Patent Application
20140287463
The present invention relates to novel engineered Pichia strains with improved fermentation yields for expressing heterologous proteins with improved N-glycosylation quality, as well as to methods of generating such strains.
The methylotrophic yeast Pichia pastoris is one of the most widely used expression hosts for genetic engineering. This ascomycetous single-celled budding yeast has been used for the heterologous expression of hundreds of proteins (Lin-Cereghino, Curr Opin Biotech, 2002; Macauley-Patrick, Yeast, 2005). Importantly, P. pastoris is a lower eukaryote which provides the further advantage of having basic machinery for protein folding and post-translational modifications.
As a protein expression system, P. pastoris provides the advantages of a microbial system with facile genetics, shorter cycle times and the capability of achieving high cell densities. Secreted protein productivities have routinely been reported in the multi-gram per liter ranges. Several promoter systems are available for expression of proteins, for example, the methanol-inducible AOX1 promoter. The AOX1 promoter is a desirable feature of the P. pastoris system because it is tightly regulated and highly induced upon exposure to methanol (Cregg, Biotechnology, 1993, 11:905-910). The native Aox1p can be expressed up to 30% of total cellular protein when cells are grown on methanol. A drawback to this system is that cultivation on methanol during large scale fermentation can be complicated.
Constitutive promoter systems have been developed using the GAPDH promoter and more recently the TEF promoter (Waterham, Gene 1997, 186: 37-44; Ahn, Appl Microb Biotech, 2007, 74:601-608). These promoters are not as strong as AOX1, but, in some instances have lead to yield higher levels of secreted product than expression by AOX1, probably due to cultivation on a more energetically rich carbon source such as glycerol or glucose. However, such alternative promoter systems can be unpredictable for heterologous protein production.
Engineered Pichia strains have been utilized as an alternative host system for producing recombinant glycoproteins with human-like glycosylation. However, the extensive genetic modifications have also caused fundamental changes in cell wall structures in many glycoengineered yeast strains, predisposing some glyco-engineered strains to cell lysis and reduced cell robustness during fermentation.
Certain glyco-engineered strains have substantial reductions in cell viability as well as a marked increase in intracellular protease leakage into the fermentation broth, resulting in a reduction in both recombinant product yield and quality. Current strategies for identifying robust glyco-engineered Pichia production strains rely heavily on screening a large number of clones using various platforms such as 96-deep-well plates, 5 ml mini-scale fermenters (Micro24), and 0.5 L-scale bioreactors (DasGip) to empirically identify clones that are compatible for large-scale (40 L and above) fermentation processes (Barnard et al. 2010). Despite the fact that high-throughput screening has been successfully used to identify several Pichia hosts capable of producing recombinant mAb with yields in excess of 1 g/L (anti-RSV and anti-Her2) (Potgieter et al. 2009; Zhang et al. 2011), these large-scale screening approach is very resource-intensive and time-consuming, and often only identify clones with incremental increases in cell-robustness.
Therefore, host strains that have improved robustness and the ability to produce high quality human-like proteins would be of value and interest to the field. Here, we present engineered Pichia host strains having a deletion, nonsense mutation, or other modification resulting in a truncation of a P. pastoris gene XRN1, which under bioprocess conditions produce both higher titer protein products that also exhibit improved N-glycosylation compared to protein produced produced in XRN1 naïve parental strains under similar production conditions. These strains are especially useful for heterologous gene expression and production of therapeutic proteins.
The present invention relates to a modified Pichia sp. host cell wherein the host cell has been modified to reduce or eliminate expression of a functional gene product of a nucleic acid sequence encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:76. In additional embodiments, the modified host cell comprises a disruption or deletion in the nucleic acid sequence encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:76. In further embodiments, the host cell further comprises disruption or deletion of one or more of a functional gene product encoding an alpha-1,6-mannosyltransferase activity, mannosylphosphate transferase activity, and β-mannosyltransferase activity.
In yet additional embodiments, the invention further comprises one or more nucleic acid sequences of interest. In certain embodiments, the nucleic acid sequences of interest encode one or more glycosylation enzymes or oligosaccharyltransferases. In certain embodiments, the glycosylation enzymes or oligosaccharyltransferases are selected from the group consisting of glycosidases, mannosidases, phosphomannosidases, phosphatases, nucleotide sugar transporters, mannosyltransferases, the N-acetylglucosaminyltransferases, the UDP-N-acetylglucosamine transporters, the galactosyltransferases, the sialyltransferases, the protein mannosyltransferases, and the oligosaccharyltransferases STT3A, STT3B, STT3C and STT3D.
In yet additional embodiments, the nucleic acid sequences of interest encode one or more therapeutic proteins. In certain embodiments, the therapeutic proteins are selected from the group consisting of an immunoglobulin heavy chain variable domain (optionally wherein the variable domain is linked to an immunoglobulin heavy chain constant domain), an immunoglobulin light chain variable domain (optionally wherein the variable domain is linked to an immunoglobulin light chain constant domain), kringle domains of the human plasminogen, erythropoietin, cytokines, coagulation factors, soluble IgE receptor α-chain, IgG, IgG fragments, IgM, urokinase, chymase, urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, osteoprotegerin, α-1 antitrypsin, DNase II, insulin, Fc-fusions, and HSA-fusions.
The present invention further provides a Pichia sp. host cell comprising a disruption or deletion of the XRN1 gene in the genomic DNA of the host cell that encodes a protein having of a nucleic acid sequence encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:76. In yet additional embodiments, the host cell further comprises a nucleic acid sequence of interest.
In yet additional embodiments, the modified host cell of the present invention produces proteins with improved N-glycosylation compared with the XRN1 naïve parental host cell under similar culture conditions.
In yet additional embodiments, the invention relates to a method for producing glycoprotein compositions in Pichia sp. host cells, said method comprising growing the modified host cells described herein under inducing conditions.
In further embodiments, the host cell further comprises disruption or deletion of one or more of a functional gene product encoding an alpha-1,6-mannosyltransferase activity, mannosylphosphate transferase activity, β-mannosyltransferase activity, or a dolichol-P-Man dependent alpha(1-3) mannosyltransferase activity.
In yet additional embodiments, the invention further comprises one or more nucleic acid sequences of interest. In certain embodiments, the nucleic acid sequences of interest encode one or more glycosylation enzymes or oligosaccharyltransferases. In certain embodiments, the glycosylation enzymes or oligosaccharyltransferases are selected from the group consisting of glycosidases, mannosidases, phosphomannosidases, phosphatases, nucleotide sugar transporters, mannosyltransferases, the N-acetylglucosaminyltransferases, the UDP-N-acetylglucosamine transporters, the galactosyltransferases, the sialyltransferases, the protein mannosyltransferases, and the oligosaccharyltransferases STT3A, STT3B, STT3C and STT3D.
