Patent Application
20110104750
Galactofuranose (Galf) is a sugar that is absent in mammals but present in a variety of microbes, often within proteins that are glycosylated. The synthesis of UDP-galactofuranose, the source of galactofuranose in glycoproteins, is catalyzed by the enzyme UDP-galactopyranose mutase (UGM) (EC 5.4.99.9), which catalyzes the rearrangement of UDP-galactopyranose (Galp) to UDP-galactofuranose. Using UDP-galactofuranose as a substrate, the enzyme UDP-galactofuranose transferase adds galactofuranose residues to a glycoprotein. Certain proteins secreted by certain filamentous fungi, e.g., A. niger, have been shown to have terminal Galf residues (Wallis et al., 2001, Eur J Biochem 268:4134-4143).
This disclosure relates to filamentous fungi having reduced UDP-galactofuranose and filamentous fungi that produce glycoproteins having reduced galactofuranose content.
Literature of interest includes: published U.S. patent applications 20060041113, 20050164351, 20060040353 and 20050208623, and the following references: Beverley et al (Eukaryotic Cell. 2005 June; 4: 1147-1154); Bakker et al (Biol. Chem. 2005 386:657-61); Wallis et al (2001, Eur. J. Biochem. 268:4134-4143) and Abstracts 33 and 47 of the 16th Joint Meeting of the Belgian Working Group for Glycosciences, Oct. 27-29, 2005. This literature is incorporated by reference herein for all purposes.
A filamentous fungal cell having reduced UDP-galactofuranose and reduced galactofuranose (Galf) is provided. The fungal cell may, in certain embodiments, contain a nuclear genome comprising an inactivated UDP-galactopyranose mutase (UDP-galp mutase) gene and in some embodiments further comprise a recombinant nucleic acid for expression of a protein. Also provided are methods of producing a protein using the subject fungal cell, as well as methods of producing the subject fungal cell.
In one embodiment, a recombinant filamentous fungal cell comprising a nuclear genome comprising an inactivated UDP-galactopyranose mutase (UDP-galp mutase) gene, wherein the fungal cell further comprises a recombinant nucleic acid for expression of a protein in the cell, is provided.
In certain embodiments, the UDP-galP mutase gene may contain a deletion, an insertion, or a rearrangement.
The fungal cell may be an Aspergillus cell such as an Aspergillus niger cell or an Aspergillus oryzae cell.
In certain embodiments, the protein may be a glycosylated protein. The glycosylated protein may be heterologous to the cell, native to the cell. In certain embodiments, the protein may be a therapeutic protein, an antibody protein or an enzyme such as an amylase, protease, cellulase, xylanase or phytase, for example.
The nuclear genome may comprise at least two inactivated UDP-galactopyranose mutase genes.
In certain embodiments, the protein may have reduced galactofuranose content, as compared to the protein produced in an equivalent cell comprising a nuclear genome comprising an intact UDP-galactopyranose mutase gene.
In certain embodiments, the cell may further comprise a recombinant nucleic acid for expression of a mannosidase.
A method of producing a protein, comprising: culturing the above-recited cell in culture medium under conditions suitable to produce the protein is also provided. The protein may, in certain embodiments, be a glycosylated protein, a therapeutic protein, or an enzyme, for example.
The method may further comprise: recovering the protein from the culture medium.
A method of making a subject cell, comprising: a) introducing a recombinant nucleic acid into a filamentous fungal cell so that the recombinant nucleic acid recombines with the UDP-galactopyranose mutase gene of the genome of the cell; and b) introducing a second recombinant nucleic acid into the cell that provides for expression of the protein, is also provided.
In certain embodiments, the nucleic acid inserts into the UDP-galactopyranose mutase gene.
The nucleic acid may delete at least a portion of the UDP-galactopyranose mutase gene.
Certain aspects of the following detailed description are best understood when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures:
a and 6b schematically show the vector construction scheme for inactivating a UDP-Galp mutase gene.
A. nidulans UDP-Galp mutase gene sequence (top; SEQ ID NO:1) and A. nidulans UDP-Galp mutase predicted amino acid sequence (bottom; SEQ ID NO:2)
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein. Still, certain terms are defined below for the sake of clarity and ease of reference.
The term “recombinant” when used in reference to a cell, nucleic acid, protein or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express nucleic acids or polypeptides that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed, over expressed or not expressed at all.
The terms “protein” and “polypeptide” are used interchangeably herein. The conventional one-letter or three-letter code for amino acid residues is used'herein.
The term “antibody protein” refers to a protein containing one or more polypeptides that specifically binds an antigen. Included by this term are antibodies of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, Fd, Fab′, Fv, F(ab′)2 antibodies, antibody fragments that retain specific binding to antigen, monoclonal antibodies, chimeric antibodies, humanized antibodies, single-chain antibodies, bi-functional (i.e. bi-specific) hybrid antibodies and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein.
