 
                 Patent Application
 Patent Application
                     20210115456
 20210115456
                    The disclosure relates to geminiviral expression systems modified to enhance transformation efficiency of plant-based expression systems using components from mastrevirus and begomovirus.
Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 75,015 byte ASCII (text) file named “SeqList” created on Aug. 12, 2020.
Geminiviruses are vector-borne plant viruses with circular ssDNA genomes ranging from 2.5-3.0 kb which cause severe diseases in many economically important crops in tropical and sub-tropical areas (Scholthof et al., 2011). As geminiviruses replicate in plant nuclei, they must cross two barriers to transit between cells: the pores of the nuclear envelope to exit to the cytoplasm, and the intercellular channels, known as plasmodesmata, to spread cell-to-cell (Jeske, 2009; Krichevsky et al., 2006; Lucas, 2006; Waigmann et al., 2004). Though these general barriers must be overcome by all geminiviruses, the specific mechanisms of doing so differ between genera.
The begomoviruses are the largest, most well-studied geminivirus genus, and are divided into the monopartite begomoviruses, which contain only one single-stranded circular DNA component about 2.8 kb in size, and the bipartite begomoviruses, which contain both a DNA-A and DNA-B component. Both DNA-A and DNA-B are small, having genomes strictly between 2.5 and 2.8 kb, which is thought to be required for cell-to-cell movement due to size restrictions imposed by the plasmodesmata (Gilbertson et al., 2003). The DNA-A component produces the replication protein Rep, the coat protein (CP), and auxiliary proteins that regulate transcription, suppress gene silencing, and enhance replication, while the DNA-B component is responsible for virus movement by encoding a nuclear shuttle protein (NSP) and a movement protein (MP) (Hanley-Bowdoin et al., 2013).
Mastreviruses are less well-studied than the begomoviruses, though they result in significant crop damage, especially in sub-Saharan Africa (Shepherd et al., 2007). The mastreviruses have only one small circular single-stranded DNA genome (2.6-2.8 kb) comprising four genes: two replication association proteins, a CP, and a MP. The CP is thought to replace the function of the NSP by shuttling viral replicons out of the nucleus (Liu et al., 1999a). Additionally, the CP is required for ssDNA production for genome packaging (Azzam et al., 1994). After nuclear export, the MP localizes the NSP-DNA complex to the cell periphery for cell-to-cell transport (Jeffrey et al., 1996). The MP from mastreviruses does not seem to bind to DNA directly, instead interacting with the CP-DNA complex. Thus, mastreviruses require the CP for all forms of movement (Liu et al., 1999a).
Exchange of genetic components can alter the host range or tissue specificity of a virus. The susceptibility of plant host species differs drastically between even closely related plant viruses, likely due to the ongoing arms race between plant defenses and virus counter-defenses (Rojas et al., 2005). Cassava mosaic geminivirus, formerly a relatively benign pathogen, underwent recombination to produce a much more severe strain that greatly impeded cassava production in Africa (Legg and Fauquet, 2004). In Spain, a tomato-infecting geminivirus isolated in a wild reservoir was shown to be a recent genetic recombinant between Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus and had a broader host range than either of the two parent viruses (Garcia-Andres et al., 2006). As a powerful illustration of the potential of geminivirus recombination, it was shown that exchanging the coat protein from African cassava mosaic begomovirus, which is transmitted by whitefly, with the CP of beet curly top curtovirus (BCTV), which is transmitted by leafhopper, allowed the generation of a chimeric virus that had acquired the ability to be transmitted by the BCTV leafhopper vector (Briddon et al., 1990).
Substantial evidence for intra- and inter-species recombination between mastreviruses exist (Kraberger et al., 2013). Nevertheless, in contrast to the many examples of successful complementation experiments reported among members of the begomoviruses that extend cross-genus to the curtoviruses and topocuviruses, there are almost no examples of successful complementation reported for the mastreviruses. Multiple chimeras created between BeYDV and maize streak virus were unable to replicate or infect either host (Liu et al., 1999b). Previous attempts to construct recombinant mastrevirus replicons capable of cell-to-cell or systemic movement with the native CP and MP have not been successful (Palmer and Rybicki, 2001). The only report of viable genetic complementation with a mastrevirus was carried out by swapping the coat and movement protein from similar strains of maize streak virus, which shared high levels of sequence homology (van der Walt et al., 2008).
The disclosure relates to plant expression systems that comprise bean yellow dwarf virus-derived (BeYDV-derived) vectors encoding a transgene, wherein the expression system also comprises at least one vector encoding a begomovirus movement protein (MP) and a begomovirus nuclear shuttle protein (NSP) to enable the cell-to-cell movement of the transgene in the transgenic plant. In some embodiments, the plant expression system consists of a chimeric dual replicon vector based on BeYDV that expresses the transgene, the begomovirus MP, and the begomovirus NSP. The expression level of transgene, MP, and NSP are driven by different promoters. In other embodiments, the plant expression system comprises two vectors: one for expressing the transgene and one for expressing begomovirus MP and NSP. In still other embodiments, the plant expression system comprises three expression vectors: one for expressing the transgene, one for expressing the begomovirus MP, and one for expressing the begomovirus NSP.
In one aspect, a T-DNA binary vector for expressing a recombinant protein in a plant cell is disclosed herein. The T-DNA binary vector comprises two replicons, a first long intergenic region (LIR) from bean yellow dwarf virus (BeYDV), a second LIR from BeYDV, and a third LIR from BeYDV. The first replicon is between the first and second LIR from BeYDV and the second replicon is an expression cassette and is between the second and third LIR from BeYDV. The first replicon comprises a first sequence encoding a begomovirus MP, a second sequence encoding a begomovirus NSP, and a first short intergenic region (SIR) from BeYDV. The first SIR separates the first and second sequences. The second replicon comprises a third sequence encoding a transgene. In some aspects, the size of each of the replicons is between 2 kb and 3.1 kb.
