Patent Application
20220275055
This application contains a Sequence Listing, which is submitted electronically via EFS-Web in ASCII format with a file name H5292-00001-SEQTXT, creation date of Mar. 3, 2022, and a size of 11 kB. This sequence listing submitted is part of the specification and is herein incorporated by reference in its entirety.
Fibrosis, the thickening and scarring of connective tissue that can result from injury, is characterized by the excessive proliferation of fibroblast cells and the accumulation of extracellular matrix (ECM) components. This disorder, which is commonly observed in organs including lungs, livers, and kidneys, among many others, causes disrupted tissue architecture and leads to major impairments in organ function1,2. Indeed, fibrosis can develop in nearly every organ and is a major cause of end-stage organ failure and death in a large variety of chronic diseases3. A common feature of pulmonary fibrosis is the excessive proliferation of fibroblasts around the air sacs of lungs (alveoli)4. Extensive biomedical studies have established that an increased number of fibroblasts, in combination with their excessive ECM deposition in the lung ultimately cause alveolar structure destruction, decreased lung compliance, and disrupted gas exchange function5-7.
The most common type of pulmonary fibrosis is idiopathic pulmonary fibrosis (IPF). This disorder eventually affects entire lung lobes, but it begins with microscopic fibrotic lesions that occur at the peripheral regions and slowly progress inward, and this fibrosis can ultimately lead to respiratory failure8,9. IPF is a fatal disease with the median survival time of only 2-4 years from diagnosis10. Scientifically, the mechanisms and nature of the pathological progression of IPF are not fully understood, although multiple studies have implicated contributions from a specific subset of alveolar epithelial cells-alveolar type II (AT2) cells4,11.
The pulmonary fibrosis patient has decreased lung compliance, disrupted gas exchange, and ultimately respiratory failure and death. It is estimated that IPF affects 1 of 200 adults over the age of 65 in the United States, with a median survival time of 2-4 years. In China, the estimated incidence of IPF is 3-5/100,000, accounting for about 65% of all interstitial lung diseases. The diagnosis is usually made between 50 and 70 years old, and the ratio of male to female is 1.5 to 2:1. The survival time of the patient is usually only 2-5 years.
Currently, there is no cure for IPF. Two known drugs, nintedanib and pirfenidone, have similar effects on the rate of decline in forced vital capacity over 1 year. Although the both drugs showed a tendency of reducing mortality, these two drugs failed to show significantly increased survival time. One of main reasons is that there is no ideal drug target of pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF), so as to screen candidate drugs for treating pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF).
The present invention relates to a drug target for idiopathic pulmonary fibrosis, and the use thereof. The drug target is AREG signaling in AT2 cells of the lung. The drug target can be used to screen drugs for treating and/or preventing pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings. The present invention further provides a method for screening candidate drugs for treating pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings using the drug target.
In the first place, the present invention provides a drug target for idiopathic pulmonary fibrosis. The drug target is AREG signaling in AT2 cells of the lung, which refers to AREG target hereafter.
It is found in the present invention that AREG was detected in AT2 cells of all IPF specimens but was not detected in AT2 cells of control lungs.
It is found in the present invention that no AREG signal can be detected in a control lung of a subject with or without PNX. No AREG signal can be detected in AT2 cells of a control lung from a subject with or without PNX.
It is further found in the present invention that AREG can be detected in AT2 cells of Cdc42 AT2 null lungs. The expression levels of AREG are gradually increased in the lungs of Cdc42 AT2 null lungs after PNX.
Therefore, the expression level of AREG is significantly up-regulated in AT2 cells of both progressive fibrosis mouse model and lung fibrosis patients.
It is further in the present invention found that overexpression of AREG in AT2 cells is sufficiently to induce lung fibrosis.
Preferably, ectopic expression of AREG in AT2 cells is sufficiently to induce lung fibrosis.
Preferably, the AREG target is AREG in AT2 cells of lung from a subject.
Preferably, the AREG target is a receptor of AREG in AT2 cells of lung from a subject.
Preferably, the AREG target is EGFR in fibroblasts of lung from a subject.
The present invention demonstrates that the strength of EGFR signaling in α-SMA positive fibroblasts is dependent on the AREG expression in AT2 cells.
