Patent Application
20230366877
The application claims priority to Chinese patent application No. 202210249414.2, filed on Mar. 14, 2022, the entire contents of which are incorporated herein by reference.
The present application relates to the technical field of EBIV, and in particular to an EBIV nucleic acid composition and the application thereof.
Ebinur Lake virus (EBIV), is a new member of Bunyamwera serogroup, belonging to the family Panbunyariridae and the genus Orthobunyavirus. It was first isolated from Culex modestus in the Ebinur Lake region of Xinjiang. China in 2014. The virus is spherical in particle, membrane-coated, and the genome is composed of three independent single-stranded RNA fragments, L, M, and S. Previous studies found that mice were highly susceptible to EBIV and even extremely low doses of virus (1 plaque forming unit) can cause death in mice. Viruses were detected in the peripheral tissues and central nervous system of the infected mice, and obviously histopathologic changes were observed in the liver, spleen, thymus, and brain. Moreover, cytokine levels in the serum, spleen, and brain of mice are significantly altered by EBIV infection. Alanine aminotransferase, lactate dehydrogenase, and creatine kinase were found to be significantly higher in infected mice compared to uninfected mice, according to an analysis of blood components. Infected mice also had lower levels of white blood cells and blood platelets. It is noteworthy that the seroepidemiological survey of people around the Ebinur Lake indicated the presence of IgM. IgG, and neutralizing antibodies of EBIV in the population, suggesting that the virus has potential pathogenic and infectious risks for humans. The reverse genetics system has been used to obtain recombinant viruses, which can be further used to study viral replication, invasion, gene function, drug screening, and vaccine development. However, the use of a reverse genetics system to construct recombinant EBIV has not been reported, which hinders the further study of new mosquito-borne EBIV.
In view of this, the purpose of the present application is to develop a recombinant EBIV and a method for constructing the same, so as to make up the blank of the functional study on the related gene sequences of the virus in the prior art, and to provide a basis for further exploring the pathogenicity, transmission mechanism of the virus, drug screening and vaccine development.
In a first aspect, an embodiment of the present application discloses a nucleic acid sequence combination for expressing a recombinant EBIV-related protein, comprising: an EBIV L segment, the nucleotide sequence of which is as shown in SEQ ID NO. 14; an EBIV M segment, the nucleotide sequence of which is as shown in SEQ ID NO. 15; an EBIV S segment, the nucleotide sequence of which is as shown in SEQ ID NO. 16; and a gene fragment of a green fluorescent protein, the nucleotide sequence of which is as shown in SEQ ID NO. 17.
In a second aspect, an embodiment of the present application discloses a plasmid composition comprising a recombinant plasmid constructed with the nucleotide sequences shown in SEQ ID NO. 14, 15, 16, and 17, respectively, for use in the construction of wild-type or recombinant EBIV. The term “wild-type EBIV” refers to the EBIV screened and isolated in the natural environment, and the term “recombinant EBIV” refers to the EBIV strain capable of expressing not only the conventional genetic characteristics of the EBIV, but also over-expressing/deleting certain genes or expressing certain tag genes obtained by using reverse genetics means to rescue the wild-type EBIV, or carrying out gene modification, gene marking and gene recombination on the wild-type EBIV.
In a third aspect, an embodiment of the present application discloses a set of primers for the nucleic acid composition of the first aspect, comprising: a primer pair for amplifying the nucleic acid sequence as shown in SEQ ID NO. 14, as shown in SEQ ID NO. 1 and 2; a primer pair for amplifying the nucleic acid sequence as shown in SEQ ID NO. 15, as shown in SEQ ID NO. 3 and 4; and a primer pair for amplifying the nucleic acid sequence as shown in SEQ ID NO. 16, as shown in SEQ ID NO. 5 and 6;
In a fourth aspect, an embodiment of the present application discloses a kit for amplifying the nucleic acid composition of the first aspect, comprising the set of primers of the third aspect.
