Patent Application
20200002766
The disclosure relates to methods, systems and kits for sequencing immune cell receptor repertoires from immune cells, such as T-cells or B-cells.
Immune cell repertoires, such as B- or T-cell repertoires, consists of millions of lymphocytes, each expressing a different protein complex that enables specific recognition of a single antigen. CD4 and CD8 positive T-cells express so-called T-cell receptors (TCRs). These heterodimeric receptors recognize antigen-derived peptides displayed by major histocompatibility complex (MHC) molecules on the surface of antigen presenting cells, as described in Rudolph M G, Stanfield R L, Wilson I A. How TCRs bind MHCs, peptides, and coreceptors. Annu Rev Immunol. 2006; 24:419-66. TCRs are composed of two subunits, most commonly of one α and one β chain. A less common type of TCR contains one γ and one δ chain.
Alpha (a) chains consists of a (variable) V, a joining (J) and a constant (C) region, while beta (β) chains contain an additional diversity (D) region between the V and the J region (see
Similarly to the TCR αβ, TCR gamma (γ) and delta (δ) segments undergo V(D)J rearrangement during thymus development. Both loci are recombined in the double negative (DN) stage of T-cell development. Differentiation towards γδ or αβ lineage relies on the ability of the cell to produce functional γδ or αβ TCR. The δ locus is embedded within the α locus. Dδ, Jδ and Cδ segments are located in between the V and the J segment of the α locus. The Vδ segments are the same as the Vα segments but only a fraction of the Vα segments are used for the TCR δ chain.
Overall, V(D)J recombination is able to generate millions of different TCR sequences and plays a critical role in an organism's ability to eliminate infections or transformed cells. Not surprisingly, TCR repertoires affect a wide range of diseases, including malignancy, autoimmune disorders and infectious diseases. TCR sequencing has been instrumental for our understanding of how the TCR repertoire evolves during infection or following treatment (e.g. after hematopoietic stem cell transplantation, chronical viral infection, immunotherapy). Further, the identification of TCRs on tumor-infiltrating lymphocytes and other T-cells that target cancer-specific epitopes has not only furthered our knowledge of malignant disease, but has also led to novel therapies for cancer such as adoptive T-cell transfer or cancer vaccines.
Due to the large diversity of sequences, determining TCR repertoires has been challenging in praxis. In the last couple of years, next generation sequencing (NGS) has opened up new opportunities to comprehensively assess the extreme diversity of TCR repertoires, as described in Genolet R, Stevenson B J, Farinelli L, Osteras M, Luescher I F. Highly diverse TCRα chain repertoire of pre-immune CD8+ T cells reveals new insights in gene recombination. EMBO J. 2012 Apr. 4; 31(7):1666-78; Robins H S, Campregher P V, Srivastava S K, Wacher A, Turtle C J, Kahsai O, Riddell S R, Warren E H, Carlson C S. Comprehensive assessment of T-cell receptor beta-chain diversity in alpha beta T cells. Blood. 2009 Nov. 5; 114(19):4099-107; Linnemann C, Heemskerk B, Kvistborg P, Kluin R J, Bolotin D A, Chen X, Bresser K, Nieuwland M, Schotte R, Michels S, Gomez-Eerland R, Jahn L, Hombrink P, Legrand N, Shu C J, Mamedov I Z, Velds A, Blank C U, Haanen J B, Turchaninova M A, Kerkhoven R M, Spits H, Hadrup S R, Heemskerk M H, Blankenstein T, Chudakov D M, Bendle G M, Schumacher T N. High-throughput identification of antigen-specific TCRs by TCR gene capture. Nat Med. 2013 November; 19(11):1534-41; Turchaninova M A, Britanova O V, Bolotin D A, Shugay M, Putintseva E V, Staroverov D B, Sharonov G, Shcherbo D, Zvyagin I V, Mamedov I Z, Linnemann C, Schumacher T N, Chudakov D M. Pairing of T-cell receptor chains via emulsion PCR. Eur J Immunol. 2013 September; 43(9):2507-15.
