joint Genome Institute.


SEQ ID NO:142 is the amino acid sequence corresponding to Sb09g024920.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of Energy Joint Genome Institute.


SEQ ID NO:143 is the amino acid sequence corresponding to Sb03g042590.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of Energy Joint Genome Institute.


SEQ ID NO:144 is the amino acid sequence corresponding to NCBI GI NO. 224109182 (Populus trichocarpa).


SEQ ID NO:145 is the amino acid sequence corresponding to NCBI GI NO. 255547444 (Ricinus communis).


SEQ ID NO:146 is the amino acid sequence corresponding to NCBI GI NO. 224101255 (Populus trichocarpa).


SEQ ID NO:147 is the amino acid sequence corresponding to NCBI GI NO. 217075865 (Medicago truncatula).


SEQ ID NO:148 is the amino acid sequence corresponding to NCBI GI NO. 224109514 (Populus trichocarpa).


SEQ ID NO:149 is the amino acid sequence corresponding to NCBI GI NO. 71534995 (Medicago sativa).


SEQ ID NO:150 is the amino acid sequence corresponding to NCBI GI NO. 224121768 (Populus trichocarpa).


SEQ ID NO:151 is the amino acid sequence corresponding to NCBI GI NO. 255567776 (Ricinus communis).


SEQ ID NO:152 is the amino acid sequence corresponding to NCBI GI NO. 119720760 (Brassica rapa).


SEQ ID NO:153 is the amino acid sequence corresponding to accession number C6T0L6 (Glycine max) from UniProtKB database.


SEQ ID NO:154 is the amino acid sequence corresponding to accession number B9P8K5 (Populus trichocarpa) from UniProtKB database.


SEQ ID NO:155 is the amino acid sequence presented in SEQ ID NO: 1227 (Arabidopsis thaliana) of US Patent Publication No. US20110277190.


SEQ ID NO:156 is the amino acid sequence corresponding to NCBI GI NO. 195639258 (Zea mays).


SEQ ID NO:157 is the amino acid sequence presented in SEQ ID NO: 28392 (Zea mays) of US Patent Publication No. US20110277190.


SEQ ID NO:158 is the amino acid sequence corresponding to NCBI GI NO. 223948063 (Zea mays).


SEQ ID NO:159 is the amino acid sequence presented in SEQ ID NO: 23610 (Zea mays) of US Patent Publication No. US20110277190.


SEQ ID NO:160 is the amino acid sequence corresponding to NCBI GI NO. 194703618 (Zea mays).


SEQ ID NO:161 is the amino acid sequence presented in SEQ ID NO: 305794 (Zea mays) of US Patent Publication No. US20110214206.


SEQ ID NO:162 is the amino acid sequence corresponding to NCBI GI NO. 223945019 (Zea mays).


SEQ ID NO:163 is the amino acid sequence presented in SEQ ID NO: 259501 (Zea mays) of US Patent Publication No. US20110214206.


SEQ ID NO:164 is the amino acid sequence corresponding to NCBI GI NO. 194691670 (Zea mays).


SEQ ID NO:165 is the amino acid sequence presented in SEQ ID NO: 8392 (Zea mays) of US Patent Publication No. US20110277190.


SEQ ID NO:166 is the amino acid sequence presented in SEQ ID NO: 814 (Zea mays) of US Patent Publication No. US20070277269.


SEQ ID NO:167 is the amino acid sequence presented in SEQ ID NO: 36698 (Zea mays) of US Patent Publication No. US20110277190.


SEQ ID NO:168 is the amino acid sequence corresponding to NCBI GI NO. 195643408 (Zea mays).


SEQ ID NO:169 is the amino acid sequence presented in SEQ ID NO: 43352 (Zea mays) of US Patent Publication No. US20110277190.


SEQ ID NO:170 is the nucleotide sequence of PN_NODE86349 (SEQ ID NO: 34) edited to complete the 5′ end using the homolog En_NODE14009660940 (SEQ ID NO: 30).


SEQ ID NO:171 is the amino acid sequence encoded by the nucleotide sequence given in SEQ ID NO:170.


SEQ ID NO:172 is the amino acid sequence presented in SEQ ID NO: 3428 (Glycine max) of US Patent Publication No. US20120096584.


SEQ ID NO:173 is the amino acid sequence corresponding to NCBI GI NO. 255629403 (Glycine max).


SEQ ID NO:174 is the amino acid sequence presented in SEQ ID NO: 52002 (Brassica napus) of US Patent Publication No. US20110277190.


SEQ ID NO:175 is the amino acid sequence corresponding to NCBI GI NO. 317106645 (Jatropha curcas).


SEQ ID NO:176 is the amino acid sequence corresponding to NCBI GI NO. 21593832 (Arabidopsis thaliana).


SEQ ID NO:177 is the amino acid sequence presented in SEQ ID NO: 1598 (Brassica napus) of US Patent Publication No. US20110162107.


SEQ ID NO:178 is the amino acid sequence corresponding to NCBI GI NO. 118483634 (Populus trichocarpa).


SEQ ID NO:179 is the nucleotide sequence of the At5g19120-5′attB forward primer, containing the attB1 sequence, used to amplify the At5g19120 protein-coding region.


SEQ ID NO:180 is the nucleotide sequence of the At5g19120-3′attB reverse primer, containing the attB2 sequence, used to amplify the At5g19120 protein-coding region.


SEQ ID NO:181 corresponds to NCBI GI No. 145358201, which is the nucleotide sequence from locus At5g19120 encoding an Arabidopsis DTP46 polypeptide.


SEQ ID NO:182 corresponds to the amino acid sequence of At5g19120 encoded by SEQ ID NO:181.


Table 3 presents SEQ ID NOs for the nucleotide sequences obtained from cDNA clones from maize. The SEQ ID NOs for the corresponding amino acid sequences encoded by the cDNAs are also presented.









TABLE 3







cDNAs and Genomic PCR Capture Sequences


Encoding DTP46 Polypeptides












SEQ ID NO:
SEQ ID NO:


Plant
Clone Designation*
(Nucleotide)
(Amino Acid)





Corn
cfp5n.pk063.i8 (FIS)
183
184


Corn
userizea.pk002.f6 (Sense
185




Genomic PCR capture)





*Sequence of the entire cDNA insert is the “Full-Insert Sequence” (“FIS”).






SEQ ID NO:186 corresponds to the FGENESH nucleotide prediction from the genomic capture sequence userizea.pk002.f6.


SEQ ID NO:187 corresponds to the protein sequence corresponding to the SEQ ID NO:186.


SEQ ID NO:188 is the amino acid sequence corresponding to NCBI GI No. 15218740 (Arabidopsis thaliana).


SEQ ID NO:189 is the amino acid sequence corresponding to NCBI GI No. 18379072 (Arabidopsis thaliana).


SEQ ID NO:190 is the amino acid sequence corresponding to NCBI GI No. 157336416 (Vitis vinifera).


SEQ ID NO:191 is the amino acid sequence corresponding to NCBI GI No. 157347926 (Vitis vinifera).


SEQ ID NO:192 is the amino acid sequence corresponding to NCBI GI No. 285741 (Daucus carota).


SEQ ID NO:193 is the amino acid sequence corresponding to NCBI GI No. 147801500 (Vitis vinifera).


SEQ ID NO:194 is the amino acid sequence corresponding to NCBI GI No. 147821120 (Vitis vinifera).


SEQ ID NO:195 is the amino acid sequence corresponding to NCBI GI No. 62362434 (Nicotiana langsdorfii×Nicotiana sanderae).


SEQ ID NO:196 is the amino acid sequence corresponding to NCBI GI No. 68449754 (Lycopersicon esculentum).


SEQ ID NO:197 is the amino acid sequence corresponding to NCBI GI No. 32482806 (Solanum tuberosum).


SEQ ID NO:198 is the amino acid sequence corresponding to Sb09g019770.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of energy Joint Genome Institute.


SEQ ID NO:199 is the amino acid sequence corresponding to Sb03g045250.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of energy Joint Genome Institute.


SEQ ID NO:200 is the amino acid sequence corresponding to Sb03g045260.1, a sorghum (Sorghum bicolor) predicted protein from the Sorghum JGI genomic sequence version 1.4 from the US Department of energy Joint Genome Institute.


SEQ ID NO:201 is the amino acid sequence corresponding to the locus LOC_Os05g33400.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009). SEQ ID NO:202 is the amino acid sequence corresponding to the locus LOC_Os05g33410.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:203 is the amino acid sequence corresponding to the locus LOC_Os05g33430.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO: 204 is the amino acid sequence corresponding to the locus LOC_Os09g25910.1, a rice (japonica) predicted protein from the Michigan State University Rice Genome Annotation Project Osa1 release 6 (January 2009).


SEQ ID NO:205 is the amino acid sequence presented in SEQ ID NO: 32757 of US Patent Publication No. US20100037355 (Arabidopsis thaliana).


SEQ ID NO:206 is the amino acid sequence corresponding to NCBI GI No. 194706824 (Zea mays).


SEQ ID NO:207 is the amino acid sequence presented in SEQ ID NO: 60221 of PCT International Patent Publication No. WO2010083178.


SEQ ID NO:208 is the amino acid sequence corresponding to NCBI GI No. 50878438 (Oryza sativa).


SEQ ID NO:209 is the amino acid sequence presented in SEQ ID NO: 49506 of PCT International Patent Publication No. WO2010083178.


The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §1.821-1.825.


The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB standards described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J. 219 (No. 2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.


DETAILED DESCRIPTION

The disclosure of each reference set forth herein is hereby incorporated by reference in its entirety.


As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to “a plant” includes a plurality of such plants, reference to “a cell” includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.


As used herein:


The term “AT-PAP polypeptide” or “AT-Phosphatidic acid phosphatase polypeptide” or “AT-Lipid phosphate phosphatase” or “AT-LPP” refers to an Arabidopsis thaliana protein that confers a drought tolerance phenotype and is encoded by the Arabidopsis thaliana locus At5g03080. “PAP polypeptide” refers to a protein with a Drought Tolerance Phenotype and refers herein to AT-PAP polypeptide and its homologs from other organisms. The terms “Phosphatidic acid phosphatase polypeptide”, “Phosphatidate phosphatase polypeptide” or “PAP polypeptide” are used interchangeably herein.


The terms Zm-PAP polypeptide and Gm-PAP polypeptide refer respectively to Zea mays and Glycine max proteins that are homologous to AT-PAP polypeptide.


The AT-PAP polypeptide (SEQ ID NO:17) is encoded by the nucleotide sequence (SEQ ID NO:16) at locus At5g03080.


The AT-PAP polypeptide is predicted to be a transmembrane protein with three transmembrane segments. It also contains three active site motifs KTSVEQARP (SEQ ID NO:85), PSSH (SEQ ID NO:86) and SRVYLGYHTVAQ (SEQ ID NO:87) that are predicted to reside in the non-transmembrane regions.


The enzyme phosphatidic acid phosphatase (EC3.1.3.4) (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG).


Nakamura et al. (Nakamura et al (2007) J Biol. Chem. vol. 282 (39): 29013-29021) have reported the isolation of a subfamily of LPP in Arabidopsis and their ancestral ortholog in the cyanobacterium Synechosystis sp. PCC6803, and they have designated AT-PAP polypeptide encoded by the locus At5g03080 as LPPγ. Nakamura et al. have also shown that “AT-PAP polypeptide” has a putative chloroplast transit peptide and have also shown that this protein is localized mainly to the chloroplasts. Franca, M. G. et al. have characterized drought-stimulated phosphatidic acid phosphatase genes from Vigna unguiculata (Franca, M. G. et al. (2008) Plant Physiol. Biochem. 46:1093-1100).


The term “AT-DTP25” refers to an Arabidopsis thaliana protein that confers a drought tolerance (DT) phenotype and is encoded by the Arabidopsis thaliana locus At3g02640. The terms “DTP” and “Drought Tolerant Phenotype” are used interchangeably herein. “DTP25 polypeptide” refers to a protein with a Drought Tolerance Phenotype and refers herein to the AT-DTP25 polypeptide and its homologs from other organisms.


The AT-DTP25 polypeptide (SEQ ID NO:98) encoded by the nucleotide sequence (SEQ ID NO:97) at locus At3g02640, has been reported to be down regulated by γ-irradiation in wild-type (WT) Arabidopsis plants, but the level of down regulation has been shown to be decreased in atr and atm protein kinase mutants (Culligan, K. M. et al Plant Journal (2006) 48, 947-961). This protein does not have any prior assigned function or annotation. One of the DTP25 homologs (SEQ ID NO:149) with the amino acid sequence corresponding to NCBI GI NO. 71534995 (Medicago sativa) is a putative adenosylhomocysteinase.


The term “AT-DTP46” polypeptide (SEQ ID NO:182) refers to an Arabidopsis thaliana protein that confers a drought tolerance (DT) phenotype and is encoded by the Arabidopsis thaliana locus At5g19120. The terms “DTP” and “Drought Tolerant Phenotype” are used interchangeably herein. “DTP46 polypeptide” refers to a protein with a Drought Tolerance Phenotype and refers herein to the AT-DTP46 polypeptide and its homologs from other organisms. The term Zm-DTP46 refers to Zea mays proteins that are homologous to AT-DTP46.


AT-DTP46 protein exhibits structural homology to the aspartic proteases. It is also homologous to the xylanase-inhibitor proteins such as TAXI-1 like proteins and to NEC4 (Saqlan Naqvi, S. M. et al (2005), Plant Physiology, 139:1389-1400).


“Aspartic proteases” or “aspartoproteases” or “aspartic-type proteases” are members of a class of endopeptidases with acidic pH optima that are inhibited by pepstatin A. They have a conserved three dimensional structure with a substrate binding cleft between the two lobes of the structure. Two conserved Asp residues are specifically involved in the catalytic cleavage of peptide bonds between amino acid residues with large hydrophobic side chains (Cruz de Carvalho, M. H. et al, (2001) FEBS Letters; 492:242-246). The motif containing the aspartates at the active site in many aspartoproteases is Asp-Thr-Gly (Sansen et al. (2004) J. Biol. Chem.; 279(34):36022-36028).


The DTP46 polypeptides described herein optionally have aspartoprotease activity. The polypeptides optionally have xyloglucanase inhibitor activity.


The gene At5g19120, that encodes AT-DTP46 protein, has been shown to be overexpressed in the plants overexpressing AtbZIP60 gene, which encodes a basic domain/leucine zipper (bZIP) class transcription factor (Fujita et al, (2007) Biochem. Biophys. Res. Comm. 364:250-257). At5g19120 is also found to be overexpressed in plants with a disrupted AtMYB60 gene (Cominelli et al, (2005) Current Biology, Vol. 15, 1196-1200), and its expression has been shown to be downregulated in roots of Arabidopsis subjected to salinity stress (Ciftci-Yilmaz, S. et al (2007) Journal Biol. Chem.; 282(12): 9260-9268)


The terms “monocot” and “monocotyledonous plant” are used interchangeably herein. A monocot of the current invention includes the Gramineae.


The terms “dicot” and “dicotyledonous plant” are used interchangeably herein. A dicot of the current invention includes the following families: Brassicaceae, Leguminosae, and Solanaceae.


The terms “full complement” and “full-length complement” are used interchangeably herein, and refer to a complement of a given nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.


An “Expressed Sequence Tag” (“EST”) is a DNA sequence derived from a cDNA library and therefore is a sequence which has been transcribed. An EST is typically obtained by a single sequencing pass of a cDNA insert. The sequence of an entire cDNA insert is termed the “Full-Insert Sequence” (“FIS”). A “Contig” sequence is a sequence assembled from two or more sequences that can be selected from, but not limited to, the group consisting of an EST, FIS and PCR sequence. A sequence encoding an entire or functional protein is termed a “Complete Gene Sequence” (“CGS”) and can be derived from an FIS or a contig.


A “trait” refers to a physiological, morphological, biochemical, or physical characteristic of a plant or particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar concentrations, or by the observation of the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.


“Agronomic characteristic” is a measurable parameter including but not limited to, abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress.


Particular phenotypes may include, but are not limited to kernel number, kernel area, grain weight, and predicted weight of the grain on the ear (based on the calibration of kernel area to grain weight).


Abiotic stress may be at least one condition selected from the group consisting of: drought, water deprivation, flood, high light intensity, high temperature, low temperature, salinity, etiolation, defoliation, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, UV irradiation, atmospheric pollution (e.g., ozone) and exposure to chemicals (e.g., paraquat) that induce production of reactive oxygen species (ROS).


“Increased stress tolerance” of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under stress conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar stress conditions.


A plant with “increased stress tolerance” can exhibit increased tolerance to one or more different stress conditions.


“Stress tolerance activity” of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased stress tolerance to the transgenic plant relative to a reference or control plant.


Increased biomass can be measured, for example, as an increase in plant height, plant total leaf area, plant fresh weight, plant dry weight or plant seed yield, as compared with control plants.


The ability to increase the biomass or size of a plant would have several important commercial applications. Crop species may be generated that produce larger cultivars, generating higher yield in, for example, plants in which the vegetative portion of the plant is useful as food, biofuel or both.


Increased leaf size may be of particular interest. Increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products. An increase in total plant photosynthesis is typically achieved by increasing leaf area of the plant. Additional photosynthetic capacity may be used to increase the yield derived from particular plant tissue, including the leaves, roots, fruits or seed, or permit the growth of a plant under decreased light intensity or under high light intensity.


Modification of the biomass of another tissue, such as root tissue, may be useful to improve a plant's ability to grow under harsh environmental conditions, including drought or nutrient deprivation, because larger roots may better reach water or nutrients or take up water or nutrients.


For some ornamental plants, the ability to provide larger varieties would be highly desirable. For many plants, including fruit-bearing trees, trees that are used for lumber production, or trees and shrubs that serve as view or wind screens, increased stature provides improved benefits in the forms of greater yield or improved screening.


The growth and emergence of maize silks has a considerable importance in the determination of yield under drought (Fuad-Hassan et al. 2008 Plant Cell Environ. 31:1349-1360). When soil water deficit occurs before flowering, silk emergence out of the husks is delayed while anthesis is largely unaffected, resulting in an increased anthesis-silking interval (ASI) (Edmeades et al. 2000 Physiology and Modeling Kernel set in Maize (eds M. E. Westgate & K. Boote; CSSA (Crop Science Society of America) Special Publication No. 29. Madison, Wis.: CSSA, 43-73). Selection for reduced ASI has been used successfully to increase drought tolerance of maize (Edmeades et al. 1993 Crop Science 33: 1029-1035; Bolanos & Edmeades 1996 Field Crops Research 48:65-80; Bruce et al. 2002 J. Exp. Botany 53:13-25).


Terms used herein to describe thermal time include “growing degree days” (GDD), “growing degree units” (GDU) and “heat units” (HU).


“Transgenic” refers to any cell, cell line, callus, tissue, plant part or plant, the genome of which has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct, including those initial transgenic events as well as those created by sexual crosses or asexual propagation from the initial transgenic event. The term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.


“Genome” as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondrial, plastid) of the cell.


“Plant” includes reference to whole plants, plant organs, plant tissues, plant propagules, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.


“Propagule” includes all products of meiosis and mitosis able to propagate a new plant, including but not limited to, seeds, spores and parts of a plant that serve as a means of vegetative reproduction, such as corms, tubers, offsets, or runners. Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention).


“Progeny” comprises any subsequent generation of a plant.


“Transgenic plant” includes reference to a plant which comprises within its genome a heterologous polynucleotide. For example, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.


The commercial development of genetically improved germplasm has also advanced to the stage of introducing multiple traits into crop plants, often referred to as a gene stacking approach. In this approach, multiple genes conferring different characteristics of interest can be introduced into a plant. Gene stacking can be accomplished by many means including but not limited to co-transformation, retransformation, and crossing lines with different transgenes.


“Transgenic plant” also includes reference to plants which comprise more than one heterologous polynucleotide within their genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant.


“Heterologous” with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.


“Polynucleotide”, “nucleic acid sequence”, “nucleotide sequence”, or “nucleic acid fragment” are used interchangeably and is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5′-monophosphate form) are referred to by their single letter designation as follows: “A” for adenylate or deoxyadenylate (for RNA or DNA, respectively), “C” for cytidylate or deoxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, “R” for purines (A or G), “Y” for pyrimidines (C or T), “K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.


“Polypeptide”, “peptide”, “amino acid sequence” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms “polypeptide”, “peptide”, “amino acid sequence”, and “protein” are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.


“Messenger RNA (mRNA)” refers to the RNA that is without introns and that can be translated into protein by the cell.


“cDNA” refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase I.


“Coding region” refers to the portion of a messenger RNA (or the corresponding portion of another nucleic acid molecule such as a DNA molecule) which encodes a protein or polypeptide. “Non-coding region” refers to all portions of a messenger RNA or other nucleic acid molecule that are not a coding region, including but not limited to, for example, the promoter region, 5′ untranslated region (“UTR”), 3′ UTR, intron and terminator. The terms “coding region” and “coding sequence” are used interchangeably herein. The terms “non-coding region” and “non-coding sequence” are used interchangeably herein.


“Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or pro-peptides present in the primary translation product have been removed.