A “signal sequence” means a sequence of amino acids present at the N-terminal portion of a protein which facilitates the secretion of the mature form of the protein outside the cell. The definition of a signal sequence is a functional one. The mature form of the extracellular protein lacks the signal sequence which is cleaved off during the secretion process.
A “gene” refers to a DNA segment that is involved in producing a polypeptide and includes regions preceding and following the coding regions, e.g., the promoter and terminator, as well as intervening sequences (introns) between individual coding segments (exons).
An “inactivated gene” is a locus of a genome that, prior to its inactivation, was capable of producing a protein, i.e., capable of being transcribed into an RNA that can be translated to produce a full length polypeptide. The gene is inactivated in that it does not produce a full length protein. A gene may be inactivated by altering a sequence required for its transcription, by altering a sequence required for RNA processing, e.g., splicing, by altering a sequence required for translation, for example, a deleted gene, a gene containing a deleted region, a gene containing a rearranged region, and a gene containing an insertion are types of inactivated gene. A gene may also be inactivated using RNAi, antisense, or any other method that abolishes gene expression.
The term “nucleic acid” encompasses DNA, RNA, single stranded or double stranded and chemical modifications thereof. The terms “nucleic acid” and “polynucleotide” may be used interchangeably herein. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present invention encompasses polynucleotides which encode a particular amino acid sequence.
A “vector” refers to a polynucleotide sequence designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.
An “expression vector” as used herein means a DNA construct comprising a DNA sequence which is operably linked to a suitable control sequence capable of effecting expression of a protein in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation.
A “promoter” is a regulatory sequence that is involved in binding RNA polymerase to initiate transcription of a gene.
“Under transcriptional control” is a term well understood in the art that indicates that transcription of a polynucleotide sequence, usually a DNA sequence, depends on its being operably linked to an element which contributes to the initiation of, or promotes transcription.
“Under translational control” is a term well understood in the art that indicates a regulatory process which occurs after mRNA has been formed.
As used herein when describing proteins and genes that encode them, the term for the gene is capitalized and is italicized, (e.g., the gene that encodes a UDP-galactopyranose mutase may be denoted as UGM). The term for the protein is generally not italicized and capitalized, (e.g., the protein encoded by the UGM gene may be denoted as UGM).
The term “operably linked” refers to juxtaposition wherein the elements are in an arrangement allowing them to be functionally related. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence.
The term “selective marker” refers to a protein capable of expression in a host that allows for ease of selection of those hosts containing an introduced nucleic acid or vector. Examples of selectable markers include but are not limited to antimicrobials (e.g., hygromycin, bleomycin, or chloramphenicol) and/or genes that confer a metabolic advantage, such as a nutritional advantage on the host cell.
The term “derived” encompasses the terms “originated from”, “obtained” or “obtainable from”, and “isolated from”.
“Host strain” or “host cell” means a suitable host for an expression vector or DNA construct comprising a polynucleotide encoding a polypeptide. In specific embodiments, the host strains may be a filamentous fungal cell. The term “host cell” includes both cells and protoplasts.
The term “filamentous fungi” refers to all filamentous forms of the subdivision Eumycotina (See, Alexopoulos, C. J. (1962), INTRODUCTORY MYCOLOGY, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, glucans, and other complex polysaccharides. The filamentous fungi of the present invention are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic.
A “non-pathogenic” filamentous fungi is a strain that is not pathogenic to humans.
The term “culturing” refers to growing a population of microbial cells under suitable conditions in a liquid or solid medium.
The term “heterologous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that does not naturally occur in a host cell. In some embodiments, the protein is a commercially important industrial protein. It is intended that the term encompass proteins that are encoded by naturally occurring genes, mutated genes, and/or synthetic genes. The term “homologous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that occurs naturally in the host cell.
The terms “recovered”, “isolated”, and “separated” as used herein refer to a protein, cell, nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
As used herein, the terms “transformed”, “stably transformed” and “transgenic” used in reference to a cell means the cell has a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained through multiple generations.
As used herein, the term “expression” refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. The process includes both transcription and translation.
The term “introduced” in the context of inserting a nucleic acid sequence into a cell, means “transfection”, or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
As used herein the term “specific activity” means an enzyme unit defined as the number of moles of substrate converted to product by an enzyme preparation per unit time under specific conditions. Specific activity is expressed as units (U)/mg of protein.
The term “glycosylation” refers to the post-transcriptional modification of a protein by the addition of carbohydrate moieties, wherein the carbohydrate is either N-linked or O-linked resulting in a glycoprotein. An N-linked carbohydrate moiety of a glycoprotein is attached by a glycosidic bond to the β-amide nitrogen of an asparagine residue. An O-linked carbohydrate is attached by a glycosidic bond to a protein through the hydroxy group of a serine or a threonine residue.
The term “equivalent fungal cell” refers to a fungal cell grown under essentially the same conditions as a subject fungal cell and which does not include an inactivated UDP-galactofuranose mutase gene. In some embodiments, the equivalent fungal cell has not been altered using the methods described below.
