Patent Application
20130137150
This application provides recombinant Aspergillus fungi that are genetically inactivated for the dolichyl-P-Man:Man(5)G1cNAc(2)-PP-dolichyl mannosyltransferase (Alg3) gene, are genetically enhanced to increase the expression levels of the loss of aflR expression A (LaeA) gene, or both, which results in substantial improvement of citric acid production. Methods of using these fungi to produce citric acid are also provided.
Filamentous fungi, such as Aspergillus niger, are well known for their industrial applications in protein and chemical productions. They are used to produce a wide variety of products ranging from human therapeutics, glycosyl hydrolases to specialty chemicals [Punt et al., Trends Biotechnol 20(5):200-206, 2002; Schuster et al., Appl Microbiol Biotechnol 59(4-5):426-435, 2002; Gerngross, Nat Biotechnol 22(11):1409-1414, 2004; Nevalainen et al., Trends Biotechnol 23(9):468-474, 2005; Sauer et al., Trends Biotechnol. 26(2):100-8, 2008; Magnuson and Lasure (2004). “Organic acid production by filamentous fungi.” Advances in fungal biotechnology for industry, agriculture, and medicine, pages 307-340]. Some of industrial A. niger strains are capable of growing on solutions of glucose or sucrose in excess of 20% (w/v) and converting approximately 90% of the supplied carbohydrate to citric acid. These remarkable properties are the reason that A. niger has been used to produce citric acid for more 80 years and is currently the primary source of commercial citric acid production (Magnuson and Lasure (2004). “Organic acid production by filamentous fungi.” Advances in fungal biotechnology for industry, agriculture, and medicine, pages 307-340).
The maximum product output in fermentation processes is the result of optimal metabolic pathways and cellular formation, which are influenced by endogenous and exogenous factors. Cellular metabolisms are tightly controlled and highly interconnected, and are regulated spatially and temporally at different levels, such as transcription, post-transcription, translation, and post-translation. Therefore, different approaches have been explored to understand the regulatory mechanisms of metabolic processes and cellular formation for maximizing the product output in filamentous fungi. For example, comparative genomics was used to examine citric-acid-producing versus enzyme-producing A. niger strains (Andersen et al., Genome Res. 21(6): 885-97, 2011), proteomics was used to examine filamentous fungi related to enzymes or organic acid production (de Oliveira and de Graaff, Appl. Microbiol. Biotechnol. 89(2): 225-37, 2011), or combination of both genomics and proteomics were used to examine enzyme production (Jacobs et al., Fungal Genetics and Biology 46(1, Supplement):S141-S152, 2009). Although these studies examined the potential involvement of selected genes and proteins in optimizing production of organic acids or proteins in filamentous fungi, methods for altering the complex post-translation modifications (such as N-glycosylation of cellular proteins) for signal transduction, cellular formation and metabolism at different growth and development stages, which may affect product output, have not been examined.
Protein glycosylation is a ubiquitous and structurally diverse form of post translation modification, which occurs at all domains of life. More than two-thirds of eukaryotic proteins are predicted to be glycosylated (Apweiler et al., Biochim Biophys Acta 1473(1):4-8, 1999). N- and O-linked protein glycosylation are common types of protein glycosylation, occurring mainly on the asparagine (N) and serine/threonine (S/T) residues, respectively. N-linked glycosylation has been implicated in many biochemical and cellular processes, including protein secretion, stability and translocation, maintenance of cell structure, receptor-ligand interactions and cell signaling, cell-cell recognition, pathogen infection, and host defense in various organisms (Haltiwanger and Lowe, Ann. Rev. Biochem. 73(1):491-537, 2004; Dellaporta et al., Plant Mol. Biol. Reporter 1(4):19-21, 1983; Nam et al., Biotech. Bioengineer. 100(6):1178-1192, 2008; Trombetta and Parodi, Ann. Rev. Cell Dev. Biol. 19(1):649-676, 2003; Tsang et al., Fungal Genetics and Biology 46(1): S153-S160, 2009; Pang et al., Science, 333(6050):1761-4, 2011).
N-glycosylation is highly complex and has been extensively studied in mammalian systems (Yan and Lennarz, J. Biol. Chem. 280(5):3121, 2005; Silberstein and Gilmore, FASEB J. 10(8): 849, 1996; Kornfeld and Kornfeld, Annu. Rev. Biochem. 54:631-664, 2005; Kim et al., PLoS ONE 4(10): e7317, 2009, 2009) and yeast (Kukuruzinska et al., Annu. Rev. Biochem. 56(1):915-944, 1987). The protein N-glycosylation pathways in filamentous fungi have also been identified (Deshpande et al., Glycobiology 18(8):626-637, 2008; Geysens et al., Fungal Genetics and Biology 46(1, Supplement): S121-S140, 2009) on the basis of the known genomic sequences. Several genes involved in N-glycosylation have been studied in filamentous fungi (Kotz et al., PLoS ONE 5(12):e15729, 2010; Kainz et al., Appl Environ Microbiol 74(4):1076-86, 2008; Maras et al., J. Biotechnol. 77(2-3):255-63, 2000; Maddi and Free, Eukaryot Cell 9(11):1766-75, 2010; Bowman et al., Eukaryotic Cell 5(3):587-600, 2006). In these studies, the effects of gene deletion on N-linked glycan patterns formation, the cell wall formation, overall protein secretion and/or the phenotypic changes were demonstrated.
Alg3 is localized in the ER and catalyzes the initial transfer of a mannose residue from dolichol pyrophosphate-mannose to lipid-linked Man5GlcNAc2-PP-Dol on the ER luminal side. It is involved in the early N-glycan synthesis in eukaryotes for the assembly of a Glc3Man9GlcNAc2 core oligosaccharide that is linked to the lipid carrier dolichol pyrophosphate. The Alg3 gene and its functions have been identified and studied in S. cerevisiae, P. pastories, T. brucei, A. thaliana, and human (Aebi et al., Glycobiol. 6(4):439-444, 1996; Korner et al., EMBO J. 18(23): 6816-6822, 1999; Davidson et al., Glycobiology 14(5):399-407, 2004; Manthri et al., Glycobiol. 18(5):367-83, 2008; Kajiura et al., Glycobiol. 20(6):736-51, 2010). In these studies, the Alg3 mutants exhibited a unique structural profile in the glycoproteins, such as Man3GlcNAc2, Man4GlcNAc2, Man5GlcNAc2, GlcMan5GlcNAc2, and Glc3Man5GlcNAc2, which affected the overall N-glycosylation by incomplete utilization of N-linked glycosites in glycoproteins. No obvious growth phenotype was observed in those Alg3Δ mutants of S. cerevisiae, P. pastoris, T. brucei, and plant except that the Alg3 defect in human caused severe diseases such as profound psychomotor delay, optic atrophy, acquired microcephaly, iris olobomas and hypsarrhythmia (Stibler et al., Neuropediatrics 26(5): 235-7, 1995; Sun et al., J. Clin. Endocrinol. Metab. 90(7):4371-5, 2005; Schollen et al., Eur. J. Med. Genet. 48(2):153-158, 2005, Kranz et al., Am. J. Med. Genet. 143A(13):1414-20, 2007; Denecke et al., Pediatr. Res. 58(2):248-53, 2005).
LaeA, a global regulator gene for the secondary metabolism, was first identified in A. nidulans through complementing the aflR deficient mutants (Bok and Keller, Eukaryot Cell 3:527-535, 2004). Deletion of LaeA gene inhibits the expression of secondary metabolic gene clusters, such as sterigmatocystin, penicillin, and lovastin, but has no effect on spore production in A. nidulans. The LaeA that was confirmed as a nuclear protein and a putative methyltransferase does not involve in gene clusters for nutrient utilization (Bok et al., Mol Microbiol 61:1636-45, 2006). Furthermore, the role of LaeA in secondary metabolism was confirmed in Aspergillus flavus and Aspergillus oryzae (Kale et al., Fungal Genet. Biol. 45:1422-9, 2008; Oda et al., Biosci Biotechnol Biochem 75:1832-4, 2011). Evidence indicates that LaeA reverses gene repression at the level of the heterochromatin state (Reyes-Dominguez et al., Molecular Microbiology 76:1376-86, 2010). LaeA is a component of the heterotrimeric VeA/VelB/LaeA protein complex (Bayram et al., Science Signalling 320:1504, 2008), which involves in the acetylation signal transduction for secondary metabolite production in A. nidulans (Soukup et al., Mol. Microbiol., 86(2):314-30, 2012). The veA/VelB/LaeA complex may coordinately respond to environmental cues (Ramamoorthy et al., Mol. Microbiol., 85(4):795-814, 2012) and has a role in fungal morphology (Calvo, Fungal Genetics and Biology 45:1053-61, 2008). LaeA may direct the formation of the VelB-VosA and VelB-VelA-LaeA complexes, control veA modification and protein levels, and be involved in light regulation of growth and development (Bayram et al., PLoS genetics 6: e1001226, 2010).
Although the current commercial conversion rate of carbohydrate to citric acid in A. niger is more than eighty to ninety percent, further improvement citric acid and other metabolites is desirable. This disclosure describes the role of the dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase gene (α-1,3-mannosyltransferase, Alg3) on the spore germination, filamentous growth, sporulation, and production of citric acid in Aspergillus niger. In addition, the role of the LaeA in citric acid production by its over-expression is shown, for example in combination with an Alg3Δ mutant background.
Based on these observations, provided herein are isolated fungi (such as filamentous fungi) having a gene inactivation (also referred to herein as a gene deletion) of a dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase (Alg3) gene (referred to herein as Alg3Δ strains), a gene enhancement (e.g., overexpression) of a LaeA gene (referred to herein as upregulated LaeA strains), or both. Any strain of fungi can be used, such as a filamentous fungi, for example Aspergillus niger (A. niger) or particular strains thereof (for example A. niger strain 11414 or 11414KusA). In particular examples, an Alg3Δ strain exhibits one or more of the following characteristics: slower growth on citric acid production (CAP) medium, complete medium (CM) or potato dextrose agar (PDA) medium; earlier spore germination and a higher germination rate in CAP medium; delayed spore germination in CM or PDA medium; reduced sporulation on complete medium; or combinations thereof. In some examples, such increases or decreases are relative to A. niger strain 11414KusA grown under the same conditions. The combination of Alg3Δ and over-expression of LaeA resulted in some improvement of sporulation on CM.