Since most current TCR sequencing techniques require enrichment of TCR genes for sequencing, the majority of methods include an amplification step, in which the nucleic acids encoding the individual TCRs are amplified. Therefore, one of the challenges of the TCR sequencing relates to the ability of the technology to maintain the proportion of each TCR during the amplification. Thus, the ways in which TCR libraries are prepared have a strong impact on the quality and the reliability of the obtained sequencing results and on the conclusions than can be drawn from the data. Several approaches have been used to amplify and sequence TCR repertoires in the past, each method with its own set of issues.
One frequently employed method for TCR sequencing is based on a multiplex PCR step, in which all the primers for the V and the J segments are mixed together to amplify all the possible V(D)J rearrangements/combinations, as described in Robins H S, Campregher P V, Srivastava S K, Wacher A, Turtle C J, Kahsai O, Riddell S R, Warren E H, Carlson C S. Comprehensive assessment of T-cell receptor beta-chain diversity in alpha beta T cells. Blood. 2009 Nov. 5; 114(19):4099-107. The main drawback of this technology is that the amplification is not quantitative: Because the efficiency of each primer pair varies, some TCR sequences are preferentially represented in the library.
Another TCR sequencing method uses a process called “DNA gene capture” to isolate TCR encoding DNA fragments, as described in Linnemann C, Heemskerk B, Kvistborg P, Kluin R J, Bolotin D A, Chen X, Bresser K, Nieuwland M, Schotte R, Michels S, Gomez-Eerland R, Jahn L, Hombrink P, Legrand N, Shu C J, Mamedov I Z, Velds A, Blank C U, Haanen J B, Turchaninova M A, Kerkhoven R M, Spits H, Hadrup S R, Heemskerk M H, Blankenstein T, Chudakov D M, Bendle G M, Schumacher T N. High-throughput identification of antigen-specific TCRs by TCR gene capture. Nat Med. 2013 November; 19(11):1534-41. However, since this method uses DNA rather than RNA, this method will also isolate V and J segments that have not yet undergone somatic rearrangement. As a consequence, many of the obtained sequencing data are uninformative for TCR gene identification as they do not contain the V(D)J region of rearranged TCR gene locus. Furthermore, using DNA instead of RNA for the TCR gene analysis may overestimate the diversity of the TCR repertoire as only one of the two β chains is expressed by the T-cells while the other gene is silenced (allelic exclusion).
A third method of TCR amplification is based on the 5′-Race PCR technology (SMARTer® Human TCR a/b Profiling Kit, Takara-Clontech). In this method, a nucleic acid adapter is added to the 5′-end of the cDNA during the reverse transcription step. As a result, TCR products can be subsequently amplified with a single primer pair, with one primer binding to the adapter at the 5′-end of the cDNA and the second primer binding to the constant region near the 3′-end of the cDNA. One of the disadvantages of this technique is that the amplification step will generate PCR fragments ranging between 500 and 600 bp. As the length of the V segment exceeds 400 bp it is actually not possible to sequence the V(D)J junction starting from the 5′end using Illumina® sequencing technology, which can generate sequencing reads of up to 300 bp only. Sequencing of the V/J junction is thus usually performed from the constant region, crossing the J segment, the CDR3 region and part of the V segment. However, sequencing errors increase with the length of the sequencing read, and are thus most frequently introduced in the V segments—the region most challenging to correctly assign due to the high homology between different V segments. Consequently, sequencing starting from the constant region may lead to a reduction in the number of V segments that can be identified unambiguously. While this caveat can be avoided by paired-end sequencing, such modification of the protocol will significantly increase the duration and cost associated with this method.
With each of the current methods exhibiting significant shortcomings, there is thus a considerable need for a TCR sequencing technology that provides TCR repertoire data with high sensitivity and reliability.
Disclosed herein are methods and kits for sequencing of T-cell receptor repertoires and other immune cell repertoires, such as B-cell repertoires, with high sensitivity and reliability. In one embodiment, the methods include the steps of (1) providing RNA from T-cells, (2) transcribing RNA into complimentary RNA (cRNA), (3) reverse transcribing the cRNA into cDNA while introducing a common adapter to the 5′ end of the cDNA products, (4) amplifying the cDNA using a single primer pair, (5) further amplifying with PCR products with a single primer pair which introduces adapters for next generation sequencing, wherein the first primer binds to the common adapter region, and wherein the second primer binds to the constant region of the TCR gene, and (6) sequencing the PCR products. In one embodiment, the methods include the steps of (1) providing RNA from T-cells, (2) reverse transcribing the RNA into cDNA, (3) generating second strand cDNA while introducing a common adapter to the 5′ end of the cDNA products, (4) amplifying the cDNA using a single primer pair, (5) further amplifying with PCR products with a single primer pair which introduces adapters for next generation sequencing, wherein the first primer binds to the common adapter region, and wherein the second primer binds to the constant region of the TCR gene, and (6) sequencing the PCR products. These embodiments are also called SEQTR method (Sequencing T-cell Receptors). Also provided are kits containing primer mixtures for the sequencing of T-cell receptor repertoires. Similar methods and kits for sequencing of B-cell receptor repertoires are provided.