In some embodiments, the begomovirus MP and the begomovirus NSP are both from BeYDV. In other embodiments, the begomovirus MP and the begomovirus NSP are both from abutilon mosaic virus (AbMV). In yet other embodiments, the begomovirus MP is from AbMV and the begomovirus NSP is from BeYDV. In still other embodiments, the begomovirus MP is from BeYDV and the begomovirus NSP is from AbMV.
In some embodiments, the expression vector further comprises a second SIR from BeYDV and a fourth sequence encoding Rep/RepA from BeYDV. The fourth sequence is downstream of the third sequence. The second SIR separates the third and fourth sequences.
In some embodiments, the second replicon further comprises 5′ untranslated region (UTR) from tobacco mosaic virus (TMV 5′), and the TMV 5′ is upstream of the third sequence.
In some embodiments the second replicon further comprises an intronless form of the gene terminator from tobacco extension (Ext 3′), and the Ext 3′ is downstream of the third sequence. In some aspects, the Ext 3′ is also upstream of the second SIR.
In some embodiments, the TATA box of at least one of the first, second, and third LIR is mutated and comprise the nucleic acid sequence TATAAG.
In some embodiments the first replicon further comprises a truncated pinII terminator downstream of the second sequence encoding the begomovirus NSP, wherein the first LIR from BeYDV is a v-sense LIR comprising a mutated TATA box having the sequence TATAAC and is upstream of the second sequence encoding the begomovirus NSP, and the second LIR from BeYDV is a c-sense LIR and is upstream of the first sequence encoding the begomovirus MP.
In another aspect, the disclosure relates to a plant expression system comprising three expression vectors for facilitating cell-to-cell movement of a transgene. The first expression vector has a T-DNA region a replicon spanning a first LIR from BeYDV and a second LIR from BeYDV. The first replicon comprises a first sequence encoding a transgene, a 5′ UTR upstream of the first sequence, a terminator downstream of the first sequence, a second sequence encoding Rep/RepA from BeYDV, and a SIR from BeYDV. The first sequence, the 5′ UTR, and the terminator are upstream of the SIR, and the second sequence is downstream of the SIR. The second expression vector has a T-DNA region comprising a promoter selected from cauliflower mosaic virus 35S promoter or agrobacterium NOS promoter, a third sequence encoding a begomovirus MP; and a terminator selected from agrobacterium NOS termination or a truncated form of the gene terminator from tobacco extension (Ext 3′). The third expression vector has a T-DNA region comprising a promoter selected from cauliflower mosaic virus 35S promoter or agrobacterium NOS promoter; a fourth sequence encoding a begomovirus NSP; and a terminator selected from agrobacterium NOS terminator or Ext 3′. In some aspects, the size of each of the replicons is between 2 kb and 3.1 kb.
In some embodiments the 5′ UTR in the first expression vector comprises 5′ UTR from tobacco mosaic virus.
In some embodiments, the terminator in the first expression system comprises Ext 3′.
In some embodiments, the begomovirus MP and the begomovirus NSP are both from BeYDV. In other embodiments, the begomovirus MP and the begomovirus NSP are both from AbMV. In yet other embodiments, the begomovirus MP is from AbMV and the begomovirus NSP is from BeYDV.
In some embodiments, the TATA box of at least one of the third LIR and the fourth LIR is mutated and comprises the nucleic acid sequence TATAAG.
In yet another aspect, the disclosure relates to a plant expression system comprising a dual replicon vector for facilitating cell-to-cell movement of a transgene comprising a first expression vector with a T-DNA region comprising a first replicon spanning a first LIR from BeYDV and a second LIR from BeYDV and a second expression vector with a T-DNA region comprising a second replicon spanning a third LIR from BeYDV and a fourth LIR from BeYDV. The first replicon comprises a first sequence encoding a transgene, a 5′ UTR upstream of the first sequence, a terminator downstream of the first sequence, a second sequence encoding Rep/RepA from BeYDV, and a first SIR from BeYDV. The first sequence, the 5′ UTR, and the terminator are upstream of the short intergenic region and the second sequence is downstream of the first SIR. The second replicon comprises a third sequence encoding a begomovirus MP, a fourth sequence encoding a begomovirus NSP, and a second SIR from BeYDV. The second SIR separates the second and third sequence. In some aspects, the size of each of the replicons is between 2 kb and 3.1 kb.
In some embodiments, the begomovirus MP and the begomovirus NSP are both from BeYDV. In other embodiments, the begomovirus MP and the begomovirus NSP are both from AbMV. In yet other embodiments, the begomovirus MP is from AbMV and the begomovirus NSP is from BeYDV.
In some embodiments the TATA box of the third LIR and/or fourth LIR is mutated and comprises the nucleic acid sequence TATAAG.
In another aspect, the disclosure relates to a plant expression system comprising a dual replicon vector for facilitating cell-to-cell movement of a transgene using begomovirus MP and begomovirus NSP. The dual replicon comprises a first expression vector and a second expression vector, where the expression vectors separately express either begomovirus MP or begomovirus NSP. The first expression vector has a T-DNA region comprising a first replicon that spans a first LIR from BeYDV and a second LIR from BeYDV. The first replicon comprises a first sequence encoding a transgene, a second sequence encoding either the begomovirus MP or the begomovirus NSP, and a SIR from BeYDV that separates the first sequence and the second sequence. The second expression vector has a T-DNA region comprising a second replicon that spans a third LIR from BeYDV and a fourth LIR from BeYDV. The second replicon comprises a third sequence encoding either the begomovirus MP or the begomovirus NSP.
In some embodiments, the begomovirus MP and the begomovirus NSP are both from BeYDV. In other embodiments, the begomovirus MP and the begomovirus NSP are both from AbMV. In yet other embodiments, the begomovirus MP is from AbMV and the begomovirus NSP is from BeYDV.
The disclosure also relates to improved methods of producing transgenic plants. The method comprises transforming the plants with an expression system or binary vector described herein using lower amount of agrobacterium, for example, at a concentration as measured by OD600 of less than 0.2, about 0.02, or about 0.002.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