In particular examples, such Alg3Δ strains, up-regulated LaeA strains, or Alg3Δ-upregulated LaeA strains, produce more citric acid when grown in CAP medium, such as at least 20%, at least 50%, or at least 70% more than A. niger strain 11414KusA under identical growing conditions after at least 4 days or at least 10 days. Thus, one strategy to increase citric acid production is to reduce the carbohydrate consumption for protein glycosylation and cellular formation, as altering protein glycosylation can augment the carbohydrate flux into citric acid production in A. niger.
Also provided herein are compositions (such as fermentation broth) and kits that include a fungal Alg3Δ strain, up-regulated LaeA strain, or Alg3Δ-upregulated LaeA strain.
Also provided herein are methods of making citric acid using the disclosed fungal Alg3Δ strains, up-regulated LaeA strains, and Alg3Δ-upregulated LaeA strains. For example, such a method can include culturing an isolated Alg3Δ fungus, up-regulated LaeA fungus, or Alg3Δ-upregulated LaeA fungus, under conditions that permit the fungus to make citric acid, thereby making citric acid. For example, the Alg3Δ fungus, up-regulated LaeA fungus, or Alg3Δ-upregulated LaeA fungus, can be cultured in CAP medium. In some examples, the method further includes isolating the citric acid produced.
The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NOS: 1 and 2 are exemplary Alg3 nucleic acid and protein sequences, respectively, from A. niger.
SEQ ID NOS: 3 and 4 are exemplary Alg3 nucleic acid and protein sequences, respectively, from A. oryzae.
SEQ ID NOS: 5-30 show exemplary primer sequences.
SEQ ID NOS: 31-36 are exemplary Alg3 protein sequences from A. nidulans, Fusarium oxysporum, Arabidopsis thaliana, Neurospora crassa, S. cerevisiae, and Homo sapiens, respectively.
SEQ ID NO: 37 is an exemplary Aspergillus nidulans glyceraldehyde 3-phosphate dehydrogenase (gpdA) promoter sequence.
SEQ ID NOS: 38 and 39 are exemplary forward and reverse primers, respectively, that can be used to isolate or amplify an A. nidulans gpdA promoter.
SEQ ID NOS: 40 and 41 are exemplary Aspergillus nidulans methyltransferase (LaeA) coding and protein sequences, respectively.
SEQ ID NOS: 42 and 43 are exemplary forward and reverse primers, respectively, that can be used to isolate or amplify an A. nidulans LaeA sequence.
SEQ ID NO: 44 is the nucleic acid sequence of the pGPDA-LaeA fragment described in
SEQ ID NO: 45 is the upstream region of A. niger pyrG gene.
SEQ ID NO: 46 is the trpC transcriptional terminator of A. nidulans.
SEQ ID NO: 47 is the pyrithiamine resistance gene (ptrA) of Aspergillus oryzae.
SEQ ID NO: 48 is the downstream region of A. niger pyrG gene.
SEQ ID NOS: 49 and 50 are exemplary forward and reverse primers, respectively, that can be used to isolate or amplify an upstream region of A. niger pyrG.
SEQ ID NOS: 51 and 52 are exemplary forward and reverse primers, respectively, that can be used to isolate or amplify the trpC transcriptional terminator of A. nidulans.
SEQ ID NOS: 53 and 54 are exemplary forward and reverse primers, respectively, that can be used to isolate or amplify ptrA of Aspergillus oryzae.
SEQ ID NOS: 55 and 56 are exemplary forward and reverse primers, respectively, that can be used to isolate or a downstream region of A. niger pyrG.
SEQ ID NO: 57 is the nucleic acid sequence of the transgene fragment described in
SEQ ID NOS: 58 and 59 are exemplary Aspergillus niger LaeA coding and protein sequences, respectively.
SEQ ID NO: 60 is the nucleic acid sequence of the transgene fragment used to complement the alg3Δ mutant with the original alg3 gene at pyrG locus.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Hence “comprising A or B” means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All references and Genbank Accession numbers mentioned herein are incorporated by reference (the sequence available on Nov. 30, 2011). The materials, methods, and examples are illustrative only and not intended to be limiting.
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Alg3 (dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase):
Also known as asparagine-linked glycosylation 3 and α-1,3-mannosyltransferase. Alg3 encodes an enzyme which catalyzes the addition of the first dol-p-man derived mannose in an α-1,3 linkage to Man5GlcNAc2-PP-Dol. The term Alg3 (or Alg3) includes any Alg3 gene (such as a fungal Alg3 sequence), cDNA, mRNA, or protein, that is an Alg3 involved in catalyzing the addition of the first dol-p-man derived mannose in an α-1,3 linkage to Man5GlcNAc2-PP-Dol, and when genetically inactivated results in a fungus that has an ability to produce more citric acid than the parent strain (such as at least 20%, at least 30%, at least 50%, at least 60%, or at least 70% more than a parent strain under the same growing conditions).
Alg3 sequences are publicly available for many species of Aspergillus. For example, GenBank Accession Nos: XM—001823992.2 and XP—001824044 disclose Aspergillus oryzae RIB40 Alg3 nucleic acid and protein sequences, respectively; GenBank Accession Nos: XM—001398659.2 and XP—001398696.2 disclose Aspergillus niger CBS 513.88 Alg3 nucleic acid and protein sequences, respectively (SEQ ID NOS: 1 and 2); and GenBank Accession Nos: XM—748359.1 and XP—753452 disclose Aspergillus fumigatus Af293 Alg3 nucleic acid and protein sequences, respectively. Addition exemplary Alg3 sequences are provided in SEQ ID NOS: 1-4 and 31-36. However, one skilled in the art will appreciate that in some examples, an Alg3 sequence can include variant sequences (such as allelic variants and homologs) that retain Alg3 activity but when genetically inactivated in Aspergillus results in a fungus that has an ability to produce more citric acid than the parent strain (such as at least 20%, at least 30%, at least 50%, at least 60%, or at least 70% more under the same growing conditions).
Detectable:
Capable of having an existence or presence ascertained. For example, production of citric acid is detectable if the signal generated is strong enough to be measurable.
Genetic Enhancement or Up-Regulation:
When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in an increase in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Examples of processes that increase transcription include those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (for example by blocking the binding of a transcriptional repressor). Gene up-regulation can include inhibition of repression as well as stimulation of expression above an existing level. Examples of processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability. In one example, additional copies of genes are introduced into a cell in order to increase expression of that gene in the resulting transgenic cell.
Gene up-regulation includes any detectable increase in the production of a gene product. In certain examples, production of a gene product increases by at least 1.5-fold, at least 2-fold, or at least 5-fold), such as LaeA. For example, a genetic enhancement of a LaeA gene in Aspergillus (e.g., A. niger) results in an Aspergillus strain having increased levels of the LaeA protein relative to the parent strain, which can increase the ability of the fungus to produce more citric acid. Genetic enhancement is also referred to herein as “enhancing or increasing expression.”
Genetic Inactivation or Down-Regulation:
When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in a decrease in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, gene down-regulation or deactivation includes processes that decrease transcription of a gene or translation of mRNA.
For example, a mutation, such as a substitution, partial or complete deletion, insertion, or other variation, can be made to a gene sequence that significantly reduces (and in some cases eliminates) production of the gene product or renders the gene product substantially or completely non-functional. For example, a genetic inactivation of an Alg3 gene in Aspergillus (e.g., A. niger) results in Aspergillus having a non-functional or non-existent Alg3 protein, which results in an ability of the fungus to produce more citric acid. Genetic inactivation is also referred to herein as “functional deletion”.
Isolated:
To be significantly separated from other agents. An “isolated” biological component (such as a nucleic acid molecule or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component occurs, for example, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acid molecules and proteins which have been “isolated” include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized proteins and nucleic acids. Samples of isolated biological components include samples of the biological component wherein the biological component represents greater than 90% (for example, greater than 95%, such as greater than 98%) of the sample.
An “isolated” microorganism (such as an Alg3Δ strain of Aspergillus) has been substantially separated or purified away from microorganisms of different types, strains, or species. Microorganisms can be isolated by a variety of techniques, including serial dilution and culturing and resistance to certain chemicals.
LaeA (Loss of aflR Expression A):
LaeA encodes a protein which regulates secondary metabolite production in Aspergillus. The term LaeA (or LaeA) includes any LaeA gene (such as a fungal LaeA sequence), cDNA, mRNA, or protein, that is an LaeA involved in secondary metabolite production, and when its expression is increased, for example in combination with a genetically inactivated Alg3 gene, results in a fungus that has an ability to produce more citric acid than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60%, or at least 70% more than a parent strain under the same growing conditions).
LaeA sequences are publicly available for many species of Aspergillus. For example, GenBank Accession Nos: AB267276 and BAF74528.1 disclose Aspergillus oryzae LaeA nucleic acid and protein sequences, respectively; GenBank Accession No. EHA27020.1 discloses an exemplary Aspergillus niger ATCC1015 LaeA protein sequence, a parent strain of 11414kusA (other exemplary sequences are provided in SEQ ID NOS: 58 and 59); GenBank Accession No: CBF88745 discloses an Aspergillus nidulans LaeA protein sequence; and GenBank Accession Nos: AY422723 and AAR01218 disclose Aspergillus fumigatus LaeA nucleic acid and protein sequences, respectively. Additional exemplary LaeA sequences are provided in SEQ ID NOS: 40-41 and 58-59. However, one skilled in the art will appreciate that in some examples, an LaeA sequence can include variant sequences (such as allelic variants and homologs) that retain LaeA activity and when genetically up-regulated in Aspergillus (for example in combination with Alg3Δ) results in a fungus that has an ability to produce more citric acid than the parent strain (such as at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% more under the same growing conditions).
