The technical field generally relates to sensors and more specifically relates to sensors comprising multiple sensing modes.
In critical applications such as healthcare, food safety, environmental monitoring, or the like, false negatives regarding biosensing are not tolerated as the consequential damages may be significant.
A novel dual mode electrochemical piezoelectric-excited millimeter cantilever sensor may be utilized for simultaneous in-liquid biochemical sensing. The sensor may combine mass-sensing measurements of dynamic-mode cantilevers with electrochemical impedance spectroscopy employed for transduction in sensitive electrochemical biosensors. The integrated design of the sensor may provide simultaneous and continuous measurement of resonant frequency shift and charge transfer resistance of a target analyte bound to a surface of the sensor. Binding of a target analyte to the surface of the sensor may cause charge transfer resistance to increase and the resonant frequency of the sensor to decrease. These simultaneous dynamic modes of the sensor may be utilized to measure an amount of mass of the target analyte accumulated on the surface of the sensor and to reduce and/or eliminate false negative measurement results.
The foregoing summary, as well as the following detailed description, may be better understood when read in conjunction with the appended drawings.
A dual mode electrochemical piezoelectric-excited millimeter cantilever (ePEMC) sensor may be utilized for simultaneous in-liquid biochemical sensing. The ePEMC may incorporate mass-sensing measurement of dynamic-mode cantilevers along with electrochemical impedance spectroscopy (EIS). EIS may be utilized to measure transduction. Such an integrated design may allow for simultaneous and continuous measurement of resonant frequency shift (Δf) and charge transfer resistance (RCT) as a target analyte binds to a surface of the sensor. In various example embodiments, the surface may comprise any appropriate material or materials with which a target analyte may bind. For example, the surface may comprise a gold coating. The coating may be of any appropriate surface area, such as, for example, 0.5 mm2. The resonant frequency shift (Δf) and charge transfer resistance (RCT) may be measured via electromechanical and electrochemical impedance spectroscopy, respectively.
Three experiments were conducted to demonstrate ePEMC properties. The three experiments included: (1) resonant frequency response to electrochemically-deposited metal thin-films, (2) resonant frequency response to adsorption of thiolated ssDNA and model proteins with subsequent EIS sensing, and (3) simultaneous resonant frequency and charge transfer resistance response to model chemisorption of a short-chain thiol molecule, mercaptohexanol. It was observed that adsorption of all model binding analytes caused a decrease in sensor resonant frequency and increase in charge transfer resistance. Comparison of sensor response to binding of protein and thiol molecules showed the two simultaneously transduced signals were proportional and showed similar kinetics.
A biosensor may use electrical, electrochemical, optical, thermal, or electromechanical transduction to convert a molecular binding event into a measureable signal. In critical applications such as healthcare, food safety, and environmental monitoring, false negatives are not tolerated as the consequential damage may be significant. Therefore, a biosensor that provides redundancy and/or dual transduction responses may be useful for verifying a response of one transduction with a second response, and thus, provide a mechanism for reducing or potentially eliminating false negatives.
Electrochemical and resonance-based transduction mechanisms may be utilized for biosensing applications in order to take advantage of their high sensitivity and label-free protocols. For example, detection at femtogram (fg)/mL to picogram (pg)/mL levels may be accomplished with a variety of biological analytes, such as toxins, pathogens, and nucleic acids. Described herein is a robust technique in which binding of target analyte causes two independent transduction responses on the same sensor surface, and both are measured simultaneously.
To achieve the aforementioned simultaneous measurements, an electrochemical approach is integrated with electromechanical transduction in the same device. The measurement of an electrochemical response in biosensing may be facilitated by the selection of an electro-active target or electro-active labeled-reagent for facilitating electrochemical measurement. However, labeling recognition molecules, such as antibodies, may reduce their avidity, and thus, reduce assay sensitivity. On the other hand, label-free electrochemical measurement via redox probes may be advantageous. Therefore, as described herein, label-free electrochemistry is combined with a label-free piezoelectric-excited millimeter-sized cantilever (PEMC) sensor. The PEMC sensor may exhibit high sensitivity at picomolar (fM) to femtomolar (fM) levels. Likewise, label-free electrochemical biosensors may yield comparably sensitive results. Results are described herein of utilizing an electrochemical-PEMC (ePEMC) which allows simultaneous EIS and mass-change measurement capabilities. Observed results of an electrochemical-quartz crystal microbalance (EQCM) and an ePEMC are described herein. Observed distinguishing features of the ePEMC from EQCM include: (1) vibration is transverse for ePEMC vs. lateral for EQCM, (2) sensing area is square millimeters for ePEMC vs. square centimeters for EQCM, (3) mass change sensitivity is fg/Hz for ePEMC vs. ng/Hz for EQCM, and (4) electrodes used for actuation and sensing are different for ePEMC vs. the same for EQCM.