“Precursor” protein refers to the primary product of translation of mRNA; i.e., with pre- and pro-peptides still present. Pre- and pro-peptides may be and are not limited to intracellular localization signals.


“Isolated” refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally accompany or interact with the materials in a naturally occurring environment. Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.


“Recombinant” refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. “Recombinant” also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.


“Recombinant DNA construct” refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. The terms “recombinant DNA construct” and “recombinant construct” are used interchangeably herein.


The terms “entry clone” and “entry vector” are used interchangeably herein.


“Regulatory sequences” refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms “regulatory sequence” and “regulatory element” are used interchangeably herein.


“Promoter” refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.


“Promoter functional in a plant” is a promoter capable of controlling transcription in plant cells whether or not its origin is from a plant cell.


“Tissue-specific promoter” and “tissue-preferred promoter” are used interchangeably, and refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell.


“Developmentally regulated promoter” refers to a promoter whose activity is determined by developmental events.


“Operably linked” refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.


“Expression” refers to the production of a functional product. For example, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.


“Phenotype” means the detectable characteristics of a cell or organism.


“Introduced” in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).


A “transformed cell” is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.


“Transformation” as used herein refers to both stable transformation and transient transformation.


“Stable transformation” refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.


“Transient transformation” refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.


“Allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant are the same that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant that plant is hemizygous at that locus.


A “chloroplast transit peptide” is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made (Lee et al. (2008) Plant Cell 20:1603-1622). The terms “chloroplast transit peptide” and “plastid transit peptide” are used interchangeably herein. “Chloroplast transit sequence” refers to a nucleotide sequence that encodes a chloroplast transit peptide. A “signal peptide” is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels (1991) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21-53). If the protein is to be directed to a vacuole, a vacuolar targeting signal (supra) can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added. If the protein is to be directed to the nucleus, any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel (1992) Plant Phys. 100:1627-1632). A “mitochondrial signal peptide” is an amino acid sequence which directs a precursor protein into the mitochondria (Zhang and Glaser (2002) Trends Plant Sci 7:14-21).


Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain “percent identity” and “divergence” values by viewing the “sequence distances” table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.


Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in the MegAlign™ v6.1 program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow-Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain “percent identity” and “divergence” values by viewing the “sequence distances” table in the same program.


Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter “Sambrook”).


Complete sequences and figures for the vectors described herein are given in PCT Application No. PCT/US2011/058273, the contents of which are herein incorporated by reference.


Turning now to the embodiments:


Embodiments include isolated polynucleotides and polypeptides, recombinant DNA constructs useful for conferring drought tolerance, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs.


Isolated Polynucleotides and Polypeptides:


The present invention includes the following isolated polynucleotides and polypeptides:


An isolated polynucleotide comprising: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and combination thereof; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present invention. The polypeptide is preferably a PAP, a DTP25 or a DTP46 polypeptide. The polypeptide preferably has drought tolerance activity.


An isolated polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and combinations thereof. The polypeptide is preferably a PAP, a DTP25 or a DTP46 polypeptide. The polypeptide preferably has drought tolerance activity.


An isolated polynucleotide comprising (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present invention. The isolated polynucleotide preferably encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186. The isolated polynucleotide preferably encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion. The isolated polynucleotide preferably encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence corresponds to an allele of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186.


It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.


The protein of the current invention may also be a protein which comprises an amino acid sequence comprising deletion, substitution, insertion and/or addition of one or more amino acids in an amino acid sequence selected from the group consisting of SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208. The substitution may be conservative, which means the replacement of a certain amino acid residue by another residue having similar physical and chemical characteristics. Non-limiting examples of conservative substitution include replacement between aliphatic group-containing amino acid residues such as Ile, Val, Leu or Ala, and replacement between polar residues such as Lys-Arg, Glu-Asp or Gln-Asn replacement.


Proteins derived by amino acid deletion, substitution, insertion and/or addition can be prepared when DNAs encoding their wild-type proteins are subjected to, for example, well-known site-directed mutagenesis (see, e.g., Nucleic Acid Research, Vol. 10, No. 20, p. 6487-6500, 1982, which is hereby incorporated by reference in its entirety). As used herein, the term “one or more amino acids” is intended to mean a possible number of amino acids which may be deleted, substituted, inserted and/or added by site-directed mutagenesis.


Site-directed mutagenesis may be accomplished, for example, as follows using a synthetic oligonucleotide primer that is complementary to single-stranded phage DNA to be mutated, except for having a specific mismatch (i.e., a desired mutation). Namely, the above synthetic oligonucleotide is used as a primer to cause synthesis of a complementary strand by phages, and the resulting duplex DNA is then used to transform host cells. The transformed bacterial culture is plated on agar, whereby plaques are allowed to form from phage-containing single cells. As a result, in theory, 50% of new colonies contain phages with the mutation as a single strand, while the remaining 50% have the original sequence. At a temperature which allows hybridization with DNA completely identical to one having the above desired mutation, but not with DNA having the original strand, the resulting plaques are allowed to hybridize with a synthetic probe labeled by kinase treatment. Subsequently, plaques hybridized with the probe are picked up and cultured for collection of their DNA.


Techniques for allowing deletion, substitution, insertion and/or addition of one or more amino acids in the amino acid sequences of biologically active peptides such as enzymes while retaining their activity include site-directed mutagenesis mentioned above, as well as other techniques such as those for treating a gene with a mutagen, and those in which a gene is selectively cleaved to remove, substitute, insert or add a selected nucleotide or nucleotides, and then ligated.


The protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence comprising deletion, substitution, insertion and/or addition of one or more nucleotides in a nucleotide sequence selected from the group consisting of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186. Nucleotide deletion, substitution, insertion and/or addition may be accomplished by site-directed mutagenesis or other techniques as mentioned above.


The protein of the present invention may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence hybridizable under stringent conditions with the complementary strand of a nucleotide sequence selected from the group consisting of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186.


The term “under stringent conditions” means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2×SSC to 6×SSC at about 40-50° C. (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42° C.) and washing conditions of, for example, about 40-60° C., 0.5-6×SSC, 0.1% SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50° C. and 6×SSC. Highly stringent conditions can also be readily determined by those skilled in the art, e.g., depending on the length of DNA.


Generally, such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65° C., 6×SSC to 0.2×SSC, preferably 6×SSC, more preferably 2×SSC, most preferably 0.2×SSC), compared to the moderately stringent conditions. For example, highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68° C., 0.2×SSC, 0.1% SDS. SSPE (1×SSPE is 0.15 M NaCl, 10 mM NaH2PO4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1×SSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.


It is also possible to use a commercially available hybridization kit which uses no radioactive substance as a probe. Specific examples include hybridization with an ECL direct labeling & detection system (Amersham). Stringent conditions include, for example, hybridization at 42° C. for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCl, and washing twice in 0.4% SDS, 0.5×SSC at 55° C. for 20 minutes and once in 2×SSC at room temperature for 5 minutes.


Recombinant DNA Constructs and Suppression DNA Constructs:


In one aspect, the present invention includes recombinant DNA constructs (including suppression DNA constructs).


In one embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i).


In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i).


In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity. The PAP, DTP25 or DTP46 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor, Saccharum officinarum, or Triticum aestivum.


In another aspect, the present invention includes suppression DNA constructs.


A suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a PAP, a DTP25 or a DTP46 polypeptide; or (c) all or part of: (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (c)(i). The suppression DNA construct may comprise a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an sRNA construct or an miRNA construct).


It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.


“Suppression DNA construct” is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in “silencing” of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. “Silencing,” as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The terms “suppression”, “suppressing” and “silencing”, used interchangeably herein, include lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing. “Silencing” or “gene silencing” does not specify mechanism and is inclusive, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem-loop suppression, RNAi-based approaches, and small RNA-based approaches.


A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to all or part of the sense strand (or antisense strand) of the gene of interest. A suppression DNA construct may comprise 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 contiguous nucleotides of the sense strand (or antisense strand) of the gene of interest, and combinations thereof.


Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as sRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.


Suppression of gene expression may also be achieved by use of artificial miRNA precursors, ribozyme constructs and gene disruption. A modified plant miRNA precursor may be used, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the nucleotide sequence of interest. Gene disruption may be achieved by use of transposable elements or by use of chemical agents that cause site-specific mutations.


“Antisense inhibition” refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product. “Antisense RNA” refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns, or the coding sequence.


“Cosuppression” refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product. “Sense” RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see Vaucheret et al., Plant J. 16:651-659 (1998); and Gura, Nature 404:804-808 (2000)).


Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083 published on Aug. 20, 1998).


RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., Nature 391:806 (1998)). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 (1999)).


Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.


Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.


MicroRNAs (miRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 (2001), Lagos-Quintana et al., Curr. Biol. 12:735-739 (2002); Lau et al., Science 294:858-862 (2001); Lee and Ambros, Science 294:862-864 (2001); Llave et al., Plant Cell 14:1605-1619 (2002); Mourelatos et al., Genes Dev. 16:720-728 (2002); Park et al., Curr. Biol. 12:1484-1495 (2002); Reinhart et al., Genes. Dev. 16:1616-1626 (2002)). They are processed from longer precursor transcripts that range in size from approximately 70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures.


MicroRNAs (miRNAs) appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1) translational inhibition; and (2) RNA cleavage. MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants, and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.


The terms “miRNA-star sequence” and “miRNA* sequence” are used interchangeably herein and they refer to a sequence in the miRNA precursor that is highly complementary to the miRNA sequence. The miRNA and miRNA* sequences form part of the stem region of the miRNA precursor hairpin structure.


Regulatory Sequences:


A recombinant DNA construct (including a suppression DNA construct) of the present invention may comprise at least one regulatory sequence.


A regulatory sequence may be a promoter.


A number of promoters can be used in recombinant DNA constructs of the present invention. The promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.


Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.


High level, constitutive expression of the candidate gene under control of the 35S or UBI promoter may have pleiotropic effects, although candidate gene efficacy may be estimated when driven by a constitutive promoter. Use of tissue-specific and/or stress-specific promoters may eliminate undesirable effects but retain the ability to enhance drought tolerance. This effect has been observed in Arabidopsis (Kasuga et al. (1999) Nature Biotechnol. 17:287-91).


Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al., Nature 313:810-812 (1985)); rice actin (McElroy et al., Plant Cell 2:163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last et al., Theor. Appl. Genet. 81:581-588 (1991)); MAS (Velten et al., EMBO J. 3:2723-2730 (1984)); ALS promoter (U.S. Pat. No. 5,659,026), the constitutive synthetic core promoter SCP1 (International Publication No. 03/033651) and the like. Other constitutive promoters include, for example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.


In choosing a promoter to use in the methods of the invention, it may be desirable to use a tissue-specific or developmentally regulated promoter.


A tissue-specific or developmentally regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant critical to tassel development, seed set, or both, and limits the expression of such a DNA sequence to the period of tassel development or seed maturation in the plant. Any identifiable promoter may be used in the methods of the present invention which causes the desired temporal and spatial expression.


Promoters which are seed or embryo-specific and may be useful in the invention include soybean Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell 1:1079-1093 (1989)), patatin (potato tubers) (Rocha-Sosa, M., et al. (1989) EMBO J. 8:23-29), convicilin, vicilin, and legumin (pea cotyledons) (Rerie, W. G., et al. (1991) Mol. Gen. Genet. 259:149-157; Newbigin, E. J., et al. (1990) Planta 180:461-470; Higgins, T. J. V., et al. (1988) Plant. Mol. Biol. 11:683-695), zein (maize endosperm) (Schemthaner, J. P., et al. (1988) EMBO J. 7:1249-1255), phaseolin (bean cotyledon) (Segupta-Gopalan, C., et al. (1985) Proc. Natl. Acad. Sci. U.S.A. 82:3320-3324), phytohemagglutinin (bean cotyledon) (Voelker, T. et al. (1987) EMBO J. 6:3571-3577), B-conglycinin and glycinin (soybean cotyledon) (Chen, Z-L, et al. (1988) EMBO J. 7:297-302), glutelin (rice endosperm), hordein (barley endosperm) (Marris, C., et al. (1988) Plant Mol. Biol. 10:359-366), glutenin and gliadin (wheat endosperm) (Colot, V., et al. (1987) EMBO J. 6:3559-3564), and sporamin (sweet potato tuberous root) (Hattori, T., et al. (1990) Plant Mol. Biol. 14:595-604). Promoters of seed-specific genes operably linked to heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants. Such examples include Arabidopsis thaliana 2S seed storage protein gene promoter to express enkephalin peptides in Arabidopsis and Brassica napus seeds (Vanderkerckhove et al., Bio/Technology 7:L929-932 (1989)), bean lectin and bean beta-phaseolin promoters to express luciferase (Riggs et al., Plant Sci. 63:47-57 (1989)), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al., EMBO J 6:3559-3564 (1987)).


Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, flooding or drought, phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, or safeners.


Promoters for use in the current invention include the following: 1) the stress-inducible RD29A promoter (Kasuga et al. (1999) Nature Biotechnol. 17:287-91); 2) the barley promoter, B22E; expression of B22E is specific to the pedicel in developing maize kernels (“Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers”. Klemsdal, S. S. et al., Mol. Gen. Genet. 228(1/2):9-16 (1991)); and 3) maize promoter, Zag2 (“Identification and molecular characterization of ZAG1, the maize homolog of the Arabidopsis floral homeotic gene AGAMOUS”, Schmidt, R. J. et al., Plant Cell 5(7):729-737 (1993); “Structural characterization, chromosomal localization and phylogenetic evaluation of two pairs of AGAMOUS-like MADS-box genes from maize”, Theissen et al. Gene 156(2):155-166 (1995); NCBI GenBank Accession No. X80206)). Zag2 transcripts can be detected 5 days prior to pollination to 7 to 8 days after pollination (“DAP”), and directs expression in the carpel of developing female inflorescences and Ciml which is specific to the nucleus of developing maize kernels. Ciml transcript is detected 4 to 5 days before pollination to 6 to 8 DAP. Other useful promoters include any promoter which can be derived from a gene whose expression is maternally associated with developing female florets.


Additional promoters for regulating the expression of the nucleotide sequences of the present invention in plants are stalk-specific promoters. Such stalk-specific promoters include the alfalfa S2A promoter (GenBank Accession No. EF030816; Abrahams et al., Plant Mol. Biol. 27:513-528 (1995)) and S2B promoter (GenBank Accession No. EF030817) and the like, herein incorporated by reference.


Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.


In one embodiment the at least one regulatory element may be an endogenous promoter operably linked to at least one enhancer element; e.g., a 35S, nos or ocs enhancer element.


Promoters for use in the current invention may include: RIP2, mLIP15, ZmCOR1, Rab17, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, the vascular tissue preferred promoters S2A (Genbank accession number EF030816) and S2B (Genbank accession number EF030817), and the constitutive promoter GOS2 from Zea mays. Other promoters include root preferred promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, published Jul. 13, 2006), the maize ROOTMET2 promoter (WO05063998, published Jul. 14, 2005), the CR1B10 promoter (WO06055487, published May 26, 2006), the CRWAQ81 (WO05035770, published Apr. 21, 2005) and the maize ZRP2.47 promoter (NCBI accession number: U38790; GI No. 1063664),


Recombinant DNA constructs of the present invention may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another embodiment of the present invention, a recombinant DNA construct of the present invention further comprises an enhancer or silencer.


An intron sequence can be added to the 5′ untranslated region, the protein-coding region or the 3′ untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); Callis et al., Genes Dev. 1:1183-1200 (1987).


Any plant can be selected for the identification of regulatory sequences and PAP, DTP25 or DTP46 polypeptide genes to be used in recombinant DNA constructs and other compositions (e.g. transgenic plants, seeds and cells) and methods of the present invention. Examples of suitable plants for the isolation of genes and regulatory sequences and for compositions and methods of the present invention would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, switchgrass, tangerine, tea, tobacco, tomato, triticale, turf, turnip, a vine, watermelon, wheat, yams, and zucchini.


Compositions:


A composition of the present invention includes a transgenic microorganism, cell, plant, and seed comprising the recombinant DNA construct. The cell may be eukaryotic, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell.


A composition of the present invention is a plant comprising in its genome any of the recombinant DNA constructs (including any of the suppression DNA constructs) of the present invention (such as any of the constructs discussed above). Compositions also include any progeny of the plant, and any seed obtained from the plant or its progeny, wherein the progeny or seed comprises within its genome the recombinant DNA construct (or suppression DNA construct). Progeny includes subsequent generations obtained by self-pollination or out-crossing of a plant. Progeny also includes hybrids and inbreds.


In hybrid seed propagated crops, mature transgenic plants can be self-pollinated to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced recombinant DNA construct (or suppression DNA construct). These seeds can be grown to produce plants that would exhibit an altered agronomic characteristic (e.g., an increased agronomic characteristic optionally under water limiting conditions), or used in a breeding program to produce hybrid seed, which can be grown to produce plants that would exhibit such an altered agronomic characteristic. The seeds may be maize seeds.


The plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant, such as a maize hybrid plant or a maize inbred plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass. The plant may be a hybrid plant or an inbred plant.


The recombinant DNA construct may be stably integrated into the genome of the plant.


Particular embodiments include but are not limited to the following:


1. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.


2. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a PAP polypeptide, a DTP25 polypeptide or a DTP46 polypeptide, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.


3. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a PAP polypeptide, a DTP25 polypeptide or a DTP46 polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.


4. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186; or (b) derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits increased tolerance to drought stress, when compared to a control plant not comprising said recombinant DNA construct. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.


5. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.


6. A plant (for example, a maize, rice or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186; or (b) derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186 by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.


7. A plant (for example, a maize, rice or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a PAP, a DTP25 or a DTP46 polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said suppression DNA construct.


8. A plant (for example, a maize, rice or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said suppression DNA construct.


9. A plant (for example, a maize, rice or soybean plant) comprising in its genome a polynucleotide operably linked to at least one recombinant regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element. The at least one recombinant regulatory element may comprise an enhancer sequence or a multimer of identical or different enhancer sequences. The at least one recombinant regulatory element may comprise one, two, three or four copies of the CaMV 35S enhancer.


10. Any progeny of the plants in the embodiments described herein, any seeds of the plants in the embodiments described herein, any seeds of progeny of the plants in embodiments described herein, and cells from any of the above plants in embodiments described herein and progeny thereof.


In any of the embodiments described herein, the PAP, DTP25 or DTP46 polypeptide may be from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja, Glycine tomentella, Oryza sativa, Brassica napus, Sorghum bicolor, Saccharum officinarum, or Triticum aestivum.


In any of the embodiments described herein, the recombinant DNA construct (or suppression DNA construct) may comprise at least a promoter functional in a plant as a regulatory sequence.


In any of the embodiments described herein or any other embodiments of the present invention, the alteration of at least one agronomic characteristic is either an increase or decrease.


In any of the embodiments described herein, the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress. For example, the alteration of at least one agronomic characteristic may be an increase in yield, greenness or biomass.


In any of the embodiments described herein, the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).


In any of the embodiments described herein, the plant may exhibit alteration of at least one phenotypes selected from kernel number, kernel area, grain weight, and predicted weight of the grain on the ear (based on the calibration of kernel area to grain weight).


In any of the embodiments described herein, the plant may exhibit less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.


“Drought” refers to a decrease in water availability to a plant that, especially when prolonged, can cause damage to the plant or prevent its successful growth (e.g., limiting plant growth or seed yield). “Water limiting conditions” refers to a plant growth environment where the amount of water is not sufficient to sustain optimal plant growth and development. The terms “drought” and “water limiting conditions” are used interchangeably herein.


“Drought tolerance” is a trait of a plant to survive under drought conditions over prolonged periods of time without exhibiting substantial physiological or physical deterioration.


“Drought tolerance activity” of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased drought tolerance to the transgenic plant relative to a reference or control plant.


“Increased drought tolerance” of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under drought conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar drought conditions. Typically, when a transgenic plant comprising a recombinant DNA construct or suppression DNA construct in its genome exhibits increased drought tolerance relative to a reference or control plant, the reference or control plant does not comprise in its genome the recombinant DNA construct or suppression DNA construct.


“Triple stress” as used herein refers to the abiotic stress exerted on the plant by the combination of drought stress, high temperature stress and high light stress.


The terms “heat stress” and “temperature stress” are used interchangeably herein, and are defined as where ambient temperatures are hot enough for sufficient time that they cause damage to plant function or development, which might be reversible or irreversible in damage.“High temperature” can be either “high air temperature” or “high soil temperature”, “high day temperature” or “high night temperature, or a combination of more than one of these.


In one embodiment of the invention, the ambient temperature can be in the range of 30° C. to 36° C. In one embodiment of the invention, the duration for the high temperature stress could be in the range of 1-16 hours.


“High light intensity” and “high irradiance” and “light stress” are used interchangeably herein, and refer to the stress exerted by subjecting plants to light intensities that are high enough for sufficient time that they cause photoinhibition damage to the plant.


In one embodiment of the invention, the light intensity can be in the range of 250 μE to 450 μE. In one embodiment of the invention, the duration for the high light intensity stress could be in the range of 12-16 hours.