Detailed aspects and applications of the disclosure are described below in the following drawings and detailed description of the technology. Unless specifically noted, it is intended that the words and phrases in the specification and the claims be given their plain, ordinary, and accustomed meaning to those of ordinary skill in the applicable arts.
In the following description, and for the purposes of explanation, numerous specific details are set forth in order to provide a thorough understanding of the various aspects of the disclosure. It will be understood, however, by those skilled in the relevant arts, that embodiments of the technology disclosed herein may be practiced without these specific details. It should be noted that there are many different and alternative configurations, devices and technologies to which the disclosed technologies may be applied. The full scope of the technology disclosed herein is not limited to the examples that are described below.
The singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a step” includes reference to one or more of such steps.
As used herein, the term “about” refers to a deviation no more than 10% of the given value, for example, a deviation of 10%, 5%, 1%, or 0.5% of the given value.
As used herein the term” expression vector” refers to a plasmid used to introduce a specific gene, for example a transgene, into a target cell and use the target cell's own mechanism of protein expression to produce the protein encoded by the specific gene. As used herein, the terms “bean yellow dwarf virus vector”, “BeYDV vector,” “BeYDV-based vector,” or a vector of the “BeYDV system” refer to an expression vector that comprises the nucleic acid sequence of BeYDV's long intergenic regions (LIRs) and short intergenic region (SIR). A replication-competent BeYDV vector further comprises the nucleic acid sequence for Rep/RepA.
As used herein, the term “expression cassette” refers to a distinct component of vector DNA, which contains gene sequences and regulatory sequences to be expressed by the transfected cell. An expression cassette comprises three components: a promoter sequence (part of the 5′ untranslated region, 5′ UTR), an open reading frame, and a 3′ untranslated region (3′ UTR). In some aspects, the regulatory sequences are found in the 5′ UTR and the 3′ UTR.
As used herein, the term “replicon cassette” refers to an expression cassette comprising at least one gene that assists with replication of an organism. For example, in certain embodiments, the expression vector disclosed herein comprise a replicon cassette comprising a sequence encoding Rep, RepA, or Rep/RepA from BeYDV. A vector that comprises a sequence encoding Rep, RepA, or Rep/RepA from BeYDV is also referred to herein as a vector that is “replication-competent.”
As used herein, the term “replicon” refers to a portion of a vector between two intergenic regions. As used herein, a “mastrevirus replicon” refers to a portion of the vector where two long intergenic region (LIR) from BeYDV designate the borders of the replicon.
As used herein, the term “transgene” refers to a gene from one organism that is introduced into another organism.
The disclosure relates to expression systems that enable cell-to-cell movement of a transgene in plants, in particular transgene in a mastrevirus replicon. The expression systems utilize the movement protein (MP) and nuclear shuttle protein (NSP) from bipartite begomovirus with the transgene being expressed on a replicon based on the mastrevirus bean yellow dwarf virus (BeYDV). In particular embodiments, the expression systems comprise a BeYDV replicon that supplies begomovirus MP and NSP from the native LIR promoter to provide the protein machinery for cell-to-cell movement of a transgene that is supplied in a replication-competent BeYDV vector.
Both the MP and NSP from begomoviruses have been shown to bind DNA in a sequence non-specific manner that instead depends on form and size. Though some differences have been reported between species, in general, genome-sized DNA molecules are efficiently transported (Hehnle et al., 2004; Rojas et al., 1998). Interestingly, the NSP is not required for virus infectivity with several begomoviruses, likely due to overlapping function with the CP (Sudarshana et al., 1998; Zhou et al., 2007). The DNA-A component of the bipartite begomoviruses can spread systemically in the absence of DNA-B, though in a very limited capacity (Hou et al., 1998). Inside the nucleus, viral genomes have been shown to interact with NSP and histone H3 (Zhou et al., 2011). The current model of intracellular movement is that a complex of histone H3, NSP, and viral genomic DNA is exported out of the nucleus, where it interacts with the MP. The MP-NSP-genome-histone H3 complex is then trafficked to the cell periphery and through the plasmodesmata to neighboring cells (Krenz et al., 2010). Though the exact mechanism of transport is not fully understood, heat shock cognate 70 kDa protein has been implicated in the movement of viral replicons through a network of stromules which are formed upon infection and connect the nucleus, plastids, and plasmodesmata (Krenz et al., 2012). The NSP is also responsible for nuclear import of replicated viral genomes in neighboring cells (Krichevsky et al., 2006)
As described herein, expression of bean dwarf mosaic virus (BDMV) MP and NSP separately at controlled levels allowed efficient cell-to-cell movement of recombinant mastreviral replicons in Nicotiana benthamiana leaves. The MP and NSP from the phloem-limited geminivirus Abutilon mosaic virus (AbMV) could efficiently move BeYDV replicons when expressed at appropriate levels. Accordingly, the MP and NSP are both from BDMV in some embodiments of the described expression system. In other embodiments, the MP and NSP are from AbMV. In still other embodiments, the MP and NSP is from different bipartite begomoviruses, for example one of the two proteins is from BDMV while the other is from AbMV. In certain embodiments, the MP is from AbMV and the NSP is from BDMV.
Efficient cell-to-cell movement in planta strongly depends on the relative expression levels of MP and NSP. Overexpression of MP and NSP causes leaf cell death, but production of functionally relevant levels of MP and NSP does not cause notable symptoms with BeYDV replicons. Accordingly, the efficiency of cell-to-cell movement is greatly improved by optimizing the vector size and expression level of MP and NSP. MP and NSP expression needs to be fine-tuned to strike a balance between providing efficient cell-to-cell movement capabilities to new viral replicons, while still allowing sufficient replicon availability in the nucleus for viral transcription, as well as avoiding triggering the plant hypersensitive response.