The present invention demonstrates that reducing the expression levels of AREG in AT2 cells of lungs from a subject significantly attenuates the development of pulmonary fibrosis of Cdc42 AT2 null mice.
Therefore, the present invention indicates that AREG, and its receptor, EGFR are therapeutic targets for treating fibrosis.
In the second place, the present invention provides a method for generating Areg AT2 overexpression transgenic mice, wherein AREG is specifically overexpressed in lung AT2 cells.
Preferably, the said method involves a step of specifically inducing the expression of Areg in AT2 cells after the doxycycline treatment. Preferably, the generated transgenic mouse is Spc-rtTA; teto-Areg mouse. Preferably, the Spc-rtTA; teto-Areg mouse has a chacterized sequence shown by SEQ ID NO:18.
Preferably, the Spc-rtTA; teto-Areg mouse may be identified using the following primer sequences:
In the third place, the present invention provides a transgenic mouse, wherein AREG is specifically overexpressed in AT2 cells of lungs. The mouse is an Areg AT2 overexpression transgenic mouse.
Preferably, in the transgenic mouse, the expression of Areg was induced specifically in AT2 cells after the doxycycline treatment. Preferably, the transgenic mouse is Spc-rtTA; teto-Areg mouse. Preferably, the Spc-rtTA; teto-Areg mouse has a chacterized sequence shown by SEQ ID NO:18.
Preferably, the Spc-rtTA; teto-Areg mouse may be identified using the following primer sequences:
In the fourth place, the present invention provides use of AREG in AT2 cells and/or its receptor EGFR in fibroblasts of lungs as a drug target for treating pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings.
In the fifth place, the present invention provides use of AREG target or the above transgenic mouse for screening a drug for treating pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings.
In the sixth place, the present invention provides use of a detector of AREG and/or a detector of its receptor EGFR in manufacturing a diagnosis kit for diagnosing pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings.
Preferably, the kit may be used to the sample from the subject suspecting suffering pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF). The sample may be the biopsy tissue. For example, the biopsy tissue may be lung tissue from the subject. Preferably, the biopsy tissue may be the lower part, the middle part or the upper part of the lung lobe from a subject. If AREG may be detected in the upper part of the lung lobe from a subject, the subject may be diagnosed as suffering a severe pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF). The most common type of lung fibrosis is known as idiopathic pulmonary fibrosis, in which fibrotic lesions start at the periphery of the lung lobe, and progress towards the center of the lung lobe, then the upper side of the lung lobe, and eventually causing respiratory failure.
In the seventh place, the present invention provides use of substance targeting AREG in AT2 cells and/or its receptor, for example, EGFR in fibroblasts of lungs in manufacturing a medicament for treating pulmonary fibrosis, in particular, idiopathic pulmonary fibrosis (IPF) of animals and human beings.
Preferably, the substance is an inhibitor of AREG in AT2 cells, or is an inhibitor of EGFR in fibroblasts of lungs.
The animal may be mouse, rabbit, rat, canine, pig, horse, cow, sheep, monkey or chimpanzee.
The invention encompasses all combination of the particular embodiments recited herein.
The descriptions of particular embodiments and examples are provided by way of illustration and not by way of limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results.
The idiopathic pulmonary fibrosis (IPF) is a type of chronic lung disease characterized by a progressive and irreversible decline in lung function. Symptoms typically include gradual onset of shortness of breath and a dry cough. Other changes may include feeling tired and nail clubbing. Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.
The alveolar epithelia of lungs are composed of a combination of both alveolar type I (AT1) and type II (AT2) cells. AT2 cells are the alveolar stem cells, and can differentiate into AT1 cells during alveolar homeostasis and post-injury repair12,13. AT1 cells-which ultimately comprise fully 95% of the alveolar surface in adult lungs-are large squamous cells that function as the epithelial component of the thin air-blood barrier14. In IPF tissues, abnormal hyperplastic AT2 cells are typically located adjacent to fibroblastic foci15, and the gene mutants that affect the functions of AT2 cells are frequently observed in IPF tissues in the clinic16,17. In addition, recent advances in identifying the molecular profiles of IPF lungs showed that TGFβ signaling (a common fibrotic signaling in many fibrotic diseases) is activated in the AT2 cells of IPF lungs18. These multiple lines of evidence collectively demonstrate an obvious pathological impact of AT2 cells in lung fibrosis, yet the precise pathological mechanisms underlying abnormal AT2 physiology and progressive pulmonary fibrosis remain to be elucidated.