The term “hybridization” refers to the process by which a strand of nucleic acid joins with a complementary strand through base pairing as known in the art. A nucleic acid is considered to be “Selectively hybridizable” to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions. Moderate and high stringency hybridization conditions are known (see, e.g., Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons 1995 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold Spring Harbor, N.Y.). One example of high stringency conditions include hybridization at about 42 C in 50% formamide, 5×SSC, 5×Denhardt's solution, 0.5% SDS and 100 ug/ml denatured carrier DNA followed by washing two times in 2×SSC and 0.5% SDS at room temperature and two additional times in 0.1×SSC and 0.5% SDS at 42 C.
Other definitions of terms may appear throughout the specification.
A filamentous fungal cell having reduced UDP-galactofuranose is provided. The fungal cell may, in certain embodiments, contain a nuclear genome comprising an inactivated UDP-galactopyranose mutase (UDP-galp mutase) gene and a recombinant nucleic acid for expression of a protein. Also provided are methods of producing a protein using the subject fungal cell, as well as methods of producing the subject fungal cell.
Before the exemplary embodiments are described in more detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a gene” includes a plurality of such candidate agents and reference to “the cell” includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
As noted above, a recombinant filamentous fungal cell having reduced UDP-galactofuranose is provided. In general terms, the subject fungal cell may have less than about 50%, e.g., less than about 40%, less than about 30%, less than about 20%, or less than about 10% of the UDP-galactofuranose of an equivalent fungal cell. In certain embodiments, the subject cell may have less than about 5% of the UDP-galactofuranose of an equivalent fungal cell. In other embodiments, UDP-galactofuranose may be undetectable in the subject fungal cell. The presence of UDP galactofuranose may be assessed by known methods, e.g., the method of Lee et al, Anal Biochem. 1996 242:1-7.
In particular embodiments, the subject cell may secrete a glycosylated protein having a reduced galactofuranose content (e.g., less than about 50%, e.g., less than about 40%, less than about 30%, less than about 20%, less than about 10%, or less than about 5%), as compared to the same protein secreted by an equivalent fungal cell. In certain embodiments, galactofuranose may be undetectable in the secreted protein. In other words, in certain embodiments a glycosylated protein secreted by the subject fungal cell may contain reduced or no galactofuranose, as compared the same protein secreted by an equivalent fungal cell that has not been altered using the instant methods. The galactofuranose content of a secreted glycoprotein may be assessed by established methods, e.g., using the DSA-FACE method of Callewaert et al. (Glycobiology 2001 11:275-281), or by the methods of Hemming et al (Anal Biochem. 2000 279:136-41) or Groisman et al (Eur. J. Biochem. 1987 65:327-32). The protein secreted by the cell may be a protein that is endogenous to the cell (i.e., a native protein), or a protein that is not native to the cell (i.e., a recombinant protein). In certain embodiments, the protein may be an antibody protein such as a monoclonal antibody, or another protein that is glycosylated by the fungal cell prior to secretion. Examples of such proteins are set forth below.
Fungal cells that secrete glycoproteins having reduced galactofuranose content may be produced using many different approaches. For example, in one embodiment, the galactofuranosyl transferase gene of the fungal cell may be inactivated to produce a fungal cell having reduced or no galactofuranosyl transferase. Since galactofuranosyl transferase activity is required for the transfer of galactofuranosyl residues onto secreted proteins, a cell having an inactivated galactofuranosyl transferase gene would contain reduced or no galactofuranose content. In an alternative embodiment, a galactofuranosidase may be produced in the cell to cleave galactofuranose residues from a glycosylated protein. Galactofuranosidase has been purified from A. niger by Wallis et al (Biochim. Biophys. Acta 2001 1525:19-28).
In one embodiment that will be described in greater detail below, the subject fungal cell is made by reducing the expression of UDP-galactopyranose mutase (UGM) in the cell, where, as noted above, UDP-galactopyranose mutase is the enzyme that catalyzes the rearrangement of UDP-galactopyranose (Galp) to UDP-galactofuranose (Gait) prior to transfer of the galactofuranose residue onto a protein. The UGM protein may be referred to as UDP-galactopyranose:UDP-galactofuranose mutase or UDP-galactofuranose mutase in other literature. The UGM protein described herein has an activity described as EC 5.4.99.9, according to IUMBM enzyme nomenclature.
In certain embodiments therefore, a subject cell may have reduced (e.g., undetectable) UDP-galactopyranose mutase activity (e.g., less than about 50%, e.g., less than about 40%, less than about 30%, less than about 20%, less than about 10%, or less than about 5% of the UDP-galactopyranose mutase activity) as compared to an equivalent fungal cell that has not been altered using the method described below. UDP-galactopyranose mutase activity assays may be determined using the methods of Beverley et al (Eukaryotic Cell. 2005 June; 4: 1147-1154).