BDMV NSP strongly inhibited GFP replication and expression from genome-sized BeYDV replicons when produced from the strong 35S promoter (
The ability to confer cell-to-cell movement to mastrevirus replicons in the expression systems described herein depend strongly on replicon size. MP was also shown to facilitate cell-to-cell movement of appropriately sized plasmid DNA (Gilbertson et al., 2003). As shown in the Examples, replicons between the sizes of 2.1 kb and 2.7 kb replicons were efficiently moved, while replicons larger that 3.1 kb were inhibited. Replicons with a size of 3.9 kb were very strongly inhibited.
Because these expression systems enable cell-to-cell movement of a transgene, a plant can be more efficiently transformed even with lower amounts of agrobacterium. Accordingly, the disclosure also relates to improved methods of producing a transgenic plant by administering agrobacterium in a concentration of OD600 less than 0.2 to the plant. In certain embodiments, the concentration of agrobacterium is OD600 of about 0.02, 0.002, or 0.0002. In particular embodiments, the plant is administered agrobacterium transformed with the chimeric dual replicon vector or chimeric expression system described herein.
In some implementations, the expression system consists of a chimeric dual replicon vector. The chimeric vector is a BeYDV vector comprising three long intergenic regions from BeYDV (LIRs) which form two replicons, a first replicon and a second replicon. The first replicon spans the region between the first LIR and the second LIR, while the second replicon spans the region between the second LIR and the third LIR.
The first replicon comprises a first sequence encoding a begomovirus MP and a second sequence encoding a begomovirus NSP. A short intergenic region from BeYDV (SIR) separates the first sequence and the second sequences. Accordingly, the first replicon comprises a first LIR, the first sequence encoding a begomovirus MP, the SIR, and the second sequence encoding a begomovirus NSP. In some aspects, the first LIR is a v-sense LIR while the second LIR is a c-sense LIR, and the arrangement of the first replicon has the first LIR driving the expression of the begomovirus NSP and the second LIR driving the expression of the begomovirus MP. In such embodiments, the expression of the begomovirus may be further modified by TMV 5′. In such embodiments, the first LIR may be mutated at the TATA box or the start codon context box as described above. In other aspects, the arrangement of the first replicon has the first LIR driving the expression of the begomovirus MP and the second LIR driving the expression of the begomovirus NSP. In some embodiments, the first replicon is replication-competent and thus comprises a sequence encoding Rep/RepA from BeYDV. Accordingly, the first replicon may further comprise another SIR to separate the sequence encoding Rep/RepA from the sequences encoding the begomovirus MP and NSP.
The second replicon is an expression cassette that comprises a third sequence encoding a transgene. In certain embodiments, the second replicon is replication-competent and further comprises a fourth sequence encoding Rep/RepA from BeYDV, which is separated from the third sequence encoding the transgene with a second SIR. In some aspects, the translation of the third sequence encoding the transgene is modified with the 3′ UTR of tobacco extensin gene, whether intronless (Ext 3′) or the full 3′ UTR. Accordingly, in certain embodiments, the second replicon comprises a third sequence encoding the transgene and Ext 3′, where Ext 3 is downstream of the third sequence encoding the transgene but upstream of the second SIR. The translation of the third sequence encoding the transgene may also be modified with a 5′ UTR, for example, PsaK truncated 5′ UTR (PsaK 5′).
In some embodiments, the arrangement of the chimeric dual replicon vector is LIR-MP-SIR-Rep/RepA-LIR-NSP-SIR-transgene-LIR.
Optimized chimeric vectors containing a BeYDV replicon supplying BDMV or AbMV MP and NSP from the native LIR promoter provided cell-to-cell movement to replication-competent BeYDV GFP vectors (see Table 1), comparable to or exceeding the movement efficiency of wildtype BDMV replicons. These vectors result in rapid accumulation of very high levels of GFP even when typical agrobacterium concentrations are substantially reduced.
In other implementations, the expression system comprises a plurality of expression vectors, each comprising at least one replicon. Among the plurality of expression vectors, at least one is a BeYDV vector and comprises a sequence encoding a transgene. In certain embodiments, the BeYDV vector comprising the sequence encoding the transgene is replication-competent, thus comprising a second sequence encoding Rep/RepA of BeYDV that is separated by from the sequence encoding the transgene with a SIR. In some aspects, the BeYDV vector comprising the sequence encoding the transgene further comprises a 5′ UTR, a terminator, or both that modify the translation of the transgene. For example, the 5′ UTR may be TMV 5′ or PsaK 5′, and the terminator may be Ext 3′. The other expression vectors in the plurality of expression vectors express begomovirus MP and NSP. In some aspects, expression system comprises two expression vectors that comprise a sequence encoding a transgene. While one vector further comprises a sequence encoding begomovirus NSP, the other vector further comprises a sequence encoding begomovirus MP. In such embodiments, the sequence encoding the transgene is separated by the sequence encoding the begomovirus NSP or MP by an intergenic region, for example SIR.
LIR is a bidirectional promoter that acts differently at different times during infection: initially, the early part of the promoter makes Rep/RepA first after infection, and then later it makes the native movement/coat proteins (Rep/RepA activate the late promoter, and suppress the early promoter). In some aspects, the expression of the MP and NSP are driven by the late promoter, thus the sequence encoding MP or NSP is downstream of the sequence encoding the transgene. In other aspects, the expression of the transgene is driven by the late side promoter, thus the sequence encoding MP or NSP is upstream of the sequence encoding the transgene.