“Triple stress tolerance” is a trait of a plant to survive under the combined stress conditions of drought, high temperature and high light intensity over prolonged periods of time without exhibiting substantial physiological or physical deterioration.


“Paraquat” is an herbicide that exerts oxidative stress on the plants. Paraquat, a bipyridylium herbicide, acts by intercepting electrons from the electron transport chain at PSI. This reaction results in the production of bipyridyl radicals that readily react with dioxygen thereby producing superoxide. Paraquat tolerance in a plant has been associated with the scavenging capacity for oxyradicals (Lannelli, M. A. et al (1999) J Exp Botany, Vol. 50, No. 333, pp. 523-532). Paraquat resistant plants have been reported to have higher tolerance to other oxidative stresses as well.


“Paraquat stress” is defined as stress exerted on the plants by subjecting them to Paraquat concentrations ranging from 0.03 to 0.3 μM.


Many adverse environmental conditions such as drought, salt stress, and use of herbicide promote the overproduction of reactive oxygen species (ROS) in plant cells. ROS such as singlet oxygen, superoxide radicals, hydrogen peroxide (H2O2), and hydroxyl radicals are believed to be the major factor responsible for rapid cellular damage due to their high reactivity with membrane lipids, proteins, and DNA (Mittler, R. (2002) Trends Plant Sci Vol. 7 No. 9).


“Increased stress tolerance” of a plant is measured relative to a reference or control plant, and is a trait of the plant to survive under stress conditions over prolonged periods of time, without exhibiting the same degree of physiological or physical deterioration relative to the reference or control plant grown under similar stress conditions.


A plant with “increased stress tolerance” can exhibit increased tolerance to one or more different stress conditions. Examples of stress include, but are not limited to sub-optimal conditions associated with salinity, drought, temperature, pathogens, metal, chemical, and oxidative stresses.


“Stress tolerance activity” of a polypeptide indicates that over-expression of the polypeptide in a transgenic plant confers increased stress tolerance to the transgenic plant relative to a reference or control plant. A polypeptide with “triple stress tolerance activity” indicates that over-expression of the polypeptide in a transgenic plant confers increased triple stress tolerance to the transgenic plant relative to a reference or control plant. A polypeptide with “paraquat stress tolerance activity” indicates that over-expression of the polypeptide in a transgenic plant confers increased Paraquat stress tolerance to the transgenic plant relative to a reference or control plant.


Typically, when a transgenic plant comprising a recombinant DNA construct or suppression DNA construct in its genome exhibits increased stress tolerance relative to a reference or control plant, the reference or control plant does not comprise in its genome the recombinant DNA construct or suppression DNA construct.


One of ordinary skill in the art is familiar with protocols for simulating drought conditions and for evaluating drought tolerance of plants that have been subjected to simulated or naturally-occurring drought conditions. For example, one can simulate drought conditions by giving plants less water than normally required or no water over a period of time, and one can evaluate drought tolerance by looking for differences in physiological and/or physical condition, including (but not limited to) vigor, growth, size, or root length, or in particular, leaf color or leaf area size. Other techniques for evaluating drought tolerance include measuring chlorophyll fluorescence, photosynthetic rates and gas exchange rates.


A drought stress experiment may involve a chronic stress (i.e., slow dry down) and/or may involve two acute stresses (i.e., abrupt removal of water) separated by a day or two of recovery. Chronic stress may last 8-10 days. Acute stress may last 3-5 days. The following variables may be measured during drought stress and well watered treatments of transgenic plants and relevant control plants:


The variable “% area chg_start chronic—acute2” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of the second acute stress.


The variable “% area chg_start chronic—end chronic” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the last day of chronic stress.


The variable “% area chg_start chronic—harvest” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and the day of harvest.


The variable “% area chg_start chronic—recovery24hr” is a measure of the percent change in total area determined by remote visible spectrum imaging between the first day of chronic stress and 24 hrs into the recovery (24 hrs after acute stress 2).


The variable “psii_acute1” is a measure of Photosystem II (PSII) efficiency at the end of the first acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSII antennae and is directly related to carbon dioxide assimilation within the leaf.


The variable “psii_acute2” is a measure of Photosystem II (PSII) efficiency at the end of the second acute stress period. It provides an estimate of the efficiency at which light is absorbed by PSII antennae and is directly related to carbon dioxide assimilation within the leaf.


The variable “fv/fm_acute1” is a measure of the optimum quantum yield (Fv/Fm) at the end of the first acute stress−(variable fluorescence difference between the maximum and minimum fluorescence/maximum fluorescence)


The variable “fv/fm_acute2” is a measure of the optimum quantum yield (Fv/Fm) at the end of the second acute stress−(variable flourescence difference between the maximum and minimum fluorescence/maximum fluorescence).


The variable “leaf rolling_harvest” is a measure of the ratio of top image to side image on the day of harvest.


The variable “leaf rolling_recovery24hr” is a measure of the ratio of top image to side image 24 hours into the recovery.


The variable “Specific Growth Rate (SGR)” represents the change in total plant surface area (as measured by Lemna Tec Instrument) over a single day (Y(t)=Y0*er*t). Y(t)=Y0*er*t is equivalent to % change in Y/Δ t where the individual terms are as follows: Y(t)=Total surface area at t; Y0=Initial total surface area (estimated); r=Specific Growth Rate day−1, and t=Days After Planting (“DAP”).


The variable “shoot dry weight” is a measure of the shoot weight 96 hours after being placed into a 104° C. oven.


The variable “shoot fresh weight” is a measure of the shoot weight immediately after being cut from the plant.


The Examples below describe some representative protocols and techniques for simulating drought conditions and/or evaluating drought tolerance.


One can also evaluate drought tolerance by the ability of a plant to maintain sufficient yield (at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% yield) in field testing under simulated or naturally-occurring drought conditions (e.g., by measuring for substantially equivalent yield under drought conditions compared to non-drought conditions, or by measuring for less yield loss under drought conditions compared to a control or reference plant).


One of ordinary skill in the art would readily recognize a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant in any embodiment of the present invention in which a control plant is utilized (e.g., compositions or methods as described herein). For example, by way of non-limiting illustrations:


1. Progeny of a transformed plant which is hemizygous with respect to a recombinant DNA construct (or suppression DNA construct), such that the progeny are segregating into plants either comprising or not comprising the recombinant DNA construct (or suppression DNA construct): the progeny comprising the recombinant DNA construct (or suppression DNA construct) would be typically measured relative to the progeny not comprising the recombinant DNA construct (or suppression DNA construct) (i.e., the progeny not comprising the recombinant DNA construct (or the suppression DNA construct) is the control or reference plant).


2. Introgression of a recombinant DNA construct (or suppression DNA construct) into an inbred line, such as in maize, or into a variety, such as in soybean: the introgressed line would typically be measured relative to the parent inbred or variety line (i.e., the parent inbred or variety line is the control or reference plant).


3. Two hybrid lines, where the first hybrid line is produced from two parent inbred lines, and the second hybrid line is produced from the same two parent inbred lines except that one of the parent inbred lines contains a recombinant DNA construct (or suppression DNA construct): the second hybrid line would typically be measured relative to the first hybrid line (i.e., the first hybrid line is the control or reference plant).


4. A plant comprising a recombinant DNA construct (or suppression DNA construct): the plant may be assessed or measured relative to a control plant not comprising the recombinant DNA construct (or suppression DNA construct) but otherwise having a comparable genetic background to the plant (e.g., sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity of nuclear genetic material compared to the plant comprising the recombinant DNA construct (or suppression DNA construct)). There are many laboratory-based techniques available for the analysis, comparison and characterization of plant genetic backgrounds; among these are Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length Polymorphisms (AFLP®s), and Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites.


Furthermore, one of ordinary skill in the art would readily recognize that a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant would not include a plant that had been previously selected, via mutagenesis or transformation, for the desired agronomic characteristic or phenotype.


Methods:


Methods include but are not limited to methods for increasing drought tolerance in a plant, methods for evaluating drought tolerance in a plant, methods for altering an agronomic characteristic in a plant, methods for determining an alteration of an agronomic characteristic in a plant, and methods for producing seed. The plant may be a monocotyledonous or dicotyledonous plant, for example, a maize or soybean plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or sorghum. The seed may be a maize or soybean seed, for example, a maize hybrid seed or maize inbred seed.


Methods include but are not limited to the following:


A method for transforming a cell (or microorganism) comprising transforming a cell (or microorganism) with any of the isolated polynucleotides or recombinant DNA constructs of the present invention. The cell (or microorganism) transformed by this method is also included. In particular embodiments, the cell is eukaryotic cell, e.g., a yeast, insect or plant cell, or prokaryotic, e.g., a bacterial cell. The microorganism may be Agrobacterium, e.g. Agrobacterium tumefaciens or Agrobacterium rhizogenes.


A method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs (including suppression DNA constructs) of the present invention and regenerating a transgenic plant from the transformed plant cell. The invention is also directed to the transgenic plant produced by this method, and transgenic seed obtained from this transgenic plant. The transgenic plant obtained by this method may be used in other methods of the present invention.


A method for isolating a polypeptide of the invention from a cell or culture medium of the cell, wherein the cell comprises a recombinant DNA construct comprising a polynucleotide of the invention operably linked to at least one regulatory sequence, and wherein the transformed host cell is grown under conditions that are suitable for expression of the recombinant DNA construct.


A method of altering the level of expression of a polypeptide of the invention in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct of the present invention; and (b) growing the transformed host cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of the polypeptide of the invention in the transformed host cell.


A method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.


A method of increasing drought tolerance, the method comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186; or (b) derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance, when compared to a control plant not comprising the recombinant DNA construct.


A method of selecting for (or identifying) increased drought tolerance in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.


A method of selecting for (or identifying) increased drought tolerance in a plant, the method comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (i) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186; or (ii) derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant for increased drought tolerance, when compared to a control plant not comprising the recombinant DNA construct.


A method of selecting for (or identifying) increased drought tolerance in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, or (ii) a full complement of the nucleic acid sequence of (a)(i); (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance compared to a control plant not comprising the suppression DNA construct.


A method of selecting for (or identifying) increased drought tolerance in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a PAP, a DTP25 or a DTP46 polypeptide; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) selecting (or identifying) the progeny plant with increased drought tolerance compared to a control plant not comprising the suppression DNA construct.


In another embodiment, a method of selecting for (or identifying) increased drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting (or identifying) the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.


A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The polynucleotide preferably encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is: (a) hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186; or (b) derived from SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 88, 90, 92, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170, 181, 183, 185 or 186, by alteration of one or more nucleotides by at least one method selected from the group consisting of: deletion, substitution, addition and insertion; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The polynucleotide preferably encodes a PAP, a DTP25 or a DTP46 polypeptide. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, or (ii) a full complement of the nucleic acid sequence of (i); (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not comprising the suppression DNA construct.


A method of selecting for (or identifying) an alteration of an agronomic characteristic in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a PAP, a DTP25 or a DTP46 polypeptide; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) selecting (or identifying) the progeny plant that exhibits an alteration in at least one agronomic characteristic when compared, optionally under water limiting conditions, to a control plant not comprising the suppression DNA construct. The PAP, DTP25 or DTP46 polypeptide preferably has drought tolerance activity.


In another embodiment, a method of selecting for (or identifying) an alteration of at least one agronomic characteristic in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93, 94, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, 182, 184, 187, 188-204 or 208, wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and (c) selecting (or identifying) the transgenic plant of part (b) that exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct. Optionally, said selecting (or identifying) step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct. The at least one agronomic trait may be yield, biomass, or both and the alteration may be an increase.


In one embodiment, the AT-PAP polypeptide contains three active site motifs KTSVEQARP (SEQ ID NO:85), PSSH (SEQ ID NO:86) and SRVYLGYHTVAQ (SEQ ID NO:87) that are predicted to reside in the non-transmembrane regions. In one embodiment, the PAP polypeptides can comprise the variants of SEQ ID N0:85 (K1T2/H2/K2S3/M3/A3V4/L4E5/A5/N5/K5/A5/Q5Q6/H6A7/S7/E7R8P9), SEQ ID NO:86 (PSSH) and SEQ ID NO:87 (S1/C1R2V3/I3Y4/L4L5/R5G6/R6Y7/L7H8T9V10/L10/P10).


A method of producing seed (for example, seed that can be sold as a drought tolerant product offering) comprising any of the preceding methods, and further comprising obtaining seeds from said progeny plant, wherein said seeds comprise in their genome said recombinant DNA construct (or suppression DNA construct).


In any of the preceding methods or any other embodiments of methods of the present invention, in said introducing step said regenerable plant cell may comprise a callus cell, an embryogenic callus cell, a gametic cell, a meristematic cell, or a cell of an immature embryo. The regenerable plant cells may derive from an inbred maize plant.


In any of the preceding methods or any other embodiments of methods of the present invention, said regenerating step may comprise the following: (i) culturing said transformed plant cells in a media comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.


In any of the preceding methods or any other embodiments of methods of the present invention, the at least one agronomic characteristic may be selected from the group consisting of: abiotic stress tolerance, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance, early seedling vigor and seedling emergence under low temperature stress. The alteration of at least one agronomic characteristic may be an increase in yield, greenness or biomass.


In any of the preceding methods or any other embodiments of methods of the present invention, the plant may exhibit the alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant not comprising said recombinant DNA construct (or said suppression DNA construct).


In any of the preceding methods or any other embodiments of methods of the present invention, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, optionally as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant invention.


The introduction of recombinant DNA constructs of the present invention into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation. Techniques for plant transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.


The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. The regenerated plants may be self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.


1. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct.


2. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94, and wherein said plant exhibits an increase in yield, biomass, or both, when compared to a control plant not comprising said recombinant DNA construct.


3. The plant of claim 2, wherein said plant exhibits said increase in yield, biomass, or both when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct.


4. The plant of any one of claims 1 to 3, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


5. Seed of the plant of any one of claims 1 to 4, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94, and wherein a plant produced from said seed exhibits an increase in at least one trait selected from the group consisting of: drought tolerance, yield and biomass, when compared to a control plant not comprising said recombinant DNA construct.


6. A method of increasing drought tolerance in a plant, comprising:

    • (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94;
    • (b) regenerating a transgenic plant from the regenerable plant cell of (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and
    • (c) obtaining a progeny plant derived from the transgenic plant of (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.


7. A method of selecting for increased drought tolerance in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
    • (c) selecting the plant of (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.


8. A method of selecting for an alteration of yield, biomass, or both in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
    • (c) selecting the plant of (b) that exhibits an alteration of yield, biomass or both when compared to a control plant not comprising the recombinant DNA construct.


9. The method of claim 8, wherein said selecting step (c) comprises determining whether the progeny plant of (b) exhibits an alteration of yield, biomass or both when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.


10. The method of claim 8 or claim 9, wherein said alteration is an increase.


11. The method of any one of claims 6 to 10, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


12. An isolated polynucleotide comprising:

    • (a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 95% sequence identity when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94, based on the Clustal V method of alignment with pairwise alignment default parameters of KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5; or
    • (b) the full complement of the nucleotide sequence of (a).


13. The polynucleotide of claim 12, wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94.


14. The polynucleotide of claim 12 wherein the nucleotide sequence comprises SEQ ID NO:16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 36.


15. A plant or seed comprising a recombinant DNA construct, wherein the recombinant DNA construct comprises the polynucleotide of any one of claims 12 to 14 operably linked to at least one regulatory sequence.


16. A plant comprising in its genome a polynucleotide operably linked to at least one recombinant regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-83, 84, 89, 91, 93 or 94, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the recombinant regulatory element.


Embodiments of the current invention also encompass:


1. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, and wherein said plant exhibits either increased drought tolerance, increased tolerance to cold stress or increased tolerance to both drought and cold stress when compared to a control plant not comprising said recombinant DNA construct.


2. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, and wherein said plant exhibits an increase in yield, biomass, or both, when compared to a control plant not comprising said recombinant DNA construct.


3. The plant of claim 2, wherein said plant exhibits said increase in yield, biomass, or both when compared, under either water limiting conditions, or cold stress conditions or both water limiting and cold stress conditions, to said control plant not comprising said recombinant DNA construct.


4. The plant of any one of claims 1 to 3, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


5. Seed of the plant of any one of claims 1 to 4, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, and wherein a plant produced from said seed exhibits an increase in at least one trait selected from the group consisting of: drought tolerance, cold stress tolerance, yield and biomass, when compared to a control plant not comprising said recombinant DNA construct.


6. A method of increasing either drought tolerance, or tolerance to cold stress or tolerance to both drought and cold stress in a plant, comprising:

    • (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178;
    • (b) regenerating a transgenic plant from the regenerable plant cell of (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and
    • (c) obtaining a progeny plant derived from the transgenic plant of (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits either increased drought tolerance, or increased tolerance to cold stress or increased tolerance to both drought and cold stress, when compared to a control plant not comprising the recombinant DNA construct.


7. A method of selecting for increased drought tolerance, increased tolerance to cold stress or increased tolerance to both drought and cold stress in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
    • (c) selecting the transgenic plant of part (b) with either increased drought tolerance, or increased tolerance to cold stress or increased tolerance to both drought and cold stress, compared to a control plant not comprising the recombinant DNA construct.


8. A method of selecting for an alteration of yield, biomass, or both in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
    • (c) selecting the transgenic plant of part (b) that exhibits an alteration of yield, biomass or both when compared to a control plant not comprising the recombinant DNA construct.


9. The method of claim 8, wherein said selecting step (c) comprises determining whether the progeny plant of (b) exhibits an alteration of yield, biomass or both when compared, under either water limiting conditions, or cold stress conditions or both water limiting and cold stress conditions, to a control plant not comprising the recombinant DNA construct.


10. The method of claim 8 or claim 9, wherein said alteration is an increase.


11. The method of any one of claims 6 to 10, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


12. An isolated polynucleotide comprising:

    • (a) a nucleotide sequence encoding a polypeptide with either drought tolerance activity, or cold stress tolerant activity, or both drought tolerance and cold stress tolerant activity, wherein the polypeptide has an amino acid sequence of at least 95% sequence identity when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, based on the Clustal V method of alignment with pairwise alignment default parameters of KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5; or
    • (b) the full complement of the nucleotide sequence of (a).


13. The polynucleotide of claim 12, wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38-78, 80, 82, 84, 86, 88, 90-96 or 97.


14. The polynucleotide of claim 12 wherein the nucleotide sequence comprises SEQ ID NO:97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 170.


15. A plant or seed comprising a recombinant DNA construct, wherein the recombinant DNA construct comprises the polynucleotide of any one of claims 12 to 14 operably linked to at least one regulatory sequence.


16. A plant comprising in its genome a polynucleotide operably linked to at least one recombinant regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 129-169, 171-178, and wherein said plant exhibits either increased drought tolerance, or increased tolerance to cold stress or increased tolerance to both drought and cold stress, when compared to a control plant not comprising the recombinant regulatory element.


Other embodiments of this invention encompass:


1. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising said recombinant DNA construct


2. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208, and wherein said plant exhibits an increase in yield, biomass, or both, when compared to a control plant not comprising said recombinant DNA construct.


3. The plant of claim 2, wherein said plant exhibits said increase in yield, biomass, or both when compared, under water limiting conditions, to said control plant not comprising said recombinant DNA construct.


4. The plant of any one of claims 1 to 3, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


5. Seed of the plant of any one of claims 1 to 4, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208, and wherein a plant produced from said seed exhibits an increase in at least one trait selected from the group consisting of: drought tolerance, yield and biomass, when compared to a control plant not comprising said recombinant DNA construct.


6. A method of increasing drought tolerance in a plant, comprising:

    • (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208;
    • (b) regenerating a transgenic plant from the regenerable plant cell of (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and
    • (c) obtaining a progeny plant derived from the transgenic plant of (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.


7. A method of selecting for increased drought tolerance in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and d
    • (c) selecting the transgenic plant of part (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.


8. A method of selecting for an alteration of yield, biomass, or both in a plant, comprising:

    • (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208;
    • (b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and
    • (c) selecting the transgenic plant of part (b) that exhibits an alteration of yield, biomass or both when compared to a control plant not comprising the recombinant DNA construct.


9. The method of claim 8, wherein said selecting step (c) comprises determining whether the transgenic plant of (b) exhibits an alteration of yield, biomass or both when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.


10. The method of claim 8 or claim 9, wherein said alteration is an increase.


11. The method of any one of claims 6 to 10, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.


12. An isolated polynucleotide comprising:

    • (a) a nucleotide sequence encoding a polypeptide with drought tolerance activity, wherein the polypeptide has an amino acid sequence of at least 95% sequence identity when compared to SEQ ID NO:182, 184, 187, 188-204 or 208, based on the Clustal V method of alignment with pairwise alignment default parameters of KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5; or
    • (b) the full complement of the nucleotide sequence of (a).


13. The polynucleotide of claim 12, wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:182, 184, 187, 188-204 or 208.


14. The polynucleotide of claim 12 wherein the nucleotide sequence comprises SEQ ID NO:181, 183, 185 or 186.


15. A plant or seed comprising a recombinant DNA construct, wherein the recombinant DNA construct comprises the polynucleotide of any one of claims 12 to 14 operably linked to at least one regulatory sequence.