Mutation:
A change in a nucleic acid sequence (such as a gene sequence) or amino acid sequence, for example as compared to a nucleic acid or amino acid sequence present in a wild-type or native organism. In particular examples, a mutation is introduced into an Alg3 gene in Aspergillus. Mutations can occur spontaneously, or can be introduced, for example using molecular biology methods. In particular examples, a mutation includes one or more nucleotide substitutions, deletions, insertions, or combinations thereof. In particular examples, the presence of one or more mutations in a gene can significantly inactivate that gene.
Recombinant:
A recombinant nucleic acid molecule or protein is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. In particular examples, this artificial combination is accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques such as those described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 3d ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001. The term recombinant includes nucleic acid molecules that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid molecule.
Sequence Identity/Similarity:
The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.
BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq-i c:\seq1.txt-j c:\seq2.txt-p blastn-o c:\output.txt-q-1 -r 2.
To compare two amino acid sequences, the options of Bl2seq can be set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq-i c:\seq1.txt-j c:\seq2.txt-p blastp-o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (i.e., 1166÷1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. In another example, a target sequence containing a 20-nucleotide region that aligns with 20 consecutive nucleotides from an identified sequence as follows contains a region that shares 75 percent sequence identity to that identified sequence (i.e., 15÷20*100=75).
For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). Homologs are typically characterized by possession of at least 70% sequence identity counted over the full-length alignment with an amino acid sequence using the NCBI Basic Blast 2.0, gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST (Hancock and Armstrong, 1994, Comput. Appl. Biosci. 10:67-70). Other programs use SEG. In addition, a manual alignment can be performed. Proteins with even greater similarity will show increasing percentage identities when assessed by this method, such as at least 75%, 80%, 85%, 90%, 95%, or 99% sequence identity.
Nucleic acid sequences that do not show a high degree of identity may nevertheless encode identical or similar (conserved) amino acid sequences, due to the degeneracy of the genetic code. Changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous nucleic acid sequences can, for example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity determined by this method.
One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside the ranges provided.
Transformed:
A cell, such as a fungal cell, into which a nucleic acid molecule has been introduced, for example by molecular biology methods known in the art. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including, but not limited to transfection with viral vectors, conjugation, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and biolistic particle delivery.
This disclosure provides the first demonstration that genetic inactivation of Alg3, a gene involved in protein N-linked glycosylation, can result in substantial improvement of citric acid production in A. niger, while the total biomass is similar to the parent strain. The core oligosaccharide Glc3Man9GlcNAc2 is synthesized by a series of membrane-bound glycosyltransferases, which begins on the cytoplasmic side of the membrane of the endoplasmic reticulum (ER) and flips into the lumenal side of the ER membrane to complete its synthesis. The lipid-linked core Glc3Man9GlcNAc2 is subsequently transferred to a nascent protein in the ER, where the glycoproteins are folded and then shuttled to the Golgi for additional, but divergent processing. The Alg3 gene encodes the enzyme α-1,3-mannosyltransferase that converts Man5GlcNAc2-Dol-PP to Man6GlcNAc2-Dol-PP on the ER membrane of the luminal side. Provided herein is a homolog of Saccharomyces cerevisiae Alg3 identified from Aspergillus niger (e.g., see SEQ ID NOS: 1 and 2).
It is shown herein that genetic inactivation of Alg3 in A. niger resulted in a significant reduction of growth on complete medium (CM) and potato dextrose agar medium (PDA), but no effect on minimal medium (MM). The Alg3 deletion also caused the substantial reduction in spore production of A. niger on CM, but no significant change on the PDA. When the spores were germinated in CM or PDA liquid culture medium, the Alg3Δ strain showed pronounced delay in spore germination. This growth phenotype is similar to the mutants with defects in signal transduction pathways observed in A. nidulans and A. niger (Fillinger et al., Mol. Microbiol. 44(4):1001-16, 2002; Saudohar et al., Microbiol. 148(8):2635-45, 2002; Xue et al., Eukaryot Cell 3(2):557-60, 2004). Deletion of pkaA, cycaA or schA/pkaA in A. nidulans substantially reduces its growth on CM medium plates and spore germination rate in MM liquid culture medium (Fillinger et al., Mol. Microbiol. 44(4):1001-1016, 2002) and similar growth phenotypes were observed in the strains with the deletion of pkaR, pkaC or double deletion of pkaR/pkaC in A. niger (Saudohar et al., Microbiol. 148(8):2635-2645, 2002). However, functional deletion of the MAP kinase SakA in A. fumigatus delays the spore germination in liquid CM, but stimulates spore germination in MM liquid medium (Xue et al., Eukaryot Cell 3(2): 557-560, 2004).
Furthermore, the Alg3 deletion reduced the overall growth on citric acid production (CAP) medium plates at different pHs. In contrast, the Alg3 deletion triggered early spore germination and substantially improved spore germination rate in CAP liquid culture medium. Citric acid production in CAP liquid culture medium was significantly improved in A. niger. When the alg3Δ mutant was complemented with the original alg3 gene at pyrG locus (
It is proposed that inactivation of Alg3 influences the N-glycosylation of those proteins involving in signal transduction pathways. The N-glycosylation consensus sequence (N-glycosite) for N— glycosylation in those proteins from the signal transduction pathways was observed. Most of those proteins contained 1 to 7 N-glycosites, such as, 6 N-glycosites found in sskB (map kinase kinase kinase), 7 in Ste11/SteC, 5 in acyA, 5 in rgsA, 6 in rgsC, 4 in gprA, 4 in pkaC2, 4 in flbA and 3 in Gβ. Comparison of these results with previous studies indicates that the effects of the Alg3 deletion on spore germination and growth may be regulated by altering the N-glycosylation in those proteins involved in signal transduction pathways in A. niger.
When the Alg3Δ strain was grown on CM medium, spore production of Alg3Δ mutants was dramatically reduced as compared to the parent strain, while maintaining a similar level when grown on PDA medium. This phenotype of sporulation production may be influenced by both endogenous and exogenous factors. For example, protein glycosylation was greatly influenced by culture conditions in filamentous fungi, such as fully glycosylated Cel7A only isolated from MM culture medium (Stals et al., Glycobiology 14(8):725-737, 2004). In addition, higher amounts of proteases were secreted by the Alg3Δ strain than the parent in liquid MM culture supplemented 1 g/l yeast extract, which further influenced nutrient uptakes, cellular formation and overall N-glycosylation. This would alter the yield and N-glycosylation in G protein system in A. niger, where G protein signaling is crucial for detection of major environmental stimuli for food acquisition, asexual sporulation, and spore germination (Chang et al., Genetics 167(3):305, 2004; Li et al., Annu. Rev. Microbiol. 61:423-452, 2007).
The spores of parent strain germinated more slowly and had a lower germination rate than the Alg3Δ strain in CAP liquid culture medium, which contains limited nitrogen source (3.1 g/l of NH4NO3), similar to MM. A similar phenotype was observed when the stress activating kinase, a MAP kinase, was deleted in A. fumigatus (SakAΔ strain) and grown in MM liquid culture medium (Xue et al., Eukaryot Cell 3(2): 557-560, 2004). The spore germination of SakAΔ strain was dramatically influenced by nitrogen sources. For example, similar rates of spore germination between parent and SakAΔ strains were observed on MM containing 10 mM NH4Cl or 10 mM Pro, while the spore germination rates of SakAΔ strain was much higher than the parent strain in the MM culture medium containing 10 mM NaNO3, NaNO2, or Phe. In addition, the CAP medium contains high level of glucose and low pH, which contributes additional stresses to A. niger growth. Although the Alg3Δ strain had earlier and higher germination in CAP medium, its biomass formation was less than the parent strain at early stages. The dried biomass yields for both parent and Alg3Δ strains were similar after growth in CAP medium for four and half days. However, more citric acid was produced by the Alg3Δ strain than the parent strain. This indicates more glucose was directly converted to citric acid by influence citric acid metabolism and reduction of glucose consumption for complex N-glycan formation and sequentially for other cellular metabolisms.
This disclosure also provides the first demonstration that genetic inactivation of Alg3, in combination with an increase in expression of the loss of aflR expression A (LaeA) gene, can result in substantial improvement of citric acid production in A. niger. It is proposed that increased expression of LaeA can also improve citric acid production in A. niger or other filamentous fungi. To increase expression of LaeA in fungal cells, a transgene was generated and expressed in A. niger as follows. The LaeA gene of A. nidulans was operably controlled by glyceraldehyde 3-phosphate dehydrogenase (gpdA) promoter and trpC transcriptional terminator (T trpC) of A. nidulans. This chimeric gene was flanked with the upstream of A. niger pyrG gene, the pyrithiamine resistance (ptrA) gene of A. oryzae and the downstream of A. niger pyrG gene. The transgene expression fragment containing the chimeric gene was used to transform the protoplasts of alg3Δ mutants of A. niger.
In summary, the deletion of Alg3, increasing expression of LaeA, or both, can be used to increase citric acid production in fungi (such as filamentous fungi, e.g., A. niger). In addition, deletion of Alg3 alters the overall N-glycosylation and further influences the spore germination, filamentous growth, sporulation and other organic acid production in A. niger.
The present disclosure provides isolated fungi having its Alg3 gene inactivated, wherein such inactivation results in increased citric acid production by the fungi. Such fungi are referred to herein as Alg3Δ fungi. It is disclosed herein that genetic inactivation of Alg3 results in Aspergillus fungi that can increase citric acid production as compared to Aspergillus having a native Alg3 sequence.
Contemplated herein are isolated fungi containing a genetic inactivation of a dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase gene (Alg3). Any fungus can be used, such as any genus or variety of Aspergillus. In particular examples, the disclosed Aspergillus fungus is A. niger, such as Aspergillus niger strain 11414 (American Type Culture Collection (ATCC) No. 11414; NRRL 2270); 1015 (ATCC No. 1015; NRRL 328, CBS 113.46); NRRL 3 (ATCC No. 9029, CBS 120.49, N400); NRRL 3122 (ATCC No. 22343); or 11414KusA-. In other specific examples, the Aspergillus is A. aculeatus, A. awamori, A. carbonarius, A. wentii, A. foetidus, A. oryzae, A. terreus, or A. fumigatus.