In some embodiments, the expression system further comprises a second expression vector comprises a sequence encoding begomovirus MP, while a third expression vector comprises a sequence encoding begomovirus NSP. In such embodiments, the expression of the begomovirus MP and NSP may be driven by a strong promoter like 35S or weaker promoter like NOS (see Examples 3 and 7). The expression of begomovirus MP and NSP may be modified with 5′ UTRs and terminators. Thus, the second and third expression vectors each may further comprise a 5′ UTR, a terminator, or both to modify the translation of the MP and NSP, for example, the 5 UTR may be TEV 5′ and the terminator may be vspB. In some implementations, the second and third expression vectors are replication-competent. Accordingly, such embodiments of the second and third expression vector further comprise a sequence encoding Rep/RepA from BeYDV.
Accordingly, in certain embodiments, the expression system comprises a first expression vector with a T-DNA region comprising a replicon spanning a first long intergenic region from BeYDV and a second long intergenic region from BeYDV, wherein the replicon further comprises a first sequence encoding transgene, a 5′ UTR upstream of the first sequence, a terminator downstream of the first sequence, a second sequence encoding Rep/RepA from BeYDV; and a short intergenic region from BeYDV; a second expression vector with a T-DNA region comprising a promoter selected from the group consisting of: cauliflower mosaic virus 35S promoter and agrobacterium NOS promoter, a third sequence encoding a begomovirus movement protein, and a terminator comprising a terminator selected from the group consisting of: agrobacterium NOS terminator and a truncated form of the gene terminator from tobacco extension (Ext 3′); and a third expression vector with a T-DNA region comprising a promoter selected from cauliflower mosaic virus 35S promoter or agrobacterium NOS promoter, a fourth sequence encoding a begomovirus nuclear shuttle protein, a terminator selected from agrobacterium NOS terminator or Ext 3′. For the first expression vector, the first sequence, the 5′ UTR, and the terminator are upstream of the short intergenic region and the second sequence is downstream of the short intergenic region. For all three expression vectors, the size of the first replicon or of the T-DNA regions is preferably between 2 kb and 3.1 kb.
In other embodiments, the expression system further comprises a second expression vector based on BeYDV that expresses both begomovirus MP and begomovirus NSP. In some aspects, the second expression vector is also replication-competent. The expression vector comprises a sequence that encodes begomovirus MP and a sequence that encodes begomovirus NSP that are separated by an intergenic region, for example, SIR. The expression of the begomovirus MP and the begomovirus NSP is driven by a LIR in the second expression vector. Accordingly, the second expression vector comprises two LIRs, and the sequence that encodes begomovirus MP and the sequence that encodes begomovirus NSP are flanked by the LIRs. In some aspects, a c-sense LIR drives the expression of the MP, while a v-sense LIR drives the expression of the NSP.
Thus, in certain embodiments, the expression system comprises a first expression vector and a second expression vector. The first expression vector has a T-DNA region comprising a first replicon spanning a first long intergenic region from bean yellow dwarf virus (BeYDV) and a second long intergenic region from BeYDV. The first replicon further comprises a first sequence encoding transgene, a 5′ UTR upstream of the first sequence, a terminator downstream of the first sequence, and a second sequence encoding Rep/RepA from BeYDV, and a first short intergenic region from BeYDV. The first sequence, the 5′ UTR, and the terminator are upstream of the short intergenic region, and the second sequence is downstream of the first short intergenic region. The second expression vector has a T-DNA region comprising a second replicon spanning a third long intergenic regions from BeYDV and a fourth long intergenic region from BeYDV. The second replicon further comprises a third sequence encoding a begomovirus movement protein, a fourth sequence encoding a begomovirus nuclear shuttle protein, and a second short intergenic region from BeYDV, wherein the second short intergenic region separates the second and the third sequences. In preferred embodiments, the size of the first replicon and the size of the second replicon is between 2 kb and 3.1 kb.
The disclosure is further illustrated by the following examples that should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the Figures, are incorporated herein by reference in their entirety for all purposes.
A mastreviral vector with GFP replacing the BeYDV CP was created by overlap extension PCR. Primers LIRAscI (5′-TGGCGCGCCGCTCTAGCAGAAGGCATGTTG, SEQ ID NO. 1) and GFP-V2-R (5′-TCGCCCTTGCTCACCATGATGCACCCCGCCTA, SEQ ID NO. 2) were used to amplify the LIR-MP from pBY002 (Mor et al., 2003) and combined by overlapping GFP segments amplified with primers GFP-V2-F (5′-GTAGGCGGGGTGCATCATGGTGAGCAAGGG CGA, SEQ ID NO. 3) and VSPHT (5′-TGAATAGTGCATATCAGCATACCTTA, SEQ ID NO. 4) from pBY-GFP (Huang et al., 2009). The final vector pBYR-V1SGFP was assembled by three fragment ligation: the vector backbone from pBY-GFP digested with AscI-EcoRI, the overlap PCR fragment digested with AscI-SacI, and the truncated extensin terminator from pBY027.Eu2 (Rosenthal et al., 2018) digested with SacI-EcoRI. A construct pBYR-V1GFP fusing GFP directly downstream from MP without the intergenic sequence upstream from the CP was created similarly, using overlapping primers GFP-V1-R (5′-TCGCCCTTGCTCACCATCTAC GGTCCTGGATGATCC, SEQ ID NO. 5) and its complementary primer. To mutate the start codon of MP, overlapping mutagenic primer V1-Mut-R (5′-CAATATACGCTTTATCAAATACCATCAC, SEQ ID NO. 6) and its complement were used with LIRascI and Ext3-R (5′-CTTCTTCTTCTTC TTTTCTCATTGTC, SEQ ID NO. 7) to amplify an LIR-V1mut-GFP segment from pBYR-V1SGFP. The product was digested with AscI-SacI and ligated into pBYR-V1SGFP digested likewise to yield pBYR-V1mutSGFP. A mastreviral replicon fusing GFP directly downstream from the LIR promoter was created by PCR amplifying the LIR from pBY-GFP with primer LIR-Xho (5′-AACTCGAGCAAATACCATCACATCG, SEQ ID NO. 8), designed to insert a XhoI site upstream from the MP start codon, and primer PNOS-Xho-R (5′-GGCTCGAGTTTGGATTGA GAGTGAATATGAGAC, SEQ ID NO. 9). The final vector pBYR-L5GFP was assembled by three fragment ligation: the vector backbone pBYR-V1GFP digested with AscI-SacI, the PCR product digested with AscI-XhoI, and the XhoI-SacI GFP fragment with TMV 5′ UTR from pBYR2e-GFP (Diamos et al., 2016). The construct pBYR-LGFP, which has the TMV 5′ UTR deleted, was created by XhoI-XbaI digestion of pBYR-L5GFP, blunting the ends with the Klenow fragment of DNA polymerase, and self-ligating the backbone vector.