According to one aspect, methods for sequencing immune cell receptor genes are provided. The methods include (1) providing RNA from immune cells; 2)(a) optionally transcribing the RNA into complementary RNA (cRNA), followed by reverse transcribing the cRNA into complementary DNA (cDNA) using one or more primers that comprise a first adapter sequence, wherein each 5′ end of the cDNA produced by reverse transcription contains the first adapter sequence; (2)(b) if step (2)(a) is not performed, reverse transcribing the RNA into complementary DNA (cDNA), followed by transcribing the cDNA into second strand cDNA using one or more primers that comprise a first adapter sequence, wherein each 5′ end of the cDNA produced by transcribing the cDNA into second strand cDNA contains the first adapter sequence; (3) amplifying the cDNA to produce a first amplification product using a first primer pair comprising a first primer that hybridizes to the first adapter sequence and a second primer that hybridizes to a constant region of immune cell receptor gene; (4) amplifying the first amplification product to produce a second amplification product using a second primer pair, in which (i) a first primer of the second primer pair binds to the adapter sequence at the 5′ end of the second amplification product, (ii) the second primer of the second primer pair binds to the constant region of immune cell receptor gene in the second amplification product, and (iii) the first and second primers comprise adapter sequences for sequencing; and (5) sequencing the second amplification product.
In some embodiments, the reverse transcription step results in PCR products ranging from 150-600 bp. In some embodiments, the immune cell receptor genes are T-cell receptor (TCR) genes or B-cell receptor (BCR) genes.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to TCR α chain V segments. In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) comprise one or more of SEQ ID NOs: 1-50 or SEQ ID NOs: 261-310.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to TCR β chain V segments. In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) comprise one or more of SEQ ID NOs: 51-100 or SEQ ID NOs: 311-360.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to TCR γ chain V segments.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to TCR δ chain V segments.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to BCR heavy chain V segments.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) hybridize to BCR light chain V segments.
In some embodiments, the one or more primers used for reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) contain a nucleotide barcode sequence. In some embodiments, the nucleotide barcode comprises 6 to 20 nucleotides. In some embodiments, the nucleotide barcode consists of 9 nucleotides. In some embodiments, the nucleotide barcode consists of the sequence NNNNTNNNN, NNNNANNNN or HHHHHNNNN.
In some embodiments, the first adapter sequence of the one or more primers used for the reverse transcription (step (2)(a)) or second strand cDNA synthesis (step (2)(b)) comprises a T7 adapter or an Illumina® adapter.
In some embodiments, the immune cells are T-cells and wherein the second primer of the first pair of primers hybridizes to the constant region of a TCR gene.
In some embodiments, the immune cells are B-cells and wherein the second primer of the first pair of primers hybridizes to the constant region of a BCR gene.
In some embodiments, the sequencing is next generation sequencing.
In some embodiments, the RNA from the immune cells is obtained by mixing immune cells with carrier cells before RNA extraction.
In some embodiments, the immune cells are tumor-infiltrating lymphocytes.
In some embodiments, the immune cells are CD4 or CD8 positive T-cells.
In some embodiments, the immune cells are purified from peripheral blood mononuclear cells (PBMC) before RNA extraction.
In some embodiments, the immune cells are part of a mixture of PBMC.
In some embodiments, the immune cells are derived from a mammal. In some embodiments, the mammal is a human or a mouse.
According to another aspect, kits for sequencing of T-cell receptors are provided. The kits include at least one primer which comprises a TCR α chain V segment portion of any one of SEQ ID NOs: 1-50 or SEQ ID NOs: 261-310 and a barcode sequence. In some embodiments, the kits include at least one primer including any one of SEQ ID NOs: 1-50 or SEQ ID NOs: 261-310.