In yet additional embodiments, the nucleic acid sequences of interest encode one or more therapeutic proteins. In certain embodiments, the therapeutic proteins are selected from the group consisting of kringle domains of the human plasminogen, erythropoietin, cytokines, coagulation factors, soluble IgE receptor α-chain, IgG, IgG fragments, IgM, urokinase, chymase, urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, osteoprotegerin, α-1 antitrypsin, DNase II,α-feto proteins, insulin, Fc-fusions, and HSA-fusions.
In certain embodiments, the invention also provides host cells comprising a disruption, deletion or mutation of a nucleic acid sequence selected from the group consisting of the coding sequence of the P. pastoris XRN1 gene, a nucleic acid sequence that is a degenerate variant of the coding sequence of the P. pastoris XRN1 gene and related nucleic acid sequences and fragments, in which the host cells have a reduced activity of the polypeptide encoded by the nucleic acid sequence compared to a host cell without the disruption, deletion or mutation.
In addition, the invention provides methods for the genetic integration of a heterologous nucleic acid sequence into a host cell comprising a disruption or deletion of the P. pastoris XRN1 gene in the genomic DNA of the host cell. These methods comprise the step of introducing a sequence of interest into the host cell comprising a disrupted, deleted or mutated nucleic acid sequence derived from a sequence selected from the group consisting of the coding sequence of the P. pastoris XRN1 gene, a nucleic acid sequence that is a degenerate variant of the coding sequence of the P. pastoris XRN1 gene and related nucleic acid sequences and fragments.
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., James M. Cregg (Editor), Pichia Protocols (Methods in Molecular Biology), Humana Press (2010), Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990); Taylor and Drickamer, Introduction to Glycobiology, Oxford Univ. Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, N.J.; Handbook of Biochemistry: Section A Proteins, Vol I, CRC Press (1976); Handbook of Biochemistry: Section A Proteins, Vol II, CRC Press (1976); Essentials of Glycobiology, Cold Spring Harbor Laboratory Press (1999), Animal Cell Culture (R.I. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); B. Perbal, A Practical Guide To Molecular Cloning (1984);
A “polynucleotide”, “nucleic acid” includes DNA and RNA in single stranded form, double-stranded form or otherwise.
A “polynucleotide sequence” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA or RNA, and means a series of two or more nucleotides. Any polynucleotide comprising a nucleotide sequence set forth herein (e.g., promoters of the present invention) forms part of the present invention.
A “coding sequence” or a sequence “encoding” an expression product, such as an RNA or polypeptide is a nucleotide sequence (e.g., heterologous polynucleotide) that, when expressed, results in production of the product (e.g., a heterologous polypeptide such as an immunoglobulin heavy chain and/or light chain).
As used herein, the term “oligonucleotide” refers to a nucleic acid, generally of no more than about 100 nucleotides (e.g., 30, 40, 50, 60, 70, 80, or 90), that may be hybridizable to a polynucleotide molecule. Oligonucleotides can be labeled, e.g., by incorporation of 32P-nucleotides, 3H-nucleotides, 14C-nucleotides, 35S-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated.
A “protein”, “peptide” or “polypeptide” (e.g., a heterologous polypeptide such as an immunoglobulin heavy chain and/or light chain) includes a contiguous string of two or more amino acids.
A “protein sequence”, “peptide sequence” or “polypeptide sequence” or “amino acid sequence” refers to a series of two or more amino acids in a protein, peptide or polypeptide.
The term “isolated polynucleotide” or “isolated polypeptide” includes a polynucleotide or polypeptide, respectively, which is partially or fully separated from other components that are normally found in cells or in recombinant DNA expression systems or any other contaminant. These components include, but are not limited to, cell membranes, cell walls, ribosomes, polymerases, serum components and extraneous genomic sequences. The scope of the present invention includes the isolated polynucleotides set forth herein, e.g., the promoters set forth herein; and methods related thereto, e.g., as discussed herein.
An isolated polynucleotide or polypeptide will, preferably, be an essentially homogeneous composition of molecules but may contain some heterogeneity.
“Amplification” of DNA as used includes the use of polymerase chain reaction (PCR) to increase the concentration of a particular DNA sequence within a mixture of DNA sequences. For a description of PCR see Saiki, et al., Science (1988) 239:487.
In general, a “promoter” or “promoter sequence” is a DNA regulatory region capable of binding an RNA polymerase in a cell (e.g., directly or through other promoter-bound proteins or substances) and initiating transcription of a coding sequence to which it operably links.
A coding sequence (e.g., of a heterologous polynucleotide, e.g., reporter gene or immunoglobulin heavy and/or light chain) is “operably linked to”, “under the control of”, “functionally associated with” or “operably associated with” a transcriptional and translational control sequence (e.g., a promoter of the present invention) when the sequence directs RNA polymerase mediated transcription of the coding sequence into RNA, preferably mRNA, which then may be RNA spliced (if it contains introns) and, optionally, translated into a protein encoded by the coding sequence.
The present invention includes vectors or cassettes which comprise modified XRN1 including nonsense mutations, truncations, deletions, knock-outs, or overexpression cassettes, including promoters optionally operably linked to a heterologous polynucleotide. The term “vector” includes a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell, so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence. Suitable vectors for use herein include plasmids, integratable DNA fragments, and other vehicles that may facilitate introduction of the nucleic acids into the genome of a host cell (e.g., Pichia pastoris). Plasmids are the most commonly used form of vector but all other forms of vectors which serve a similar function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels, et al., Cloning Vectors: A Laboratory Manual, 1985 and Supplements, Elsevier, N.Y., and Rodriguez et al. (eds.), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, Mass.
A polynucleotide (e.g., a heterologous polynucleotide, e.g., encoding an immunoglobulin heavy chain and/or light chain), operably linked to a promoter, may be expressed in an expression system. The term “expression system” means a host cell and compatible vector which, under suitable conditions, can express a protein or nucleic acid which is carried by the vector and introduced to the host cell. Common expression systems include fungal host cells (e.g., Pichia pastoris) and plasmid vectors, insect host cells and Baculovirus vectors, and mammalian host cells and vectors.
