A sequence listing, named “065869-0569568_SEQUENCE_LISTING.xml”, created Oct. 17, 2022, 337,122 bytes, in XML format accompanies this application. The sequence listing is incorporated by reference in its entirety herein for all purposes.
Frequent tests and quick results are critical for stopping the spread of SARS-CoV-2 and ending the current COVID-19 pandemic C. RT-qPCR (reverse transcriptase-quantitative polymerase chain reaction) has been the gold standard for viral diagnostics, but this method is slow and requires sophisticated equipment that is expensive to purchase and operate. Thus, there is an urgent need for inexpensive new technologies that enable fast, reliable, and scalable detection of viruses.
The disclosure relates to methods and engineered systems to detect presence of nucleic acid in a sample. In some examples, the nucleic acid may be associated with disease of a subject that provided the sample, which may include bodily fluid and/or other type of sample. In some examples, the nucleic acid may be ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). In some examples, the nucleic acid is from one or more genomes of a pathogen. In some examples, the pathogen may be a virus. In some examples, the pathogen may an RNA from bacteria. Various examples disclosed herein may be described in the context of detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that causes the Coronavirus Disease 2019 (COVID-19) in humans, although other nucleic acids may be detected. Furthermore, subjects other than humans may be tested based on the disclosures herein. It should be further understood that particular nucleic acids may be detected based on the disclosures herein, whether such nucleic acid to be detected originates from a pathogen or subject being tested. For example, the genetic makeup such as mutations or subject-specific sequences may be detected based on the disclosures herein.
One general aspect includes an engineered system to detect nucleic acid (NA) in a sample. The engineered system also includes an engineered type III clustered regularly interspaced short palindromic repeat (CRISPR)-Cas system to detect NA in the sample, the engineered CRISPR-Cas system may include: may include a CRISPR RNA-guide sequence that is complementary to a locus of the nucleic acid; a first subunit that undergoes a conformational change upon binding of the engineered type III CRISPR-Cas system to the locus of the nucleic acid, the conformational change activating DNase activity of the first subunit and/or polymerase activity of the first subunit, the polymerase activity generating one or more products. The system also includes a detection system to detect the DNase activity and/or the one or more products of the polymerase activity.
Implementations may include one or more of the following features. The nucleic acid may include a viral RNA. The viral RNA may include RNA of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The locus may include a nucleocapsid gene (n-gene) of the SARS-CoV-2. The locus may include a region of the viral RNA that is conserved among a plurality of SARS-CoV-2 genomes. The CRISPR guide sequence may include a nucleic acid sequence of SEQ ID NO. 1.
The one or more products may include a linear or cyclic oligonucleotide and where the detection system may include instrumented fluorometric detection may include: an RNA tether linking a fluorophore to a quencher; and a nuclease activated by the linear or cyclic oligonucleotide, the activated nuclease cleaving the RNA tether to thereby release the fluorophore that is detected by a fluorescence detecting instrument. The linear or cyclic oligonucleotide may include a cyclic oligoadenylate, and where the nuclease activated by the linear or cyclic oligonucleotide may include Csm6. The instrumented fluorometric detection further may include: a DNA tether linking the fluorophore or a second fluorophore to the quencher or a second quencher, where the DNase activity cleaves the DNA tether to thereby release the fluorophore or the second fluorophore. The detection system may include instrumented fluorometric detection may include: a DNA tether linking a fluorophore to a quencher, where the first subunit has a DNase activity that is activated upon hybridization of the RNA guide to the locus of the viral RNA, the DNase activity cleaving the DNA tether to thereby release the fluorophore that is detected. The one or more products may include a linear or cyclic oligonucleotide and where the detection system may include instrumented fluorometric detection may include: a DNA tether linking a fluorophore to a quencher; and a nuclease activated by the linear or cyclic oligonucleotide, the activated nuclease cleaving the DNA tether to thereby release the fluorophore that is detected by a fluorescence detecting instrument. The one or more products may include a pyrophosphate, and where the detection system may include visible fluorometric detection may include: a fluorescent dye quenched by a quencher; where the pyrophosphate forms an insoluble precipitate with the quencher to thereby unquench the fluorescent dye that is detected based on a color change. The fluorescent molecule may be calcein and the quencher may include manganese, and where unquenched calcein is bound by magnesium to form a fluorescent complex that is detected.
The first subunit may include a Cas10 subunit, the second subunit may include Csm3, and where an activity of the Cas10 subunit is moderated by activity of the second subunit in the wildtype form, and where the introduced mutation to the second subunit disrupts the moderation of the Cas10 subunit. The one or more products may include protons, and where the detection system may include a colorimetric system, the colorimetric system may include: a solution may include a pH-sensitive dye; and where the protons acidify the solution, resulting in a change in color of the pH-sensitive dye. The engineered type III CRISPR-Cas system further may include: an engineered second subunit may include a backbone subunit of the engineered type III CRISPR-Cas system with an introduced mutation, the engineered second subunit having RNase activity when in wildtype form, but the introduced mutation disrupting the RNase activity to prevent degradation of the viral RNA, thereby increasing signal generation of the detection system. The wildtype form of the second subunit may include an amino acid sequence of SEQ ID NO. 26 and the second subunit with the introduced mutation may include an amino acid sequence of SEQ ID NO. 27.