According to another aspect, kits for sequencing of T-cell receptors are provided. The kits include at least one primer which comprises a TCR β chain V segment portion of any one of SEQ ID NOs: 51-100 or SEQ ID NOs: 311-360 and a barcode sequence. In some embodiments, the kits include at least one primer comprising any one of SEQ ID NOs: 51-100 or SEQ ID NOs: 311-360.
These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, appended claims and accompanying drawings.
In light of the shortcomings of existing techniques to sequence TCRs, it was determined that a TCR sequencing technology providing the most reliable TCR repertoire data includes the following features:
The disclosed methods, systems and kits fulfill all these criteria. These same features are of use in sequencing receptors from other immune cells, such as B-cells.
In some embodiments, the immune cell receptor sequencing methods comprise the following steps:
The genetic information to be sequenced is immune cell receptor genes. In the some embodiments of the invention, the genetic information to be sequenced comprises T-cell receptors genes. In some embodiments, the TCR genes that are sequenced encode TCR α chains or TCR β chains. In other embodiments, TCR genes that are sequenced encode TCR δ chains or TCR γ chains.
In other embodiments of the invention, the genetic information to be sequenced comprises B-cell receptor (BCR) genes.
RNA is isolated from immune cells and used to generate complimentary RNA (cRNA) by in vitro transcription. This is in contrast to existing TCR sequencing techniques that use DNA or complementary DNA (cDNA) as their genetic starting material.
In some embodiments, the immune cells from which RNA is obtained are isolated from peripheral blood mononuclear cells before RNA extraction. The immune cells are, in some embodiments, T-cells or B-cells.
In some embodiments, T-cells from which RNA is obtained express CD4 or CD8.
Generation of cRNA Through Transcription (Step (2)(a))
Complementary RNA (cRNA) is generated by in vitro transcription. Any method for performing in vitro transcription known to those skilled in molecular biology can be used. In some embodiments, the in vitro transcription in step 2 is performed using commercially available kits, such as the AMBION™ kits available from Thermo Fisher Scientific.
Reverse Transcription (Step (2)(a))
Reverse transcription of the cRNA is performed to generate complementary DNA (cDNA). Methods known to persons skilled in molecular biology are used to reverse transcribe cRNA to cDNA. Typically, such methods include hybridization of a primer to the 3′ end of the cRNA molecule and production of DNA starting at the hybridized primer using a reverse transcriptase enzyme and appropriate nucleotides, salts and buffers.
The choice of primers used in the reverse transcription reaction is important for the ability to differentiate between homologous, yet distinct, immune cell receptor sequences with high degrees of certainty and allows shortening of the V segments from the 5′ end, generating PCR products with a size of 250-300 bp. Such a size range of PCR products is optimal for next generation sequencing.
In some embodiments, the primers used for the reverse transcription are designed to bind within the V segments of the TCR genes (see
In some embodiments of the invention, a set of preferred primers is used (see, e.g., the sequences in Table 2 and Table 4, and Table 8 and Table 9). Due to the high degree of homology between different V segments, some of the primers described in Table 2 and Table 4 (and Table 8 and Table 9) bind to more than one V segment (see Table 3 and Table 5; the binding sites in their respective V segments for primers SEQ ID NOs: 1-100 and SEQ ID NOs: 261-360 are indicated in Table 15 and Table 16). However, the design of the primers presented in Table 2 and Table 4 (likewise Table 8 and Table 9) still allows the unambiguous assignment/identification of the respective V segments based on differences between the V segments downstream of the primer-binding site. In an alternative embodiment of the invention, only a subset of the preferred primers SEQ ID NOs: 1-100 and SEQ ID NOs: 261-360 may be used for the reverse transcription.
In yet another embodiment of the invention, primer sets may be used that bind to different regions in the V segments when compared to the primers having SEQ ID NOs: 1-100 and SEQ ID NOs: 261-360. For instance, the binding site of one or more primers may be moved towards the CDR3 region of the TCR gene. Due to the high degree of homology between V segments, the further the primer binding site is moved in the direction of the CDR3 region of the TCR gene, the larger the likelihood that the resulting sequencing data are consistent with the presence of more than one V segment. While, in these cases, the respective V segments cannot be assigned or identified unambiguously, the number of V/J segments possibly present in the sample can often be narrowed down to a small subset. Depending on the application, such limited information can already be of value to the experimenter.