UDP-galactopyranose mutase expression may be reduced in a fungal cell using a number of methods, including methods that employ antisense molecules, RNA interference, or ribozymes, for example. In certain embodiments, however, expression of UDP-galactopyranose mutase may be reduced by inactivating one or more of the genes encoding the UDP-galactopyranose mutase in the cell. Genes encoding UDP-galactopyranose mutase are termed UGM genes herein. Such genes may be referred to as GLF genes in some disclosures. A fungal cell that has not been altered by the methods described herein may contain one, two or three or more UGM genes. In certain embodiments, therefore, a fungal cell containing one or more (e.g., one, two or three or more) inactivated UGM genes is provided, depending on the number of UGM genes present in the genome of the cell.
The DNA sequences of several fungal UGM genes and the proteins encoded by those genes have been determined and deposited into NCBI's Genbank database. Further, several conserved domains of UDP-galactopyranose mutase have been identified, as well as a number of conserved amino acids, allowing the identification of further fungal UGM genes by bioinformatic methods (see, e.g., FIG. 1 of Bakker, supra and FIG. 1 of Beverley, supra). Methods for identifying UGM genes in filamentous fungi are set forth in Beverley et al supra and Bakker et al, supra.
In certain embodiments, a UGM gene may have: a) at least 70% (e.g., at least 80%, at least 90%, at least 95%, at least 97% or at least 98% sequence identity) to a UGM sequence deposited in NCBI's Genbank database or depicted in
A subject fungal cell may be constructed using any convenient method, for example, by altering the sequence of the UGM gene of the cell by making an insertion, deletion, replacement, or rearrangement in the gene for example. The portion of the gene to be altered may be, for example, the coding region or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence of a gene may be a promoter sequence or a functional part thereof, i.e., a part which is necessary for expression of the gene.
In one embodiment, the subject fungal cell may be constructed by gene deletion methods. Gene deletion techniques enable the partial or complete removal of the gene thereby eliminating their expression. In such methods, the deletion of the gene may be accomplished by homologous recombination using a plasmid that has been constructed to contiguously contain the 5′ and 3′ regions flanking the gene.
In another embodiment, the subject fungal cell may be constructed by introducing, substituting, and/or removing one or more nucleotides in the gene or a regulatory element thereof required for the transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, removal of a splice cite, or a frame-shift of the open reading frame. Such a modification may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. See, for example, Botstein and Shortie, 1985, Science 229: 4719; Lo et al., 1985, Proceedings of the National Academy of Sciences USA 81: 2285; Higuchi et al., 1988, Nucleic Acids Research 16: 7351; Shimada, 1996, Meth. Mol. Biol. 57: 157; Ho et al., 1989, Gene 77: 61; Horton et al., 1989, Gene 77: 61; and Sarkar and Sommer, 1990, BioTechniques 8: 404.
In another embodiment, the subject fungal cell may be constructed by gene disruption techniques by inserting into the gene of interest an integrative plasmid containing a nucleic acid fragment homologous to the gene which will create a duplication of the region of homology and incorporate vector DNA between the duplicated regions. Such gene disruption can eliminate gene expression if the inserted vector separates the promoter of the gene from the coding region or interrupts the coding sequence such that a non-functional gene product results. A disrupting construct may be simply a selectable marker gene accompanied by 5′ and 3′ regions homologous to the gene. The selectable marker enables identification of transformants containing the disrupted gene.
In another embodiment, the subject fungal cell may be constructed by the process of gene conversion (see, for example, Iglesias and Trautner, 1983, Molecular General Genetics 189: 73-76). For example, in the gene conversion method, a nucleotide sequence corresponding to the gene(s) is mutagenized in vitro to produce a defective nucleotide sequence which is then transformed into the parent strain to produce a defective gene. By homologous recombination, the defective nucleotide sequence replaces the endogenous gene.
In an alternative embodiment, the subject fungal cell may be constructed using random or specific mutagenesis using methods that include, but are not limited to, chemical mutagenesis (see, for example, Hopwood, The Isolation of Mutants in Methods in Microbiology (J. R. Norris and D. W. Ribbons, eds.) pp 363-433, Academic Press, New York, 1970) and insertional mutagenesis, such as transposition (see, for example, Youngman et al., 1983, Proc. Natl. Acad. Sci. USA 80: 2305-2309). Modification of the gene may be performed by subjecting the parent strain to mutagenesis and screening for mutant strains in which expression of the gene has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, for example.
Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N′-nitro-N-nitrosoguanidine (MNNG), N-methyl-N′-nitrosogaunidine (NTG) O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the parent strain to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and selecting for mutants exhibiting reduced or no expression of a gene.
As noted above, the subject fungal cell is a filamentous fungal cell. In certain embodiments, the cell may be non-pathogenic, i.e., non-pathogenic to humans. In particular embodiments, the cells may be filamentous fungal cells of a strain that has a history of use for production of proteins that has GRAS status, i.e., a Generally Recognized as Safe, by the FDA.