16. A plant comprising in its genome an endogenous polynucleotide operably linked to at least one heterologous regulatory element, wherein said endogenous polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:182, 184, 187, 188-204 or 208, and wherein said plant exhibits increased drought tolerance when compared to a control plant not comprising the heterologous regulatory element.


EXAMPLES

The present invention is further illustrated in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.


Example 1

Creation of an Arabidopsis Population with Activation-Tagged Genes


An 18.5-kb T-DNA based binary construct was created, pHSbarENDs2, that contains four multimerized enhancer elements (SEQ ID NO:1) derived from the Cauliflower Mosaic Virus 35S promoter (corresponding to sequences −341 to −64, as defined by Odell et al., Nature 313:810-812 (1985)). The construct also contains vector sequences (pUC9) and a polylinker to allow plasmid rescue, transposon sequences (Ds) to remobilize the T-DNA, and the bar gene to allow for glufosinate selection of transgenic plants. In principle, only the 10.8-kb segment from the right border (RB) to left border (LB) inclusive will be transferred into the host plant genome. Since the enhancer elements are located near the RB, they can induce cis-activation of genomic loci following T-DNA integration.



Arabidopsis activation-tagged populations were created by whole plant Agrobacterium transformation. The pHSbarENDs2 construct was transformed into Agrobacterium tumefaciens strain C58, grown in LB at 25° C. to OD600 ˜1.0. Cells were then pelleted by centrifugation and resuspended in an equal volume of 5% sucrose/0.05% Silwet L-77 (OSI Specialties, Inc). At early bolting, soil grown Arabidopsis thaliana ecotype Col-0 were top watered with the Agrobacterium suspension. A week later, the same plants were top watered again with the same Agrobacterium strain in sucrose/Silwet. The plants were then allowed to set seed as normal. The resulting T1 seed were sown on soil, and transgenic seedlings were selected by spraying with glufosinate (Finale®; AgrEvo; Bayer Environmental Science). A total of 100,000 glufosinate resistant T1 seedlings were selected. T2 seed from each line was kept separate.


Example 2

Screens to Identify Lines with Enhanced Drought Tolerance


Quantitative Drought Screen:


From each of 96,000 separate T1 activation-tagged lines, nine glufosinate resistant T2 plants are sown, each in a single pot on Scotts® Metro-Mix® 200 soil. Flats are configured with 8 square pots each. Each of the square pots is filled to the top with soil. Each pot (or cell) is sown to produce 9 glufosinate resistant seedlings in a 3×3 array.


The soil is watered to saturation and then plants are grown under standard conditions (i.e., 16 hour light, 8 hour dark cycle; 22° C.; ˜60% relative humidity). No additional water is given.


Digital images of the plants are taken at the onset of visible drought stress symptoms. Images are taken once a day (at the same time of day), until the plants appear dessicated. Typically, four consecutive days of data is captured. Color analysis is employed for identifying potential drought tolerant lines.


Color analysis can be used to measure the increase in the percentage of leaf area that falls into a yellow color bin. Using hue, saturation and intensity data (“HSI”), the yellow color bin consists of hues 35 to 45.


Maintenance of leaf area is also used as another criterion for identifying potential drought tolerant lines, since Arabidopsis leaves wilt during drought stress. Maintenance of leaf area can be measured as reduction of rosette leaf area over time.


Leaf area is measured in terms of the number of green pixels obtained using the LemnaTec imaging system. Activation-tagged and control (e.g., wild-type) plants are grown side by side in flats that contain 72 plants (9 plants/pot). When wilting begins, images are measured for a number of days to monitor the wilting process. From these data wilting profiles are determined based on the green pixel counts obtained over four consecutive days for activation-tagged and accompanying control plants. The profile is selected from a series of measurements over the four day period that gives the largest degree of wilting. The ability to withstand drought is measured by the tendency of activation-tagged plants to resist wilting compared to control plants.


LemnaTec HTSBonitUV software is used to analyze CCD images. Estimates of the leaf area of the Arabidopsis plants are obtained in terms of the number of green pixels. The data for each image is averaged to obtain estimates of mean and standard deviation for the green pixel counts for activation-tagged and wild-type plants. Parameters for a noise function are obtained by straight line regression of the squared deviation versus the mean pixel count using data for all images in a batch. Error estimates for the mean pixel count data are calculated using the fit parameters for the noise function. The mean pixel counts for activation-tagged and wild-type plants are summed to obtain an assessment of the overall leaf area for each image. The four-day interval with maximal wilting is obtained by selecting the interval that corresponds to the maximum difference in plant growth. The individual wilting responses of the activation-tagged and wild-type plants are obtained by normalization of the data using the value of the green pixel count of the first day in the interval. The drought tolerance of the activation-tagged plant compared to the wild-type plant is scored by summing the weighted difference between the wilting response of activation-tagged plants and wild-type plants over day two to day four; the weights are estimated by propagating the error in the data. A positive drought tolerance score corresponds to an activation-tagged plant with slower wilting compared to the wild-type plant. Significance of the difference in wilting response between activation-tagged and wild-type plants is obtained from the weighted sum of the squared deviations.


Lines with a significant delay in yellow color accumulation and/or with significant maintenance of rosette leaf area, when compared to the average of the whole flat, are designated as Phase 1 hits. Phase 1 hits are re-screened in duplicate under the same assay conditions. When either or both of the Phase 2 replicates show a significant difference (score of greater than 0.9) from the whole flat mean, the line is then considered a validated drought tolerant line.


Example 3
Identification of Activation-Tagged Genes

Genes flanking the T-DNA insert in drought tolerant lines are identified using one, or both, of the following two standard procedures: (1) thermal asymmetric interlaced (TAIL) PCR (Liu et al., (1995), Plant J. 8:457-63); and (2) SAIFF PCR (Siebert et al., (1995) Nucleic Acids Res. 23:1087-1088). In lines with complex multimerized T-DNA inserts, TAIL PCR and SAIFF PCR may both prove insufficient to identify candidate genes. In these cases, other procedures, including inverse PCR, plasmid rescue and/or genomic library construction, can be employed.


A successful result is one where a single TAIL or SAIFF PCR fragment contains a T-DNA border sequence and Arabidopsis genomic sequence.


Once a tag of genomic sequence flanking a T-DNA insert is obtained, candidate genes are identified by alignment to publicly available Arabidopsis genome sequence.


Specifically, the annotated gene nearest the 35S enhancer elements/T-DNA RB are candidates for genes that are activated.


To verify that an identified gene is truly near a T-DNA and to rule out the possibility that the TAIL/SAIFF fragment is a chimeric cloning artifact, a diagnostic PCR on genomic DNA is done with one oligo in the T-DNA and one oligo specific for the candidate gene. Genomic DNA samples that give a PCR product are interpreted as representing a T-DNA insertion. This analysis also verifies a situation in which more than one insertion event occurs in the same line, e.g., if multiple differing genomic fragments are identified in TAIL and/or SAIFF PCR analyses.


Example 4A
Identification of Activation-Tagged PAP Polypeptide Gene

Two different activation-tagged lines (No. 112380 and No. 105633) showing drought tolerance were further analyzed. DNA from the lines was extracted, and genes flanking the T-DNA insert in the mutant lines were identified using SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A PCR amplified fragment was identified that contained T-DNA border sequence and Arabidopsis genomic sequence. Genomic sequence flanking the T-DNA insert was obtained, and the candidate gene was identified by alignment to the completed Arabidopsis genome. For a given T-DNA integration event, the annotated gene nearest the 35S enhancer elements/T-DNA RB was the candidate for gene that is activated in the line. In the case of lines 112380 and 105633, the insertions were inside the At5g03070 gene. Approximately 2 kb downstream of At5g03070 is At5g03080 (SEQ ID NO:16; NCBI GI No. 42567603), encoding a AT-PAP polypeptide (SEQ ID NO:17; NCBI GI No. 15242619).


Example 4B
Assay for Expression Level of Candidate Drought Tolerance Genes

A functional activation-tagged allele should result in either up-regulation of the candidate gene in tissues where it is normally expressed, ectopic expression in tissues that do not normally express that gene, or both.


Expression levels of the candidate genes in the cognate mutant line vs. wild-type are compared. A standard RT-PCR procedure, such as the QuantiTect® Reverse Transcription Kit from Qiagen®, is used. RT-PCR of the actin gene is used as a control to show that the amplification and loading of samples from the mutant line and wild-type are similar.


Assay conditions are optimized for each gene. Expression levels are checked in mature rosette leaves. If the activation-tagged allele results in ectopic expression in other tissues (e.g., roots), it is not detected by this assay. As such, a positive result is useful but a negative result does not eliminate a gene from further analysis.


Example 4C
Identification of Activation-Tagged DTP25 Polypeptide Gene

An activation-tagged line (No. 109282) showing drought tolerance was further analyzed. DNA from the line was extracted, and genes flanking the T-DNA insert in the mutant line were identified using SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A PCR amplified fragment was identified that contained T-DNA border sequence and Arabidopsis genomic sequence. Genomic sequence flanking the T-DNA insert was obtained, and the candidate gene was identified by alignment to the completed Arabidopsis genome. For a given T-DNA integration event, the annotated gene nearest the 35S enhancer elements/T-DNA RB or LB was the candidate for gene that is activated in the line. In the case of line 109282, the gene nearest the LB of the 35S enhancer elements/T-DNA at the integration site was At3g02640 (SEQ ID NO:97; NCBI GI No. 30678629), encoding a DTP25 polypeptide (SEQ ID NO:98; NCBI GI No. 18396262).


Example 4D
Identification of Activation-Tagged DTP46 Polypeptide Gene

An activation-tagged line (No. 118280) showing drought tolerance was further analyzed. DNA from the line was extracted, and genes flanking the T-DNA insert in the mutant line were identified using SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A PCR amplified fragment was identified that contained T-DNA border sequence and Arabidopsis genomic sequence. Genomic sequence flanking the T-DNA insert was obtained, and the candidate gene was identified by alignment to the completed Arabidopsis genome. For a given T-DNA integration event, the annotated gene nearest the 35S enhancer elements/T-DNA RB was the candidate for gene that is activated in the line. In the case of line 118280, the T-DNA was inserted into the 3′UTR of At5g19120 with the 35S enhancer elements pointing back towards the 5′ end of the gene At5g19120 (SEQ ID NO:181; NCBI GI No. 145358201), encoding an AT-DTP46 polypeptide (SEQ ID NO:182; NCBI GI No. 15239656).


Example 5A
Validation of Arabidopsis Candidate Gene At5g03080 (PAP Polypeptide) via Transformation into Arabidopsis

Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated “lead gene” in Arabidopsis.


The candidate Arabidopsis PAP polypeptide gene (At5g03080; SEQ ID NO:16; NCBI GI No. 42567603) was tested for its ability to confer drought tolerance in the following manner.


A 16.8-kb T-DNA based binary vector, called pBC-yellow, was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed.


The At5g03080 cDNA protein-coding region was amplified by RT-PCR with the following primers:









(1) At5g03080-5′attB forward primer 


(SEQ ID NO: 12):


TTAAACAAGTTTGTACAAAAAAGCAGGCTCAACAATGGACCTAATAC





CTCAGCAG





(2) At5g03080-3′attB reverse primer 


(SEQ ID NO: 13):


TTAAACCACTTTGTACAAGAAAGCTGGGTTTAATCAGATTTAGCAGA





ATC






The forward primer contains the attB1 sequence (ACAAGTTTGTACAAAAAAGCAGGCT; SEQ ID NO:10) and a consensus Kozak sequence (CAACA) adjacent to the first 21 nucleotides of the protein-coding region, beginning with the ATG start codon.


The reverse primer contains the attB2 sequence (ACCACTTTGTACAAGAAAGCTGGGT; SEQ ID NO:11) adjacent to the reverse complement of the last 21 nucleotides of the protein-coding region, beginning with the reverse complement of the stop codon.


Using the INVITROGEN™ GATEWAY® CLONASE™ technology, a BP Recombination Reaction was performed with pDONR™/Zeo. This process removed the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™/Zeo and directionally cloned the PCR product with flanking attB1 and attB2 sites creating an entry clone, PHP42498. This entry clone was used for a subsequent LR Recombination Reaction with a destination vector, as follows.


A 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow, was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences (SEQ ID NO:4). The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed. Using the INVITROGEN™GATEWAY® technology, an LR Recombination Reaction was performed on the PHP42498 entry clone, containing the directionally cloned PCR product, and pBC-yellow. This allowed for rapid and directional cloning of the candidate gene behind the 35S promoter in pBC-yellow to create the 35S promoter:At5g03080 expression construct, pBC-Yellow-At5g03080.


Applicants then introduced the 35S promoter: At5g03080 expression construct into wild-type Arabidopsis ecotype Col-0, using the same Agrobacterium-mediated transformation procedure described in Example 1. Transgenic T1 seeds were selected by yellow fluorescence, and T1 seeds were plated next to wild-type seeds and grown under water limiting conditions. Growth conditions and imaging analysis were as described in Example 2. It was found that the original drought tolerance phenotype from activation tagging could be recapitulated in wild-type Arabidopsis plants that were transformed with a construct where At5g03080 was directly expressed by the 35S promoter. The drought tolerance score, as determined by the method of Example 2, was 1.562.


Example 5B
Validation of Arabidopsis Candidate Gene At3q02640 (AT-DTP25 Polypeptide) via Transformation into Arabidopsis

Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated “lead gene” in Arabidopsis.


The candidate Arabidopsis DTP25 polypeptide gene (AtDTP25; SEQ ID NO:97; NCBI GI NO. 30678629) was tested for its ability to confer drought tolerance in the following manner.


A 16.8-kb T-DNA based binary vector, called pBC-yellow (PCT Publication No. WO/2012/058528; herein incorporated by reference), was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed.


The At3g02640 protein-coding region (the At3g02640 gene does not contain any introns) was amplified by RT-PCR with the following primers:









(3) At3g02640-5′attB forward primer 


SEQ ID NO: 95):


TTAAACAAGTTTGTACAAAAAAGCAGGCTCAACAATGGGTTTAATTC





CTCAACCA





(4) At3g02640-3′attB reverse primer 


(SEQ ID NO: 96):


TTAAACCACTTTGTACAAGAAAGCTGGGTTCAAACTTGGAACGCCCA





TGG






The forward primer contains the attB1 sequence (ACAAGTTTGTACAAAAAAGCAGGCT; SEQ ID NO:10) and a consensus Kozak sequence (CAACA) adjacent to the first 21 nucleotides of the protein-coding region, beginning with the ATG start codon.


The reverse primer contains the attB2 sequence (ACCACTTTGTACAAGAAAGCTGGGT; SEQ ID NO:11) adjacent to the reverse complement of the last 21 nucleotides of the protein-coding region, beginning with the reverse complement of the stop codon.


Using the INVITROGEN™ GATEWAY® CLONASE™ technology, a BP Recombination Reaction was performed with pDONR™/Zeo (PCT Publication No. WO/2012/058528; herein incorporated by reference). This process removed the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™/Zeo and directionally cloned the PCR product with flanking attB1 and attB2 sites creating an entry clone, PHP42496. This entry clone was used for a subsequent LR Recombination Reaction with a destination vector, as follows.


A 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow (PCT Publication No. WO/2012/058528; herein incorporated by reference), was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® 01 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed. Using the INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed on the PHP42496 entry clone, containing the directionally cloned PCR product, and pBC-yellow. This allowed for rapid and directional cloning of the candidate gene behind the 35S promoter in pBC-yellow to create the 35S promoter:At3g02640 expression construct, pBC-Yellow-At3g02640.


Applicants then introduced the 35S promoter:At3g02640 expression construct into wild-type Arabidopsis ecotype Col-0, using the same Agrobacterium-mediated transformation procedure described in Example 1. Transgenic T1 seeds were selected by yellow fluorescence, and T1 seeds were plated next to wild-type seeds and grown under water limiting conditions. Growth conditions and imaging analysis were as described in Example 2. It was found that the original drought tolerance phenotype from activation tagging could be recapitulated in wild-type Arabidopsis plants that were transformed with a construct where At3g02640 was directly expressed by the 35S promoter. The drought tolerance score, as determined by the method of Example 2, was 1.863.


Example 5C

Validation of Arabidopsis Candidate Gene At5g19120 (AT-DTP46 Polypeptide) via Transformation into Arabidopsis


Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated “lead gene” in Arabidopsis.


The candidate Arabidopsis DTP46 polypeptide gene (At5g19120; SEQ ID NO:181; NCBI GI No. 145358201) was tested for its ability to confer drought tolerance in the following manner.


A 16.8-kb T-DNA based binary vector, called pBC-yellow (PCT Publication No. WO/2012/058528; herein incorporated by reference), was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® C1 conversion insert. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed.


The At5g19120 cDNA protein-coding region was amplified by RT-PCR with the following primers:









(5) At5g19120-5′attB forward primer 


(SEQ ID NO: 179):


TTAAACAAGTTTGTACAAAAAAGCAGGCTCAACAATGGCTTCTTCTTC





TTGTTTG





(6) At5g19120-3′attB reverse primer 


(SEQ ID NO: 180):


TTAAACCACTTTGTACAAGAAAGCTGGGTTTACAACGAAGTTGAATC





AGA






The forward primer contains the attB1 sequence (ACAAGTTTGTACAAAAAAGCAGGCT; SEQ ID NO:10) and a consensus Kozak sequence (CAACA) adjacent to the first 21 nucleotides of the protein-coding region, beginning with the ATG start codon.


The reverse primer contains the attB2 sequence (ACCACTTTGTACAAGAAAGCTGGGT; SEQ ID NO:11) adjacent to the reverse complement of the last 18 nucleotides of the protein-coding region, beginning with the reverse complement of the stop codon.


Using the INVITROGEN™ GATEWAY® CLONASE™ technology, a BP Recombination Reaction was performed with pDONR™/Zeo (PCT Publication No. WO/2012/058528; herein incorporated by reference). This process removed the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™/Zeo and directionally cloned the PCR product with flanking attB1 and attB2 sites creating an entry clone, PHP37240. This entry clone was used for a subsequent LR Recombination Reaction with a destination vector, as follows.


A 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow (PCT Publication No. WO/2012/058528; herein incorporated by reference), was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN™ GATEWAY® 01 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN™), which confers yellow fluorescence to transformed seed. Using the INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed on the PHP37240 entry clone, containing the directionally cloned PCR product, and pBC-yellow. This allowed for rapid and directional cloning of the candidate gene behind the 35S promoter in pBC-yellow to create the 35S promoter:At5g19120 expression construct, pBC-Yellow-At5g19120.


Applicants then introduced the 35S promoter:At5g19120 expression construct into wild-type Arabidopsis ecotype Col-0, using the same Agrobacterium-mediated transformation procedure described in Example 1. Transgenic T1 seeds were selected by yellow fluorescence, and T1 seeds were plated next to wild-type seeds and grown under water limiting conditions. Growth conditions and imaging analysis were as described in Example 2. It was found that the original drought tolerance phenotype from activation tagging could be recapitulated in wild-type Arabidopsis plants that were transformed with a construct where At5g19120 was directly expressed by the 35S promoter. The drought tolerance score, as determined by the method of Example 2, was 5.316.


Example 6A
Preparation of cDNA Libraries and Isolation and Sequencing of cDNA Clones

cDNA libraries may be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in UNI-ZAP™ XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, Calif.). The UNI-ZAP™ XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBLUESCRIPT®. In addition, the cDNAs may be introduced directly into precut BLUESCRIPT® II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBLUESCRIPT® plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or “ESTs”; see Adams et al., (1991) Science 252:1651-1656). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.


Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers. Confirmation of clone identification is performed by sequence alignment to the original EST sequence from which the FIS request is made.


Confirmed templates are transposed via the Primer Island transposition kit (PE Applied Biosystems, Foster City, Calif.) which is based upon the Saccharomyces cerevisiae Ty1 transposable element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772). The in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules. The transposed DNA is then used to transform DH10B electro-competent cells (GIBCO BRL/Life Technologies, Rockville, Md.) via electroporation. The transposable element contains an additional selectable marker (named DHFR; Fling and Richards (1983) Nucleic Acids Res. 11:5147-5158), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI PRISM® dye-terminator ReadyReaction mix) outward from the transposition event site, utilizing unique primers specific to the binding sites within the transposon.


Sequence data is collected (ABI PRISM® Collections) and assembled using Phred and Phrap (Ewing et al. (1998) Genome Res. 8:175-185; Ewing and Green (1998) Genome Res. 8:186-194). Phred is a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files. The Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (Gordon et al. (1998) Genome Res. 8:195-202).