The Sftpc gene promoter-driven recombinase (Spc-CreER) is used to specifically delete genes in AT2 cells after administration of tamoxifen to the animal. The CreER mouse system is commonly used for inducible gene knockout studies.
Amphiregulin (AREG) is a member of the epidermal growth factor family. AREG is synthesized as a membrane-anchored precursor protein, which can directly function on adjacent cells as a juxtacrine factor. After proteolytic processing by cell membrane proteases (TACE/ADAM17), AREG is secreted and functions as an autocrine or paracrine factor. AREG is a ligand of the epidermal growth factor receptor (EGFR), a transmembrane tyrosine kinase. By binding to EGFR, AREG can activate major intracellular signaling cascades that control cell survival, proliferation, and differentiation19-21.
Physiologically, AREG plays an important role in the development and maturation of mammary glands, bone tissue, and oocytes20,22. At normal conditions, AREG is expressed in low levels in adult tissues, except placenta. However, the chronic elevation of AREG expression has been shown to be associated with some pathological conditions. The increased expression of AREG is associated with a psoriasis-like skin phenotype and some inflammatory conditions23. Several studies have described the oncogenic activity of AREG in lung, breast, colorectal, ovary and prostate carcinomas, as well as in some hematological and mesenchymal cancers24,25. In addition, AREG may be involved in resistance to several cancer treatments26,27.
It has been shown that TGFβ can activate the expression of AREG in bleomycin-induced lung fibrosis mouse model28. It was shown that the expression level of AREG increases in liver fibrosis, cystic fibrosis, and polycystic kidney disease23. It is therefore hypothesized that AREG may contribute to the growth and survival of fibrogenic cells during these fibrotic disease, especial idiopathic pulmonary fibrosis(IPF). However, scientifically, the mechanisms and nature of the pathological progression of IPF are not fully understood29. Although it was speculated that AREG might play a function in IPF development, the cell that express AREG during progressive lung fibrosis remains unknown. In addition, the effect of targeting AREG in progressive lung fibrosis is unknown due to lack of a progressive lung fibrosis mouse model.
In an embodiment of the present invention, it is shown that no AREG signal can be detected in a control lung of a subject with or without PNX, and further, no AREG signal can be detected in AT2 cells of a control lung from a subject with or without PNX.
In an embodiment of the present invention, it is shown that AREG can be detected in AT2 cells of PNX-treated Cdc42 AT2 null lungs or aged Cdc42 AT2 null mice, the expression levels of AREG are gradually increased in the lungs of Cdc42 AT2 null lungs after PNX, and remarkably, AREG was detected in AT2 cells of all IPF specimens. Therefore, the present invention first shows that the expression level of AREG is significantly up-regulated in AT2 cells of the both progressive fibrosis mouse model and lung fibrosis patients.
In an embodiment of the present invention, a transgenic mouse, wherein AREG is specifically overexpressed in AT2 cells of the lung, is generated. The transgenic mouse has obvious fibrotic changes in the lung.
In an embodiment of the present invention, a transgenic mouse, wherein both Areg gene and Cdc42 gene are null, is generated. This transgenic mouse is an Areg&Cdc42 AT2 double null mouse. Lungs of Areg&Cdc42 AT2 double null mice showed minimal fibrosis at post-PNX day 21, as compared to the significant lung fibrosis in Cdc42 AT2 null lungs. Therefore, reducing the expression levels of AREG significantly attenuated the development of pulmonary fibrosis of Cdc42 AT2 null mice. Accordingly, the present invention suggests that AREG and its receptor, EGFR, are therapeutic targets for treating fibrosis. AREG means AREG in AT2 cells of lung, and EGFR means EGFR on the fibroblasts of lungs.
In an embodiment of the present invention, it is shown that blocking AREG and its receptor, EGFR, can be a therapeutic approach for treating the IPF and other fibrosis diseases.