In another embodiment of the invention, the binding site of one or more primers may be moved towards the 5′ end of the V segment as compared to the binding sites of primers SEQ ID NOs: 1-100 and SEQ ID NOs: 261-360. Many next generation sequencing technologies generate sequencing reads that are 150 bp long. Therefore, the further the primer binding site is moved towards the 5′ end of the V segment, the larger is the probability that the respective J segment (which can be found at the 3′ end of the resulting sequencing read) cannot be identified unambiguously. However, this problem can be circumvented by using alternative sequencing technologies that generate reads >150 bp.
In some embodiments, the primers used in step (2)(a) additionally contain a unique bar code. Such barcoding of each RNA molecule before the amplification can be used to correct the obtained sequencing results for PCR and sequencing errors.
In some embodiments, the primers for this reverse transcription step introduce a common T7 adapter at the 5′ end of the resulting PCR products. However, alternative adapter sequences are possible, including, but not limited to Illumina® adapters and sequences presented in Table 1.
Reverse Transcription (Step (2)(b))
Reverse transcription of the RNA is performed to generate complementary DNA (cDNA). Methods known to persons skilled in molecular biology are used to reverse transcribe RNA to cDNA. Typically, such methods include hybridization of a primer to the 3′ end of the RNA molecule and production of DNA starting at the hybridized primer using a reverse transcriptase enzyme and appropriate nucleotides, salts and buffers.
Transcribing the cDNA into Second Strand cDNA (Step (2)(b))
Following generation of cDNA, second strand cDNA is synthesized using methods known to persons skilled in molecular biology. Typically, such methods include hybridization of a primer to the 3′ end of the cDNA molecule and production of second strand cDNA starting at the hybridized primer using a polymerase enzyme and appropriate nucleotides, salts and buffers.
The choice of primers used in the second strand synthesis reaction is step (2)(b) is as described above for reverse transcription in step (2)(a). The choice of primers is important for the ability to differentiate between homologous, yet distinct, immune cell receptor sequences with high degrees of certainty and allows shortening of the V segments from the 5′ end, generating PCR products with a size of 250-300 bp. Such a size range of PCR products is optimal for next generation sequencing.
Amplification of the cDNA is performed by any of the well-known amplification reactions, such as polymerase chain reaction (PCR). Methods known to persons skilled in the molecular biology art are used to amplify the cDNA or a portion thereof (e.g., as depicted in
In some embodiments, the first primer of a primer pair used in an amplification step binds to the common adapter region of the cDNA products produced in step 3 and the second primer of the primer pair binds to a region of the cDNA products that constitutes the constant region of the TCR to be sequenced (see
Of note, not all reverse primers designed to target the constant region of the TCR gene perform equally well in this reaction. For example, the primers listed in Table 7 all failed to provide good amplification with the selected T7 5′ adapter. Therefore, in certain embodiments, the primers listed in are Table 6 used in this amplification step.
A second amplification step is performed to add additional sequences to the amplified molecules, such as sequences that are useful in downstream DNA sequencing reactions. In some embodiments of the present invention, the primers used in this step add appropriate adapters for Illumina® sequencing.
Various suitable sequencing methods described herein or known in the art are used to obtain sequence information from the amplified sequences from the nucleic acid molecules within a sample. For example, sequencing methodologies that can be used in the methods disclosed herein include: classic Sanger sequencing, massively parallel sequencing, next generation sequencing, polony sequencing, 454 pyrosequencing, Illumina® sequencing, Solexa® sequencing, SOLiD™ sequencing, ion semiconductor sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, single molecule real time sequencing, nanopore DNA sequencing, tunneling currents DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, microscopy-based sequencing, RNA polymerase sequencing, in vitro virus high-throughput sequencing, Maxam-Gilbert sequencing, single-end sequencing, paired-end sequencing, deep sequencing, and/or ultra-deep sequencing.
As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
As used herein, a “primer” is a nucleic acid molecule that hybridizes with a complementary (including partially complementary) polynucleotide strand. Primers can be DNA molecules, RNA molecules, or DNA or RNA analogs. DNA or RNA analogs can be synthesized from nucleotide analogs.