Vectors pBDA1.5-GFP containing the BDMV DNA-A with coat protein replaced by GFP (Sudarshana et al., 1998). NSP was amplified from pBDB1.5 with primers BV1-Xba-F (5′-gaTCTAGAATGTATGGTTTGCGGAATAAAC, SEQ ID NO. 10) and BV1-Sac-R (5′-ccGAGCTCT CAACCGATATAATCAAGGTCAAAC, SEQ ID NO. 11) designed to insert XbaI and SacI sites flanking the NSP gene. The amplification product was digested with XbaI-SacI and ligated into pGFPe-TMV (Diamos et al., 2016), an agrobacterium T-DNA expression vector containing the strong 35S promoter and the P19 suppressor of RNA silencing, digested likewise to yield pBV1e (referred to as 35S-NSP). The BDMV MP was amplified from pBDB1.5 with primers BC1-Xba-F (5′-ggTCTAGAATGGATTCTCAATTGGTCAATC, SEQ ID NO. 12) and BC1-Sac-R (5′-gcGAG CTCTTATTGCAACGATTTGGGCT, SEQ ID NO. 13), digested with XbaI-SacI, and ligated into pGFPe-TMV digested likewise to create pBC1e (referred to as 35S-MP).
To create chimeric mastrevirus replicons containing the BDMV MP and NSP, a preliminary cloning vector was created by four fragment ligation: from pBYRL5-GFP, the AscI-XhoI fragment (LIR-TMV-GFP) and EcoRI-FseI fragment (SIR-Rep-LIR) were excised and, along with the SacI-EcoRI potato pinII terminator fragment from pHB114 (Richter et al., 2000), ligated into pBY027 (Mor et al., 2003) digested with AscI-FseI. To create a vector with only the BeYDV bidirectional SIR terminator but with available SacI-EcoRI sites for further terminator insertions, the potato pinII terminator was deleted by digestion with SbfI-SmaI, blunting the ends with Klenow fragment of DNA polymerase, and self-ligating the backbone. Then, BDMV NSP was excised from pBV1e by XhoI-SacI digestion and ligated into this new vector digested likewise to yield pBYR0-LBV1. The initial MP/NSP hybrid vector pBY0BDa was created by four fragment ligation: the vector backbone from pBYR0-LBV1 digested with AgeI-SacI, the SIR-containing SacI-AvaI fragment from pBYR0-LBV1, the BDMV MP amplified from pBC1e with primers BC1-Xba-F and BC1-Ava-R (5′-CACCCGAGTTATTGCAACGATTTGGGCT, SEQ ID NO. 14) digested with XbaI-AvaI, and the BeYDV LIR amplified from pBY027 with primers LIR-C-Xba-R (5′-GGTCTAGAGTTGTTGTGACTCCGAGG, SEQ ID NO. 15) and M13RHT (5′-GGAAACAGCTATGACCATG, SEQ ID NO. 16) digested with AgeI-XbaI. Modifications to the promoters, 5′ UTRs, terminators, and other elements in pBY0BDa were carried out similarly and are shown in Table 1 as well as in the supplementary material. A T-DNA dual replicon vector pBYBDa-L5GFP (referred to as pBYBDx in Table 1, where “x” denotes the indicated letter) containing both the mastreviral GFP replicon and the BDMV MP/NSP hybrid replicon was created by four fragment ligation: the AscI-SacI backbone fragment and SacI-ApaI (GFP-TMV-LIR) fragment from pBYR-L5GFP were ligated with the ApaI-NsiI (LIR-MP) and NsiI-AscI (MP-SIR-NSP-LIR) fragments from pBY0BDx. For vector pBYBDf3.0 containing a 3.0 kb GFP replicon, the SacI-ApaI fragment from the ligation shown above was substituted with the SacI-ApaI fragment from pBYR2eFa-GFP (Diamos et al., 2016). For vector pBYBDf3.9 containing a 3.9 kb GFP replicon, the backbone of pBYBDf3.0 digested SbfI-HindIII was ligated with the SbfI-HindIII fragment containing the 35S promoter with duplicated enhancer and intron-containing extensin terminator from pBYR2e-GFP (Diamos et al., 2016).
The construction of the empty vector pPS1 was described previously in Huang and Mason, 2004.
An HA epitope tag was added to BDMV NSP by amplifying pBV1e with BV1-Xba-F and BV1HA-Sac-R (5′-tatGAGCTCTCATGCGTAATCTGGCACATCATAAGGATAACCGATATAA TCAAGGTCAAACG, SEQ ID NO. 17) designed to add HA tag to the 3′ end of NSP. The product was digested XbaI-SacI and cloned into pGFPe-TMV to yield pHA-BV1e. HA-tagged MP was generated similarly with the primer BC1HA-Sac-R (5′-tatgAGCTCTTATGCGTAATC TGGCACATCATAAGGATATTGCAACGATTTGGGCTG, SEQ ID NO. 18). Vectors containing MP and NSP driven by the NOS promoter were created by three fragment ligation: the vector backbone from pBI101 (Jefferson et al., 1987) digested with NheI-Sac, the NOS promoter amplified from pRep111 (Diamos and Mason 2018b) with primers PNOS-Xho-R (5′-GGCTCGAGTTTGGATTGAGAGTGAATATGAGAC, SEQ ID NO. 19) and PNOS-Asc-F (5′-acggcgcgccCATGAGCGGAGAATTAAGGG, SEQ ID NO. 20) digested with NheI-XhoI, and either the MP from pBC1e or NSP from pBV1e digested with XhoI-SacI, creating either pNOS-BC1 or pNOS-BV1.
AbMV NSP was amplified from pMDC7-HA-NSP (Kleinow et al., 2009) with primers AbBV1-Xba-F (5′-cgTCTAGAATGTACCCGTCTAGGAATAAA, SEQ ID NO. 21) and AbBV1-Sac-R (5′-agGAGCTCTTAACCAATATAGTCAAGGTCAAAC, SEQ ID NO. 22), digested with XbaI-SacI, and ligated into either pBV1e digested likewise to yield pABV1e, or into pBYR0-LBV1 digested likewise to create pBYR0-LABV1. AbMV MP was amplified from pMDC7-c-Myc-MP (Kleinow et al., 2009) with primers AbBC1-Bsr-F (5′-ggTGTACAATGGATTCTCAGTTAGTAAATCCTC, SEQ ID NO. 23) and AbBC1-Kpn-R (5′-gcGGTACCTTATTTCAATGATTTGGCTTGAGAAG, SEQ ID NO. 24), digested with BsrGI-KpnI, and ligated into pBD209 digested likewise to yield pBD209-AbBC1. The AbMV TMV 5′ UTR-AbMV MP-35S terminator fragment was excised from pBD209-AbBC1 by XhoI-EcoRI digestion and ligated with the backbone fragment from pBC1e digested with XhoI-ApaLI and the small ApaLI-EcoRI fragment from pBC1e to yield pABC1e. The hybrid vector pBY0ABa was created by four fragment ligation: the vector backbone from pBYR0-LABV1 digested with AgeI-SacI; the SIR-containing SacI-AvaI fragment from pBYR0-LABV1; the AbMV MP amplified from pBD209-ABC1 with primers AbBC1-Bsr-F and AbBC1-Ava-R (5′-gcCCCGAGTTATTTCAATGATTTGCTTGAGAAG, SEQ ID NO. 25) digested with BsrGI, blunted, then AvaI; and the BeYDV LIR amplified from pBY027 with primers LIR-C-Xba-R (5′-GGTCTAGAGTTGTTGTGACTCCGAGG, SEQ ID NO. 26) and M13RHT (5′-GGAAACAGCTATGACCATG, SEQ ID NO. 27) digested with XbaI, blunted, then digested with AgeI. pBY0ABa was used to create dual replicon hybrid vectors (pBYAMa and pBYAMb) with pBYR-L5GFP as described for pBY0BDa.
All genetic elements were sequence verified, as were any introduced mutations, any clones using segments amplified by PCR, and any clones generated with blunt ligations. Subclones made by transferring sequence-verified elements using standard restriction/ligation with compatible ends were verified by diagnostic PCR and diagnostic digests.
The specific constructs described herein listed below:
Table 1 describes the genetic components for expression of BDMV MP and NSP using the disclosed chimeric replicon, as shown in 
  