Methods
Mice and Survival Curve Record
Rosa26-CAG-mTmG (Rosa26-mTmG), and Cdc42flox/flox mice30 have been described previously. All experiments were performed in accordance with the recommendations in the Guide for Care and Use of Laboratory Animals of the National Institute of Biological Sciences. To monitor the survival of mice, both the Control and the Cdc42AT2 null mice were weighed every week after the PNX treatment. Once the mice reached the pre-defined criteria for end-points, the mice were sacrificed. We define the endpoints according to the pre-defined criteria31,32.
Generating Spc-CreER;rtTA (Spc-CreER) knock-in mice. The CreERT2, p2a, and rtTA element were enzyme-linked and inserted into the mouse endogenous Sftpc gene. The insertion site is the stop codon of the endogenous Sftpc gene, then a new stop codon was created at the 3′ end of rtTA. The CRISPR/Cas9 technology was used to insert the CreERT2-p2a-rtTA fragment into the genome.
Generating Aregflox/flox Mice
The Aregflox/flox mice were generated according to the previous work33. Briefly, the Areg exon3 was anchored by loxp. The loxp1 (GACACGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATCGAGTC (SEQ ID NO:3)) was inserted into the Areg DNA position 3704, and the loxp2 (CCGCGGATAACTTCGTATAATGTATGCTATACGAAGTTATACTAGTCCAACG(SEQ ID NO:4)) was inserted into the Areg DNA position 4208. After the tamoxifen-induced Cre-loxP recombination, the exon3 of Areg gene was deleted, and then the AREG function was blocked.
Generating Teto-Areg Mice
Inserting a tetracycline response element before CMV promoter-driven Areg so that the expression of Areg can induced when mice are treated with doxycycline (Dox). The sequence of tetracycline response element is shown as followed:
Inserting a minimal CMV promoter before Areg CDNA so that Areg is overexpressed. The sequence of CMV promter is shown as followed:
The sequence of Areg cDNA is shown as followed:
The tetracycline response element, CMV promoter, and Areg CDNA were enzyme-linked and inserted into the mouse genome. The sequence of teto-Areg is shown as followed:
In Spc-rtTA; teto-Areg mice, the expression of Areg was induced specifically in AT2 cells after the doxycycline treatment.
Pneumonectomy (PNX)
The male mice of 8 weeks old were injected with tamoxifen (dosage: 75mg/kg) every other day for 4 times. The mice were anesthetized and connected to a ventilator (Kent Scientific, Topo) from 14th day after the final dose of tamoxifen injection. The chest wall was incised at the fourth intercostal ribs and the left lung lobe was removed.
Pulmonary Function Test
Lung function parameters were measured using the invasive pulmonary function testing system (DSI Buxco® PFT Controller). Mice were first anesthetized before inserting an endotracheal cannula into their trachea. The dynamic compliance results were obtained from the Resistance & Compliance Test. The forced vital capacity results were obtained from the Pressure Volume Test.
Hematoxylin and Eosin (H&E) Staining and Immunostaining
Lungs were inflated with 4% paraformaldehyde (PFA) and were continually fixed in 4% PFA at 4° C. for 24 hours. Then the lungs were cryoprotected in 30% sucrose and embedded in OCT (Tissue Tek).
The H&E staining experiment followed the standard H&E protocol. Briefly, slides were washed by water to remove the OCT. The nuclei were stained by hemotoxylin (Abcam, ab150678) for 2 minutes and the cytoplasm were stained by eosin (Sigma, HT110280) for 3 minutes. Slices were sealed with neutral resin after the dehydration and clearing steps.
The immunofluorescence staining experiments followed the protocol previously described34. In brief, after removing the OCT, the lung slices were blocked with 3%BSA/0.1%TritonX-100/PBS for 1 hour, and then slides were incubated with primary antibodies at 4° C. for overnight. After washing the slides with 0.1%TritonX-100/PBS for 3 times, the slices were incubated with secondary antibodies for 2 hours at room temperature.
The primary antibodies used herein are listed below:
The secondary antibodies used herein are listed below:
For the p-SMAD2 staining experiment, 1X phosphatase inhibitor (Bimake, B15002) was added in 4% PFA during the tissue fixation process. The tyramide signal amplification method was used for pSMAD2 staining.
The human lung tissues were fixed with 4% PFA for 24 hours at 4° C., cryoprotected in 30% sucrose and embedded in OCT. All experiments were performed with the Institutional Review Board approval at both National Institute of Biological Sciences, Beijing, and China-Japan Friendship Hospital, Beijing.
