NOT APPLICABLE
In recent years optical imaging has emerged as a sensitive detection method for diagnostic and therapeutic purposes. Quantum dots (Qdots), nanometer scale semiconductor materials, represent an important class of fluorescence probe for biomolecular and cellular imaging (Michalet, X. et al., Science 307, 538544 (2005)). Qdots are promising as optical probes because they are brighter than traditional organic chromophores, are resistance to photobleaching, have narrow and size-tunable emission wavelength, and have broad excitation spectra. These unique optical properties of Qdots make them appealing as in vivo and in vitro fluorophores in a variety of biological investigations. Furthermore, since the emission wavelength is readily tuned by controlling the size of the Qdots, they can be synthesized to emit different colors, allowing multiplex imaging which is essential in diagnosis of complex biological systems (Xing, Y. et at., Nat Proc., 2, 1152-1165 (2007). The use of Qdots as optical probes was originally pioneered by Alivisatos and Weiss and by Nie, in 1998. In the investigations of Alivisatos et al, two different size CdSe—CdS core-shell nanocrystals enclosed in a silica shell were prepared for fluorescent imaging of mouse fibroblast cells (Bruchez, M., Jr. et al., Science, 281, 2013-2016 (1998)). Nie et al investigated receptor mediated endocytosis of transferrin receptor in cultured HeLa cells using CdSe—ZnS Qdots coupled with transferrin (Chan, W. C.; Nie, S., Science, 281, 2016-2018 (1998)). By chemically conjugating antibodies and peptides to their surface, quantum dots can specifically target cellular ligands of interest. Biocompatible Qdots have thus been applied for labeling cells (fixed and live) and tissues (Wu, X. et al., Nat Biotechnol, 21, 41-46 (2003)), long term cell trafficking (Stroh, M. et al., Nat Med, 11, 678-682 (2005)), multicolor cell imaging (JaiswaI, J. K. et al., Nat Biotechnol., 21, 47-51 (2003)), tumor cell extravasation tracking (Voura, E. B. et al., Nat Med., 10, 993998 (2004); Tada, H. et al., Cancer Res., 67, 11381144 (2007)), fluorescence resonance energy transfer (FRET)-based sensing (Medintz., L. et al., Nat Mater., 2, 630-638 (2003)), bioluminescence resonance energy transfer (BRET-based imaging (So, M. K. et al., Nat Biotechnol., 24, 339-343 (2006) and sentinel lymph-node mapping (Kim, S. et al., Nat Biotechnol., 22, 93-97 (2004)). Semiconductor Qdots are also suitable for real-time in vivo imaging (Maysinger, a et al., Nano Lett, 7(8):2513-20 (2007)), Qdots surface-modified with polyethylene glycol (PEG) were reported to be biocompatible for in vivo cancer targeting and imaging (Maysinger, D. et al., al., Nano Lett. 7(8):2513-20 (2007); Ballou, B. et al., Bioconjug Chem., IS, 79-86 (2004); Gao, X. et al., Nat Biotechnol., 22, 969-976 (2004)).