In particular embodiments, the subject fungal cell may be a cell of the following species: Trichoderma, (e.g., Trichoderma reesei (previously classified as T. longibrachiatum and currently also known as Hypocrea jecorina), Trichoderma viride, Trichoderma koningii, and Trichoderma harzianum)); Penicillium sp., Humicola sp. (e.g., Humicola insolens and Humicola grisea); Chrysosporium sp. (e.g., C. lucknowense), Gliocladium sp., Aspergillus sp. (e.g., Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus kawachi, Aspergillus aculeatus, Aspergillus japonicus, Aspergillus sojae, and Aspergillus awamori), Fusarium sp., Neurospora sp., Hypocrea sp., or Emericella sp. (See also, Innis et al., (1985) Sci. 228:21-26), among others. In some embodiments, subject fungal cells may be strains of Aspergillus niger which include ATCC 22342, ATCC 44733, ATCC 14331 and strains derived therefrom. In some embodiments, a host cell may be one wherein native genes have been deleted or inactivated. For example genes corresponding to protease genes or genes corresponding to cellulase genes.
In one embodiment, the subject fungal cell may contain a recombinant nucleic acid for expression of a protein in the cell. The protein may be not native to the cell (i.e., heterologous) or native to the cell (i.e., endogenous to the cell). The protein may be expressed using a number of different protocols, e.g., by use of an expression cassette for production of the protein, by operably linking a nucleic acid encoding the protein to a promoter that is part of the genome of the cell with another promoter, or by replacing the promoter that is part of the genome of the cell, for example.
In one embodiment, the protein may be, for example, an enzyme, e.g., a so-called “industrial enzyme”, or a protein having therapeutic activity such an antibody.
In some embodiments, the nucleic acid encoding a protein may be operably linked to a suitable promoter. The promoter may be derived from genes encoding proteins either homologous or heterologous to the host cell. The promoter may be a truncated or hybrid promoter. Further the promoter may be an inducible or constitutive promoter. Preferably the promoter is useful in an Aspergillus or Trichoderma host. Suitable nonlimiting examples of promoters include cbh1, cbh2, egl1, pepA, hfb1, hfb2, xyn1 and amy. In some embodiments, the promoter will be a Trichoderma reesei cbh1 promoter. In other embodiments the promoter will be derived from the genes encoding an Aspergillus awamori or Aspergillus niger glucoamylase (glaA) (Nunberg et al., (1984) Mol. Cell Biol. 4:2306-2315 and Boel et al., (1984) EMBO J. 3:1581-1585), an Aspergillus niger alpha amylase, an Aspergillus oryzae TAKA amylase or a Rhizomucor miehei aspartic proteinase.
In some embodiments a vector comprising a nucleic acid encoding a protein of interest will include a selectable marker. Examples of selectable markers include but are not limited to ones that confer antimicrobial resistance (e.g. hygromycin, bleomycin, chloroamphenicol and phleomycin). Genes that confer metabolic advantage, such as nutritional selective markers also find use in the invention. Some of these markers include amdS, argB and pyr4. Reference is made to Kelley et al., (1985) EMBO J. 4: 475-479; Penttila et al., (1987) Gene 61:155-164 and Kinghom et al (1992) Applied Molecular Genetics of Filamentous Fungi, Blackie Academic and Professional, Chapman and Hall, London.
In particular embodiments, therefore, the subject fungal cell may be engineered to produce a carbohydrase, such as a liquefying and saccharifying α-amylase, an alkaline α-amylase, a β-amylase, a cellulase; a dextranase, an α-glucosidase, an α-galactosidase, a glucoamylase, a hemicellulase, a pentosanase, a xylanase, an invertase, a lactase, a naringanase, a pectinase pullulanase; a protease such as an acid protease, an alkali protease, bromelain, ficin, a neutral protease, papain, pepsin, a peptidase, rennet, rennin, chymosin, subtilisin, thermolysin, an aspartic proteinase, or trypsin; a lipase or esterase, such as a triglyceridase, a phospholipase, a pregastric esterase, a phosphatase, a phytase, an amidase, an iminoacylase, a glutaminase, a lysozyme, or a penicillin acylase; an isomerase such as glucose isomerase; an oxidoreductases, e.g., an amino acid oxidase, a catalase, a chloroperoxidase, a glucose oxidase, a hydroxysteroid dehydrogenase or a peroxidase; a lyase such as a acetolactate decarboxylase, a aspartic β-decarboxylase, a fumarese or a histadase; a transferase such as cyclodextrin glycosyltranferase; or a ligase, for example. In particular embodiments, the protein may be an aminopeptidase, a carboxypeptidase, a chitinase, a cutinase, a deoxyribonuclease, an α-galactosidase, a β-galactosidase, a β-glucosidase, a laccase, a mannosidase, a mutanase, a pectinolytic enzyme, a polyphenoloxidase, ribonuclease or transglutaminase.