Statistical analysis. All data are presented as mean±s.e.m. (as indicated in figure legends). The data presented in the figures were collected from multiple independent experiments that were performed on different days using different mice. Unless otherwise mentioned, most of the data presented in figure panels are based on at least three independent experiments. The inferential statistical significance of differences between sample means was evaluated using two-tailed unpaired Student's t-tests.
Isolating Mouse AT2 Cells
After 4 doses of tamoxifen injection, the lungs of Spc-CreER, Rosa26-mTmG mice were dissociated as previously described23. Briefly, anesthetized mice were inflated with neutral protease (Worthington-Biochem, LS02111) and DNase I (Roche, 10104159001). AT2 cells were directly sorted based on the GFP fluorescence using the single-cell-select-mode in BD FACS Aria II and III appliances.
Quantitative RT-PCR (qPCR)
Total RNA was isolated from either whole lung or primary AT2 cells using Zymo Research RNA Mini Prep Kits (R2050). Reverse transcription reactions were performed with a two-step cDNA synthesis Kit (Takara, Cat. #6210A/B) according to the manufacturer's recommendations. qPCR was done with a CFX96 Touch™ Real-Time PCR Detection System. The mRNA levels of target genes were normalized to the Gapdh mRNA level. Primers used for qPCR are listed below.
Primers used for qPCR are listed below.
Areg Elisa
The mouse AREG immunoassay kit (R&D Systems, DY989) was used to detect the AREG concentration of the whole lung lysates. Specifically, the whole lung lobes were grinded in liquid nitrogen, then lysed using the cell lysis buffer. Then the lung lysates were added into the microplate wells applied. After the reaction, the absorbance at 450 nm was measured. The human areg immunoassay kit (abnova, B0RB01090J00018) was used to detect the AREG concentration of the human lung tissue lysates. Briefly, the human lung tissues were grinded in liquid nitrogen, then lysed using the cell lysis buffer. Then the lung lysates were added into the microplate wells applied. After the reaction, the absorbance at 450nm was measured. All experiments were performed with the Institutional Review Board approval at both National Institute of Biological Sciences, Beijing, and China-Japan Friendship Hospital, Beijing.
Primer sequence for sequencing the fragment of Cdc42 DNA sequence before and after deleting the exon2 of the Cdc42: Forward: CTGCCAACCATGACAACCTAA(SEQ ID NO:1); Reverse: AGACAAAACAACAAGGTCCAG (SEQ ID NO:2).
Primer sequences for sequencing the fragment of Areg DNA sequence before and after deleting the exon3 of the Areg: Forward: AAACAAAACAAGCTGAAATGTGG (SEQ ID NO: 4); Reverse: AAGGCCTTTAAGAACAAGTTGT (SEQ ID NO:15).
In order to construct a progressive lung fibrosis animal model, Cdc42 AT2 null mice are generated by knocking out Cdc42 gene specifically in alveolar type II cells (AT2).
In order to specifically delete Cdc42 gene in AT2 cells, the mice carrying a Spc-CreER allele are crossed with the Cdc42 foxed (Cdc42flox/flox) mice (
The fragments of Cdc42 DNA sequence before or after deleting the exon2 of the Cdc42 gene are shown in
We performed PNX on control and Cdc42 AT2 null mice and analyzed the alveolar regeneration and AT2 cell differentiation at post-PNX day 21 (
Under normal homeostatic conditions, AT2 cells slowly self-renew and differentiate into AT1 cells to establish new alveoli. To examine whether Cdc42 is required for AT2 cell differentiation during homeostasis, we deleted Cdc42 gene in AT2 cells when the mice were two-months old and analyzed the fate of AT2 cells until the mice were 12-month old. Lungs of Control and Cdc42 null mice without PNX treatment were collected at 12 months (
Cdc42 AT2 null and Control mice after PNX are observed for a longer period of time (
H&E staining of post-PNX Control and Cdc42 AT2 null mice reveals severe fibrosis in the lungs of Cdc42 AT2 null mice at their endpoints (
In addition to detecting strong immunofluorescence signals for Collagen I in these dense fibrotic regions of lungs of Cdc42 AT2 null mice (
Since it is found that impaired AT2 differentiation and enlarged alveoli in 12-month old Cdc42 AT2 null mice (
Fibroblastic foci are considered as a relevant morphologic marker of progressive pulmonary fibrosis and are recognized as sites where fibrotic responses are initiated and/or perpetuated in progressive pulmonary fibrosis35. The fibroblastic foci contain proliferating α-SMA+ fibroblasts. Lungs of Cdc42 AT2 null mice at post-PNX day 21 are stained with antibodies against α-SMA (
Collectively, the loss of Cdc42 in AT2 cells leads to progressive lung fibrosis in PNX-treated mice. Moreover, this progressive lung fibrosis phenotype also occurs in no-PNX-treated Cdc42 AT2 null mice starting from around 12 months of age. All these results demonstrate that deletion of Cdc42 in AT2 cells leads to IPF like progressive pulmonary fibrosis in mice, and therefore, a mouse model of IPF like progressive lung fibrosis is established and can be used to study human IPF disease.