Antibodies can be engineered into a wide variety of formats that retain binding, specificity with target antigen and exhibit optimal properties such as rapid targeting and controlled blood clearance for in vitro or in vivo applications (Kenanova, V.; Wu, A. M. Expert Opin Drug Deliv., 3, 53-70 (2006)). Intact monoclonal antibodies are large (150 kDa) protein molecules. Smaller antibody fragments have been shown to be superior in their ability to extravasate and penetrate solid tumors in vivo, when compared with intact antibodies (Yokota, T. et al., Cancer Res., 52, 34023408 (1992)). Genetically fusing variable light (VL) and heavy (VH) chain domains of a parental antibody through a peptide linker results in the production of a single-chain variable fragments (scFv, 27 kDa.), at. about ⅙ the size of native antibody, with the same specificity as that of parental antibody. The noncovalent dimers of scFvs are called diabodies (Db, 55 kDa) which can retain full antigen binding activity and specificity in smaller formats (Holliger, P. et al., Proc. Natl Acad Sci USA, 90, 6444-6448 (1993)). Our lab has previously demonstrated that radiolabeled diabodies against cancer antigens efficiently targeted to tumors in vivo by microPET (Sundaresan, G. et al., J Nucl Med, 44, 1962-1969 (2003); Wu, A. M. et al., Tumor Targeting, 4, 47-58 (1999)). Their small size (5×7 nm) makes these engineered antibody fragments specifically appropriate for conjugation to nanoscale particles (Carmichael, J. A. et al., Bioconjug Chem., 13, 985-995 (2002)). Conjugation by random chemical modification may be risky fir small antibody fragments, due to the possibility of inadvertently disrupting the binding site. Site-specific conjugation is more likely to preserve the binding activity of an antibody. X-ray crystallographic structure of the anti-CEA T84.66 diabody shows that the C-termini of the diabody subunits are almost 70 Angstrom apart and on an alternate face from the antigen combining site (Carmichael, J. A. et al., Bioconjug Chem., 13, 985-995 (2002)), Introduction of cysteine residues at the C-termini of scFv fragment has been considered as an approach to allow site-specific, thiol-reactive coupling at a site away from the antigen binding site to a wide variety of agents (
This invention provides conjugates of cys-diabodies with nanoparticles and methods of using the conjugates in optical imaging for diagnostic purposes. The invention relates to Applicants surprising finding that the conjugates retain their specificities and advantageous affinities fir their molecular targets when so used. The Applicants demonstrated that the conjugates retained their dual functionality: antigen binding and fluorescent signaling.
In a first aspect the invention provides a conjugate of a C-terminal modified diabody and a nanoparticle, wherein the C-terminal modification introduces a cysteine residue at a C-terminus of the diabody (cys-diabody) and the cys-diabody is covalently linked to the nanoparticle by a heterobiofunctional linker attached to the cysteine residue.
In another aspect, the invention provides a method of conjugating a cys diabody to a nanoparticle by 1) making or providing a cysteine modified diabody wherein the modification introduces a cysteine residue at the C-terminus of each monomer of the diabody, wherein the introduced cysteines are joined by disulfide bond between them or may form a disulfide bond with another monomers or another diabody; 2) reducing the disulfide bond to form sulfhydryl groups; and 3) reacting the sulfhydryl groups with a heterobifunctional marker or a maleimide-activated nanoparticle; thereby conjugating the diabody to the nanoparticle. In some embodiments, the nanoparticle is a Quantum rod or carbon nanotube or a Qdot.
In still another aspect, the invention provides a method of detecting a cancer markers on tumor cells by optical imaging by contacting the cancer cell with a conjugate according to the invention. Where the conjugate comprises a fluorescent nanoparticle (e.g., r Qrod), the methods detects the presence of the conjugate by detecting the fluorescence of the conjugated fluorescent nanoparticle. The method may be practiced in vitro or in vivo.
With respect to any of the above aspects, in some embodiments, the nanoparticle is a quantum dot or quantum rod (e.g., a CdSe/ZnS Qdot), In a particular embodiment, the quantum dot is CdSe/ZnS Qdot 655. In a preferred embodiment, the diabody is an anti-cancer antigen diabody. In another preferred embodiment, the quantum dot is a pegylated quantum dot. In a still further embodiment, the quantum dot is PEG Qdot 800. In some embodiments, the conjugate comprises an amine sulfhydryl reactive linker which covalently links the diabody to the nanoparticle. For instance, in some embodiments, the linker is EMCS. In another embodiment, the diabody is linked to the nanoparticle via a heterobifunctional linker which connects the cysteine reside to the quantum dot via an aminopolyethyleneglycol moiety. In still other embodiment, the C-terminal modification of the diabody is an insertion of a Gly-Gly-Cys at the C-terminus of the VH domain of each monomer of the diabody. In yet another embodiment in any of these aspects, the diabody has a pentapeptide sequence Ser-Gly-Gly-Gly-Gly-Gly inserted between the VL and VH domains. In a preferred embodiment, the diabody is an anti-HER2 diabody or an anti-PSCA diabody. The conjugate may comprise a plurality of cys-diabodies covalently linked to the nanoparticle (e.g., 6).