The piezoelectric portion 14 can comprise any appropriate material such as lead zirconate titanate, lead magnesium niobate-lead titanate solid solutions, strontium lead titanate, quartz silica, piezoelectric ceramic lead zirconate and titanate (PZT), piezoceramic-polymer fiber composites, or the like, for example. The non-piezoelectric portion 16 can comprise any appropriate material such as glass, ceramics, metals, polymers and composites of one or more of ceramics, and polymers, such as silicon dioxide, copper, stainless steel, titanium, or the like, for example.
The piezoelectric cantilever sensor can comprise portions having any appropriate combination of dimensions. Further, physical dimensions can be non-uniform. Thus, the piezoelectric layer and/or the non-piezoelectric layer can be tapered. For example, the length (e.g., LP in
Electrodes may be placed at any appropriate location. In an example embodiment, electrodes may be operatively located near a location of concentrated stress in the piezoelectric layer 14. As described above, the sensitivity of the piezoelectric cantilever sensor is due in part to advantageously directing (concentrating) the stress in the piezoelectric layer 14 and placing electrodes proximate thereto. The configurations of the piezoelectric cantilever sensor described herein (and variants thereof) tend to concentrate oscillation associated stress in the piezoelectric layer 14. At resonance, in some of the configurations of the piezoelectric cantilever sensor, the oscillating cantilever concentrates stress in the piezoelectric layer 14 toward the base portion 20. This may result in an amplified change in the resistive component of the piezoelectric layer 14, and a large shift in resonance frequency at the locations of high stress. Directing this stress to a portion of the piezoelectric layer 14 having a low bending modulus (e.g., more flexible) allows for exploitation of the associated shift in resonance frequency to detect extremely small changes in mass of the piezoelectric cantilever sensor. Thus, in example configurations of the piezoelectric cantilever sensor, the thickness of the piezoelectric layer 14 located near the base portion 20 is thinner than portions of the piezoelectric layer 14 further away from the base portion 20. This may tend to concentrate stress toward the thinner portion of the piezoelectric layer 14. In example configurations, electrodes may be located at or near the locations of the oscillation associated concentrated stress near the base portion of the piezoelectric cantilever sensor. In other example configurations of the piezoelectric cantilever sensor electrodes are positioned proximate the location of concentrated stress in the piezoelectric layer regardless of the proximity of the concentrated stress to a base portion of the piezoelectric cantilever sensor.
The description of piezoelectric cantilever sensors as depicted in
Electrochemical impedance spectroscopy (EIS), also referred to as dielectric spectroscopy or impedance spectroscopy, may be utilized to measure dielectric properties of a medium. Dielectric properties may be measured as a function of frequency. Various properties may be measured, such as, for example impedance and charge transfer resistance (RCT). RCT represents the resistance that a current experiences when cross an electrode/electrolyte interface. EIS may be achieved by applying an electric field to the medium as measured the desired properties.
As mentioned above, experiments were conducted to demonstrate ePEMC properties. Three experiments included: (1) resonant frequency response to electrochemically-deposited metal thin-films, (2) resonant frequency response to adsorption of thiolated ssDNA and model proteins with subsequent EIS sensing, and (3) simultaneous resonant frequency and charge transfer resistance response to model chemisorption of a short-chain thiol molecule, mercaptohexanol. Reagents utilized to conduct the aforementioned experiments included Concentrated sulfuric acid (H2SO4), 30% hydrogen peroxide (H2O2), sodium chloride (NaCl) and potassium chloride (KCl) were from Fisher Scientific. Thiolated DNA strand (HS-C6T6CCCTGAGTGTCAGATACAGCCCAGTAG) was purchased from Integrated DNA Technologies (IDT, Coralville, Iowa). Ethylenediaminetetraacetic acid (EDTA) and tris-hydrochloride (Tris-HCl) were from Sigma-Aldrich. DNA was reconstituted in Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, pH=7.9, 1 M NaCl) and stored at −22° C. until removed for use. Ethanol (EtOH, 200 proof) was from Decon Laboratories, Inc (King of Prussia, Pa.). Bond-Breaker TCEP (tris(2-carboxyethyl)phosphine) solution (500 mM) used for reduction of disulfide form of DNA strands was from Fisher. Phosphate buffered saline (PBS, 10 mM, pH 7.4), potassium ferrocyanide (K4Fe(CN)6), potassium ferricyanide (K3Fe(CN)6), bovine serum albumin (BSA), and copper (II) sulfate (CuSO4) were from Sigma-Aldrich. Polyurethane (MC, clear) was from Wassar Corporation (Auburn, Wash.). Lead zirconate titanate (PZT-5A) was from Piezo Systems (Woburn, Mass.). Deionized water (DIW, 18 MΩ, Milli-Q system, Millipore) was used for buffer preparation and rinsing protocols. Hydrogen tetrachloroaurate (III) trihydrate (HAuCl4.H2O) was purchased from Acros Organics. Adhesive copper tape for connection to potentiostat leads was from 3M.