The Spc-CreER, Cdc42flox/− mice were performed genome purification and PCR amplification. Then the fox and null bands of Cdc42 were purified and sequenced using the primers as below: CTGCCAACCATGACAACCTAA (SEQ ID NO.1): AGACAAAACAACAAGGTCCAG (SEQ ID NO:2).
The fragments of Cdc42 DNA sequence before or after deleting the exon2 of the Cdc42 gene are shown in
In the Cdc42 AT2 null fibrosis model, the Cdc42 AT2 null lungs start to show fibrotic changes at post-PNX day 21 (
As shown in Example 3, the positive correlation between the expression level of AREG and the progression of lung fibrosis in Cdc42 AT2 null mice is observed. The expression levels of AREG in 2 donor and 3 IPF lungs are analyzed. Remarkably, it is observed that AREG is detected in AT2 cells (HTII-280 expressing cells) of all IPF specimens but is not detected in AT2 cells of donor lungs (
Together, these results show that the expression level of AREG is significantly up-regulated in AT2 cells of the both progressive fibrosis mouse model and lung fibrosis patients.
Generation of Teto-Areg Mice
Insert a tetracycline response element before CMV promoter-driven Areg so that the expression of Areg can induced when mice are treated with doxycycline (Dox). The sequence of tetracycline response element is shown as followed:
Insert a minimal CMV promoter before Areg cDNA so that Areg is overexpressed. The sequence of CMV promter is shown as followed:
5
The sequence of Areg cDNA is shown as followed:
The tetracycline response element, CMV promoter, and Areg CDNA were enzyme-linked and inserted into the mouse genome. The sequence of teto-Areg is shown as followed:
In Spc-rtTA; teto-Areg mice, the expression of Areg was induced specifically in AT2 cells after the doxycycline treatment.
Primer sequences for sequencing Leto-Areg sequence are shown as follo red:
In order to assess the function of increased expression of AREG in AT2 cells, Areg AT2 overexpression transgenic mice, in which Areg can be specifically overexpressed in AT2 cells, are generated. Firstly, transgenic mice that express Areg under the control of a tetracycline-responsive promoter element (tetO) are generated. The mice that carry the allele of Spc-rtTA are crossed with mice that carry the allele of teto-Areg in order to get the offspring mice that carry Spc-rtTA; teto-Areg. When exposing the Spc-rtTA; teto-Areg mice to the tetracycline analog, doxycycline (Dox), the expression of Areg is specifically induced in AT2 cells. The Spc-rtTA; teto-Areg mice are named as AregAT2OE mice (
The AregAT2OE mice are treated with Dox-containing water for 21 days (
For the first time, these results indicate that ectopic expression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.
Generating Aregflox/flox mice: the Aregflox/flox mice were generated according to the previous work33. Briefly, the Areg exon3 was anchored by loxp. The loxpl (GACACGGA TCCATAACTTCGTATAATGTATGCTATACGAAGTTATCGAGTC (SEQ ID NO:3)) was inserted into the Areg DNA position 3704, and the loxp2 (CCGCGGATAACTTC GTATAATGTATGCTATACGAAGTTATACTAGTCCAACG(SEQ ID NO:4)) was inserted into the Areg DNA position 4208. After the tamoxifen-induced Cre-loxP recombination, the Areg exon3 was deleted then the AREG function was blocked.