The term methanol-induction refers to increasing expression of a polynucleotide (e.g., a heterologous polynucleotide) operably linked to a methanol-inducible promoter in a host cell of the present invention by exposing the host cells to methanol.
The term methanol-repression refers to decreasing expression of a polynucleotide (e.g., a heterologous polynucleotide) operably linked to a methanol-repressible promoter in a host cell of the present invention by exposing the host cells to methanol.
The following references regarding the BLAST algorithm are herein incorporated by reference: BLAST ALGORITHMS: Altschul, S. F., et al., J. Mol. Biol. (1990) 215:403-410; Gish, W., et al., Nature Genet. (1993) 3:266-272; Madden, T. L., et al., Meth. Enzymol. (1996) 266:131-141; Altschul, S. F., et al., Nucleic Acids Res. (1997) 25:3389-3402; Zhang, J., et al., Genome Res. (1997) 7:649-656; Wootton, J. C., et al., Comput. Chem. (1993) 17:149-163; Hancock, J. M., et al., Comput. Appl. Biosci. (1994) 10:67-70; ALIGNMENT SCORING SYSTEMS: Dayhoff, M. O., et al., “A model of evolutionary change in proteins.” in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3. M.O. Dayhoff (ed.), pp. 345-352, Natl. Biomed. Res. Found., Washington, D.C.; Schwartz, R. M., et al., “Matrices for detecting distant relationships.” in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3.” M.O. Dayhoff (ed.), pp. 353-358, Natl. Biomed. Res. Found., Washington, D.C.; Altschul, S.F., J. Mol. Biol. (1991) 219:555-565; States, D. J., et al., Methods (1991) 3:66-70; Henikoff, S., et al., Proc. Natl. Acad. Sci. USA (1992)89:10915-10919; Altschul, S. F., et al., J. Mol. Evol. (1993) 36:290-300; ALIGNMENT STATISTICS: Karlin, S., et al., Proc. Natl. Acad. Sci. USA (1990) 87:2264-2268; Karlin, S., et al., Proc. Natl. Acad. Sci. USA (1993) 90:5873-5877; Dembo, A., et al., Ann. Prob. (1994) 22:2022-2039; and Altschul, S.F. “Evaluating the statistical significance of multiple distinct local alignments.” in Theoretical and Computational Methods in Genome Research (S. Suhai, ed.), (1997) pp. 1-14, Plenum, N.Y.
The present invention encompasses any isolated Pichia sp. host cell (e.g., such as Pichia pastoris) comprising a modified, truncated, or deleted form of the XRN1 gene, including host cells comprising a promoter e.g., operably linked to a polynucleotide encoding a heterologous polypeptide (e.g., a reporter or immunoglobulin heavy and/or light chain; e.g., optionally, wherein the immunoglobulin heavy chain or light chain is linked to an immunoglobulin constand domain) as well as methods of use thereof, e.g., methods for expressing the heterologous polypeptide in the host cell. Host cells of the present invention, may be also genetically engineered so as to express particular glycosylation patterns on polypeptides that are expressed in such cells. Host cells of the present invention are discussed in detail herein. Any engineered Pichia host cell comprising a modified, truncated, or deleted form of the XRN1 gene forms part of the present invention. In an embodiment of the invention, the host cell is selected from the group consisting of any Pichia cell, such as Pichia pastoris, Pichia angusta (Hansenula polymorpha), Pichia flnlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia.
As used herein, the terms “N-glycan” and “glycoform” are used interchangeably and refer to an N-linked oligosaccharide, e.g., one that is attached by an asparagine-N-acetylglucosamine linkage to an asparagine residue of a polypeptide. N-linked glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an asparagine residue in the protein. Predominant sugars found on glycoproteins are glucose, galactose, mannose, fucose, N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc) and sialic acid (e.g., N-acetyl-neuraminic acid (NANA)).
N-glycans have a common pentasaccharide core of Man3GlcNAc2 (“Man” refers to mannose; “Glc” refers to glucose; and “NAc” refers to N-acetyl; GlcNAc refers to N-acetylglucosamine). N-glycans differ with respect to the number of branches (antennae) comprising peripheral sugars (e.g., GlcNAc, galactose, fucose and sialic acid) that are added to the Man3GlcNAc2 (“Man3”) core structure which is also referred to as the “trimannose core”, the “pentasaccharide core” or the “paucimannose core”. N-glycans are classified according to their branched constituents (e.g., high mannose, complex or hybrid). A “high mannose” type N-glycan has five or more mannose residues. A “complex” type N-glycan typically has at least one GlcNAc attached to the 1,3 mannose arm and at least one GlcNAc attached to the 1,6 mannose arm of a “trimannose” core. Complex N-glycans may also have galactose (“Gal”) or N-acetylgalactosamine (“GalNAc”) residues that are optionally modified with sialic acid or derivatives (e.g., “NANA” or “NeuAc”, where “Neu” refers to neuraminic acid and “Ac” refers to acetyl). Complex N-glycans may also have intrachain substitutions comprising “bisecting” GlcNAc and core fucose (“Fuc”). Complex N-glycans may also have multiple antennae on the “trimannose core,” often referred to as “multiple antennary glycans.” A “hybrid” N-glycan has at least one GlcNAc on the terminal of the 1,3 mannose arm of the trimannose core and zero or more mannoses on the 1,6 mannose arm of the trimannose core. The various N-glycans are also referred to as “glycoforms.” “PNGase”, or “glycanase” or “glucosidase” refer to peptide N-glycosidase F (EC 3.2.2.18).
Thus, the present invention includes isolated Pichia host cells comprising a modified, truncated, or deleted form of the XRN1 gene, optionally further comprising an expression construct (e.g., a promoter operably linked to a heterologous polynucleotide encoding a heterologous polypeptide) and further comprising a deletion of one or more of the genes encoding PMTs, and/or, e.g., wherein the host cell can be cultivated in a medium that includes one or more Pmtp inhibitors. Pmtp inhibitors include but are not limited to a benzylidene thiazolidinedione. Examples of benzylidene thiazolidinediones are 5-[[3,4bis(phenylmethoxy)phenyl]methylene]-4-oxo-2-thioxo-3-thiazolidineacetic Acid; 5-[[3-(1-25 Phenylethoxy)-4-(2-phenylethoxy)]phenyl]methylene]-4-oxo-2-thioxo-3-thiazolidineacetic Acid; and 5-[[3-(1-Phenyl-2-hydroxy)ethoxy)-4-(2-phenylethoxy)] phenyl]methylene]-4-oxo-2-thioxo3-thiazolidineacetic acid.