The one or more products may include (i) a linear or cyclic oligonucleotide, (ii) protons, and (iii) pyrophosphates where the detection system may include: fluorometric detection may include: an RNA tether linking a fluorophore to a quencher; a nuclease activated by the linear or cyclic oligonucleotide, the activated nuclease cleaving the RNA tether to thereby release the fluorophore that is detected; and colorimetric detection may include: a solution may include a pH-sensitive dye; and where the solution is acidified by the protons resulting in a change in color of the pH-sensitive dye. The fluorometric detection further may include: a DNA tether linking the fluorophore or a second fluorophore to the quencher or a second quencher, where the DNase activity cleaves the DNA tether to thereby release the fluorophore or the second fluorophore. The one or more products may include protons, where the detection system may include: fluorometric detection may include: a DNA tether linking a fluorophore to a quencher, where the DNase activity cleaves the DNA tether to thereby release the fluorophore that is detected; and colorimetric detection may include: a solution may include a pH-sensitive dye; and where the solution is acidified by the protons resulting in a change in color of the pH-sensitive dye. The nucleic acid may include RNA, the system may include: a reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer having a T7 binding site for RT-LAMP-T7 amplification of the RNA. The RT-LAMP-T7 amplification and the detection of the RNA may include a single pot combination.
One general aspect includes a method of detecting nucleic acid in a sample based on an engineered type III clustered regularly interspaced short palindromic repeat (CRISPR)-Cas system. The method of detecting nucleic acid also includes contacting the sample with the engineered type III CRISPR-Cas system, the engineered type III CRISPR-Cas system may include: a first subunit, and a CRISPR guide may include a CRISPR guide sequence engineered to be complementary to a locus of the nucleic acid. When the engineered CRISPR-Cas system binds to the nucleic acid at the locus via the CRISPR guide, the first subunit undergoes a conformational change that activates a nuclease activity and/or a polymerase activity of the first subunit; and detecting the nuclease activity and/or one or more products of the polymerase activity.
Implementations may include one or more of the following features. The method where the nucleic acid may include a viral RNA. The viral RNA may include RNA of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The method may include: prior to contacting the sample with the engineered type III CRISPR-Cas system, amplifying the viral RNA with an isothermal amplification. The isothermal amplification may include a reverse transcription loop-mediated isothermal amplification based on primers directed to the locus, the primers including a T7 promotor site for T7 RNA polymerization. The viral RNA is amplified without a polymerase chain reaction (PCR). The type III engineered CRISPR-Cas system may include a Csm3 subunit that cleaves the viral RNA, the method may include: introducing a mutation to the Csm3 subunit in the engineered CRISPR-Cas system to prevent degradation of the viral RNA. Contacting the sample with the engineered type III CRISPR-Cas system may include: contacting the sample with a fluorophore and a quencher tethered together by a nucleic acid tether, where the conformational change causes the Cas10 subunit to generate a linear or cyclic oligonucleotide that activates a nuclease, the activated nuclease cleaving the nucleic acid tether to thereby release the fluorophore from the quencher; and where detecting the one or more products may include detecting a level of fluorescence of the released fluorophore. The tether may include a ribonucleic acid and/or a deoxyribonucleic acid tether.
Contacting the sample with the engineered type III CRISPR-Cas system may include: contacting the sample with a pH-sensitive dye, where the conformational change causes the Cas10 subunit to generate protons that acidifies the solution; and where detecting the occurrence of the conformational change may include detecting acidification of the solution through a change in color of the pH-sensitive dye. Contacting the sample with the engineered type III CRISPR-Cas system may include: contacting the sample with a solution may include a fluorescein dye quenched by metal ions, where the polymerase activity of the first subunit generates pyrophosphates that sequester the metal ions to free the fluorescein dye, the free fluorescein dye binding with the cofactors to generate a fluorescent complex; where detecting the one or more products may include detecting the fluorescent complex.
The engineered type III CRISPR-Cas system may be implemented as an assay for testing SARS-CoV-2 virus (or other target nucleic acid in the sample) that can be performed quickly, such as in one hour or less. Nucleic acid recognition by type III systems may trigger Cas10-mediated nuclease activity and/or polymerase activity, which may generate one or more products such as pyrophosphates, protons and cyclic oligonucleotides. The nuclease activity and/or the one or more products of the Cas10-polymerase are detected using colorimetric, visible fluorometric, and/or instrumented fluorometric detection.
The engineered system 100 may include a modified CRISPR complex, detection components, and/or other components. The modified CRISPR complex may include a modified type III CRISPR complex. The modified CRISPR complex may include a CRISPR guide and a plurality of subunits.
The plurality of subunits may include a CRISPR guide, Cas10 subunit, backbone subunits associated with the Csm (such as Csm3) or Cmr systems, and/or other subunits necessary for assembly of the type III surveillance complex as well as the ancillary nucleases (such as Csm6, Can1, Csx). Various examples described herein may describe a CRISPR complex purified from the organism Thermus thermophilus. These examples may further describe the use of protein subunits of T. thermophilus CRISPR complexes. Accordingly, these examples may refer to the subunits as TtCas10, TtCsm3, TtCsm6, and so forth. It should be noted, however, that other protein subunits that perform similar functions may be used as well and/or instead of these examples of subunits.
