The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 19, 2016, is named 44854-717_201_SL.txt and is 1,341 bytes in size.
Biomolecule based information storage systems, e.g., DNA-based, have a large storage capacity and stability over time. However, there is a need for scalable, automated, highly accurate and highly efficient systems for generating biomolecules for information storage.
Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; providing a flexible structure having a surface; synthesizing a plurality of oligonucleic acids having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleic acids comprises at least about 100,000 oligonucleic acids, and wherein the plurality of oligonucleic acids extends from the surface of the flexible structure; and storing the plurality of oligonucleic acids. Further provided herein are methods wherein synthesizing comprises: depositing nucleosides on the surface at predetermined locations; and moving least a portion of the flexible structure through a bath or emissions from a spray bar. Further provided herein are methods wherein the bath or emissions from a spray bar expose the surface of the structure to an oxidizing reagent or a deblocking reagent. Further provided herein are methods wherein synthesizing further comprises capping the nucleosides deposited on the surface. Further provided herein are methods wherein the nucleosides comprise a nucleoside phosphoramidite. Further provided herein are methods wherein the flexible structure comprises a reel-to-reel tape or a continuous tape. Further provided herein are methods wherein the flexible structure comprises a thermoplastic material. Further provided herein are methods wherein the thermoplastic material comprises a polyaryletherketone. Further provided herein are methods wherein the polyaryletherketone is polyetherketone, polyetherketoneketone, poly(ether ether ketone ketone), polyether ether ketone or polyetherketoneetherketoneketone. Further provided herein are methods wherein the flexible structure comprises nylon, nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene, polyethylene terephthalate, polymethyl methacrylate, polyvinyl chloride, transparent PVC foil, Poly(methyl methacrylate), styrenic polymer, fluorine-containing polymers, polyethersulfone or polyimide. Further provided herein are methods wherein each oligonucleic acid of the plurality of oligonucleic acids comprises from 50 to 500 bases in length. Further provided herein are methods wherein the plurality of oligonucleic acids comprises at least about 10 billion oligonucleic acids. Further provided herein are methods wherein at least about 1.75×1013 nucleobases are synthesized within 24 hours. Further provided herein are methods wherein at least about 262.5×109 oligonucleic acids are synthesized within 72 hours. Further provided herein are methods wherein the item of information is text information, audio information or visual information. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.
Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; providing a structure having a surface; synthesizing a plurality of oligonucleic acids having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleic acids comprises at least about 100,000 oligonucleic acids, wherein the plurality of oligonucleic acids extends from the surface of the structure, and wherein synthesizing comprises: cleaning a surface of the structure; depositing nucleosides on the surface at predetermined locations; oxidizing, deblocking, and optionally capping the nucleosides deposited on the surface; wherein the cleaning, oxidizing, deblocking, and capping comprises moving at least a portion of the flexible structure through a bath or emissions from a spray bar; and storing the plurality of oligonucleic acids. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.
Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; synthesizing a plurality of oligonucleic acids having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleic acids comprises at least about 10,000 oligonucleic acids, wherein the plurality of oligonucleic acids collectively encode for a sequence that differs from the predetermined sequences by no more than 1 base in 1000, and wherein each oligonucleic acid of the plurality of oligonucleic acids comprises from 50 to 500 bases in length; and storing the at least about 10,000 oligonucleic acids. Further provided herein are methods wherein the plurality of oligonucleic acids comprises at least about 100,000 oligonucleic acids. Further provided herein are methods wherein the plurality of oligonucleic acids comprises at least about 1,000,000 oligonucleic acids. Further provided herein are methods wherein the plurality of oligonucleic acids comprises at least about 10 billion oligonucleic acids. Further provided herein are methods wherein greater than 90% of the oligonucleic acids encode for a sequence that does not differ from the predetermined sequence. Further provided herein are methods wherein the item of information is text information, audio information or visual information. Further provided herein are methods wherein the structure is rigid or flexible, and wherein the structure comprises a surface, and wherein the plurality of oligonucleic acids extend from the surface. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.
Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; synthesizing a plurality of oligonucleic acids having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleic acids comprises at least about 10,000 oligonucleic acids, wherein each oligonucleic acid of the plurality of oligonucleic acids comprises from 50 to 500 bases in length, and where the plurality of oligonucleic acids extends from the surface of a flexible structure; and storing the plurality of oligonucleic acids. Further provided herein are methods wherein the flexible structure comprises a reel-to-reel tape or a continuous tape. Further provided herein are methods wherein each oligonucleic acid extends from a feature on the surface of the flexible structure, wherein the feature is about 1 um to about 500 um in diameter. Further provided herein are methods wherein the feature is about 1 um to about 50 um in diameter. Further provided herein are methods wherein the feature is about 10 um in diameter. Further provided herein are methods wherein the flexible structure comprises a thermoplastic material. Further provided herein are methods wherein the thermoplastic material comprises a polyaryletherketone. Further provided herein are methods wherein the polyaryletherketone is polyetherketone, polyetherketoneketone, poly(ether ether ketone ketone), polyether ether ketone or polyetherketoneetherketoneketone. Further provided herein are methods wherein the flexible structure comprises nylon, nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene, polyethylene terephthalate, polymethyl methacrylate, polyvinyl chloride, transparent PVC foil, Poly(methyl methacrylate), styrenic polymer, fluorine-containing polymers, polyethersulfone or polyimide. Further provided herein are methods wherein the flexible structure has a thickness of less than about 10 mm. Further provided herein are methods wherein each oligonucleic acid is about 200 bases in length. Further provided herein are methods wherein at least about 1.75×1013 nucleobases are synthesized within 24 hours. Further provided herein are methods wherein at least about 262.5×109 oligonucleic acids are synthesized within 72 hours. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.
Provided herein are methods for storing information, the method comprising: encrypting at least one item of information in the form of at least one digital sequence to at least one nucleic acid sequence; synthesizing a plurality of oligonucleic acids having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleic acids comprises at least about 10,000 oligonucleic acids, and wherein each oligonucleic acid of the plurality of oligonucleic acids comprises from 50 to 500 bases in length; storing the plurality of oligonucleic acids; sequencing the plurality of oligonucleic acids; decrypting the plurality of oligonucleic acids from a nucleic acid sequence to a digital sequence; and assembling the digital sequence to form the at least one digital sequence, wherein the at least one digital sequence is recovered with 100% accuracy. Further provided herein are methods further comprising releasing the plurality of oligonucleic acids. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.
Provided herein are devices for information storage, comprising: a flexible structure having a surface; and a plurality of features on the surface, wherein each feature has a width of from about 1 to about 500 um, and wherein each feature of the plurality of features is coated with a moiety that binds to the surface and comprises a hydroxyl group available for nucleoside coupling. Further provided herein are devices wherein the flexible structure rests in a curved position. Further provided herein are devices wherein the curved position comprises a curve that is greater than 30 degrees. Further provided herein are devices wherein the curved position comprises a curve that is greater than 180 degrees. Further provided herein are devices wherein the flexible structure comprises at least about 1 million features. Further provided herein are devices wherein the flexible structure has a total surface area of less than about 4.5 m2. Further provided herein are devices wherein the flexible structure comprises more than 2 billion features per m2. Further provided herein are devices wherein the flexible structure comprises a thermoplastic material. Further provided herein are devices wherein the thermoplastic material comprises a polyaryletherketone. Further provided herein are devices wherein the polyaryletherketone is polyetherketone, polyetherketoneketone, poly(ether ether ketone ketone), polyether ether ketone or polyetherketoneetherketoneketone. Further provided herein are devices wherein the flexible structure comprises nylon, nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene, polyethylene terephthalate, polymethyl methacrylate, polyvinyl chloride, transparent PVC foil, Poly(methyl methacrylate), styrenic polymer, fluorine-containing polymers, polyethersulfone or polyimide. Further provided herein are devices wherein the flexible structure has a thickness of less than about 10 mm. Further provided herein are devices wherein each feature is from about 1 um to about 50 um in width. Further provided herein are devices wherein each feature has a diameter of about 10 um. Further provided herein are devices wherein the center of a first feature is about 21 um from the center of a second feature and the first feature and the second feature. Further provided herein are devices wherein the flexible structure comprises a reel-to-reel tape or a continuous tape. Further provided herein are devices wherein each feature comprises a channel.
Provided herein are oligonucleic acid libraries for information storage, comprising a plurality of oligonucleic acids, wherein the plurality of oligonucleic acids comprises at least about 10,000 oligonucleic acids, wherein the plurality of oligonucleic acids collectively encodes for a sequence that differs from an aggregate of predetermined sequences by no more than 1 base in 1000, and wherein each oligonucleic acid of the plurality of oligonucleic acids comprises: a predetermined sequence that, when decrypted, encodes for digital information; and from 50 to 500 bases in length. Further provided herein are libraries wherein the plurality of oligonucleic acids comprises at least about 100,000 oligonucleic acids. Further provided herein are libraries wherein the plurality of oligonucleic acids comprises at least about 10 billion oligonucleic acids. Further provided herein are libraries wherein each oligonucleic acid of the plurality of oligonucleic acids is attached to a surface of a structure by a tether. Further provided herein are libraries wherein the tether comprises a cleavable region having at least one nucleotide chemically modified to detach from the oligonucleic acid in the presence of a cleaving reagent. Further provided herein are libraries wherein the tether comprises from about 10 to about 50 bases. Further provided herein are libraries wherein greater than 90% of the oligonucleic acids encode for a sequence that does not differ from the predetermined sequences. Further provided herein are libraries wherein the digital information encodes for text, audio or visual information. Further provided herein are libraries wherein the library is synthesized in less than 3 days. Further provided herein are libraries wherein the library is synthesized in less than 24 hours.
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
There is a need for larger capacity storage systems as the amount of information generated and stored is increasing exponentially. Traditional storage media have a limited capacity and require specialized technology that changes with time, requiring constant transfer of data to new media, often at a great expense. A biomolecule such as a DNA molecule provides a suitable host for information storage in-part due to its stability over time and capacity for four bit information coding, as opposed to traditional binary information coding. Thus, large amounts of data are encoded in the DNA in a relatively smaller amount of physical space than used by commercially available information storage devices.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which these inventions belong.
Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.
Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers +/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
Nucleic Acid Based Information Storage
Provided herein are devices, compositions, systems and methods for nucleic acid-based information (data) storage. An exemplary workflow is provided in
Information Storage
Provided herein are methods and systems for storing information encoded by biomolecules on a substrate. In some instances, the information is digital data. In some instances, the biomolecules comprise DNA. In some cases, the biomolecules comprise oligonucleic acids. In some instances, methods are provided for the synthesis of the oligonucleic acids onto the substrate. In some instances, the synthesized oligonucleic acids are positioned on the substrate at a high density to encode large and complex amounts of data in a small footprint. Exemplary substrates are flexible, allowing for the manipulation of the substrate during synthesis, storage, and/or data extraction. In some instances, the flexible substrates are configured for rolling onto a reel for long term storage.
To store data in a sequence of DNA, the information is converted from the 1s and 0s of binary code into the code of A, T, G, and C bases of DNA. In some instances, items of information are first encoded in a digital information form. Items of information include, without limitation, text, audio and visual information. Exemplary sources for items of information include, without limitation, books, periodicals, electronic databases, medical records, letters, forms, voice recordings, animal recordings, biological profiles, broadcasts, films, short videos, emails, bookkeeping phone logs, internet activity logs, drawings, paintings, prints, photographs, pixelated graphics, and software code. Exemplary biological profiles sources for items of information include, without limitation, gene libraries, genomes, gene expression data, and protein activity data. Exemplary formats for items of information include, without limitation, .txt, .PDF, .doc, .docx, .ppt, .pptx, .xls, .xlsx, .rtf, .jpg, .gif, .psd, .bmp, .tiff, .png, and .mpeg. In some instances, the binary code of digital sequence is converted into a biomolecule-based (e.g., DNA-based) sequence while preserving the information that the code represents. The amount of individual file sizes encoding for an item of information, or a plurality of files encoding for items of information, in digital format include, without limitation, up to 1024 bytes (equal to 1 KB), 1024 KB (equal to 1 MB), 1024 MB (equal to 1 GB), 1024 GB (equal to 1 TB), 1024 TB (equal to 1PB), 1 exabyte, 1 zettabyte, 1 yottabyte, 1 xenottabyte or more. This converted code (digital binary code to a biomolecule code) is referred to herein as “predetermined” sequence with respect to the deposit of a biomolecule disclosed herein on a surface disclosed herein.
A predetermined sequence comprising the converted DNA code is synthesized into one or a plurality of oligonucleic acids that are supported on a structure (aka substrate) for data storage. In some instances, the oligonucleic acids are synthesized on the substrate using an oligonucleic acid synthesizer device that releases nucleic acid synthesis reagents in a step wise fashion such that that multiple oligonucleic acids extend, in parallel, one residue at a time from the surface of the substrate. Each oligonucleic acid is positioned on distinct regions, or features, of the substrate. In many cases, these regions are positioned in addressable locations of the substrate. In some instances, two or more of the oligonucleic acids on a substrate have sequences that differ. In some instances, two or more of the oligonucleic acids on a substrate have sequences that are the same.
A structure described herein for oligonucleic acid extension during synthesis may be a rigid or flexible material. An exemplary process workflow for de novo synthesis of an oligonucleic acid on a substrate using an oligonucleic acid synthesizer is shown in
In some instances, a substrate that supports the synthesis and storage of oligonucleic acids encoding information comprises a flexible material. In some cases, the flexible material is in the form of a tape. In some cases, substrates having flexible materials are used in a reel-to-reel tape, where a first end of the substrate is attached (reversibly or irreversibly) to a first reel and a second end of the substrate is attached (reversibly or irreversibly) to a second reel. In this manner, the body of the substrate is be wrapped around the first reel, the second reel, or both. The reels of the system are rotatable so that the substrate is transferred between the reels while in use. During an oligonucleic acid synthesis reaction performed on a substrate of a reel-to-reel tape system, sections of the substrate pass through various stages of the synthesis reaction in a production assembly line manner. As an example, a portion of the substrate passes through a stage at which a nucleobase is attached to the substrate during a nucleic acid synthesis reaction. In another example, a portion of the substrate passes through a wash stage of a nucleic acid synthesis reaction. In some cases, one portion of a substrate is positioned at a different stage of a nucleic acid synthesis reaction than another portion of the substrate.
In some instances, a flexible material described herein for oligonucleic acid synthesis comprises continuous tape. In some instances, a substrate for the synthesis and/or storage of oligonucleic acids comprises a flexible material that is rotatable around a rotating drum in a continuous conveyor belt configuration or a “continuous tape system.” In an exemplary continuous tape system, oligonucleic acid synthesis steps are partitioned into zones and regions of the substrate are conveyed continuously through each of the zones. As an example, an oligonucleic acid synthesis reaction proceeds by conveying a flexible substrate from a deposition zone where droplets comprising oligonucleic acid building blocks are deposited and coupled onto the conveyed substrate surface, to one or more processing zones (e.g., capping, oxidation, washing, drying) in a continuous cycle, extending the synthesized oligonucleic acids by a single base in each cycle. In some instances, continuous conveyance of a substrate through an oligonucleic acid synthesis reaction proceeds with more efficiency as compared to an oligonucleic acid synthesis reaction that occurs in distinct steps because multiple chemistries are performed on different regions of the substrate at the same time.
In another exemplary continuous tape system, the entire continuous tape is exposed to a single step in a reaction as the tape proceeds in a rotatable fashion. After each portion of the surface of the tape is exposed to reaction step in a single pass, the next step of the reaction occurs. As an example, an oligonucleic acid synthesis reaction proceeds by conveying the tape through a section of a device that releases an oxidizing reagent. After the entire tape is receives nucleoside monomer deposition, the tape is then exposed to a washing step, followed by a rounds of oxidation, washing, deblocking, washing, capping, washing and then repeating, resulting in extending the synthesized oligonucleic acids by a single base in each cycle.
The DNA code of synthesized and stored oligonucleic acids is read either directly on the substrate, or after extraction from the substrate, by using any suitable sequencing technology. In some cases, the DNA sequence is read on the substrate or within a feature of a substrate. In some cases, the oligonucleic acids stored on the substrate are extracted is optionally assembled into longer nucleic acids and then sequenced.
Provided here are systems and methods configured to synthesize a high density of oligonucleic acids on a substrate in a short amount of time. In some cases, the substrate is a flexible substrate. In some instances, at least about 1010, 1011, 1012, 1013, 1014, or 1015 bases are synthesized in one day. In some instances, at least about 10×108, 10×109, 10×1010, 10×1011, or 10×1012 oligonucleic acids are synthesized in one day. In some cases, each oligonucleic acid synthesized comprises at least about 20, 50, 100, 200, 300, 400 or 500 nucleobases. In an example, at least 10×109, 200 base oligonucleic acids are synthesized within 3 days. In some cases, these bases are synthesized with a total average error rate of less than about 1 in 100; 200; 300; 400; 500; 1000; 2000; 5000; 10000; 15000; 20000 bases.
Oligonucleic acids synthesized and stored on the substrates described herein encode data that can be interpreted by reading the sequence of the synthesized oligonucleic acids and converting the sequence into binary code (“decrypting”) readable by a computer. In a further aspect, provided is a detection system comprising a device capable of sequencing stored oligonucleic acids, either directly on the substrate and/or after removal from the substrate. In cases where the substrate is a reel-to-reel tape of flexible material, the detection system comprises a device for holding and advancing the substrate through a detection location and a detector disposed proximate the detection location for detecting a signal originated from a section of the tape when the section is at the detection location. In some instances, the signal is indicative of a presence of an oligonucleic acid. In some instances, the signal is indicative of a sequence of an oligonucleic acid. In another aspect, described herein are detection methods for detecting and reading a biomolecule stored on a substrate. In cases where the substrate is a flexible material on a reel-to-reel tape, the method comprises sequentially advancing through a fixed position the substrate for sequential detection and reading of bound biomolecules. In some instances, information encoded within oligonucleic acids on a continuous tape is read by a computer as the tape is conveyed continuously through a detector operably connected to the computer. In some instances, a detection system comprises a computer system comprising an oligonucleic acid sequencing device, a database for storage and retrieval of data relating to oligonucleic acid sequence, software for converting DNA code of an oligonucleic acid sequence to binary code, a computer for reading the binary code, or any combination thereof.
In a further aspect of the disclosure, provided is a cassette that comprises a housing and a tape, wherein the tape is a flexible substrate comprising a plurality of attached biomolecules. The tape is housed in the housing such that the tape is advanceable along a path from a first end to a second end of the tape.
Structures
Provided herein are structures (also referred to as substrates) comprising a plurality of features, wherein biomolecules are attached directly or indirectly to a surface of the structure. In many cases, the biomolecules comprise nucleic acid sequences that are synthesized on features of the substrate. In some instances, the features are closely spaced so that a small area of the structure encodes a high density of data. For example, the distance between the centers of two features is from about 1 um to about 200 um, from about 1 um to about 100 um, from about 1 um to about 50 um, from about 1 um to about 25 um, from about 10 um to about 50 um, or from about 10 um to about 25. In some cases, the distance between two features is less than about 100 um, 50 um, 40 um, 30 um, 20 um or 10 um. The size of each feature may range from about 0.1 um to about 100 um, from about 1 um to about 100 um, from about 1 um to about 50 um, or from about 0.1 um to about 100 um. In some cases, each feature is less than about 100 um, 50 um, 20 um, 10 um, or 5 um in diameter. In some instances, each square meter of a structure allows for at least about 107, 108, 109, 1010, 1011 features, where each feature supports one oligonucleic acid. In some cases, the oligonucleic acids have lengths up to about 100, 200, 300, 400, 500 or more bases. In some instances, 109 oligonucleic acids are supported on less than about 6, 5, 4, 3, 2 or 1 m2 of surface of the structure.
To illustrate exemplary dimensions of a structure described herein, reference is made to
Flexible Structures
Provided herein are flexible structures that allow for manipulation during biomolecule attachment, storage and/or reading. The term “flexible” is used herein to refer to a structure that is capable of being bent, folded or similarly manipulated without breakage. In some instances, a flexible structures is bent 180 degrees around a roller. In some instances, a flexible structure is bent about 30 to about 330 degrees around a roller. In some instances, a flexible structure is bent up to about 360 degrees around a roller. In some cases, the roller is less than about 10 cm, 5 cm, 3 cm, 2 cm or 1 cm in radius. In some instances, the structures is bent and straightened repeatedly in either direction at least 100 times without failure (for example, cracking) or deformation at 20° C. In some instances, a structure comprises rigid materials. In some cases, a structure has a thickness that is amenable to rolling. In some cases, the thickness of the structure is less than about 500 mm, 100 mm, 50 mm, 10 mm, or 1 mm. In some cases, the thickness of the structure is less than about 1 mm, 0.5 mm, 0.1 mm, 0.05, 0.01, or thinner.
Exemplary flexible materials described herein include, without limitation, nylon (unmodified nylon, modified nylon, clear nylon), nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene (ABS), polyester films such as polyethylene terephthalate, polymethyl methacrylate or other acrylics, polyvinyl chloride or other vinyl resin, transparent PVC foil, transparent foil for printers, Poly(methyl methacrylate) (PMMA), methacrylate copolymers, styrenic polymers, high refractive index polymers, fluorine-containing polymers, polyethersulfone, polyimides containing an alicyclic structure, rubber, fabric, metal foils, and any combination thereof. Various plasticizers and modifiers may be used with polymeric materials to achieve selected flexibility characteristics.
In some instances, the structure comprises a plastic material. In some instances, the structure comprises a thermoplastic material. Non-limiting examples of thermoplastic materials include acrylic, acrylonitrile butadiene styrene, nylon, polylactic acid, polybenzimidazole, polycarbonate, polyether sulfone, polyetherether ketone, polyetherimide, polyethylene, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, polyvinyl chloride, and polytetrafluoroethylene. In some instances, the structure comprises a thermoplastic material in the polyaryletherketone (PEAK) family. Non-limiting examples of PEAK thermoplastics include polyetherketone (PEK), polyetherketoneketone (PEKK), poly(ether ether ketone ketone) (PEEKK), polyether ether ketone (PEEK), and polyetherketoneetherketoneketone (PEKEKK). In some instances, the structure comprises a thermoplastic material compatible with toluene. In some cases, the flexibility of the plastic material is increased by the addition of a plasticizer. An example of a plasticizer is an ester-based plasticizer, such as phthalate. Phthalate plasticizers include bis(2-ethylhexyl) phthalate (DEHP), diisononly phthalate (DINP), di-n-butyl phthalate (DnBP, DBP), butyl benzyl phthalate (BBzP), diisodecyl phthalate (DIDP), dioctyl phthalate (DOP, DnOP), diisooctyl phthalate (DIOP), diethyl phthalate (DEP), diisobutyl phthalate (DIBP), and di-n-hexyl phthalate. In some instances, modification of the thermoplastic polymer through copolymerization or through the addition of non-reactive side chains to monomers before polymerization also increases flexibility.
In some instances, the structure comprises a fluoroelastomer. Materials having about 80% fluoroelastomers are designated as FKMs. Fluoroelastomers include perfluoro-elastomers (FFKMs) and tetrafluoroethylene/propylene rubbers (FEPM). Fluoroelastomers have five known types. Type 1 FKMs are composed of vinylidene fluoride (VDF) and hexafluoropropylene (HFP) and their fluorine content typically is around 66% by weight. Type 2 FKMs are composed of VDF, HFP, and tetrafluoroethylene (TFE) and typically have between about 68% and 69% fluorine. Type 3 FKMs are composed of VDF, TFE, and perfluoromethylvinylether (PMVE) and typically have between about 62% and 68% fluorine. Type 4 FKMs are composed of propylene, TFE, and VDF and typically have about 67% fluorine. Type 5 FKMs are composed of VDF, HFP, TFE, PMVE, and ethylene.
In some instances, a structure disclosed herein comprises a computer readable material. Computer readable materials include, without limitation, magnetic media, reel-to-reel tape, cartridge tape, cassette tape, flexible disk, paper media, film, microfiche, continuous tape (e.g., a belt) and any media suitable for storing electronic instructions. In some cases, the structure comprises magnetic reel-to-reel tape or a magnetic belt. In some cases, the structure comprises a flexible printed circuit board.
In some instances, a substrate material disclosed herein is transparent to visible and/or UV light. In some instances, substrate materials are sufficiently conductive to form uniform electric fields across all or a portion of a substrate. In some cases, the substrate is heat conductive or insulated. In some cases, the materials are chemical resistant and heat resistant to support a chemical reaction such as an oligonucleic acid synthesis reaction. In some instances, the substrate is magnetic. In some instances, the substrate comprises a metal or a metal alloy.
In some instances, a surface comprises a rigid material. A rigid material includes, without limitation, glass; fused silica; silicon such as silicon dioxide or silicon nitride; metals such as gold or platinum; plastics such as polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and any combination thereof.
In some instances, a substrate material disclosed herein comprises a flat region. In some instances, the substrate comprises embedded pores, which are a series of individual reaction sections that capture released oligonucleic acids, facilitating direct sequencing of the oligonucleic acids within the pores of the substrate. In some cases, a substrate material disclosed herein comprises pores. In some cases the pores are coated with a functionalizing agent disclosed herein where the agent couples nucleoside base to the surface of a substrate. In some cases, the pores comprise microchannels. In some cases, a single pore comprises at least 2 microchannels. In some cases, a single pore contains about 2 to about 200, about 100 to about 150 microchannels. In some cases, the micropores are coated with a functionalizing agent disclosed herein where the agent couples nucleoside base to the surface of a substrate. In some cases, a substrate material disclosed herein comprises wells. In some cases the wells are coated with a functionalizing agent disclosed herein where the agent couples nucleoside base to the surface of a substrate. In some cases, deposition of a monomeric oligonucleotide in a manner described herein is into a pore, microchannel or well on the surface of a substrate. In some cases, reading of an oligonucleic acid synthesized by methods disclosed herein occurs within a pore, microchannel, or well on the surface of the substrate.