To prepare the sensor surface, prior to conducting the biosensing experiments, the freshly sputtered 1 mm2 Au electrode was cleaned in room temperature piranha solution (3:1 v/v H2SO4:H2O2) for ˜30 seconds. Caution: Piranha solution is highly reactive; handle with care. The sensor was then rinsed immediately with copious DIW and installed in the flow cell.
To prepare DNA, thiolated DNA was supplied by a vendor in disulfide form. The disulfide bond was reduced by adding 1 μL 500 mM TCEP to 300 μL of 1.4 μM DNA which was subsequently mixed and allowed to react ˜60 minutes at room temperature. The reduced-DNA was added to the re-circulating buffer (flow rate=500 μL/min) for chemisorbing DNA strand on the Au surface. Flow was maintained by a peristaltic pump.
Resonant frequency of the ePEMC was obtained by monitoring the PZT layer impedance-based frequency response at 100 mV sinusoidal driving input with zero bias using an impedance analyzer (Agilent Model 4294A). Sensor spectra were characterized by frequency sweep over the range of 1-250 kHz. Resonant frequency was determined from continual sweeping of frequency within 5-10 kHz of resonant frequency by a custom LabView® program. Resonance was identified by the frequency at maximum phase angle between the exciting voltage and the resulting current through the PZT.
The Au-layer on the ePEMC served as the working electrode. Copper sulfate (CuSO4, 1 M, DIW) and hydrogen tetrachloroaurate (III) trihydrate salt (HAuCl4.3H2O, 50 mM, DIW) were used in the respective copper and gold half-cells. A salt bridge (saturated KCl, diameter ˜3 mm) was used to connect the two half cells. Voltage and current were measured by a multimeter (Fluka Model 289).
To describe the electromechanical characterization of the results, resonant frequency of the nth transverse mode depends on effective cantilever mass (mc) and spring constant (k) as:
where keff=Ewt3/(12L3), mc=ρLwt, cn=λn2/2π, L, w, and t are the cantilever length, width, and thickness, respectively, ρ is the density, and λn is the corresponding eigenvalue. Thus, changes in frequency are associated with changes in both mass and stiffness as:
which reduces to the following when stiffness changes are negligible, as is the case for biomolecular surface reactions:
From the above, it is evident that when mass of the sensor increases there is a corresponding decrease in resonant frequency.
Electrochemical impedance behavior measured using planar electrode biosensors may follow Randles or modified Randles equivalent circuit models. Similar to monitoring Δf, measurement of electrochemical impedance spectra facilitates monitoring changes in the charge transfer resistance (RCT). As shown schematically in
The response of the ePEMC to spontaneous deposition of Au thin-films is now discussed. One way to demonstrate simultaneous chemical sensing is the application of the ePEMC to monitoring electrochemical metal thin-film deposition, since such reactions produce both an added mass effect and demonstrate the ability of the sensing surface to conduct electric current. The reduction of metal ions occurring on the gold surface of ePEMC is given by:
Mn++ne−→M(s),
where Mn+ is the metal ion reduced on the sensor, e− is an electron, n is the number of electrons, and M(s) is the solid metal deposited on ePEMC. Cu2++2e− was utilized as the counter half-cell to ensure spontaneous metal deposition on the sensor surface given its standard reduction potential is less positive than that of most gold cations and cation-complexes.
Bovine serum albumin (BSA) and linear molecules containing thiol end groups were chosen to examine the ePEMC's potential in biosensing applications for surface-based biosensing because they readily bind to Au. A typical binding experiment, started with cleaning the gold surface, followed by measuring the sensor's electrochemical impedance spectrum. Subsequently, the sensor was installed in a flow cell for mass-change sensing, thus allowing the sensor to stabilize in flowing PBS at 500 μL/min.
