TREA

Eimeria acervulina 16S rDNA probes

Follow

Information

  • Patent Grant
  • 5298613
  • Patent Number
    5,298,613
  • Date Filed
    Tuesday, May 12, 1992
    32 years ago
  • Date Issued
    Tuesday, March 29, 1994
    30 years ago
Information
Abstract
Unique species-specific Eimeria acervulina DNA probes comprising divergent DNA sequences are disclosed. The probes are complementary to a small subunit ribosomal RNA gene of Eimeria acervulina.
Description
Claims
  • 1. A DNA probe, the DNA probe consisting of 5' TACGATAACCGAAGTTACCG 3' (SEQ ID NO:35).
  • 2. A composition, consisting essentially of a DNA probe consisting of 5' TACGATAACCGAAGTTACCG 3' (SEQ ID NO:35).
RELATED U.S. APPLICATION DATA

This application is a continuation-in-part of application Ser. No. 07/706,817, filed May 29, 1991 now abandoned, which is incorporated herein by reference. FIGS. 1A & B. Single strand nucleotide sequence for E. acervulina small subunit rRNA gene. (SEQ ID NO:24) FIGS. 2A & B. Single strand nucleotide sequence for E. brunetti small subunit rRNA gene. (SEQ ID NO:25) FIGS. 3A & B. Single strand nucleotide sequence for E. maxima small subunit rRNA gene. (SEQ ID NO:26) FIGS. 4A & B. Single strand nucleotide sequence for E. mitis small subunit rRNA gene. (SEQ ID NO:27) FIGS. 5A & B. Single strand nucleotide sequence for E. necatrix small subunit rRNA gene. (SEQ ID NO:28) FIGS. 6A & B. Single strand nucleotide sequence for E. praecox small subunit rRNA gene. (SEQ ID NO:29) FIGS. 7A & B. Single strand nucleotide sequence for E. tenella small subunit rRNA gene. (SEQ ID NO:30) FIG. 8. Species-specific hybridization to genomic DNA isolated from purified preparations of Eimeria, showing the specificity of the E. tenella probe. FIG. 9. Species-specific hybridization to genomic DNA isolated from purified preparations of Eimeria, showing that the Eimeria probes hybridize to both nonprecocious laboratory isolates and vaccine strains. FIG. 10. Species-specific detection of Eimeria in the intestinal mucosa of infected chickens. FIG. 11. Species-specific detection of Eimeria in the intestinal mucosa of heptavalent infected chickens. FIGS. 12A, 12B, 12C, 12D, 12E, 12F, 12G, 12H, 12I, 12J, 12K, 12L, 12M, 12N, 12O, 12P, 12Q, 12R. Multiple nucleotide sequence alignment for chicken Eimeria using the sequences in FIGS. 1-7. (SEQ ID NO:24-30) FIG. 13. DNA dot blot analysis using total RNA and species-specific oligonucleotide probes. FIG. 14. DNA dot blot analysis using total RNA and species-specific oligonucleotide probes. FIG. 15. Design of species-specific oligonucleotide probes. FIG. 16. Direct fecal oocysts DNA target in probe hybridization/parasite quantitation assay.

US Referenced Citations (5)
Number Name Date Kind
4544548 Davis et al. Oct 1985
4552759 Davis et al. Nov 1985
4752475 Davis et al. Jun 1988
4863731 Davis et al. Sep 1989
4908308 Van der Ploeg et al. Mar 1990
Foreign Referenced Citations (1)
Number Date Country
WO8500752 Aug 1984 WOX
Non-Patent Literature Citations (28)
Entry
Joyner & Long, Avian Path. 3: 145-157, 1974.
Shirley, Research in Avian Coccidiosis, pp. 13-35, 1985.
Hasegawa et al, J. Mol. Evol. 22: 32-38, 1985.
Johnson et al, Exp. Parasitol. 63: 272-278, 1987.
Dame & McCutchan, J. Biol. Chem. 258: 6984-6990, 1983.
Langsley et al, Nucleic Acids Res. 11: 8703-8717, 1983.
Ellis & Blumstead, Parasitol. 101: 1-6, 1990.
Johnson et al, System Parasitol. 18: 1-8, 1991.
McCutchan et al, Mol. Biochem. Parasitol. 28: 63-68, 1988.
Forsman et al, Appld Environ. Microbiol. 56: 949-955, 1990.
Dans et al, Nucleic Acids Res. 165: r187-r173, 1988.
Ferreira et al, Mol. Biochem. Parasitol. 19: 103-109, 1986.
Arreaza et al, Exp. Parasitol. 72: 103-105, 1991.
Saiki et al, Science 239: 487-491, 1988.
Labarca & Paigen, Anal. Biochem. 102: 344-352, 1980.
Johnston et al, Electrophoresis 11: 355-360, 1990.
Jackson, Parasiotol. 54: 87-93, 1964.
Edgar, Trans. Am. Micro. Soc. 62: 237-242, 1954.
Neefs et al, Nucleic Acids Res. 18S: 2237-2317, 1990.
Clark, Nucleic Acids Res. 16: 9677-9686, 1988.
Vogelstein & Gillespie, Proc. Nat. Acad Sci. USA 76: 615-619, 1979.
Sanger et al, J. Mol. Biol. 143: 161-178, 1980.
Chen & Seeburg, DNA, 4: 165-170, 1985.
Tabor & Richardson, Proc. Natl. Acad. Sci. USA 84: 4767-4771, 1987.
Freier et al, Proc. Natl. Sci. USA 83: 9373-9377, 1986.
Suggs et al, ICN-UCLA Symp. Dev. Biol. Using Purified Genes, 23: 683-693, 1981.
Chirgwin et al, Biochemistry 18: 5294-5299, 1979.
Hans et al. (1987) Biochemistry, vol. 26, pp. 1617-1625.
Continuation in Parts (1)
Number Date Country
Parent 706817 May 1991