In some of the clones the cDNA fragment may correspond to a portion of the 3′-terminus of the gene and does not cover the entire open reading frame. In order to obtain the upstream information one of two different protocols is used. The first of these methods results in the production of a fragment of DNA containing a portion of the desired gene sequence while the second method results in the production of a fragment containing the entire open reading frame. Both of these methods use two rounds of PCR amplification to obtain fragments from one or more libraries. The libraries some times are chosen based on previous knowledge that the specific gene should be found in a certain tissue and sometimes are randomly-chosen. Reactions to obtain the same gene may be performed on several libraries in parallel or on a pool of libraries. Library pools are normally prepared using from 3 to 5 different libraries and normalized to a uniform dilution. In the first round of amplification both methods use a vector-specific (forward) primer corresponding to a portion of the vector located at the 5′-terminus of the clone coupled with a gene-specific (reverse) primer. The first method uses a sequence that is complementary to a portion of the already known gene sequence while the second method uses a gene-specific primer complementary to a portion of the 3′-untranslated region (also referred to as UTR). In the second round of amplification a nested set of primers is used for both methods. The resulting DNA fragment is ligated into a pBLUESCRIPT® vector using a commercial kit and following the manufacturer's protocol. This kit is selected from many available from several vendors including INVITROGEN™ (Carlsbad, Calif.), Promega Biotech (Madison, Wis.), and GIBCO-BRL (Gaithersburg, Md.). The plasmid DNA is isolated by alkaline lysis method and submitted for sequencing and assembly using Phred/Phrap, as above.


An alternative method for preparation of cDNA Libraries and obtainment of sequences can be the following. mRNAs can be isolated using the Qiagen® RNA isolation kit for total RNA isolation, followed by mRNA isolation via attachment to oligo(dT) Dynabeads from Invitrogen (Life Technologies, Carlsbad, Calif.), and sequencing libraries can be prepared using the standard mRNA-Seq kit and protocol from Illumina, Inc. (San Diego, Calif.). In this method, mRNAs are fragmented using a ZnCl2 solution, reverse transcribed into cDNA using random primers, end repaired to create blunt end fragments, 3′ A-tailed, and ligated with Illumina paired-end library adaptors. Ligated cDNA fragments can then be PCR amplified using Illumina paired-end library primers, and purified PCR products can be checked for quality and quantity on the Agilent Bioanalyzer DNA 1000 chip prior to sequencing on the Genome Analyzer II equipped with a paired end module.


Reads from the sequencing runs can be soft-trimmed prior to assembly such that the first base pair of each read with an observed FASTQ quality score lower than 15 and all subsequent bases are clipped using a Python script. The Velvet assembler (Zerbino et al. Genome Research 18:821-9 (2008)) can be run under varying kmer and coverage cutoff parameters to produce several putative assemblies along a range of stringency. The contiguous sequences (contigs) within those assemblies can be combined into clusters using Vmatch software (available on the Vmatch website) such that contigs which are identified as substrings of longer contigs are grouped and eliminated, leaving a non-redundant set of longest “sentinel” contigs. These non-redundant sets can be used in alignments to homologous sequences from known model plant species.


Example 6B
cDNA Indexing and Assembly

Plants were treated either with drought or with nitrogen deficiency. Aerial and root tissues were harvested separately. Total RNA was then extracted separately from leaf and root tissues and subsequently polyA RNA was purified. PolyA RNAs were subjected to RNA ligase-mediated full-length transcript enrichment method. First strand cDNAs were synthesized using SUPERSCRIPT® III with barcoded 3′ primers which differentiate transcripts source (root vs aerial). These cDNAs were then combined and subjected to second strand synthesis. Normalization of cDNAs was performed using a modified EVROGEN® protocol. After SfiI digestion and size fractionation, cDNAs were cloned into pENTR™-SfiI vector. For indexing process, independent clones were arrayed into 384 well plates, a total of 260 plates per library. Each clone was then PCR amplified, using barcode primers. 1,536 clones having unique barcodes in their 5′ and 3′ ends were pooled as one sample and processed to have one ILLUMINA® tag. A total of 8 samples (12,288 clones) were loaded onto one lane of Hi-seq sequencer and sequenced.


Assembly:


Reads from the sequencing runs can be soft-trimmed prior to assembly such that the first base pair of each read with an observed FASTQ quality score lower than 15 and all subsequent bases are clipped using a Python script. The Velvet assembler (Zerbino et al. (2008) Genome Research 18:821-829) can be run under varying kmer and coverage cutoff parameters to produce several putative assemblies along a range of stringency. The contiguous sequences (contigs) within those assemblies can be combined into clusters using Vmatch software (available on the Vmatch website) such that contigs which are identified as substrings of longer contigs are grouped and eliminated, leaving a non-redundant set of longest “sentinel” contigs. These non-redundant sets can be used in alignments to homologous sequences from known model plant species.


Bar-coded reads can be extended from both ends of a clone with the SSAKE assembler (Warren et al. Bioinformatics. 23:500-501 2007). End sequences of clones that do not assemble to completion with SSAKE can be matched to each other with the CAP3 assembler (Huang X et al. (1999) Genome Res. 9:868-877) at high stringency, with the resulting matches forming a complete contig. End sequences from clones that still fail to assemble completely are aligned with Velvet contigs from the bulk assembly at a high homology setting with BLAST, assembly of the resulting matches can be contiged with CAP3, or with the Minimo component of the AMOS package (Treangen et al. (2011) Curr Protoc Bioinformatics Unit 11.8). Clone ends that fail to complete are stored as incomplete assemblies.


Example 7
Identification of cDNA Clones

cDNA clones encoding PAP, DTp25 and DTP46 polypeptides can be identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410; see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health) searches for similarity to amino acid sequences contained in the BLAST “nr” database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The DNA sequences from clones can be translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the “nr” database using the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI. The polypeptides encoded by the cDNA sequences can be analyzed for similarity to all publicly available amino acid sequences contained in the “nr” database using the BLASTP algorithm provided by the National Center for Biotechnology Information (NCBI). For convenience, the P-value (probability) or the E-value (expectation) of observing a match of a cDNA-encoded sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as “pLog” values, which represent the negative of the logarithm of the reported P-value or E-value. Accordingly, the greater the pLog value, the greater the likelihood that the cDNA-encoded sequence and the BLAST “hit” represent homologous proteins.


ESTs sequences can be compared to the Genbank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTN algorithm (Altschul et al (1997) Nucleic Acids Res. 25:3389-3402) against the DUPONT™ proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction. Once the most 5-prime EST is identified, its complete sequence can be determined by Full Insert Sequencing as described above. Homologous genes belonging to different species can be found by comparing the amino acid sequence of a known gene (from either a proprietary source or a public database) against an EST database using the TBLASTN algorithm. The TBLASTN algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.


In cases where the sequence assemblies are in fragments, the percent identity to other homologous genes can be used to infer which fragments represent a single gene. The fragments that appear to belong together can be computationally assembled such that a translation of the resulting nucleotide sequence will return the amino acid sequence of the homologous protein in a single open-reading frame. These computer-generated assemblies can then be aligned with other polypeptides of the invention.


Example 8A
Characterization of cDNA Clones Encoding PAP Polypeptides

cDNA libraries representing mRNAs from various tissues of maize, rice, Bahia grass, resurrection grass, chickling vetch and pearl millet were prepared and cDNA clones encoding PAP polypeptides were identified.


The BLAST search using the sequences from clones listed in Table 1 revealed similarity of the polypeptides encoded by the cDNAs to the PAP polypeptides from various organisms. As shown in Table 4 and FIGS. 1A-1H, certain cDNAs encoded polypeptides similar to PAP polypeptide from Arabidopsis (GI No. 15242619; SEQ ID NO:17),


Shown in Table 4 (non-patent literature) and Table 5 (patent literature) are the BLASTP results for the amino acid sequences derived from the nucleotide sequences of the entire cDNA inserts (“Full-Insert Sequence” or “FIS”) of the clones listed in Table 1. Each cDNA insert encodes an entire or functional protein (“Complete Gene Sequence” or “CGS”). Also shown in Tables 2 and 3 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:









TABLE 4







BLASTP Results for PAP polypeptides












BLASTP
Percent


Sequence
NCBI GI No.
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













dpzm01g019960
195654141
>180
100


(SEQ ID NO: 19)
(SEQ ID NO: 66)




dpzm04g043730.1.1
194707170
>180
100


(SEQ ID NO: 21)
(SEQ ID NO: 68)




dpzm04g043730.1.2
194707170
>180
77.4


(SEQ ID NO: 23)
(SEQ ID NO: 68)




dpzm05g064280.1.1
194707170
>180
85.2


(SEQ ID NO: 25)
(SEQ ID NO: 68)




dpzm05g064280.1.2
194707170
>180
73


(SEQ ID NO: 27)
(SEQ ID NO: 68)




ehsf2n.pk008.o17
116778929
178
60.4


(SEQ ID NO: 29)
(SEQ ID NO: 43)




En_NODE_41174
215766799
>180
88.4


(SEQ ID NO: 31)
(SEQ ID NO: 72)




epn2n.pk047.a14
195654141
>180
94.7


(SEQ ID NO: 33)
(SEQ ID NO: 66)




gcvf3c.pk003.a24
110737805
>180
70.6


(SEQ ID NO: 35)
(SEQ ID NO: 75)




pgfp1n.pk009.k20
219888527
180
87.1


(SEQ ID NO: 37)
(SEQ ID NO: 77)




arttr1n.pk093.f13
147865849
>180
67.1


(SEQ ID NO: 89)
(SEQ ID NO: 39)




ahgr1c.pk165.p4
147865849
>180
67.4


(SEQ ID NO: 91)
(SEQ ID NO: 39)




sesgr1n.pk158.n19
147865849
>180
75.6


(SEQ ID NO: 93)
(SEQ ID NO: 39)
















TABLE 5







BLASTP Results for PAP polypeptides












BLASTP
Percent


Sequence
Reference
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













At5g03080
SEQ ID NO: 1376
>180
100


(SEQ ID NO: 17)
of U.S. Pat. No.





7,569,389





(SEQ ID NO: 65)




dpzm01g019960
SEQ ID NO: 298683
>180
100


(SEQ ID NO: 19)
of US20110214206





(SEQ ID NO: 67)




dpzm04g043730.1.1
SEQ ID NO: 358618
>180
88.9


(SEQ ID NO: 21)
of US20110214206





(SEQ ID NO: 69)




dpzm04g043730.1.2
SEQ ID NO: 358618
109
47.7


(SEQ ID NO: 23)
of US20110214206





(SEQ ID NO: 69)




dpzm05g064280.1.1
SEQ ID NO: 66003
>180
98.9


(SEQ ID NO: 25)
of US20110277178





(SEQ ID NO: 70)




dpzm05g064280.1.2
SEQ ID NO: 66003
>180
85.7


(SEQ ID NO: 27)
of US20110277178





(SEQ ID NO: 70)




ehsf2n.pk008.o17
SEQ ID NO: 184398
79
55.9


(SEQ ID NO: 29)
of US20110131679





(SEQ ID NO: 71)




En_NODE_41174
SEQ ID NO: 101048
>180
91.2


(SEQ ID NO: 31)
of US20110214205





(SEQ ID NO: 73)




epn2n.pk047.a14
SEQ ID NO: 23235
>180
95.6


(SEQ ID NO: 33)
of US20110167514





(SEQ ID NO: 74)




gcvf3c.pk003.a24
SEQ ID NO: 260063
>180
77.1


(SEQ ID NO: 35)
of US20040031072





(SEQ ID NO: 76)




pgfp1n.pk009.k20
SEQ ID NO: 101048
>180
98.2


(SEQ ID NO: 37)
of US20110214205





(SEQ ID NO: 73)




arttr1n.pk093.f13
SEQ ID NO: 1376
179
62.2


(SEQ ID NO: 89)
of US20100083407





(SEQ ID NO: 94)




ahgr1c.pk165.p4
SEQ ID NO: 184398
86
63


(SEQ ID NO: 91)
of US20110131679





(SEQ ID NO: 71)




sesgr1n.pk158.n19
SEQ ID NO: 260063
>180
84.4


(SEQ ID NO: 93)
of US20040031072





(SEQ ID NO: 76)










FIGS. 1A-1H present an alignment of the amino acid sequences of PAP polypeptides set forth in SEQ ID NOs:17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 43, 65-77, 89, 91, 93 and 94. FIG. 2 presents the percent sequence identities and divergence values for each sequence pair presented in FIGS. 1A-1H.


Sequence alignments and percent identity calculations were performed using the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.


Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode PAP polypeptides.


Example 8B
Characterization of cDNA Clones Encoding DTP25 Polypeptides

cDNA libraries representing mRNAs from various tissues of maize, rice, soybean, resurrection grass and Bahia grass were prepared and cDNA clones encoding DTP25 polypeptides were identified. The contigs were assembled from two or more EST, FIS or PCR sequences (“Contig”). DTP25 polypeptides identified from maize, Bahia grass and resurrection grass are given in Table 2, with their corresponding SEQ ID NOS.


The BLAST search using the sequences from clones listed in Table 2 revealed similarity of the polypeptides encoded by the cDNAs to the DTP25 polypeptides from various organisms. As shown in Table 6 and FIGS. 7A-7F, certain cDNAs and contigs encoded polypeptides similar to DTP25 polypeptide from Arabidopsis (GI No. 18396262; SEQ ID NO:98),


Shown in Table 6 (non-patent literature) and Table 7 (patent literature) are the BLAST results for one or more of the following: individual Expressed Sequence Tag (“EST”), the sequences of the entire cDNA inserts comprising the indicated cDNA clones (“Full-Insert Sequence” or “FIS”), the sequences of contigs assembled from two or more EST, FIS or PCR sequences (“Contig”), or sequences encoding an entire or functional protein derived from an FIS or a contig (“Complete Gene Sequence” or “CGS”). Also shown in Tables 6 and 7 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:









TABLE 6







BLASTP Results for DTP25 polypeptides












BLASTP
Percent


Sequence
NCBI GI No.
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













pco521600 (contig)
195639258
>180
99.5


(SEQ ID NO: 100)
(SEQ ID NO: 156)




pco591575 (contig)
223948063
114
100.0


(SEQ ID NO: 102)
(SEQ ID NO: 158)




pco612806 (contig)
194703618
>180
100.0


(SEQ ID NO: 104)
(SEQ ID NO: 160)




pco521599 (contig)
223945019
>180
100.0


(SEQ ID NO: 106)
(SEQ ID NO: 162)




pco521598 (contig)
194691670
>180
100.0


(SEQ ID NO: 108)
(SEQ ID NO: 164)




En_NODE_159114
195639258
>180
93.8


(SEQ ID NO: 110)
(SEQ ID NO: 156)




En_NODE_140096_60940
194691670
180
91.9


(SEQ ID NO: 112)
(SEQ ID NO: 164)




Pn_NODE_337969
195639258
>180
97.4


(SEQ ID NO: 114)
SEQ ID NO: 156




Pn_NODE_86349
194691670
175
90.6


(SEQ ID NO: 116)
(SEQ ID NO: 164)




Pn_NODE_301475
195643408
>180
90.4


(SEQ ID NO: 118)
(SEQ ID NO: 168)




sesgr1n.pk051.b9
71534995
170
82.1


(SEQ ID NO: 120)
(SEQ ID NO: 149)




ahgr1c.pk148.d21
255629403
120
58.4


(SEQ ID NO: 122)
(SEQ ID NO: 173)




ahgr1c.pk081.j23
317106645
147
65.7


(SEQ ID NO: 124)
(SEQ ID NO: 175)




ahgr1c.pk066.n24
21593832
126
59.5


(SEQ ID NO: 126)
(SEQ ID NO: 176)




hengr1n.pk110.p6
118483634
151
69.7


(SEQ ID NO: 128)
(SEQ ID NO: 178)
















TABLE 7







BLASTP Results for DTP25 polypeptides












BLASTP
Percent


Sequence
Reference
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













At3g02640
SEQ ID NO: 1227
>180
100.0


(SEQ ID NO:98)
of US20110277190





(SEQ ID NO: 155)




pco521600 (contig)
SEQ ID NO: 28392
>180
100.0


(SEQ ID NO: 100)
of US20110277190





(SEQ ID NO: 157)




pco591575 (contig)
SEQ ID NO: 23610
>180
97.9


(SEQ ID NO: 102)
of US20110277190





(SEQ ID NO: 159)




pco612806 (contig)
SEQ ID NO: 305794
>180
100.0


(SEQ ID NO: 104)
of US20110214206





(SEQ ID NO: 161)




pco521599 (contig)
SEQ ID NO: 259501
>180
100.0


(SEQ ID NO: 106)
of US20110214206





(SEQ ID NO: 163)




pco521598 (contig)
SEQ ID NO: 8392
>180
100.0


(SEQ ID NO: 108)
of US20110277190





(SEQ ID NO: 165)




En_NODE_159114
SEQ ID NO: 814
>180
93.8


(SEQ ID NO: 110)
of US20070277269





(SEQ ID NO: 166)




En_NODE_140096_60940
SEQ ID NO: 36698
>180
92.5


(SEQ ID NO: 112)
of US20110277190





(SEQ ID NO: 167)




Pn_NODE_337969
SEQ ID NO: 814
>180
97.4


(SEQ ID NO: 114)
of US20070277269





(SEQ ID NO: 166)




Pn_NODE_86349
SEQ ID NO: 36698
179
91.2


(SEQ ID NO: 116)
of US20110277190





(SEQ ID NO: 167)




Pn_NODE_301475
SEQ ID NO: 43352
>180
91.0


(SEQ ID NO: 118)
of US20110277190





(SEQ ID NO: 169)




sesgr1n.pk051.b9
SEQ ID NO: 3428
>180
78.7


(SEQ ID NO: 120)
of US20120096584





(SEQ ID NO: 172)




ahgr1c.pk148.d21
SEQ ID NO: 52002
120
67


(SEQ ID NO: 122)
of US20110277190





(SEQ ID NO: 174)




ahgr1c.pk081.j23
SEQ ID NO: 52002
73
67


(SEQ ID NO: 124)
of US20110277190





(SEQ ID NO: 174)




ahgr1c.pk066.n24
SEQ ID NO: 1598
126
59.5


(SEQ ID NO: 126)
of US20110162107





(SEQ ID NO: 177)




hengr1n.pk110.p6
SEQ ID NO: 3428
140
67.4


(SEQ ID NO: 128)
of US20120096584





(SEQ ID NO: 172)










FIGS. 7A-7F show the multiple alignment of the amino acid sequences of the DTP25 polypeptides of SEQ ID NOS: 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 149, 155-169, 172-178. FIG. 8 presents the percent sequence identities and divergence values for each sequence pair presented in FIGS. 7A-7F.


Sequence alignments and percent identity calculations were performed using the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.


Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode DTP25 polypeptides.


Example 8C

Characterization of cDNA Clones Encoding DTP46 Polypeptides


cDNA libraries representing mRNAs from various tissues of maize were prepared and cDNA clones encoding DTP46 polypeptides were identified. The characteristics of the cfp5n library is described below.









TABLE 8







cDNA Libraries from Maize











Library
Description
Clone






cfp5n
Maize Kernel, pooled stages,
cfp5n.pk063.i8:fis




Full-length enriched,





normalized*





These libraries were normalized essentially as described in U.S. Pat. No. 5,482,845






A BLAST search using the sequences from clones listed in Table 8 revealed similarity of the polypeptides encoded by the cDNAs to the DTP46 polypeptides from various organisms. Shown in Table 3 and FIGS. 12A-12E are polypeptides similar to the DTP46 polypeptide from Arabidopsis (GI No. 15239656; SEQ ID NO:182).


Shown in Table 9 (non-patent literature) and Table 10 (patent literature) are the BLASTP results for the amino acid sequences derived from the nucleotide sequences of the entire cDNA inserts (“Full-Insert Sequence” or “FIS”) of the clones listed in Table 8, and of the FGENESH prediction of the long range genomic PCR capture sequence userizea.pk002.f6.


Each nucleotide sequence shown in Tables 9 and 10 encodes an entire or functional protein (“Complete Gene Sequence” or “CGS”). Also shown in Tables 3 and 4 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters:









TABLE 9







BLASTP Results for DTP46 Polypeptides












BLASTP
Percent


Sequence
NCBI GI No.
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













cfp5n.pk063.j8 (FIS)
194706824
>180
100


(SEQ ID NO: 184)
(SEQ ID NO: 206)




FGENESH prediction of
50878438
>180
71.9


userizea.pk002.f6
(SEQ ID NO: 208)




(SEQ ID NO: 187)
















TABLE 10







BLASTP Results for DTP46 Polypeptides












BLASTP
Percent


Sequence
Reference
pLog of
Sequence


(SEQ ID NO)
(SEQ ID NO)
E-value
Identity













At5g19120
SEQ ID NO: 32757
>180
100


(SEQ ID NO: 182)
of US20100037355





(SEQ ID NO: 205)




cfp5n.pk063.j8 (FIS)
SEQ ID NO: 60221
>180
100


(SEQ ID NO: 184)
of WO2010083178





(SEQ ID NO: 207)




FGENESH prediction of
SEQ ID NO: 49506
>180
100


userizea.pk002.f6
of WO2010083178




(SEQ ID NO: 187)
(SEQ ID NO: 209)










FIGS. 12A-12E present an alignment of the amino acid sequences of DTP46 polypeptides set forth in SEQ ID NOs:182, 184, 187-189, 205-209. FIG. 13 presents the percent sequence identities and divergence values for each sequence pair presented in FIGS. 12A-12E.


Sequence alignments and percent identity calculations were performed using the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.


Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode DTP46 polypeptides.