The CRISPR guide may include a CRISPR guide sequence that is engineered to be complementary to a locus of the nucleic acid. The CRISPR guide sequence may be selected based on one or more conserved regions of the target nucleic acid. For example,
The CRISPR guide sequence may be designed based on conserved sequence across different samples of the SARS-CoV-2, different strains of the SARS-CoV-2, and/or other samples available for the SARS-CoV-2. Such conserved sequence may be determined based on sequence alignments. A pairwise match may be considered when an alignment quality of the pairwise match is sufficient to determine that aligned portions of two sequences represent a conservation of the nucleotides in the sequences across genomes of SARS-CoV-2 (or other target). The alignment quality may be specified as having a minimum overlap of at least about 1 base, 2 bases, 4 bases, 4 bases, 5 bases, 10 bases, 15 bases, 40 bases, 25 bases, 40 bases, 45 bases, 40 bases, 45 bases, 50 bases, 55 bases, 60 bases, 65 bases, 70 bases, 75 bases, 80 bases, 85 bases, 90 bases, 95 bases, or 100 bases. Alternatively, or additionally, the alignment quality may be based on a minimum alignment identity of at least about 5%, 10%, 15%, 40%, 25%, 40%, 45%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In some cases, a criterion may require at least a 25-nt overlap with at least about 70% identity.
In this example, the sequencing encoding the SARS-CoV-2 nucleocapsid (N) gene was selected to serve as the basis for generating the CRISPR guide sequence. Examples of the CRISPR guide sequence include SEQ ID NO. 1 and SEQ ID NO. 2.
Recently, loop-mediated isothermal amplification (LAMP) (Notomi et al., 2000) has been developed as a sensitive (1-100 copies/μL) point-of-care diagnostic (Dao Thi et al., 2020; Zhang et al., 2020). However, LAMP is prone to generating false positives unless a second sequence-specific technique is used to check the amplified DNA (Dao Thi et al., 2020; Rolando et al., 2020). The type V (Cas12-based) and type VI (Cas13-based) CRISPR systems have been coupled to LAMP or RPA (recombinase polymerase amplification) for sensitive and reliable detection of viral nucleic acids (Broughton et al., 2020; Chen et al., 2018; Gootenberg et al., 2018, 2017; Joung et al., 2020). Following isothermal amplification, the RNA-guided Cas12 or Cas13 proteins bind to the amplified target and trigger a non-sequence specific nuclease activity that cleaves a fluorophore and quencher labelled DNA or RNA (Chen et al., 2018; Gootenberg et al., 2018). Cleavage of the tether results in an increase in fluorescence that can be detected in 45 minutes. While Cas12 and Cas13 detection methods have been optimized over several iterations to be compatible with isothermal amplification of viral RNA, the ultimate goal is to develop CRISPR-based technologies that are sensitive enough to detect the viral RNA directly, without prior amplification. Recently, Fozouni et al reported that the type IV (Cas13a-based) CRISPR systems can be used for amplification-free detection of SARS-CoV-2 RNA in ˜30 minutes and with sensitivity of ˜100 copies/μL (Fozouni et al., 2020).
Like the type VI (Cas13-based) systems, type III systems also target RNA (Hale et al., 2009; Kazlauskiene et al., 2016; Samai et al., 2015; Staals et al., 2014; Tamulaitis et al., 2014). However, type III systems rely on a unique intrinsic signal amplification mechanism (
Results and Discussion
Sequence-Specific Activation of Cas10 Polymerase Yields Three Detectable Products
Sequence-specific recognition of RNA by type III CRISPR systems initiates a signaling Cascade, as illustrated in
Still referring to
An example of purification of TtCsm complexes and TtCsm6 is illustrated in
Referring to
Single mismatches in the target RNA have been shown to result in 10-fold lower amounts of cyclic oligoadenylate production by other Csm complexes (Nasef et al., 2019). Using fluorometric detection, both the mutant and the wildtype Csm complex could detect the SARS-CoV-2 RNA at concentrations above 108 copies per reaction, and neither complex cross-reacted with the SARS-CoV-1 RNA at the highest concentrations tested. The RNase-dead TtCsm complex was roughly 3-fold more sensitive than wildtype, with an LoD of ˜107 copies per reaction.
Csm-Based Direct Detection of SARS-CoV-2 RNA in Patient Samples
The LoD using crRNAN1 is between 107 and 108 copies of IVT RNA per μL, which is insufficient to be clinically relevant. To identify other guides that might outperform or complement the activity of crRNAN1 we aligned 45,641 SARS-CoV-2 genomes available from GISAID (Elbe and Buckland-Merrett, 2017). These alignments were used to select guides based on four key criteria. First, each target sequence had to be more than 99% identical among the available SARS-CoV-2 genomes. Second, complementarity between the target and the crRNA was not allowed to extend beyond the spacer sequence (guide), and into repeat derived portions of the crRNA that have been shown to suppress Cas10 activity (Kazlauskiene et al., 2017). Third, we targeted regions of SARS-CoV-2 that were different by at least two-nucleotides in SARS-CoV-1 and MERS-CoV. Fourth, the list of target sequences was pruned to remove guides with similarity to human mRNA sequences, or common oral and respiratory pathogen sequences (E-value <1000). Finally, we focused on target sequences located 3′ of the ORF3a gene, which are present on both the viral genome and on subgenomic RNAs generated during infection. In total, we designed crRNAs targeting 10 different locations on the SARS-CoV-2 genome as illustrated in
To determine how each of these guides perform, we measured sequence specific detection of RNA using a fluorometric reporter assay (i.e., FAM-RNA-Iowa Black FQ), results of which are illustrated in
Fozouni et al., recently showed that multiplexing Cas13 (i.e., combining multiple guides into a single reaction) improves the sensitivity of SARS CoV-2 detection (Fozouni et al., 2020). We reasoned that similar benefits might be possible for Csm-based detection. To test this idea, we combined 10 of the guides (2.5 nM each) into a single multiplexed reaction. Multiplexing 10 guides improves the sensitivity of TtCsm-mediated detection of SARS-CoV-2 RNA isolated form the nasal swab of a positive patient by approximately 10 times as shown in
Testing Clinical Samples for SARS-CoV-2 Using RT-LAMP and T7-Csm.