In another set of embodiments with respect to any of the above embodiments, the conjugate comprises an anti-CD20 diabody.
In another aspect still the invention provides conjugates of cys-diabodies as discussed above wherein the cys-diabody is conjugated to a fluorophore other than a nanoparticle. These fluorophore conjugates find diagnostic, therapeutic, and imaging uses as for the nanoparticle conjugates with a cys-diabody. These fluorophore conjugates can be conjugated by heterobifunctional linkers as for the nanoparticles. Suitable cys-diabody conjugates with fluorophores and methods of making the fluorophores are disclosed in Sirk et al., Bioconjug Chem. 2008 December;19(12):2527-34, the disclosure of which is incorporated herein be reference in its entirety as well as specifically with respect to the fluorophores used in the conjugates, the cys-diabodies of the conjugates, the linkers used, and the particular fluorophore cys-diabody conjugates described therein as well as being incorporated with respect to methods of making the conjugates, the conjugates so made, their methods of using the conjugates, and the experimental data evidencing the construction and operability of the conjugates.
The Her kinase growth factor receptor HER2/neu and prostate stem cell antigen (PSCA) are well characterized cell surface proteins whose expression is elevated in a subset of breast, prostate, and other epithelial cancers. Both proteins are targets for antibody therapeutics. The transmembrane glycoprotein of 185 kDa (p185HER-2), encoded by the HFR2/neu proto-oncogene is overexpressed in 20-30% of breast cancers and in some other cancers. Trastuzumab (Herceptin; Genentech, San Francisco, Calif.) is the humanized version of the 4D5 monoclonal antibody (mAb) that has been approved by the FDA for the treatment of p185HER-2 positive tumors. Anti-HER2 cys-diabody was constructed from the variable regions of trastuzumab with the introduction of a cysteine residue at the C-terminal of the diabody. The murine 1G8 (mulG8) mAb directed against PSCA prevents prostate tumor establishment, growth and metastasis in murine models (Safran et al., Proc Nat. Acad. Sci USA 98:2658-2663 (2001). Affinity matured recombinant scFv fragment composed of peptide-linked VL and VH domains, derived from the humanized IG8 mAb (2B3) was used as template for anti-PSCA cys-diabody (Lepin, E. unpublished data). For coupling to Qdots or other nanoparticies smaller antibody fragments would be preferable to intact IgGs (
In the present work, anti-HER2 and anti-PSCA cys-diabodies were site specifically coupled to visible/near infrared (NIR) Qdots and then these immunoQdots were used as targeted optical probes for in vitro cell imaging. Amino PEG CdSe/ZnS Qdot 655 (emission maxima at 655 nm, Invitrogen, Carlsbad, Calif.) was first conjugated to the heterobifunctional cross-linker[N-emaleimidocaproyloxy] succinimide ester (EMCS) (pierce, Rockford, Ill.), yielding a maleimide-nano crystal surface (
To visualize the structure of synthesized anti-HER2 immunoQdot 655,transmission electron microscopy (TEM) was performed on anti-HER2 immunoQdot 655 and mock conjugated Qdot 655. TEM bright field images revealed that Qdots were uniform in size at approximately 15×5 nm (
Photoluminescence (PL) measurements of Qdots were performed by excitation with a 488 nm laser.