In some instances, the substrate comprises an alignment structure or printed alignment element, such as a fiducial marking. In some instances, the substrate comprises a detectable marker attached to a section of the substrate for identifying that section. In some cases, the substrate comprises one or more regions for annotation. In some cases, the substrate is labeled.
In some cases, a substrate disclosed herein comprises one or more identifiers. In some instances, each identifier is associated with each biomolecule on a substrate, or a group of biomolecules on a substrate, by having a fixed location on the substrate in relation to a bar code from which relative location the identity of each biomolecule or group of biomolecules is determined. In one aspect, an identifier provides a means to identify biomolecule information. In some cases the biomolecule is an oligonucleic acid and the information is the sequence identity. In some cases, the information is stored in a database.
Surface Modification
In some instances, to support the immobilization of a biomolecule on a substrate for de novo synthesis of nucleic acids, the surface of the structure comprises a material and/or is coated with a material that facilitates a coupling reaction with the biomolecule for attachment. In various instances, to prepare a substrate for biomolecule immobilization, surface modifications are employed that chemically and/or physically alter the substrate surface by an additive or subtractive process to change one or more chemical and/or physical properties of a substrate surface or a selected site or region of the surface. For example, surface modification involves (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e., providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface. In some cases, a substrate is selectively functionalized to produce two or more distinct areas on a structure, wherein at least one area has a different surface or chemical property that another area of the same structure. Such properties include, without limitation, surface energy, chemical termination, surface concentration of a chemical moiety, and the like.
In some instances, the surface of the substrate is modified to comprise one or more actively functionalized surfaces configured to bind to both the surface of the substrate and a biomolecule, thereby supporting a coupling reaction to the surface. In some cases, the surface is also functionalized with a passive material that does not efficiently bind the biomolecule, thereby preventing biomolecule attachment at sites where the passive functionalization agent is bound. In some cases, the surface comprises an active layer only defining distinct features for biomolecule support. In some cases, the surface is not coated.
In some instances, the substrate surface is contacting with a mixture of functionalization groups which are in any different ratio. In some instances, a mixture comprises at least 2, 3, 4, 5 or more different types of functionalization agents. In some cases, the ratio of the at least two types of surface functionalization agents in a mixture is about 1:1, 1:2, 1:5, 1:10, 2:10, 3:10, 4:10, 5:10, 6:10, 7:10, 8:10, 9:10, or any other ratio to achieve a desired surface representation of two groups. In some instances, desired surface tensions, wettabilities, water contact angles, and/or contact angles for other suitable solvents are achieved by providing a substrate surface with a suitable ratio of functionalization agents. In some cases, the agents in a mixture are chosen from suitable reactive and inert moieties, thus diluting the surface density of reactive groups to a desired level for downstream reactions. In some instances, the mixture of functionalization reagents comprises one or more reagents that bind to a biomolecule and one or more reagents that do not bind to a biomolecule. Therefore, modulation of the reagents allows for the control of the amount of biomolecule binding that occurs at a distinct area of functionalization.
In some instances, a method for substrate functionalization comprises deposition of a silane molecule onto a surface of a substrate. In some instances, the silane molecule is deposited on a high energy surface of the substrate. In some instances the high surface energy region includes a passive functionalization reagent. The silane group binds to the surface, while the rest of the molecule provides a distance from the surface and a free hydroxyl group at the end to which a biomolecule attaches. In some instances, the silane is an organofunctional alkoxysilane molecule. Non-limiting examples of organofunctional alkoxysilane molecules include dimethylchloro-octodecyl-silane, methyldichloro-octodecyl-silane, trichloro-octodecyl-silane, and trimethyl-octodecyl-silane, triethyl-octodecyl-silane. In some instances, the silane is an amino silane. Examples of amino silanes include, without limitation, 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. In some instances, the silane comprises 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, or any combination thereof. In some cases, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane. In some cases, an active functionalization agent comprises n-decyltriethoxysilane. In some cases, an active functionalization agent comprises glycidyloxypropyltriethoxysilane (GOPS). In some instances, the silane is a fluorosilane. In some instances, the silane is a hydrocarbon silane. In some cases, the silane is 3-iodo-propyltrimethoxysilane. In some cases, the silane is octylchlorosilane.
In some instances, silanization is performed on a surface through self-assembly with organofunctional alkoxysilane molecules. The organofunctional alkoxysilanes are classified according to their organic functions. Non-limiting examples of siloxane functionalizing reagents include hydroxyalkyl siloxanes (silylate surface, functionalizing with diborane and oxidizing the alcohol by hydrogen peroxide), diol (dihydroxyalkyl) siloxanes (silylate surface, and hydrolyzing to diol), aminoalkyl siloxanes (amines require no intermediate functionalizing step), glycidoxysilanes (3-glycidoxypropyl-dimethyl-ethoxysilane, glycidoxy-trimethoxysilane), mercaptosilanes (3-mercaptopropyl-trimethoxysilane, 3-4 epoxycyclohexyl-ethyltrimethoxysilane or 3-mercaptopropyl-methyl-dimethoxysilane), bicyclohepthenyl-trichlorosilane, butyl-aldehydr-trimethoxysilane, or dimeric secondary aminoalkyl siloxanes. Exemplary hydroxyalkyl siloxanes include allyl trichlorochlorosilane turning into 3-hydroxypropyl, or 7-oct-1-enyl trichlorochlorosilane turning into 8-hydroxyoctyl. The diol (dihydroxyalkyl) siloxanes include glycidyl trimethoxysilane-derived (2,3-dihydroxypropyloxy)propyl (GOPS). The aminoalkyl siloxanes include 3-aminopropyl trimethoxysilane turning into 3-aminopropyl (3-aminopropyl-triethoxysilane, 3-aminopropyl-diethoxy-methylsilane, 3-aminopropyl-dimethyl-ethoxysilane, or 3-aminopropyl-trimethoxysilane). In some cases, the dimeric secondary aminoalkyl siloxanes is bis (3-trimethoxysilylpropyl) amine turning into bis(silyloxylpropyl)amine.
In some instances, active functionalization areas comprise one or more different species of silanes, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more silanes. In some cases, one of the one or more silanes is present in the functionalization composition in an amount greater than another silane. For example, a mixed silane solution having two silanes comprises a 99:1, 98:2, 97:3, 96:4, 95:5, 94:6, 93:7, 92:8, 91:9, 90:10, 89:11, 88:12, 87:13, 86:14, 85:15, 84:16, 83:17, 82:18, 81:19, 80:20, 75:25, 70:30, 65:35, 60:40, 55:45 ratio of one silane to another silane. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane in a ratio from about 20:80 to about 1:99, or about 10:90 to about 2:98, or about 5:95.
Synthesis on a Substrate
The substrates described herein may comprise a plurality of features that allow for the attachment and synthesis of oligonucleic acids to the surface. In some instances, droplets comprising oligonucleic acid synthesis reagents are released from oligonucleic acid synthesis material deposition unit to the substrate in a stepwise manner from a deposition device having a piezo ceramic material and electrodes to convert electrical signals into a mechanical signal for releasing the droplets. The droplets are release to specific locations on the surface of the substrate one nucleobase at a time to generate a plurality of synthesized oligonucleic acids having predetermined sequences that encode data. In some cases, the synthesized oligonucleic acids are stored on the substrate. In some cases, oligonucleic acids are cleaved from the surface. Cleavage includes gas cleavage with such gases as ammonia or methylamine.
Provided herein are structures that may comprise a surface that supports the synthesis of a plurality of oligonucleic acids having different predetermined sequences at addressable locations on a common support. In some instances, a device provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical oligonucleic acids. In some instances, the device provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 75,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more oligonucleic acids encoding for distinct sequences. In some instances, the device provides support for the synthesis of more than 1 million, 1 billion, 10 billion or more oligonucleic acids. In some instances, at least a portion of the oligonucleic acids have an identical sequence or are configured to be synthesized with an identical sequence.
Provided herein are methods and devices for manufacture and growth of oligonucleic acids about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 bases in length. In some instances, the length of the oligonucleic acid formed is about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or 225 bases in length. An oligonucleic acid may be at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bases in length. An oligonucleic acid may be from 10 to 225 bases in length, from 12 to 100 bases in length, from 20 to 150 bases in length, from 20 to 130 bases in length, from 25 to 1000 bases in length, from 75 to 500 bases in length, from 30 to 100 bases in length, or from 50 to 500 bases in length.
In some instances, oligonucleic acids are synthesized on distinct loci of a substrate, wherein each locus supports the synthesis of a population of oligonucleic acids. In some instances, each locus supports the synthesis of a population of oligonucleic acids having a different sequence than a population of oligonucleic acids grown on another locus. In some instances, the loci of a device are located within a plurality of clusters. In some instances, a device comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a device comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some instances, a device comprises about 10,000 distinct loci. The amount of loci within a single cluster is varied in different instances. In some instances, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more loci. In some instances, each cluster includes about 50-500 loci. In some instances, each cluster includes about 100-200 loci. In some instances, each cluster includes about 100-150 loci. In some instances, each cluster includes about 109, 121, 130 or 137 loci. In some instances, each cluster includes about 19, 20, 61, 64 or more loci.
The number of distinct oligonucleic acids synthesized on a device may be dependent on the number of distinct loci available in the substrate. In some instances, the density of loci (or feature) within a cluster of a device is at least or about 1 locus per mm2, 10 loci per mm2, 25 loci per mm2, 50 loci per mm2, 65 loci per mm2, 75 loci per mm2, 100 loci per mm2, 130 loci per mm2, 150 loci per mm2, 175 loci per mm2, 200 loci per mm2, 300 loci per mm2, 400 loci per mm2, 500 loci per mm2, 1,000 loci per mm2 or more. In some instances, a device comprises from about 10 loci per mm2 to about 500 mm2, from about 25 loci per mm2 to about 400 mm2, from about 50 loci per mm2 to about 500 mm2, from about 100 loci per mm2 to about 500 mm2, from about 150 loci per mm2 to about 500 mm2, from about 10 loci per mm2 to about 250 mm2, from about 50 loci per mm2 to about 250 mm2, from about 10 loci per mm2 to about 200 mm2, or from about 50 loci per mm2 to about 200 mm2. In some instances, the distance from the centers of two adjacent loci within a cluster is from about 10 um to about 500 um, from about 10 um to about 200 um, or from about 10 um to about 100 um. In some instances, the distance from two centers of adjacent loci is greater than about 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some instances, the distance from the centers of two adjacent loci is less than about 200 um, 150 um, 100 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, each locus has a width of about 0.5 um, 1 um, 2 um, 3 um, 4 um, 5 um, 6 um, 7 um, 8 um, 9 um, 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some instances, the each locus has a width of about 0.5 um to 100 um, about 0.5 um to 50 um, about 10 um to 75 um, about 0.5 um to 50 um, or about 1 um to about 500 um.
In some cases, synthesized oligonucleic acids disclosed herein comprise a tether of 12 to 25 bases. In some instances, the tether comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more bases.
A suitable method for oligonucleic acid synthesis on a substrate of this disclosure is a phosphoramidite method comprising the controlled addition of a phosphoramidite building block, i.e. nucleoside phosphoramidite, to a growing oligonucleic acid chain in a coupling step that forms a phosphite triester linkage between the phosphoramidite building block and a nucleoside bound to the substrate. In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition and linkage of a nucleoside phosphoramidite in the coupling step, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, an oligonucleic acid synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).
Following coupling, phosphoramidite oligonucleic acid synthesis methods optionally comprise a capping step. In a capping step, the growing oligonucleic acid is treated with a capping agent. A capping step generally serves to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of oligonucleic acids with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole often react, to a small extent, with the O6 position of guanosine. Without being bound by theory, upon oxidation with I2/water, this side product, possibly via O6-N7 migration, undergoes depurination. The apurinic sites can end up being cleaved in the course of the final deprotection of the oligonucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I2/water. In some instances, inclusion of a capping step during oligonucleic acid synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound oligonucleic acid with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.
In some instances, following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid is oxidized. The oxidation step comprises oxidizing the phosphite triester into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some cases, oxidation of the growing oligonucleic acid is achieved by treatment with iodine and water, optionally in the presence of a weak base such as a pyridine, lutidine, or collidine. Oxidation is sometimes carried out under anhydrous conditions using tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing oligonucleic acid is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain oligonucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including, but not limited to, 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).
In order for a subsequent cycle of nucleoside incorporation to occur through coupling, a protected 5′ end of the substrate bound growing oligonucleic acid must be removed so that the primary hydroxyl group can react with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound oligonucleotide and thus reduces the yield of the desired full-length product. Methods and compositions described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some cases, the substrate bound oligonucleic acid is washed after deblocking. In some cases, efficient washing after deblocking contributes to synthesized oligonucleic acids having a low error rate.
Methods for the synthesis of oligonucleic acids on the substrates described herein typically involve an iterating sequence of the following steps: application of a protected monomer to a surface of a substrate feature to link with either the surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it can react with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation and/or sulfurization. In some cases, one or more wash steps precede or follow one or all of the steps.
In some instances, oligonucleic acids are synthesized with photolabile protecting groups, where the hydroxyl groups generated on the surface are blocked by photolabile-protecting groups. When the surface is exposed to UV light, such as through a photolithographic mask, a pattern of free hydroxyl groups on the surface may be generated. These hydroxyl groups can react with photoprotected nucleoside phosphoramidites, according to phosphoramidite chemistry. A second photolithographic mask can be applied and the surface can be exposed to UV light to generate second pattern of hydroxyl groups, followed by coupling with 5′-photoprotected nucleoside phosphoramidite. Likewise, patterns can be generated and oligomer chains can be extended. Without being bound by theory, the lability of a photocleavable group depends on the wavelength and polarity of a solvent employed and the rate of photocleavage may be affected by the duration of exposure and the intensity of light. This method can leverage a number of factors such as accuracy in alignment of the masks, efficiency of removal of photo-protecting groups, and the yields of the phosphoramidite coupling step. Further, unintended leakage of light into neighboring sites can be minimized. The density of synthesized oligomer per spot can be monitored by adjusting loading of the leader nucleoside on the surface of synthesis.
In some instances, the surface of the substrate that provides support for oligonucleic acid synthesis is chemically modified to allow for the synthesized oligonucleic acid chain to be cleaved from the surface. In some cases, the oligonucleic acid chain is cleaved at the same time as the oligonucleic acid is deprotected. In some cases, the oligonucleic acid chain is cleaved after the oligonucleic acid is deprotected. In an exemplary scheme, a trialkoxysilyl amine such as (CH3CH2O)3Si—(CH2)2-NH2 is reacted with surface SiOH groups of a substrate, followed by reaction with succinic anhydride with the amine to create an amide linkage and a free OH on which the nucleic acid chain growth is supported.
Oligonucleic acids synthesized using the methods and substrates described herein are optionally released from the surface from which they are synthesized. In some cases, oligonucleic acids are cleaved from the surface after synthesis. In some cases, oligonucleic acids are cleaved from the surface after storage. Cleavage includes gas cleavage with ammonia or methylamine. In some instances, the application of ammonia gas simultaneous deprotects phosphates groups protected during the synthesis steps, i.e. removal of electron-withdrawing cyano group. In some instances, once released from the surface, oligonucleic acids are assembled into larger nucleic acids that are sequenced and decoded to extract stored information. In some cases, wherein the oligonucleic acids stored on the substrate are to be removed, each sequence fragment comprises an index that provides instructions for how to assemble it with other sequences stored with it.
In some instances, synthesized oligonucleic acids are designed to collectively span a large region of a predetermined sequence that encodes for information. In some instances, larger oligonucleic acids are generated through ligation reactions to join the synthesized oligonucleic acids. One example of a ligation reaction is polymerase chain assembly (PCA). In some cases, at least of a portion of the oligonucleic acids are designed to include an appended region that is a substrate for universal primer binding. For PCA reactions, the presynthesized oligonucleic acids include overlaps with each other (e.g., 4, 20, 40 or more bases with overlapping sequence). During the polymerase cycles, the oligonucleic acids anneal to complementary fragments and then are filled in by polymerase. Each cycle thus increases the length of various fragments randomly depending on which oligonucleic acids find each other. Complementarity amongst the fragments allows for forming a complete large span of double-stranded DNA. In some cases, after the PCA reaction is complete, an error correction step is conducted using mismatch repair detecting enzymes to remove mismatches in the sequence. Once larger fragments of a target sequence are generated, they can be amplified. For example, in some cases, a target sequence comprising 5′ and 3′ terminal adapter sequences is amplified in a polymerase chain reaction (PCR) which includes modified primers that hybridize to the adapter sequences. In some cases, the modified primers comprise one or more uracil bases. The use of modified primers allows for removal of the primers through enzymatic reactions centered on targeting the modified base and/or gaps left by enzymes which cleave the modified base pair from the fragment. What remains is a double-stranded amplification product that lacks remnants of adapter sequence. In this way, multiple amplification products can be generated in parallel with the same set of primers to generate different fragments of double-stranded DNA.
In some instances, error correction is performed on synthesized oligonucleic acids and/or assembled products. An example strategy for error correction involves site-directed mutagenesis by overlap extension PCR to correct errors, which is optionally coupled with two or more rounds of cloning and sequencing. In certain instances, double-stranded nucleic acids with mismatches, bulges and small loops, chemically altered bases and/or other heteroduplexes are selectively removed from populations of correctly synthesized nucleic acids. In some instances, error correction is performed using proteins/enzymes that recognize and bind to or next to mismatched or unpaired bases within double-stranded nucleic acids to create a single or double-strand break or to initiate a strand transfer transposition event. Non-limiting examples of proteins/enzymes for error correction include endonucleases (T7 Endonuclease I, E. coli Endonuclease V, T4 Endonuclease VII, mung bean nuclease, Cell, E. coli Endonuclease IV, UVDE), restriction enzymes, glycosylases, ribonucleases, mismatch repair enzymes, resolvases, helicases, ligases, antibodies specific for mismatches, and their variants. Examples of specific error correction enzymes include T4 endonuclease 7, T7 endonuclease 1, S1, mung bean endonuclease, MutY, MutS, MutH, MutL, cleavase, CELI, and HINF1. In some cases, DNA mismatch-binding protein MutS (Thermus aquaticus) is used to remove failure products from a population of synthesized products. In some instances, error correction is performed using the enzyme Correctase. In some cases, error correction is performed using SURVEYOR endonuclease (Transgenomic), a mismatch-specific DNA endonuclease that scans for known and unknown mutations and polymorphisms for heteroduplex DNA.
Error Rate
In some instances, these error rates are for at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleic acids synthesized. In some instances, these at least 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleic acids synthesized do not differ from a predetermined sequence for which they encode. In some instances, the error rate for synthesized oligonucleic acids on a substrate using the methods and systems described herein is less than about 1 in 200. In some instances, the error rate for synthesized oligonucleic acids on a substrate using the methods and systems described herein is less than about 1 in 1,000. In some instances, the error rate for synthesized oligonucleic acids on a substrate using the methods and systems described herein is less than about 1 in 2,000. In some instances, the error rate for synthesized oligonucleic acids on a substrate using the methods and systems described herein is less than about 1 in 3,000. In some instances, the error rate for synthesized oligonucleic acids on a substrate using the methods and systems described herein is less than about 1 in 5,000. Individual types of error rates include mismatches, deletions, insertions, and/or substitutions for the oligonucleic acids synthesized on the substrate. The term “error rate” refers to a comparison of the collective amount of synthesized oligonucleic acid to an aggregate of predetermined oligonucleic acid sequences.
Average error rates for oligonucleic acids synthesized within a library using the systems and methods provided may be less than 1 in 1000, less than 1 in 1250, less than 1 in 1500, less than 1 in 2000, less than 1 in 3000 or less often. In some instances, average error rates for oligonucleic acids synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less. In some instances, average error rates for oligonucleic acids synthesized within a library using the systems and methods provided are less than 1/1000.
In some instances, aggregate error rates for oligonucleic acids synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less compared to the predetermined sequences. In some instances, aggregate error rates for oligonucleic acids synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, or 1/1000. In some instances, aggregate error rates for oligonucleic acids synthesized within a library using the systems and methods provided are less than 1/1000.
In some instances, an error correction enzyme may be used for oligonucleic acids synthesized within a library using the systems and methods provided can use. In some instances, aggregate error rates for oligonucleic acids with error correction can be less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less compared to the predetermined sequences. In some instances, aggregate error rates with error correction for oligonucleic acids synthesized within a library using the systems and methods provided can be less than 1/500, 1/600, 1/700, 1/800, 1/900, or 1/1000. In some instances, aggregate error rates with error correction for oligonucleic acids synthesized within a library using the systems and methods provided can be less than 1/1000.
Libraries disclosed herein may be synthesized with base insertion, deletion, substitution, or total error rates that are under 1/300, 1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1250, 1/1500, 1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000, 1/7000, 1/8000, 1/9000, 1/10000, 1/12000, 1/15000, 1/20000, 1/25000, 1/30000, 1/40000, 1/50000, 1/60000, 1/70000, 1/80000, 1/90000, 1/100000, 1/125000, 1/150000, 1/200000, 1/300000, 1/400000, 1/500000, 1/600000, 1/700000, 1/800000, 1/900000, 1/1000000, or less, across the library, or across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the library. The methods and compositions of the disclosure further relate to large synthetic oligonucleotide libraries with low error rates associated with at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the oligonucleotides in at least a subset of the library to relate to error free sequences in comparison to a predetermined/preselected sequence. In some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the oligonucleotides in an isolated volume within the library have the same sequence. In some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of any oligonucleotides related with more than 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more similarity or identity have the same sequence. In some instances, the error rate related to a specified locus on an oligonucleotide is optimized. Thus, a given locus or a plurality of selected loci of one or more oligonucleotides as part of a large library may each have an error rate that is less than 1/300, 1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1250, 1/1500, 1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000, 1/7000, 1/8000, 1/9000, 1/10000, 1/12000, 1/15000, 1/20000, 1/25000, 1/30000, 1/40000, 1/50000, 1/60000, 1/70000, 1/80000, 1/90000, 1/100000, 1/125000, 1/150000, 1/200000, 1/300000, 1/400000, 1/500000, 1/600000, 1/700000, 1/800000, 1/900000, 1/1000000, or less. In various instances, such error optimized loci may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 50000, 75000, 100000, 500000, 1000000, 2000000, 3000000 or more loci. The error optimized loci may be distributed to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 75000, 100000, 500000, 1000000, 2000000, 3000000 or more oligonucleotides.
The error rates can be achieved with or without error correction. The error rates can be achieved across the library, or across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the library.
Devices
Provided herein are systems and devices for the deposition and storage of biomolecules on a substrate. In some instances, the biomolecules are oligonucleic acids that store encoded information in their sequences. In some instances, the system comprises a substrate to support biomolecule attachment and/or a device for application of a biomolecule to the surface of the substrate. In an example, the device for biomolecule application is an oligonucleic acid synthesizer. In some instances, the system comprises a device for treating the substrate with a fluid, for example, a flow cell. In some instances, the system comprises a device for moving the substrate between the application device and the treatment device. For instances where the substrate is a reel-to-reel tape, the system may comprise two or more reels that allow for access of different portions of the substrate to the application and optional treatment device at different times.
In some instances, a flexible substrate comprising thermoplastic material is coated with nucleoside coupling reagent. The coating is patterned into features such that each feature has diameter of about 10 um, with a center-to-center distance between two adjacent features of about 21 um. In this case, the feature size is sufficient to accommodate a sessile drop volume of 0.2 pl during an oligonucleic acid synthesis deposition step. In some cases, the feature density is about 2.2 billion features per m2 (1 feature/441×10−12 m2). In some cases, a 4.5 m2 substrate comprise about 10 billion features, each with a 10 um diameter.
In some instances, a deposition device comprises about 2,048 nozzles that each deposit about 100,000 droplets per second at 1 nucleobase per droplet. For each deposition device, at least about 1.75×1013 nucleobases are deposited on the substrate per day. In some cases, 100 to 500 nucleobase oligonucleic acids are synthesized. In some cases, 200 nucleobase oligonucleic acids are synthesized. Optionally, over 3 days, at a rate of about 1.75×1013 bases per day, at least about 262.5×109 oligonucleic acids are synthesized.
In one aspect, provided is an automated system for use with an oligonucleic acid synthesis method described herein that is capable of processing one or more substrates, comprising: a material deposition device for spraying a microdroplet comprising a reagent on a substrate; a scanning transport for scanning the substrate adjacent to the material deposition device to selectively deposit the microdroplet at specified sites; a flow cell for treating the substrate on which the microdroplet is deposited by exposing the substrate to one or more selected fluids; and an alignment unit for aligning the substrate correctly relative to the material deposition device for deposition. In some instances, the system optionally comprises a treating transport for moving the substrate between the material deposition device and the flow cell for treatment in the flow cell, where the treating transport and said scanning transport are different elements. In other instances, the system does not comprise a treating transport.
In some instances, a device for application of one or more reagents to a substrate during a synthesis reaction is an oligonucleic acid synthesizer comprising a plurality of material deposition devices. In some instances, each material deposition device is configured to deposit nucleotide monomers for phosphoramidite synthesis. In some instances, the oligonucleic acid synthesizer deposits reagents to distinct features of a substrate. Reagents for oligonucleic acid synthesis include reagents for oligonucleic acid extension and wash buffers. As non-limiting examples, the oligonucleic acid synthesizer deposits coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile, gases such as nitrogen gas, and any combination thereof. In addition, the oligonucleic acid synthesizer optionally deposits reagents for the preparation and/or maintenance of substrate integrity. In some instances, the oligonucleic acid synthesizer deposits a drop having a diameter less than about 200 um, 100 um, or 50 um in a volume less than about 1000, 500, 100, 50, or 20 pl. In some cases, the oligonucleic acid synthesizer deposits between about 1 and 10000, 1 and 5000, 100 and 5000, or 1000 and 5000 droplets per second. In some instances, the oligonucleic acid synthesizer uses organic solvents.