In an embodiment of the invention, a Pichia host cell (e.g., Pichia pastoris) comprising a modified, truncated, or deleted form of the XRN1 gene is, in an embodiment of the invention, genetically engineered to include a nucleic acid that encodes an alpha-1,2-mannosidase that has a signal peptide that directs it for secretion. For example, in an embodiment of the invention, the host cell is engineered to express an exogenous alpha-1,2-mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5. In an embodiment of the invention, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host cell, where it trims N-glycans such as Man8GlcNAc2 to yield MansGlcNAc2. See U.S. Pat. No. 7,029,872.
Pichia host cells (e.g., Pichia pastoris) comprising a modified, truncated, or deleted form of the XRN1 gene are, in an embodiment of the invention, genetically engineered to eliminate glycoproteins having alpha-mannosidase-resistant N-glycans by deleting or disrupting one or more of the beta-mannosyltransferasegenes (e.g., BMT1, BMT2, BMT3, and BMT4)(See, U.S. Pat. No. 7,465,577) or abrogating translation of RNAs encoding one or more of the beta-mannosyltransferasesusinginterfering RNA, antisense RNA, or the like. The scope of the present invention includes such an engineered Pichia host cell (e.g., Pichia pastoris) comprising an expression cassette (e.g., a promoter operably linked to a heterologous polynucleotide encoding a heterologous polypeptide).
Engineered host cells (e.g., Pichia pastoris) of the present invention also include those that are genetically engineered to eliminate glycoproteins having phosphomannose residues, e.g., by deleting or disrupting one or both of the phosphomannosyl transferase genes PNO1 and MNN4B (See for example, U.S. Pat. Nos. 7,198,921 and 7,259,007), which can include deleting or disrupting the MNN4A gene or abrogating translation of RNAs encoding one or more of the phosphomannosyltransferases using interfering RNA, antisense RNA, or the like. In an embodiment of the invention, an engineered Pichia host cell has been genetically modified to produce glycoproteins that have predominantly an N-glycan selected from the group consisting of complex N-glycans, hybrid N-glycans, and high mannose N-glycans wherein complex N-glycans are, in an embodiment of the invention, selected from the group consisting of Man3GlcNAc2, GlcNAC(1-4)Man3GlcNAc2, NANA(1-4)GlcNAc(1-4)Man3GlcNAc2, and NANA(1-4)Gal(1-4)Man3GlcNAc2; hybrid N-glycans are, in an embodiment of the invention, selected from the group consisting of Man5GlcNAc2, GlcNAcMan5GlcNAc2, GalGlcNAcMan5GlcNAc2, and NANAGalGlcNAcMan5GlcNAc2; and high mannose N-glycans are, in an embodiment of the invention, selected from the group consisting of Man6GlcNAc2, Man7GlcNAc2, Man9cNAc2, and Man9GlcNAc2. The scope of the present invention includes such engineered Pichia host cells (e.g., Pichia pastoris) comprising g a modified, truncated, or deleted form of the XRN1 gene.
Additionally, engineered Pichia host cells (e.g., Pichia pastoris) of the present invention also include those that are genetically engineered to include a nucleic acid that encodes the Leishmania sp. single-subunit oligosaccharyltransferase STT3A protein, STT3B protein, STT3C protein, STT3D protein, or combinations thereof such as those described in WO2011/06389. Additionally, engineered host cells (e.g., Pichia pastoris) of the present invention also include those that are genetically engineered to eliminate nucleic acids encoding Dolichol-P-Man dependent alpha(1-3) mannosyltransferase, e.g., Alg3, such as described in US Patent Publication No. US2005/0170452. The scope of the present invention includes any such engineered Pichia host cells (e.g., Pichia pastoris) further comprising a modified, truncated, deleted form of the XRN1 gene.
As used herein, the term “essentially free of” as it relates to lack of a particular sugar residue, such as fucose, or galactose or the like, on a glycoprotein, is used to indicate that the glycoprotein composition is substantially devoid of N-glycans which contain such residues. Expressed in terms of purity, essentially free means that the amount of N-glycan structures containing such sugar residues does not exceed 10%, and preferably is below 5%, more preferably below 1%, most preferably below 0.5%, wherein the percentages are by weight or by mole percent.
As used herein, a glycoprotein composition “lacks” or “is lacking” a particular sugar residue, such as fucose or galactose, when no detectable amount of such sugar residue is present on the N-glycan structures. For example, in an embodiment of the present invention, glycoprotein compositions produced by host cells of the invention will “lack fucose,” because the cells do not have the enzymes needed to produce fucosylated N-glycan structures. Thus, the term “essentially free of fucose” encompasses the term “lacking fucose.” However, a composition may be “essentially free of fucose” even if the composition at one time contained fucosylated N-glycan structures or contains limited, but detectable amounts of fucosylated N-glycan structures as described above.
CHARACTERIZATION OF PICHIA PASTORISXRN1
The Pichia pastoris gene XRN1 (SEQ ID NO:75, GenBank Accession No.: 002492616.1, amino acid sequence: SEQ ID NO:76) (is homologous to Kem1 in yeast Saccharomyces cerevisiae), part of a family of evolutionarily conserved cytoplasmic 5′ to 3′ exoribonucleases. XRN1 is a member of a large family of conserved exonucleases, although little is known about the catalytic mechanism of its members. Capped RNA is resistant to Xrn1, and Xrn1 strongly prefers mRNA with a 5′ monophosphate as substrate over RNA with a 5′ hydroxyl end. Eukaryotic cells also contain a related exonuclease, Rat1, which is localized to the nucleus and seems to carry out the relevant 5′ to 3′ degradation and processing reactions in the nucleus.
To broadly improve protein quality produced by engineered host strains, several mutant XRN1 knock-out strains were produced from a series of Pichia host strains. While non-mutagenized glyco-engineered parental strains typically produce heterologous proteins with a variety of N-glycosylation patterns, the engineered Pichia host strains with XRN1 deletions produced heterologous protein products with decreased proteolytic degradation as well as desired glycosylation patterns. These engineered Pichia host strains produced glycoproteins with predominant complex N-glycans typically seen of the therapeutic proteins produced from mammalian cells (shown in Tables 7-11).