The fragments of Areg DNA sequence before or after deleting the exon3 of the Areg gene are shown in
Given the fibrotic function of AREG in AT2 cells, whether reducing the expression level of AREG in Cdc42 null AT2 cells will attenuate the fibrosis development in Cdc42 AT2 null lungs is assessed. Areg flox mice in which the exons 3 of Areg gene are flanked by two loxp sites are generated. The mice, in which Areg gene was deleted in whole body, are analyzed. The Areg−/− mice are viable and fertile, suggesting that Areg gene is not essential for the survival and development of mice. After several generations of crossings, we obtain Areg&Cdc42 AT2 double null mice, in which Areg and Cdc42 genes are both deleted in AT2 cells.
Thereafter, the effect of deleting Areg genes in Cdc42 null AT2 cells is investigated. Control, Cdc42 AT2 null, and Areg&Cdc42 AT2 double null mice are exposed to 4 doses of tamoxifen 14 days prior to PNX (
AREG binds to EGFR, which can activate the phosphorylation of EGFR. The p-EGFR expression in α-SMA+ fibroblasts is examined by an immunostaining experiment using an antibody against GFP (labeling AT2 cells), p-EGFR, and α-SMA. Strong p-EGFR expression in α-SMA positive fibroblasts in Cdc42 AT2 null lungs is observed (
Together, these results demonstrate that reducing the expression level of AREG in AT2 cells significantly attenuated the development of pulmonary fibrosis of Cdc42 AT2 null mice. These results also indicate that AREG and its receptor, EGFR, are therapeutic targets for treating fibrosis.
The Spc-CreER, Aregflox/− mice were performed genome purification and PCR amplification. Then the fox and null bands of Areg were purified and sequenced using the primers as below: AAACAAAACAAGCTGAAATGTGG (SEQ ID NO:14); AAGGCCTTTAAGAACAAGTTGT (SEQ ID NO:15).
Given the fact that EGFR in α-SMA positive fibroblasts can be activated by AREG (
Taking together, these results demonstrate that blocking AREG and its receptor, EGFR, is an ideal therapeutic approach for treating the IPF and other fibrosis diseases.
1 Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology 214, 199-210, doi:10.1002/path.2277 (2008).
2 Wynn, T. A. & Ramalingam, T. R. Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nature medicine 18, 1028-1040, doi:10.1038/nm.2807 (2012).
3 Mehal, W. Z., Iredale, J. & Friedman, S. L. Scraping fibrosis: expressway to the core of fibrosis. Nature medicine 17, 552-553, doi:10.1038/nm0511-552 (2011).
4 Barkauskas, C. E. & Noble, P. W. Cellular mechanisms of tissue fibrosis. 7. New insights into the cellular mechanisms of pulmonary fibrosis. American journal of physiology. Cell physiology 306, C987-996, doi:10.1152/ajpce11.00321.2013 (2014).
5 Rock, J. R. et al. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proceedings of the National Academy of Sciences of the United States of America 108, E1475-1483, doi:10.1073/pnas.1117988108 (2011).
6 Gross, T. J. & Hunninghake, G. W. Idiopathic pulmonary fibrosis. New England Journal of Medicine 345, 517-525 (2001).
7 Vyalov, S. L., Gabbiani, G. & Kapanci, Y. Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis. The American journal of pathology 143, 1754 (1993).
8 King Jr, T. E., Pardo, A. & Selman, M. Idiopathic pulmonary fibrosis. The Lancet 378, 1949-1961 (2011).
9 Plantier, L. et al. Ectopic respiratory epithelial cell differentiation in bronchiolised distal airspaces in idiopathic pulmonary fibrosis. Thorax 66, 651-657, doi:10.1136/thx.2010.151555 (2011).
10 Steele, M. P. & Schwartz, D. A. Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276, doi:10.1146/annurev-med-042711-142004 (2013).
11 Camelo, A., Dunmore, R., Sleeman, M. A. & Clarke, D. L. The epithelium in idiopathic pulmonary fibrosis: breaking the barrier. Frontiers in pharmacology 4, 173, doi:10.3389/fphar.2013.00173 (2014).