Csm-based detection is currently not sensitive enough to directly detect SARS-CoV-2 in all patients capable of spreading the infection, which requires an LoD of 103 RNA copies/μL. (La Scola et al., 2020; Larremore et al., 2021; Paltiel et al., 2020; Wölfel et al., 2020). To decrease the LoD of a type III CRISPR-based diagnostic to 103 RNA copies/μL or lower, we incorporated an upstream nucleic acid amplification technique as illustrated in
To confirm the specificity of TtCsm-based detection, we tested SARS-CoV-2 alongside a panel of eight other oral and respiratory pathogens, including coronaviruses SARS-CoV-1, Middle East respiratory syndrome coronavirus (MERS-CoV), Human coronavirus HKU1 and Human coronavirus NL63 as illustrated in
These samples resulted in background signal similar to the no template control (NTC). In contrast, SARS-CoV-2 RNA results in a 4-5-fold increase in signal.
To determine the LoD of RT-LAMP-T7-Csm, we tested 20 replicates of 2-fold serial dilutions ranging from ˜100-400 copies/μL SARS-CoV-2 RNA as illustrated in
The LoD of RT-LAMP-T7-Csm is 198 copies/μL SARS-CoV-2 RNA (20/20 replicates), in an assay that relies on a 29-minute RT-LAMP step, followed by a 1-minute T7-Csm fluorometric detection reaction.
To further validate this method, we next tested RNA extracted from 56 nasopharyngeal swab samples taken from patients that had previously been tested using RT-qPCR. Of the 56 samples tested, 46 were positive for SARS-CoV-2 and 10 were negative by RT-qPCR as illustrated in
Using two different crRNA guides, we demonstrate that the type III CRISPR system has a specificity (negative predictive agreement) of 100%, as well as a positive predictive agreement of 100% for nasopharyngeal swab samples with 100-200 copies/μL SARS-CoV-2 RNA as determined by RT-qPCR. Whole genome sequencing revealed three of the patient samples used here belonging to the B.1.1.7. lineage. These genome sequences have been deposited in GISAID (Accession IDs: EPI_ISL_1081321, EPI-ISL_1081322, EPI_ISL_1081323) (Elbe and Buckland-Merrett, 2017). Importantly, the B.1.1.7. variants were positively identified by RT-LAMP-T7-Csm with both N1 and N9 crRNA guides (illustrated in
In some examples, at least one of the plurality of subunits may be genetically modified. For example, the TtCsm3 subunit may be genetically modified according to the sequence of SEQ ID NO. 27.
Examples of Methods
Nucleic Acid Preparation
Previously published LAMP primers (Eurofins) were designed to amplify the SARS-CoV-2 N-gene (Broughton et al., 2020). Target SARS-CoV-2 and SARS-CoV-1 RNAs were in vitro transcribed with MEGAscript T7 (Thermo Fisher Scientific) from PCR products generated from pairs of synthesized overlapping DNA oligos or using SARS-CoV-2 genome as a template (SEQ ID NOS. 13-17). Previously designed primer pools (IDT) were used for RT-PCR and sequencing of SARS-CoV-2 genomes (https://artic.network/ncov-2019) (link should omit spaces). Transcribed RNAs were purified by denaturing PAGE. Fluorescent reporter RNA A and fluorescent reporter RNA B purified by RNase-free HPLC (See Table 1) (IDT). Purified genomes of viral, bacterial and fungal pathogens were used as is, or resuspended in 1×TE (10 mM Tris-HCl pH 7.5, 1 mM Ethylenediaminetetraacetic acid (EDTA)) to ˜1×106 genomes/μL. Examples of purified genomic nucleic acids (such as purified genomes of the viral, bacterial and fungal pathogens) are illustrated in Table 2.
Pseudomonas
aeruginosa
Candida albicans
Plasmids
Expression vectors for Thermus thermophilus type III-A Csm1-Csm5 genes, pCDF-5×T7-TtCsm (Liu et al., 2019) were used as a template for site-directed mutagenesis to mutate the Csm3 residue D33 to alanine (D33A) to inactivate Csm3-mediated cleavage of target RNA (pCDF-5×T7-TtCsmCsm3-D34A) (Liu et al., 2017). The CRISPR array in pACYC-TtCas6-4×crRNA4.5 (Liu et al., 2019) was replaced with a synthetic CRISPR array (GeneArt) containing five repeats and four identical spacers, designed to target the N-gene of SARS-CoV2 (i.e., pACYC-TtCas6-4×gCoV2N1). TtCas6 was PCR amplified from the pACYC-TtCas6-4×crRNA4.5 plasmid and cloned between the NcoI and XhoI sites of pRSF-1b (pRSF-TtCas6). The CARF-HEPN nuclease TtCsm6 was expressed from pC0075 TtCsm6 His6-TwinStrep-SUMO-BsaI (Gootenberg et al., 2018).