Example 9
Preparation of a Plant Expression Vector Containing a Homolog to the Arabidopsis Lead Gene

Sequences homologous to the Arabidopsis PAP polypeptide, DTP25 polypeptide or DTP46 polypeptide can be identified using sequence comparison algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul et al., J. Mol. Biol. 215:403-410 (1993); see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health). Sequences encoding homologous PAP polypeptides, DTP25 polypeptides or DTP46 polypeptides can be PCR-amplified by any of the following methods.


Method 1 (RNA-based): If the 5′ and 3′ sequence information for the protein-coding region, or the 5′ and 3′ UTR, of a gene encoding a PAP, DTP25 or DTP46 polypeptide homolog is available, gene-specific primers can be designed as outlined in Example 5. RT-PCR can be used with plant RNA to obtain a nucleic acid fragment containing the protein-coding region flanked by attB1 (SEQ ID NO:10) and attB2 (SEQ ID NO:11) sequences. The primer may contain a consensus Kozak sequence (CAACA) upstream of the start codon.


Method 2 (DNA-based): Alternatively, if a cDNA clone is available for a gene encoding a PAP, a DTP25 or a DTP46 polypeptide homolog, the entire cDNA insert (containing 5′ and 3′ non-coding regions) can be PCR amplified. Forward and reverse primers can be designed that contain either the attB1 sequence and vector-specific sequence that precedes the cDNA insert or the attB2 sequence and vector-specific sequence that follows the cDNA insert, respectively. For a cDNA insert cloned into the vector pBulescript SK+, the forward primer VC062 (SEQ ID NO:14) and the reverse primer VC063 (SEQ ID NO:15) can be used.


Method 3 (genomic DNA): Genomic sequences can be obtained using long range genomic PCR capture. Primers can be designed based on the sequence of the genomic locus and the resulting PCR product can be sequenced. The sequence can be analyzed using the FGENESH (Salamov, A. and Solovyev, V. (2000) Genome Res., 10: 516-522) program, and optionally, can be aligned with homologous sequences from other species to assist in identification of putative introns.


The above methods can be modified according to procedures known by one skilled in the art. For example, the primers of Method 1 may contain restriction sites instead of attB1 and attB2 sites, for subsequent cloning of the PCR product into a vector containing attB1 and attB2 sites. Additionally, Method 2 can involve amplification from a cDNA clone, a lambda clone, a BAC clone or genomic DNA. A PCR product obtained by either method above can be combined with the GATEWAY® donor vector, such as pDONR™/Zeo (INVITROGEN™) or pDONR™221 (INVITROGEN™), using a BP Recombination Reaction. This process removes the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR™221 and directionally clones the PCR product with flanking attB1 and attB2 sites to create an entry clone. Using the INVITROGEN™ GATEWAY® CLONASE™ technology, the sequence encoding the homologous PAP, DTP25 or DTP46 polypeptide from the entry clone can then be transferred to a suitable destination vector, such as pBC-Yellow, PHP27840 or PHP23236, to obtain a plant expression vector for use with Arabidopsis, soybean and corn, respectively.


Sequences of the the attP1 and attP2 sites of donor vectors pDONR™/Zeo or pDONR™221 are given in SEQ ID NOS:2 and 3, respectively. The sequences of the attR1 and attR2 sites of destination vectors pBC-Yellow, PHP27840 and PHP23236 are given in SEQ ID NOS:8 and 9, respectively. A BP Reaction is a recombination reaction between an Expression Clone (or an attB-flanked PCR product) and a Donor (e.g., pDONR™) Vector to create an Entry Clone. A LR Reaction is a recombination between an Entry Clone and a Destination Vector to create an Expression Clone. A Donor Vector contains attP1 and attP2 sites. An Entry Clone contains attL1 and attL2 sites. A Destination Vector contains attR1 and attR2 site. An Expression Clone contains attB1 and attB2 sites. The attB1 site is composed of parts of the attL1 and attR1 sites. The attB2 site is composed of parts of the attL2 and attR2 sites.


Alternatively a MultiSite GATEWAY® LR recombination reaction between multiple entry clones and a suitable destination vector can be performed to create an expression vector.


Example 10
Preparation of Soybean Expression Vectors and Transformation of Soybean with Validated Arabidopsis Lead Genes

Soybean plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.


The same GATEWAY® entry clone described in Example 5A, 5B and 5C can be used to directionally clone each gene into the PHP27840 vector such that expression of the gene is under control of the SCP1 promoter (International Publication No. 03/033651).


Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides. Techniques for soybean transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.


T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in soybean to enhance drought tolerance.


Soybean plants transformed with validated genes can then be assayed under more vigorous field-based studies to study yield enhancement and/or stability under well-watered and water-limiting conditions.


Example 11
Transformation of Maize with Validated Arabidopsis Lead Genes Using Particle Bombardment

Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.


The same GATEWAY® entry clone described in Example 5A, 5B and 5C can be used to directionally clone each gene into a maize transformation vector. Expression of the gene in the maize transformation vector can be under control of a constitutive promoter such as the maize ubiquitin promoter (Christensen et al., (1989) Plant Mol. Biol. 12:619-632 and Christensen et al., (1992) Plant Mol. Biol. 18:675-689)


The recombinant DNA construct described above can then be introduced into corn cells by particle bombardment. Techniques for corn transformation by particle bombardment have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.


T1 plants can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color analysis can be taken at multiple times before and during drought stress. Overexpression constructs that result in a significant delay in wilting or leaf area reduction, yellow color accumulation and/or increased growth rate during drought stress will be considered evidence that the Arabidopsis gene functions in maize to enhance drought tolerance.


Example 12
Electroporation of Agrobacterium tumefaciens LBA4404

Electroporation competent cells (40 μL), such as Agrobacterium tumefaciens LBA4404 containing PHP10523, are thawed on ice (20-30 min). PHP10523 contains VIR genes for T-DNA transfer, an Agrobacterium low copy number plasmid origin of replication, a tetracycline resistance gene, and a Cos site for in vivo DNA bimolecular recombination. Meanwhile the electroporation cuvette is chilled on ice. The electroporator settings are adjusted to 2.1 kV. A DNA aliquot (0.5 μL parental DNA at a concentration of 0.2 μg-1.0 μg in low salt buffer or twice distilled H2O) is mixed with the thawed Agrobacterium tumefaciens LBA4404 cells while still on ice. The mixture is transferred to the bottom of electroporation cuvette and kept at rest on ice for 1-2 min. The cells are electroporated (Eppendorf electroporator 2510) by pushing the “pulse” button twice (ideally achieving a 4.0 millisecond pulse). Subsequently, 0.5 mL of room temperature 2×YT medium (or SOC medium) are added to the cuvette and transferred to a 15 mL snap-cap tube (e.g., FALCON™ tube). The cells are incubated at 28-30° C., 200-250 rpm for 3 h.


Aliquots of 250 μL are spread onto plates containing YM medium and 50 μg/mL spectinomycin and incubated three days at 28-30° C. To increase the number of transformants one of two optional steps can be performed:


Option 1: Overlay plates with 30 μL of 15 mg/mL rifampicin. LBA4404 has a chromosomal resistance gene for rifampicin. This additional selection eliminates some contaminating colonies observed when using poorer preparations of LBA4404 competent cells.


Option 2: Perform two replicates of the electroporation to compensate for poorer electrocompetent cells.


Identification of Transformants:


Four independent colonies are picked and streaked on plates containing AB minimal medium and 50 μg/mL spectinomycin for isolation of single colonies. The plates are incubated at 28° C. for two to three days. A single colony for each putative co-integrate is picked and inoculated with 4 mL of 10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride and 50 mg/L spectinomycin. The mixture is incubated for 24 h at 28° C. with shaking. Plasmid DNA from 4 mL of culture is isolated using Qiagen® Miniprep and an optional Buffer PB wash. The DNA is eluted in 30 μL. Aliquots of 2 μL are used to electroporate 20 μL of DH10b+20 μL of twice distilled H2O as per above. Optionally a 15 μL aliquot can be used to transform 75-100 μL of INVITROGEN™ Library Efficiency DH5a. The cells are spread on plates containing LB medium and 50 μg/mL spectinomycin and incubated at 37° C. overnight.


Three to four independent colonies are picked for each putative co-integrate and inoculated 4 mL of 2×YT medium (10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride) with 50 μg/mL spectinomycin. The cells are incubated at 37° C. overnight with shaking. Next, isolate the plasmid DNA from 4 mL of culture using QIAprep® Miniprep with optional Buffer PB wash (elute in 50 μL). Use 8 μL for digestion with SalI (using parental DNA and PHP10523 as controls). Three more digestions using restriction enzymes BamHI, EcoRI, and HindIII are performed for 4 plasmids that represent 2 putative co-integrates with correct SalI digestion pattern (using parental DNA and PHP10523 as controls). Electronic gels are recommended for comparison.


Example 13
Transformation of Maize Using Agrobacterium

Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.



Agrobacterium-mediated transformation of maize is performed essentially as described by Zhao et al. in Meth. Mol. Biol. 318:315-323 (2006) (see also Zhao et al., Mol. Breed. 8:323-333 (2001) and U.S. Pat. No. 5,981,840 issued Nov. 9, 1999, incorporated herein by reference). The transformation process involves bacterium innoculation, co-cultivation, resting, selection and plant regeneration.


1. Immature Embryo Preparation:


Immature maize embryos are dissected from caryopses and placed in a 2 mL microtube containing 2 mL PHI-A medium.


2. Agrobacterium Infection and Co-Cultivation of Immature Embryos:


2.1 Infection Step:


PHI-A medium of (1) is removed with 1 mL micropipettor, and 1 mL of Agrobacterium suspension is added. The tube is gently inverted to mix. The mixture is incubated for 5 min at room temperature.


2.2 Co-culture Step:


The Agrobacterium suspension is removed from the infection step with a 1 mL micropipettor. Using a sterile spatula the embryos are scraped from the tube and transferred to a plate of PHI-B medium in a 100×15 mm Petri dish. The embryos are oriented with the embryonic axis down on the surface of the medium. Plates with the embryos are cultured at 20° C., in darkness, for three days. L-Cysteine can be used in the co-cultivation phase. With the standard binary vector, the co-cultivation medium supplied with 100-400 mg/L L-cysteine is critical for recovering stable transgenic events.


3. Selection of Putative Transgenic Events:


To each plate of PHI-D medium in a 100×15 mm Petri dish, 10 embryos are transferred, maintaining orientation and the dishes are sealed with parafilm. The plates are incubated in darkness at 28° C. Actively growing putative events, as pale yellow embryonic tissue, are expected to be visible in six to eight weeks. Embryos that produce no events may be brown and necrotic, and little friable tissue growth is evident. Putative transgenic embryonic tissue is subcultured to fresh PHI-D plates at two-three week intervals, depending on growth rate. The events are recorded.


4. Regeneration of T0 Plants:


Embryonic tissue propagated on PHI-D medium is subcultured to PHI-E medium (somatic embryo maturation medium), in 100×25 mm Petri dishes and incubated at 28° C., in darkness, until somatic embryos mature, for about ten to eighteen days. Individual, matured somatic embryos with well-defined scutellum and coleoptile are transferred to PHI-F embryo germination medium and incubated at 28° C. in the light (about 80 μE from cool white or equivalent fluorescent lamps). In seven to ten days, regenerated plants, about 10 cm tall, are potted in horticultural mix and hardened-off using standard horticultural methods.


Media for Plant Transformation:

    • 1. PHI-A: 4 g/L CHU basal salts, 1.0 mL/L 1000× Eriksson's vitamin mix, 0.5 mg/L thiamin HCl, 1.5 mg/L 2,4-D, 0.69 g/L L-proline, 68.5 g/L sucrose, 36 g/L glucose, pH 5.2. Add 100 μM acetosyringone (filter-sterilized).
    • 2. PHI-B: PHI-A without glucose, increase 2,4-D to 2 mg/L, reduce sucrose to 30 g/L and supplemente with 0.85 mg/L silver nitrate (filter-sterilized), 3.0 g/L Gelrite®, 100 μM acetosyringone (filter-sterilized), pH 5.8.
    • 3. PHI-C: PHI-B without Gelrite® and acetosyringonee, reduce 2,4-D to 1.5 mg/L and supplemente with 8.0 g/L agar, 0.5 g/L 2-[N-morpholino]ethane-sulfonic acid (MES) buffer, 100 mg/L carbenicillin (filter-sterilized).
    • 4. PHI-D: PHI-C supplemented with 3 mg/L bialaphos (filter-sterilized).
    • 5. PHI-E: 4.3 g/L of Murashige and Skoog (MS) salts, (Gibco, BRL 11117-074), 0.5 mg/L nicotinic acid, 0.1 mg/L thiamine HCl, 0.5 mg/L pyridoxine HCl, 2.0 mg/L glycine, 0.1 g/L myo-inositol, 0.5 mg/L zeatin (Sigma, Cat. No. Z-0164), 1 mg/L indole acetic acid (IAA), 26.4 μg/L abscisic acid (ABA), 60 g/L sucrose, 3 mg/L bialaphos (filter-sterilized), 100 mg/L carbenicillin (filter-sterilized), 8 g/L agar, pH 5.6.
    • 6. PHI-F: PHI-E without zeatin, IAA, ABA; reduce sucrose to 40 g/L; replacing agar with 1.5 g/L Gelrite®; pH 5.6.


Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al., Bio/Technology 8:833-839 (1990)).


Transgenic T0 plants can be regenerated and their phenotype determined. T1 seed can be collected.


Furthermore, a recombinant DNA construct containing a validated Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.


Transgenic plants, either inbred or hybrid, can undergo more vigorous field-based experiments to study yield enhancement and/or stability under water limiting and water non-limiting conditions.


Subsequent yield analysis can be done to determine whether plants that contain the validated Arabidopsis lead gene have an improvement in yield performance (under water limiting or non-limiting conditions), when compared to the control (or reference) plants that do not contain the validated Arabidopsis lead gene. Specifically, water limiting conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants. Plants containing the validated Arabidopsis lead gene would have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss, under water limiting conditions, or would have increased yield, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield, relative to the control plants under water non-limiting conditions.


Example 14A
Preparation of Arabidopsis Lead Gene (At5g03080; AT-PAP) Expression Vector for Transformation of Maize

PCR amplified AT-PAP was cloned into PHP41831, to generate the plasmid PHP42946 which contains the cassette AttL4:Ubiquitin promoter:At5g03080:PinII terminator:AttL2.


Using INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed with PHP42946, PHP42833 and PHP41981 to create the plasmid PHP42968. The vector PHP42968 contains the following expression cassettes:


1. Ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Ubiquitin promoter:At5g03080:PinII terminator; cassette overexpressing the gene of interest, Arabidopsis PAP polypeptide.


Example 14B
Transformation of Maize with the Arabidopsis Lead Gene (At5q03080) Using Agrobacterium

The PAP polypeptide expression cassette present in vector PHP42968 can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.


The plasmid PHP42968 contains the 3 expression cassettes given above in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 14C
Preparation of Arabidopsis Lead Gene (At3g02640; AT-DTP25) Expression Vector for Transformation of Maize

The coding sequence of At3g02640 (SEQ ID NO:97; At-DTP25) was PCR amplified and cloned into PHP41831 vector to give the PHP42945 plasmid.


Using the INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed with the GATEWAY® entry clone PHP42945 (containing the Arabidopsis dtp25 gene), PHP42833, PHP41981, and to create a precursor plasmid (PHP42955) with the following expression cassettes:


1. Ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Ubiquitin promoter:At3g02640:PinII terminator; cassette overexpressing the gene of interest, Arabidopsis DTP25 polypeptide.


Example 14D
Transformation of Maize with the Arabidopsis Lead Gene (At3g02640; AT-DTP25) Using Agrobacterium

The DTP25 polypeptide expression cassette present in vector PHP42955 can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.


Vector PHP42955 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 to create a co-integrate vector. The co-integrate vector is formed by recombination of the 2 plasmids, PHP42955 and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector contains the same 3 expression cassettes as above (Example 14C) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 14E

Preparation of Arabidopsis Lead Gene (At5g19120; AT-DTP46) Expression Vector for Transformation of Maize


A MultiSite GATEWAY® LR recombination reaction was performed between the following multiple entry clones:


1. PHP31948, containing Att L4:Zm Ubi promoter:Zm Ubi 5′UTR:Zm Ubi intron 1:AttR1


2. PHP20234, containing AttR2:PIN II term:AttL3 and


3. PHP37240, containing AttL1:At-DTP46:AttL2;


and the destination vector PHP22655 containing AttR4:ccdB: Cmr:AttR3, to create an expression vector PHP37247. The vector PHP37247 contains the following expression cassettes:


1. Zm ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Zm ubiquitin promoter: At5g19120:PinII terminator; cassette overexpressing the gene of interest, Arabidopsis DTP46 polypeptide.


Example 14F
Transformation of Maize with the Arabidopsis Lead Gene (At5g19120; AT-DTP46) Using Agrobacterium

The AT-DTP46 polypeptide expression cassette present in vector PHP37247 can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.


Vector PHP37427 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 to create the co-integrate vector PHP37480. The co-integrate vector is formed by recombination of the 2 plasmids, PHP37427 and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector PHP37480 contains the same 3 expression cassettes as above (Example 14E) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 15
Preparation of the Destination Vector PHP23236 for Transformation into Gaspe Flint Derived Maize Lines

Destination vector PHP23236 can be obtained by transformation of Agrobacterium strain LBA4404 containing plasmid PHP10523 with plasmid PHP23235 and isolation of the resulting co-integration product. Destination vector PHP23236, can be used in a recombination reaction with an entry clone as described in Example 16 to create a maize expression vector for transformation of Gaspe Flint-derived maize lines.


Example 16A
Preparation of AT-PAP Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5A, PHP42498, can be directionally cloned into the destination vector PHP23236 to create an expression vector. This expression vector contains the protein-coding region of interest, encoding the AT-PAP polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Alternatively, using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5A, PHP42498, can be directionally cloned into the destination vector PHP29634 to create an expression vector. Destination vector PHP29634 is similar to destination vector PHP23236, however, destination vector PHP29634 has site-specific recombination sites FRT1 and FRT87 and also encodes the GAT4602 selectable marker protein for selection of transformants using glyphosate. This expression vector would contain the protein-coding region of interest, encoding the Arabidopsis AT-PAP polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 16B
Preparation of AT-DTP25 Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5, PHP42496, can be directionally cloned into the destination vector PHP23236 to create an expression vector. This expression vector contains the protein-coding region of interest, encoding the DTP25 polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Alternatively, using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5, PHP42945, can be directionally cloned into the destination vector PHP29634 to create an expression vector. Destination vector PHP29634 is similar to destination vector PHP23236, however, destination vector PHP29634 has site-specific recombination sites FRT1 and FRT87 and also encodes the GAT4602 selectable marker protein for selection of transformants using glyphosate. This expression vector contains the protein-coding region of interest, encoding the Arabidopsis DTP25 polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 16C
Preparation of AT-DTP46 Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Using the INVITROGEN™ GATEWAY® LR Recombination technology, the protein-coding region of the candidate gene described in Example 5, PHP37240, was directionally cloned into the destination vector PHP29634 (SEQ ID NO: 16) to create an expression vector, PHP38206. Destination vector PHP29634 is similar to destination vector PHP23236, however, destination vector PHP29634 has site-specific recombination sites FRT1 and FRT87 and also encodes the GAT4602 selectable marker protein for selection of transformants using glyphosate. This expression vector contains the protein-coding region of interest, encoding the Arabidopsis DTP46 polypeptide, under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 17
Transformation of Gaspe Flint Derived Maize Lines With a Validated Arabidopsis Lead Gene

Maize plants can be transformed to overexpress the Arabidopsis lead gene or the corresponding homologs from other species in order to examine the resulting phenotype.


Recipient Plants:


Recipient plant cells can be from a uniform maize line having a short life cycle (“fast cycling”), a reduced size, and high transformation potential. Typical of these plant cells for maize are plant cells from any of the publicly available Gaspe Flint (GBF) line varieties. One possible candidate plant line variety is the F1 hybrid of GBF×QTM (Quick Turnaround Maize, a publicly available form of Gaspe Flint selected for growth under greenhouse conditions) disclosed in Tomes et al. U.S. Patent Application Publication No. 2003/0221212. Transgenic plants obtained from this line are of such a reduced size that they can be grown in four inch pots (¼ the space needed for a normal sized maize plant) and mature in less than 2.5 months. (Traditionally 3.5 months is required to obtain transgenic T0 seed once the transgenic plants are acclimated to the greenhouse.) Another suitable line is a double haploid line of GS3 (a highly transformable line) X Gaspe Flint. Yet another suitable line is a transformable elite inbred line carrying a transgene which causes early flowering, reduced stature, or both.


Transformation Protocol:


Any suitable method may be used to introduce the transgenes into the maize cells, including but not limited to inoculation type procedures using Agrobacterium based vectors. Transformation may be performed on immature embryos of the recipient (target) plant.


Precision Growth and Plant Tracking:


The event population of transgenic (T0) plants resulting from the transformed maize embryos is grown in a controlled greenhouse environment using a modified randomized block design to reduce or eliminate environmental error. A randomized block design is a plant layout in which the experimental plants are divided into groups (e.g., thirty plants per group), referred to as blocks, and each plant is randomly assigned a location with the block.