    
      
        
        
          
            
          
        
        
          
            
          
          
            
          
        
      
      
        
        
        
        
        
        
        
        
        
        
        
          
            
            
            
            
            
            
            
            
            
            
          
          
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
            
            
            
            
            
            
            
            
            
          
          
            
          
          
            
          
        
      
    
  
The plasmid maps for the GFP and MP/NSP replicon constructs is given in 
To create a system to study geminivirus movement in Nicotiana benthamiana, a mastreviral GFP expression vector based on bean yellow dwarf virus (BeYDV) was constructed for delivery by agroinfiltration. GFP was fused to the BeYDV LIR virion-sense promoter which natively drives expression of the MP and CP.
The vector was designed to contain the BeYDV rep and repA genes for vector replication, with the CP and/or MP replaced by GFP (
While an intron was shown to be active in the MP gene of maize streak virus (Wright et al., 1997), none has been detected in BeYDV, though it has been suggested that the CP in BeYDV may be produced by translational frameshifting (Dekker et al., 1991). When the CP was replaced with GFP, MP with the mutated start codon prevented GFP expression. These data support a mechanism such as translational frameshifting, which would require initiation to first occur at MP for later CP translation (
To verify that MP translation is necessary for CP production, the MP start codon was mutated (pBYRV1 mS-GFP), which abolished GFP production despite the presence of an intact start codon in the GFP gene (
Additionally, a small intervening sequence between the MP and CP coding sequences was required for GFP expression, though GFP expression was still low in this configuration. This suggests a role for the native CP coding sequence in efficient CP production. Fusion of GFP directly downstream from the LIR resulted in robust GFP production, indicating that the low levels of observed GFP expression with CP replacements likely did not result from a lack of transcriptional capacity by the LIR promoter, providing further support for translation control as the key determining factor in MP/CP production. When GFP was placed in an optimal translation initiation context (ACAAUG) (Sugio et al., 2010), especially with the TMV 5′ UTR, a known translational enhancer (Gallie, 2010), very high levels of GFP were produced from the LIR promoter (
3. Coexpression of BDMV MP and NSP with BeYDV GFP Replicons
Previous attempts to create a recombinant mastreviral system capable of cell-to-cell movement using the maize streak virus CP and MP were unsuccessful (Palmer et al., 2003). In agreement with these results, our experiments with the BeYDV MP and CP either from separate expression vectors, on BeYDV replicons, or from wildtype genomes all failed to achieve cell-to-cell movement of recombinant genomes. Instead, the potential for begomovirus movement proteins to interact with recombinant mastreviral genomes was investigated as they have been reported to interact with DNA molecules in a sequence nonspecific manner. The BDMV MP and NSP were each separately cloned with an HA epitope tag into an agrobacterium T-DNA binary vector under the control of the strong 35S promoter, tobacco etch virus 5′ UTR, and soybean vspB terminator. This vector was previously used to efficiently produce BeYDV Rep and RepA in Nicotiana benthamiana leaves (Huang et al., 2009). Each vector was separately agroinfiltrated into the leaves of Nicotiana benthamiana, and harvested leaf tissue was found to produce readily detectable MP and NSP (
To assess the interaction between BeYDV replicons and the BDMV MP and NSP, the replicating vector pBYR-L5GFP was compared with or without coinfiltration of 35S-MP and 35S-NSP. While the vector alone produced intense green fluorescence, GFP expression was strongly inhibited by addition of MP and NSP together (
BDMV NSP strongly inhibited GFP replication and expression from genome-sized BeYDV replicons when produced from the strong 35S promoter (
Increased cell death was also observed with overexpression of NSP (
In support of the general sequence-nonspecific transport capabilities of the BDMV MP and NSP to move genome-sized DNA molecules, coexpression of each by the NOS promoter caused an increase in GFP fluorescent area produced by recombinant mastreviral replicons (
In native begomovirus infection, MP/NSP are expressed from replicating DNAs (DNA B), which, along with a rep-supplying replicon (DNA A), spread together from cell-to-cell. To more authentically model native replicon movement, a chimeric BeYDV/BDMV vector was created which expresses BDMV MP and NSP from the BeYDV bidirectional LIR promoter. The native BeYDV replication proteins were replaced by the BDMV MP, and the BeYDV coat and movement proteins were replaced by the BDMV CP. Importantly, while this vector is incapable of replicating on its own, it contains all of the necessary cis-elements for replication, and thus is capable of replication when Rep and RepA are supplied in trans from a replication-competent BeYDV vector (Mor et al., 2003). The chimeric BeYDV/BDMV genome uses the replication and transcription elements from BeYDV to produce MP and NSP from BeYDV replicons.
Geminiviruses contain bidirectional terminator elements at the ends of the c-sense and v-sense genes. For BeYDV and BDMV DNA-B, efficient termination requires the upstream coding sequence of the gene be terminated, the SIR in the case of BeYDV, and also the downstream reverse coding sequence of the opposite-sense gene (Diamos and Mason, 2018a). Geminivirus gene products are temporally regulated: in the early stages of infection, complementary-sense nonstructural gene products predominate, which then activate virion-sense gene products late in infection (Muñoz-Martin et al., 2003). Native NSP production requires transactivation late in infection by AC2 (Berger and Sunter, 2013), so NSP was inserted under the control of the late-acting virion-sense LIR promoter, which is similarly controlled by transactivation by Rep/RepA to mimic the native configuration of DNA-B.
To optimize expression of MP and NSP, and to modify the size of the vector, various vector configurations were constructed with different relative positions of the MP and NSP, and with modified 5′ UTR, terminator, and promoter elements (Table 1). Each of these modified hybrid vectors were then combined with the replication-competent GFP vector pBYR-L5GFP to create a single vector containing both replicons placed in tandem and separated by a LIR (
Hybrid BDMV/BeYDV vectors were compared to the original vector pBYR-L5GFP, which lacks MP/NSP, at a low agrobacterium OD600 of 0.002 to allow monitoring of individual GFP foci for movement. Numerous MP/NSP vector iterations strongly inhibited GFP expression, likely due to improper expression levels of MP/NSP. By contrast, several vector configurations produced GFP spots which strongly increased in fluorescent size between 4-8 DPI, whereas GFP spots infiltrated with pBYR-L5GFP reached peak fluorescence around 4 DPI and remained unchanged thereafter (