Such mutations in XRN1 when engineered into any Pichia host strain would serve to increase fermentation robustness, improve recombinant protein yield, and reduce protein product proteolytic degradation. The mRNA stabilization in the engineered Pichia XRN1 knockouts described herein provides useful strains and methods to improve protein fermentation titer and protein glycosylation quality simultaneously. Inhibition of global mRNA turnover by XRN1 knockout increases mRNA abundance of both target protein and corresponding glycosyltransferases. This leads to a yeast host strain with high protein productivity and enhanced complex N-glycan profile. Moreover, mutation of XRN1 may affect translation initiation to prevent stress-induced translation regulation and further improve the titer in these engineered Pichia host strains.
Plasmid pGLY7392 (
Plasmid pGLY7392 was linearized with SfiI and the linearized plasmid was transformed into a number of P. pastoris strains in which the URA5 gene flanked by the lacZ repeats has been inserted into the XRN1/KEM1 loci by double-crossover homologous recombination to generate the XRN1 knock-out strains as shown in the following examples.
Genetically engineered Pichia pastoris strain YGLY12501, YGLY13992, and YGLY14836 are strains that produce recombinant human anti-Her2 antibodies. Construction of the strains is illustrated schematically in
The strain YGLY8316 was constructed from wild-type Pichia pastoris strain NRRL-Y 11430 using methods described earlier (See for example, U.S. Pat. No. 7,449,308; U.S. Pat. No. 7,479,389; U.S. Published Application No. 20090124000; Published PCT Application No. WO2009085135; Nett and Gerngross, Yeast 20:1279 (2003); Choi et al., Proc. Natl. Acad. Sci. USA 100:5022 (2003); Hamilton et al., Science 301:1244 (2003)). All plasmids were made in a pUC 19 plasmid using standard molecular biology procedures. For nucleotide sequences that were optimized for expression in P. pastoris, the native nucleotide sequences were analyzed by the GENEOPTIMIZER software (GeneArt, Regensburg, Germany) and the results used to generate nucleotide sequences in which the codons were optimized for P. pastoris expression. Yeast strains were transformed by electroporation (using standard techniques as recommended by BioRad, Hercules, Calif.).
Plasmid pGLY6 (
Plasmid pGLY40 (
Plasmid pGLY43a (
Plasmid pGLY48 (
Plasmid pGLY45 (
Plasmid pGLY1430 (
Plasmid pGLY582 (
Plasmid pGLY167b (
Plasmid pGLY3411 (
Plasmid pGLY3419 (
Plasmid pGLY3421 (
Plasmid pGLY3673 (
Plasmid p GLY5883 (
Plasmid p GLY6833 (
Plasmid pGLY3714 (
Strain YGLY12501 was generated by transforming pGLY5883, which encodes the anti-Her2 antibody, into YGLY8316. The strain YGLY12501 was selected from the strains produced. In this strain, the expression cassettes encoding the anti-Her2 heavy and light chains are targeted to the Pichia pastoris TRP2 locus (PpTRP2). This strain contains the wild-type XRN1 sequence.
Strain YGLY13992 was generated by transforming pGLY6833, which encodes the anti-Her2 antibody, into YGLY8316. The strain YGLY13992 was selected from the strains produced. In this strain, the expression cassettes encoding the anti-Her2 heavy and light chains are targeted to the Pichia pastoris TRP2 locus (PpTRP2). This strain contains the wild-type XRN1 sequence.
Strain YGLY12511 was generated by transforming pGLY5883, which encodes the anti-Her2 antibody, into YGLY8316. The strain YGLY12511 was selected from the strains produced. Strain YGLY14836 was generated by transforming pGLY3714, which encodes the GD9, into YGLY12511. The strain YGLY14836 was selected from the strains produced. In this strain, the expression cassettes encoding the anti-Her2 heavy and light chains are targeted to the Pichia pastoris TRP2 locus (PpTRP2). This strain contains the wild-type XRN1 sequence.
Transformation of the appropriate strains disclosed herein with pGLY7392 XRN1 knock-out plasmid vector was performed essentially as follows. Appropriate Pichia pastoris strains were grown in 50 mL YPD media (yeast extract (1%), peptone (2%), and dextrose (2%)) overnight to an OD of about 0.2 to 6. After incubation on ice for 30 minutes, cells were pelleted by centrifugation at 2500-3000 rpm for five minutes. Media was removed and the cells washed three times with ice cold sterile 1 M sorbitol before resuspension in 0.5 mL ice cold sterile 1 M sorbitol. Ten μL linearized DNA (5-20 μg) and 100 μL cell suspension was combined in an electroporation cuvette and incubated for 5 minutes on ice. Electroporation was in a Bio-Rad GenePulser Xcell following the preset Pichia pastoris protocol (2 kV, 25 μF, 200 0), immediately followed by the addition of 1 mL YPDS recovery media (YPD media plus 1 M sorbitol). The transformed cells were allowed to recover for four hours to overnight at room temperature (24° C.) before plating the cells on selective media.
Strains YGLY13992, YGLY12501 and YGLY14836 were each then transformed with pGLY7392 as described above to produce the strains described in Example 4.
Engineered Pichia pastoris Xrn1Δ Strains for Improved Fermentation Yield and N-Glycosylation Quality
The XRN1 knock-out integration plasmid pGLY7392 was linearized with SfiI and the linearized plasmid was transformed into each of the Pichia pastoris strains YGLY12501, YGLY13992, and YGLY14836 to produce respective Δxrn1 strains (i.e., xrn1 deletion strains) used in the following examples. Transformations were performed essentially as described in Example 3.
The genomic integration of pGLY7392 at the XRN1 locus was confirmed by cPCR using the primers, PpXRN1-5′ out/UP (5′-GTTAAATGACTCTAACACCTTGCACTTGA-3′; SEQ ID NO:69) and PpALG3TT/LP (5′-CCTCCCACTGGAACCGATGATATGGAA-3′; SEQ ID NO:70) or PpTEFTT/UP (5′-GATGCGAAGTTAAGTGCGCAGAAAGTAATATCA-3′; SEQ ID NO:71) and PpXRN1-3′ out/LP (5′-TTGCAAAAACCAGTGAGGAATAGC-3; SEQ ID NO:72). Loss of genomic XRN1 sequences was confirmed using cPCR primers, PpXRN1/iUP (5′-GAATGCTGAAGAACGTCAAAGAAACT-3′ (SEQ ID NO:73) and PpXRN1/iLP (5′-TGAGACTTCAGAGCTTTCCATACGA-3′ (SEQ ID NO:74). The PCR conditions were one cycle of 95° C. for two minutes, 35 cycles of 95° C. for 20 seconds, 52° C. for 20 seconds, and 72° C. for one minute; followed by one cycle of 72° C. for 10 minutes.