In a fifth aspect, an embodiment of the present application discloses a recombinant EBIV strain carrying the gene sequences as shown in SEQ ID NO. 14, 15, 16, and 17, which was deposited at the China Center for Type Culture Collection on Jan. 25, 2022, with the deposit address of Wuhan University, Wuhan, China (address of No. 299, Bayi Road, Wuhan City, Hubei Province), and the Deposit Number of CCTCC NO. V202204.
In a sixth aspect, an embodiment of the present application discloses a recombinant host bacterium carrying the nucleic acid sequences shown in SEQ ID NO. 14, 15, 16, and 17.
In a seventh aspect, an embodiment of the present application discloses a method for preparing a recombinant EBIV strain, the method comprising the steps of amplifying the nucleic acid composition of the first aspect using the set of primers and the kit of the third and fourth aspects; ligating the gene sequence with a vector plasmid to obtain the recombinant plasmid of the second aspect; obtaining a positive clonal culture of the recombinant host bacterium carrying the recombinant plasmid of the sixth aspect; obtaining a plurality of the recombinant plasmids from the positive clone culture; transfecting the recombinant plasmid into host cells and culturing same; harvesting the transfected culture containing the recombinant EBIV strain.
In an eighth aspect, an embodiment of the present application discloses the use of the nucleic acid composition of the first aspect, wherein the use includes at least one of the preparation of a recombinant EBIV, expression of a protein associated with the recombinant EBIV, screening for drugs that antagonize EBIV, in vitro tracing of a recombinant EBIV, preparation of a vaccine against EBIV, and preparation of a product associated with detection of EBIV.
Compared with the prior art, the present application has at least the following beneficial effects:
In order that the objects, aspects, and advantages of the present invention will become more apparent, a more particular description of the present invention will be rendered by reference to the embodiments. It should be understood that the particular embodiments described herein are illustrative only and are not restrictive. The reagents not described in detail separately in the present application are all conventional and can be obtained from commercial sources; Methods not specifically described in detail are conventional experimental methods and are known from the prior art.
Acquisition of EBIV Genome Sequence
The original EBIV strain used in the present application was isolated from Culx modestus by the Center for Disease Control and Prevention of Xinjiang Military Command. It was used to clone the L. M, and S segments of EBIV. The specific implementation process was as follows:
1. Materials
Source of strain: the original strain was isolated from Cx. modestus by the Center for Disease Control and Prevention of Xinjiang Military Command. The Cx. modestus were washed with PBS 3 times, added with 2 mL of DMEM medium, and repeatedly ground. The ground product was centrifuged for 5 min at 3000 r/min. The supernatant was filtered by a 0.22 μm filter membrane. The filtered supernatant (1 mL) was added into BHK-21 cells (the cells were cultured in a 25 cm2 cell culture flask). After adsorption at 37° C.: for 1 h. the supernatant was removed and 5 mL of DMEM medium containing 2% fetal bovine serum (v/v) was added into the cell culture flask. The flask was placed in a 5% CO2 incubator for culture for more than 3 d. Olympus IX51 microscope was used to observe the cytopathic effect every day. The virus supernatant was absorbed and stored at −80° C. Source of cells: BHK-21 cells, Item No: C1-0034; specification: 1×106 cells/T25 culture flask, Procell Life Science & Technology Co., Ltd., Wuhan.
2. RT-PCR
The EBIV isolate was serially diluted and inoculated into BHK-21 medium (cell concentration: 1×106 cells/mL) at an inoculum with a multiplicity of infection (MOI) of 0.01. After 72 h of culture at 37° C., the viruses were harvested. The QIAamp®10 Viral RNA Mini KIT (Qiagen) was used to extract virus RNA. The GoScript™ Reverse Transcription System (Promega) was used to synthesize cDNA, which is used as a template for PCR amplification using KOD One™ PCR Master Mix Blue (TOYOBO). The PCR reaction system of 50 μL: 2× Reaction Mix Buffer, 25 μL, 10 μM Forward Primer, 2 μL, 10 μM Reverse Primer, 2 μL, Template DNA, 1 μL, and Nuclease-Free Water, 20 μL. The amplification condition: 98° C. for 10 s, 57° C. for 5 s, and 68° C. for 5 s, for 25 cycles. Among them, all the primer were generated and provided by Tsingke Biotechnology Co., Ltd., Beijing.