In the second experiment, chemisorption of thiolated ssDNA took ˜40 minutes causing a 180±22 Hz shift (n=2) in resonant frequency as shown in
The results of simultaneous sensing of molecular self-assembly via changes in resonant frequency and charge transfer resistance are now described. The potential for making both measurements simultaneously during the course of surface molecular binding is examined Thus, sensor response to chemisorption of short chain (C6) thiol molecule, mercaptohexanol (MCH), in the absence of flow while tracking both change in resonant frequency and charge transfer resistance. was examined
Sensor resonant frequency decreases for BSA and MCH, shown in
A first charge transfer resistance of the sensor may be measured at step 62. The first charge transfer resistance may be measured as described herein and/or in accordance with any appropriate variant thereof.
The sensor may be prepared to receive an analyte. In an example embodiment, an analyte attractor is applied to the sensor. The attractor is specific to a target analyte. Thus the attractor will attract a target analyte and not attract other substances. For example, the sensor may comprise an attractor for attracting Bacillus anthracis, food-borne pathogens, such as E. coli, pathogens in food and water, cell types in body fluids (e.g., circulating tumor cells), biomarkers in body fluids (e.g., proteins that mark specific pathophysiology—alpha-fetoprotein, beta-2-microglobulin, bladder tumor antigen, breast cancer marker CA-15-3, and other CAs (cancer antigens), calcitonin, carcinoembryonic antigen, and others), markers of explosives such as trinitrotoluene, dinitrotoluene, airborne and waterborne toxins, biological entities, such as a protein, DNA, or any appropriate combination thereof.
The sensor may be exposed to a medium at step 64. The medium may comprise any appropriate medium, such as a liquid, a gas, a combination of a liquid and a gas, or a vacuum, for example. The medium may exhibit a wide variety of flow conditions. If a target analyte is present in the medium, the target analyte may accumulate on the surface of the sensor that has been treated with the attractor. As described herein, accumulation (e.g., binding) of the target analyte on the surface of the sensor may result in a change in stiffness of the sensor and/or an increase the mass of the sensor, which will decrease the resonance frequency of the sensor.
A second resonance frequency of the sensor may be measured at step 66. The second resonance frequency may be measured as described herein and/or in accordance with any appropriate variant thereof. A second charge transfer resistance of the sensor may be measured at step 68. The second charge transfer resistance may be measured as described herein and/or in accordance with any appropriate variant thereof.
The second measured resonance frequency may be compared to a baseline resonance frequency. That is, a difference between the first resonance frequency (baseline) and the second resonance frequency may be determined at step 70. The baseline resonance frequency may be the resonance frequency of the sensor having no analyte accumulated thereon. If a difference in the measured (first and second) resonance frequencies (frequency shift) is not measured (at step 74), it is determined, at step 80, that no analyte is detected. If a difference in frequency between the measured resonance frequency and the baseline resonance frequency is measured (at step 74), it is determined, at step 76, that an analyte is detected, i.e., an analyte is present in the medium. Additionally, based on the resonance frequency difference, an amount of analyte accumulated on the sensor may be determined at step 76.
The second charge transfer resistance measurement may be compared to a baseline charge transfer resistance. That is, a difference between the first charge transfer resistance (baseline) and the second resonance frequency may be determined at step 78. If the charge transfer resistance difference is below a threshold value, it may be determined that the determination that no analyte has accumulated on the surface of the sensor (step 80) is not a false negative result. If charge transfer resistance difference is above a threshold value, it may be determined that the determination that analyte has accumulated on the surface of the sensor (step 76) is not a false positive result.
In an example embodiment, the apparatus 90 may comprise a processor and memory coupled to the processor. The memory may comprise executable instructions that when executed by the processor cause the processor to effectuate operations associated with dual mode sensing as described herein. As evident from the herein description, apparatus 90 is not to be construed as software per se.
In an example configuration, the apparatus 90 may comprise a processing portion 92, a memory portion 94, and an input/output portion 96. The processing portion 92, memory portion 94, and input/output portion 96 may be coupled together (coupling not shown in
The processing portion 92 may be capable of performing functions associated with dual mode sensing as described herein. For example, the processing portion 92 may be capable of, in conjunction with any other portion of the apparatus 90, installing an application for effectuating dual mode sensing as described herein.