In some instances, during oligonucleic acid synthesis, the substrate is positioned within and/or sealed within a flow cell. In some instances, the flow cell provides continuous or discontinuous flow of liquids such as those comprising reagents necessary for reactions within the substrate, for example, oxidizers and/or solvents. In some instances, the flow cell provides continuous or discontinuous flow of a gas, such as nitrogen, for drying the substrate typically through enhanced evaporation of a volatile substrate. A variety of auxiliary devices are useful to improve drying and reduce residual moisture on the surface of the substrate. Examples of such auxiliary drying devices include, without limitation, a vacuum source, depressurizing pump and a vacuum tank. In some cases, an oligonucleic acid synthesis system comprises one or more flow cells, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 and one or more substrates, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or 20. In some cases, a flow cell is configured to hold and provide reagents to the substrate during one or more steps in a synthesis reaction. In some instances, a flowcell comprises a lid that slides over the top of a substrate and can be clamped into place to form a pressure tight seal around the edge of the substrate. An adequate seal includes, without limitation, a seal that allows for about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 atmospheres of pressure. In some cases, the lid of the flow cell is opened to allow for access to an application device such as an oligonucleic acid synthesizer. In some cases, one or more steps of an oligonucleic acid synthesis method are performed on a substrate within a flow cell, without the transport of the substrate.
In some instances, a device for treating a substrate with a fluid comprises a spray bar. In an exemplary oligonucleic acid synthesis process, nucleotide monomers are applied onto a substrate surface with an application device and then a spray bar sprays the substrate surface with one or more treatment reagents using spray nozzles of the spray bar. In some instances, the spray nozzles are sequentially ordered to correlate with different treatment steps during oligonucleic acid synthesis. The chemicals used in different process steps are easily changed in the spray bar to readily accommodate changes in a synthesis method or between steps of a synthesis method. In some instances, the spray bar continuously sprays a given chemistry on a surface of a substrate as the substrate moves past the spray bar. In some cases, the spray bar deposits over a wide area of a substrate, much like the spray bars used in lawn sprinklers. In some instances, the spray bar nozzles are positioned to provide a uniform coat of treatment material to a given area of a substrate.
In some instances, an oligonucleic acid synthesis system comprises one or more elements useful for downstream processing of synthesized oligonucleic acids. As an example, the system comprises a temperature control element such as a thermal cycling device. In some instances, the temperature control element is used with a plurality of resolved reactors to perform nucleic acid assembly such as PCA and/or nucleic acid amplification such as PCR.
The oligonucleic acid synthesizer includes a material deposition device that moves in the X-Y direction to align with the location of the substrate. The oligonucleic acid synthesizer can also move in the Z direction to seal with the substrate, forming a resolved reactor. A resolved reactor is configured to allow for the transfer of fluid, including oligonucleic acids and/or reagents, from the substrate to a capping element and/or vice versa. Fluid may pass through either or both the substrate and the capping element and includes, without limitation, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile and nitrogen gas.
An oligonucleic acid synthesizer comprises one or more deposition devices that deposit reagents for nucleic acid synthesis onto distinct features or regions of a substrate at a high resolution. Examples of devices that are capable of high resolution droplet deposition include the printhead of inkjet printers and laser printers. The devices useful in the systems and methods described herein achieve a resolution from about 100 dots per inch (DPI) to about 50,000 DPI; from about 100 DPI to about 20,000 DPI; from about 100 DPI to about 10,000 DPI; from about 100 DPI to about 5,000 DPI; from about 1,000 DPI to about 20,000 DPI; or from about 1,000 DPI to about 10,000 DPI. In some cases, the devices have a resolution at least about 1,000; 2,000; 3,000; 4,000; 5,000; 10,000; or 20,000 DPI. The high resolution deposition performed by the device is related to the number and density of each nozzle that corresponds to a feature of the substrate.
The size of the droplets dispensed correlates to the resolution of the device. In some instances, the devices deposit droplets of reagents at sizes from about 0.01 pl to about 20 pl, from about 0.01 pl to about 10 pl, from about 0.01 pl to about 1 pl, from about 0.01 pl to about 0.5 pl, from about 0.01 pl to about 0.01 pl, or from about 0.05 pl to about 1 pl. In some cases, the droplet size is less than about 1 pl, 0.5 pl, 0.2 pl, 0.1 pl, or 0.05 pl. The size of droplets dispensed by the device is correlated to the diameters of deposition nozzles, wherein each nozzle is capable of depositing a reagent onto a feature of the substrate. In some instances, a deposition device of an oligonucleic acid synthesizer comprises from about 100 to about 10,000 nozzles; from about 100 to about 5,000 nozzles; from about 100 to about 3,000 nozzles; from about 500 to about 10,000 nozzles; or from about 100 to about 5,000 nozzles. In some cases, the deposition device comprises greater than 1,000; 2,000; 3,000; 4,000; 5,000; or 10,000 nozzles. In some cases, each material deposition device comprises a plurality of nozzles, where each nozzle is optionally configured to correspond to a feature on a substrate. In some cases, each nozzle deposits a reagent component that is different from another nozzle. In some instances, each nozzle deposits a droplet that covers one or more features of the substrate. In some instances, one or more nozzles are angled. In some instances, multiple deposition devices are stacked side by side to achieve a fold increase in throughput. In some cases, the gain is 2×, 4×, 8× or more. An example of a deposition device is Samba Printhead (Fujifilm). A Samba Printhead may be used with the Samba Web Administration Tool (SWAT).
In some oligonucleic acid synthesis methods, nucleic acid reagents are deposited on the substrate surface in a non-continuous, or drop-on-demand method. Examples of such methods include the electromechanical transfer method, electric thermal transfer method, and electrostatic attraction method. In the electromechanical transfer method, piezoelectric elements deformed by electrical pulses cause the droplets to be ejected. In the electric thermal transfer method, bubbles are generated in a chamber of the device, and the expansive force of the bubbles causes the droplets to be ejected. In the electrostatic attraction method, electrostatic force of attraction is used to eject the droplets onto the substrate. In some cases, the drop frequency is from about 5 KHz to about 500 KHz; from about 5 KHz to about 100 KHz; from about 10 KHz to about 500 KHz; from about 10 KHz to about 100 KHz; or from about 50 KHz to about 500 KHz. In some cases, the frequency is less than about 500 KHz, 200 KHz, 100 KHz, or 50 KHz.
In some instances, the number of deposition sites increases by using and rotating the same deposition device by a certain degree or saber angle. By rotating the deposition device, each nozzle is jetted with a certain amount of delay time corresponding to the saber angle. This unsynchronized jetting creates a cross talk among the nozzles. Therefore, when the droplets are jetting at a certain saber angle different from 0 degrees, the droplet volume from the nozzle could be different.
In some instances, the configuration of an oligonucleic acid synthesis system allows for a continuous oligonucleic acid synthesis process that exploits the flexibility of a substrate for traveling in a reel-to-reel type process. This synthesis process operates in a continuous production line manner with the substrate travelling through various stages of oligonucleic acid synthesis using one or more reels to rotate the position of the substrate. In some instances, an oligonucleic acid synthesis reaction comprises rolling a substrate: through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a deblock bath. Optionally, the tape is also traversed through a capping bath. A reel-to-reel type process allows for the finished product of a substrate comprising synthesized oligonucleic acids to be easily gathered on a take-up reel, where it can be transported for further processing or storage.
In some instances, oligonucleic acid synthesis proceeds in a continuous process as a continuous flexible tape is conveyed along a conveyor belt system. Similar to the reel-to-reel type process, oligonucleic acid synthesis on a continuous tape operates in a production line manner, with the substrate travelling through various stages of oligonucleic acid synthesis during conveyance. However, in a conveyor belt process, the continuous tape revisits an oligonucleic acid synthesis step without rolling and unrolling of the tape, as in a reel-to-reel process. In some instances, oligonucleic acid synthesis steps are partitioned into zones and a continuous tape is conveyed through each zone one or more times in a cycle. In some instances, an oligonucleic acid synthesis reaction comprises (1) conveying a substrate through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a block bath in a cycle; and then (2) repeating the cycle as necessary to achieve synthesized oligonucleic acids of a predetermined length. In some cases, after oligonucleic acid synthesis, the flexible substrate is removed from the conveyor belt system and rolled, optionally around a reel, for storage.
Computer Systems
In various aspects, any of the systems described herein are operably linked to a computer and are optionally automated through a computer either locally or remotely. In some instances, the methods and systems described herein further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the invention. In some instances, the computer systems are programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.
The computer system 400 illustrated in
As illustrated in
In some embodiments, system 500 can include an accelerator card 522 attached to the peripheral bus 518. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.
Software and data are stored in external storage 524 and can be loaded into RAM 510 and/or cache 504 for use by the processor. The system 500 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example embodiments of the present invention.
In this example, system 500 also includes network interface cards (NICs) 520 and 521 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.
In some example embodiments, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In other embodiments, some or all of the processors can use a shared virtual address memory space.
The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example embodiments, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some embodiments, all or part of the computer system can be implemented in software or hardware. Any variety of data storage media can be used in connection with example embodiments, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.
In example embodiments, the computer system can be implemented using software modules executing on any of the above or other computer architectures and systems. In other embodiments, the functions of the system can be implemented partially or completely in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in
The following examples are set forth to illustrate more clearly the principle and practice of embodiments disclosed herein to those skilled in the art and are not to be construed as limiting the scope of any claimed embodiments. Unless otherwise stated, all parts and percentages are on a weight basis.
A device was functionalized to support the attachment and synthesis of a library of oligonucleic acids. The device surface was first wet cleaned using a piranha solution comprising 90% H2SO4 and 10% H2O2 for 20 minutes. The device was rinsed in several beakers with DI water, held under a DI water gooseneck faucet for 5 min, and dried with N2. The device was subsequently soaked in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with DI water for 1 min each, and then rinsed again with DI water using the handgun. The device was then plasma cleaned by exposing the device surface to O2. A SAMCO PC-300 instrument was used to plasma etch O2 at 250 watts for 1 min in downstream mode.
The cleaned device surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70° C., 135° C. vaporizer. The device surface was resist coated using a Brewer Science 200× spin coater. SPR™ 3612 photoresist was spin coated on the device at 2500 rpm for 40 sec. The device was pre-baked for 30 min at 90° C. on a Brewer hot plate. The device was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The device was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the device soaked in water for 5 min. The device was baked for 30 min at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A descum process was used to remove residual resist using the SAMCO PC-300 instrument to O2 plasma etch at 250 watts for 1 min.
The device surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The device was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air. The device was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The device was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The device was dipped in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to serve as a support for oligonucleic acid synthesis.
A two dimensional oligonucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (AB1394 DNA Synthesizer”). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) was used to synthesize an exemplary oligonucleotide of 50 bp (“50-mer oligonucleotide”) using oligonucleotide synthesis methods described herein.
The sequence of the 50-mer was as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTT TTT3′ (SEQ ID NO.: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of oligonucleic acids from the surface during deprotection.
The synthesis was done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 1 and an ABI synthesizer.
The phosphoramidite/activator combination was delivered similar to the delivery of bulk reagents through the flowcell. No drying steps were performed as the environment stays “wet” with reagent the entire time.
The flow restrictor was removed from the ABI 394 synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole (“BTT”; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M 12 in 20% pyridine, 10% water, and 70% THF) were roughly ˜100 uL/sec, for acetonitrile (“ACN”) and capping reagents (1:1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ˜200 uL/sec, and for Deblock (3% dichloroacetic acid in toluene), roughly ˜300 uL/sec (compared to ˜50 uL/sec for all reagents with flow restrictor). The time to completely push out Oxidizer was observed, the timing for chemical flow times was adjusted accordingly and an extra ACN wash was introduced between different chemicals. After oligonucleotide synthesis, the chip was deprotected in gaseous ammonia overnight at 75 psi. Five drops of water were applied to the surface to recover oligonucleic acids. The recovered oligonucleic acids were then analyzed on a BioAnalyzer small RNA chip (data not shown).
The same process as described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer oligonucleotide (“100-mer oligonucleotide”; 5′ CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGC TAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3′, where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 2) on two different silicon chips, the first one uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the oligonucleic acids extracted from the surface were analyzed on a BioAnalyzer instrument (data not shown).
All ten samples from the two chips were further PCR amplified using a forward (5′ATGCGGGGTTCTCATCATC3′; SEQ ID NO.: 3) and a reverse (5′CGGGATCCTTATCGTCATCG3; SEQ ID NO.: 4) primer in a 50 uL PCR mix (25 uL NEB Q5 mastermix, 2.5 uL 10 uM Forward primer, 2.5 uL 10 uM Reverse primer, 1 uL oligonucleic acid extracted from the surface, and water up to 50 uL) using the following thermalcycling program:
98 C, 30 sec
98 C, 10 sec; 63 C, 10 sec; 72 C, 10 sec; repeat 12 cycles
72 C, 2 min
The PCR products were also run on a BioAnalyzer (data not shown), demonstrating sharp peaks at the 100-mer position. Next, the PCR amplified samples were cloned, and Sanger sequenced. Table 2 summarizes the results from the Sanger sequencing for samples taken from spots 1-5 from chip 1 and for samples taken from spots 6-10 from chip 2.
Thus, the high quality and uniformity of the synthesized oligonucleotides were repeated on two chips with different surface chemistries. Overall, 89%, corresponding to 233 out of 262 of the 100-mers that were sequenced were perfect sequences with no errors.
Finally, Table 3 summarizes error characteristics for the sequences obtained from the oligonucleotides samples from spots 1-10.
Digital information was selected in the form of binary data totaling about 0.2 GB included content for the Universal Declaration of Human Rights in more than 100 languages, the top 100 books of Project Guttenberg and a seed database. The digital information was encrypted into a nucleic acid-based sequence and divided into strings. Over 10 million non-identical oligonucleic acids, each corresponding to a string, were synthesized on a rigid silicon surface in a manner similar to that described in Example 2. Each non-identical oligonucleic acid was under equal or less than 200 bases in length. The synthesized oligonucleic acids were collected and sequenced and decoded back to digital code, with 100% accuracy for the source digital information.
A flexible structure comprising thermoplastic material is coated with a nucleoside coupling reagent. The coating agent is patterned for a high density of features. A portion of the flexible surface is illustrated in
A flexible substrate is prepared comprising a plurality of features on a thermoplastic flexible material. The substrate serves as a support for the synthesis of oligonucleic acids using an oligonucleic acid synthesis device comprising a deposition device. The flexible substrate is in the form of a flexible media much like a magnetic reel-to-reel tape.
De novo synthesis operates in a continuous production line manner with the substrate travelling through a solvent bath and then beneath a stack of printheads where the phosphoramidites are printed on to the substrate. The flexible substrate with the sessile drops deposited on to the surface is rolled into a bath of oxidizing agent, then the tape emerges from the oxidizing bath and is immersed in an acetonitrile wash bath then submerged in a deblock bath. Optionally, the tape is traversed through a capping bath. In an alternative workflow, the flexible substrate emerges from the oxidizing bath and is sprayed with acetonitrile in a wash step.
Alternatively, a spray bar is used instead of a liquid bath. In this process, the nucleotides are still deposited on the surface with an inkjet device but the flood steps are now done in a chamber with a spray nozzles. For example, the deposition device has 2,048 nozzles that each deposit 100,000 droplets per second at 1 nucleobase per droplet. There is a sequential ordering of spray nozzles to mimic the ordering of the flood steps in standard phosphoramidite chemistry. This technique provides for easily changing the chemicals loaded in the spray bar to accommodate different process steps. Oligonucleic acids are deprotected or cleaved in the same manner as described in Example 2.
For each deposition device, more than 1.75×1013 nucleobases are deposited on the substrate per day (24 hours). A plurality of 200 nucleobase oligonucleic acids is synthesized. In 3 days (72 hours), at a rate of 1.75×1013 bases per day, 262.5×109 oligonucleic acids are synthesized.
While certain embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
This application claims the benefit of U.S. Provisional Application No. 62/222,020 filed on Sep. 22, 2015, which is incorporated herein by reference in its entirety.
Number | Name | Date | Kind |
---|---|---|---|
3549368 | Robert et al. | Dec 1970 | A |
3920714 | Streck | Nov 1975 | A |
4123661 | Wolf et al. | Oct 1978 | A |
4415732 | Caruthers et al. | Nov 1983 | A |
4613398 | Chiong et al. | Sep 1986 | A |
4726877 | Fryd et al. | Feb 1988 | A |
4808511 | Holmes | Feb 1989 | A |
4837401 | Hirose et al. | Jun 1989 | A |
4863557 | Kokaku et al. | Sep 1989 | A |
4981797 | Jessee et al. | Jan 1991 | A |
4988617 | Landegren et al. | Jan 1991 | A |
5102797 | Tucker et al. | Apr 1992 | A |
5118605 | Urdea | Jun 1992 | A |
5137814 | Rashtchian et al. | Aug 1992 | A |
5143854 | Pirrung et al. | Sep 1992 | A |
5242794 | Whiteley et al. | Sep 1993 | A |
5242974 | Holmes | Sep 1993 | A |
5288514 | Ellman | Feb 1994 | A |
