TREA

Eimeria brunetti 16s rDNA probes

Follow

Information

  • Patent Grant
  • 5278298
  • Patent Number
    5,278,298
  • Date Filed
    Tuesday, May 12, 1992
    32 years ago
  • Date Issued
    Tuesday, January 11, 1994
    30 years ago
Information
Abstract
Unique species-specific Eimeria brunetti DNA probes comprising divergent DNA sequences are disclosed. The probes are complementary to a small subunit ribosomal RNA gene of Eimeria brunetti.
Description
Claims
  • 1. A DNA probe, the DNA probe selected from the group consisting of 5'CCCCTTCATAGAAAGGAAGCC3'(SEQ ID NO:8) and 5'GATACGGTAACCAAAGTCACC3'(SEQ ID NO:36).
  • 2. A DNA sequence composition, the composition consisting of essentially of 5'CCCCTTCATAGAAAGGAAGCC3'(SEQ ID NO:8), 5'GATACGGTAACCAAAGTCACC3'(SEQ ID NO:36), and mixtures thereof.
RELATED U.S. APPLICATION DATA

This application is a continuation-in-part of application Ser. No. 07/706,717, filed May 29, 1991 now abandoned, which is incorporated herein by reference.

US Referenced Citations (4)
Number Name Date Kind
4544548 Davis et al. Oct 1985
4552759 Davis et al. Nov 1985
4752475 Davis et al. Jun 1988
4863731 Davis et al. Sep 1989
Foreign Referenced Citations (1)
Number Date Country
WO8500752 Aug 1984 WOX
Non-Patent Literature Citations (28)
Entry
Hans et al. (1987) Biochemistry, vol. 26, pp. 1617-1625.
Joyner and Long, Avian Path. 3: 145-157, 1974.
Shirley, Research in Avian Coccidiosis, pp. 13-35, 1985.
Hasegawa et al, J. Mol. Evol. 22: 32-38, 1985.
Johnson et al, Exp. Parasitol. 63: 272-278, 1987.
Dame and McCutchan, J. Biol. Chem. 258: 6984-6990, 1983.
Langsley et al, Nucleic Acids Res. 11: 8703-8717, 1983.
Ellis and Blumstead, Parasitol. 101: 1-6, 1990.
Johnson et al, System Parasitol. 18: 1-8, 1991.
McCutchan et al, Mol. Biochem. Parasitol. 28: 63-68, 1988.
Forsman et al, Appld Environ. Microbiol. 56: 949-955, 1990.
Dans et al, Nucleic Acid Res. 165: r87-r173, 1988.
Ferreira et al, Mol. Biochem. Parasitol. 19: 103-109, 1986.
Arreaza et al, Exp. Parasitol. 72: 103-105, 1991.
Saiki et al, Science 239: 487-491, 1988.
Labarca and Paigen, Anal. Biochem. 102: 344-352, 1980.
Johnston et al, Electrophoresis 11: 355-360, 1990.
Jackson, Parasiotol 54: 87-93, 1964.
Edgar, Trans. Am. Micro. Soc. 62: 237-242, 1954.
Neefs et al, Nucleic Acids Res. 18S: 2237-2317, 1990.
Clark, Nucleic Acids Res. 16: 9677-9686, 1988.
Vogelstein and Gillespie, Proc. Natl. Acad Sci. USA 76: 615-619, 1979.
Sanger et al, J. Mol. Biol. 143: 161-178, 1980.
Chen and Seeburg, DNA, 4: 165-170, 1985.
Tabor and Richardson, Proc. Natl. Acad. Sci. USA 84: 4767-4771, 1987.
Freier et al, Proc. Natl. Acad. Sci. USA 83: 9373-9377, 1986.
Suggs et al, ICN-UCLA Symp. Dev. Biol. Using Purified Genes, 23: 683-693, 1981.
Chirgwin et al, Biochemistry 18: 5294-5299, 1979.
Continuation in Parts (1)
Number Date Country
Parent 706717 May 1991