In a basic configuration, the apparatus 90 may include at least one memory portion 94. The memory portion 94 may comprise a storage medium having a concrete, tangible, physical structure. Thus, the memory portion 94, as well as any computer-readable storage medium described herein, is not to be construed as a transient signal per se. The memory portion 94, as well as any computer-readable storage medium described herein, is not to be construed as a propagating signal per se. The memory portion 94, as well as any computer-readable storage medium described herein, is not to be construed as a signal per se. The memory portion 94, as well as any computer-readable storage medium described herein, is to be construed as an article of manufacture. The memory portion 94 may store any information utilized in conjunction with effectuating dual mode sensing as described herein. Depending upon the exact configuration and type of processor, the memory portion 94 may be volatile 98 (such as some types of RAM), non-volatile 100 (such as ROM, flash memory, etc.), or a combination thereof. The apparatus 90 may include additional storage (e.g., removable storage 102 and/or non-removable storage 104) including, for example, tape, flash memory, smart cards, CD-ROM, digital versatile disks (DVD) or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, universal serial bus (USB) compatible memory, or any other medium which can be used to store information and which can be accessed by the apparatus 90.
The apparatus 90 also may contain communications connection(s) 110 that allow the apparatus 90 to communicate with other devices, network entities, or the like. A communications connection(s) may comprise communication media. Communication media may embody computer readable instructions, data structures, program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media. By way of example, and not limitation, communication media may include wired media such as a wired network or direct-wired connection, and wireless media such as acoustic, RF, infrared, and other wireless media. The term computer readable media as used herein includes both storage media and communication media. The apparatus 90 also may include input device(s) 106 such as keyboard, mouse, pen, voice input device, touch input device, etc. Output device(s) 108 such as a display, speakers, printer, etc. also may be included.
As described herein, a new dual mode sensing platform capable of robust biochemical sensing comprises the integration, in a piezoelectric cantilever sensor, of electrochemical sensing capabilities with mass sensing measurement capabilities. Validation of the ePEMC's electrochemical and mass sensing features were shown by examining a number of surface binding experiments, including metal thin-film deposition, protein adsorption, and chemisorption of thiolated molecules (short-chain thiols and ssDNA).
It is to be understood that even though numerous characteristics and advantages of dual mode sensors have been set forth in the foregoing description, together with details of the structure and function, the instant disclosure is illustrative only, and changes may be made in detail, especially in matters of shape, size, and arrangement of parts within the principles of asymmetric sensors to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed.
While example embodiments of dual mode sensors have been described in connection with various computing devices/processors, the underlying concepts may be applied to any computing device, processor, or system capable of dual mode measurement. The various techniques described herein may be implemented in connection with hardware or software or, where appropriate, with a combination of both. Thus, the methods and apparatuses associated with dual mode sensors, or certain aspects or portions thereof, may take the form of program code (i.e., instructions) embodied in tangible computer-readable storage media. Examples of tangible computer-readable storage media include floppy diskettes, CD-ROMs, DVDs, hard drives. When the program code is loaded into and executed by a machine, such as a computer, the machine becomes an apparatus for implementation of dual mode sensors. In the case of program code execution on programmable computers, the computing device will generally include a processor, a storage medium readable by the processor (including volatile and non-volatile memory and/or storage elements), at least one input device, and at least one output device. The program(s) can be implemented in assembly or machine language, if desired. The language can be a compiled or interpreted language, and combined with hardware implementations. As evident from the herein description, a tangible computer-readable storage medium is not to be construed as a signal. As evident from the herein description, a tangible computer-readable storage medium is not to be construed as a propagating signal. As evident from the herein description, a tangible computer-readable storage medium is not to be construed as a transient signal. As evident from the herein description, a tangible computer-readable storage medium is an article of manufacture.
The methods and apparatuses associated with dual mode sensors also may be practiced via communications embodied in the form of program code that is transmitted over some transmission medium, such as over electrical wiring or cabling, through fiber optics, or via any other form of transmission, wherein, when the program code is received and loaded into and executed by a machine, such as an EPROM, a gate array, a programmable logic device (PLD), a client computer, or the like, the machine becomes an apparatus for detection and measurement of mass change using impedance determinations. When implemented on a general-purpose processor, the program code combines with the processor to provide a unique apparatus that operates to effectuate processes associated with asymmetric sensors.
This application claims priority to U.S. provisional patent application No. 61/871,991, filed Aug. 30, 2013. U.S. provisional patent application No. 61/871,991 is incorporated herein by reference in its entirety.
Number | Date | Country | |
---|---|---|---|
61871991 | Aug 2013 | US |