In addition, any method for genetic inactivation can be used, as long as the expression of the gene is significantly reduced or eliminated, or the function of the expressed protein is significantly reduced or eliminated. In particular examples, the Alg3 gene is genetically inactivated by complete or partial deletion mutation or by insertional mutation. In some examples genetic inactivation need not be 100% genetic inactivation. In some embodiments, genetic inactivation refers to at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% gene or protein inactivation. The term “reduced” or “decreased” as used herein with respect to a cell and a particular gene or protein activity refers to a lower level of activity than that measured in a comparable cell of the same species. For example, a particular fungi lacking Alg3 activity has reduced Alg3 activity if a comparable fungi not having an Alg3 genetic inactivation has detectable Alg3 activity.
Alg3 sequences are disclosed herein and others are publicly available, for example from GenBank or EMBL. In some examples, the Alg3 gene functionally deleted encodes a protein having at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 2, 4, 31, 32, 33, 34, 35, or 36. In some examples, the Alg3 gene functionally deleted comprises at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 1 or 3 or nucleotides 1186-2582 of SEQ ID NO: 1.
The inactivation of Alg3 results in many phenotypes in the fungi. For example, Alg3Δ mutants can have one or more of the following phenotypes: slower growth on citric acid production (CAP) medium, earlier spore germination in CAP medium (for example germination in at least 3 hours, at least 4 hours, or at least 5 hours after inoculation, such as within 3 hours of inoculation), increased spore germination rate in CAP medium, increased citric acid production in CAP medium, slower growth on complete medium (CM) or potato dextrose (PDA) medium, delay initiation of spore germination in CM or PDA medium, reduced sporulation on CM, or combinations thereof.
Such changes (such as increases or decreases) can be relative to a fungi having a wild-type Alg3 gene, such as a parental strain (e.g., A. niger strain 11414KusA), grown under the same conditions as the Alg3Δ mutant. In some examples, an increased germination rate is germination of at least 20%, at least 25%, or at least 30% of the spores from an Alg3Δ fungus have germinated 8 hours after inoculation in CAP medium (such as 20% to 35%, such as 32%), as compared to no more than 20%, no more than 15%, or no more than 10% (such as 5 to 15%, or 10%) for A. niger strain 11414KusA. In some examples, an increased germination rate is germination of at least 80%, at least 85%, or at least 90% of the spores from an Alg3Δ fungus have germinated 15 hours after inoculation in CAP medium (such as 80% to 95%, such as 90%), as compared to no more than 60%, no more than 65%, or no more than 75% (such as 55 to 65%, or 60%) for A. niger strain 11414KusA. In some examples, increased citric acid production in CAP medium is an increase of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, or at least 70%, by an Alg3Δ fungus as compared to A. niger strain 11414KusA. In some examples, reduced sporulation on complete medium is a reduction of sporulation by at least 20%, at least 30%, at least 40%, at least 50%, or at least 60%, (such as a 40% to 60% reduction) by an Alg3Δ fungus as compared to A. niger strain 11414KusA.
One skilled in the art will appreciate that additional genes can also be inactivated, wherein the additional genes may or may not provide additional enhancement of citric acid production to the fungus. In one example KusA (e.g., GenBank Accession No. EF061656) is also genetically inactivated.
Also provided by the present disclosure are compositions that include isolated Alg3Δ fungi, such as a growth medium. Also provided by the present disclosure are kits that include isolated Alg3Δ fungi, such as a kit that includes a medium for culturing, storing, or growing the fungus. Exemplary mediums include solid medium (such as those containing agar, for example CM, PDA or MM) and liquid media (such as a fermentation broth, such as CM, MM, or CAP medium).
A. Methods of Functionally Deleting Genes
As used herein, an “inactivated” or “functionally deleted” gene means that the gene has been mutated, for example by insertion, deletion, or substitution (or combinations thereof) of one or more nucleotides such that the mutation substantially reduces (and in some cases abolishes) expression or biological activity of the encoded gene product. The mutation can act through affecting transcription or translation of the gene or its mRNA, or the mutation can affect the polypeptide product itself in such a way as to render it substantially inactive.
Genetic inactivation of one or more genes (which in some examples is also referred to as functional deletion) can be performed using any conventional method known in the art. In one example, a strain of Aspergillus is transformed with a vector which has the effect of down-regulating or otherwise inactivating an Alg3 gene. This can be done by mutating control elements such as promoters and the like which control gene expression, by mutating the coding region of the gene so that any protein expressed is substantially inactive, or by deleting the Alg3 gene entirely. For example, an Alg3 gene can be functionally deleted by complete or partial deletion mutation (for example by deleting a portion of the coding region of the gene) or by insertional mutation (for example by inserting a sequence of nucleotides into the coding region of the gene, such as a sequence of about 1-5000 nucleotides). Thus, the disclosure in some examples provides transformed fungi that include at least one exogenous nucleic acid molecule which genetically inactivates an Alg3 gene (such as a nucleic acid sequence encoding SEQ ID NO: 2 or 4). In one example, such a transformed cell produces more citric acid, for example relative to a comparable fungus with a native Alg3 sequence.
In particular examples, an insertional mutation includes introduction of a sequence that is in multiples of three bases (e.g., a sequence of 3, 9, 12, or 15 nucleotides) to reduce the possibility that the insertion will be polar on downstream genes. For example, insertion or deletion of even a single nucleotide that causes a frame shift in the open reading frame, which in turn can cause premature termination of the encoded Alg3 polypeptide or expression of a substantially inactive polypeptide. Mutations can also be generated through insertion of foreign gene sequences, for example the insertion of a gene encoding antibiotic resistance (such as hygromycin or bleomycin).
In one example, genetic inactivation is achieved by deletion of a portion of the coding region of the Alg3 gene. For example, some, most (such as at least 50%) or virtually the entire coding region can be deleted. In particular examples, about 5% to about 100% of the gene is deleted, such as at least 20% of the gene, at least 40% of the gene, at least 75% of the gene, or at least 90% of the Alg3 gene.
Deletion mutants can be constructed using any of a number of techniques known in the art. In one example, allelic exchange is employed to genetically inactivate one or more genes in Aspergillus. A specific example of such a method is described in Example 2 below.
In one example, a strategy using counterselectable markers can be employed which has been utilized to delete genes. For a review, see Reyrat et al. (Infec. Immun. 66:4011-4017, 1998). In this technique, a double selection strategy is employed wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for fungi in which the plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of fungi that have spontaneously eliminated the integrated plasmid. A fraction of these fungi will then contain only the desired deletion with no other foreign DNA present.
In another technique, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). The system includes 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, the targeted gene of interest (e.g., Alg3) can be deleted in the Aspergillus genome and to replace it with a selectable marker (for example a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a mutant containing the desired deletion mutation and one copy of the lox sequence.
In another method, an Alg3 gene sequence in the Aspergillus genome is replaced with a marker gene, such as green fluorescent protein, β-galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for Aspergillus. An expression cassette, containing a promoter active in Aspergillus and the appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into wild-type Aspergillus. Fungi that incorporate and express the marker gene are isolated and examined for the appropriate recombination event (replacement of the wild type Alg3 gene with the marker gene).
Thus, for example, a fungal cell can be engineered to have a disrupted Alg3 gene using common mutagenesis or knock-out technology. (Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Sterns, Cold Spring Harbor Press, 1998; Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97: 6640-5, 2000; and Dai et al., Appl. Environ. Microbiol. 70(4):2474-85, 2004). Alternatively, antisense technology can be used to reduce or eliminate the activity of Alg3. For example, a fungal cell can be engineered to contain a cDNA that encodes an antisense molecule that prevents Alg3 from being translated. The term “antisense molecule” encompasses any nucleic acid molecule or nucleic acid analog (e.g., peptide nucleic acids) that contains a sequence that corresponds to the coding strand of an endogenous Alg3 gene. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus, antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axehead structures, provided the molecule cleaves RNA. Further, gene silencing can be used to reduce the activity of Alg3.
B. Measuring Gene Inactivation
A fungus having an inactivated Alg3 gene can be identified using any method known in the art. For example, PCR and nucleic acid hybridization techniques, such as Northern and Southern analysis, can be used to confirm that a fungus has an inactivated Alg3 gene. Alternatively, real-time reverse transcription PCR (qRT-PCR) can be used for detection and quantification of targeted messenger RNA, such as mRNA of Alg3 gene in the parent and mutant strains as grown at the same culture conditions. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses Alg3 by detecting the expression of the Alg3 peptide encoded by Alg3. For example, an antibody having specificity for Alg3 can be used to determine whether or not a particular fungus contains a functional nucleic acid encoding Alg3 protein. Further, biochemical techniques can be used to determine if a cell contains a particular gene inactivation by detecting a product produced as a result of the expression of the peptide. For example, structural determination of N-glycans excised from glycoproteins can indicate that a fungal cell contains an inactivated Alg3 gene. In addition, measurements of sporulation, germination, secondary metabolite production, and citric acid production can be measured using the methods described herein.
C. Measuring Citric Acid Production
Methods of determining whether a genetic inactivation of Alg3 in Aspergillus increases citric acid production, for example relative to the same strain with a native Alg3 sequence (such as a parental strain), are routine in the art. Although particular examples are disclosed herein, the methods are not limiting.
For example, production of citric acid by Aspergillus (such as an Alg3Δ strain) can be measured using a spectrophotometric assay. In one example citric acid production can be determined with an endpoint spectrophotometric enzyme assay (for example see, Bergmeyer, H. U. 1985. Metabolites 2: tri- and dicarboxylic acids, purines, pyrimidines and derivatives, coenzymes, inorganic compounds, p. 5-10. In Citric acids. VCH Publishers, Weinheim, Germany). Citric acid can also be measured by liquid chromatography (LC) or high-performance liquid chromatography (HPLC) methods.
D. Alg3 Sequences
Alg3 protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, Alg3 sequences can be identified using routine molecular biology methods.