5291897 | Gastrin et al. | Mar 1994 | A |
5299491 | Kawada | Apr 1994 | A |
5368823 | McGraw et al. | Nov 1994 | A |
5384261 | Winkler et al. | Jan 1995 | A |
5387541 | Hodge et al. | Feb 1995 | A |
5395753 | Prakash | Mar 1995 | A |
5431720 | Nagai et al. | Jul 1995 | A |
5445934 | Fodor et al. | Aug 1995 | A |
5449754 | Nishioka | Sep 1995 | A |
5459039 | Modrich et al. | Oct 1995 | A |
5474796 | Brennan | Dec 1995 | A |
5476930 | Letsinger et al. | Dec 1995 | A |
5487993 | Herrnstadt et al. | Jan 1996 | A |
5494810 | Barany et al. | Feb 1996 | A |
5501893 | Laermer et al. | Mar 1996 | A |
5508169 | Deugau et al. | Apr 1996 | A |
5510270 | Fodor et al. | Apr 1996 | A |
5514789 | Kempe | May 1996 | A |
5527681 | Holmes | Jun 1996 | A |
5530516 | Sheets | Jun 1996 | A |
5534507 | Cama et al. | Jul 1996 | A |
5556750 | Modrich et al. | Sep 1996 | A |
5586211 | Dumitrou et al. | Dec 1996 | A |
5641658 | Adams et al. | Jun 1997 | A |
5677195 | Winkler et al. | Oct 1997 | A |
5679522 | Modrich et al. | Oct 1997 | A |
5683879 | Laney et al. | Nov 1997 | A |
5688642 | Chrisey et al. | Nov 1997 | A |
5700637 | Southern | Dec 1997 | A |
5700642 | Monforte et al. | Dec 1997 | A |
5702894 | Modrich et al. | Dec 1997 | A |
5707806 | Shuber | Jan 1998 | A |
5712124 | Walker | Jan 1998 | A |
5712126 | Weissman et al. | Jan 1998 | A |
5739386 | Holmes | Apr 1998 | A |
5750672 | Kempe | May 1998 | A |
5780613 | Letsinger et al. | Jul 1998 | A |
5830643 | Yamamoto et al. | Nov 1998 | A |
5830655 | Monforte et al. | Nov 1998 | A |
5830662 | Soares et al. | Nov 1998 | A |
5834252 | Stemmer et al. | Nov 1998 | A |
5843669 | Kaiser et al. | Dec 1998 | A |
5843767 | Beattie | Dec 1998 | A |
5846717 | Brow et al. | Dec 1998 | A |
5854033 | Lizardi | Dec 1998 | A |
5858754 | Modrich et al. | Jan 1999 | A |
5861482 | Modrich et al. | Jan 1999 | A |
5863801 | Southgate et al. | Jan 1999 | A |
5869245 | Yeung | Feb 1999 | A |
5877280 | Wetmur | Mar 1999 | A |
5882496 | Northrup et al. | Mar 1999 | A |
5922539 | Modrich et al. | Jul 1999 | A |
5922593 | Livingston | Jul 1999 | A |
5928907 | Woudenberg et al. | Jul 1999 | A |
5962272 | Chenchik et al. | Oct 1999 | A |
5976842 | Wurst | Nov 1999 | A |
5976846 | Passmore et al. | Nov 1999 | A |
5989872 | Luo et al. | Nov 1999 | A |
5994069 | Hall et al. | Nov 1999 | A |
6001567 | Brow et al. | Dec 1999 | A |
6008031 | Modrich et al. | Dec 1999 | A |
6013440 | Lipshutz et al. | Jan 2000 | A |
6015674 | Woudenberg et al. | Jan 2000 | A |
6017434 | Simpson et al. | Jan 2000 | A |
6020481 | Benson et al. | Feb 2000 | A |
6027898 | Gjerde et al. | Feb 2000 | A |
6028189 | Blanchard | Feb 2000 | A |
6028198 | Liu et al. | Feb 2000 | A |
6040138 | Lockhart et al. | Mar 2000 | A |
6077674 | Schleifer et al. | Jun 2000 | A |
6087482 | Teng et al. | Jul 2000 | A |
6090543 | Prudent et al. | Jul 2000 | A |
6090606 | Kaiser et al. | Jul 2000 | A |
6103474 | Dellinger et al. | Aug 2000 | A |
6107038 | Choudhary et al. | Aug 2000 | A |
6110682 | Dellinger et al. | Aug 2000 | A |
6114115 | Wagner, Jr. | Sep 2000 | A |
6130045 | Wurst et al. | Oct 2000 | A |
6132997 | Shannon | Oct 2000 | A |
6136568 | Hiatt et al. | Oct 2000 | A |
6171797 | Perbost | Jan 2001 | B1 |
6180351 | Cattell | Jan 2001 | B1 |
6201112 | Ach | Mar 2001 | B1 |
6218118 | Sampson et al. | Apr 2001 | B1 |
6221653 | Caren et al. | Apr 2001 | B1 |
6222030 | Dellinger et al. | Apr 2001 | B1 |
6232072 | Fisher | May 2001 | B1 |
6235483 | Wolber et al. | May 2001 | B1 |
6242266 | Schleifer et al. | Jun 2001 | B1 |
6251588 | Shannon et al. | Jun 2001 | B1 |
6251595 | Gordon et al. | Jun 2001 | B1 |
6251685 | Dorsel et al. | Jun 2001 | B1 |
6258454 | Lefkowitz et al. | Jul 2001 | B1 |
6262490 | Hsu et al. | Jul 2001 | B1 |
6274725 | Sanghvi et al. | Aug 2001 | B1 |
6284465 | Wolber | Sep 2001 | B1 |
6287776 | Hefti | Sep 2001 | B1 |
6287824 | Lizardi | Sep 2001 | B1 |
6297017 | Schmidt et al. | Oct 2001 | B1 |
6300137 | Earhart et al. | Oct 2001 | B1 |
6306599 | Perbost | Oct 2001 | B1 |
6309822 | Fodor et al. | Oct 2001 | B1 |
6309828 | Schleifer et al. | Oct 2001 | B1 |
6312911 | Bancroft et al. | Nov 2001 | B1 |
6319674 | Fulcrand et al. | Nov 2001 | B1 |
6323043 | Caren et al. | Nov 2001 | B1 |
6329210 | Schleifer | Dec 2001 | B1 |
6346423 | Schembri | Feb 2002 | B1 |
6365355 | McCutchen-Maloney | Apr 2002 | B1 |
6372483 | Schleifer et al. | Apr 2002 | B2 |
6375903 | Cerrina et al. | Apr 2002 | B1 |
6376285 | Joyner et al. | Apr 2002 | B1 |
6384210 | Blanchard | May 2002 | B1 |
6387636 | Perbost et al. | May 2002 | B1 |
6399394 | Dahm et al. | Jun 2002 | B1 |
6399516 | Ayon | Jun 2002 | B1 |
6403314 | Lange et al. | Jun 2002 | B1 |
6406849 | Dorsel et al. | Jun 2002 | B1 |
6406851 | Bass | Jun 2002 | B1 |
6408308 | Maslyn et al. | Jun 2002 | B1 |
6419883 | Blanchard | Jul 2002 | B1 |
6428957 | Delenstarr | Aug 2002 | B1 |
6440669 | Bass et al. | Aug 2002 | B1 |
6444268 | Lefkowitz et al. | Sep 2002 | B2 |
6446642 | Caren et al. | Sep 2002 | B1 |
6446682 | Viken | Sep 2002 | B1 |
6451998 | Perbost | Sep 2002 | B1 |
6458526 | Schembri et al. | Oct 2002 | B1 |
6458535 | Hall et al. | Oct 2002 | B1 |
6458583 | Bruhn et al. | Oct 2002 | B1 |
6461812 | Barth et al. | Oct 2002 | B2 |
6461816 | Wolber et al. | Oct 2002 | B1 |
6469156 | Schafer et al. | Oct 2002 | B1 |
6472147 | Janda et al. | Oct 2002 | B1 |
6492107 | Kauffman et al. | Dec 2002 | B1 |
6518056 | Schembri et al. | Feb 2003 | B2 |
6521427 | Evans | Feb 2003 | B1 |
6521453 | Crameri et al. | Feb 2003 | B1 |
6555357 | Kaiser et al. | Apr 2003 | B1 |
6558908 | Wolber et al. | May 2003 | B2 |
6562611 | Kaiser et al. | May 2003 | B1 |
6566495 | Fodor et al. | May 2003 | B1 |
6582908 | Fodor et al. | Jun 2003 | B2 |
6582938 | Su et al. | Jun 2003 | B1 |
6586211 | Staehler et al. | Jul 2003 | B1 |
6587579 | Bass | Jul 2003 | B1 |
6589739 | Fisher | Jul 2003 | B2 |
6599693 | Webb | Jul 2003 | B1 |
6602472 | Zimmermann et al. | Aug 2003 | B1 |
6610978 | Yin et al. | Aug 2003 | B2 |
6613513 | Parce et al. | Sep 2003 | B1 |
6613523 | Fischer | Sep 2003 | B2 |
6613560 | Tso et al. | Sep 2003 | B1 |
6613893 | Webb | Sep 2003 | B1 |
6621076 | Van de Goor et al. | Sep 2003 | B1 |
6630581 | Dellinger et al. | Oct 2003 | B2 |
6632641 | Brennan et al. | Oct 2003 | B1 |
6635226 | Tso et al. | Oct 2003 | B1 |
6642373 | Manoharan et al. | Nov 2003 | B2 |
6649348 | Bass et al. | Nov 2003 | B2 |
6660338 | Hargreaves | Dec 2003 | B1 |
6664112 | Mulligan et al. | Dec 2003 | B2 |
6670127 | Evans | Dec 2003 | B2 |
6670461 | Wengel et al. | Dec 2003 | B1 |
6673552 | Frey | Jan 2004 | B2 |
6682702 | Barth et al. | Jan 2004 | B2 |
6689319 | Fisher et al. | Feb 2004 | B1 |
6692917 | Neri et al. | Feb 2004 | B2 |
6702256 | Killeen et al. | Mar 2004 | B2 |
6706471 | Brow et al. | Mar 2004 | B1 |
6706875 | Goldberg et al. | Mar 2004 | B1 |
6709841 | Short | Mar 2004 | B2 |
6709852 | Bloom et al. | Mar 2004 | B1 |
6709854 | Donahue et al. | Mar 2004 | B2 |
6713262 | Gillibolian et al. | Mar 2004 | B2 |
6716629 | Hess et al. | Apr 2004 | B2 |
6716634 | Myerson | Apr 2004 | B1 |
6723509 | Ach | Apr 2004 | B2 |
6728129 | Lindsey et al. | Apr 2004 | B2 |
6743585 | Dellinger et al. | Jun 2004 | B2 |
6753145 | Holcomb et al. | Jun 2004 | B2 |
6768005 | Mellor et al. | Jul 2004 | B2 |
6770748 | Imanishi et al. | Aug 2004 | B2 |
6770892 | Corson et al. | Aug 2004 | B2 |
6773676 | Schembri | Aug 2004 | B2 |
6773888 | Li et al. | Aug 2004 | B2 |
6780982 | Lyamichev et al. | Aug 2004 | B2 |
6787308 | Balasubramanian et al. | Sep 2004 | B2 |
6789965 | Barth et al. | Sep 2004 | B2 |
6790620 | Bass et al. | Sep 2004 | B2 |
6794499 | Wengel et al. | Sep 2004 | B2 |
6796634 | Caren et al. | Sep 2004 | B2 |
6800439 | McGall | Oct 2004 | B1 |
6814846 | Berndt | Nov 2004 | B1 |
6815218 | Jacobson et al. | Nov 2004 | B1 |
6824866 | Glazer et al. | Nov 2004 | B1 |
6830890 | Lockhart et al. | Dec 2004 | B2 |
6833246 | Balasubramanian | Dec 2004 | B2 |
6833450 | McGall et al. | Dec 2004 | B1 |
6835938 | Ghosh et al. | Dec 2004 | B2 |
6838888 | Peck | Jan 2005 | B2 |
6841131 | Zimmermann et al. | Jan 2005 | B2 |
6845968 | Killeen et al. | Jan 2005 | B2 |
6846454 | Peck | Jan 2005 | B2 |
6846922 | Manoharan et al. | Jan 2005 | B1 |
6852850 | Myerson et al. | Feb 2005 | B2 |
6858720 | Myerson et al. | Feb 2005 | B2 |
6879915 | Cattell | Apr 2005 | B2 |
6880576 | Karp et al. | Apr 2005 | B2 |
6884580 | Caren et al. | Apr 2005 | B2 |
6887715 | Schembri | May 2005 | B2 |
6890723 | Perbost et al. | May 2005 | B2 |
6890760 | Webb | May 2005 | B1 |
6893816 | Beattie | May 2005 | B1 |
6897023 | Fu et al. | May 2005 | B2 |
6900047 | Bass | May 2005 | B2 |
6900048 | Perbost | May 2005 | B2 |
6911611 | Wong et al. | Jun 2005 | B2 |
6914229 | Corson et al. | Jul 2005 | B2 |
6916113 | Van De Goor et al. | Jul 2005 | B2 |
6916633 | Shannon | Jul 2005 | B1 |
6919181 | Hargreaves | Jul 2005 | B2 |
6927029 | Lefkowitz et al. | Aug 2005 | B2 |
6929951 | Corson et al. | Aug 2005 | B2 |
6936472 | Earhart et al. | Aug 2005 | B2 |
6938476 | Chesk | Sep 2005 | B2 |
6939673 | Bass et al. | Sep 2005 | B2 |
6943036 | Bass | Sep 2005 | B2 |
6946285 | Bass | Sep 2005 | B2 |
6950756 | Kincaid | Sep 2005 | B2 |
6951719 | Dupret et al. | Oct 2005 | B1 |
6958119 | Yin et al. | Oct 2005 | B2 |
6960464 | Jessee et al. | Nov 2005 | B2 |
6969449 | Maher et al. | Nov 2005 | B2 |
6969488 | Bridgham et al. | Nov 2005 | B2 |
6976384 | Hobbs et al. | Dec 2005 | B2 |
6977223 | George et al. | Dec 2005 | B2 |
6987263 | Hobbs et al. | Jan 2006 | B2 |
6989267 | Kim et al. | Jan 2006 | B2 |
6991922 | Dupret et al. | Jan 2006 | B2 |
7008037 | Caren et al. | Mar 2006 | B2 |
7025324 | Slocum et al. | Apr 2006 | B1 |
7026124 | Barth et al. | Apr 2006 | B2 |
7027930 | Cattell | Apr 2006 | B2 |
7028536 | Karp et al. | Apr 2006 | B2 |
7029854 | Collins et al. | Apr 2006 | B2 |
7034290 | Lu et al. | Apr 2006 | B2 |
7041445 | Chenchik et al. | May 2006 | B2 |
7045289 | Allawi et al. | May 2006 | B2 |
7051574 | Peck | May 2006 | B2 |
7052841 | Delenstarr | May 2006 | B2 |
7062385 | White et al. | Jun 2006 | B2 |
7064197 | Rabbani et al. | Jun 2006 | B1 |
7070932 | Leproust et al. | Jul 2006 | B2 |
7075161 | Barth | Jul 2006 | B2 |
7078167 | Delenstarr et al. | Jul 2006 | B2 |
7078505 | Bass et al. | Jul 2006 | B2 |
7094537 | Leproust et al. | Aug 2006 | B2 |
7097974 | Staehler et al. | Aug 2006 | B1 |
7101508 | Thompson et al. | Sep 2006 | B2 |
7101986 | Dellinger et al. | Sep 2006 | B2 |
7105295 | Bass et al. | Sep 2006 | B2 |
7115423 | Mitchell | Oct 2006 | B1 |
7122303 | Delenstarr et al. | Oct 2006 | B2 |
7122364 | Lyamichev et al. | Oct 2006 | B1 |
7125488 | Li | Oct 2006 | B2 |
7125523 | Sillman | Oct 2006 | B2 |
7128876 | Yin et al. | Oct 2006 | B2 |
7129075 | Gerard et al. | Oct 2006 | B2 |
7135565 | Dellinger et al. | Nov 2006 | B2 |
7138062 | Yin et al. | Nov 2006 | B2 |
7141368 | Fisher et al. | Nov 2006 | B2 |
7141807 | Joyce et al. | Nov 2006 | B2 |
7147362 | Caren et al. | Dec 2006 | B2 |
7150982 | Allawi et al. | Dec 2006 | B2 |
7153689 | Tolosko et al. | Dec 2006 | B2 |
7163660 | Lehmann | Jan 2007 | B2 |
7166258 | Bass et al. | Jan 2007 | B2 |
7179659 | Stolowitz et al. | Feb 2007 | B2 |
7183406 | Belshaw et al. | Feb 2007 | B2 |
7192710 | Gellibolian et al. | Mar 2007 | B2 |
7193077 | Dellinger et al. | Mar 2007 | B2 |
7195872 | Agrawal et al. | Mar 2007 | B2 |
7198939 | Dorsel et al. | Apr 2007 | B2 |
7202264 | Ravikumar et al. | Apr 2007 | B2 |
7202358 | Hargreaves | Apr 2007 | B2 |
7205128 | Ilsley et al. | Apr 2007 | B2 |
7205400 | Webb | Apr 2007 | B2 |
7206439 | Zhou et al. | Apr 2007 | B2 |
7208322 | Stolowitz et al. | Apr 2007 | B2 |
7217522 | Brenner | May 2007 | B2 |
7220573 | Shea et al. | May 2007 | B2 |
7221785 | Curry et al. | May 2007 | B2 |
7226862 | Staehler et al. | Jun 2007 | B2 |
7227017 | Mellor et al. | Jun 2007 | B2 |
7229497 | Stott et al. | Jun 2007 | B2 |
7247337 | Leproust et al. | Jul 2007 | B1 |
7247497 | Dahm et al. | Jul 2007 | B2 |
7252938 | Leproust et al. | Aug 2007 | B2 |
7269518 | Corson | Sep 2007 | B2 |
7271258 | Dellinger et al. | Sep 2007 | B2 |
7276336 | Webb et al. | Oct 2007 | B1 |
7276378 | Myerson | Oct 2007 | B2 |
7276599 | Moore et al. | Oct 2007 | B2 |
7282183 | Peck | Oct 2007 | B2 |
7282332 | Caren et al. | Oct 2007 | B2 |
7282705 | Brennen | Oct 2007 | B2 |
7291471 | Sampson et al. | Nov 2007 | B2 |
7302348 | Ghosh et al. | Nov 2007 | B2 |
7306917 | Prudent et al. | Dec 2007 | B2 |
7314599 | Roitman et al. | Jan 2008 | B2 |
7323320 | Oleinikov | Jan 2008 | B2 |
7344831 | Wolber et al. | Mar 2008 | B2 |
7348144 | Minor | Mar 2008 | B2 |
7351379 | Schleifer | Apr 2008 | B2 |
7353116 | Webb et al. | Apr 2008 | B2 |
7361906 | Ghosh et al. | Apr 2008 | B2 |
7364896 | Schembri | Apr 2008 | B2 |
7368550 | Dellinger et al. | May 2008 | B2 |
7371348 | Schleifer et al. | May 2008 | B2 |
7371519 | Wolber et al. | May 2008 | B2 |
7371580 | Yakhini et al. | May 2008 | B2 |
7372982 | Le Cocq | May 2008 | B2 |
7384746 | Lyamichev et al. | Jun 2008 | B2 |
7385050 | Dellinger et al. | Jun 2008 | B2 |
7390457 | Schembri | Jun 2008 | B2 |
7393665 | Brenner | Jul 2008 | B2 |
7396676 | Robotti et al. | Jul 2008 | B2 |
7399844 | Sampson et al. | Jul 2008 | B2 |
7402279 | Schembri | Jul 2008 | B2 |
7411061 | Myerson et al. | Aug 2008 | B2 |
7413709 | Roitman et al. | Aug 2008 | B2 |
7417139 | Dellinger et al. | Aug 2008 | B2 |
7422911 | Schembri | Sep 2008 | B2 |
7427679 | Dellinger et al. | Sep 2008 | B2 |
7432048 | Neri et al. | Oct 2008 | B2 |
7435810 | Myerson et al. | Oct 2008 | B2 |
7439272 | Xu | Oct 2008 | B2 |
7476709 | Moody et al. | Jan 2009 | B2 |
7482118 | Allawi et al. | Jan 2009 | B2 |
7488607 | Tom-Moy et al. | Feb 2009 | B2 |
7504213 | Sana et al. | Mar 2009 | B2 |
7514369 | Li et al. | Apr 2009 | B2 |
7517979 | Wolber | Apr 2009 | B2 |
7524942 | Wang et al. | Apr 2009 | B2 |
7524950 | Dellinger et al. | Apr 2009 | B2 |
7527928 | Neri et al. | May 2009 | B2 |
7531303 | Dorsel et al. | May 2009 | B2 |
7534561 | Sana et al. | May 2009 | B2 |
7534563 | Hargreaves | May 2009 | B2 |
7537936 | Dahm et al. | May 2009 | B2 |
7541145 | Prudent et al. | Jun 2009 | B2 |
7544473 | Brenner | Jun 2009 | B2 |
7556919 | Chenchik et al. | Jul 2009 | B2 |
7563600 | Oleinikov | Jul 2009 | B2 |
7572585 | Wang | Aug 2009 | B2 |
7572907 | Dellinger et al. | Aug 2009 | B2 |
7572908 | Dellinger et al. | Aug 2009 | B2 |
7585970 | Dellinger et al. | Sep 2009 | B2 |
7588889 | Wolber et al. | Sep 2009 | B2 |
7595350 | Xu | Sep 2009 | B2 |
7604941 | Jacobson | Oct 2009 | B2 |
7604996 | Stuelpnagel et al. | Oct 2009 | B1 |
7608396 | Delenstarr | Oct 2009 | B2 |
7618777 | Myerson et al. | Nov 2009 | B2 |
7629120 | Bennett et al. | Dec 2009 | B2 |
7635772 | McCormac | Dec 2009 | B2 |
7648832 | Jessee et al. | Jan 2010 | B2 |
7651762 | Xu et al. | Jan 2010 | B2 |
7659069 | Belyaev et al. | Feb 2010 | B2 |
7678542 | Lyamichev et al. | Mar 2010 | B2 |
7682809 | Sampson | Mar 2010 | B2 |
7709197 | Drmanac | May 2010 | B2 |
7718365 | Wang | May 2010 | B2 |
7718786 | Dupret et al. | May 2010 | B2 |
7723077 | Young et al. | May 2010 | B2 |
7737088 | Staehler et al. | Jun 2010 | B1 |
7737089 | Guimil et al. | Jun 2010 | B2 |
7741463 | Gormley et al. | Jun 2010 | B2 |
7749701 | Leproust et al. | Jul 2010 | B2 |
7759471 | Dellinger et al. | Jul 2010 | B2 |
7776021 | Borenstein et al. | Aug 2010 | B2 |
7776532 | Gibson et al. | Aug 2010 | B2 |
7790369 | Stahler et al. | Sep 2010 | B2 |
7790387 | Dellinger et al. | Sep 2010 | B2 |
7807356 | Sampson et al. | Oct 2010 | B2 |
7807806 | Allawi et al. | Oct 2010 | B2 |
7811753 | Eshoo | Oct 2010 | B2 |
7816079 | Fischer | Oct 2010 | B2 |
7820387 | Neri et al. | Oct 2010 | B2 |
7829314 | Prudent et al. | Nov 2010 | B2 |
7855281 | Dellinger et al. | Dec 2010 | B2 |
7862999 | Zheng et al. | Jan 2011 | B2 |
7867782 | Barth | Jan 2011 | B2 |
7875463 | Adaskin et al. | Jan 2011 | B2 |
7879541 | Kincaid | Feb 2011 | B2 |
7879580 | Carr et al. | Feb 2011 | B2 |
7894998 | Kincaid | Feb 2011 | B2 |
7919239 | Wang | Apr 2011 | B2 |
7919308 | Schleifer | Apr 2011 | B2 |
7927797 | Nobile et al. | Apr 2011 | B2 |
7927838 | Shannon | Apr 2011 | B2 |
7932025 | Carr et al. | Apr 2011 | B2 |
7932070 | Hogrefe et al. | Apr 2011 | B2 |
7935800 | Allawi et al. | May 2011 | B2 |
7939645 | Borns | May 2011 | B2 |
7943046 | Martosella et al. | May 2011 | B2 |
7943358 | Hogrefe et al. | May 2011 | B2 |
7960157 | Borns | Jun 2011 | B2 |
7977119 | Kronick et al. | Jul 2011 | B2 |
7979215 | Sampas | Jul 2011 | B2 |
7998437 | Berndt et al. | Aug 2011 | B2 |
7999087 | Dellinger et al. | Aug 2011 | B2 |
8021842 | Brenner | Sep 2011 | B2 |
8021844 | Wang | Sep 2011 | B2 |
8034917 | Yamada | Oct 2011 | B2 |
8036835 | Sampas et al. | Oct 2011 | B2 |
8048664 | Guan et al. | Nov 2011 | B2 |
8053191 | Blake | Nov 2011 | B2 |
8058001 | Crameri et al. | Nov 2011 | B2 |
8058004 | Oleinikov | Nov 2011 | B2 |
8058055 | Barrett et al. | Nov 2011 | B2 |
8063184 | Allawi et al. | Nov 2011 | B2 |
8067556 | Hogrefe et al. | Nov 2011 | B2 |
8073626 | Troup et al. | Dec 2011 | B2 |
8076064 | Wang | Dec 2011 | B2 |
8076152 | Robotti | Dec 2011 | B2 |
8097711 | Timar et al. | Jan 2012 | B2 |
8137936 | Macevicz | Mar 2012 | B2 |
8148068 | Brenner | Apr 2012 | B2 |
8154729 | Baldo et al. | Apr 2012 | B2 |
8168385 | Brenner | May 2012 | B2 |
8168388 | Gormley et al. | May 2012 | B2 |
8173368 | Staehler et al. | May 2012 | B2 |
8182991 | Kaiser et al. | May 2012 | B1 |
8194244 | Wang et al. | Jun 2012 | B2 |
8198071 | Goshoo et al. | Jun 2012 | B2 |
8202983 | Dellinger et al. | Jun 2012 | B2 |
8202985 | Dellinger et al. | Jun 2012 | B2 |
8206952 | Carr et al. | Jun 2012 | B2 |
8213015 | Kraiczek et al. | Jul 2012 | B2 |
8242258 | Dellinger et al. | Aug 2012 | B2 |
8247221 | Fawcett | Aug 2012 | B2 |
8263335 | Carr et al. | Sep 2012 | B2 |
8268605 | Sorge et al. | Sep 2012 | B2 |
8283148 | Sorge et al. | Oct 2012 | B2 |
8288093 | Hall et al. | Oct 2012 | B2 |
8298767 | Brenner et al. | Oct 2012 | B2 |
8304273 | Stellacci et al. | Nov 2012 | B2 |
8309307 | Barrett et al. | Nov 2012 | B2 |
8309706 | Dellinger et al. | Nov 2012 | B2 |
8309710 | Sierzchala et al. | Nov 2012 | B2 |
8314220 | Mullinax et al. | Nov 2012 | B2 |
8318433 | Brenner | Nov 2012 | B2 |
8318479 | Domansky et al. | Nov 2012 | B2 |
8357489 | Chua et al. | Jan 2013 | B2 |
8357490 | Froehlich et al. | Jan 2013 | B2 |
8367016 | Quan et al. | Feb 2013 | B2 |
8367335 | Staehler et al. | Feb 2013 | B2 |
8380441 | Webb et al. | Feb 2013 | B2 |
8383338 | Kitzman et al. | Feb 2013 | B2 |
8415138 | Leproust | Apr 2013 | B2 |
8435736 | Gibson et al. | May 2013 | B2 |
8445205 | Brenner | May 2013 | B2 |
8445206 | Bergmann et al. | May 2013 | B2 |
8470996 | Brenner | Jun 2013 | B2 |
8476018 | Brenner | Jul 2013 | B2 |
8476598 | Pralle et al. | Jul 2013 | B1 |
8481292 | Casbon et al. | Jul 2013 | B2 |
8481309 | Zhang et al. | Jul 2013 | B2 |
8491561 | Borenstein et al. | Jul 2013 | B2 |
8497069 | Hutchison, III et al. | Jul 2013 | B2 |
8500979 | Elibol et al. | Aug 2013 | B2 |
8501454 | Liu et al. | Aug 2013 | B2 |
8507226 | Carr et al. | Aug 2013 | B2 |
8507239 | Lubys et al. | Aug 2013 | B2 |
8507272 | Zhang et al. | Aug 2013 | B2 |
8530197 | Li et al. | Sep 2013 | B2 |
8552174 | Dellinger et al. | Oct 2013 | B2 |
8563478 | Gormley et al. | Oct 2013 | B2 |
8569046 | Love et al. | Oct 2013 | B2 |
8577621 | Troup et al. | Nov 2013 | B2 |
8586310 | Mitra et al. | Nov 2013 | B2 |
8614092 | Zhang et al. | Dec 2013 | B2 |
8642755 | Sierzchala et al. | Feb 2014 | B2 |
8664164 | Ericsson et al. | Mar 2014 | B2 |
8669053 | Stuelpnagel et al. | Mar 2014 | B2 |
8679756 | Brenner et al. | Mar 2014 | B1 |
8685642 | Sampas | Apr 2014 | B2 |
8685676 | Hogrefe et al. | Apr 2014 | B2 |
8685678 | Casbon et al. | Apr 2014 | B2 |
8715933 | Oliver | May 2014 | B2 |
8715967 | Casbon et al. | May 2014 | B2 |
8716467 | Jacobson | May 2014 | B2 |
8722368 | Casbon et al. | May 2014 | B2 |
8722585 | Wang | May 2014 | B2 |
8728766 | Casbon et al. | May 2014 | B2 |
8741606 | Casbon et al. | Jun 2014 | B2 |
8808896 | Choo et al. | Aug 2014 | B2 |
8808986 | Jacobson et al. | Aug 2014 | B2 |
8815600 | Liu et al. | Aug 2014 | B2 |
8889851 | Leproust et al. | Nov 2014 | B2 |
8932994 | Gormley et al. | Jan 2015 | B2 |
8962532 | Shapiro et al. | Feb 2015 | B2 |
8968999 | Gibson et al. | Mar 2015 | B2 |
8980563 | Zheng et al. | Mar 2015 | B2 |
9018365 | Brenner | Apr 2015 | B2 |
9023601 | Oleinikov | May 2015 | B2 |
9051666 | Oleinikov | Jun 2015 | B2 |
9073962 | Fracchia et al. | Jul 2015 | B2 |
9074204 | Anderson et al. | Jul 2015 | B2 |
9085797 | Gebeyehu et al. | Jul 2015 | B2 |
9102731 | Boone et al. | Aug 2015 | B2 |
9133510 | Andersen et al. | Sep 2015 | B2 |
9139874 | Myers et al. | Sep 2015 | B2 |
9150853 | Hudson et al. | Oct 2015 | B2 |
9187777 | Jacobson et al. | Nov 2015 | B2 |
9194001 | Brenner | Nov 2015 | B2 |
9216414 | Chu | Dec 2015 | B2 |
9217144 | Jacobson et al. | Dec 2015 | B2 |
9279149 | Efcavitch et al. | Mar 2016 | B2 |
9286439 | Shapiro et al. | Mar 2016 | B2 |
9295965 | Jacobson et al. | Mar 2016 | B2 |
9315861 | Hendricks et al. | Apr 2016 | B2 |
9328378 | Earnshaw et al. | May 2016 | B2 |
9347091 | Bergmann et al. | May 2016 | B2 |
9375748 | Harumoto et al. | Jun 2016 | B2 |
9376677 | Mir | Jun 2016 | B2 |
9376678 | Gormley et al. | Jun 2016 | B2 |
9384320 | Church | Jul 2016 | B2 |
9384920 | Bakulich | Jul 2016 | B1 |
9388407 | Jacobson | Jul 2016 | B2 |
9394333 | Wada et al. | Jul 2016 | B2 |
9403141 | Banyai et al. | Aug 2016 | B2 |