The strains were cultivated in either a DasGip 1 Liter or Micro24 5 mL fermentor to produce the antibodies for titer and protein N-glycosylation analyses.
Cell growth conditions of the transformed strains for antibody production in the Micro24 5 mL fermentor were generally as follows. Protein expression for the transformed yeast strain seed cultures were prepared by adding Pichia pastoris cells from YSD plates to each well of a Whatman 24-well Uniplate (10 ml, natural polypropylene) containing 3.5 ml of 4% BMGY medium buffered to pH 6.0 with potassium phosphate buffer. The seed cultures were grown for approximately 65-72 hours in a temperature controlled shaker at 24° C. and 650 rpm agitation. 1.0 mL of the 24 well plate grown seed culture and 4.0 ml of 4% BMGY medium was then used to inoculate each well of a Micro24 plate (Type:REG2). 30 μl of Antifoam 204 (1:25 dilution, Sigma Aldrich) was added to each well. The Micro24 was operated in Microaerobicl mode and the fermentations were controlled at 200% dissolved oxygen, pH at 6.5, temperature at 24° C. and agitation at 800 rpm. The induction phase was initiated upon observance of a DO spike after the growth phase by adding bolus shots of methanol feed solution (100% [w/w] methanol, 5 mg/l biotin and 12.5 ml/l PTM1 salts).
Cell growth conditions of the transformed strains for.antibody production in the DasGip fermentor were generally as follows. Protein expression for the transformed yeast strains was carried out in shake flasks at 24° C. with buffered glycerol-complex medium (BMGY) consisting of 1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer pH 6.0, 1.34% yeast nitrogen base, 4×10−5% biotin, and 4% glycerol. The induction medium for protein expression was buffered methanol-complex medium (BMMY) consisting of 1% methanol instead of glycerol in BMGY. Pmt inhibitor Pmti-3 (5-[[3-(1-Phenyl-2-hydroxy)ethoxy)-4-(2-phenylethoxy)]phenyl]methylene]-4-oxo-2-thioxo-3-thiazolidineacetic Acid) (See Published International Application No. WO 2007061631) in methanol was added to the growth medium to a final concentration of 18.3 μM at the time the induction medium was added. Cells were harvested and centrifuged at 2,000 rpm for five minutes.
DasGip Fermentor Screening Protocol followed the parameters shown in Table 2.
At time of about 18 hours post-inoculation, DasGip vessels containing 350 mL media A (See Table 3 below) plus 4% glycerol were inoculated with strain of interest. A small dose (0.3 mL of 0.2 mg/mL in 100% methanol) of Pmti-3 was added with inoculum. At time about 20 hour, a bolus of 17 mL 50% glycerol solution (Glycerol Fed-Batch Feed, See Table 4 below) plus a larger dose (0.3 mL of 4 mg/mL) of Pmti-3 was added per vessel. At about 26 hours, when the glycerol was consumed, as indicated by a positive spike in the dissolved oxygen (DO) concentration, a methanol feed (See Table 5 below) was initiated at 0.7 mL/hr continuously. At the same time, another dose of Pmti-3 (0.3 mL of 4 mg/mL stock) was added per vessel. At time about 48 hours, another dose (0.3 mL of 4 mg/mL) of Pmti-3 was added per vessel. Cultures were harvested and processed at about 60 hours post-inoculation.
The quality of N-glycan composition of the anti-Her2 antibodies was determined as follows. The antibodies were recovered from the cell culture medium and purified by protein A column chromatography. The N-glycans from protein A-purified antibodies were analyzed with 2AB labeling. The high performance liquid chromatography (HPLC) system used consisted of an Agilent 1200 equipped with autoinjector, a column-heating compartment and a UV detector detecting at 210 and 280 nm. All LC-MS experiments performed with this system were running at 1 mL/min. The flow rate was not split for MS detection. Mass spectrometric analysis was carried out in positive ion mode on Accurate-Mass Q-TOF LC/MS 6520 (Agilent technology). The temperature of dual ESI source was set at 350° C. The nitrogen gas flow rates were set at 13 L/h for the cone and 3501/h and nebulizer was set at 45 psig with 4500 volt applied to the capillary. Reference mass of 922.009 was prepared from HP-0921 according to API-TOF reference mass solution kit for mass calibration and the protein mass measurements. The data for ion spectrum range from 300-3000 m/z were acquired and processed using Agilent Masshunter.
Sample preparation was as follows. An intact antibody sample (50 μg) was prepared 50 μL 25 mM NH4HCO3, pH 7.8. For deglycosylated antibody, a 50 μL aliquot of intact antibody sample was treated with PNGase F (10 units) for 18 hours at 37° C. Reduced antibody was prepared by adding 1 M DTT to a final concentration of 10 mM to an aliquot of either intact antibody or deglycosylated antibody and incubated for 30 min at 37° C.
Three micrograms of intact or deglycosylated antibody sample was loaded onto a Poroshell 300SB-C3 column (2.1 mm×75 mm, 5 μm) (Agilent Technologies) maintained at 70°C. The protein was first rinsed on the cartridge for 1 minute with 90% solvent A (0.1% HCOOH), 5% solvent B (90% Acetonitrile in 0.1% HCOOH). Elution was then performed using a gradient of 5-100% of B over 26 minutes followed by a three-minute regeneration at 100% B and by a final equilibration period of 10 minute at 5% B.
For reduced antibody, a three microgram sample was loaded onto a Poroshell 300SB-C3 column (2.1 mm×75 mm, 5 μm) (Agilent Technologies) maintained at 40° C. The protein was first rinsed on the cartridge for three minutes with 90% solvent A, 5% solvent B. Elution was then performed using a gradient of 5-80% of B over 20 minutes followed by a seven-minute regeneration at 80% B and by a final equilibration period of 10 minutes at 5% B.
This example describes construction of strain YGLY21058. Genetically engineered Pichia pastoris strain YGLY21058 produces recombinant human glycoinsulin molecules. The strain produces glycoproteins having sialylated N-glycans and expressing the insulin analogue comprising an N-glycosylation site on the B-chain at position 28 encoded by the expression cassette in plasmid pGLY4362. Construction of the strains is illustrated schematically in
Strain YGLY12900 was transformed with plasmid pGLY4362, which is an expression plasmid that in Pichia pastoris enables expression of a glycosylated insulin analogue precursor molecule comprising the Yps1ss domain fused to the TA57 propeptide domain fused to an N-terminal spacer fused to the human insulin B-chain having a P28N substitution fused to a C-peptide having the amino acid sequence AAK fused to the human insulin A-chain, to produce a number of strains of which strain YGLY21058 was selected. The strain is capable of producing an N-glycosylated insulin analogue precursor comprising an N-terminal spacer fused to the human insulin B-chain having a P28N substitution fused to a C-peptide having the amino acid sequence AAK fused to the human insulin A-chain. The analysis of the N-glycosylated insulin analogue precursor expression from this engineered Pichia pastoris XRN1 knock-out strain is shown in Table 11.