In other embodiments, the protein may be a therapeutic protein such as a glycosylated therapeutic protein (i.e., a protein having a therapeutic biological activity that would be glycosylated in an equivalent cell, e.g., an equivalent cell not altered by the methods described above). Examples of suitable target glycoproteins which may be produced using a subject cell include: erythropoietin, cytokines such as interferon-α, interferon-β, interferon-γ, interferon-o, and granulocyte-CSF, GM-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, antithrombin III, thrombin, soluble IgE receptor α-chain, IgG, IgG fragments, IgG fusions, IgM, IgA, interleukins, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, osteoprotegerin, .alpha.-1-antitrypsin, α-feto proteins, DNase II, kringle 3 of human plasminogen, glucocerebrosidase, TNF binding protein 1, follicle stimulating hormone, cytotoxic T lymphocyte associated antigen 4-Ig, transmembrane activator and calcium modulator and cyclophilin ligand, soluble TNF receptor Fc fusion, glucagon like protein 1 and IL-2 receptor agonist. Monoclonal antibodies are of particular interest.
In certain embodiments, the cell may be engineered so that the recombinant protein (i.e., non-native) produced by the cell may be secreted from the cell into culture media. As such, the cell may further contain a recombinant nucleic acid encoding a fusion polypeptide containing a signal sequence, a protease cleavage site and the protein. In some embodiments, the signal sequence may be one is naturally associated with the polypeptide to be expressed.
In addition to the above-described non-native protein, a subject cell may be further engineered to contain a recombinant nucleic acid for expression of non-native enzyme involved in glycan metabolism. For example, the cell may further express an enzyme for adding monosaccharide residues to a glycosylated protein, removing monosaccharide residues from a glycosylated protein, altering monosaccharide residues on a glycosylated protein, or biosynthesis of a particular monosaccharide. In certain embodiments for example, in order to “trim back” mannose resides, the cell may be engineered to produce a mannosidase (e.g., α-1,2-mannosidase I, mannosidase II, mannosidase IIx, class III mannosidase or an α-mannosidase from T. reesei) to release terminal mannose residues from a protein. In other embodiments, in order to transfer other monosaccharides onto the protein, a glycan transferase may be employed. As such, in particular embodiments: a) a fucosyltransferase, e.g., an α1,2, α 1,3/4 or α 1,3 fucosyltransferase; b) a galactosyltransferase, e.g., an α1,3 β1,4 galactosyltransferase; c) an N-acetylgalactosaminyltransferase, e.g., an α1,3, β1,4α1 or Thr polypeptide acetylgalactosaminyltransferase; d) an N-acetylglucosaminyltransferase, e.g., a β1,2, β1,4, β1,6, GPT or hyaluronan synthetase N-acetylglucosaminyltransferase; e) a sialyltransferase, e.g., a α2,6, α2,3, α2,8 or STX sialyltransferase; f) a glucosyltransferase, e.g., a Alg8 or Alg5 glucosyltransferase; or g) a mannosyltransferase such as an α1,2, α1,3, β1,4, Dpm1, Och1 or Pmt mannosyltransferase may be expressed in the cell. Further description of exemplary transferases is found in published U.S. patent application 20050164351.
If such a glycosylation-related enzyme is expressed in a subject cell, it may be targeted to the endoplasmic reticulum (ER), to the golgi apparatus or to other membrane bound components of the secretory apparatus.
Methods of expressing proteins in filamentous fungi, including methods in which cells are engineered to produce secreted protein include those described in U.S. Pat. Nos. 6,022,725; 6,268,328; and published U.S. patent applications 20060041113, 20060040353, 20060040353 and 20050208623, which publications are incorporated herein by reference. In addition, general methods for the transformation of Aspergillus strains are disclosed in Cao et al., (Protein Sci. 2000 9:991-1001) and Yelton et al., (Proc. Natl. Acad. Sci. 1984 USA 81: 1470-1474) and general methods for the transformation of Trichoderma strains are disclosed in Nevalainen et al., (The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes” in Molecular Industrial Mycology, Eds. Leong and Berka, Marcel Dekker Inc., NY (1992) pp 129-148).
Methods of using the above-described cells are also provided. The proteins produced by the cells may be employed in a variety of methods.
In certain embodiments, the subject methods include: culturing the cell to produce a recombinant protein. In certain embodiments and as discussed above, the protein may be secreted into the culture medium. As such, certain embodiments of the method include the step of recovering the protein from the culture medium.
In some embodiments, a subject fungal cell is cultured under batch or continuous fermentation conditions. A classical batch fermentation is a closed system, wherein the composition of the medium is set at the beginning of the fermentation and is not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a “batch” with respect to the addition of the carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures, cells progress through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of end product.
A variation on the standard batch system is the “fed-batch fermentation” system, which also finds use with the present invention. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Batch and fed-batch fermentations are common and known in the art.
Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth and/or end product concentration. For example, in one embodiment, a limiting nutrient such as the carbon source or nitrogen source is maintained at a fixed rate and all other parameters are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are known. Methods for recovering protein from growth media by any convenient methods.
In one embodiment, a cell engineered in accordance with the above may produce a glycosylated protein that contains fewer or no terminal galactofuranose residues, allowing a co-expressed mannosidase to “trim back” mannose resides on the protein to deglycosylate the protein. If other transferases are expressed in the cell, particularly transferases of mammalian, e.g., human, origin, other residues may be added to the protein, giving the protein a more “human” glycosylation pattern. Such a protein may be less immunoreactive when administered to a human and, in certain embodiment, more active, than the same protein produced in an equivalent cell not engineered according to the above.
The ability to modulate glycosylation patterns in proteins produced by filamentous fungi is important for the production of industrial enzymes and therapeutic proteins.
Also provided are polynucleotides, polypeptides and vectors.
A subject polynucleotide may comprise a sequence set forth in any of the figures, a fragment of one of a sequence set forth in any of the figures (where a “fragment” of a polynucleotide is a contiguous sequence of residues at least about 50 nt or 100 nt to at least about 200 nt to 1000 nt, or greater), or a sequence that hybridizes to one of the sequence set forth in any of the figures under stringent hybridization conditions.
In certain embodiments, a subject polynucleotide may be at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more (i.e. 100%) identical to one of the sequence in the figures. The subject polynucleotide may be a full-length cDNA, for example.
A subject polynucleotide may comprise a sequence set forth in any of the figures, a fragment of one of a sequence set forth in any of the figures (where a “fragment” of a polynucleotide is a contiguous sequence of residues at least about 10 aa or 20 aa to at least about 50 aa to 200 aa, or greater) or a variant polypeptide that has at least about 80%, at least about 90%, or at least about 98% sequence identity to a sequence set forth in the figures.
A subject polypeptide may be naturally-occurring and isolated, recombinant, or not naturally-occurring. In one embodiment, the polypeptide may have UDP-galactopyranose mutase activity.
Polynucleotides encoding a subject polypeptide are also provided. A subject polynucleotide may be present in a vector, for example, a phage, plasmid, viral, or retroviral vector. In certain embodiments, the vector may be an expression vector for expressing a subject polypeptide in a filamentous fungal cell.
A cell comprising an instant vector is also provided.
Also provided are kits. The subject kits at least include one or more of a subject fungal cell. Other optional components of the kit include: a vector adapted for use in the cell, where the vector contains an expression cassette containing restriction sites (i.e., may contain a multiple cloning site) for inserting a protein coding sequence therein. The various components of the kit may be present in separate containers or certain compatible components may be precombined into a single container, as desired.
In addition to above-mentioned components, the subject kits typically further include instructions for using the components of the kit to practice the subject methods. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
Aspergillus niger strain dgr246ΔGAP is a derivative of strain dgr246 P2 (Ward, Wilson nd Kodama, 1993, Appl. Microbiol. Biotechnol. 39:738-743) in which the glucoamylase gene glaA) has been deleted by replacement with the A. niger pyrG gene. Consequently, the pepA encoding an aspartic proteinase and glaA genes have been deleted from the strain, and the strain has been subjected to several rounds of mutagenesis and screening for improved secretion of foreign proteins.
Strain dgr246ΔGAP was grown for 2 days in CM medium pH 6 (2% sucrose, 0.5% yeast extract). Glycans of secreted proteins were analyzed by DSA-FACE using the methods of Callewaert et al., 2001 (Glycobiology 11:275-281) (
The plasmid pFGPDGLAT3-MFManHDEL was described in Vervecken, 2004 (PhD thesis, University of Ghent). It contains an open reading frame encoding the Trichoderma reesei α-1,2-mannosidase with the addition of a C-terminal HDEL amino acid sequence for retention in the endoplasmic reticulum and with the N-terminal signal sequence replaced with the Saccharomyces cerevisiae α-mating factor prepro signal sequence as described by Callewaert et al., 2001, FEBS Lett 503:173-178. The mannosidase open reading frame is under control of the Aspergillus nidulans gpdA promoter and the Aspergillus nidulans trpC terminator (
The transformants were selected on minimal medium containing 5 mM acetamide as sole nitrogen source and 10 mM CsCl to reduce background growth. 21 transformants able to grow on acetamide were identified. Transformants were grown in liquid CM medium for 2 days in 100 mL shake flasks. Total secreted proteins were collected and N-glycans were analyzed by DSA-FACE. 13 out of 21 transformants (
Glycans from dgr246ΔGAP ManHDEL#2 were in vitro treated with α-1,2-mannosidase to evaluate the efficiency of the expressed α-1,2-mannosidaseHDEL (