Protein Purifications
Expression and purification of the TtCsm complex was performed as previously described with minor modifications (Liu et al., 2019). Briefly, the crRNA plasmid (such as pACYC-TtCas6-4×gCoV2N1) was co-transformed with pRSF-TtCas6 and either pCDF-5×T7-TtCsm or pCDF-5×T7-TtCsmCsm3-D34A into Escherichia coli BL21(DE3) cells and grown in LB Broth (Lennox) (Thermo Fisher Scientific) at 37° C. to an OD600 of 0.5. Cultures were then induced with 0.5 mM IPTG (isopropyl-β-D-thiogalactoside) for expression overnight at 25° C. Cells were pelleted (3,000×g for 25 mins at 4° C.) and lysed via sonication in Lysis buffer (25 mM HEPES pH 7.5, 150 mM KCl, 10 mM imidazole, 1 mM TCEP, 0.01% Triton X-100, 5% glycerol, 1 mM PMSF). Lysate was clarified by centrifugation at 10,000×g for 25 mins at 4° C. The lysate was then heat-treated at 55° C. for 45 minutes and further clarified by centrifugation at 10,000×g for 25 mins at 4° C. His-tagged Csm1 and TtCsm complex were bound to HisTrap HP resin (Cytiva) and washed with Wash buffer (50 mM HEPES pH 7.5, 150 mM KCl, 1 mM TCEP, 5% glycerol, 20 mM imidazole). Protein was eluted in Lysis buffer supplemented with 300 mM imidazole. Eluted protein was concentrated (100 k MWCO Corning Spin-X concentrators) at 4° C. before further purification over HiLoad Superdex 200 26/600 or Superose 6 Increase 10/300 GL size-exclusion columns (Cytiva) in 25 mM HEPES pH 7.5, 150 mM NaCl, 5% glycerol, 1 mM TCEP. Fractions containing the TtCsm complex were pooled, concentrated, aliquoted, flash frozen in liquid nitrogen, and stored at −80° C.
Expression and purification of TtCsm6 was performed as previously described with minor modifications (Gootenberg et al., 2018). pTtCsm6 was transformed into Escherichia coli BL21(DE3) cells and grown in LB Broth (Lennox) (Thermo Fisher Scientific) at 37° C. to an OD600 of 0.5. Cultures were then incubated on ice for 1 hour, and then induced with 0.5 mM IPTG for expression overnight at 16° C. Cells were lysed via sonication in TtCsm6 Lysis buffer (20 mM Tris-HCl pH 8, 500 mM NaCl, 1 mM TCEP) and lysate was clarified by centrifugation at 10,000×g for 25 mins at 4° C. The lysate was heat-treated at 55° C. for 45 minutes and clarified by centrifugation at 10,000×g for 25 mins at 4° C. His6-TwinStrep-tagged TtCsm6 was bound to StrepTrap HP resin (Cytiva) and washed in TtCsm6 Lysis buffer. The protein was eluted with TtCsm6 Lysis buffer supplemented with 2.5 mM desthiobiotin and concentrated (10 k MWCO Corning Spin-X concentrators) at 4° C. Affinity tags were removed from TtCsm6 using SUMO protease (100 μL of 2.5 mg/ml protease per 20 mg of TtCsm6 substrate) during dialysis against SUMO digest buffer (30 mM Tris-HCl pH 8, 500 mM NaCl 1 mM DTT, 0.15% Igepal) at 4° C. overnight. Cleaved His6-TwinStrep tag and uncleaved His6-TwinStrep-TtCsm6 were removed by binding to HisTrap HP resin (Cytiva), and the flow-through was concentrated using Corning Spin-X concentrators at 4° C. Finally, TtCsm6 was purified using a HiLoad Superdex 200 26/600 size-exclusion column (Cytiva) in 20 mM Tris-HCl pH 7.5, 1 mM DTT, 400 mM monopotassium glutamate, 5% glycerol. Fractions containing TtCsm6 were pooled, concentrated, aliquoted, flash frozen in liquid nitrogen, and stored at −80° C.
To screen guide RNAs in a high throughput format, ten TtCsm complexes were first crudely purified. 8 mL cultures of E. coli BL21-DE3 cells transformed with pTtCsm and pT7-5×CRISPR-Cas6 were grown at 37° C. and 250 RPM in LB media with selective antibiotics until they reached an OD600 reading of 0.4. Protein expression was then induced with the addition of 0.5 mM IPTG to the media, and cells were grown overnight at 16° C. Cells were collected by centrifugation at 4000 RPM, and cell pellets were resuspended in 250 μL of Ni-NTA Equilibration buffer (PBS; 100 mM sodium phosphate, 600 mM sodium chloride), 0.05% Tween™-20 Detergent, 30 mM imidazole; pH 8.0). Resuspended cells were sonicated twice for twenty seconds, then clarified by centrifugation at 15,000 rpm for 20 minutes at −4° C. to remove cellular debris. The lysate was then heat-treated at 55° C. for 45 minutes, and re-clarified by centrifugation at 15,000 rpm, for 30 mins at 4° C. TtCsm was then purified using HisPur Ni-NTA magnetic beads (ThermoFisher) according to the manufacturers recommendations, but with modified wash (25 mM HEPES pH 7.5, 150 mM NaCl, 0.05% Tween-20, 1 mM TCEP) and equilibration (25 mM HEPES pH 7.5, 150 mM NaCl, 1 mM TCEP) and elution buffers (25 mM HEPES pH 7.5, 150 mM NaCl, 1 mM TCEP, 300 mM Imidazole). TtCsm complex concentration was quantified on a Nanodrop (ThermoFisher).