The hybrid BDMV/BeYDV vectors provided very high levels of GFP expression even when the agrobacterium concentration was reduced by a factor of 10, unlike vectors lacking the BDMV MP and NSP (
Mutation of the LIR v-sense TATA-box (TATAAA to TATAAG) decreased promoter activity by an estimated 50% without impacting replication (
When the native 3′ ends of BDMV DNA-B, including the wildtype intergenic region, were used in the chimeric vector pBYBDp, GFP fluorescent area was strongly reduced (
To further study the cell-to-cell movement of hybrid BDMV/BeYDV vectors, fluorescence microscopy of agroinfiltrated leaf tissue was performed. Leaves of Nicotiana benthamiana were agroinfiltrated with either hybrid BeYDV/BDMV vectors containing MP/NSP, or pBYR-L5GFP lacking MP/NSP, using a low agrobacterium OD600 of 0.0002 to produce predominately isolated infected cells. As a control for authentic geminiviral movement, the T-DNA vector pBDA-GFP, which contains BDMV DNA-A modified to produce GFP in place of the coat protein (Sudarshana 1998), was agroinfiltrated either alone or in combination with pBDB, a T-DNA vector containing BDMV DNA-B to supply MP and NSP in their native configuration. Leaf spots agroinfiltrated with only pBDA-GFP contained mostly isolated fluorescent cells, with an average fluorescent cell cluster size of 1.2±0.1 cells at 6 DPI. By contrast, leaf spots coinfiltrated with pBDA-GFP and pBDB produced predominately clusters of fluorescent cells, with an average fluorescent cluster size of 2.4±0.2 (
By fluorescence microscopy, MP and NSP expressing replicons produced fluorescent cell clusters similar in size to those reported for BDMV replicons (Gilbertson et al., 2003; Levy and Czosnek, 2003), which agreed with our results coinfiltrating BDMV DNA-B and DNA-A (
The BDMV MP and NSP have been reported to bind DNA in a size-dependent manner. To test whether chimeric BeYDV/BDMV vectors were size-restricted, a dual-replicon vector (pBYBDf-3.9) was constructed which contained an unmodified MP/NSP replicon as well as a substantially larger 3.9 kb GFP replicon. The larger replicon was constructed by insertion of a 35S promoter driving GFP, as well as insertion of a longer form of the extensin 3′ UTR. These modifications were designed to increase replicon size while minimally altering the activity of the vector, as the LIR and 35S promoters are both strong, and the short and long forms of the extensin terminator have not been found to vary substantially in activity in BeYDV vectors (Rosenthal et al., 2018).
Using size-increased mastrevirus replicons, movement function by MP and NSP was inhibited by even a small increase from a 2.5 kb to a 3.0 kb replicon, and severely inhibited with a 3.9 kb replicon (
Efficient GFP spreading required genome-size replicons (
Taken together, these data strongly suggest that the observed increase in GFP fluorescence results from cell-to-cell movement, not from an increase in GFP expression in individual cells or from diffusion of GFP between cells.
7. Characterization of AbMV MP and NSP Expression with BeYDV Replicons
The AbMV MP and NSP have shown similar DNA-binding properties to BDMV (Hehnle et al., 2004). AbMV is restricted to the phloem, whereas the related BDMV can spread through epidermal, cortical and phloem cells in Phaseolus vulgaris (Wang et al., 1996; Wege et al., 2000). Attempts to overexpress AbMV MP and NSP in transgenic plants have failed due to the toxic effects of the proteins, however successful expression was achieved using a transient inducible system (Kleinow et al., 2009). Prior studies have found that complementing the DNA-A from AbMV with the DNA-B of BDMV conferred enhanced tissue invasion to the AbMV DNA-A, successfully moving AbMV out of the phloem (Levy and Czosnek, 2003). Interestingly, the DNA-B from AbMV did not limit the movement capacity of BDMV DNA-A, despite its phloem limitation when paired with its own DNA-A. Additionally, a begomovirus lacking DNA-B entirely was complemented in movement function by both a curtovirus and a topocuvirus mixed infection (Briddon and Markham, 2001).
To explore whether AbMV MP and NSP can also function with mastreviral replicons in planta, AbMV MP and NSP was produced in Nicotiana benthamiana leaves. Despite the phloem limitation of the native AbMV, AbMV NSP interacts with BeYDV replicons similarly to BDMV (
Chimeric AbMV/BeYDV dual replicon vectors modeled after functional BDMV/BeYDV vectors were constructed and tested for their capacity to provide functional cell-to-cell movement. Similar to the results observed with BDMV, significant increases in leaf fluorescent area were observed with the AbMV MP and NSP (vector pBYAMa) when agroinfiltrated at low concentrations, which corresponded to increased numbers of adjacent fluorescent cells (
These data also demonstrate that the phloem limitation of AbVM does not arise from the intrinsic function of the MP and NSP themselves but rather due to insufficient MP and NSP expression by AbMV in non-phloem cells.
a. Agroinfiltration of Nicotiana benthamiana Leaves
Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old Nicotiana benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 min at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to the OD600 indicated in each experiment. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang and Mason, 2004). Plant tissue was harvested between 4-8 days post infiltration (DPI) as indicated in each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, Calif.). GFP fluorescent cells were observed with a Zeiss Axio Scope A1.
b. Protein Extraction, SDS-PAGE, and Western Blot
Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, N.Y.) following the manufacturer's instruction. The crude plant extract was clarified by centrifugation at 13,000 g for 10 min at 4° C.
Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad, Hercules, Calif., USA). For GFP fluorescence, PAGE gels were visualized under UV illumination (365 nm). PAGE gels were stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. The 26 kDa band corresponding to GFP was analyzed using ImageJ software to quantify the band intensity (Gassmann et al., 2009). For western blot, polyacrylamide gels were transferred to PVDF membranes, blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) for 1 h at 37° C. and probed in succession with rabbit anti-HA (1:2000) and goat anti-rabbit IgG-horseradish peroxidase conjugated (Sigma-Aldrich, St. Louis, Mo.) diluted 1:10,000 in 1% PBSTM. Bound antibody was detected with ECL reagent (Amersham, Little Chalfont, United Kingdom).
c. Plant DNA Extraction and Replicon Visualization
Agroinfiltrated leaf samples (100 mg) were harvested and ground to a fine powder in liquid nitrogen. Total DNA was extracted from ground leaf samples using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. DNA (1 μg) was separated on 1% agarose gels stained with ethidium bromide and visualized under UV light to observe replicon production.
  
Virology 2006; 344:169-184.
This application claims the benefit of and priority to U.S. provisional patent application 62/916,211, filed Oct. 16, 2019, the entirety of the disclosure of which is hereby incorporated by this reference thereto.
| Number | Date | Country | |
|---|---|---|---|
| 62916211 | Oct 2019 | US |