9409139 | Banyai et al. | Aug 2016 | B2 |
9410149 | Brenner et al. | Aug 2016 | B2 |
9410173 | Betts et al. | Aug 2016 | B2 |
9416411 | Stuelpnagel et al. | Aug 2016 | B2 |
9422600 | Ramu et al. | Aug 2016 | B2 |
9487824 | Kutyavin et al. | Nov 2016 | B2 |
9523122 | Zheng et al. | Dec 2016 | B2 |
9528148 | Zheng et al. | Dec 2016 | B2 |
9534251 | Young et al. | Jan 2017 | B2 |
9555388 | Banyai et al. | Jan 2017 | B2 |
9568839 | Stahler et al. | Feb 2017 | B2 |
9580746 | Leproust et al. | Feb 2017 | B2 |
9670529 | Osborne et al. | Jun 2017 | B2 |
9670536 | Casbon et al. | Jun 2017 | B2 |
9677067 | Toro et al. | Jun 2017 | B2 |
9695211 | Wada et al. | Jul 2017 | B2 |
9718060 | Venter et al. | Aug 2017 | B2 |
9745573 | Stuelpnagel et al. | Aug 2017 | B2 |
9745619 | Rabbani et al. | Aug 2017 | B2 |
9765387 | Rabbani et al. | Sep 2017 | B2 |
9771576 | Gibson et al. | Sep 2017 | B2 |
9833761 | Banyai et al. | Dec 2017 | B2 |
9834774 | Carstens | Dec 2017 | B2 |
9839894 | Banyai et al. | Dec 2017 | B2 |
9879283 | Ravinder et al. | Jan 2018 | B2 |
9889423 | Banyai et al. | Feb 2018 | B2 |
9895673 | Peck et al. | Feb 2018 | B2 |
9925510 | Jacobson et al. | Mar 2018 | B2 |
9932576 | Raymond et al. | Apr 2018 | B2 |
9981239 | Banyai et al. | May 2018 | B2 |
10053688 | Cox | Aug 2018 | B2 |
10272410 | Banyai | Apr 2019 | B2 |
10583415 | Banyai et al. | Mar 2020 | B2 |
10754994 | Peck | Aug 2020 | B2 |
10773232 | Banyai et al. | Sep 2020 | B2 |
10963953 | Sweeder et al. | Mar 2021 | B2 |
11214798 | Brown | Jan 2022 | B2 |
11236393 | Dubinsky et al. | Feb 2022 | B2 |
11268149 | Targan et al. | Mar 2022 | B2 |
20010018512 | Blanchard | Aug 2001 | A1 |
20010039014 | Bass et al. | Nov 2001 | A1 |
20010055761 | Kanemoto et al. | Dec 2001 | A1 |
20020012930 | Rothberg et al. | Jan 2002 | A1 |
20020025561 | Hodgson | Feb 2002 | A1 |
20020076716 | Sabanayagam et al. | Jun 2002 | A1 |
20020081582 | Gao et al. | Jun 2002 | A1 |
20020094533 | Hess et al. | Jul 2002 | A1 |
20020095073 | Jacobs et al. | Jul 2002 | A1 |
20020119459 | Griffiths et al. | Aug 2002 | A1 |
20020132308 | Liu et al. | Sep 2002 | A1 |
20020155439 | Rodriguez et al. | Oct 2002 | A1 |
20020160536 | Regnier et al. | Oct 2002 | A1 |
20020164824 | Xiao et al. | Nov 2002 | A1 |
20030008411 | Van Dam et al. | Jan 2003 | A1 |
20030022207 | Balasubramanian et al. | Jan 2003 | A1 |
20030022317 | Jack et al. | Jan 2003 | A1 |
20030044781 | Korlach et al. | Mar 2003 | A1 |
20030058629 | Hirai et al. | Mar 2003 | A1 |
20030064398 | Barnes | Apr 2003 | A1 |
20030068633 | Belshaw et al. | Apr 2003 | A1 |
20030082719 | Schumacher et al. | May 2003 | A1 |
20030100102 | Rothberg et al. | May 2003 | A1 |
20030108903 | Wang et al. | Jun 2003 | A1 |
20030120035 | Gao et al. | Jun 2003 | A1 |
20030130827 | Bentzien et al. | Jul 2003 | A1 |
20030138782 | Evans | Jul 2003 | A1 |
20030143605 | Lok et al. | Jul 2003 | A1 |
20030148291 | Robotti | Aug 2003 | A1 |
20030148344 | Rothberg et al. | Aug 2003 | A1 |
20030171325 | Gascoyne et al. | Sep 2003 | A1 |
20030186226 | Brennan et al. | Oct 2003 | A1 |
20030228602 | Parker et al. | Dec 2003 | A1 |
20030228620 | Du Breuil Lastrucci | Dec 2003 | A1 |
20040009498 | Short | Jan 2004 | A1 |
20040043509 | Stahler et al. | Mar 2004 | A1 |
20040053362 | De Luca et al. | Mar 2004 | A1 |
20040086892 | Crothers et al. | May 2004 | A1 |
20040087008 | Schembri | May 2004 | A1 |
20040106130 | Besemer et al. | Jun 2004 | A1 |
20040106728 | McGall et al. | Jun 2004 | A1 |
20040110133 | Xu et al. | Jun 2004 | A1 |
20040175710 | Haushalter | Sep 2004 | A1 |
20040175734 | Stahler et al. | Sep 2004 | A1 |
20040191810 | Yamamoto | Sep 2004 | A1 |
20040213795 | Collins et al. | Oct 2004 | A1 |
20040219663 | Page et al. | Nov 2004 | A1 |
20040236027 | Maeji et al. | Nov 2004 | A1 |
20040248161 | Rothberg et al. | Dec 2004 | A1 |
20040253242 | Bowdish et al. | Dec 2004 | A1 |
20040259146 | Friend et al. | Dec 2004 | A1 |
20050022895 | Barth et al. | Feb 2005 | A1 |
20050049402 | Babcook et al. | Mar 2005 | A1 |
20050049796 | Webb et al. | Mar 2005 | A1 |
20050053968 | Bharadwaj et al. | Mar 2005 | A1 |
20050079510 | Berka et al. | Apr 2005 | A1 |
20050100932 | Lapidus et al. | May 2005 | A1 |
20050112608 | Grossman et al. | May 2005 | A1 |
20050112636 | Hurt et al. | May 2005 | A1 |
20050112679 | Myerson et al. | May 2005 | A1 |
20050124022 | Srinivasan et al. | Jun 2005 | A1 |
20050137805 | Lewin et al. | Jun 2005 | A1 |
20050208513 | Agbo et al. | Sep 2005 | A1 |
20050214778 | Peck et al. | Sep 2005 | A1 |
20050214779 | Peck et al. | Sep 2005 | A1 |
20050227235 | Carr et al. | Oct 2005 | A1 |
20050255477 | Carr et al. | Nov 2005 | A1 |
20050266045 | Canham et al. | Dec 2005 | A1 |
20050277125 | Benn et al. | Dec 2005 | A1 |
20050282158 | Landegren | Dec 2005 | A1 |
20050287585 | Oleinikov | Dec 2005 | A1 |
20060003381 | Gilmore et al. | Jan 2006 | A1 |
20060003958 | Melville | Jan 2006 | A1 |
20060012784 | Ulmer | Jan 2006 | A1 |
20060012793 | Harris | Jan 2006 | A1 |
20060019084 | Pearson | Jan 2006 | A1 |
20060024678 | Buzby | Feb 2006 | A1 |
20060024711 | Lapidus et al. | Feb 2006 | A1 |
20060024721 | Pedersen | Feb 2006 | A1 |
20060076482 | Hobbs et al. | Apr 2006 | A1 |
20060078909 | Srinivasan et al. | Apr 2006 | A1 |
20060078927 | Peck et al. | Apr 2006 | A1 |
20060078937 | Korlach et al. | Apr 2006 | A1 |
20060127920 | Church et al. | Jun 2006 | A1 |
20060134638 | Mulligan et al. | Jun 2006 | A1 |
20060160138 | Church | Jul 2006 | A1 |
20060171855 | Yin et al. | Aug 2006 | A1 |
20060202330 | Reinhardt et al. | Sep 2006 | A1 |
20060203236 | Ji et al. | Sep 2006 | A1 |
20060203237 | Ji et al. | Sep 2006 | A1 |
20060207923 | Li | Sep 2006 | A1 |
20060219637 | Killeen et al. | Oct 2006 | A1 |
20070031857 | Makarov et al. | Feb 2007 | A1 |
20070031877 | Stahler et al. | Feb 2007 | A1 |
20070043516 | Gustafsson et al. | Feb 2007 | A1 |
20070054127 | Hergenrother et al. | Mar 2007 | A1 |
20070059692 | Gao et al. | Mar 2007 | A1 |
20070087349 | Staehler et al. | Apr 2007 | A1 |
20070099196 | Kauppinen et al. | May 2007 | A1 |
20070099208 | Drmanac et al. | May 2007 | A1 |
20070122817 | Church et al. | May 2007 | A1 |
20070128635 | Macevicz | Jun 2007 | A1 |
20070141557 | Raab et al. | Jun 2007 | A1 |
20070196834 | Cerrina et al. | Aug 2007 | A1 |
20070196854 | Stahler et al. | Aug 2007 | A1 |
20070207482 | Church et al. | Sep 2007 | A1 |
20070207487 | Emig et al. | Sep 2007 | A1 |
20070231800 | Roberts et al. | Oct 2007 | A1 |
20070238104 | Barrett et al. | Oct 2007 | A1 |
20070238106 | Barrett et al. | Oct 2007 | A1 |
20070238108 | Barrett et al. | Oct 2007 | A1 |
20070259344 | Leproust et al. | Nov 2007 | A1 |
20070259345 | Sampas | Nov 2007 | A1 |
20070259346 | Gordon et al. | Nov 2007 | A1 |
20070259347 | Gordon et al. | Nov 2007 | A1 |
20070269870 | Church et al. | Nov 2007 | A1 |
20080085511 | Peck et al. | Apr 2008 | A1 |
20080085514 | Peck et al. | Apr 2008 | A1 |
20080087545 | Jensen et al. | Apr 2008 | A1 |
20080161200 | Yu et al. | Jul 2008 | A1 |
20080182296 | Chanda et al. | Jul 2008 | A1 |
20080214412 | Stahler et al. | Sep 2008 | A1 |
20080227160 | Kool | Sep 2008 | A1 |
20080233616 | Liss | Sep 2008 | A1 |
20080287320 | Baynes et al. | Nov 2008 | A1 |
20080300842 | Govindarajan et al. | Dec 2008 | A1 |
20080308884 | Kalvesten | Dec 2008 | A1 |
20080311628 | Shoemaker | Dec 2008 | A1 |
20090036664 | Peter | Feb 2009 | A1 |
20090053704 | Novoradovskaya et al. | Feb 2009 | A1 |
20090062129 | McKernan et al. | Mar 2009 | A1 |
20090074771 | Koenig et al. | Mar 2009 | A1 |
20090087840 | Baynes et al. | Apr 2009 | A1 |
20090088679 | Wood et al. | Apr 2009 | A1 |
20090105094 | Heiner et al. | Apr 2009 | A1 |
20090170802 | Stahler et al. | Jul 2009 | A1 |
20090176280 | Hutchison, III et al. | Jul 2009 | A1 |
20090181861 | Li et al. | Jul 2009 | A1 |
20090194483 | Robotti et al. | Aug 2009 | A1 |
20090230044 | Bek | Sep 2009 | A1 |
20090238722 | Mora-Fillat et al. | Sep 2009 | A1 |
20090239759 | Balch | Sep 2009 | A1 |
20090246788 | Albert | Oct 2009 | A1 |
20090263802 | Drmanac | Oct 2009 | A1 |
20090285825 | Kini et al. | Nov 2009 | A1 |
20090324546 | Notka et al. | Dec 2009 | A1 |
20100004143 | Shibahara | Jan 2010 | A1 |
20100008851 | Nicolaides et al. | Jan 2010 | A1 |
20100009872 | Eid et al. | Jan 2010 | A1 |
20100047805 | Wang | Feb 2010 | A1 |
20100051967 | Bradley et al. | Mar 2010 | A1 |
20100069250 | White, III et al. | Mar 2010 | A1 |
20100090341 | Wan et al. | Apr 2010 | A1 |
20100099103 | Hsieh et al. | Apr 2010 | A1 |
20100111768 | Banerjee et al. | May 2010 | A1 |
20100160463 | Wang et al. | Jun 2010 | A1 |
20100167950 | Juang et al. | Jul 2010 | A1 |
20100173364 | Evans, Jr. et al. | Jul 2010 | A1 |
20100216648 | Staehler et al. | Aug 2010 | A1 |
20100256017 | Larman et al. | Oct 2010 | A1 |
20100258487 | Zelechonok et al. | Oct 2010 | A1 |
20100272711 | Feldman et al. | Oct 2010 | A1 |
20100286290 | Lohmann et al. | Nov 2010 | A1 |
20100292102 | Nouri | Nov 2010 | A1 |
20100300882 | Zhang et al. | Dec 2010 | A1 |
20100311960 | Dellinger | Dec 2010 | A1 |
20100323404 | Lathrop | Dec 2010 | A1 |
20110009607 | Komiyama et al. | Jan 2011 | A1 |
20110082055 | Fox et al. | Apr 2011 | A1 |
20110114244 | Yoo et al. | May 2011 | A1 |
20110114549 | Yin et al. | May 2011 | A1 |
20110124049 | Li et al. | May 2011 | A1 |
20110124055 | Carr et al. | May 2011 | A1 |
20110126929 | Velasquez-Garcia et al. | Jun 2011 | A1 |
20110171651 | Richmond | Jul 2011 | A1 |
20110172127 | Jacobson et al. | Jul 2011 | A1 |
20110201057 | Carr et al. | Aug 2011 | A1 |
20110217738 | Jacobson | Sep 2011 | A1 |
20110229975 | Matthiesen et al. | Sep 2011 | A1 |
20110230653 | Novoradovskaya et al. | Sep 2011 | A1 |
20110254107 | Bulovic et al. | Oct 2011 | A1 |
20110287435 | Grunenwald et al. | Nov 2011 | A1 |
20120003713 | Hansen et al. | Jan 2012 | A1 |
20120021932 | Mershin et al. | Jan 2012 | A1 |
20120027786 | Gupta et al. | Feb 2012 | A1 |
20120028843 | Ramu et al. | Feb 2012 | A1 |
20120032366 | Ivniski et al. | Feb 2012 | A1 |
20120046175 | Rodesch et al. | Feb 2012 | A1 |
20120050411 | Mabritto et al. | Mar 2012 | A1 |
20120094847 | Warthmann et al. | Apr 2012 | A1 |
20120128548 | West | May 2012 | A1 |
20120129704 | Gunderson et al. | May 2012 | A1 |
20120149602 | Friend et al. | Jun 2012 | A1 |
20120164127 | Short et al. | Jun 2012 | A1 |
20120164633 | Laffler | Jun 2012 | A1 |
20120164691 | Eshoo et al. | Jun 2012 | A1 |
20120184724 | Sierzchala et al. | Jul 2012 | A1 |
20120220497 | Jacobson et al. | Aug 2012 | A1 |
20120231968 | Bruhn et al. | Sep 2012 | A1 |
20120238737 | Dellinger et al. | Sep 2012 | A1 |
20120258487 | Chang et al. | Oct 2012 | A1 |
20120264653 | Carr et al. | Oct 2012 | A1 |
20120270750 | Oleinikov | Oct 2012 | A1 |
20120270754 | Blake | Oct 2012 | A1 |
20120283140 | Chu | Nov 2012 | A1 |
20120288476 | Hartmann et al. | Nov 2012 | A1 |
20120289691 | Dellinger et al. | Nov 2012 | A1 |
20120315670 | Jacobson et al. | Dec 2012 | A1 |
20120322681 | Kung et al. | Dec 2012 | A1 |
20130005585 | Anderson et al. | Jan 2013 | A1 |
20130005612 | Carr et al. | Jan 2013 | A1 |
20130017642 | Milgrew et al. | Jan 2013 | A1 |
20130017977 | Oleinikov | Jan 2013 | A1 |
20130017978 | Kavanagh et al. | Jan 2013 | A1 |
20130035261 | Sierzchala et al. | Feb 2013 | A1 |
20130040836 | Himmler et al. | Feb 2013 | A1 |
20130045483 | Treusch et al. | Feb 2013 | A1 |
20130053252 | Xie et al. | Feb 2013 | A1 |
20130059296 | Jacobson et al. | Mar 2013 | A1 |
20130059761 | Jacobson et al. | Mar 2013 | A1 |
20130065017 | Sieber | Mar 2013 | A1 |
20130109595 | Routenberg | May 2013 | A1 |
20130109596 | Peterson et al. | May 2013 | A1 |
20130123129 | Zeiner et al. | May 2013 | A1 |
20130130321 | Staehler et al. | May 2013 | A1 |
20130137161 | Zhang et al. | May 2013 | A1 |
20130137173 | Zhang et al. | May 2013 | A1 |
20130137174 | Zhang et al. | May 2013 | A1 |
20130137861 | Leproust et al. | May 2013 | A1 |
20130164308 | Foletti et al. | Jun 2013 | A1 |
20130165328 | Previte et al. | Jun 2013 | A1 |
20130196864 | Govindarajan et al. | Aug 2013 | A1 |
20130225421 | Li et al. | Aug 2013 | A1 |
20130244884 | Jacobson et al. | Sep 2013 | A1 |
20130252849 | Hudson et al. | Sep 2013 | A1 |
20130261027 | Li et al. | Oct 2013 | A1 |
20130281308 | Kung et al. | Oct 2013 | A1 |
20130289246 | Crowe et al. | Oct 2013 | A1 |
20130296192 | Jacobson et al. | Nov 2013 | A1 |
20130296194 | Jacobson et al. | Nov 2013 | A1 |
20130298265 | Cunnac et al. | Nov 2013 | A1 |
20130309725 | Jacobson et al. | Nov 2013 | A1 |
20130323722 | Carr et al. | Dec 2013 | A1 |
20130323725 | Peter et al. | Dec 2013 | A1 |
20130330778 | Zeiner et al. | Dec 2013 | A1 |
20140011226 | Bernick et al. | Jan 2014 | A1 |
20140018441 | Fracchia et al. | Jan 2014 | A1 |
20140031240 | Behlke et al. | Jan 2014 | A1 |
20140038240 | Temme et al. | Feb 2014 | A1 |
20140106394 | Ko et al. | Apr 2014 | A1 |
20140141982 | Jacobson et al. | May 2014 | A1 |
20140170665 | Hiddessen et al. | Jun 2014 | A1 |
20140178992 | Nakashima et al. | Jun 2014 | A1 |
20140221250 | Vasquez et al. | Aug 2014 | A1 |
20140274729 | Kurn et al. | Sep 2014 | A1 |
20140274741 | Hunter et al. | Sep 2014 | A1 |
20140303000 | Armour et al. | Oct 2014 | A1 |
20140309119 | Jacobson et al. | Oct 2014 | A1 |
20140309142 | Tian | Oct 2014 | A1 |
20150010953 | Lindstrom et al. | Jan 2015 | A1 |
20150012723 | Park et al. | Jan 2015 | A1 |
20150031089 | Lindstrom | Jan 2015 | A1 |
20150038373 | Banyai et al. | Feb 2015 | A1 |
20150056609 | Daum et al. | Feb 2015 | A1 |
20150057625 | Coulthard | Feb 2015 | A1 |
20150065357 | Fox | Mar 2015 | A1 |
20150065393 | Jacobson | Mar 2015 | A1 |
20150099870 | Bennett et al. | Apr 2015 | A1 |
20150119293 | Short | Apr 2015 | A1 |
20150120265 | Amirav-Drory et al. | Apr 2015 | A1 |
20150159152 | Allen et al. | Jun 2015 | A1 |
20150183853 | Sharma et al. | Jul 2015 | A1 |
20150191524 | Smith et al. | Jul 2015 | A1 |
20150191624 | Scheibel et al. | Jul 2015 | A1 |
20150191719 | Hudson et al. | Jul 2015 | A1 |
20150196917 | Kay et al. | Jul 2015 | A1 |
20150203839 | Jacobson et al. | Jul 2015 | A1 |
20150211047 | Borns | Jul 2015 | A1 |
20150225782 | Walder et al. | Aug 2015 | A1 |
20150240232 | Zamore et al. | Aug 2015 | A1 |
20150240280 | Gibson et al. | Aug 2015 | A1 |
20150261664 | Goldman et al. | Sep 2015 | A1 |
20150269313 | Church | Sep 2015 | A1 |
20150293102 | Shim | Oct 2015 | A1 |
20150307875 | Happe et al. | Oct 2015 | A1 |
20150321191 | Kendall et al. | Nov 2015 | A1 |
20150322504 | Lao et al. | Nov 2015 | A1 |
20150344927 | Sampson et al. | Dec 2015 | A1 |
20150353921 | Tian | Dec 2015 | A9 |
20150353994 | Myers et al. | Dec 2015 | A1 |
20150361420 | Hudson et al. | Dec 2015 | A1 |
20150361422 | Sampson et al. | Dec 2015 | A1 |
20150361423 | Sampson et al. | Dec 2015 | A1 |
20150368687 | Saaem et al. | Dec 2015 | A1 |
20150376602 | Jacobson et al. | Dec 2015 | A1 |
20160001247 | Oleinikov | Jan 2016 | A1 |
20160002621 | Nelson et al. | Jan 2016 | A1 |
20160002622 | Nelson et al. | Jan 2016 | A1 |
20160010045 | Cohen et al. | Jan 2016 | A1 |
20160017394 | Liang et al. | Jan 2016 | A1 |
20160017425 | Ruvolo et al. | Jan 2016 | A1 |
20160019341 | Harris et al. | Jan 2016 | A1 |
20160024138 | Gebeyehu et al. | Jan 2016 | A1 |
20160024576 | Chee | Jan 2016 | A1 |
20160026753 | Krishnaswami et al. | Jan 2016 | A1 |
20160026758 | Jabara et al. | Jan 2016 | A1 |
20160032396 | Diehn et al. | Feb 2016 | A1 |
20160046973 | Efcavitch et al. | Feb 2016 | A1 |
20160046974 | Efcavitch et al. | Feb 2016 | A1 |
20160082472 | Perego et al. | Mar 2016 | A1 |
20160089651 | Banyai | Mar 2016 | A1 |
20160090422 | Reif et al. | Mar 2016 | A1 |
20160090592 | Banyai et al. | Mar 2016 | A1 |
20160096160 | Banyai et al. | Apr 2016 | A1 |
20160097051 | Jacobson et al. | Apr 2016 | A1 |
20160102322 | Ravinder et al. | Apr 2016 | A1 |
20160108466 | Nazarenko et al. | Apr 2016 | A1 |
20160122755 | Hall et al. | May 2016 | A1 |
20160122800 | Bernick et al. | May 2016 | A1 |
20160152972 | Stapleton et al. | Jun 2016 | A1 |
20160168611 | Efcavitch et al. | Jun 2016 | A1 |
20160184788 | Hall et al. | Jun 2016 | A1 |
20160200759 | Srivastava et al. | Jul 2016 | A1 |
20160215283 | Braman et al. | Jul 2016 | A1 |
20160229884 | Indermuhle et al. | Aug 2016 | A1 |
20160230175 | Carstens | Aug 2016 | A1 |
20160230221 | Bergmann et al. | Aug 2016 | A1 |
20160251651 | Banyai et al. | Sep 2016 | A1 |
20160256846 | Smith et al. | Sep 2016 | A1 |
20160264958 | Toro et al. | Sep 2016 | A1 |
20160289758 | Akeson et al. | Oct 2016 | A1 |
20160289839 | Harumoto et al. | Oct 2016 | A1 |
20160303535 | Banyai et al. | Oct 2016 | A1 |
20160304862 | Igawa et al. | Oct 2016 | A1 |
20160304946 | Betts et al. | Oct 2016 | A1 |
20160310426 | Wu | Oct 2016 | A1 |
20160310927 | Banyai et al. | Oct 2016 | A1 |
20160318016 | Hou et al. | Nov 2016 | A1 |
20160333340 | Wu | Nov 2016 | A1 |
20160339409 | Banyai et al. | Nov 2016 | A1 |
20160340672 | Banyai et al. | Nov 2016 | A1 |
20160348098 | Stuelpnagel et al. | Dec 2016 | A1 |
20160354752 | Banyai et al. | Dec 2016 | A1 |
20160355880 | Gormley et al. | Dec 2016 | A1 |
20170017436 | Church | Jan 2017 | A1 |
20170066844 | Glanville | Mar 2017 | A1 |
20170067047 | Link et al. | Mar 2017 | A1 |
20170067099 | Zheng et al. | Mar 2017 | A1 |
20170073731 | Zheng et al. | Mar 2017 | A1 |
20170081660 | Cox et al. | Mar 2017 | A1 |
20170081716 | Peck | Mar 2017 | A1 |
20170088887 | Makarov et al. | Mar 2017 | A1 |
20170095785 | Banyai et al. | Apr 2017 | A1 |
20170096706 | Behlke et al. | Apr 2017 | A1 |
20170114404 | Behlke et al. | Apr 2017 | A1 |
20170141793 | Strauss et al. | May 2017 | A1 |
20170147748 | Staehler et al. | May 2017 | A1 |
20170151546 | Peck et al. | Jun 2017 | A1 |
20170159044 | Toro et al. | Jun 2017 | A1 |
20170175110 | Jacobson et al. | Jun 2017 | A1 |
20170218537 | Olivares | Aug 2017 | A1 |
20170233764 | Young et al. | Aug 2017 | A1 |
20170247473 | Short | Aug 2017 | A1 |
20170249345 | Malik et al. | Aug 2017 | A1 |
20170253644 | Steyaert et al. | Sep 2017 | A1 |
20170298432 | Holt | Oct 2017 | A1 |
20170320061 | Venter et al. | Nov 2017 | A1 |
20170327819 | Banyai et al. | Nov 2017 | A1 |
20170355984 | Evans et al. | Dec 2017 | A1 |
20170357752 | Diggans | Dec 2017 | A1 |
20170362589 | Banyai et al. | Dec 2017 | A1 |
20180029001 | Banyai et al. | Feb 2018 | A1 |
20180051278 | Cox et al. | Feb 2018 | A1 |
20180051280 | Gibson et al. | Feb 2018 | A1 |
20180068060 | Ceze et al. | Mar 2018 | A1 |
20180101487 | Peck | Apr 2018 | A1 |
20180104664 | Fernandez | Apr 2018 | A1 |
20180126355 | Peck et al. | May 2018 | A1 |
20180142289 | Zeitoun | May 2018 | A1 |
20180171509 | Cox | Jun 2018 | A1 |
20180236425 | Banyai et al. | Aug 2018 | A1 |
20180253563 | Peck et al. | Sep 2018 | A1 |
20180264428 | Banyai et al. | Sep 2018 | A1 |
20180273936 | Cox et al. | Sep 2018 | A1 |
20180282721 | Cox et al. | Oct 2018 | A1 |
20180291445 | Betts et al. | Oct 2018 | A1 |
20180312834 | Cox et al. | Nov 2018 | A1 |
20180326388 | Banyai et al. | Nov 2018 | A1 |
20180334712 | Singer et al. | Nov 2018 | A1 |
20180346585 | Zhang et al. | Dec 2018 | A1 |
20180355351 | Nugent et al. | Dec 2018 | A1 |
20190060345 | Harrison et al. | Feb 2019 | A1 |
20190083596 | Orentas et al. | Mar 2019 | A1 |
20190118154 | Marsh et al. | Apr 2019 | A1 |
20190135926 | Glanville | May 2019 | A1 |
20190224711 | Demeris, Jr. | Jul 2019 | A1 |
20190240636 | Peck et al. | Aug 2019 | A1 |
20190244109 | Bramlett et al. | Aug 2019 | A1 |
20190314783 | Banyai et al. | Oct 2019 | A1 |
20190352635 | Toro et al. | Nov 2019 | A1 |
20190366293 | Banyai et al. | Dec 2019 | A1 |
20190366294 | Banyai et al. | Dec 2019 | A1 |
20200017907 | Zeitoun et al. | Jan 2020 | A1 |
20200056229 | Mir | Feb 2020 | A1 |
20200102611 | Zeitoun et al. | Apr 2020 | A1 |
20200156037 | Banyai et al. | May 2020 | A1 |
20200181667 | Wu et al. | Jun 2020 | A1 |
20200222875 | Peck et al. | Jul 2020 | A1 |
20200283760 | Nugent et al. | Sep 2020 | A1 |
20200299322 | Indermuhle et al. | Sep 2020 | A1 |
20200299684 | Toro et al. | Sep 2020 | A1 |
20200308575 | Sato | Oct 2020 | A1 |
20200325235 | Tabibiazar et al. | Oct 2020 | A1 |
20200342143 | Peck | Oct 2020 | A1 |
20210002710 | Gantt et al. | Jan 2021 | A1 |
20210040476 | Cox et al. | Feb 2021 | A1 |
20210071168 | Nugent et al. | Mar 2021 | A1 |
20210102192 | Tabibiazar et al. | Apr 2021 | A1 |
20210102195 | Sato et al. | Apr 2021 | A1 |
20210102198 | Cox et al. | Apr 2021 | A1 |
20210115594 | Cox et al. | Apr 2021 | A1 |
20210129108 | Marsh et al. | May 2021 | A1 |
20210142182 | Bramlett et al. | May 2021 | A1 |
20210147830 | Liss | May 2021 | A1 |
20210170356 | Peck et al. | Jun 2021 | A1 |
20210179724 | Sato et al. | Jun 2021 | A1 |
20210207197 | Gantt et al. | Jul 2021 | A1 |
20210332078 | Wu | Oct 2021 | A1 |
20210348220 | Zeitoun et al. | Nov 2021 | A1 |
20210355194 | Sato et al. | Nov 2021 | A1 |
20210395344 | Sato et al. | Dec 2021 | A1 |
20220032256 | Lackey et al. | Feb 2022 | A1 |
20220064206 | Fernandez et al. | Mar 2022 | A1 |
20220064313 | Sato et al. | Mar 2022 | A1 |
20220064628 | Toro et al. | Mar 2022 | A1 |
20220106586 | Nugent et al. | Apr 2022 | A1 |
20220106590 | Arbiza et al. | Apr 2022 | A1 |
20220135690 | Sato et al. | May 2022 | A1 |
20220135965 | Gantt et al. | May 2022 | A1 |
20220138354 | Peck | May 2022 | A1 |
20220145289 | Lackey et al. | May 2022 | A1 |
20220206001 | Sato | Jun 2022 | A1 |
20220243195 | Nugent et al. | Aug 2022 | A1 |
20220246236 | Amirav-Drory | Aug 2022 | A1 |
20220259319 | Sato et al. | Aug 2022 | A1 |