The results are shown in
Construction of Recombinant Plasmids
1. Construction of pLCK-EBIV-L, pLCK-EBIV-M andpLCK-EBIV-S
Through the method of homologous recombination, L, M, and S sequence fragments were respectively ligated with linearized pLCK plasmids using ClonExpress® II One Step Cloning Kit (Vazyme) to obtain plasmids pLCK-EBIV-L, pLCK-EBIV-M and pLCK-EBIV-S. The ligation reaction system of 20 μL: 5×CE II Buffer 4 μL, Exnase II 2 μL, pLCK 46 ng, L fragment 280 ng, and ddH2O to 20 μL. The reaction condition: 37° C. for 30 min.
Transformation procedures of three plasmids: 5 μL of each of the three ligation reactants (pLCK-EBIV-L, pLCK-EBIV-M and pLCK-EBIV-S into one of three tubes containing XL10 (Vazyme) was added into competent cells respectively. The tubes containing cells were kept into the ice for 30 min and were heat shock at 42° C. for 90 s. Then they were put into ice for 2 min again. After that, each tube containing cells were then added with 900 mL of LB medium and incubated in a shaker of 200 rpm at 37° C. for 1 h. Subsequently, the bacterial cells was coated on a plate containing kanamycin and cultured in an incubator at 37° C. overnight.
Colony PCR procedures of three plasmids: after the colonies on the plate grew to a visible size, one colony was picked, put into a tube containing 300 μL of LB medium, and the tubes were shaken at 220 rpm for 3-4 h at 37° C. Then, 2 μL bacterial solution was aspirated for colony PCR.
Colony PCR: colony PCR amplification reactions were performed using 2× Rapid Taq Master Mix (Vazyme), the reaction system of 50 μL: 2× Rapid Taq Master Mix 25 μL, each of upstream and downstream primers (see L-F/R, M-FIR, and S-F/R in the primer table 1) 2 μL, bacterial solution 2 μL, ddH2O 19 μL. The amplification condition: 95° C. for 3 min, 95° C. for 15 s, 60° C. for 15 s, 72° C. for 1 min, for 35 cycles, and 72° C. for 5 min.
As shown in
2. Construction of pLCK-EBIV-eGFP/S
In this step, since the length of the self-cleaved polypeptide 2A sequence (P2A sequence) of Porcine teschovirus 1 is too short, only 66 bp, which is not convenient for gel recovery, the sequences were added into primers eGFP-R and CS-F, respectively, and then inserted into the plasmid by homologous recombination. The sequences of the primers used are shown in Table 1.
ctccagcctgcttcagcaggctgaggttagtagctccgc
ttcccttgtacagctcgtccatgccgag, as shown
cctgctgaagcaggctggagacgtggaggagaaccctggac
ctttggagctagaatttgaagatgtccctactaac, as
(1) Obtain eGFP Fragment
The plasmid pcDNA3.1-eGFP (Biofeng) carrying eGFP was used as a template for amplification using KOD One™ PCR Master Mix-Blue (TOYOBO) and the primers (eGFP-F and eGFP-R) shown in the primer table 1 to obtain a specific fragment of eGFP (as shown in SEQ ID NO. 17). As shown in
The PCR reaction system of 50 μL: 2× Reaction Mix Buffer, 25 μL, 10 μM eGFP-F, 2 μL, 10 μM eGFP-R, 2 μL, Template DNA, 1 μL, and Nuclease-Free Water, 20 μL. The amplification condition: 98° C. for 10 s, 57° C. for 5 s, 68° C. for 30 s, for 25 cycles.
(2) Obtain Linearized pLCK-EBIV-S Fragment
The pLCK-EBIV-S plasmid was used as a template for amplification using KOD One™ PCR Master Mix-Blue-(TOYOBO) and the primers (CS-F and CS-R) as shown in Table 1. The result is shown in
The PCR reaction system of 50 μL: 2× Reaction Mix Buffer, 25 μL, 10 μM CS-F, 2 μL, 10 μM CS-R, 2 μL, Template DNA, 1 μL, and Nuclease-Free Water, 20 μL. The amplification condition included: 98° C. for 10 s, 57° C. for 5 s, 68° C. for 30 s, for 25 cycles.