Examples of Alg3 nucleic acid sequences shown in SEQ ID NOS: 1 and 3. However, the disclosure also encompasses variants of SEQ ID NOS: 1 and 3 which retain the ability to encode an Alg3 protein. One skilled in the art will understand that variant Alg3 nucleic acid sequences can be inactivated. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. For example,
Examples of Alg3 protein sequences shown in SEQ ID NOS: 2, 4, 31, 32, 33, 34, 35, and 36. However, the disclosure also encompasses variants SEQ ID NOS: 2, 4, 31, 32, 33, 34, 35, and 36 which retain Alg3 activity. One skilled in the art will understand that variant Alg3 enzyme sequences can be inactivated. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). Such polypeptides share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to an Alg3 sequence, such as SEQ ID NO: 2, 4, 31, 32, 33, 34, 35, or 36.
Variant sequences can be identified, for example by aligning known Alg3 sequences. For example,
In some examples, an Alg3 sequence that is to be genetically inactivated encodes or includes one or more conservative amino acid substitutions. A conservative amino acid substitution is a substitution of one amino acid (such as one found in a native sequence) for another amino acid having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting peptide. In one example, an Alg3 sequence (such as any of SEQ ID NOS: 2, 4, 31, 32, 33, 34, 35, or 36) includes one or more amino acid substitutions (for example at 1, 2, 5 or 10 residues). Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp; Ser for Cys; Asn for Gln; Asp for Glu; Pro for Gly; Asn or Gln for His; Leu or Val for Ile; Ile or Val for Leu; Arg or Gln for Lys; Leu or Ile for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and Ile or Leu for Val. Further information about conservative substitutions can be found in, among other locations in, Ben-Bassat et al., (J. Bacteriol. 169:751-7, 1987), O'Regan et al., (Gene 77:237-51, 1989), Sahin-Toth et al., (Protein Sci. 3:240-7, 1994), Hochuli et al., (Bio/Technology 6:1321-5, 1988), WO 00/67796 (Curd et al.) and in standard textbooks of genetics and molecular biology.
The Alg3 gene inactivated in a fungus, in particular examples, includes a sequence that encodes an Alg3 protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to an Alg3 sequence, such as SEQ ID NO: 2, 4, 31, 32, 33, 34, 35, or 36, wherein the protein can catalyze the addition of the first dol-p-man derived mannose in an α-1,3 linkage to Man5GlcNAc2-PP-Dol. In a specific example, the Alg3 gene inactivated in a fungus encodes an Alg3 protein shown in SEQ ID NO: 2, 4, 31, 32, 33, 34, 35, or 36.
The Alg3 gene that is to be inactivated in a fungus, in particular examples, includes a sequence having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to an Alg3 nucleic acid sequence, such as SEQ ID NO: 1 or 3 or nucleotides 1186-1306, 1393-1916 and 1989-2582 of SEQ ID NO: 1, and encode an Alg3 protein that can catalyze the addition of the first dol-p-man derived mannose in an α-1,3 linkage to Man5GlcNAc2-PP-Dol. In a specific example, the Alg3 gene inactivated in a fungus is shown in SEQ ID NO: 2 or 4.
One skilled in the art will appreciate that additional Alg3 sequences can be identified using any method such as those described herein. For example, Alg3 nucleic acid molecules that encode an Alg3 protein can be identified and obtained using common molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, standard nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known Alg3 sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.
In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes an Alg3 protein. Briefly, any known Alg3 nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is an Alg3 protein.
Any method can be used to introduce an exogenous nucleic acid molecule into a fungal cell, for example to genetically inactivate Alg3. For example, chemical mediated-protoplast transformation, electroporation, Agrobacterium-mediated transformation, fusion of protoplasts, and biolistic delivery are common methods for introducing nucleic acid into fungal cells. (See, e.g., Ito et al., J. Bacterol. 153:163-8, 1983; Durrens et al., Curr. Genet. 18:7-12, 1990; Sambrook et al., Molecular cloning: A laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, third edition, 2001; and Becker and Guarente, Methods in Enzymology 194:182-7, 1991. An exogenous nucleic acid molecule contained within a particular cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state. That is, a cell can be a stable or transient transformant.
The present disclosure provides isolated fungi having increased LaeA expression, wherein such increased expression or activity (for example in combination with an Alg3 functional inactivation, Alg3Δ) results in increased citric acid production by the fungi. Such fungi are referred to herein as increased LaeA fungal strains. It is disclosed herein that increased expression of LaeA (for example in combination with genetic inactivation of Alg3, Alg3Δ) results in Aspergillus fungi that can increase citric acid production as compared to Aspergillus having native LaeA levels of expression.
Contemplated herein are isolated fungi having increased LaeA activity/expression, for example in combination with a genetic inactivation of Alg3. Any fungus can be used, such as any genus or variety of Aspergillus. In particular examples, the Aspergillus fungus is A. niger, such as Aspergillus niger strain 11414 (American Type Culture Collection (ATCC) No. 11414; NRRL 2270); 1015 (ATCC No. 1015; NRRL 328, CBS 113.46); NRRL 3 (ATCC No. 9029, CBS 120.49, N400); NRRL 3122 (ATCC No. 22343); or 11414KusA-. In other specific examples, the Aspergillus is A. aculeatus, A. awamori, A. carbonarius, A. wentii, A. foetidus, A. fumigatus, A. oryzae, or A. terreus.
Any method for genetic enhancement or up-regulation can be used, as long as the expression of the gene and/or gene product is significantly increased, or the function of the expressed protein is significantly increased. In particular examples, LaeA gene expression is up-regulated by transformation of the fungi with one or more copies of a LaeA coding or genomic sequence (which can be a native or non-native LaeA sequence). In some embodiments, up-regulation refers to an increase in gene or protein expression of at least 20%, at least 40%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, or at least 500%, for example relative to the parental fungal strain without the additional copies of an LaeA gene. The term “increased” or “up-regulated” as used herein with respect to a cell and a particular gene or protein activity refers to a higher level of activity than that measured in a comparable cell of the same species. For example, a particular fungi having increased or up-regulated LaeA activity has increased LaeA activity if a comparable fungi having native LaeA activity has less detectable LaeA activity (for example as measured by gene or protein expression).
LaeA sequences are disclosed herein and others are publicly available, for example from GenBank or EMBL. In some examples, the LaeA gene upregulated encodes a protein having at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 41 or 59. In some examples, the LaeA gene upregulated comprises at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 40 (e.g., nt 1-236 and 367-1252 of SEQ ID NO: 41) or 58 (e.g., nt 1-230 and 373-1267 of SEQ ID NO: 58).
Increasing LaeA activity (for example in combination with genetic inactivation of Alg3) results in many phenotypes in the fungi. For example, such recombinant fungi exhibit increased citric acid production in CAP medium. Such increases can be relative to a fungi having a native or wild-type level of LaeA (or LaeA and Alg3) gene or protein expression, such as a parental strain (e.g., A. niger strain 11414KusA), grown under the same conditions as the fungi with increased LaeA activity (or increased LaeA activity and decreased Alg3 activity). In some examples, increased citric acid production in CAP medium is an increase of at least 20%, at least 30%, at least 50%, at least 60%, at least 65%, or at least 70%, by such a recombinant fungus as compared to A. niger strain 11414KusA. In some examples, recombinant fungi with increased LaeA activity (for example in combination with genetic inactivation of Alg3) have increased sporulation relative to A. niger Alg3Δ on MM, accumulate red color pigments to A. niger strain 11414KusA on complete medium, or both.
One skilled in the art will appreciate that additional genes can also be inactivated or upregulated, wherein the additional genes may or may not provide additional enhancement of citric acid production to the fungus. In one example KusA (e.g., GenBank Accession No. EF061656) is also genetically inactivated.
Also provided by the present disclosure are compositions that include isolated LaeA up-regulated fungi, such as a growth medium. Also provided by the present disclosure are kits that include isolated LaeA up-regulated fungi, such as a kit that includes a medium for culturing, storing, or growing the fungus. Exemplary mediums include solid medium (such as those containing agar, for example CM, PDA or MM) and liquid media (such as a fermentation broth, such as CM, MM, or CAP medium).
A. Methods of Up-Regulating Gene and/or Protein Expression
As used herein, an “activated” or “up-regulated” gene means that expression of the gene or gene product (e.g., protein) has been up-regulated, for example by introduction of additional copies of the appropriate gene or coding sequence into the fungus (or other common molecular biology methods), such that the introduce nucleic acid sequence is expressed, resulting in increased expression or biological activity of the encoded gene product.
Increasing expression of one or more genes (which in some examples is also referred to as up-regulation) can be performed using any conventional method known in the art. In one example, a strain of Aspergillus is transformed with a vector which has the effect of up-regulating or otherwise activating a LaeA gene (such as a native or non-native LaeA gene). This can be done by introducing one or more LaeA coding sequences (such as a gene sequence), whose expression is controlled by elements such as promoters and the like which control gene expression, by introducing a nucleic acid sequence which itself (or its encoded protein) can increase LaeA protein activity in the fungus, or by introducing another molecule (such as a protein or antibody) increases LaeA protein activity in the fungus. For example, a LaeA gene can be up-regulated by introduction of a vector that includes one or more LaeA sequences (such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 LaeA sequences or copies of such sequences) into the desired fungus. In some examples, such LaeA sequences are from different fungal species, can be multiple copies from a single species, or combinations thereof, such as LaeA sequences from at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different fungal species. In some examples, the LaeA sequence(s) introduced into the fungus is optimized for codon usage. Thus, the disclosure in some examples provides transformed fungi that include at least one exogenous nucleic acid molecule which includes a LaeA gene or coding sequence (such as a nucleic acid sequence encoding SEQ ID NO: 41 or 59), for example in combination with Alg3Δ. In one example, such transformed cells produce more citric acid, for example relative to a comparable fungus with a native LaeA sequence (or a native LaeA sequence combined with a native Alg3 sequence).