Type III CRISPR-Based RNA Detection
Fluorescent CRISPR-Csm Based Detection
For experiments shown in
For experiments shown in
Colorimetric CRISPR-Csm Based Detection
TtCsmCsm3-D34A stocks were buffer exchanged into a low buffering capacity buffer (0.5 mM Tris-HCl pH 8.8, 50 mM Potassium chloride, 10 mM Ammonium sulphate, 8 mM Magnesium sulphate) using Microspin G25 columns (Cytiva) as per the manufacturer's instructions. TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA) or in vitro transcribed SARS-CoV-2 or SARS-CoV-1 RNA were incubated with 200 nM TtCsmCsm3-D34A in 1× WarmStart Colorimetric LAMP Master Mix (NEB), supplemented with an additional 1 mM ATP, in a 25 μL reaction. The volume of buffer-exchanged TtCsm used contributed approximately 40 μM Tris-HCl pH 8.8 buffer to the final reaction. Reactions were assembled on ice and imaged on an LED tracing pad with a Galaxy S9 phone (Samsung). Then reactions were incubated at 60° C. for 30 minutes, rapidly cooled, and imaged again.
Visible Fluorometric CRISPR-Csm Based Detection
TE buffer or in vitro transcribed SARS-CoV-2 or SARS-CoV-1 RNA were incubated with 500 nM TtCsmCsm3-D34A in reaction buffer (20 mM Tris-HCl pH 8.8, 100 mM Potassium chloride, 10 mM Ammonium sulphate, 6 mM Magnesium sulphate, 0.5 mM Manganese chloride, 1 mM TCEP, 1 mM ATP and 25 μM Calcein), in a 30 μL reaction. Reactions were incubated at 60° C., and fluorescence was measured over time in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems), using the manufacturers default filter settings for FAM dye. After incubating at 60° C. for 50 minutes, the same reactions were then imaged under visible light, and under UV light (365 nm) with a Galaxy S9 phone (Samsung). To screen guide RNAs in a high throughput format (
RT-LAMP-T7-Csm
Isothermal amplification of nucleic acids in swab samples was performed by RT-LAMP. In brief, 25 μL reactions contained 8 units (U) of WarmStart Bst 2.0 (NEB), and 7.5 U of WarmStart RTx Reverse Transriptase (NEB), 1.4 mM dNTPs, LAMP primers, 25 U of Murine RNase Inhibitor (NEB) in reaction buffer (20 mM Tris-HCl pH 7.8, 8 mM Magnesium sulfate, 10 mM Ammonium sulfate, 50 mM potassium chloride, 0.1% Tween-20). LAMP primers designed to amplify the SARS-CoV-2 N-gene (Broughton et al., 2020), were added at an optimized final concentration of 0.2 μM F3 and B3, 0.4 μM LoopF and LoopB, 1.6 μM BIP, 0.53 μM FIP, and 1.07 μM of T7-FIP (such as the primers for RT-LAMP: SEQ ID NOS. 19-25). The T7-FIP primer consists of a T7 promoter fused to the 5′ end of the FIP primer, and allows for the generation of T7 transcription templates during the second step of T7-Csm reaction. RT-LAMP reactions were performed using 5 μL of input RNA at 65° C. for 29 minutes. 3 μL of RT-LAMP reactions were mixed with 27 μL of a modified T7-Csm fluorescent detection reaction containing 0.5 mM rNTPs, 300 nM TtCsm6, 150 nM fluorescent reporter RNA B, and 20 nM of either TtCsmCsm3-D34A N1 or N9, in reaction buffer (40 mM Tris-HCl pH 7.5, 4 mM Magnesium chloride, 50 mM Sodium chloride, 2 mM spermidine, 1 mM DTT). Reactions were incubated at 55° C. for up to 20 min and fluorescence kinetics was monitored in a QuantStudio 3 Real-Time PCR system (ThermoFisher) as described above.
LoD standards were prepared by diluting SARS-CoV-2 RNA into RNA extracted from COVID-19-negative patient nasopharyngeal swabs. Concentrations were determined with RT-qPCR using a standard curve generated from 10-fold dilution series)(1×106-1×100 of IVT fragment.
Human Clinical Sample Collection and Preparation
Nasopharyngeal swabs from patients that either tested negative or positive for SARS-CoV-2 were collected in viral transport media. RNA was extracted from all patient samples using QIAamp Viral RNA Mini Kit (Qiagen).