(3) Construction of pLCK-EBIV-eGFP/S Plasmid
Since P2A was only 66 bp, it was added to primers eGFP-R and CS-F and both were inserted into the vector by homologous recombination. The reaction system for homologous recombination of 20 μL: 5× Reaction Buffer, 4 μL, eGFP fragment, 30 ng, cS fragment, 60 ng, Enzyme, 2 μL, and Nuclease-Free Water, 33 μL. The reaction condition: 37° C. for 30 min. Transformation of the ligation product was performed by using XL10 competent cells. The cultured single colony was subjected to colony PCR using primers eGFP-F and eGFP-R. The results are shown in
Preparation of Recombinant EBIV
In this example, the sequences of pLCK-EBIV-L, pLCK-EBIV-M, and pLCK-EBIV-eGFP/S after sequencing are as shown in SEQ ID NO. 18-20. The three plasmids were co-transfected into BSR-T7 cells (RE59683, Sciencell) to generate the recombinant EBIV.
1. Preparation Method
The concentrations of plasmids pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L were determined by Nanodrop; BSR-T7 cells were prepared and inoculated into 12-well cell culture plate (the number of cells in each well was 2×105). The cells were cultured in a cell incubator with a temperature of 37° C. and a C02 concentration of 5% until the cell confluence was 40-50%. The plasmids pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L were mixed in a mass ratio of 1:1:1 and 1:2:3 (the total mass of mixed plasmids was 1.5 mg). Then the mixed plasmids were added into 100 μL of serum-free medium (Gibco Opti-MEM), and then added with 4.5 μL of transfection reagent (Item No. MIR 2305, specification 5×1 mL, Mirus). The mixture was gently mixed well and then incubated at room temperature for 15-30 min. The medium of BSR-T7 cell was changed into the DMEM medium containing 2% FBS. Then, the above-mentioned transfection mixture was gently dropped into the wells. The control group cells were added with the same amount of null vector plasmid transfection mixture. The cell plate was placed into a cell incubator with a temperature of 37° C. and a CO2 concentration of 5% for culture. After transfection, the cell status and fluorescence expressions of the experimental group and control group were observed by Olympus inverted fluorescence microscope every 24 h. Rescue efficiency (%)=the number of wells showing cytopathic effect/number of experimental wells×100%.
The detection of virus titer: the rescued virus was diluted to 106 with a 10-fold gradient with DMEM medium. Add 100 μL of virus dilution into a 24-well cell culture plate containing BHK-21 cell monolayer at 37° C. After incubation for 1 h. remove virus dilution and add 500 μL DMEM cover containing 1.0% sodium carboxymethyl cellulose. The culture was performed in a 37° C. incubator for 3 d. After that, cells were immobilized with 3.7% formaldehyde overnight, and stained with 2% crystal violet to count the number of plaques. Virus titer (PFU/mL)=the number of plaques/(dilution factor x inoculation volume per well).
2. Results
As a result, as shown in
At the same time, according to the results in Table 2, when the co-transfection ratio of pLCK-EB1V-eGFP/S, pLCK-EBIV-M and pLCK-EBIV-L plasmids is 1:2:3, the rescue efficiency of recombinant EBIV is higher than that of the co-transfection ratio of 1:1:1. Furthermore, in the present application, the constructed recombinant EBIV (named as green fluorescent-labeled recombinant EBIV, rEBIV/eGFP/S) was deposited at the China Center for Type Culture Collection on Jan. 25, 2022, with the deposit address of Wuhan University, Wuhan. China (address of No. 299, Bayi Road, Wuhan City, Hubei Province), and Deposit Number of CCTCC NO. V202204.
Continuous Passage of Recombinant EBIV
Furthermore, the present application also studies the stability of the fluorescence signal of the continuous passaged recombinant EBIV. The specific steps were as follows.