To determine the HER2 receptor binding affinity of anti-HER2 immunoQdot, HER2-transfected human breast carcinoma MCF7/HER2 cells (Olafsen, T. et al., Cancer Res., 65, 5907-5916 (2005)) were incubated with anti-HER2 immunoQdot 655 and examined by confocal microscopy (Carl Zeiss, excitation: Argon Laser 488 nm). The result demonstrated homogeneous surface labeling of cell membrane with minimal cytoplasmic compartment labeling. Little non-specific binding to the cells was observed with mock conjugated Qdot 655 (
The anti-HER2 immunoQdot 655 was also used to assess HER2 expression on MCF7/HER2 cells by flow cytometry. Results showed a strong fluorescent shift of antiHER2 immunoQdot 655 with MCF7/HER2 cells (
Specific binding of anti-HER2 immunoQdot 655 was demonstrated by cell-based competition, in which Qdot conjugated cys diabody was incubated simultaneously in presence of increasing concentrations (0.1-1,000 nM) of competitor and analyzed by flow cytometry (
In small animals, NIR (700-900 nm) fluorescence imaging is expected to have major utility, because the absorbance spectra for biomolecules reach minima in the NIR region, providing a window for in vivo optical imaging. We extended the coupling of anti-HER2 cys-diabody to amino PEG CdSe/ZnS Qdot 800 (NIR Qdots, emission maxima at 785 nm, invitrogen, anti-HER2 immunoQdot 800). The specific binding of anti-HER2 immunoQdot 800 on MCF7/HER2 cells was confirmed by cell binding assay (
Following excitation with a 532 nm laser, the PL spectrum measurements of the Qdot showed maxima at around 785 nm (
Initially using individual Qdot conjugated cys-diabodies, anti-HER2 immunoQdot 655 and anti-PSCA immunoQdot 800, the expression of each cancer antigen, HER2 and PSCA, was examined on different cancer cells (Supporting information; Table 1). The simultaneous detection of the two cancer markers on LNCaP/PSCA prostate cancer cells (which also express HER2) was then demonstrated using a mixture of two immunoQdots, anti-HER2 immunoQdot 655 and anti-PSCA immunoQdot 800. Flow cytometric analysis showed that 96% of LNCaP/PSCA cells were stained with both immuno dots, compared to minimum background staining (1.4%) with mock conjugated Qdots (
In this work, we report the site-specific conjugation of engineered antibody fragments with visible NIR quantum dots for in vitro cell labeling and multiplex imaging. The amine modified quantum dots used in this work include a PEG spacer covalently attached to the Qdot surface. We found that the PEG linker gave less non-specific background compared to the corresponding carboxyl-modified Qdot 655, which does not possess a PEG linker (unpublished data). This characterization is most likely due to the increased hydrophilicity and higher stability resulting from the PEG-coating.
PEGylated Qdots have been previously described for imaging of whole animals (Gao, X. et al., Nat Biotechnol., 22, 969-976 (2004)). Addition of multiple PEG molecules provides improved biocompatibility and blood retention time. These improved properties of immunoQdots can facilitate their use as optical imaging probes in vivo. Recently the delivery of Qdot 655 labeled antibody to tumor cells was investigated by in vivo real-time tracking (Tada, H. et al., Cancer Res., 67, 1138-1144 (2007)). ROD modified Qdots have also recently been tracked in vasculature by their binding with integrins (Smith, B. R. et al., Nano Lett. (in Press) (2008)).
Most recent studies have been performed using streptavidin conjugated quantum dots to label antigen on the surface of the cells (Fountaine, T. J. et al., Mod Pathol., 19, 1181-1191 (2006); Laiswal, J. K. et al., Nat Methods., 1, 73-78 (2004); Howarth, M. et al., Proc Natl. Acad Sci USA., 102, 7583-7588 (2005)). In addition, several groups have developed methodologies for introducing specificities onto Qdots by conjugating intact antibodies (Tada, H. et al., Cancer Res., 67, 11381144 (2007); Ciao, X. et al., Nat Biotechnol., 22, 969-976(2004)>. One potential shortcoming of the existing Qdot conjugation with biomolecules, especially vis-a-vis in vivo applications, is that the Qdot bioconjugates become quite large (˜40-50 nm), once streptavidin or intact antibodies are incorporated. For large nanoparticles, it would be difficult to traverse the endothelium and penetrate into tissues and tumors. In contrast, in this work, small antibody fragments, cys-diabodies were directly labeled to Quantum dots. The overall small size (approximately 15-20 nm) of these immunoQdots make them ideal candidate for application in living organisms.