In another technique, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). The system includes 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, the targeted gene of interest (e.g., LaeA) can be deleted in the Aspergillus genome and replaced with one or more copies of a non-native LaeA sequence (for example in A. niger, replacing one or both A. niger LaeA sequences with one or more, or combination of, LaeA sequences from A. nidulans, A. flavus, fusarium oxysperorum, penicillium chrysogenum, which have high secondary metabolite production) flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a fungus containing the desired insertion mutation and one copy of the lox sequence.
In one example, one or more LaeA genes are introduced into fugal cells by chemical mediated proteoplast transformation in combination of yeast-gap repairing method for transgene expression construction.
In one example, a transgene is generated and expressed in the desired fungal cell, such as an Alg3Δ cell, to increase LaeA expression. For example, such a transgene can include a LaeA genomic or cDNA sequence (such as one having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any known LaeA sequence, such as SEQ ID NO: 40 or 58), for example operably linked to a promoter, such as a glyceraldehyde 3-phosphate dehydrogenase (gpdA) promoter or other promoter, such as one that has high activity in CAP culture medium, for example a polyubiquitin promoter, Arsa-7, and A-37 from A. niger. In one example, the promoter has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 37. In one example, the promoter comprises or consists of the sequence shown in SEQ ID NO: 37. In some examples, the transgene further includes pyrG upstream and downstream sequences (for example that are at the 5′- and 3′-end, respectively, of the transgene). The pyrG gene in A. niger is mutated and has lost its original functions. Thus, other non-essential gene loci can be used as long as it is not influenced by the native neighbor genes. In one example, the pyrG upstream and downstream sequences have at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 45 and 48, respectively. In one example, the pyrG upstream and downstream sequences comprise or consist of the sequence shown in SEQ ID NO: 45 or 48, respectively. In some examples, the transgene further includes a trpC transcriptional terminator sequence of A. nidulans, for example downstream of the LaeA sequence. As an alternative to trpC, other transcriptional terminators can be used, such as promoters which include a transcriptional terminators (e.g., ArsA7, Arsa-37, polyubiquitin (ubi4)). In one example, the trpC transcriptional terminator has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 46. In one example, the trpC transcriptional terminator comprises or consists of the sequence shown in SEQ ID NO: 46. In some examples, the transgene further includes a ptrA sequence, for example downstream of the trpC transcriptional terminator sequence. As an alternative to ptrA, the bleomycin gene or bar gene can be used. In one example, the ptrA sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 47. In one example, the ptrA sequence comprises or consists of the sequence shown in SEQ ID NO: 47. In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 44 or 57. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 44 or 57.
Thus, for example, a fungal cell can be engineered to have increased copies of LaeA using common recombinant technology methods.
B. Measuring Gene Activation or Up-Regulation
A fungus having an activated or up-regulated LaeA gene can be identified using any method known in the art. For example, PCR and nucleic acid hybridization techniques, such as Northern, RT-PCR, and Southern analysis, can be used to confirm that a fungus has an up-regulated LaeA gene, such as an increase in the LaeA copy number. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses LaeA by detecting the expression of the LaeA peptide encoded by LaeA. For example, an antibody having specificity for LaeA can be used to determine whether or not a particular fungus has increased LaeA protein expression. Further, biochemical techniques can be used to determine if a cell has increased LaeA expression by detecting a product produced as a result of the expression of the peptide. For example, measurement of secondary metabolites can indicate that a fungal cell contains an up-regulated LaeA gene. In addition, measurements of citric acid production can be measured using the methods described herein.
C. Measuring Citric Acid Production
Methods of determining whether a genetic up-regulation of LaeA (alone or in combination with inactivation of Alg3) in Aspergillus increases citric acid production, for example relative to the same strain with a native LaeA sequence, Alg3 sequence, or both (such as a parental strain), are routine in the art. Although particular examples are disclosed herein (see above and in the examples below), the methods are not limiting.
D. LaeA Sequences
LaeA protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, LaeA sequences can be identified using routine molecular biology methods.
Examples of LaeA nucleic acid sequences shown in SEQ ID NOS: 40 and 58. However, the disclosure also encompasses variants of SEQ ID NOS: 40 and 58 (such as the coding regions nt 1-236 and 367-1252 of SEQ ID NO: 41 and nt 1-230 and 373-1267 of SEQ ID NO: 58) which retain the ability to encode a LaeA protein. One skilled in the art will understand that variant LaeA nucleic acid sequences can be used to increase expression of LaeA. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. Thus, in one example, a LaeA sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any known LaeA sequence, such as SEQ ID NO: 40 or 58 (such as the coding regions nt 1-236 and 367-1252 of SEQ ID NO: 41 and nt 1-230 and 373-1267 of SEQ ID NO: 58) can be expressed in a fungal cell to increase LaeA expression in the fungal cell.
For example,
Such protein molecules can share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any known LaeA nucleic acid sequence, such as SEQ ID NOS: 41 and 59, and such variants can be used to increase LaeA activity in a fungal cell. One skilled in the art will understand that variant LaeA enzyme sequences can be used to increase LaeA activity in a fungal cell. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions).
In some examples, a LaeA sequence whose expression is to be up-regulated encodes or includes one or more conservative amino acid substitutions. A conservative amino acid substitution is a substitution of one amino acid (such as one found in a native sequence) for another amino acid having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting peptide. In one example, a LaeA sequence (such as any of SEQ ID NOS: 41 and 59) includes one or more amino acid substitutions (for example at 1, 2, 5 or 10 residues). Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include those discussed above for Alg3.
The LaeA gene up-regulated in a fungus, in particular examples, includes a sequence that encodes a LaeA protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to an LaeA sequence, such as SEQ ID NO: 41 or 59, wherein the protein can regulate secondary metabolite production in Aspergillus. In a specific example, the LaeA gene up-regulated in a fungus encodes a LaeA protein shown in SEQ ID NO: 41 or 59.
The LaeA gene up-regulated in a fungus, in particular examples, includes a sequence having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to a LaeA nucleic acid sequence, such as SEQ ID NO: 40 or 58 (or to the coding regions nt 1-236 and 367-1252 of SEQ ID NO: 41 or nt 1-230 and 373-1267 of SEQ ID NO: 58), and encodes a LaeA protein which can regulate secondary metabolite production in Aspergillus. In a specific example, the LaeA gene upregulated in a fungus is shown in SEQ ID NO: 40 or 58 (or includes the coding regions nt 1-236 and 367-1252 of SEQ ID NO: 41 or nt 1-230 and 373-1267 of SEQ ID NO: 58).
One skilled in the art will appreciate that additional LaeA sequences can be identified and obtained using any method such as those described herein. For example, LaeA nucleic acid molecules that encode a LaeA protein can be identified and obtained using common molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, standard nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known LaeA sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.
In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a LaeA protein. Briefly, any known LaeA nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is a LaeA protein. The gene specific oligonucleotide pair can also be designed, synthesized and used for real-time RT-PCR to quantify the LaeA gene transcription level.
Any method can be used to introduce an exogenous nucleic acid molecule into a fungal cell, for example to genetically enhance LaeA expression. For example, chemical mediated-protoplast transformation, electroporation, Agrobacterium-mediated transformation, fusion of protoplasts, and biolistic delivery are common methods for introducing nucleic acid into fungal cells. (See, e.g., Ito et al., J. Bacterol. 153:163-8, 1983; Durrens et al., Curr. Genet. 18:7-12, 1990; Sambrook et al., Molecular cloning: A laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, second edition, 1989; and Becker and Guarente, Methods in Enzymology 194:182-7, 1991). An exogenous nucleic acid molecule contained within a particular cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state. That is, a cell can be a stable or transient transformant.
The fungi provided herein, namely Alg3Δ fungi, up-regulated LaeA fungi, and fungi with both Alg3Δ and up-regulated LaeA, can be used to produce citric acid, as well as derivatives thereof such as hydroxycitric acid (for example for medical applications). Such fungi can be from any species, such as Aspergillus or Rhizopus cells. For example, the disclosure provides methods of making citric acid, which can include culturing Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, under conditions that permit the fungus to make citric acid, for example in CAP medium.
Citric acid (2-hydroxy-propane-1,2,3-tricarboxylic acid) combines a pleasant taste with low toxicity and palatability and is a ubiquitous food additive. It is also able to complex heavy metal ions, like iron and copper, and is therefore applied in the stabilization of oils and fats or ascorbinic acid during metal ion-catalyzed oxidation reactions. Consequently, it is today one of the bulk products produced by fermentation, most of which occurs with the fungus Aspergillus niger, although a small portion is also produced by fermentation with yeast, such as Candida oleophila and Candida lipolytica.
Citric acid production generally requires a unique combination of several unusual nutrient conditions (e.g., excessive concentrations of carbon source, and dissolved oxygen, or suboptimal concentrations of certain trace metals and phosphate), which synergistically influence the yield of citric acid. Table 1 below shows the environmental parameters that influence citric acid accumulation.
Methods of making citric acid, which can include culturing Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, under conditions that permit the fungus to make citric acid, are provided. In general, the culture media and/or culture conditions can be such that the fungi grow to an adequate density and produce citric acid efficiently. In one example the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, are cultured or grown in a liquid medium that includes sucrose and/or glucose as the carbon source, for example at a concentration of at least 50 g/liter, such as at least 100 g/l, or at least 140 g/l. Thus, a fungus within the scope of the disclosure in some examples can utilize a variety of carbon sources. In one example the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, are cultured or grown in a liquid medium that includes a very small amount of manganese, such as less than 100 parts per billion (ppb), less than 50 ppb, less than 20 ppb, less than 15 ppb, for example 5 ppb to 15 ppb or 10 ppb to 15 ppb, such as 5, 10, 13, 15 or 20 ppb. In one example the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, are cultured or grown in a liquid medium having an initial pH of less than 3, such as less than 2.5, for example about pH 1.8 to 3, 1.8 to 2.5, 1.8 to 2.2, 1.9 to 2.1, for example pH 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8 or 2.9. In some examples the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, are cultured or grown in a liquid medium at about 25 to 35° C. with rotation (such as 28 to 32° C., or 30° C.).