TCR α and β chain genes were sequenced in two independent reactions.
1) Starting Material and RNA Extraction
2) cRNA Synthesis by In Vitro Transcription (IVT):
3) cDNA Synthesis by Reverse Transcription:
4) TCR Gene Amplification:
5) Addition of Next Generation Sequencing Adapters:
6) TCR Library Purification:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT
CTTCCGATCTTGTAATACGACTCACTATAG
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGAC
GTGTGCTCTTCCGATCCTCAGCTGGTACACGGCAGGGTCA
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGAC
GTGTGCTCTTCCGATCAAACACAGCGACCTCGGGTGGGAAC
TCR α and β chain genes were sequenced in two independent reactions.
1) Starting Material and RNA Extraction
2) cRNA Synthesis by In Vitro Transcription (IVT):
3) cDNA Synthesis by Reverse Transcription:
4) TCR Gene Amplification:
5) Addition of Next Generation Sequencing Adapters:
6) TCR Library Purification:
GTCTCGTGGGCTCGGAGATGTGTATAA
GAGACAGGAATCAAAATCGGTGAATA
GTCTCGTGGGCTCGGAGATGTGTATAA
GAGACAGGCCAGGCACACCAGTGTGG
TCR α and β chain genes were sequenced in two independent reactions.
1) Starting Material and RNA Extraction
2) cDNA Synthesis by Reverse Transcription:
3) Second Strand cDNA Synthesis:
4) cDNA Purification:
5) TCR Gene Amplification:
6) Addition of Next Generation Sequencing Adapters:
7) TCR Library Purification:
One of the challenges of TCR sequencing are the small amounts of genetic material for each T-cell clone. In many cases, the number of T-cells that can be recovered from a given experiment is too small for researchers to directly extract sufficient amounts of RNA for a subsequent amplification of the TCR genes. In such instances, the T-cells of interest can be mixed with 3T3 mouse cells, which serve as a carrier.
5×10{circumflex over ( )}4 3T3 cells were mixed with 10{circumflex over ( )}6, 10{circumflex over ( )}5, 10{circumflex over ( )}4, 10{circumflex over ( )}3 or 0 CD8 positive T-cells, respectively. The RNA of each mixture was isolated and subjected to steps 2 to 4 of the SEQTR method outlined above (see Detailed Description of the Invention). PCR products were separated on an agarose gel and visualized.
No TCR-specific PCR products were observed in samples that only contained 3T3 cells (see
Another challenge of TCR sequencing is the lack of specific amplification of TCR genes from complex samples. Competing TCR sequencing technologies such as services offered by Adaptive Biotechnology are characterized by up to 90% unspecific amplification. As a result, only as little as 10% of all sequencing data are informative for TCR repertoire determination, increasing cost and duration of any project aiming to sequence TCR repertoires.
5×10{circumflex over ( )}4 3T3 cells were mixed with 10{circumflex over ( )}6, 10{circumflex over ( )}5, 10{circumflex over ( )}4, 10{circumflex over ( )}3 or 0 CD8 positive T-cells, respectively. TCR repertoires for the individual samples were sequenced using the SEQTR method, and the percentage of reads that corresponded to TCR or non-TCR sequences, respectively, was determined. As shown in
In humans, the TCR locus comprises 54 different V segments for the TCR α chain and 65 different V segments for the TCR β chain. However, many of these V segments are highly homologous. Consequently, one of the big challenges of TCR sequencing is to successfully differentiate between two or more TCR gene segments with high degrees of homology. For instance, depending on the choice of primer used in the amplification of the TCR gene and the length of the generated PCR product, the resulting sequencing data might be compatible with more than one V or J segment (in other words, two or more TCR V or J segments show 100% homology in the sequenced region). In these cases, the TCR gene for a specific read cannot be unambiguously assigned/identified.