In conclusion, cys-diabodies are small, bivalent tumor-targeting antibody fragments that retain antigen binding specificity after incorporation of the cysteine modification at the C-termini. Their small size (5×7 nm) and favorable pharmacokinetics make them ideal for use in imaging and therapeutic applications. The present work demonstrates site-directed thiol-specific conjugation of cys-diabodies at a site away from the antigen binding site to the commercially available amino PEG quantum dots. The immunoQdots retain the photoluminescence properties of the unconjugated Qdots as well as the antigen binding specificity. The overall small size of cys-diabody conjugated Qdots should be suitable for use biological applications. The results of Qdot conjugation to cys-diabodies with different tumor specificities opens up new prospects for multiplex imaging in cancer. This thiol-reactive conjugation approach can be used as a generalized platform for site-specific coupling of cys-diabodies with a wide variety of other nanoparticles, such as Quantum rods or carbon nanotubes.
This work demonstrates successful thiol-specific, oriented coupling of tumor targeting small engineered antibody fragments, cys-diabodies, at a position away from the antigen binding site. These bioconjugated quantum dots (termed immunoQdots) demonstrated dual functionality: retention of antigen binding as well as fluorescent signal. Simultaneous detection of two tumor antigens on LNCaP/PSCA prostate cancer cells (which express PSCA and HER2) in culture was possible using two immuno dots, anti-HER2 immunoQdot 655 and anti-PSCA immunoQdot 800. The Applicants work in this field has now been published. See, Barat et al., Bioconjug Chem. 2009 Jul. 31 (epublished), the disclosures of which is incorporated herein be reference in its entirety as well as specifically with respect to the fluorophores used in the conjugates, the cys-diabodies of the conjugates, the linkers used, and the particular fluorophore cys-diabody conjugates described therein as well as with respect to methods of making the conjugates, the conjugates so made, their methods of use, and the experimental data evidencing their construction and operability.
The anti-HER2 diabody was constructed from trastuzumab (Herceptin™) human variable regions using an existing single-chain variable fragment (scFv) gene construct as template (Olafsen et al., Cancer Res., 65: 5907-5916 (2005)). Anti-HER2 CysDb was constructed from an existing minibody, composed of two trastuzumab (Herceptin™, Genentech) humanized scFvs linked to the CH3 domain of human IgG1. The scFv orientation and linker of the anti-HER2 minibody were as follows: VL-GSTSGGGSGGGSGGGGSS-VH. Overlapping PCR was used to shorten the 18 amino-acid-linker in the anti-HER2 scFv gene with a 5 amino-acid-linker (SGGGG). A Gly-Gly-Cys modification at the C-terminus of the VH domain in the pEE12 expression vector was also used (Lonza Biologics, Slough, UK) (Sirk, S. unpublished data), The pEE12 construct contains a mammalian leader sequence for extra cellular expression of the recombinant protein.
For anti-HER2 cys-diabody, 2.5×106 NSO cells (Galfre G. et al; Methods Enzymol. 1981, 73:3-46) were transfected by electroporation with 10 micrograms of linearized plasmid DNA and selected in glutamine-deficient media as described (Yazaki et al., Immunol Methods., 253:195-208 (2001)). Anti-HER2 cys-diabody, expression was screened by SDS-PAGE using pre-cast 4-20% gels (Bio-Rad, Hercules, Calif.), under reducing and non-reducing conditions. The highest expressing clones were expanded into triple flasks (Nunclon, Rochester, N.Y.). Supernatants containing the anti-HER2 cys-diabody were loaded onto a Protein L column (Pierce, Rockford, Ill.). Bound protein was anted using 0-100% gradient of 0.1 M glycine (pH 2.5) in PBS (pH 7.0). Eluted fractions were collected in the presence of 1/10 volume of 2 M Tris HCl pH 8.0. Eluted fractions containing the desired protein were pooled, dialyzed against PBS and concentrated by Centriprep 30 (Millipore Corp., Bedford, Mass.).
An anti-PSCA diabody was constructed from an existing affinity matured scFv (2B3, human variable regions of antibody against PSCA gene construct, (Olafsen et al. J Immunother, 30:396-405 (2007)). PCR overlap extension was used to amplify the VL and VH domains separately, inserting overlapping 6-amino acid linker (VL-SGGGGS-VH), as well as a Gly-Gly-Cys modification at the C-terminus of the VH domain. The final PCR product of anti-PSCA cys diabody was cloned into pSyn1 bacterial expression vector.