In a specific example, the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, are grown in citric acid production (CAP) medium. In a specific example, the CAP medium includes 140 g of glucose/liter, 3.1 g of NH4NO3/liter, 0.15 g of KH2PO4/liter, 0.15 g of NaCl/liter, 2.2 g of MgSO4 7H2O/liter, 6.6 mg of ZnSO4 7H2O/liter, and 0.1 mg of FeCl3/liter adjusted to about pH 2 with 4 M H2SO4. Cations can be removed from the glucose solution by ion exchange on Dowex 50W-X8, 100/200-mesh, H cation exchange resin (Fisher Scientific, Pittsburgh, Pa.) prior to adding the other nutrient components. The manganese concentration in the medium can be adjusted by the addition of appropriate volumes of a stock solution of MnCl2 4H2O (10 mM). In one example, the manganese concentration is less than 50 ppb, such as less than 20 ppb, for example 5 to 15 ppb, such as 10 ppb.
Methods of culturing Aspergillus to enable citric acid production are well known in the art. In one example, the fungi are grown in culture containers (such as baffled flasks, and in some examples are silanized (5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.)). The Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, provided herein can be grown in CAP media containing low amounts of Mn2+ (e.g., 10 ppb) at 30° C. with rotation (e.g., 200 to 250 rpm) for at least 3 days (e.g., 3 to 7 days). Each culture container is inoculated with spores (such as at least 106 spores/ml) and incubated for at least 12 or at least 15 hours at 30° C. and 200 to 250 rpm to obtain properly pelleted morphology.
In one example, the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, produce more citric acid than a corresponding fungus with wild-type Alg3. In specific examples, the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA, produce at least 25 g/l of citric acid (for example at least 30 g/l, at least 32 g/l, at least 35 g/l, at least 40 g/l, at least 42 g/l, at least 45 g/l, at least 50 g/l, at least 52 g/l or at least 55 g/l), for example after at least 4 days (such as at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days) when grown in CAP medium at 30° C. with 200 rpm shaking.
In some examples, the method further includes isolating the citric acid made by the Alg3Δ fungi, up-regulated LaeA fungi, or fungi with both Alg3Δ and up-regulated LaeA. Once produced, any method can be used to isolate the citric acid. For example, common separation techniques can be used to remove the fungal biomass from the culture medium, and common isolation procedures (e.g., filtration, distillation, precipitation, electrodialysis, and ion-exchange procedures) can be used to obtain the citric acid from the broth (such as a fungi-free broth). In addition, the citric acid can be isolated from the culture medium after the citric acid production phase has been terminated.
This example describes methods used in the experiments described in Examples 2-5 below.
Strains and Media.
The Escherichia coli strains Top 10 and Saccharomyces cerevisiae strain YVH10 were used as hosts for routine cloning and gap repair experiments. A. niger strain ATCC 11414 (American Type Culture Collection, Rockville, Md.), was grown on potato dextrose agar plates (PDA) and complete medium (CM) agar plates at 30° C. for culture maintenance and spore preparation, respectively. The mutant strain Aspergillus niger 11414KusA was generated by the deletion of kusA in A. niger strain 11414 by the replacement with A. fumigatus pyrG gene, which encodes the ortholog of the ku70 protein that involves in the non-homologous end joining pathway of DNA repair for the integration of a DNA fragment into the genome in other eukaryotes, and was confirmed by Southern blotting analysis. The 11414kusA strain with high rate of homologous replacement was mainly used as a parent strain. The cultures on PDA or complete medium (CM) agar plates were incubated for four days at 30° C. and the spores were harvested by washing with sterile 0.8% Tween 80 (polyoxyethylenesorbitan monooleate). The CM medium contains 20 g of D-glucose/liter, 5 g yeast extract/liter, 2 g trypticase peptone/liter, 1 g casamino acids/liter, 6 g NaNO3/liter, 0.52 g KCl/liter, 0.52 g MgSO4.7H2O/liter, 1.52 g KH2PO4/liter, 36.7 mg ZnSO4.7H2O/liter, 18.3 mg H3BO3/liter, 8.3 mg MnCl2.4H2O/liter, 8.3 mg FeSO47H2O, 2.8 mg CoCl2.6H2O/liter, 2.7 mg CuSO4.5H2O/liter, 2.5 mg Na2MoO4.2H2O/liter, 83.3 mg Na2EDTA/liter, 1 mg biotin/liter, 1 mg pyridoxin/liter, 1 mg thiamine/liter, 1 mg riboflavin/liter, 1 mg p-aminobenzoic acid/liter and 1 mg nicotinic acid/liter. The PDA medium contains 4 g/liter potato starch and 20 g/liter dextrose. Conidia were enumerated with a hemacytometer. Aliquots of the resulting spore suspension (1×109 spores/ml) were used to inoculate baffled-flask liquid cultures. The citric acid production (CAP) medium contained 140 g/l of glucose, 3.1 g/l NH4NO3, 0.15 g/l KH2PO4, 0.15 g/l NaCl, 2.2 g/l MgSO4.7H2O, 6.6 mg/l ZnSO4.7H2O, and 0.1 mg/l FeCl3 adjusted to pH 2.1 with 4 M H2SO4. Cations were removed from the glucose solution by ion-exchange on Dowex 50W-X8, 100-200 mesh, H cation exchange resin (Fisher Scientific, Pittsburgh, Pa.) prior to adding the other nutrient components.
Culture Methods.
Glass baffled-flasks of 250 ml or 1000 ml were silanized by rinsing in a 5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.) to minimize leaching of metals. For citric acid production tests, 1×10A6 spores/ml of parent or mutant strains were grown in 80 ml CAP media containing 10 ppb Mn2+ in 250 ml baffled flasks or 220 ml CAP media in 1000 ml baffled flasks at 30° C. and 200 rpm. Samples for citric acid analysis were taken at intervals. The biomass of transgenic clones and parent stain were prepared from 2 ml CM station cultures with proper antibiotics and grown in 16×125 mm glass culture-tubes at 30° C. without shaking The biomass formed on the surface of the culture medium was collected, frozen immediately in liquid nitrogen and dried in the lyophilizer.
Dried Biomass Measurement:
After proper cultivation, the cell mass from citric acid production culture was collected by centrifugation at room temperature and 4500×g for 5 min in Sorvall floor centrifuge with swinging-bucket rotor. The cell mass was then transferred onto the Whatman Grade No 1 filter paper or left in centrifuge tubes for freeze-drying. The biomass was then dried in high temperature oven at 80° C. or freeze-dried in the lyophilizer. Prior to being used, the centrifuge tube or Whatman filter paper was weighted and re-weighted after the biomass was completely dried.
Total Genomic DNA Isolation for PCR and Southern Blotting Analysis.
Total genomic DNA was isolated from A. niger according to the SDS extraction method described previously by Dellaporta et al. (Plant Molecular Biology Reporter 1(4):19-21, 1983) with some modifications. Briefly, fungal biomass from 2 ml station cultures was looped and transferred into a 1.5 ml microcentrifuge tube. A needle size hole on the cap was punched with 18 gauge needle. The tube was immediately frozen in liquid N2 for 5 minutes and biomass in the tube was dried in a VirTis benchtop manifold freeze dryer (SP Scientific, Gardiner, N.Y.) overnight. The dried biomass and two 3.5 mm diameter glass beads were transferred into the 2 ml polypropylene microvial, where biomass was pulverized into fine power with Mini-Beadbeater-8 (Bio Spec Products Inc., Bartlesville, Okla.) for one minute. Then, 500 μl of 60° C. extraction buffer and 80 μl of 15% SDS were added into the microcentrifuge tube and incubated at 65° C. for at least 30 minutes with occasionally swirling to mix. Two-hundred microliters of 5M potassium acetate was added, mixed and incubated on ice for 30 minutes. The supernatant was collected by centrifugation at 12,000 g for 10 minutes at 4° C. and transferred into the new microcentrifuge tube. The total nucleic acids were precipitated with 780 μl of 2-propanol for 30 minutes at −20° C. and centrifuged at 12,000 g for 10 minutes. The nucleic acids were re-suspended in 200 μl 50TE buffer containing 2 RNase (10 stock solution) and incubated in Eppendorf thermomixer at 50° C. and 500 rpm for 30 minutes. The proteins and cell debris was removed by being added and well mixed 20 μl 3M sodium acetate and equal volume of phenol:chloroform and centrifuged at 15,000 g for 5 minutes. The supernatant was transferred to new DNase-free microcentrifuge tube containing 220 μl of 2-propanol, mixed well and incubated at room temperature for 5 minutes. The genomic DNA was pelleted by centrifugation at 15,000 g for 10 minutes and washed with 500 μl of 70% ethanol. The genomic DNA was re-suspended in 80 μl 10 mM TrisHCl (pH8.0) buffer and determined with Qubit fluorometer (Invitrogen, Carisbad, Calif.). One microgram of total genomic DNA was digested with restriction endonuclease BamH and SacII. The genomic DNA fragments were separated in 1% agarose gel electrophoretically and transferred onto the zeta-probe membrane (BioRad) with alkaline capillary transfer method. A 3.8 kb genomic DNA fragment containing the Alg3 sequence was used for preparation of the biotin-labeled probe. The genomic DNA in Zeta-probe membrane was hybridized with the biotin-labeled probe overnight in 60° C. hybridization oven. The genomic DNA on hybridized membrane was visualized with North2South chemiluminescent detection kit (Pierce Protein Research Products, Rockford, Ill.).
Spore Production and Germination.
The spore production on the PDA or CM agar plates described above was excised with plastic closures of culture tubes in 27 mm diameter and transferred into the 50 ml centrifuge tubes containing 25 ml 0.8% tween 80. The spores were released from the agar surface by scraping with plastic loops and vortexed with vortex mixer at top speed. The spores were diluted properly and enumerated with a hemacytometer. The spore production in a unit area (cm2) was determined. For spore germination, 1×105 spores per well were added into each well of 24 well Schwarz sensoplate and incubated in the microscopic incubator with temperature control at 30° C. The spore germination was automatically imaged hourly for 24 hrs through the Olympus inverted system microscope (Olympus America Inc., Center Valley, Pa., USA). The spore germination was visualized with Adobe Photoshop CSS (San Jose, Calif.) and counted manually.