This example describes construction of strain YGLY7117. Genetically engineered Pichia pastoris strain YGLY7117 produces recombinant human erythropoietin molecules. The strain produces glycoproteins having sialylated N-glycans. The strain YGLY7117 was constructed from wild-type Pichia pastoris strain NRRL-Y 11430 described earlier (“Add Reference here: J. Biotechnol. 2012 January; 157(1):198-206. Nett et al. “Optimization of erythropoietin production with controlled glycosylation-PEGylated erythropoietin produced in glycoengineered Pichia pastoris”). The analysis of the N-glycosylated insulin analogue precursor expression from this engineered Pichia pastoris XRN1 knock-out strain is shown in Table 7.
Analysis of xrn1Δ Pichia mutants illustrate that mRNA degradation enzymes are involved in regulating general translation repression in response to a variety of nutritional and environmental stresses. In two well-characterized examples, global protein synthesis is rapidly inhibited upon glucose deprivation or severe amino acid starvation. In general, the stress-induced translation inhibition is a rapid response mediated by a well-described pathway involving Gcn2 protein kinase and its subsequent phosphorylation of translation initiation factor eIF2. mRNA degradation enzymes have not been described to be involved in this Gcn2 protein phosphorylation process. However, Saccharomyces mutants effecting 5′ to 3′ mRNA decay such as Δdcp1 and Δxrn1 are generally resistant to this stress-induced translation repression. Thus, it has been surprisingly found that Δxrn1 Pichia strains of the present invention continue to translate at a rate typical of that seen with glucose-containing medium, even in glucose deprivation or amino acid starvation conditions. Because current high cell-density fermentors usually operate at oxygen-limited or carbon-source limited processes, it is likely that part of the yield improvement result of Δxrn1 Pichia cells can be attributed to this Δxrn1 translation derepression during fermentation process.
Tables 7-11 summarize yield improvement and N-Glycan quality improvement results with engineered Pichia xrn1 knockout host cells expressing exemplary heterologous proteins, in this case three different therapeutic proteins, as described in Examples 2-5.
In summary, the mRNA stabilization technique presented herein provides a powerful and flexible method to improve protein fermentation titer and protein glycosylation quality simultaneously. Inhibition of global mRNA turnover by XRN1 knockout increases mRNA abundance of both target protein and corresponding glycosyltransferases. Moreover, mutation of XRN 1 may affect translation initiation to prevent stress-induced translation regulation and further improve the titer.
ScSUC2 S. cerevisiae Invertase
OCH1 Alpha-1,6-mannosyltransferase
K1MNN2-2: K. lactis UDP-GlcNAc transporter
BMT1: Beta-mannose-transfer (beta-mannose elimination)
BMT2: Beta-mannose-transfer (beta-mannose elimination)
BMT3: Beta-mannose-transfer (beta-mannose elimination)
BMT4: Beta-mannose-transfer (beta-mannose elimination)
MNN4L1: MNN4-like 1 (charge elimination)
MmSLC35A3 Mouse homologue of UDP-GlcNAc transporter
PNO1: Phosphomannosylation of N-glycans (charge elimination)
MNN4: Mannosyltransferase (charge elimination)
ScGAL10 UDP-glucose 4-epimerase
XB33 Truncated HsGalT1 fused to ScKRE2 leader
DmUGT UDP-Galactose transporter
KD53 Truncated DmMNSII fused to ScMNN2 leader
TC54 Truncated RnGNTII fused to ScMNN2 leader
NA10 Truncated HsGNTI fused to PpSEC12 leader
FB8: Truncated MmMNS1A fused to ScSEC12 leader
TrMDS1: Secreted T. reseei MNS 1
Sh ble: Zeocin resistance marker
Nat: Streptomyces noursei nourseothricin acetyltransferase
GD9: Truncated MmMNS1B fused to ScSEC12 leader
MmCST Mouse CMP-sialic acid transporter
HsGNE Human UDP-GlcNAc 2-epimerase/N-acetylmannosamine kinase
HsCSS Human CMP-sialic acid synthase
HsSPS Human N-acetylneuraminate-9-phosphate synthase
MmST6-33 Truncated Mouse alpha-2,6-sailyl transferase fused to ScKRE2 leader
TrMDS 1: Secreted T. reseei MNS 1
STE13 Golgi dipeptidyl aminopeptidase
DAP2 Vacuolar dipeptidyl aminopeptidase
NatR Nourseothricin resistance marker
HygR Hygromycin resistance marker
TRP2 Tryptophan biosynthesis
Sh ble: Zeocin resistance marker
Insulin precursor variant: YPS1ss+TA57propeptide+N-spacer+Bchain(P28N)+C-peptide(AAK)+Achain insulin precursor
Pichia pastoris
Pichia pastoris
S. cerevisiae
GTTTTGCAGCCAAAATATCTGCATCAATGACAAACGA
AACTAGCGATAGACCTTTGGTCCACTTCACACCCAAC
AAGGGCTGGATGAATGACCCAAATGGGTTGTGGTACG
ATGAAAAAGATGCCAAATGGCATCTGTACTTTCAATA
CAACCCAAATGACACCGTATGGGGTACGCCATTGTTT
TGGGGCCATGCTACTTCCGATGATTTGACTAATTGGGA
AGATCAACCCATTGCTATCGCTCCCAAGCGTAACGAT
TCAGGTGCTTTCTCTGGCTCCATGGTGGTTGATTACAA
CAACACGAGTGGGTTTTTCAATGATACTATTGATCCAA