20220259638 | Brown | Aug 2022 | A1 |
20220277808 | Arbiza et al. | Sep 2022 | A1 |
20220281989 | Glanville | Sep 2022 | A1 |
Number | Date | Country |
---|---|---|
3157000 | Sep 2000 | AU |
2362939 | Aug 2000 | CA |
2792676 | Sep 2011 | CA |
1771336 | May 2006 | CN |
101277758 | Oct 2008 | CN |
102159726 | Aug 2011 | CN |
103003431 | Mar 2013 | CN |
103907117 | Jul 2014 | CN |
104520864 | Apr 2015 | CN |
104562213 | Apr 2015 | CN |
104734848 | Jun 2015 | CN |
104974929 | Oct 2015 | CN |
204714802 | Oct 2015 | CN |
105637097 | Jun 2016 | CN |
10260805 | Jul 2004 | DE |
201890763 | Aug 2018 | EA |
0090789 | Oct 1983 | EP |
0126621 | Aug 1990 | EP |
0753057 | Jan 1997 | EP |
1153127 | Nov 2001 | EP |
1314783 | May 2003 | EP |
1363125 | Nov 2003 | EP |
1546387 | Jun 2005 | EP |
1153127 | Jul 2006 | EP |
1728860 | Dec 2006 | EP |
1072010 | Apr 2010 | EP |
2175021 | Apr 2010 | EP |
2330216 | Jun 2011 | EP |
1343802 | May 2012 | EP |
2504449 | Oct 2012 | EP |
2751729 | Jul 2014 | EP |
2872629 | May 2015 | EP |
2928500 | Oct 2015 | EP |
2971034 | Jan 2016 | EP |
3030682 | Jun 2016 | EP |
3044228 | Apr 2017 | EP |
2994509 | Jun 2017 | EP |
3204518 | Aug 2017 | EP |
H07505530 | Jun 1995 | JP |
2001518086 | Oct 2001 | JP |
2002511276 | Apr 2002 | JP |
2002536977 | Nov 2002 | JP |
2002538790 | Nov 2002 | JP |
2003522119 | Jul 2003 | JP |
2004521628 | Jul 2004 | JP |
2006503586 | Feb 2006 | JP |
2006238724 | Sep 2006 | JP |
2008505642 | Feb 2008 | JP |
2008097189 | Apr 2008 | JP |
2008523786 | Jul 2008 | JP |
2008214343 | Sep 2008 | JP |
2009294195 | Dec 2009 | JP |
2016527313 | Sep 2016 | JP |
WO-9015070 | Dec 1990 | WO |
WO-9210092 | Jun 1992 | WO |
WO-9210588 | Jun 1992 | WO |
WO-9309668 | May 1993 | WO |
WO-9320242 | Oct 1993 | WO |
WO-9525116 | Sep 1995 | WO |
WO-9526397 | Oct 1995 | WO |
WO-9615861 | May 1996 | WO |
WO-9710365 | Mar 1997 | WO |
WO-9822541 | May 1998 | WO |
WO-9841531 | Sep 1998 | WO |
WO-9942813 | Aug 1999 | WO |
WO-9953101 | Oct 1999 | WO |
WO-0013017 | Mar 2000 | WO |
WO-0018957 | Apr 2000 | WO |
WO-0042559 | Jul 2000 | WO |
WO-0042560 | Jul 2000 | WO |
WO-0042561 | Jul 2000 | WO |
WO-0049142 | Aug 2000 | WO |
WO-0053617 | Sep 2000 | WO |
WO-0156216 | Aug 2001 | WO |
WO-0210443 | Feb 2002 | WO |
WO-0156216 | Mar 2002 | WO |
WO-0220537 | Mar 2002 | WO |
WO-0224597 | Mar 2002 | WO |
WO-0227638 | Apr 2002 | WO |
WO-0233669 | Apr 2002 | WO |
WO-02072791 | Sep 2002 | WO |
WO-02072864 | Sep 2002 | WO |
WO-03040410 | May 2003 | WO |
WO-03046223 | Jun 2003 | WO |
WO-03054232 | Jul 2003 | WO |
WO-03060084 | Jul 2003 | WO |
WO-03064026 | Aug 2003 | WO |
WO-03064027 | Aug 2003 | WO |
WO-03064699 | Aug 2003 | WO |
WO-03065038 | Aug 2003 | WO |
WO-03066212 | Aug 2003 | WO |
WO-03089605 | Oct 2003 | WO |
WO-03093504 | Nov 2003 | WO |
WO-03100012 | Dec 2003 | WO |
WO-2004024886 | Mar 2004 | WO |
WO-2004029220 | Apr 2004 | WO |
WO-2004029586 | Apr 2004 | WO |
WO-2004031351 | Apr 2004 | WO |
WO-2004031399 | Apr 2004 | WO |
WO-2004059556 | Jul 2004 | WO |
WO-03060084 | Aug 2004 | WO |
WO-2005014850 | Feb 2005 | WO |
WO-2005051970 | Jun 2005 | WO |
WO-2005059096 | Jun 2005 | WO |
WO-2005059097 | Jun 2005 | WO |
WO-2005093092 | Oct 2005 | WO |
WO-2006023144 | Mar 2006 | WO |
WO-2006044956 | Apr 2006 | WO |
WO-2006076679 | Jul 2006 | WO |
WO-2006116476 | Nov 2006 | WO |
WO-2007073171 | Jun 2007 | WO |
WO-2007109221 | Sep 2007 | WO |
WO-2007118214 | Oct 2007 | WO |
WO-2007120627 | Oct 2007 | WO |
WO-2007137242 | Nov 2007 | WO |
WO-2008003116 | Jan 2008 | WO |
WO-2008006078 | Jan 2008 | WO |
WO-2008027558 | Mar 2008 | WO |
WO-2008045380 | Apr 2008 | WO |
WO-2008054543 | May 2008 | WO |
WO-2008063134 | May 2008 | WO |
WO-2008063135 | May 2008 | WO |
WO-2008068280 | Jun 2008 | WO |
WO-2008103474 | Aug 2008 | WO |
WO-2008109176 | Sep 2008 | WO |
WO-2009132876 | Nov 2009 | WO |
WO-2010001251 | Jan 2010 | WO |
WO-2010025310 | Mar 2010 | WO |
WO-2010025566 | Mar 2010 | WO |
WO-2010027512 | Mar 2010 | WO |
WO-2010089412 | Aug 2010 | WO |
WO-2010141249 | Dec 2010 | WO |
WO-2010141433 | Dec 2010 | WO |
WO-2011020529 | Feb 2011 | WO |
WO-2010141433 | Apr 2011 | WO |
WO-2011053957 | May 2011 | WO |
WO-2011056644 | May 2011 | WO |
WO-2011056872 | May 2011 | WO |
WO-2011066185 | Jun 2011 | WO |
WO-2011066186 | Jun 2011 | WO |
WO-2011085075 | Jul 2011 | WO |
WO-2011103468 | Aug 2011 | WO |
WO-2011109031 | Sep 2011 | WO |
WO-2011143556 | Nov 2011 | WO |
WO-2011150168 | Dec 2011 | WO |
WO-2011161413 | Dec 2011 | WO |
WO-2012013913 | Feb 2012 | WO |
WO-2012061832 | May 2012 | WO |
WO-2012078312 | Jun 2012 | WO |
WO-2012149171 | Nov 2012 | WO |
WO-2012154201 | Nov 2012 | WO |
WO-2013010062 | Jan 2013 | WO |
WO-2013030827 | Mar 2013 | WO |
WO-2013032850 | Mar 2013 | WO |
WO-2013036668 | Mar 2013 | WO |
WO-2013049227 | Apr 2013 | WO |
WO-2013101896 | Jul 2013 | WO |
WO-2013134881 | Sep 2013 | WO |
WO-2013154770 | Oct 2013 | WO |
WO-2013170168 | Nov 2013 | WO |
WO-2013177220 | Nov 2013 | WO |
WO-2014004393 | Jan 2014 | WO |
WO-2014008447 | Jan 2014 | WO |
WO-2014021938 | Feb 2014 | WO |
WO-2014035693 | Mar 2014 | WO |
WO-2014088693 | Jun 2014 | WO |
WO-2014089160 | Jun 2014 | WO |
WO-2014093330 | Jun 2014 | WO |
WO-2014093694 | Jun 2014 | WO |
WO-2014151117 | Sep 2014 | WO |
WO-2014151696 | Sep 2014 | WO |
WO-2014160004 | Oct 2014 | WO |
WO-2014160059 | Oct 2014 | WO |
WO-2014206304 | Dec 2014 | WO |
WO-2015017527 | Feb 2015 | WO |
WO-2015021080 | Feb 2015 | WO |
WO-2015021280 | Feb 2015 | WO |
WO-2015031689 | Mar 2015 | WO |
WO-2015040075 | Mar 2015 | WO |
WO-2015054292 | Apr 2015 | WO |
WO-2015066174 | May 2015 | WO |
WO-2015081114 | Jun 2015 | WO |
WO-2015081142 | Jun 2015 | WO |
WO-2015081440 | Jun 2015 | WO |
WO-2015090879 | Jun 2015 | WO |
WO-2015120403 | Aug 2015 | WO |
WO-2015136072 | Sep 2015 | WO |
WO-2015160004 | Oct 2015 | WO |
WO-2015175832 | Nov 2015 | WO |
WO-2016007604 | Jan 2016 | WO |
WO-2016011080 | Jan 2016 | WO |
WO-2016022557 | Feb 2016 | WO |
WO-2016053883 | Apr 2016 | WO |
WO-2016055956 | Apr 2016 | WO |
WO-2016065056 | Apr 2016 | WO |
WO-2016126882 | Aug 2016 | WO |
WO-2016126987 | Aug 2016 | WO |
WO-2016130868 | Aug 2016 | WO |
WO-2016161244 | Oct 2016 | WO |
WO-2016162127 | Oct 2016 | WO |
WO-2016164779 | Oct 2016 | WO |
WO-2016172377 | Oct 2016 | WO |
WO-2016173719 | Nov 2016 | WO |
WO-2016183100 | Nov 2016 | WO |
WO-2017017423 | Feb 2017 | WO |
WO-2017049231 | Mar 2017 | WO |
WO-2017053450 | Mar 2017 | WO |
WO-2017059399 | Apr 2017 | WO |
WO-2017095958 | Jun 2017 | WO |
WO-2017100441 | Jun 2017 | WO |
WO-2017118761 | Jul 2017 | WO |
WO-2017158103 | Sep 2017 | WO |
WO-2017214574 | Dec 2017 | WO |
WO-2018026920 | Feb 2018 | WO |
WO-2018038772 | Mar 2018 | WO |
WO-2018057526 | Mar 2018 | WO |
WO-2018094263 | May 2018 | WO |
WO-2018112426 | Jun 2018 | WO |
WO-2018119246 | Jun 2018 | WO |
WO-2018156792 | Aug 2018 | WO |
WO-2018170164 | Sep 2018 | WO |
WO-2018170169 | Sep 2018 | WO |
WO-2018170559 | Sep 2018 | WO |
WO-2018200380 | Nov 2018 | WO |
WO-2018231872 | Dec 2018 | WO |
WO-2019014781 | Jan 2019 | WO |
WO-2019051501 | Mar 2019 | WO |
WO-2019079769 | Apr 2019 | WO |
WO-2019084500 | May 2019 | WO |
WO-2019136175 | Jul 2019 | WO |
WO-2019222706 | Nov 2019 | WO |
WO-2020139871 | Jul 2020 | WO |
WO-2020176362 | Sep 2020 | WO |
WO-2020176678 | Sep 2020 | WO |
WO-2020176680 | Sep 2020 | WO |
WO-2020257612 | Dec 2020 | WO |
WO-2021046655 | Mar 2021 | WO |
WO-2021119193 | Jun 2021 | WO |
WO-2022010934 | Jan 2022 | WO |
WO-2022046797 | Mar 2022 | WO |
WO-2022046944 | Mar 2022 | WO |
WO-2022047076 | Mar 2022 | WO |
WO-2022076326 | Apr 2022 | WO |
WO-2022086866 | Apr 2022 | WO |
WO-2022087293 | Apr 2022 | WO |
WO-2022098662 | May 2022 | WO |
WO-2022159620 | Jul 2022 | WO |
WO-2022178137 | Aug 2022 | WO |
Entry |
---|
Saaem et al. (ACS Applied Materials & Interfaces 2:491-7 supplementary information) (Year: 2010). |
Abudayyeh et al., C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science, available on line, Jun. 13, 2016, at: http://zlab.mit.edu/assets/reprints/Abudayyeh_OO_Science_2016.pdf, 17 pages. |
Adessi, et al. Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms. Nucleic Acids Res. Oct. 15, 2000;28(20):E87. |
Alexeyev, Mikhail F. et al., “Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase”, Biochimica et Biophysics Acta, vol. 1419, 299-306 (1999). |
Al-Housseiny et al., Control of interfacial instabilities using flow geometry Nature Physics, 8:747-750 (2012). Published online at: DOI:10.1038/NPHYS2396. |
Amblard, Francois et al., “A magnetic manipulator for studying local rheology and micromechanical properties of biological systems”, Rev. Sci. Instrum., vol. 67, No. 3, 818-827, Mar. 1996. |
Arkles, et al. The Role of Polarity in the Structure of Silanes Employed in Surface Modification. Silanes and Other Coupling Agents. 2009; 5:51-64. |
Arkles, Hydrophobicity, Hydrophilicity Reprinted with permission from the Oct. 2006 issue of Paint & Coatings Industry magazine, Retrieved on Mar. 19, 2016, 10 pages. |
Assi, Fabiano et al., “Massive-parallel adhesion and reactivity-measurements using simple and inexpensive magnetic tweezers”, J. Appl. Phys., vol. 92, No. 9, 5584-5586, Nov. 1, 2002. |
Au, Lo-Chun et al. “Gene synthesis by a LCR-based approach: high level production of Leptin-L54 using synthetic gene in Escherichia coli”, Biochemical and Biophysical Research Communications, vol. 248, 200-203 (1998). |
Baedeker, Mathias et al., Overexpression of a designed 2.2kb gene of eukaryotic phenylalanine ammonialyase in Escherichia coli•. FEBS Letters, vol. 457, 57-60 (1999). |
Barbee, et al. Magnetic Assembly of High-Density DNA Arrays for Genomic Analyses. Anal Chern. Mar. 1, 20085; 80(6): 2149-2154. |
Beaucage, et al. Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron. 1992; 48:2223-2311. |
Beaucage, et al. Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 1981; 22(20):1859-1862. |
Beaulieu, Martin et al., “PCR candidate region mismatch scanning adaptation to quantitative, high-throughput genotyping”, Nucleic Acids Research, vol. 29, No. 5, 1114-1124 (2001). |
Beigelman, et al. Base-modified phosphoramidite analogs of pyrimidine ribonucleosides for RNA structure-activity studies. Methods Enzymol. 2000;317:39-65. |
Biswas, Indranil et al., “Identification and characterization of a thermostable MutS homolog from Thennus aquaticus”, The Journal of Biological Chemistry, vol. 271, No. 9, 5040-5048 (Mar. 1, 1996). |
Biswas, Indranil et al., “Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA”, The Journal of Biological Chemistry, vol. 272, No. 20, 13355-13364 (May 1, 1997). |
Bjornson, Keith P. et al., “Differential and simultaneous adenosine Di- and Tri˜hosphate binding by MutS”, The Journal of Biological Chemistry, vol. 278, No. 20, 18557-18562 (May 16, 2003). |
Blanchard, et al. High-Density Oligonucleotide Arrays. Biosens. & Bioelectronics. 1996; 11:687-690. |
Blanchard, in: Genetic Engineering, Principles and Methods, vol. 20, Ed. J. Sedlow, New York: Plenum Press, p. 111-124, 1979. |
Butler, et al. In situ synthesis of oligonucleotide arrays by using surface tension. J Am Chem Soc. Sep. 19, 2001;123(37):8887-94. |
Calvert, Lithographically patterned self-assembled films. In: Organic Thin Films and Surfaces: Directions for the Nineties, vol. 20, p. 109, ed. By Abraham Ulman, San Diego: Academic Press, 1995. |
Carr, et al. Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Res. Nov. 23, 2004;32(20):e162. |
Caruthers, Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. In Methods in Enzymology, Chapter 15, 154:287-313 (1987). |
Caruthers. Gene synthesis machines: DNA chemistry and its uses. Science. Oct. 18, 1985;230(4723):281-5. |
Casmiro, Danilo R. et al., “PCR-based gene synthesis and protein NMR spectroscopy”, Structure, vol. 5, •No. 11, 1407-1412 (1997). |
Cello, et al. Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science. Aug. 9, 2002;297(5583):1016-8. Epub Jul. 11, 2002. |
Chalmers, et al. Scaling up the ligase chain reaction-based approach to gene synthesis. Biotechniques. Feb. 2001;30(2):249-52. |
Chan, et al. Natural and engineered nicking endonucleases—from cleavage mechanism to engineering of strand-specificity. Nucleic Acids Res. Jan. 2011; 39(1): 1-18. |
Chen, et al. Chemical modification of gene silencing oligonucleotides fordrug discovery and development. Drug Discov Today. Apr. 15, 2005;10(8):587-93. |
Cheng, et al. High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer. Nucleic Acids Res. Sep. 15, 2002;30(18):e93. |
Cho, et al. Capillary passive valve in microfluidic systems. NSTI-Nanotech. 2004; 1:263-266. |
Chrisey et al., Fabrication of patterned DNA surfaces Nucleic Acids Research, 24(15):3040-3047 (1996). |
Chung et al., One-step preparation of competentEscherichia coli:Transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci U S A. Apr. 1989;86(7):2172-2175. |
Cleary, et al. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nat Methods. Dec. 2004;1(3):241-8. Epub Nov. 18, 2004. |
Crick. On protein synthesis. Symp Soc Exp BioH 2:138-163,1958. |
Cutler, David J. et al., “High-throughput variation detection and genotyping using microarrays”, Genome Research, vol. 11, 1913-19 (2001). |
Dahl, et al. Circle-to-circle amplification for precise and sensitive DNA analysis. Proc Natl Acad Sci U S A. Mar. 30, 2004;101(13):4548-53. Epub Mar. 15, 2004. |
De Mesmaeker, et al. Backbone modifications in oligonucleotides and peptide nucleic acid systems. Curr Opin Struct Biol. Jun. 1995;5(3):343-55. |
Deamer, David W. et al., “Characterization of nucleic acids by nanopore analysis”, Ace. Cham. Res., vol. 35, No. 10, 817-825 (2002). |
Deaven, The Human Genome Project: Recombinant clones for mapping and sequencing DNA. Los Alamos Science, 20:218-249, 1992. |
Deng et al., Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming Nature Biotechnology, 27:352-360 (2009). |
Dietrich, Rudiger.et al., “Gene assembly based on blunt-ended double-stranded DNA-modules”, Biotechnology Techniques, vol. 12, No. 1, 49-54 (Jan. 1998). |
Doudna et al. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346(6213):1258096-1-1258096-9, 2014. |
Dower et al., High efficiency transformation of Escherichia coli by high voltage electroporation. Nucleic Acids Res. 16(13):6127-45 (1988). |
Dressman, et al. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc Natl Acad Sci USA. Jul. 22, 2003;100(15):8817-22. Epub Jul. 11, 2003. |
Drmanac, et al. Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays. Science. Jan. 1, 2010;327(5961):78-81. doi: 10.1126/science.1181498. Epub Nov. 5, 2009. |
Droege and Hill, The Genome Sequencer FLXTM System-Longer reads, more applications, straight forward bioinformatics and more complete data sets Journal of Biotechnology, 136:3-10, 2008. |
Duffy, et al. Rapid Prototyping of Microfluidic Systems in Poly(dimethylsiloxane). Anal Chem. Dec. 1, 1998;70(23):4974-84. doi: 10.1021/ac980656z. |
Duggan, et al. Expression profiling using cDNA microarrays. Nat Genet. Jan. 1999; 21(1 Suppl):10-4. |
Eadie, et al. Guanine modification during chemical DNA synthesis. Nucleic Acids Res. Oct. 26, 1987;15(20):8333-49. |
Eisen, Jonathan A., “A phylogenomic study of the MutS family of proteins”, Nucleic Acids Research, vol. 26, No. 18, 4291-4300 (1998). |
Ellis, et al. DNA assembly for synthetic biology: from parts to pathways and beyond. Integr Biol (Camb). Feb. 2011;3(2):109-18. doi: 10.1039/c0ib00070a. Epub Jan. 19, 2011. |
El-Sagheer, et al. Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli. Proc Natl Acad Sci U S A. Jul. 12, 2011;108(28):11338-43. doi: 10.1073/pnas.1101519108. Epub Jun. 27, 2011. |
Elsner et al., 172 nm excimer VUV-triggered photodegradation and micropatterning of aminosilane films, Thin Solid Films, 517:6772-6776 (2009). |
Engler, et al. A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3(11):e3647. doi: 10.1371/journal.pone.0003647. Epub Nov. 5, 2008. |
Engler, et al. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One. 2009;4(5):e5553. doi: 10.1371/journal.pone.0005553. Epub May 14, 2009. |
Evans et al., DNA Repair Enzymes. Current Protocols in Molecular Biology 84:III:3.9:3.9.1-3.9.12 http://www.ncbi.nlm.nih.gov/pubmed/18972391 (Published online Oct. 1, 2008 Abstract only provided. |
Fahy, et al. Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. Aug. 1991;1(1):25-33. |
Fedoryak, Olesya D. et al., “Brominated hydroxyquinoline as a photolabile protecting group with sensitivity to multiphoton excitation”, Org. Lett., vol. 4, No. 2, 3419-3422 (2002). |
Ferretti et al., Total synthesis of a gene for bovine rhodopsin. PNAS, 83:599-603 (1986). |
Fodor, et al. Light-directed, spatially addressable parallel chemical synthesis. Science. Feb. 15, 1991;251(4995):767-73. |
Foldesi, et al. The synthesis of deuterionucleosides. Nucleosides Nucleotides Nucleic Acids. Oct. 2000-Dec. 19(10-12):1615-56. |
Frandsen, et al. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Molecular Biology 2008, 9:70. |
Frandsen. Experimental setup. Dec. 7, 2010, 3 pages. http://www.rasmusfrandsen.dk/experimental_setup.htm. |
Frandsen. The USER Friendly technology. USER cloning. Oct. 7, 2010, 2 pages. http://www.rasmusfrandsen.dk/user_cloning.htm. |
Fullwood et al., Next-generation DNA sequencing of paired-end tags [PET] fortranscriptome and genome analysis Genome Research, 19:521-532, 2009. |
Galneder et al., Microelectrophoresis of a bilayer-coated silica bead in an optical trap: application to enzymology. Biophysical Journal, vol. 80, No. 5, 2298-2309 (May 2001). |
Gao, et al. A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids. Nucleic Acids Res. Nov. 15, 2001;29(22):4744-50. |
Gao, et al. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res. Nov. 15, 2003;31(22):e143. |
Garaj, et al. Graphene as a subnanometre trans-electrode membrane. Nature. Sep. 9, 2010;467(7312):190-3. doi: 10.1038/nature09379. |
Garbow, Norbert et al., “Optical tweezing electroghoresis of isolated, highly charged colloidal spheres”, Colloids and Surfaces A: Physiochem. Eng. Aspects, vol. 195, 227-241 (2001). |
Genomics 101. An Introduction to the Genomic Workflow. 2016 edition, 64 pages. Available at: http://www.frontlinegenomics.com/magazine/6757/genomics-101/. |
Geu-Flores, et al. USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 2007;35(7):e55. Epub Mar. 27, 2007. |
Gibson, et al. Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. Feb. 29, 2008;319(5867):1215-20. doi: 10.1126/science.1151721. Epub Jan. 24, 2008. |
Gosse, Charlie et al. “Magnetic tweezers: micromanipulation and force measurement at the molecular level”, Biophysical Journal, vol. 8, 3314-3329 (Jun. 2002). |
Grovenor. Microelectronic materials. Graduate Student Series in Materials Science and Engineering. Bristol, England: Adam Hilger, 1989; p. 113-123. |
Haber, Charbel et al., Magnetic tweezers for DNA micromanipulation, Rev. Sci. Instrum., vol. 71, No. 12, 4561-4570 (Dec. 2000). |
Hanahan and Cold Spring Harbor Laboratory, Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557-580 (1983). |
Hanahan et al., Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol, vol. 204, p. 63-113 (1991). |
Harada, et al. Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection. Nucleic Acids Res. May 25, 1993;21(10):2287-91. |
Heckers Karl H. et al., “Error analysis of chemically synthesized polynucleotides”, BioTechniques, vol. 24, No. 2, 256-260 (1998). |
Herzer et al.: Fabrication of patterned silane based self-assembled monolayers by photolithography and surface reactions on silicon-oxide substrates Chm. Commun., 46:5634-5652 (2010). |
Hoover et al., “DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis”, Nucleic Acids Research, vol. 30, No. 10, e43, 7 pages (2002). |
Hosu, Basarab G. et al., Magnetic tweezers for intracellular applications•, Rev. Sci. Instrum., vol. 74, No. 9, 4158-4163 (Sep. 2003). |
Huang, Hayden et al., “Three-dimensional cellular deformation analysis with a two-photon magnetic manipulator workstation”, Biophysical Journal, vol. 8 2, No. 4, 2211•2223 (Apr. 2002). |
Hughes, et al. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nat Biotechnol. Apr. 2001;19(4):342-7. |
Hughes et al. Principles of early drug discovery. Br J Pharmacol 162(2):1239-1249, 2011. |
Hutchison, et al. Cell-free cloning using phi29 DNA polymerase. Proc Natl Acad Sci U S A. Nov. 2, 20059;102(48):17332-6. Epub Nov. 14, 2005. |
Jackson, Brian A. et al., “Recognition of DNA base mismatches by a rhodium intercalator”, J. Am. Chem. Soc., vol. 19, 12986•12987 (1997). |
Jacobs and Schar, DNA glycosylases: In DNA repair and beyond Chromosome, 121:1-20 (2012)—http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3260424/. |
Karagiannis and El-Osta, RNA interference and potential therapeutic applications of short interfering RNAs Cancer Gene Therapy, 12:787-795, 2005. |
Ke, Song-Hua et al., “Influence of neighboring base pairs on the stability of single base bulges and base pairs in a DNA fragment”, Biochemistry, Vo. 34, 4593-4600 (1995). |
Kelley, Shana, et al. Single-base mismatch detection based on charge transduction through DNA, Nucleic Acids Research, vol. 27, No. 24, 4830-4837 (1999). |
Kim, Yang-Gyun et al., “Chimeric restriction endonuclease”, Proc. Natl. Acad. Sci. USA, vol. 91, 883-887 (Feb. 1994). |
Kim, Yang-Gyun, “The interaction between Z-ONA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases”, The Journal of Biological Chemistry, vol. 274, No. 27, 19081-19086 (1999). |
Kim, Yan˜Gyun et al., “Site specific cleavage of DNA-RNA hybrids by zinc finger/Fok I cleavage domain fusions” Gene, vol. 203, 43-49 (1997). |