Citric Acid Measurements.
Citric acid concentrations were determined with an end-point spectrophotometric enzyme assay as described in the instruction from the manufacturer (R-Biopharm AG/Roche, Darmstadt, Germany) with a proper dilution.
Table 2 shows oligonucleotides used in the methods.
TCCAACCTTGTAGCAACCAAAGCTTCGAGCGTCCCAAAACCT
AGGTTTTGGGACGCTCGAAGCTTTGGTTGCTACAAGGTTGGA
TCAGATACTATTTGCTGTGCTCTACTTGA
(SEQ ID NO: 23)
TGGTATCGATGACCACGTAGGAtggtgtggcacaaggatcaa
This example describes methods used to genetically clone and then inactivate Alg3 in A. niger strain 11414KusA. Based on these teachings, one skilled in the art will appreciate that Alg3 can be similarly inactivated in other strains of Aspergillus.
Alg3 has been identified and characterized in Arabidopsis thaliana, Homo sapiens, Pichia pastoris, Trypanosoma brucei and Saccharomyces cerevisiae (see for example Korner et al., EMBO J. 18(23): 6816-6822, 1999; Davidson et al., Glycobiology 14(5):399-407, 2004; Manthri et al., Glycobiology 18(5): 367-383, 2008; Kajiura et al., Glycobiology 20(6):736-751, 2010). A database search based on the amino acid sequence of S. cerevisiae Alg3 identified a putative α-1,3-mannosyltransferase gene in JGI (DOE Joint Genome Institute)-A. niger genome database (jgi|Aspni5|42720). The A. niger Alg3 gene contains two introns and its 1400 by open reading frame (nt 1186-1306, 1393-1916 and 1989-2582 of SEQ ID NO: 1) encodes a protein consisting of 413 amino acids (SEQ ID NO: 2), which contains one potential N-glycosite at the amino acid position 374. The predicted Alg3 amino acid sequence has 39% sequence identity to the S. cerevisiae Alg3.
Alg3 was functionally inactivated in A. niger using a gene deletion vector constructed by yeast gap repairing approach. The 5′- and 3′-end of the hygromycin marker (hph) gene was flanked with about 1 kb upstream and downstream fragments of Alg3 coding region that were isolated by PCR from A. niger genomic DNA. The DNA sequence of the upstream and downstream fragments was confirmed by DNA sequencing analysis. The Alg3 in A. niger was deleted by homologous replacement with hygromycin marker (hph) gene in the kusA deletion background of A. niger, where the kusA gene, encoding the ortholog of the Ku70 protein in other eukaryotes, was deleted for dramatically improved homologous integration efficiency.
This example describes methods used to determine the effect genetically inactivating Alg3 in A. niger.
It was previously demonstrated that the deletion of Alg3 in different organisms causes underglycosylation, but no obvious phenotype changes were observed at the selected culture condition in those studies (Aebi et al., Glycobiology 6(4):439-444, 1996; Korner et al., EMBO J. 18(23): 6816-6822, 1999; Davidson et al., Glycobiology 14(5):399-407, 2004; Manthri et al., Glycobiology 18(5): 367-383, 2008; Kajiura et al., Glycobiology 20(6):736-751, 2010).
The effects of the Alg3 deletion were examined on CM, PDA and MM plates. As exhibited in
The effects of Alg3 deletion on spore production on both CM and PDA plates were also examined. The Alg3 deletion had a substantial reduction of sporulation on CM medium plate, while no obvious difference was exhibited on PDA plate (
This example describes methods used to measure spore germination, growth, and citric acid production in the Alg3Δ A. niger strain generated in Example 1. Based on these teachings, one skilled in the art will appreciate that spore germination, growth, and citric acid production can be similarly measured in other Alg3Δ strains of Aspergillus.
A. niger strain ATCC11414 is a strain developed for industrial production of citric acid. A. niger morphology plays a role in citric acid production. The fungal morphology affect overall molecular regulation in response to the endogenous and exogenous factors, which include the regulations of transcription, post-transcription, translation and post-translation. Therefore, the effects of Alg3 deletion on A. niger growth on CAP agar plates at different pHs or in CAP liquid culture conditions was determined.
The spore germination of the Alg3Δ and parent strains in CAP liquid culture medium was also examined by using automated microscopic imaging, enumerating the germination manually in a same visual unit area, and expressing spore germination as a percentage of total spores at the same visual unit area.
The effect of Alg3 deletion on citric acid production was determined in CAP flask cultures.
The effect of Alg3 deletion on citric acid production was also examined by complementation of its original gene into the alg3Δ mutant.
This example describes methods used to generate the pPTRpGPDALaeA plasmid vector (
The Aspergillus nidulans glyceraldehyde 3-phosphate dehydrogenase (gpdA) promoter (SEQ ID NO: 37) was isolated from the pAN8-1 plasmid DNA using the primer set gpdA5F/gpdA3R (gpdA5F: CGCAGATCTC AAGCTGTAAG GATTTCGGCA SEQ ID NO: 38; gpdA3R: CACCGGGCCC ATCTCAAACA TTGTGATGTC TGCTCAAGCG SEQ ID NO: 39) and the LaeA coding sequence of genomic DNA from A. nidulans (SEQ ID NO: 40) obtained by PCR using LaeA5F/LaeA3R (LaeA5F: CGCTTGAGCA GACATCACAA TGTTTGAGAT GGGCCCGGTG; SEQ ID NO: 42; LaeA3R: CGCAGATCTG AGGATTATGA GAAGGGAGC; SEQ ID NO: 43).
The DNA fragment of pGPDA and LaeA was filled together by overlap PCR and a HindIII restriction enzyme site was introduced at both 5′- and 3′-end of the DNA fragment. The DNA fragment (SEQ ID NO: 44) and pPTR1 plasmid DNA were cut with Hind III and ligated together by a quick DNA ligation kit at 25° C. for 30 min. The ligated plasmid DNA was transferred into the Top 10 E. coli competent cells by lithium acetate mediated transformation. The transformed bacterial colonies were screened for the DNA fragment insertion by PCR with the primers gpdA5F (SEQ ID NO: 38) and LaeA3R (SEQ ID NO: 43). The plasmid DNA for the selected transformed colonies was prepared for restriction enzyme confirmation and further expression vector construction.
This example describes methods used to generate a transgene containing A. niger LaeA (
PCR was performed to isolate DNA fragments of A. niger pyrG upstream region (SEQ ID NO: 45), trpC transcriptional terminator of A. nidulans (SEQ ID NO: 46), pyrithiamine resistance gene (ptrA) of Aspergillus oryzae (SEQ ID NO: 47), and A. niger pyrG downstream region (SEQ ID NO: 48), using primers pyrGU5F/PTRU3R (pyrGU5F: GTAACGCCAG GGTTTTCCCA GTCACGACGT TTAAACATGC ATCATTCTCC CGCTTTGT, SEQ ID NO: 49; pyrGU3R: TGCCGAAATC CTTACAGCTT GAAGCTTCAT CGCCAATCAC CTCAATCAC, SEQ ID NO: 50), Trp5F/Trp3R (Trp5F: AGCTCCCTTC TCATAATCCT CAAGCTTGGA CCGATGGCTG TGTAGAAGT, SEQ ID NO: 51; Trp3R: CGTAATCAAT TGCCCGTCTG TCAGAGAGCG GATTCCTCAG TCTCGT; SEQ ID NO: 52), PTR5F/PTR3R (PTR5F: ACGAGACTGA GGAATCCGCT CTCTGACAGA CGGGCAATTG ATTACG, SEQ ID NO: 53; PTR3R: ACAGCAGTGC TTATCTGCGA TGACGAGCCG CTCTTGCATC TTTGT, SEQ ID NO: 54) and PyrGD5F/PTRD3R (pyrGD5F: ACAAAGATGC AAGAGCGGCT CGTCATCGCA GATAAGCACT GCTGT; SEQ ID NO: 55, pyrGD3R: TGAGACGCTG TTTCACCGAG TACATCGCCA ATCACCTCAA TCAC, SEQ ID NO: 56), respectively.
As shown in
The transformed plasmid DNA was confirmed by PCR and digested with PmeI. The PmeI DNA fragment (SEQ ID NO: 57) was used for A. niger transformation.
One skilled in the art will appreciate that although the pyrG upstream and downstream sequences, trpC transcriptional terminator sequence, and ptrA sequence used were from particular organisms, one skilled in the art will appreciate that variants of these sequences can be used in the fungi and methods provided herein, such as those from other Aspergillus species. In one example, pyrG upstream and downstream sequences having at least 80%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 45 and 48 are used in the fungi and methods provided herein. In one example, a trpC transcriptional terminator sequence having at least 80%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 46 is used in the fungi and methods provided herein. In one example, a ptrA sequence having at least 80%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 47 is used in the fungi and methods provided herein.
This example describes methods used to introduce pGPDALaeA (SEQ ID NO: 57) into A. niger.
The originally transformed A. niger colonies were picked from the minimal medium plates with 0.1 μg/ml pyrithiamine hydrobromide selection on minimal medium agar plates without thiamine supplementation. The single spore colonies were picked for spore production after the initial transformant spores were grown on the same selection medium plates. The biomass was harvested from the single spore colony isolates grown in minimal medium with pyrithiamine selection and dried in the VirTis bench top freeze dryer. The genomic DNA was prepared for PCR confirmation of pGDPALaeA insertion in transgenic A. niger. As shown in
This example describes methods used to demonstrate that citric acid production was increased in the presence of increased expression of LaeA, alone or in combination with deletion of Alg3.
Citric acid was produced as described in Example 1.
As shown in
In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only examples of the disclosure and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
This application claims priority to U.S. Provisional Application No. 61/565,018 filed Nov. 30, 2011, herein incorporated by reference.
| Number | Date | Country | |
|---|---|---|---|
| 61565018 | Nov 2011 | US |