GACAAAGATGCGTTGCGATTTGGACTTATAACACTCC
TGAAAGTGAAGAGCAATACATTAGCTATTCTCTTGAT
GGTGGTTACACTTTTACTGAATACCAAAAGAACCCTG
TTTTAGCTGCCAACTCCACTCAATTCAGAGATCCAAAG
GTGTTCTGGTATGAACCTTCTCAAAAATGGATTATGAC
GGCTGCCAAATCACAAGACTACAAAATTGAAATTTAC
TCCTCTGATGACTTGAAGTCCTGGAAGCTAGAATCTGC
ATTTGCCAATGAAGGTTTCTTAGGCTACCAATACGAAT
GTCCAGGTTTGATTGAAGTCCCAACTGAGCAAGATCC
TTCCAAATCTTATTGGGTCATGTTTATTTCTATCAACC
CAGGTGCACCTGCTGGCGGTTCCTTCAACCAATATTTT
GTTGGATCCTTCAATGGTACTCATTTTGAAGCGTTTGA
CAATCAATCTAGAGTGGTAGATTTTGGTAAGGACTAC
TATGCCTTGCAAACTTTCTTCAACACTGACCCAACCTA
CGGTTCAGCATTAGGTATTGCCTGGGCTTCAAACTGG
GAGTACAGTGCCTTTGTCCCAACTAACCCATGGAGAT
CATCCATGTCTTTGGTCCGCAAGTTTTCTTTGAACACT
GAATATCAAGCTAATCCAGAGACTGAATTGATCAATT
TGAAAGCCGAACCAATATTGAACATTAGTAATGCTGG
TCCCTGGTCTCGTTTTGCTACTAACACAACTCTAACTA
AGGCCAATTCTTACAATGTCGATTTGAGCAACTCGACT
GGTACCCTAGAGTTTGAGTTGGTTTACGCTGTTAACAC
CACACAAACCATATCCAAATCCGTCTTTGCCGACTTAT
CACTTTGGTTCAAGGGTTTAGAAGATCCTGAAGAATA
TTTGAGAATGGGTTTTGAAGTCAGTGCTTCTTCCTTCT
TTTTGGACCGTGGTAACTCTAAGGTCAAGTTTGTCAAG
GAGAACCCATATTTCACAAACAGAATGTCTGTCAACA
ACCAACCATTCAAGTCTGAGAACGACCTAAGTTACTA
TAAAGTGTACGGCCTACTGGATCAAAACATCTTGGAA
TTGTACTTCAACGATGGAGATGTGGTTTCTACAAATAC
CTACTTCATGACCACCGGTAACGCTCTAGGATCTGTGA
ACATGACCACTGGTGTCGATAATTTGTTCTACATTGAC
AAGTTCCAAGTAAGGGAAGTAAAATAGAGGTTATAA
Pichia pastoris
Pichia pastoris
Pichia pastoris
Escherichia coli
Pichia pastoris
Pichia pastoris
Kluyveromyces
lactis
K. lactis UDP-
AGTGTTCGGAGGATGTTGTTCCAATGTGATTAGTTTCG
AGCACATGGTGCAAGGCAGCAATATAAATTTGGGAAA
TATTGTTACATTCACTCAATTCGTGTCTGTGACGCTAA
TTCAGTTGCCCAATGCTTTGGACTTCTCTCACTTTCCGT
TTAGGTTGCGACCTAGACACATTCCTCTTAAGATCCAT
ATGTTAGCTGTGTTTTTGTTCTTTACCAGTTCAGTCGCC
AATAACAGTGTGTTTAAATTTGACATTTCCGTTCCGAT
TCATATTATCATTAGATTTTCAGGTACCACTTTGACGA
TGATAATAGGTTGGGCTGTTTGTAATAAGAGGTACTCC
AAACTTCAGGTGCAATCTGCCATCATTATGACGCTTGG
TGCGATTGTCGCATCATTATACCGTGACAAAGAATTTT
CAATGGACAGTTTAAAGTTGAATACGGATTCAGTGGG
TATGACCCAAAAATCTATGTTTGGTATCTTTGTTGTGC
TAGTGGCCACTGCCTTGATGTCATTGTTGTCGTTGCTC
AACGAATGGACGTATAACAAGTACGGGAAACATTGGA
AAGAAACTTTGTTCTATTCGCATTTCTTGGCTCTACCG
TTGTTTATGTTGGGGTACACAAGGCTCAGAGACGAAT
TCAGAGACCTCTTAATTTCCTCAGACTCAATGGATATT
CCTATTGTTAAATTACCAATTGCTACGAAACTTTTCAT
GCTAATAGCAAATAACGTGACCCAGTTCATTTGTATC
AAAGGTGTTAACATGCTAGCTAGTAACACGGATGCTT
TGACACTTTCTGTCGTGCTTCTAGTGCGTAAATTTGTT
AGTCTTTTACTCAGTGTCTACATCTACAAGAACGTCCT
ATCCGTGACTGCATACCTAGGGACCATCACCGTGTTCC
TGGGAGCTGGTTTGTATTCATATGGTTCGGTCAAAACT
GCACTGCCTCGCTGAAACAATCCACGTCTGTATGATA
Pichia pastoris
Pichia pastoris
Mus musculus
Pichia pastoris
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Mus musculus
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Pichia pastoris
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Saccharomyces
cerevisiae
Drosophila
melanogaster
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Drosophila
melanogaster
Drosophila
melanogaster
Saccharomyces
cerevisiae
Pichia pastoris
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Trichoderma
reesei
Saccharomyces
cerevisiae
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Pichia pastoris
Streptoalloteichus
hindustanus
Saccharomyces
cerevisiae
Pichia pastoris
Pichia pastoris
Streptomyces
noursei
Ashbya gossypii
Ashbya gossypii
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Pichia pastoris
Escherichia coli
Pichia pastoris
Pichia pastoris
Saccharomyces
cerecisiae
Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes. All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, was specifically and individually indicated to be incorporated by reference. This statement of incorporation by reference is intended by Applicants, pursuant to 37 C.F.R. §1.57(b)(1), to relate to each and every individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, each of which is clearly identified in compliance with 37 C.F.R. §1.57(b)(2), even if such citation is not immediately adjacent to a dedicated statement of incorporation by reference. The inclusion of dedicated statements of incorporation by reference, if any, within the specification does not in any way weaken this general statement of incorporation by reference. Citation of the references herein is not intended as an admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.
The present invention is not to be limited in scope by the specific embodiments described herein; the embodiments specifically set forth herein are not necessarily intended to be exhaustive. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.
This application claims the benefit of U.S. provisional patent application No. 61/553,801; filed Oct. 31, 2011; which is herein incorporated by reference in its entirety.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US12/61599 | 10/24/2012 | WO | 00 | 4/28/2014 |
| Number | Date | Country | |
|---|---|---|---|
| 61553801 | Oct 2011 | US |