RT-qPCR
RT-qPCR was performed using two primers pairs (N1 and N2) and probes from the 2019-nCoV CDC EUA Kit (IDT #10006606). SARS-CoV-2 in RNA-extracted, nasopharyngeal patient samples was detected and quantified using one-step RT-qPCR in ABI 7500 Fast Real-Time PCR System according to CDC guidelines and protocols (https://www.fda.gov/media/134922/download) (link should omit spaces). In brief, 20 μL reactions included 8.5 μL of Nuclease-free Water, 1.5 μL of Primer and Probe mix (IDT, 10006713), 5 μL of TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher, A15299) and 5 μL of the template. Nuclease-free water was used as negative template control (NTC). Amplification was performed as follows: 25° C. for 2 min, 50° C. for 15 min, 95° C. for 2 min followed by 45 cycles of 95° C. for 3 s and 55° C. for 30 s. To quantify viral genome copy numbers in the samples, standard curves for N1 and N2 were generated using a dilution series of a SARS-CoV-2 synthetic RNA fragment (RTGM 10169, National Institute of Standards and Technology) spanning N gene with concentrations ranging from 10 to 106 copies per μL. Three technical replicates were performed at each dilution. The NTC showed no amplification throughout the 45 cycles of qPCR.
Bioinformatic Design of TtCsm crRNA Guides Targeting SARS-CoV-2
An alignment of 45,641 SARS-CoV-2 genomes was downloaded front the GISAID database (Global Initiative for Sharing All Influenza Data; GISAID.org) (link should omit spaces) on 6-23-2020 (Elbe and Buckland-Merrett, 2017; Katoh and Standley, 2013). The alignment was scanned for conservation with a 40-nucleotide sliding window, and 40-nucleotide segments with strong conservation were saved for downstream analysis. Next, four nucleotides flanking the above 40-nucleotide candidate viral target sequences were checked for base pairing to the first four nucleotides of the prospective 5′-crRNA handle (underlined; 5′-AUUGCGAC-3′), only candidates lacking handle complementarity were considered further. Candidate sites with less than two mismatches to SARS-CoV (NC_004718.3) and MERS-CoV (NC_019843.3) in the first 18 nucleotides of the target sequence were discarded. Next, candidate crRNAs targeting the above sites were screened for potential cross-reactivity with human mRNAs and a list of human pathogens and common respiratory flora downloaded from the FDA's Emergency Use Authorization requirements (downloaded on 7-29-2020) using BLAST (−evalue 1000). The remaining 6,229 crRNA sequences were then sorted by genomic location and only guides that were located 3′ of the SARS-CoV-2 ORF3a gene (positions 25,393 to 29,903) were considered further. Finally, 76 guides were selected from the remaining pool that had the greatest conservation amongst SARS-CoV-2. sequences and the largest number of mismatches to SARS and MERS-CoV sequences.
Sequencing of SARS-CoV-2 RNA Isolated from Patient Samples
SARS-CoV-2 genomic RNA isolated from patient samples was sequenced as previously described (Nemudryi et al., 2021). In brief, 10 μL of SARS-CoV-2 genomic RNA extracted from nasopharyngeal patient swabs was first reverse transcribed with SuperScript IV (ThermoFisher) according to the manufacturer's instructions. The ARTIC Network protocol was followed to generate a sequence amplicon library covering the whole SARS-CoV-2 genome on Oxford Nanopore using a ligation sequencing kit (Oxford Nanopore, SQK-LSK109) (https://artic.network/ncov-2019) (Grubaugh et al., 2019; Tyson et al., 2020) (link should omit spaces). Two multiplex PCR reactions were performed with primer pools described in the ARTIC nCoV-2019 V3 Panel (such as primers to generate an amplicon library for SARS-CoV-2 whole genome sequencing: SEQ ID NOS. 29-246), amplified with Q5 DNA Polymerase (NEB). The two resulting amplicon pools for each patient sample were then combined and used for library preparation. Samples were end repaired (NEB, E7546) and then barcoded using Native Barcoding Expansion Kits (Oxford Nanopore, EXP-NBD104 and EXP-NBD114). Barcoded samples were pooled together and then Nanopore adaptors were ligated.
The multiplexed library was loaded onto the MinION flowcell, and a total of 0.3 Gb of raw sequencing data was collected per patient sample. Raw Nanopore reads were base-called in high-accuracy mode (Oxford Nanopore, MinKNOW), and further analyzed using the ARTIC bioinformatic pipeline for COVID-19 (https://artic.network/ncov-2019) (link should omit spaces). Consensus sequences were uploaded to GISAID (https://www.gisaid.org/) (link should omit spaces), IDs: EPI_ISL_1081321, EPI-ISL_1081322, EPI_ISL_1081323 (Elbe and Buckland-Merrett, 2017). These three SARS-CoV-2 genome sequences were identified as members of the B.1.1.7 lineage by an automated lineage assigner (Rambaut et al., 2020) (https://github.com/hCoV-2019/pangolin) (link should omit spaces).
Statistical Analyses
All experiments were performed in triplicate or duplicate and error is reported as ±1 standard deviation. The merged datasets of replicates of fluorescence kinetics of direct Csm-based detection of SARS-CoV-2 RNA in patient samples was fit to a simple linear regression, in Prism 9 (Graphpad). The fitted slopes of SARS-CoV-2 RNA-containing patient samples were compared pairwise to the negative swab RNA control by an F-test, ****p<0.0001.