UDP-Galp mutase genes have been cloned from Aspergillus fumigatus (Bakker et al., 2005, Biol Chem 386:657-661) and Aspergillus nidulans (Hans Bakker, unpublished data). A draft sequence of the A. nidulans UDP-Galp mutase gene was obtained from Dr. Hans Bakker (Medizinische Hochschule Hannover). The A. nidulans sequence (
The unconfirmed DNA sequence and predicted amino acid sequence of one A. niger UDP-Galp mutase homolog was obtained from the A. niger genome database are shown in
A pair of primers (CCGAAGCTTATGCTCAGCCTCGCCCG; SEQ ID NO:12 and CGCGGATCCTTACTGCGCCTGOCTCTTAG; SEQ ID NO:13) were designed to amplify the open reading frame from start to stop codon by PCR. A PCR reaction using genomic DNA from strain dgr246ΔGAP as template was performed using these primers. A fragment of approximately the expected length was obtained and was purified by agarose gel electrophoresis, cloned into the pCR2.1-TOPO cloning vector (Invitrogen, Carlsberg, Calif.) according to the manufacturer's instructions, and sequenced. Some sequence differences were identified. Introns and exons were identified using the Genewise program and by comparison with a publicly available A. niger ESTs and the deduced A. nidulans protein sequence. The corrected sequences are set forth in
To construct a deletion vector for the A. niger UDP-Galp mutase a strategy (illustrated in
Similarly, a fragment containing by 1044-1969 was obtained by PCR using the following primers and cloned into pCR2.1-TOPO: GGCAGATCTGGCGCGCCATCTGGATTGCCGTCGCCG (SEQ ID NO:16; BglII site is underlined) and GCCTCTAGATTAATTAATTACTGCGCCTGGCTCTTACCAAA (SEQ ID NO:17; XbaI site is in bold, PacI site is underlined).
The two fragments were isolated by restriction digest and ligated into a vector with unique PacI, NotI and BglII sites (pBluhCASP-6) to create pBluGalMutKO. See construction scheme
The plasmid pBluGalMutKOhph was cut with PacI and SacII or NotI and PvuII. The desired fragments were isolated after agarose gel electrophoresis (see
To confirm that the UDP-Galp mutase gene had been deleted in the five transformants that showed altered glycan patterns Southern analysis was performed. Genomic DNA was isolated, digested with BamHI, separated by agarose gel electrophoresis, blotted to a membrane and probed with a radioactively labeled BspHI/SphI fragment of the UDP-Galp mutase gene (5′ end). This fragment would be expected to hybridize to a fragment of 6185 bp in the parental strain and to a fragment of 2473 bp in a UDP-Galp mutase deletion strain (see
From the N-glycan profiles (
A second homolog of the UDP-Galp mutase gene was identified by searching the Aspergillus niger genome database. It is possible that this gene is responsible for an activity that leads to residual Galf residues on glycans after deletion of the first UDP-Galp mutase gene. Only a portion of the open reading frame is present within this sequence. This gene may be inactivated using methods similar to those discussed above.
An expression vector is constructed and contains the following components. The promoter and terminator regions from the Aspergillus niger glucoamylase (glaA) gene are operably linked to an open reading frame encoding a fusion protein comprising, from the amino terminus, the A. niger glucoamylase signal sequence, prosequence, catalytic core region and linker region followed by a human IgG1 antibody heavy chain. A KexB cleavage site (Lys Arg) is located after the glucoamylase linker and before the antibody heavy chain so that cleavage after the Arg residue releases the antibody heavy chain from the fusion protein. A second expression vector is constructed and contains the following components. The promoter and terminator regions from the Aspergillus niger glucoamylase (glaA) gene are operably linked to an open reading frame encoding a fusion protein comprising, from the amino terminus, the A. niger glucoamylase signal sequence, prosequence, catalytic core region and linker region followed by a human antibody light chain. A KexB cleavage site (Lys Arg) is located after the glucoamylase linker and before the antibody light chain so that cleavage after the Arg residue releases the antibody light chain from the fusion protein.
The two expression vectors are introduced into A. niger cells by co-transformation. A selectable marker for transformation is either present on at least one of the two expression vectors or may be encoded by a third DNA molecule included during the co-transformation process.
Transformants are obtained and are grown in suitable liquid culture medium. Supernatant samples containing secreted proteins are recovered from the cultures and human antibody is purified. DSA-FACE analysis is performed to determine the size and structure of the N-linked glycan attached to the antibody. It is expected that the glycan is predominantly of the Man5GlcNAc2 form. Further details of the construction and use of the vectors described in this example may be found in WO03089614, which is incorporated by reference herein in its entirety.
The preceding description merely illustrates principles of exemplary embodiments. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions.
Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein.
This patent application claims the benefit of U.S. provisional patent application Ser. No. 60/789,317, filed Apr. 5, 2006, which application is incorporated by reference in its entirety for all purposes.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US2007/008067 | 4/3/2007 | WO | 00 | 8/4/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60789317 | Apr 2006 | US |