For bacterial expression, Escherichia coli BL21 cells were grown in Luria-Bertani broth (LB) to an OD600 of 0.7, induced with a final concentration of 1 mM IPTG and grown 4 hours at 37° C. Periplasmic extracts were prepared using Peripreps Periplasting Kits (Epicentre, Madison, Wis.). The anti PSCA cys-diabody was purified by immobilized Protein L chromatography as per manufacturer instructions (Pierce).
Qdots were conjugated to cys diabodies with Qdot 655 or Qdot 800 amino (PEG) quantum dots (Quantum Dot Corp., Hayward, Calif.). Qdots were activated with the heterobifunctional cross-linker [N-e-maleimidocaproyloxy] succinimide ester (EMCS) (Pierce) for 30 minutes at room temperature, yielding a maleimide-nanocrystal surface. Excess EMCS was removed by desalting column. cys diabodies were simultaneously reduced by incubating in 20 mM DTT at room temperature for 30 min. Then, activated Qdots were covalently coupled with reduced antibody fragment at room temperature for one hour in borate buffer (pH 7.4). The molar ratio of antibody fragment to the Qdots was 22:1. The reaction was quenched by adding 34 micrograms of N-ethyl maleimide (NEM) (Pierce) per mg of antibody fragment. The uncoupled free cys diabody and excess NEM were removed by three washes using a 100 KD ultrafiltration unit, Amicon Ultra-4 (Millipore Corp.) The final complex was kept in 10 mM borate buffer at 4° C.
Human breast tumor cell MCF7/HER2 was incubated with either anti-HER2 immunoQdot 655 or anti-HER2 immunoQdot 800 for 1 hour at 4° C. in PBS containing 1% BSA. Prostate cancer cells LNCaP/PSCA was incubated with anti-PSCA immunoQdot 800 using the same condition. Antibody fragments binding to tumor cells were quantified by FACS Calibur flow cytometer (Beckton Dickinson, UK) and data were analyzed by Cell Quest software. FL3 (λem: 670 run long pass) and FL5 (λem: 740 run long pass) were the filters used for Qdot 655 and Qdot 800 respectively.
MCF7/HER2 cells were plated on poly-L lysine coated glass coverslips (BD Biosciences, San Jose, Calif.) in 12 well-plates in DMEM medium containing 5% Fetal bovine serum (FBS) for 24 hours. The next day, cells were incubated with mock conjugated Qdot 655 and anti-HER2 immunoQdot 655 in PBS/1.% FBS on ice for 1 hr. Cells were then fixed with 3.7% paraformaldehyde at 4° C. for 30 min. Cell nuclei were counterstained with DAPI. Coverslips were mounted on glass slides and observed using a Leica TCS-SP inverted confocal microscope equipped with a 100× oil immersion objective lens.
All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety, to the extent not inconsistent with the present disclosure, for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.
A2 anti-PSCA cys-diabody nucleic acid and protein sequences.
DNA and protein sequences for anti-CD20 cysdiabody scFV subunit. The sequence begins with the mammalian leader sequence (bold type) followed by the V1 domain, 5-amino acid linker domain (underlined) VH domain and C-terminal cysteine modification (hold type):
atggattttcaggtgcagattatcagcttcctgctaatcagtgcttcagt
M D F Q V Q I I S F L L I S A S V
cataatgtccagaggacaaattgttctctcccagtctccagcaatcctgt
I M S R G Q I V L S Q S P A I L
tagtag
- -
The sequence for the HER Cys Db nucleic acid and diabody follows:
This application claims priority benefit of U.S. Provisional Application Ser. No. 61/086,741 filed Aug. 6, 2008, the contents of which are incorporated herein by reference in their entirety for all purposes.
This invention was made with Government support of Grant Nos. CAT 19367 and EB000312 awarded by the National Institutes of Health. The Government has certain rights in this invention.
| Number | Date | Country | |
|---|---|---|---|
| 61086741 | Aug 2008 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12537145 | Aug 2009 | US |
| Child | 14456452 | US |