AUUGCGAC
ACGCUGAAGCGCUGGG
GGCAAAUUGUGCAAUUUGCGGCCA
GUUGCAAGGGAUUGAGCCCCGUAA
GGGG
AUUGCGAC
ACGCUGAAGCGCUGGG
GGCAAAUUGUGCAAUUUGCGGCCA
GUUGCAAG
GGCAAAUUGUGCAAUUUGCGGCCA
AUCGCGCCCCACUGCGUUCUCCAU
GAGGAACGAGAAGAGGCUUGACU
GGUUGCAAGGGAUUGAGCCCCGUA
GAGCAGCAUCACCGCCAUUGCCAG
UACGUUUUUGCCGAGGCUUCUUAG
AGUUGCAAGGGAUUGAGCCCCGUA
AGCGCUGGGGGCAAAUUGUGCAA
UGUUGCAAGGGAUUGAGCCCCGUA
UGAUCUUUGAAAUUUGGAUCUUU
GGUUGCAAGGGAUUGAGCCCCGUA
CUGUCUCUGCGGUAAGGCUUGAGU
GAUUGUUGCAAUUGUUUGGAGAA
AGUUGCAAGGGAUUGAGCCCCGUA
UAUAUAGCCCAUCUGCCUUGUGUG
GGUUGCAAGGGAUUGAGCCCCGUA
A subject may refer to an animal, such as a mammalian species (preferably human) or avian (e.g., bird) species, or other organism, such as a plant. More specifically, a subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Animals include farm animals, sport animals, and pets. A subject can be a healthy individual, an individual that has symptoms or signs or is suspected of having a disease or a predisposition to the disease, or an individual that is in need of therapy or suspected of needing therapy.
A genetic modification or mutation in the context of an engineered system may refer to an alteration, variant or polymorphism in a nucleic acid that may result in altered or disabled functionality of a corresponding protein. Such alteration, variant or polymorphism can be with respect to a reference genome, the subject or other individual. Variations include one or more single nucleotide variations (SNVs), insertions, deletions, repeats, small insertions, small deletions, small repeats, structural variant junctions, variable length tandem repeats, and/or flanking sequences, CNVs, transversions, gene fusions and other rearrangements may also be considered forms of genetic variation. A variation can be a base change, insertion, deletion, repeat, copy number variation, transversion, or a combination thereof.
A “polynucleotide”, “nucleic acid”, “nucleic acid molecule”, or “oligonucleotide” may each refer to a polymer of nucleosides (including deoxyribonucleosides, ribonucleosides, or analogs thereof) joined by inter-nucleosidic linkages. Typically, a polynucleotide comprises at least three nucleosides. Oligonucleotides often range in size from a few monomeric units, e.g. 3-4, to hundreds of monomeric units. Whenever a polynucleotide is represented by a sequence of letters, such as “ATGCCTG,” it will be understood that the nucleotides are in 5′→3′ order from left to right and that “A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, and “T” denotes thymidine, unless otherwise noted. The letters A, C, G, and T (or “U” denoting Uracil in RNA) may be used to refer to the bases themselves, to nucleosides, or to nucleotides comprising the bases, as is standard in the art.
A “polynucleotide”, “nucleic acid”, “nucleic acid molecule”, or “oligonucleotide” may each refer to a polymer of nucleosides (including deoxyribonucleosides, ribonucleosides, or analogs thereof) joined by inter-nucleosidic linkages. Typically, a polynucleotide comprises at least three nucleosides. Oligonucleotides often range in size from a few monomeric units, e.g. 3-4, to hundreds of monomeric units. Whenever a polynucleotide is represented by a sequence of letters, such as “ATGCCTG,” it will be understood that the nucleotides are in 5′→3′ order from left to right and that “A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, and “T” denotes thymidine, unless otherwise noted. The letters A, C, G, and T (or “U” denoting Uracil in RNA) may be used to refer to the bases themselves, to nucleosides, or
All patent filings, websites, other publications, accession numbers and the like cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be so incorporated by reference. If different versions of a sequence are associated with an accession number at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or filing date of a priority application referring to the accession number if applicable. Likewise, if different versions of a publication, website or the like are published at different times, the version most recently published at the effective filing date of the application is meant unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the disclosure can be used in combination with any other unless specifically indicated otherwise. Although the present disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.
This patent application is a continuation of U.S. patent application Ser. No. 17/240,858, filed on Apr. 26, 2021, and claims the benefit of priority of U.S. Provisional Application No. 63/016,081, filed on Apr. 27, 2020, U.S. Provisional Application No. 63/046,936, filed on Jul. 1, 2020, U.S. Provisional Application No. 63/047,598, filed on Jul. 2, 2020, U.S. Provisional Application No. 63/065,094, filed on Aug. 13, 2020, U.S. Provisional Application No. 63/065,626, filed on Aug. 14, 2020, U.S. Provisional Application No. 63/080,128, filed on Sep. 18, 2020, and U.S. Provisional Application No. 63/157,568, filed on Mar. 5, 2021, each of which is incorporated by reference herein for all purposes.
| Number | Date | Country | |
|---|---|---|---|
| 63320199 | Mar 2022 | US | |
| 63016081 | Apr 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 17240858 | Apr 2021 | US |
| Child | 17814674 | US |