Kinde et al., Detection and quantification of rare mutations with massively parallel sequencing PNAS, 108(23):9530-9535, 2011. |
Kodumal, et al. Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc Natl Acad Sci U S A. Nov. 2, 2004;101(44):15573-8. Epub Oct. 20, 2004. |
Kong et al., Parallel gene synthesis in a microfluidic device. Nucleic Acids Res., 35(8):e61 (2007). |
Kong. Microfluidic Gene Synthesis. MIT Thesis. Submitted to the program in Media Arts and Sciences, School of Architecture and Planning, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Media Arts and Sciences at the Massachusetts Institute of Technology. 143 pages Jun. 2008. |
Kopp, Martin U. et al., “Chemical amplification: continuous-flow PCR on a chip”, Science, vol. 280, 1046-1048 (May 15, 1998). |
Kosuri et al., A scalable gene synthesis platform using high-fidelity DNA microchips Nat.Biotechnol., 28(12):1295-1299, 2010. |
Lagally, E.T. et al., “Single-molecule DNA amplification and analysis in an integrated microfluidic device” Anal. Chem., vol. 73, No. 565-570 (Feb. 1, 2001). |
Lahue, R.S. et al., “DNA mismatch correction in a defined system”, Science, vol. 425; No. 4914, 160-164 (Jul. 14, 1989). |
Lambrinakos, A. et al., “Reactivity of potassium permanganate and tetraethylammonium chloride with mismatched bases and a simple mutation detection protocol”,Nucleic Acids Research, vol. 27, No. 8, 1866-1874 (1999). |
Landegren, et al. A ligase-mediated gene detection technique. Science. Aug. 26, 1988;241(4869):1077-80. |
Lang, Matthew J. et al., “An automated two-dimensional optical force clamp for single molecule studies”, Biophysical Journal, vol. 83, 491•501 (Jul. 2002). |
Lashkari, et al. An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis. Proc Natl Acad Sci U S A. Aug. 15, 1995;92(17):7912-5. |
Leamon, et al. A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions. Electrophoresis. Nov. 2003;24(21):3769-77. |
Lee, Covalent end-immobilization of oligonucleotides onto solid surfaces. Thesis submitted to the Department of Chemical Engineering in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Chemical Engineering at the Massachusetts Institute of Technology. Aug. 2001, 315 pages. |
Lee, C.S. et al., “Microelectromagnets for the control of magnetic nanoparticles”, Appl. Phys. Lett., vol. 79, No. 20, 3308-3310 (Nov. 12, 2001). |
Lee, et al. A microfluidic oligonucleotide synthesizer. Nucleic Acids Research 2010 vol. 38(8):2514-2521. DOI: 10.1093/nar/gkq092. |
Leproust, et al. Agilent's Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements. 2008; 1-12. http://www.miltenyibiotec.com/˜/media/Files/Navigation/Genomic%20Services/Agilent_DNA_Microarray_Platform.ashx. |
Leproust, et al. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 2010; 38(8):2522-2540. |
Lesnikowski, et al. Nucleic acids and nucleosides containing carboranes. J. Organometallic Chem. 1999;581:156-169. |
Leumann. DNA analogues: from supramolecular principles to biological properties. Bioorg Med Chem. Apr. 2002;10(4):841-54. |
Levene, et al. Zero-mode waveguides for single-molecule analysis at high concentrations. Science. Jan. 31, 2003;299(5607):682-6. |
Lipshutz, Robert J. et al., “High density synthetic oligonucleotide arrays”, Nature Genetics Supplement, vol. 21, 20-24 (Jan. 1999). |
Lishanski, Alia et al., “Mutation detection by mismatch binding protein, MutS, in amplified DNA: application to the cystic fibrosis gene”, Proc. Natl. Acad. Sci. USA, vol. 91, 2674-2678 (Mar. 1994). |
Liu et al., Comparison of Next-Generation Sequencing Systems. Journal of Biomedicine and Biotechnology, 11 pages, 2012. |
Liu, et al. Enhanced Signals and Fast Nucleic Acid Hybridization by Microfluidic Chaotic Mixing. Angew. Chem. Int. Ed. 2006; 45:3618-3623. |
Lizardi, et al. Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. Jul. 1998;19(3):225-32. |
Li, Lin et al., “Functional domains in Fok I restriction endonuclease”, Proc. Natl. Acad. Sci. USA, vol. 89, 4275-4279 (May 1992). |
Lu, A.-Lien et al., “Methyl-directed repair of DNA base-pair mismatches in vitro”, Proc. Natl. Acad. Sci. USA, vol. 80, 4639-4643 (Aug. 1983). |
Lund, et al. A validated system for ligation-free uracilexcision based assembly of expression vectors for mammalian cell engineering. DTU Systems of Biology. 2011. 1 page. http://www.lepublicsystemepco.com/files/modules/gestion_rubriques/REF-B036-Lund_Anne%20Mathilde.pdf. |
Ma, et al. DNA synthesis, assembly and application in synthetic biology. Current Opinion in Chemical Biology. 2012; 16:260-267. |
Ma et al., Versatile surface functionalization of cyclic olefin copolymer (COC) with sputtered SiO2 thin film for potential BioMEMS applications. Journal of Materials Chemistry, DOI: 10.1039/b904663a, 11 pages (2009). |
Mahato et al., Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA Expert Opin. Drug Delivery, 2(1):3-28, 2005. |
Margulies, et al. Genome sequencing in open microfabricated high-density picolitre reactors. Nature. Sep. 15, 2005;437(7057):376-80. Epub Jul. 31, 2005. |
Matteucci, et al. Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 1981; 103(11):3185-3191. |
Matzas et al., Next generation gene synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device. Nat. Biotechnol., 28(12):1291-1294, 2010. |
McGall, et al. Light-directed synthesis of high-density oligonucleotide arrays using semiconductor photoresists. Proc Natl Acad Sci U S A. Nov. 26, 1996;93(24):13555-60. |
McGall, et al. The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 1997; 119(22):5081-5090. |
Mei et al., Cell-free protein synthesis in microfluidic array devices Biotechnol. Prog., 23(6):1305-1311, 2007. |
Mendel-Hartvig. Padlock probes and rolling circle amplification. New possibilities for sensitive gene detection. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1175. Uppsala University. 2002, 39 pages. http://www.diva-portal.org/smash/get/diva2:161926/FULLTEXT01.pdf. |
Meyers and Friedland, Knowledge-based simulation of genetic regulation in bacteriophage lambda. Nucl. Acids Research, 12(1):1-16, 1984. |
Mitra, et al. In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. Dec. 15, 1999;27(24):e34. |
Muller, Caroline et al. “Protection and labelling of thymidine by a fluorescent photolabile group”, Helvetica Chimica Acta, vol. 84, 3735-3741 (2001). |
Nakatani, Kazuhiko et al., “Recognition of a single guanine bulge by 2-Acylamino-1 ,8-naphthyridine”, J. Am. Chem. Soc., vol. 122, 2172-2177 (2000). |
Nishikura, A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst Cell, 107:415-418, 2001. |
Nour-Eldin, et al. USER Cloning and USER Fusion: The Ideal Cloning Techniques for Small and Big Laboratories. Plant Secondary Metabolism Engineering. Methods in Molecular Biology vol. 643, 2010, pp. 185-200. |
Ochman, et al. Genetic applications of an inverse polymerase chain reaction. Genetics. Nov. 1988;120(3):621-3. |
Pan, et al. An approach for global scanning of single nucleotide variations. Proc Natl Acad Sci U S A. Jul. 9, 2002;99(14):9346-51. |
Pankiewicz. Fluorinated nucleosides. Carbohydr Res. Jul. 10, 2000;327(1-2):87-105. |
PCT Patent Applicatio No. PCT/US14/049834 International Preliminary Report on Patentability dated Feb. 18, 2016. |
PCT Patent Application No. PCT/US2015/043605 International Search Report and Written Opinion dated Jan. 6, 2016. |
PCT Patent Application No. PCT/US2015/043605 Invitation to Pay Additional Fees dated Oct. 28, 2015. |
PCT Patent Application No. PCT/US2016/016459 International Search Report and Written Opinion dated Apr. 13, 2016. |
PCT Patent Application No. PCT/US2016/016636 International Search Report and Written Opinion dated May 2, 2016. |
PCT Patent Application No. PCT/US2016/028699 International Search Report and Written Opinion dated Jul. 29, 2016. |
PCT Patent Application No. PCT/US2016/031674 International Search Report and Written Opinion dated Aug. 11, 2016. |
PCT/US2014/049834 International Search Report and Written Opinion dated Mar. 19, 2015. |
PCT/US2014/049834, “Invitation to Pay Additional Fees and, where applicable, protest fee,” mailed Jan. 5, 2015. |
Pease, et al. Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad Sci U S A. May 24, 1994;91(11):5022-6. |
Peisajovich, et al. BBF RFC 28: A method for combinatorial multi-part assembly based on the type-lis restriction enzyme aarl. Sep. 16, 2009, 7 pages. |
Pellois, et al. “Individually addressable parallel peptide synthesis on microchips”, Nature Biotechnology, vol. 20, 922-926 (Sep. 2002). |
Petersen, et al. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. Feb. 2003;21(2):74-81. |
Pierce, et al. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. Methods Mol Med. 2007;132:65-85. |
Pirrung. How to make a DNA chip. Angew. Chem. Int. Ed., 41:1276-1289, 2002. |
Pon. Solid-phase supports for oligonucleotide synthesis. Methods Mol Biol. 1993;20:465-96. |
Poster. Reimagine Genome Scale Research. 2016, 1 page. Available at http://www2.twistbioscience.com/Oligo_Pools_CRISPR_poster. |
Powers et al. Optimal strategies for the chemical and enzymatic synthesis of bihelical deoxyribonucleic acids. J Am Chem Soc., 97(4):875-884, 1975. |
Prodromou, et al. Recursive PCR: a novel technique for total gene synthesis. Protein Eng. Dec. 1992;5(8):827-9. |
Quan, et al. Parallel on-chip gene synthesis and application to optimization of protein expression. Nature Biotechnology. 2011; 29:449-452. |
Reimagine SequenceSpace, Reimagine Research, Twist Bioscience, Product Brochure, Published Apr. 6, 2016 online at: www2.twistbioscience.com/TB_Product_Brochure_04.2016, 8 pages. |
RF Electric discharge type excimer lamp. Products Catalog. Excimer lamp light source “flat excimer,” 16 pages dated Jan. 2016. From: http://www.hamamatsu.com/jp/en/product/category/1001/3026/index.html. |
Richmond, et al. Amplification and assembly ofchip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Res. Sep. 24, 2004;32(17):5011-8. Print 2004. |
Roche. Restriction Enzymes from Roche Applied Science—A Tradition of Premium Quality and Scientific Support. FAQS and Ordering Guide. Roche Applied Science. Accessed Jan. 12, 2015, 37 pages. |
Ruminy, et al., “Long-range identification of hepatocyte nuclear factor-3 (FoxA) high and low-affinity binding Sites with a chimeric nuclease”, J. Mol. Bioi., vol. 310, 523-535 (2001). |
Saaem et al., In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate ACS Applied Materials & Interfaces, 2(2):491-497, 2010. |
Saboulard, et al. High-throughput site-directed mutagenesis using oligonucleotides synthesized on DNA chips. Biotechniques. Sep. 2005;39(3):363-8. |
Sacconi, L. et al., Three-dimensional magneto-optic trap for micro-object manipulation, Optics Letters, vol. 26, No. 17, 1359-1361 (Sep. 1, 2001). |
Saiki et al. Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allelespecific oligonucleotide probes Nature 324:163-166 (1986). |
Sandhu, et al. Dual asymmetric PCR: one-step construction of synthetic genes. Biotechniques. Jan. 1992;12(1):14-6. |
Schaller, et al. Studies on Polynucleotides. XXV.1 The Stepwise Synthesis of Specific Deoxyribopolynucleotides (5). Further Studies on the Synthesis of Internucleotide Bond by the Carbodiimide Method. The Synthesis of Suitably Protected Dinucleotides as Intermediates in the Synthesis of Higher Oligonucleotides. J. Am. Chem. Soc. 1963; 85(23):3828-3835. |
Schmalzing, Dieter et al., “Microchip electrophoresis: a method for high-speed SNP detection”, Nucleic Acids Research, vol. 28, No. 9, i-vi (2000). |
Smith, et al. Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci U S A. Dec. 23, 2003;100(26):15440-5. Epub Dec. 2, 2003. |
Smith, et al. Generation of cohesive ends on PCR products by UDG-mediated excision of dU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl. May 1993;2(4):328-32. |
Smith, Jane et al., “Mutation detection with MutH, MutL, and MutS mismatch repair proteins.” Proc. Natl. Acad. Sci. USA, vol. 93, 4374-4379 (Apr. 1996). |
Smith Jane et al., “Removal of Polymerase-Produced mutant sequences from PCR products”, Proc. Natl. Acad. Sci. USA, vol. 94, 6847-6850 (Jun. 1997). |
Smith, Steven B. et al., “Direct mechanical measurements of the elasticity of single DNA molecules using magnetic beads”, Science, vol. 258, 1122-1126 (Nov. 13, 1992). |
Soni, et al. Progress toward ultrafast DNA sequencing using solid-state nanopores. Clin Chem. Nov. 2007;53(11):1996-2001. Epub Sep. 21, 2007. |
Southern, et al. Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics. Aug. 1992;13(4):1008-17. |
Sproat, et al. An efficient method for the isolation and purification of oligoribonucleotides. Nucleosides & Nucleotides. 1995; 14(1&2):255-273. |
Steel, The Flow-Thru Chip a Three-dimensional biochip platform. In: Schena, Microarray Biochip Technology, Chapter 5, Natick, MA: Eaton Publishing, 2000, 33 pages. |
Stemmer, et al. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. Oct. 16, 1995;164(1):49-53. |
Stryer. “DNA Probes and genes can be synthesized by automated solid-phase methods.” Biochemistry, 3rd edition, New York: W.H. Freeman and Company, 1988; 123-125. |
Stutz, et al. Novel fluoride-labile nucleobase-protecting groups for the synthesis of 3′(2′)-O-amino-acylated RNA sequences. Helv. Chim. Acta. 2000; 83(9):2477-2503. |
Takahashi, Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers. Biotechniques. Jul. 2009;47(1):609-15. doi: 10.2144/000113155. |
Tanase, M. et al., “Magnetic trapping of multicomponent nanowires”, The Johns Hopkins University, Baltimore, Maryland, p. 1-3 (Jun. 25, 2001). |
Taylor et al., Impact of surface chemistry and blocking strategies on DNA microarrays. Nucleic Acids Research, 31(16):e87, 19 pages, 2003. |
Tian, et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature. Dec. 23, 2004;432(7020):1050-4. |
Tsai et al., Dimeric CRISPR RNA-guided Fokl nucleases for highly specific genome editing Nat. Biotechnol., 32(6):569-576, 2014. |
Unger, et al. Monolithic microfabricated valves and pumps by multilayer soft lithography. Science. Apr. 7, 2000;288(5463):113-6. |
U.S. Appl. No. 14/885,965 Office Action dated Jul. 7, 2016. |
U.S. Appl. No. 14/452,429 Notice of Allowance dated Jun. 7, 2016. |
U.S. Appl. No. 14/452,429 Office Action dated Apr. 9, 2015. |
U.S. Appl. No. 14/452,429 Office Action dated Oct. 21, 2015. |
U.S. Appl. No. 14/452,429 Restriction Requirement dated Dec. 12, 2014. |
U.S. Appl. No. 14/885,962 Office Action dated Sep. 8, 2016. |
U.S. Appl. No. 14/885,962 Restriction Requirement dated Mar. 1, 2016. |
U.S. Appl. No. 14/885,963 Notice of Allowance dated May 24, 2016. |
U.S. Appl. No. 14/885,965 Office Action dated Feb. 18, 2016. |
Vaijayanthi, et al. Recent advances in oligonucleotide synthesis and their applications. Indian J Biochem Biophys. Dec. 2003;40(6):377-91. |
Van Den Brulle, et al. A novel solid phase technology for high-throughput gene synthesis. Biotechniques. 2008; 45(3):340-343. |
Vargeese, et al. Efficient activation of nucleoside phosphoramidites with 4,5-dicyanoimidazole during oligonucleotide synthesis. Nucleic Acids Res. Feb. 15, 1998;26(4):1046-50. |
Verma, et al. Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem. 1998;67:99-134. |
Vincent, et al. Helicase-dependent isothermal DNA amplification. EMBO Rep. Aug. 2004;5(8):795-800. |
Visscher et al., “Construction of multiple-beam optical traps with nanometer-resolution position sensing”, IEEE Journal of Selected Topics in Quantum Electronics, vol. 2, No. 4, 1066-1076 (Dec. 1996. |
Voldmans Joel et al., “Holding forces of single-particle dielectrophoretic traps.” Biophysical Journal, vol. 80, No. 1, 531-541 (Jan. 2001). |
Vos, et al. AFLP:A new technique for DNA fingerprinting. Nucleic Acids Res. Nov. 11, 1995;23(21):4407-14. |
Wah, David A. et al., “Structure of Fok 1 has implications for DNA cleavage”, Proc. Natl. Acad. Sci. USA, vol. 95, 10564-10569 (Sep. 1998). |
Wah, David A. et al., “Structure of the multimodular endonuclease Fok I bound to DNA”, Nature, vol. 388, 97-100 (Jul. 1997). |
Walker, et al. Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res. Apr. 11, 1992;20(7):1691-6. |
Weber, et al. A modular cloning system for standardized assembly of multigene constructs. PLoS One. Feb. 18, 2011;6(2):e16765. doi: 10.1371/journal.pone.0016765. |
Welz, et al. 5-(Benzylmercapto)-1H-tetrazole as activator for 2′-O-TBDMS phosphoramidite building blocks in RNA synthesis. Tetrahedron Lett. 2002; 43(5):795-797. |
Westin et al., Anchored multiplex amplification on a microelectronic chip array Nature Biotechnology, 18:199-202 (2000) (abstract only). |
Whitehouse, Adrian et al. “Analysis of the mismatch and insertion/deletion binding properties of Thermus thermophilus, HB8, MutS”, Biochemical and Biophysical Research Communications, vol. 233, 834-837 (1997). |
Wirtz, Denis, “Direct measurement of the transport properties of a single DNA molecule”, Physical Review Letters, vol. 75, No. 12, 2436-2439 (Sep. 18, 1995). |
Withers-Martinez, Chrislaine et al., “PCR-based gene synthesis as an efficient approach forexpression of the A+ T-rich malaria genome”, Protein Engineering, vol. 12, No. 12, 1113-1120 (1999). |
Wood, Richard D. et al., “Human DNA repair genes”, Science, vol. 291, 1284-1289 (Feb. 16, 2001). |
Wosnick, et al. Rapid construction of large synthetic genes: total chemical synthesis of two different versions of the bovine prochymosin gene. Gene. 1987;60(1):115-27. |
Wu, et al. RNA-mediated gene assembly from DNA arrays. Angew Chem Int Ed Engl. May 7, 2012;51(19):4628-32. doi: 10.1002/anie.201109058. |
Wu, et al. Specificity of the nick-closing activity of bacteriophage T4 DNA ligase. Gene. 1989;76(2):245-54. |
Wu, Xing-Zheng et al., “An improvement of the on-line electrophoretic concentration method for capillary electrophoresis of proteins an experimental factors affecting he concentration effect”, Analytical Sciences, vol. 16, 329-331 (Mar. 2000). |
Xiong, et al. A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucleic Acids Res. Jul. 7, 2004;32(12):e98. |
Xiong, et al. Non-polymerase-cycling-assembly-based chemical gene synthesis: Strategies, methods, and progress. Biotechnology Advances. 2008; 26(2):121-134. |
Yang, et al. “Purification, cloning, and characterization of the CEL I nuclease”, Biochemistry, vol. 39, No. 13, 3533-351 (2000). |
Yehezkel et al., De novo DNA synthesis using single molecule PCR Nucleic Acids Research, 36(17):e107, 2008. |
Youil, Rima et al., “Detection of 81 of 81 known mouse Beta-Giobin promoter mutations with T4 Endonuclease VII The EMC Method”, Genomics, vol. 32, 431-435 (1996). |
Young, et al. Two-step total gene synthesis method. Nucleic Acids Res. Apr. 15, 2004;32(7):e59. |
Zheleznaya, et al. Nicking endonucleases. Biochemistry (Mosc). Dec. 2009;74(13):1457-66. |
Zhou et al., Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences Nucleic Acids Research, 32(18):5409-5417, 2004. |
Andoni and Indyk, Near-Optimal Hashing Algorithms for Approximate Nearest Neighbor in High Dimensions, Communications of the ACM, 51(1):117-122, 2008. |
ATDBio, “Nucleic Acid Structure,” Nucleic Acids Book, 9 pages, published on Jan. 22, 2005. from: http://www.atdbio.com/content/5/Nucleic-acid-structure. |
ATDBio, “Solid-Phase Oligonucleotide Synthesis,” Nucleic Acids Book, 20 pages, Published on Jul. 31, 2011. from: http://www.atdbio.com/content/17/Solid-phase-oligonucleotide-synthesis. |
Barton et al., A desk electrohydrodynamic jet printing system. Mechatronics, 20:611-616, 2010. |
Bethge et al., “Reverse synthesis and 3′-modification of RNA.” Jan. 1, 2011, pp. 64-64, XP055353420. Retrieved from the Internet: URL:http://www.is3na.org/assets/events/Category%202-Medicinal %20Chemistry%20of%2001igonucleotides%20%2864-108%29.pdf. |
Binkowski et al., Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Research, 33(6):e55, 8 pages, 2005. |
Blanchard, et al., “High-Density Oligonucleotide Arrays,” Biosensors & Bioelectronics, 11(6/7):687-690, 1996. |
Blawat et al., Forward error correction for DNA data storage. Procedia Computer Science, 80:1011-1022, 2016. |
Bonini and Mondino, Adoptive T-cell therapy for cancer: The era of engineered T cells. European Journal of Immunology, 45:2457-2469, 2015. |
Bornholt et al., A DNA-Based Archival Storage System, in International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Apr. 2-6, 2016, Atlanta, GA, 2016, 637-649. |
Borovkov et al., High-quality gene assembly directly from unpurified mixtures of microassay-synthesized oligonucleotides. Nucleic Acid Research, 38(19):e180, 10 pages, 2010. |
Brunet, Aims and methods of biosteganography. Journal of Biotechnology, 226:56-64, 2016. |
Buermans et al., “Next Generation sequencing technology: Advances and applications,” Biochimica et Biophysica Acta (BBA) Molecular Basis of Disease, 1842:1931-1941, 2014. |
Cardelli, Two-Domain DNA Strand Displacement, Electron. Proc. Theor. Comput. Sci., 26:47-61, 2010. |
Carlson, “Time for New DNA Synthesis and Sequencing Cost Curves,” 2014. [Online], Available: http://www.synthesis.cc/synthesis/2014/02/time_for_new_cost_curves_2014. 10 pages. |
Caruthers, The Chemical Synthesis of DNA/RNA: Our Gift to Science. J. Biol. Chem., 288(2):1420-1427, 2013. |
Chen et al., Programmable chemical controllers made from DNA, Nat. Nanotechnol., 8(10):755-762, 2013. |
Church et al., Next-generation digital information storage in DNA. Science, 337:6102, 1628-1629, 2012. |
Cleary et al., “Production of complex nucleic acid libraries using highly parallel n s tu oligonucleotide synthesis,” Nature Methods, 1(13):241-248, 2004. |
Cohen et al., Human population: The next half century. Science, 302:1172-1175, 2003. |