For a group of thirty plants, twenty-four transformed, experimental plants and six control plants (plants with a set phenotype) (collectively, a “replicate group”) are placed in pots which are arranged in an array (a.k.a. a replicate group or block) on a table located inside a greenhouse. Each plant, control or experimental, is randomly assigned to a location with the block which is mapped to a unique, physical greenhouse location as well as to the replicate group. Multiple replicate groups of thirty plants each may be grown in the same greenhouse in a single experiment. The layout (arrangement) of the replicate groups should be determined to minimize space requirements as well as environmental effects within the greenhouse. Such a layout may be referred to as a compressed greenhouse layout.


An alternative to the addition of a specific control group is to identify those transgenic plants that do not express the gene of interest. A variety of techniques such as RT-PCR can be applied to quantitatively assess the expression level of the introduced gene. T0 plants that do not express the transgene can be compared to those which do.


Each plant in the event population is identified and tracked throughout the evaluation process, and the data gathered from that plant is automatically associated with that plant so that the gathered data can be associated with the transgene carried by the plant. For example, each plant container can have a machine readable label (such as a Universal Product Code (UPC) bar code) which includes information about the plant identity, which in turn is correlated to a greenhouse location so that data obtained from the plant can be automatically associated with that plant.


Alternatively any efficient, machine readable, plant identification system can be used, such as two-dimensional matrix codes or even radio frequency identification tags (RFID) in which the data is received and interpreted by a radio frequency receiver/processor. See U.S. Published Patent Application No. 2004/0122592, incorporated herein by reference.


Phenotypic Analysis Using Three-Dimensional Imaging:


Each greenhouse plant in the T0 event population, including any control plants, is analyzed for agronomic characteristics of interest, and the agronomic data for each plant is recorded or stored in a manner so that it is associated with the identifying data (see above) for that plant. Confirmation of a phenotype (gene effect) can be accomplished in the T1 generation with a similar experimental design to that described above.


The T0 plants are analyzed at the phenotypic level using quantitative, non-destructive imaging technology throughout the plant's entire greenhouse life cycle to assess the traits of interest. A digital imaging analyzer may be used for automatic multi-dimensional analyzing of total plants. The imaging may be done inside the greenhouse. Two camera systems, located at the top and side, and an apparatus to rotate the plant, are used to view and image plants from all sides. Images are acquired from the top, front and side of each plant. All three images together provide sufficient information to evaluate the biomass, size and morphology of each plant.


Due to the change in size of the plants from the time the first leaf appears from the soil to the time the plants are at the end of their development, the early stages of plant development are best documented with a higher magnification from the top. This may be accomplished by using a motorized zoom lens system that is fully controlled by the imaging software.


In a single imaging analysis operation, the following events occur: (1) the plant is conveyed inside the analyzer area, rotated 360 degrees so its machine readable label can be read, and left at rest until its leaves stop moving; (2) the side image is taken and entered into a database; (3) the plant is rotated 90 degrees and again left at rest until its leaves stop moving, and (4) the plant is transported out of the analyzer.


Plants are allowed at least six hours of darkness per twenty four hour period in order to have a normal day/night cycle.


Imaging Instrumentation:


Any suitable imaging instrumentation may be used, including but not limited to light spectrum digital imaging instrumentation commercially available from LemnaTec GmbH of Wurselen, Germany. The images are taken and analyzed with a LemnaTec Scanalyzer HTS LT-0001-2 having a ½″ IT Progressive Scan IEE CCD imaging device. The imaging cameras may be equipped with a motor zoom, motor aperture and motor focus. All camera settings may be made using LemnaTec software. For example, the instrumental variance of the imaging analyzer is less than about 5% for major components and less than about 10% for minor components.


Software:


The imaging analysis system comprises a LemnaTec HTS Bonit software program for color and architecture analysis and a server database for storing data from about 500,000 analyses, including the analysis dates. The original images and the analyzed images are stored together to allow the user to do as much reanalyzing as desired. The database can be connected to the imaging hardware for automatic data collection and storage. A variety of commercially available software systems (e.g. Matlab, others) can be used for quantitative interpretation of the imaging data, and any of these software systems can be applied to the image data set.


Conveyor System:


A conveyor system with a plant rotating device may be used to transport the plants to the imaging area and rotate them during imaging. For example, up to four plants, each with a maximum height of 1.5 m, are loaded onto cars that travel over the circulating conveyor system and through the imaging measurement area. In this case the total footprint of the unit (imaging analyzer and conveyor loop) is about 5 m×5 m.


The conveyor system can be enlarged to accommodate more plants at a time. The plants are transported along the conveyor loop to the imaging area and are analyzed for up to 50 seconds per plant. Three views of the plant are taken. The conveyor system, as well as the imaging equipment, should be capable of being used in greenhouse environmental conditions.


Illumination:


Any suitable mode of illumination may be used for the image acquisition. For example, a top light above a black background can be used. Alternatively, a combination of top- and backlight using a white background can be used. The illuminated area should be housed to ensure constant illumination conditions. The housing should be longer than the measurement area so that constant light conditions prevail without requiring the opening and closing or doors. Alternatively, the illumination can be varied to cause excitation of either transgene (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP)) or endogenous (e.g. Chlorophyll) fluorophores.


Biomass Estimation Based on Three-Dimensional Imaging:


For best estimation of biomass the plant images should be taken from at least three axes, for example, the top and two side (sides 1 and 2) views. These images are then analyzed to separate the plant from the background, pot and pollen control bag (if applicable). The volume of the plant can be estimated by the calculation:





Volume(voxels)=√{square root over (TopArea(pixels))}×√{square root over (Side1Area(pixels))}×√{square root over (Side2Area(pixels))}


In the equation above the units of volume and area are “arbitrary units”. Arbitrary units are entirely sufficient to detect gene effects on plant size and growth in this system because what is desired is to detect differences (both positive-larger and negative-smaller) from the experimental mean, or control mean. The arbitrary units of size (e.g. area) may be trivially converted to physical measurements by the addition of a physical reference to the imaging process. For instance, a physical reference of known area can be included in both top and side imaging processes. Based on the area of these physical references a conversion factor can be determined to allow conversion from pixels to a unit of area such as square centimeters (cm2). The physical reference may or may not be an independent sample. For instance, the pot, with a known diameter and height, could serve as an adequate physical reference.


Color Classification:


The imaging technology may also be used to determine plant color and to assign plant colors to various color classes. The assignment of image colors to color classes is an inherent feature of the LemnaTec software. With other image analysis software systems color classification may be determined by a variety of computational approaches.


For the determination of plant size and growth parameters, a useful classification scheme is to define a simple color scheme including two or three shades of green and, in addition, a color class for chlorosis, necrosis and bleaching, should these conditions occur. A background color class which includes non plant colors in the image (for example pot and soil colors) is also used and these pixels are specifically excluded from the determination of size. The plants are analyzed under controlled constant illumination so that any change within one plant over time, or between plants or different batches of plants (e.g. seasonal differences) can be quantified.


In addition to its usefulness in determining plant size growth, color classification can be used to assess other yield component traits. For these other yield component traits additional color classification schemes may be used. For instance, the trait known as “staygreen”, which has been associated with improvements in yield, may be assessed by a color classification that separates shades of green from shades of yellow and brown (which are indicative of senescing tissues). By applying this color classification to images taken toward the end of the T0 or T1 plants' life cycle, plants that have increased amounts of green colors relative to yellow and brown colors (expressed, for instance, as Green/Yellow Ratio) may be identified. Plants with a significant difference in this Green/Yellow ratio can be identified as carrying transgenes which impact this important agronomic trait.


The skilled plant biologist will recognize that other plant colors arise which can indicate plant health or stress response (for instance anthocyanins), and that other color classification schemes can provide further measures of gene action in traits related to these responses.


Plant Architecture Analysis:


Transgenes which modify plant architecture parameters may also be identified using the present invention, including such parameters as maximum height and width, internodal distances, angle between leaves and stem, number of leaves starting at nodes and leaf length. The LemnaTec system software may be used to determine plant architecture as follows. The plant is reduced to its main geometric architecture in a first imaging step and then, based on this image, parameterized identification of the different architecture parameters can be performed. Transgenes that modify any of these architecture parameters either singly or in combination can be identified by applying the statistical approaches previously described.


Pollen Shed Date:


Pollen shed date is an important parameter to be analyzed in a transformed plant, and may be determined by the first appearance on the plant of an active male flower. To find the male flower object, the upper end of the stem is classified by color to detect yellow or violet anthers. This color classification analysis is then used to define an active flower, which in turn can be used to calculate pollen shed date.


Alternatively, pollen shed date and other easily visually detected plant attributes (e.g. pollination date, first silk date) can be recorded by the personnel responsible for performing plant care. To maximize data integrity and process efficiency this data is tracked by utilizing the same barcodes utilized by the LemnaTec light spectrum digital analyzing device. A computer with a barcode reader, a palm device, or a notebook PC may be used for ease of data capture recording time of observation, plant identifier, and the operator who captured the data.


Orientation of the Plants:


Mature maize plants grown at densities approximating commercial planting often have a planar architecture. That is, the plant has a clearly discernable broad side, and a narrow side. The image of the plant from the broadside is determined. To each plant a well defined basic orientation is assigned to obtain the maximum difference between the broadside and edgewise images. The top image is used to determine the main axis of the plant, and an additional rotating device is used to turn the plant to the appropriate orientation prior to starting the main image acquisition.


Example 18A
Evaluation of Gaspe Flint Derived Maize Lines for Drought Tolerance

Transgenic Gaspe Flint derived maize lines containing the candidate gene can be screened for tolerance to drought stress in the following manner.


Transgenic maize plants are subjected to well-watered conditions (control) and to drought-stressed conditions. Transgenic maize plants are screened at the T1 stage or later.


For plant growth, the soil mixture consists of ⅓ TURFACE®, ⅓ SB300 and ⅓ sand. All pots are filled with the same amount of soil ±10 grams. Pots are brought up to 100% field capacity (“FC”) by hand watering. All plants are maintained at 60% FC using a 20-10-20 (N—P-K) 125 ppm N nutrient solution. Throughout the experiment pH is monitored at least three times weekly for each table. Starting at 13 days after planting (DAP), the experiment can be divided into two treatment groups, well watered and reduce watered. All plants comprising the reduced watered treatment are maintained at 40% FC while plants in the well watered treatment are maintained at 80% FC. Reduced watered plants are grown for 10 days under chronic drought stress conditions (40% FC). All plants are imaged daily throughout chronic stress period. Plants are sampled for metabolic profiling analyses at the end of chronic drought period, 22 DAP. At the conclusion of the chronic stress period all plants are imaged and measured for chlorophyll fluorescence. Reduced watered plants are subjected to a severe drought stress period followed by a recovery period, 23-31 DAP and 32-34 DAP respectively. During the severe drought stress, water and nutrients are withheld until the plants reached 8% FC. At the conclusion of severe stress and recovery periods all plants are again imaged and measured for chlorophyll fluorescence. The probability of a greater Student's t Test is calculated for each transgenic mean compared to the appropriate null mean (either segregant null or construct null). A minimum (P<t) of 0.1 is used as a cut off for a statistically significant result.


Example 18B
Evaluation of Maize Lines for Drought Tolerance

Lines with Enhanced Drought Tolerance can also be screened using the following method (see also FIG. 3 for treatment schedule):


Transgenic maize seedlings are screened for drought tolerance by measuring chlorophyll fluorescence performance, biomass accumulation, and drought survival. Transgenic plants are compared against the null plant (i.e., not containing the transgene). Experimental design is a Randomized Complete Block and Replication consist of 13 positive plants from each event and a construct null (2 negatives each event).


Plant are grown at well watered (WW) conditions=60% Field Capacity (% FC) to a three leaf stage. At the three leaf stage and under WW conditions the first fluorescence measurement is taken on the uppermost fully extended leaf at the inflection point, in the leaf margin and avoiding the mid rib.


This is followed by imposing a moderate drought stress (FIG. 3, day 13, MOD DRT) by maintaining 20% FC for duration of 9 to 10 days. During this stress treatment leaves may appear gray and rolling may occur. At the end of MOD DRT period, plants are recovered (MOD rec) by increasing to 25% FC. During this time, leaves will begin to unroll. This is a time sensitive step that may take up to 1 hour to occur and can be dependent upon the construct and events being tested. When plants appear to have recovered completed (leaves unrolled), the second fluorescence measurement is taken.


This is followed by imposing a severe drought stress (SEV DRT) by withholding all water until the plants collapse. Duration of severe drought stress is 8-10 days and/or when plants have collapse. Thereafter, a recovery (REC) is imposed by watering all plants to 100% FC. Maintain 100% FC 72 hours. Survival score (yes/no) is recorded after 24, 48 and 72 hour recovery.


The entire shoot (Fresh) is sampled and weights are recorded (Fresh shoot weights). Fresh shoot material is then dried for 120 hrs at 70 degrees at which time a Dry Shoot weight is recorded.


Measured variables are defined as follows:


The variable “Fv′/Fm′ no stress” is a measure of the optimum quantum yield (Fv′/Fm′) under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib. Fv′/Fm′ provides an estimate of the maximum efficiency of PSII photochemistry at a given PPFD, which is the PSII operating efficiency if all the PSII centers were open (QA oxidized).


The variable “Fv′/Fm′ stress” is a measure of the optimum quantum yield (Fv′/Fm′) under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.


The variable “phiPSII_no stress” is a measure of Photosystem II (PSII) efficiency under optimal water conditions on the uppermost fully extended leaf (most often the third leaf) at the inflection point, in the leaf margin and avoiding the mid rib. The phiPSII value provides an estimate of the PSII operating efficiency, which estimates the efficiency at which light absorbed by PSII is used for QA reduction.


The variable “phiPSII_stress” is a measure of Photosystem II (PSII) efficiency under water stressed conditions (25% field capacity). The measure is preceded by a moderate drought period where field capacity drops from 60% to 20%. At which time the field capacity is brought to 25% and the measure collected.


Example 19A
Yield Analysis of Maize Lines with the Arabidopsis Lead Gene

A recombinant DNA construct containing a validated Arabidopsis gene can be introduced into an elite maize inbred line either by direct transformation or introgression from a separately transformed line.


Transgenic plants, either inbred or hybrid, can undergo more vigorous field-based experiments to study yield enhancement and/or stability under well-watered and water-limiting conditions.


Subsequent yield analysis can be done to determine whether plants that contain the validated Arabidopsis lead gene have an improvement in yield performance under water-limiting conditions, when compared to the control plants that do not contain the validated Arabidopsis lead gene. Specifically, drought conditions can be imposed during the flowering and/or grain fill period for plants that contain the validated Arabidopsis lead gene and the control plants. Reduction in yield can be measured for both. Plants containing the validated Arabidopsis lead gene have less yield loss relative to the control plants, for example, at least 25%, at least 20%, at least 15%, at least 10% or at least 5% less yield loss.


The above method may be used to select transgenic plants with increased yield, under water-limiting conditions and/or well-watered conditions, when compared to a control plant not comprising said recombinant DNA construct. Plants containing the validated Arabidopsis lead gene may have increased yield, under water-limiting conditions and/or well-watered conditions, relative to the control plants, for example, at least 5%, at least 10%, at least 15%, at least 20% or at least 25% increased yield.


Example 19B
Yield Analysis of Maize Lines Transformed with PHP42968 Encoding the Arabidopsis Lead Gene At5g03080

The AT-PAP polypeptide present in the vector PHP42968 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14A and 14B.


Ten transgenic events were field tested in 2011 at 5 locations, A, B, C, D and E. At the location B, drought conditions were imposed during flowering (this treatment was divided into 2 areas B1 and B2) and during the grain fill period (“grain fill stress”; B3). The location A was well-watered, and the location E experienced mild drought during the grain-filling period. Both locations C and D experienced severe stress.


Yield data were collected in all locations in 2011, with 4-6 replicates per location.


Yield data (bushel/acre; bu/ac) for 2011 for the 10 transgenic events is shown in FIG. 4 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased Prediction) (Cullis, B. R et al (1998) Biometrics 54: 1-18, Gilmour, A. R. et al (2009). ASRemI User Guide 3.0, Gilmour, A. R., et al (1995) Biometrics 51: 1440-50).


To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.


In the single location analysis, main effect of construct is considered as a random effect. (However, construct effect might be considered as fixed in other circumstances). The main effect of event is considered as random. The blocking factors such as replicates and incblock (incomplete block design) within replicates are considered as random.


There are 3 components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1*AR1 to remove the noise caused by spatial variation in the field.


In the multi-location analysis (ML), main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as replicates and incblock within replicates are considered as random.


We performed single_loc analysis across_loc analysis (last column in FIG. 4) and calculated blup (Best Linear Unbiased Prediction) for each event. The significance test between the event and BN was performed using a p-value of 0.1 in a two-tailed test, and the results are shown in FIG. 4. The significant values showing positive effect (with p-value less than or equal to 0.1 with a 2-tailed test) are shown in bold.


As shown in FIG. 4, small but consistent effect of the transgene on yield was seen across locations that resulted in a significant positive effect for 6 of the 10 events, with the positive event magnitude ranging from 4 to 7 bu/ac.


Example 19C
Yield Analysis of Maize Lines Transformed with PHP42968 Encoding the Arabidopsis Lead Gene At5q03080

The AT-PAP polypeptide present in the vector PHP42968 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14A and 14B.


Nine transgenic events were field tested as toperosses using two contrasting inbred lines as testers, Tester 1 and Tester 2 in 2012 at the locations A, B, C, D and E. At the location B, drought conditions were imposed from the mid vegetative stage up to the onset of flowering (this treatment was divided into 2 areas B1 and B2) and during the grain fill period (grain fill stress; B3). The location A had supplemental irrigation and experienced only mild stress despite the widespread drought conditions in Iowa in 2012. The location E experienced mild drought during the grain-filling period. Both locations C and D experienced severe vegetative stage stress.


Yield data were collected in all locations in 2012, with 4-6 replicates per location.


Yield data (bushel/acre; bu/ac) for 2012 for the nine transgenic events is shown in FIG. 5 and FIG. 6 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased Prediction) (Cullis, B. R et al (1998) Biometrics 54: 1-18, Gilmour, A. R. et al (2009). ASRemI User Guide 3.0, Gilmour, A. R., et al (1995) Biometrics 51: 1440-50).


To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.


In the single location analysis, main effect of construct is considered as a random effect. (However, construct effect might be considered as fixed in other circumstances). The main effect of event is considered as random. The blocking factors such as replicates and incblock (incomplete block design) within replicates are considered as random.


There are 3 components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1*AR1 to remove the noise caused by spatial variation in the field.


In the multi-location analysis (ML), main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as replicates and incblock within replicates are considered as random.


We performed single_loc analysis across_loc analysis (last column in FIG. 5 and FIG. 6) and calculated blup (Best Linear Unbiased Prediction) for each event. The significance test between the event and BN was performed using a p-value of 0.1 in a two-tailed test, and the results are shown in FIG. 5 and FIG. 6. The significant values (with p-value less than or equal to 0.1 with a 2-tailed test) are shown in bold when the value is greater than the null comparator and in bold and italics when that value is less than the null.


As shown in FIG. 5 and FIG. 6, the effect of the transgene on yield was negative for several events in 2012, particularly in the lowest-yielding locations (shown in bold and italics), in the across-location analysis, the overall effect of the transgene was negative for both testers. This contrasts with 2011 results, and may have been due to the severe early drought experienced in 2012. In contrast to the yield data collected for the whole plot by combine harvester, this construct produced larger individual ears on well-bordered plants in the interior of the plot, in the single location tester combination where individual ear traits were measured (Table 11). These traits are measured for 10 evenly spaced plants in the center of the plot, which are identified for harvest at the early vegetative stage to avoid sampling bias. Ears are harvested at maturity and are imaged to quantify ear length (EARLGT), kernel number (PHTKPE), and the predicted weight of the grain on that ear (PHTYLD) based on a calibration of kernel area to grain weight. PHP42968 resulted in significantly longer ears and predicted yield of individually measured ears from fully bordered plants. This was associated with a significant increase of twelve kernels per ear. These characteristics were measured in the B3 location, where combine yield was 112 bu/ac for the null, indicating substantial drought stress.


This contrast between whole plot performance and the characteristics of individual ears can reflect differences in the ability of a variety to “flex” and increase the size of exterior ears. Variation in ear flex reflects fundamental differences in the internal signaling dynamics that control kernel set in maize.











TABLE 11







Plasmid

B3


(Promoter::

Tester 2












CDS)
Event
EARLGT
PHTKPE
PHTYLD
Yield





BN(Empty)
BN
15.00
420.00
121.00
112.00


PHP42968
E9276.43.1.20
(++)16
(++)432
(++)126

custom-character



(UBI::
E9276.43.1.21
(++)16
(++)432
(++)126

custom-character



AT-PAP)
E9276.43.1.24
(++)16
(++)432
(++)126

custom-character




E9276.43.2.1
(++)16
(++)432
(++)126

custom-character




E9276.43.2.16
(++)16
(++)432
(++)126

custom-character




E9276.43.2.21
(++)16
(++)432
(++)126

custom-character




E9276.43.2.22
(++)16
(++)432
(++)126

custom-character




E9276.43.3.11
(++)16
(++)432
(++)126

custom-character










Example 19D

Yield Analysis of Maize Lines Transformed with PHP42955 Encoding the Arabidopsis Lead Gene At3g02640 (AT-DTP25) The DTP25 polypeptide present in the vector PHP42955 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14C and 14D.