12 Barkauskas, C. E. et al. Type 2 alveolar cells are stem cells in adult lung. The Journal of clinical investigation 123, 3025-3036, doi:10.1172/JCI68782 (2013).
13 Desai, T. J., Brownfield, D. G. & Krasnow, M. A. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature 507, 190-194, doi:10.1038/nature12930 (2014).
14 Haies, D. M., Gil, J. & Weibel, E. R. Morphometric study of rat lung cells: I. Numerical and dimensional characteristics of parenchymal cell population. American Review of Respiratory Disease 123, 533-541 (1981).
15 Selman, M. & Pardo, A. Idiopathic pulmonary fibrosis: an epithelial/fibroblastic cross-talk disorder. Respiratory research 3, 3 (2001).
16 Kropski, J. A., Blackwell, T. S. & Loyd, J. E. The genetic basis of idiopathic pulmonary fibrosis. European Respiratory Journal 45, 1717-1727 (2015).
17 Goodwin, A. T. & Jenkins, G. Molecular endotyping of pulmonary fibrosis. Chest 149, 228-237 (2016).
18 Xu, Y. et al. Single-cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis. JCI insight 1 (2016).
19 Sternlicht, M. D. & Sunnarborg, S. W. The ADAM17—amphiregulin—EGFR axis in mammary development and cancer. Journal of mammary gland biology and neoplasia 13, 181-194 (2008).
20 Berasain, C. & Avila, M. A. in Seminars in cell & developmental biology. 31-41 (Elsevier).
21 Sternlicht, M. D. et al. Mammary ductal morphogenesis requires paracrine activation of stromal EGFR via ADAM17-dependent shedding of epithelial amphiregulin. Development 132, 3923-3933 (2005).
22 Macias, H. & Hinck, L. Mammary gland development. Wiley Interdisciplinary Reviews:
Developmental Biology 1, 533-557 (2012).
23 (!!! INVALID CITATION !!!).
24 Busser, B., Sancey, L., Brambilla, E., Coll, J.-L. & Hurbin, A. The multiple roles of amphiregulin in human cancer. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1816, 119-131 (2011).
25 Chen, Z. et al. Aberrantly activated AREG—EGFR signaling is required for the growth and survival of CRTC1—MAML2 fusion-positive mucoepidermoid carcinoma cells. Oncogene 33, 3869 (2014).
26 Busser, B. et al. Amphiregulin promotes resistance to gefitinib in nonsmall cell lung cancer cells by regulating Ku70 acetylation. Molecular Therapy 18, 536-543 (2010).
27 Wang, X., Masri, S., Phung, S. & Chen, S. The role of amphiregulin in exemestane-resistant breast cancer cells: evidence of an autocrine loop. Cancer research 68, 2259-2265 (2008).
28 Zhou, Y. et al. Amphiregulin, an epidermal growth factor receptor ligand, plays an essential role in the pathogenesis of transforming growth factor-f3-induced pulmonary fibrosis. Journal of Biological Chemistry 287, 41991-42000 (2012).
29 Steele, M. P. & Schwartz, D. A. Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276 (2013).
30 Chen, L. et al. Cdc42 deficiency causes Sonic hedgehog-independent holoprosencephaly. Proceedings of the National Academy of Sciences 103, 16520-16525 (2006).
31 Council, N. R. Guide for the care and use of laboratory animals. (National Academies
Press, 2010).
32 Foltz, C. J. & Ullman-Cullere, M. Guidelines for assessing the health and condition of mice. Resource 28 (1999).
33 Luetteke, N. C. et al. Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development. Development 126, 2739-2750 (1999).
34 Wang, Y. et al. Pulmonary alveolar type I cell population consists of two distinct subtypes that differ in cell fate. Proceedings of the National Academy of Sciences, 201719474 (2018).
35 Lynch, D. A. et al. Diagnostic criteria for idiopathic pulmonary fibrosis: a Fleischner Society White Paper. The Lancet Respiratory Medicine 6, 138-153, doi:10.1016/s2213-2600(17)30433-2 (2018).
The present application is a National Stage Application, filed under 35 U.S.C. 371, of International Patent Application No. PCT/CN2019/089358, filed on May 30, 2019, which is incorporated herein by reference in its entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2019/089358 | 5/30/2019 | WO |