5×10{circumflex over ( )}4 3T3 cells were mixed with 10{circumflex over ( )}6, 10{circumflex over ( )}5, 10{circumflex over ( )}4, 10{circumflex over ( )}3 or 0 CD8 positive T-cells, respectively. The RNA of each mixture was isolated and subjected to the TCR sequencing method. Out of all the sequencing reads that were identified as TCR genes, it was assessed if the V or J segments could be identified unambiguously. The data show that between 95% and 97% of all TCR sequencing reads could be assigned to a specific TCR segment, even when using as little as 1,000 T-cells as genetic starting material (see
Due to the homology between V segments, it can be sometimes difficult to clearly identify the TCR sequence. hTRBV6-2 and hTRBV6-3 cannot be differentiated as they have 100% homology and thus will code for the same TCR. Due to their sequences, hTRBV12-3 and hTRBV12-4 cannot be differentiated with the method disclosed herein. Only paired-end sequencing that will catch the 5′-end of the V segment can discriminate these two sequences. Thus the hTRBV12-3 and hTRBV12-4 were considered as a unique sequence for the analysis of the repertoire.
Because non-linear amplification of individual TCR sequences can lead to an incorrect over- or underrepresentation of the affected TCR genes in the final TCR repertoire, linearity of amplification is a critical determinant of the reliability and quality of the TCR sequencing data.
To test linearity of TCR gene amplification in our system, a fixed amount of DNA encoding a known TCR sequence was diluted at different concentrations into a DNA pool representing a naïve CD8 repertoire. Subsequently, the TCR repertoire of each sample was analyzed with SEQTR.
The observed frequency of the known TCR sequence in the entire TCR repertoire was then sequenced for each dilution and compared to the expected frequency. The scatter plot in
The reproducibility of the method was tested by performing two independent technical replicates starting from the same sample. The frequencies for each V-J rearrangement in the TCR β chains were determined and compared between the two replicates, as illustrated in
The data show that only 13% of all V-J rearrangements showed a significant frequency difference of more than two-fold between the two technical replicates (see
The SEQTR method was tested on three different type of CD8 positive T-cells:
The relative frequencies of each V-J rearrangement were determined using the SEQTR method (see
In order to determine how accurate the TCR repertoire data obtained using the SEQTR method were as compared to the true TCR repertoire present in a given T-cell population, we compared our results to data obtained by single cell sequencing.
Tetramer-specific CD8 were sorted from PBMC by FACS. The recovered cell population was split in two. Half of the cells were subjected to the SEQTR method to sequence the TCR repertoire. For the other half of the cells, individual T-cell clones were isolated and expanded in vitro (single cell cloning). Once the clones were established, the TCR genes of each T-cell clones were amplified and sequenced using classical Sanger sequencing (see
Among the 42 individual clones tested using the single cell method, six different TCRs were identified (see
Tumor samples from 16 patients were collected and the tumor cells were separated from the surrounding tissue (stroma). In addition, epitope-specific TIL were sorted by FACS from the tumor samples using tetramer staining (TET). Finally, the tumor cells were engrafted into humanized mice. After some time, the tumor was collected and epitope specific TIL were sorted by FACS.
DNA extraction was performed for each sample. DNA was sent to Adaptive Biotechnology for TCR sequencing (immunoSEQ® method, survey protocol 200,000-300,000 reads per sample).
In 80% of the samples, the immunoSEQ® method failed to generate 200,000 reads per samples, suggesting that the immunoSEQ® method fails to generate TCR repertoires with significant reliability.
RNA was isolated from 10{circumflex over ( )}6 PBMC or 10{circumflex over ( )}6 CD4 positive T-cells, respectively, from three independent samples, The RNA was then subjected to steps 2 to 4 of the SEQTR method outlined above (see Detailed Description of the Invention). PCR products were separated on an agarose gel and visualized (see
The foregoing examples and description of the embodiments should be taken as illustrating, rather than as limiting the present invention as defined by the claims. As will be readily appreciated, numerous variations and combinations of the features set forth above can be utilized without departing from the present invention as set forth in the claims. Such variations are not regarded as a departure from the scope of the invention, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference herein in their entireties.
As described and claimed herein, including in the accompanying drawings, reference is made to particular features, including method steps. It is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment, or a particular claim, that feature can also be used, to the extent possible, in combination with and/or in the context of other particular aspects and embodiments, and in the disclosed methods, systems and kits generally.
Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all the defined steps (except where the context excludes that possibility).
This application claims priority under 35 U.S.C. § 119(e) to U.S. provisional patent application Ser. No. 62/452,409, filed Jan. 31, 2017, the entire contents of which are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2018/015819 | 1/30/2018 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62452409 | Jan 2017 | US |