Nine transgenic events were field tested in 2010 at 5 locations, A, B, C, D and E. At the location B drought conditions were imposed during flowering (this treatment was divided into 2 areas B1 and B2) and during the grain fill period (“grain fill stress”; B3). The location A was well-watered, and the location E experienced mild drought during the grain-filling period. Both C and D locations experienced severe stress.


Yield data were collected in all locations in 2011, with 4-6 replicates per location.


Yield data (bushel/acre; bu/ac) for 2011 for the 9 transgenic events is shown in FIG. 4 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased Prediction) (Cullis, B. R et al. (1998) Biometrics 54: 1-18; Gilmour, A. R. et al. (2009) ASRemI User Guide 3.0; Gilmour, A. R., et al. (1995) Biometrics 51: 1440-50).


To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.


In the single location analysis, main effect of construct is considered as a random effect. (However, construct effect might be considered as fixed in other circumstances). The main effect of event is considered as random. The blocking factors such as replicates and incblock (incomplete block design) within replicates are considered as random.


There are 3 components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1*AR1 to remove the noise caused by spatial variation in the field.


In the multi-location analysis (ML-216), main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as replicates and incblock within replicates are considered as random.


We performed single_loc analysis across_loc analysis (last column in FIG. 9) and calculated blup (Best Linear Unbiased Prediction) for each event. The significance test between the event and BN was performed using a p-value of 0.1 in a two-tailed test, and the results are shown in FIG. 9. The significant values (with p-value less than or equal to 0.1 with a 2-tailed test) are shown in bold font.


As shown in FIG. 9, the effect of the transgene on yield was positive and significant for at three events in one location, two events in another, and one in a third location. In the across-location analysis, the overall effect of the transgene was positive, with four events reaching statistical significance.


Example 19E
Yield Analysis of Maize Lines transformed with PHP42955 Encoding the Arabidopsis Lead Gene At3q02640 (AT-DTP25)

The DTP25 polypeptide present in the vector PHP42955 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14C and 14D.


Eight transgenic events were field tested as toperosses using two contrasting inbred lines as testers, tester 1 and tester 2, in 2012 at 5 locations A, B, C, D and E.


At the location B, drought conditions were imposed from the mid-vegetative stage up to the onset of flowering (this treatment was divided into 2 areas B1 and B2) and during the grain fill period (grain fill stress; B3). The location A had supplemental irrigation and experienced only mild stress despite the widespread drought conditions in 2012. The location E experienced mild drought during the grain-filling period. Both the locations C and D experienced severe vegetative stage stress.


Yield data were collected in all locations in 2012, with 4-6 replicates per location.


Yield data (bushel/acre; bu/ac) for 2012 for the 8 transgenic events is shown in FIG. 5 and FIG. 6 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased Prediction) (Cullis, B. R et al (1998) Biometrics 54: 1-18, Gilmour, A. R. et al (2009). ASRemI User Guide 3.0, Gilmour, A. R., et al (1995) Biometrics 51: 1440-50).


To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.


In the single location analysis, main effect of construct is considered as a random effect. (However, construct effect might be considered as fixed in other circumstances). The main effect of event is considered as random. The blocking factors such as replicates and incblock (incomplete block design) within replicates are considered as random.


There are 3 components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1*AR1 to remove the noise caused by spatial variation in the field.


In the multi-location analysis (ML), main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as replicates and incblock within replicates are considered as random.


We performed single_loc analysis across_loc analysis (last column in FIG. 10 and FIG. 11) and calculated blup (Best Linear Unbiased Prediction) for each event. The significance test between the event and BN was performed using a p-value of 0.1 in a two-tailed test, and the results are shown in FIG. 10 and FIG. 11. The significant values (with p-value less than or equal to 0.1 with a 2-tailed test) are shown in bold when the value is greater than the null comparator and in bold and italics when that value is less than the null.


As shown in FIG. 10 and FIG. 11, the effect of the transgene on yield was negative for several events in 2012, particularly in the lowest-yielding locations (shown in bold and italics), in the across-location analysis, the overall effect of the transgene was negative for both testers. This contrasts with 2011 results, and may have been due to the severe early drought experienced in 2012. In contrast to the yield data collected for the whole plot by combine harvester, this construct produced larger individual ears on well-bordered plants in the interior of the plot, in the single location tester combination where individual ear traits were measured (Table 12). These traits are measured for 10 evenly spaced plants in the center of the plot, which are identified for harvest at the early vegetative stage to avoid sampling bias. Ears are harvested at maturity and are imaged to quantify ear length EARLGT), kernel number (PHTKPE), and the predicted weight of the grain on that ear (PHTYLD) based on a calibration of kernel area to grain weight. PHP42955 resulted in significantly longer ears (bold) and predicted yield. This was associated with 9 more kernels per ear, though that difference was not significant. This contrast between whole plot performance (last column in Table 12/yield for whole plot) and the characteristics of individual ears can reflect differences in the ability of a variety to “flex” and increase the size of exterior ears. Variation in ear flex reflects fundamental differences in the internal signaling dynamics that control kernel set in maize.










TABLE 12








B3



Tester 2












Plasmid
Factor/Event
EARLGT
PHTKPE
PHTYLD
Yield





BN
BN
15.00
420.00
121.00
112.00


PHP42955*
E9276.43.1.20
(++)16
(+−)429
(++)124
(− −)110



E9276.43.1.21



(− −)111



E9276.43.1.24
(+−)16
(+−)429
(++)124

custom-character




E9276.43.2.1
(++)16
(+−)429
(++)124
(− −)111



E9276.43.2.16
(++)16
(+−)429
(++)124

custom-character




E9276.43.2.21
(++)16
(+−)429
(++)124

custom-character




E9276.43.2.22
(+−)16
(+−)429
(++)124

custom-character




E9276.43.3.11
(++)16
(+−)429
(++)124

custom-character






*Plasmid PHP42955 contains: Ubiquitin promoter::AT-DTP25::PinII terminator






Example 19F
Yield Analysis of Maize Lines Transformed with PHP37480 Encoding the Arabidopsis Lead Gene At5g19120 (AT-DTP46)

The DTP46 polypeptide present in the cointegrate vector PHP37480 was introduced into a transformable maize line derived from an elite maize inbred line as described in Examples 14E and 14F.


Yield data were collected from three locations in 2010 (locations E, A, B), with 4-8 replicates per location. Yield data (bushel/acre; bu/ac) for the 10 transgenic events is shown in FIG. 14 together with the bulk null control (BN). Yield analysis was by ASREML (VSN International Ltd), and the values are BLUPs (Best Linear Unbiased Prediction) (Cullis, B. R et al (1998) Biometrics 54: 1-18, Gilmour, A. R. et al (2009); ASRemI User Guide 3.0, Gilmour, A. R., et al (1995) Biometrics 51: 1440-50).


To analyze the yield data, a mixed model framework was used to perform the single and multi location analysis.


In the single_location analysis, main effect of construct is considered as fixed effects in this analysis; however, construct effect might be considered as random effect in other circumstances. The main effect of event is considered as random effects. The blocking factors such as replicates and incblock (incomplete block design) within rep are considered as random.


There are three components of spatial effects including x_adj, y_adj and autoregressive correlation as AR1*AR1 to remove the noise caused by spatial.


In the multi_location analysis, main effect of loc_id, construct and their interaction are considered as fixed effects in this analysis. The main effect of event and its interaction with loc_id are considered as random effects. The blocking factors such as rep and incblock within rep are considered as random.


We performed single_loc (locations “E”, “A” and “B”) and across_loc analysis (“E, A, B”) and got the blups (Best Linear Unbiased Prediction) for event. The significant test between the event and BN was performed and the results are shown in FIG. 14.


As shown in FIG. 14, the effect of the transgene on yield was significant and positive for all events in location A. Minimal variation was detected among events; for this reason the average effect of the construct, PHP37480 is attributed to each event and they all show the same 8 bushel advantage in the figure. Location A was a wet environment in 2010. In location E, the effect of the gene was consistently positive by 1 to 4 bushels, but not significantly better than the null. In location B, the effect was neutral (some non-sig positive, some non-sig negative). In the across-location analysis (last column in the table), 3 events were identified as yielding significantly more than the null. No significant differences were observed in plant or ear height or flowering date. There was a tendency for slightly higher grain moisture at harvest; this difference was significant for 1 event in location E and for 2 events in location A. The data is shown in FIG. 14. The significant values (with p-value less than or equal to 0.1 with a 2-tailed test) are shown in bold.


Example 20A
Preparation of Maize PAP polypeptide Lead Gene Expression Vector for Transformation of Maize

Clones dpzm01g019960, dpzm04g043730.1.1, dpzm04g043730.1.2, dpzm05g064280.1.1 and dpzm05g064280.1.2 encode maize PAP polypeptides designated “Zm-PAP1”, “Zm-PAP2”, “Zm-PAP3”, “Zm-PAP4” and “Zm-PAP5” (SEQ ID NOS:19, 21, 23, 25 and 27, respectively). The protein-coding region of these clones can be introduced into the INVITROGEN™ vector pENTR/D-TOPO® to create entry clones.


Using INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction can be performed with an entry clone and a destination vector to create the precursor plasmid. The vector would contain the following expression cassettes:


1. Ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Ubiquitin promoter:Zm-PAP-Polypeptide:PinII terminator; cassette overexpressing the gene of interest, maize PAP polypeptide.


Example 20B
Transformation of Maize with Maize PAP Polypeptide Lead Gene Using Agrobacterium

The maize PAP polypeptide expression cassette present in the vector can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.


The vector can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 to create a co-integrate vector. The co-integrate vector is formed by recombination of the 2 plasmids, the Zm-PAP expression cassette vector and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector contains the same 3 expression cassettes as above (Example 20A) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 20C
Preparation of Maize DTP25 Polypeptide Lead Gene Expression Vector for Transformation of Maize

Contigs pco521600, pco591575, pco612806, pco521599, and pco521598 encode maize DTP25 polypeptides designated “Zm-DTP25-1”, “Zm-DTP25-2”, “Zm-DTP25-3”, “Zm-DTP25-4”, and “Zm-DTP25-5” (SEQ ID NOS:100, 102, 104, 106 and 108). The protein-coding region of clones pco521600, pco591575, pco612806, pco521599, and pco521598 can be introduced into the INVITROGEN™ vector pENTR/D-TOPO® to create entry clones.


Using INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction can be performed with an entry clone and a destination vector to create a precursor plasmid. The precursor plasmid contains the following expression cassettes:


1. Ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Ubiquitin promoter:Zm-DTP25-Polypeptide:PinII terminator; cassette overexpressing the gene of interest, maize DTP25 polypeptide.


Example 20D

Transformation of Maize with Maize DTP25 Polypeptide Lead Gene Using Agrobacterium


The maize DTP25 polypeptide expression cassette present in the vector described in example 20A can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13. This vector can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 to create a co-integrate vector. The co-integrate vector is formed by recombination of the 2 plasmids, the expression vector and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector contains the same 3 expression cassettes as above (Example 20C) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 20E
Preparation of Maize DTP46 Polypeptide Lead Gene Expression Vector for Transformation of Maize

Clones cfp5n.pk063.i8, and the FGENESH prediction for the genomic PCR capture sequence userizea.pk002.f6 encode complete DTP46 polypeptides and are designated as Zm-DTP6-1 and Zm-DTP6-2 (presented in SEQ ID NOS:184 and 187, respectively). The protein-coding region of the clones Zm-DTP6-1 and Zm-DTP6-2 can be introduced into the INVITROGEN™ vector pENTR/D-TOPO® to create entry clones.


Using INVITROGEN™ GATEWAY® technology, an LR Recombination Reaction was performed with an entry clone and a destination vector to create a precursor plasmid. The precursor plasmid contains the following expression cassettes:


1. Ubiquitin promoter:moPAT:PinII terminator; cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.


2. LTP2 promoter:DS-RED2:PinII terminator; cassette expressing the DS-RED color marker gene used for seed sorting.


3. Ubiquitin promoter:Zm-DTP46-Polypeptide:PinII terminator; cassette overexpressing the gene of interest, maize DTP46 polypeptide.


Example 20F
Transformation of Maize with Maize DTP46 Polypeptide Lead Gene Using Agrobacterium

The maize DTP46 polypeptide expression cassette present in the precursor plasmid described in example 20A can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13.


The precursor plasmid can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 to create a co-integrate vector. The co-integrate vector is formed by recombination of the 2 plasmids, the precursor plasmid from example 20A and PHP10523, through the COS recombination sites contained on each vector. The co-integrate vector contains the same 3 expression cassettes as above (Example 20E) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR C1, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation.


Example 21A
Preparation of Maize Expression Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Clones dpzm01g019960, dpzm04g043730.1.1, dpzm04g043730.1.2, dpzm05g064280.1.1 and dpzm05g064280.1.2 encode maize PAP polypeptides designated “Zm-PAP1”, “Zm-PAP2”, “Zm-PAP3”, “Zm-PAP4” and “Zm-PAP5” (SEQ ID NOS:19, 21, 23, 25 and 27 respectively).


Using the INVITROGEN™ GATEWAY® Recombination technology described in Example 9, the clones encoding maize PAP polypeptide homologs can be directionally cloned into the destination vector PHP23236 to create expression vectors. Each expression vector will contain the cDNA of interest under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 21B
Preparation of Maize Expression Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Contigs pco521600, pco591575, pco612806, pco521599, and pco521598 encode a complete maize DTP25 polypeptide homologs designated “Zm-DTP25-1”, “Zm-DTP25-2”, “Zm-DTP25-3”, “Zm-DTP25-4”, and “Zm-DTP25-5” (SEQ ID NOS:100, 102, 104, 106 and 108).


Using the INVITROGEN™ GATEWAY® Recombination technology described in Example 9, the clones encoding maize DTP25 polypeptide homologs can be directionally cloned into the destination vector PHP23236 to create expression vectors. Each expression vector contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 21C
Preparation of Maize Expression Plasmids for Transformation into Gaspe Flint Derived Maize Lines

Clones cfp5n.pk063.i8, and the FGENESH prediction for the genomic PCR capture sequence userizea.pk002.f6 encode complete DTP46 polypeptides and are designated as Zm-DTP6-1 and Zm-DTP6-2, (presented in SEQ ID NOS:184 and 187 respectively).


Using the INVITROGEN™ GATEWAY® Recombination technology described in Example 9, the clones encoding maize DTP46 polypeptide homologs were directionally cloned into the destination vector PHP23236 to create expression vectors. Each expression vector contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary vector for Agrobacterium-mediated transformation into corn as described, but not limited to, the examples described herein.


Example 22
Transformation and Evaluation of Soybean with Soybean Homologs of Validated Lead Genes

Based on homology searches, one or several candidate soybean homologs of validated Arabidopsis lead genes can be identified and also be assessed for their ability to enhance drought tolerance in soybean. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.


Example 23
Transformation of Arabidopsis with Maize and Soybean Homologs of Validated Lead Genes

Soybean and maize homologs to validated Arabidopsis lead genes can be transformed into Arabidopsis under control of the 35S promoter and assessed for their ability to enhance drought tolerance in Arabidopsis. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.


Example 24
Screen for Seedling Emergence Under Cold Temperature Stress

Seeds from an Arabidopsis activation-tagged mutant line can be tested for emergence after cold stress at 4° C. Each trial can consist of a 96 well plate of MS/GELRITE® medium with an individual seed in each well. MS/GELRITE® medium is prepared as follows: 0.215 g of PHYTOTECHNOLOGY LABORATORIES™ Murashige and Skoog (MS) basal salt mixture per 100 ml of medium, pH adjusted to 5.6 with KOH, GELRITE® to 0.6%; the medium is autoclaved for 30 min. Row “A” of each plate is filled with Arabidopsis thaliana Colombia wild-type seed as a control. The seeds are sterilized with 20% bleach (20% bleach; 0.05% TWEEN® 20) and placed into 1% agarose. The sterilized seed is covered with aluminum and placed into the wall refrigerator at 4° C. for three days. After cold dark stratification treatment the seeds are plated onto 96 well plates and placed in a dark growth chamber at 4° C. Each plate is labeled with a unique plate number. On the third day after plating, germination counts are taken using a dissecting microscope. The plates are then removed from 4° C. and placed on the lab bench at 22-25° C. Seedlings are allowed to grow within the plates until the two leaf stage (3-4 days), and are sprayed with glufosinate herbicide (e.g., 0.002% FINALE® herbicide). After the non-transgenic seedlings have died from the herbicide spray (approximately three days), the number of germinated activation-tagged transgenic seeds are assessed.


Example 25A
Chilling Stress at Grain-Fill Cross-Validation Assay

A systematic screen to identify mutants tolerant to chilling stress at grain fill is presented.


Materials and Methods:


Arabidopsis transgenic plants are transformed with a vector carrying the candidate gene cDNA sequence driven by the CaMV 35S promoter and a fluorescent marker. T2 seeds of sieve 60 size (250 μm) are separated into transgenic and non-transgenic pools by fluorescence presence and absence using COPAS™ (Complex Object Parametric Analyzer and Sorter). Transgenic seeds are used as test lines. Non-transgenic lines are used as susceptible controls.


Test and control lines seeds are cold shocked and planted on soil in 100 pots of 2 inch square for each test or control line with excess seed per pot. Seedlings of similar sizes at one week post-germination are selected and excess seedlings are discarded. Plants are grown under non-stressed conditions of 22° C./16 h light and 20° C./8 h dark and inflorescence bolt lengths are monitored from day 30 after planting. Twenty plants per line showing bolts with lengths ranging from 1 to 2 inches are selected for the assay. Ten of the twenty plants are transferred to chilling stress conditions of 7° C./16 h light and 4° C./8 h dark. The remaining ten plants are transferred to control conditions of 22° C./light and 20° C./8 h dark.


After 7 days of incubation, three traits are measured: shoot fresh weight, total branch length and silique number. The shoot of each plant is clipped at the shoot/root junction and the shoot fresh weight is immediately measured. The primary bolt is clipped and primary and secondary branch lengths are immediately measured and summed to calculate the total branch length. The number of plump siliques elongated above petals height is counted. Test lines under stress conditions that show increase relative to the susceptible control in at least one of the three traits measurements with Student's t-test p-value of 0.05 and below are considered as significant positive leads.


Example 25B
Data from Chilling Stress at Grain-Fill Cross-Validation Assay

AT-DTP25 transgenic lines were assayed as described above. Table 13 shows total branch length (TBL), silique number (SN) and shoot fresh weight (SFW) results for SEQ ID NO:97.















TABLE 13





TBL_Comp
TBL_p
SN_Comp
SN_p
SFW_Comp
SFW_p
CSGF Results







+
0.55
+
0.41
+
0.03
Positive SFW





Comparison (“Comp”) values of “+” or “−” indicate that a test line had a positive or negative trait value as compared to the control line. The p-value is with respect to the difference between the test and control lines.






In Table 13 SEQ ID NO:97 was positive for shoot fresh weight with t-test p-value of 0.03 and was thus considered a significantly positive lead.

Claims
  • 1-5. (canceled)
  • 6. A method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17;(b) regenerating a transgenic plant from the regenerable plant cell of (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and(c) obtaining a progeny plant derived from the transgenic plant of (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant not comprising the recombinant DNA construct.
  • 7. A method of selecting for increased drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17;(b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and(c) selecting the plant of (b) with increased drought tolerance compared to a control plant not comprising the recombinant DNA construct.
  • 8. A method of selecting for an increase of yield, biomass, or both in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17;(b) growing the transgenic plant of part (a) under conditions wherein the polynucleotide is expressed; and(c) selecting the plant of (b) that exhibits an increase of yield, biomass or both when compared to a control plant not comprising the recombinant DNA construct.
  • 9. The method of claim 8, wherein said selecting step (c) comprises determining whether the progeny plant of (b) exhibits an increase of yield, biomass or both when compared, under water limiting conditions, to a control plant not comprising the recombinant DNA construct.
  • 10. (canceled)
  • 11. The method of claim 8, wherein said plant is selected from the group consisting of: Arabidopsis, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane and switchgrass.
  • 12-16. (canceled)
CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 61/714,312, filed Oct. 16, 2012, U.S. Provisional Application No. 61/714,320, filed Oct. 16, 2012, U.S. Provisional Application No. 61/739,454, filed Dec. 19, 2012, U.S. Provisional Application No. 61/775,720, filed Mar. 8, 2013, and U.S. Provisional Application No. 61/786,679, filed Mar. 15, 2013, the entire content of each is herein incorporated by reference.

Provisional Applications (5)
Number Date Country
61714312 Oct 2012 US
61714320 Oct 2012 US
61739454 Dec 2012 US
61775720 Mar 2013 US
61786679 Mar 2013 US