1. Materials and Methods
(1) A 6-well plate for BHK-21 cells (hamster kidney cells, Procell Life Science & Technology Co., Ltd, Wuhan) was prepared. DMEM medium (Gibco) containing 10% FBS (Gibco) was used as a culture medium. The experiment would be conducted when the cells grew to 40-50%.
(2) 100 μl of the recombinant EBIV obtained above was added into BHK-21 cells, which were then incubated in a 37° C. incubator for 1 h. Remove the cell supernatant and add DMEM medium containing 2% FBS. The cell plate was placed in an incubator with a temperature of 37° C. and a CO2 concentration of 5% for culture. Cell fluorescence and cell status were observed every 24 hours. After the cells developed the cytopathic effect, the cell supernatant was inoculated into new cells. The virus was serially passaged for 10 generations to observe whether its fluorescence was stable.
(3) the RNA of each generation of the P1-P10 virus was extracted to RT-PCR.
(4) RNA Extraction: 200 μL of each generation of P1-P10 virus was collected. S-48 flux nucleic acid extractor (NanoMagBio) and its matching kit, magnetic bead method virus RNA extraction kit (NanoMagBio) were used to perform RNA extraction.
(5) RT-PCR: RT-PCR amplification reactions were performed using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara). The system of 50 μL: 2× One Step Buffer (Dye Plus), 25 μL, PrimeScript one Step Enzyme Mix, 2 μL, each of upstream and downstream primers (see eGFP-Test-F/R in Primer Table), 1 μL, each of RNA of P1-P10, 1 μL, and RNase Free dH2O, 20 μL. The amplification condition: 50° C. for 30 min, 94° C. for 2 min, 94° C. for 30 s, 55° C. for 30 s, for 35 cycles, and 72° C. for 1 min.
2. Results
The results shown in
Application of Antiviral Drug Screening
Further, the recombinant EBIV disclosed in the examples of the present application can also be used for the screening of antiviral drugs, for example for the screening of antiviral compounds. The specific steps were as follows.
(1) A 96-well plate for BHK-21 cells was prepared. The cells were planked at 104 cells/well. The plate was cultured in a cell incubator with a temperature of 37° C. and a CO2 concentration of 5%. The drug screening test was conducted when the cells grew to 40-50%. The drug to be tested was dissolved in dimethyl sulfoxide. Then the drug was diluted to 100 μM with DMEM medium containing 2% FBS. After that, the drug was subjected to serial 2-fold dilution to obtain the dilution gradient with the concentration of 100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, and 1.5625 μM, respectively (the concentration of DMSO in the diluted drug shall be <0.1%).
(2) The original culture medium was removed from the 96-well plate. The virus was inoculated into the 96-well plate at an MOI of 0.01 and a volume of 100 μL/well. At the same time, the diluted drugs to be tested were respectively added into the same 96-well plate at 100 μL/well and mixed well with the virus solution. The plate was incubated in a cell incubator with a temperature of 37° C. and a CO2 concentration of 5% for 36 hours before detection.
(3) The 96-well plate was photographed and data was analyzed using a high content screening (HCS) system to determine the amount of fluorescence per well and calculate the Z-factor for each compound:
where the four parameters σs, σc, μs, and μc represent the standard deviation and mean of the sample to be tested (s) and the negative (c) control, respectively. The stability and sensitivity of the screening system were then assessed using the Z′-factor:
where the four parameters σp, σn, μp, and μn represent the standard deviation and mean of the positive sample (p) and the negative (n) control, respectively.
(4) Cell viability per well (and the percentage of cells remaining per well) was observed under a microscope and the half-maximal effect concentration (EC50) of the drug was calculated using GraphPad Prism 9 software and an EC50 graph was plotted.
As can be seen in
The above experimental results prove that the recombinant EBIV stably carrying the green fluorescent protein in the present application can provide a research basis for in vivo and in vitro virus tracing, virus detection, antiviral drugs, and vaccine screening, and has a very important application prospect.
The above is only the preferred specific implementation method of this application, and the scope of this application is not limited to this. Any changes or replacements that can be easily thought of by technical personnel familiar with the technical field within the scope of the disclosure in this application should be covered within the scope of this application.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2022102494142 | Mar 2022 | CN | national |