Dormitzer et al., Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Translational Medicine, 5(185):185ra68, 14 pages, 2013. |
Elsik et al., The Genome sequence of taurine cattle: A window of ruminant biology and evolution. Science, 324:522-528, 2009. |
Erlich and Zielinski, DNA fountain enables a robust and efficient storage architecture. Science, 355(6328):950-054, 2017. |
European Patent Application No. 14834665.3 Communication dated Jan. 16, 2018. |
European Patent Application No. 14834665.3 extended European Search Report dated Apr. 28, 2017. |
Finger et al., The wonders of Flap Endonucleases: Structure, function, mechanism and regulation. Subcell Biochem., 62:301-326, 2012. |
Fodor et al. “Light-Directed, Spatially Addressable Parallel Chemical Synthesis,” Science, 251(4995):767-773, 1991. |
Fogg et al., Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology, 9(12):922-927, 2002. |
GeneArt Seamless Cloning and Assembly Kits. Life Technologies Synthetic Biology. 8 pages, available online Jun. 15, 2012. |
Gibson Assembly. Product Listing. Application Overview. 2 pages, available online Dec. 16, 2014. |
Goldman et al., Towards practical, high-capacity, low-maintenance information storage in synthesized DNA, Nature, 494(7435):77-80, 2013. |
Grass, et al., Robust chemical preservation of digital information on DNA in silica with errorcorrecting codes, Angew. Chemie—Int. Ed., 54(8):2552-2555, 2015. |
Greagg et al., A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil. Proc. Nat. Acad. Sci. USA, 96:9045-9050, 1999. |
Gu et al., Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biology, 17:41, 13 pages, 2016. |
IMGUR: The magic of the internet. Uploaded May 10, 2012, 2 pages, retrieved from: https://imgur.com/mEWuW. |
In-Fusion Cloning: Accuracy, Not Background. Cloning & Competent Cells, ClonTech Laboratories, 3 pages, available online Jul. 6, 2014. |
Jinek et al., A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337:816-821, 2012. |
Kim et al., High-resolution patterns of quantum dots formed by electrohydrodynamic jet printing for light-emitting diodes. Nano Letters, 15:969-973, 2015. |
Koike-Yusa et al., Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology, 32:267-273, 2014 (with three pages of supplemental “Online Methods”). |
Kosuri and Church, “Large-scale de novo DNA synthesis: technologies and applications,” Nature Methods, 11:499-507, 2014. Available at: http://www.nature.com/nmeth/journal/v11/n5/full/nmeth.2918.html. |
Krayden, Inc., A Guide to Silane Solutions. Silane coupling agents. 7 pages. Published on May 31, 2005 at: http://krayden.com/pdf/xia_silane_chemistry.pdf. |
Lausted et al., “POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer,” Genome Biology, 5:R58, 17 pages, 2004. available at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC507883/. |
Leproust et al., “Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process,” Nucleic Acids Research, 35(8):2522-2540, 2010. |
Lewontin and Harti, Population genetics in forensic DNA typing. Science, 254:1745-1750, 1991. |
Li et al., Beating bias in the directed evolution of proteins: Combining high-fidelity on-chip solidphase gene synthesis with efficient gene assembly for combinatorial library construction. First published Nov. 24, 2017, 2 pages, retrieved from: https://doi.org/10.1002/cbic.201700540. |
Limbachiya et al., Natural data storage: A review on sending information from now to then via Nature. ACM Journal on Emerging Technologies in Computing Systems, V(N):Article A, May 19, 2015, 17 pages. |
Link Technologies. “Product Guide 2010.” Nov. 27, 2009, 136 pages. XP055353191. Retrieved from the Internet: URL:http://www.linktech.co.uk/documents/517/517.pdf. |
Liu et al., Rational design of CXCR4 specific antibodies with elongated CDRs. JACS, 136:10557-10560, 2014. |
McBride & Caruthers, “An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides.” Tetrahedron Lett. 24: 245-248, 1983. |
Milo and Phillips, Numbers here reflect the number of protein coding genes and excludes tRNA and non-coding RNA. Cell Biology by the Numbers, p. 286, 2015. |
Morin et al., Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques, 45:81-94, 2008. |
Morris and Stauss, Optimizing T-cell receptor gene therapy for hematologic malignancies. Blood, 127(26):3305-3311,2016. |
Neiman M.S,. Negentropy principle in information processing systems. Radiotekhnika, 1966, No. 11, p. 2-9. |
Neiman M.S., On the bases of the theory of information retrieval. Radiotekhnika, 1967, No. 5, p. 2-10. |
Neiman M.S., On the molecular memory systems and the directed mutations. Radiotekhnika, 1965, No. 6, pp. 1-8. |
Neiman M.S., On the relationships between the reliability, performance and degree of microminiaturization at the molecular-atomic level. Radiotekhnika, 1965, No. 1, pp. 1-9. |
Neiman M.S., Some fundamental issues of microminiaturization. Radiotekhnika, 1964, No. 1, pp. 3-12. |
Organick et al., Random access in large-scale DNA data storage. Nature Biotechnology, Advance Online Publication, 8 pages, 2018. |
Organick et al., Scaling up DNA data storage and random access retrieval, bioRxiv, preprint first posted online Mar. 7, 2017, 14 pages. |
PCT/US2015/043605 International Preliminary Report on Patentability dated Feb. 16, 2017. |
PCT/US2016/016459 International Preliminary Report on Patentability dated Aug. 17, 2017. |
PCT/US2016/016636 International Preliminary Report on Patentability dated Aug. 17, 2017. |
PCT/US2016/028699 International Preliminary Report on Patentability dated Nov. 2, 2017. |
PCT/US2016/031674 International Preliminary Report on Patentability dated Nov. 23, 2017. |
PCT/US2016/052336 International Search Report and Written Opinion dated Dec. 7, 2016. |
PCT/US2016/052916 International Search Report and Written Opinion dated Dec. 30, 2016. |
PCT/US2016/064270 International Search Report and Written Opinion dated Apr. 28, 2017. |
PCT/US2017/026232 International Search Report and Written Opinion dated Aug. 28, 2017. |
PCT/US2017/036868 International Search Report and Written Opinion dated Aug. 11, 2017. |
PCT/US2017/045105 International Search Report and Written Opinion dated Oct. 20, 2017. |
PCT/US2017/052305 International Search Report and Written Opinion dated Feb. 2, 2018. |
PCT/US2017/062391 International Search Report and Written Opinion dated Mar. 28, 2018. |
Plesa et al., Multiplexed gene synthesis in emulsions for exploring protein functional landscapes. Science, 10.1126/science.aao5167, 10 pages, 2018. |
Pray. “Discovery of DNA Structure and Function: Watson and Crick,” Nature Education, 2008, 6 pages, available at: http://www.nature.com/scitable/topicpage/discovery-of-dna-structure-and-function-watson-397. |
Qian and Winfree, Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332(6034):196-1201, 2011. |
Qian, et al., Neural network computation with DNA strand displacement cascades, Nature, 475(7356):368-372, 2011. |
Quan et al., “Parallel on-chip gene synthesis and application to optimization of protein expression,” Nature Biotechnology, 29(5):449-452, 2011. |
Rafalski and Morgante, Corn and humans: recombination and linkage disequilibrium in two genomes of similar size. Trends in Genetics, 20(2):103-111, 2004. |
Raje and Murma, A Review of electrohydrodynamic-inkjet printing technology. International Journal of Emerging Technology and Advanced Engineering, 4(5):174-183, 2014. |
Rastegari, et al., XNOR-Net: ImageNet Classification Using Binary Convolutional Neural Networks, in ECCV 2016, Part IV, LNCS 9908, p. 525-542, 2016. |
Rogozin et al., Origin and evolution of spliceosomal introns. Biology Direct, 7:11, 2012. |
Sargolzaei et al., Extent of linkage disequilibrium in Holstein cattle in North America. J.Dairy Science, 91:2106-2117, 2007. |
Schmitt et al., New strategies in engineering T-cell receptor gene-modified T cells to more effectively target malignancies. Clinical Cancer Research, 21(23):5191-5197, 2015. |
Seelig, et al., Enzyme-Free Nucleic Acid Logic Circuits, Science 314(5805):1585-1588, 2006. |
Sharpe and Mount, Genetically modified T cells in cancer therapy: opportunities and challenges. Disease Models and Mechanisms, 8:337-350, 2015. |
Simonyan and Zisserman, Very Deep Convolutional Networks for Large-Scale Image Recognition, Published as a conference paper at Int. Conf. Learn. Represent., pp. 1-14, 2015. |
Srivannavit et al., Design and fabrication of microwell array chips for a solution-based, photogenerated acid-catalyzed parallel oligonuclotide DNA synthesis. Sensors and Actuators A, 116:150-160, 2004. |
Srivastava et al., “RNA synthesis: phosphoramidites for RNA synthesis in the reverse direction. Highly efficient synthesis and application to convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end”, Nucleic Acids Symposium Series, 52(1):103-104, 2008. |
The Hood Laboratory, “Beta Group.” Assembly Manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, Inkjet Microarrayer Manual Version 1.2, 50 pages, May 28, 2004. |
The SLIC, Gibson, CPEC and SLiCE assembly methods (and GeneArt Seamless, In-Fusion Cloning). 5 pages, available online Sep. 2, 2010. |
Twist Bioscience | White Paper. DNA-Based Digital Storage. Retrieved from the internet, Twistbioscience.com, Mar. 27, 2018, 5 pages. |
U.S. Appl. No. 14/885,962 Notice of Allowance dated Nov. 8, 2017 and Sep. 29, 2017. |
U.S. Appl. No. 14/885,962 Office Action dated Dec. 16, 2016. |
U.S. Appl. No. 14/885,965 Office Action dated Aug. 30, 2017. |
U.S. Appl. No. 14/885,965 Office Action dated Feb. 10, 2017. |
U.S. Appl. No. 14/885,965 Office Action dated Jan. 4, 2018. |
U.S. Appl. No. 15/135,434 Notice of Allowance dated Feb. 9, 2018. |
U.S. Appl. No. 15/135,434 Office Action dated Nov. 30, 2017. |
U.S. Appl. No. 15/135,434 Restriction Requirement dated Jul. 12, 2017. |
U.S. Appl. No. 15/154,879 Notice of Allowance dated Feb. 1, 2017. |
U.S. Appl. No. 15/187,721 Notice of Allowance dated Dec. 7, 2016. |
U.S. Appl. No. 15/187,721 Office Action dated Oct. 14, 2016. |
U.S. Appl. No. 15/233,835 Notice of Allowance dated Oct. 4, 2017. |
U.S. Appl. No. 15/233,835 Office Action dated Feb. 8, 2017. |
U.S. Appl. No. 15/233,835 Office Action dated Jul. 26, 2017. |
U.S. Appl. No. 15/233,835 Restriction Requirement dated Nov. 4, 2016. |
U.S. Appl. No. 15/245,054 Office Action dated Mar. 21, 2017. |
U.S. Appl. No. 15/245,054 Office Action dated Oct. 19, 2016. |
U.S. Appl. No. 15/377,547 Office Action dated Mar. 24, 2017. |
U.S. Appl. No. 15/377,547 Office Action dated Nov. 30, 2017. |
U.S. Appl. No. 15/602,991 Notice of Allowance dated Oct. 25, 2017. |
U.S. Appl. No. 15/602,991 Office Action dated Sep. 21, 2017. |
U.S. Appl. No. 15/603,013 Office Action dated Jan. 30, 2018. |
U.S. Appl. No. 15/603,013 Office Action dated Oct. 20, 2017. |
U.S. Appl. No. 15/682,100 Office Action dated Jan. 2, 2018. |
U.S. Appl. No. 15/682,100 Restriction Requirement dated Nov. 8, 2017. |
Van Tassell et al., SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries. Nature Methods, 5:247-252, 2008. |
Wagner et al., “Nucleotides, Part LXV, Synthesis of 2′-Deoxyribonucleoside 5′-Phosphoramidites: New Building Blocks for the Inverse (5′-3′)-0iigonucleotide Approach.” Helvetica Chimica Acta, 83(8):2023-2035, 2000. |
Wan et al., Deep Learning for Content-Based Image Retrieval: A comprehensive study, in Proceedings of the 22nd ACM International Conference on Multimedia—Nov. 3-7, 2014, Orlando, FL, p. 157-166, 2014. |
Wiedenheft et al., RNA-guided genetic silencing systems in bacteria and archaea. Nature, 482:331-338, 2012. |
Wijshoff, Herman. Structure and fluid-dynamics in Piezo inkjet printheads. Thesis. Venio, The Netherlands, published 2008, p. 1-185. |
Wright and Church, An open-source oligomicroarray standard for human and mouse. Nature Biotechnology, 20:1082-1083, 2002. |
Xiong et al., Chemical gene synthesis: Strategies, softwares, error corrections, and applications. FEMS Microbiol. Rev., 32:522-540, 2008. |
Xu et al., Design of 240,000 orthogonal 25mer DNA barcode probes. PNAS, 106(7):2289-2294, 2009. |
Yazdi, et al., A Rewritable, Random-Access DNA-Based Storage System, Scientific Reports, 5, Article No. 14138, 27 pages, 2015. |
Zhang and Seelig, Dynamic DNA nanotechnology using strand-displacement reactions, Nat. Chem., 3(2):103-113, 2011. |
Zhirnov et al., Nucleic acid memory. Nature Materials, 15:366, 2016. |
Acevedo-Rocha et al. Directed evolution of stereoselective enzymes based on genetic selection as opposed to screening systems. J. Biotechnol. 191:3-10 (2014). |
Arand et al. Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22:2583-2592 (2003). |
Assembly manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, The Institute for Systems Biology, May 28, 2004 (50 pages). |
Beaucage, Serge L. et al., “The Chemical synthesis of DNA/RNA” Chapter 2 in: Encyclopedia of Cell Biology, 1:36-53, 2016. |
CeGaT. Tech Note available at https://www.cegat.de/web/wp-content/uploads/2018/06/Twist-Exome-Tech-Note.pdf (4 pgs.) (2018). |
Chilamakuri et al. Performance comparison of fourexome capture systems for deep sequencing. BMC Genomics 15(1):449 (2014). |
Cruse et al. Atlas of Immunology, Third Edition. Boca Raton:CRC Press (pp. 282-283) (2010). |
De Silva et al. New Trends of Digital Data Storage in DNA. BioMed Res Int. 2016:8072463 (2016). |
Dillon et al. Exome sequencing has higher diagnostic yield compared to simulated diseasespecific panels in children with suspected monogenic disorders. Eur J Hum Genet 26(5):644-651 (2018). |
Dvorsky. Living Bacteria Can Now Store Data. Gizmodo internet publication. Retrieved from https://gizmodo.com/living-bacteria-can-now-store-data-1781773517 (4 pgs) (Jun. 10, 2016). |
European Patent Application No. 12827479.2 Extended European Search Report dated May 18, 2015. |
European Patent Application No. 12827479.2 Partial European Search Report dated Jan. 29, 2015. |
European Patent Application No. 14834665.3 Further Examination Report dated Nov. 28, 2018. |
European Patent Application No. 14834665.3 Office Action dated May 2, 2018. |
European Patent Application No. 16847497.1 Extended European Search Report dated Jan. 9, 2019. |
European Patent Application No. 16871446.7 European Search Report dated Apr. 10, 2019. |
Gao et al. A method for the generation of combinatorial antibody libraries using pIX phage display. PNAS 99(20):12612-12616 (2002). |
Gibson et al. Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome. Science 329(5989):52-56 (2010). |
Goldfeder et al. Medical implications of technical accuracy in genome sequencing. Genome Med 8(1):24 (2016). |
Han et al. Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32(7):684-692 (2014). |
International Application No. PCT/US2017/026232 International Preliminary Report on Patentability dated Feb. 26, 2019. |
International Application No. PCT/US2017/045105 International Preliminary Report on Patentability dated Feb. 5, 2019. |
International Application No. PCT/US2017/052305 International Preliminary Report on Patentability dated Apr. 30, 2019. |
International Application No. PCT/US2017/062391 International Preliminary Report on Patentability dated May 21, 2019. |
International Application No. PCT/US2018/050511 International Search Report and Written Opinion dated Jan. 11, 2019. |
International Application No. PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019. |
International Application No. PCT/US2019/012218 International Search Report and Written Opinion dated Mar. 21, 2019. |
Jacobus et al. Optimal cloning of PCR fragments by homologous recombination in Escherichia coli. PLoS One 10(3):e0119221 (2015). |
Jager et al. Simultaneous Humoral and Cellular: Immune Response against Cancer—Testis Antigen NY-ES0-1: Definition of Human Histocompatibility LeukocyteAntigen (HLA)-A2—binding Peptide Epitopes. J. Exp. Med. 187(2):265-270 (1998). |
Kosuri, et al. A scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 2010; 28:1295-1299. |
Lee: Covalent End-Immobilization of Oligonucleotides onto Solid Surfaces; Thesis, Massachusetts Institute of Technology, Aug. 2001 (315 pages). |
Li et al. Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction. ChemBioChem 19:221-228 (2018). |
Light source unit for printable patterning VUV-Aligner/USHIO Inc., Link here: https://www.ushio.co.jp/en/products/1005.html, published Apr. 25, 2016, printed from the internet on Aug. 2, 2016, 3 pages. |
Meynert et al. Quantifying single nucleotide variant detection sensitivity in exome sequencing. BMC Bioinformatics 14:195 (2013). |
Meynert et al. Variant detection sensitivity and biases in whole genome and exome sequencing. BMC Bioinformatics 15:247 (2014). |
Mulligan. Commercial Gene Synthesis Technology PowerPoint presentation. BlueHeron® Biotechnology. Apr. 5, 2006 (48 pgs). |
Eroshenko et al.: Gene Assembly from Chip-Synthesized Oligonucleotides; Current Protocols in Chemical biology 4: 1-17 (2012). |
Jo et al.: Engineering therapeutic antibodies targeting G-protein-coupled receptors; Experimental & Molecular Medicine; 48; 9 pages (2016). |
Lausted et al.: POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer; Genome Biology 2004, 5:R58. |
Douthwaite et al.: Affinity maturation of a novel antagonistic human monoclonal antibody with a long VH CDR3 targeting the Class A GPCR formyl-peptide receptor 1; mAbs, vol. 7, Iss. 1, pp. 152-166 (Jan. 1, 2015). |
PCT/IL2012/000326 International Preliminary Report on Patentability dated Dec. 5, 2013. |
PCT/IL2012/000326 International Search Report dated Jan. 29, 2013. |
PCT/US2016/052336 International Preliminary Report on Patentability dated Mar. 29, 2018. |
PCT/US2016/052916 International Preliminary Report on Patentability dated Apr. 5, 2018. |
PCT/US2016/064270 International Preliminary Report on Patentability dated Jun. 14, 2018. |
PCT/US2017/066847 International Search Report and Written Opinion dated May 4, 2018. |
PCT/US2018/022487 International Search Report and Written Opinion dated Aug. 1, 2018. |
PCT/US2018/022493 International Search Report and Written Opinion dated Aug. 1, 2018. |
PCT/US2018/037152 International Search Report and Written Opinion dated Aug. 28, 2018. |
PCT/US2018/037161 International Search Report and Written Opinion dated Oct. 22, 2018. |
PCT/US2018/037161 Invitation to Pay Additional Fees dated Aug. 27, 2018. |
PCT/US2018/056783 International Search Report and Written Opinion of the International Searching Authority dated Dec. 20, 2018. |
PCT/US2018/19268 International Search Report and Written Opinion dated Jun. 26, 2018. |
PCT/US2018/19268 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 2, 2018. |
PCT/US2018/22487 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018. |
PCT/US2018/22493 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018. |
Pierce and Wangh, Linear-after-the-exponential polymerase chain reaction and allied technologies Real-time detection strategies for rapid, reliable diagnosis from single cells Methods Mol. Med. 132:65-85 (2007) (Abstract only). |
Puigbo. Optimizer: a web server for optimizing the codon usage of DNA sequences. Nucleic Acid Research, 35(14):126-131, 2007. |
Sharan et al. Recombineering: a homologous recombination-based method of genetic engineering. Nat Profile 4(2):1-37 (originally pp. 206-223) (2009). |
Singh-Gasson, Sangeet et al., Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array, Nature Biotechnology, vol. 17, 974-978 (Oct. 1999). |
Skerra. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. Jul. 25, 1992; 20(14):3551-4. |
Martinez-Torrecuadrada et al.: Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies Inhibits Bladder Carcinoma Cell Line Proliferation; Clinical Cancer Research; vol. 11; pp. 6282-6290 (2005). |
Sierzchala, Agnieszka B. et al., “Solid-phase oligodeoxynucleotide synthesis: a two-step cycle using peroxy anion deprotection”, J. Am. Chem. Soc., vol. 125, No. 44, 13427-13441 (2003). |
U.S. Appl. No. 15/187,714 Office Action dated Apr. 4, 2019. |
U.S. Appl. No. 15/603,013 Office Action dated Jun. 26, 2019. |
Sullivan et al. Library construction and evaluation for site saturation mutagenesis. Enzyme Microb. Technol. 53:70-77 (2013). |
Sun et al. Structure-Guided Triple-Code Saturation Mutagenesis: Efficient Tuning of the Stereoselectivity of an Epoxide Hydrolase. ACS Catal. 6:1590-1597 (2016). |
U.S. Appl. No. 14/241,874 Final Office Action dated Jan. 28, 2019. |
U.S. Appl. No. 14/241,874 Office Action dated Feb. 27, 2017. |
U.S. Appl. No. 14/241,874 Office Action dated Jul. 14, 2016. |
U.S. Appl. No. 14/241,874 Office Action dated May 4, 2018. |
U.S. Appl. No. 14/885,963 Office Action dated Feb. 5, 2016. |
U.S. Appl. No. 14/885,965 Office Action dated Aug. 28, 2018. |
U.S. Appl. No. 15/015,059 Office Action dated Feb. 7, 2019. |
U.S. Appl. No. 15/151,316 Office Action dated Jun. 7, 2018. |
U.S. Appl. No. 15/156,134 Office Action dated Apr. 4, 2019. |
U.S. Appl. No. 15/187,714 Restriction Requirement dated Sep. 17, 2018. |
U.S. Appl. No. 15/268,422 Office Action dated Mar. 1, 2019. |
U.S. Appl. No. 15/268,422 Restriction Requirement dated Oct. 4, 2018. |
U.S. Appl. No. 15/377,547 Final Office Action dated Feb. 8, 2019. |
U.S. Appl. No. 15/377,547 Office Action dated Jul. 27, 2018. |
U.S. Appl. No. 15/433,909 Non-Final Office Action dated Feb. 8, 2019. |
U.S. Appl. No. 15/433,909 Restriction Requirement dated Sep. 17, 2018. |
U.S. Appl. No. 15/602,991 Final Office Action dated Dec. 13, 2018. |
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2018. |
U.S. Appl. No. 15/603,013 Office Action dated Jul. 10, 2018. |
U.S. Appl. No. 15/729,564 Final Office Action dated Dec. 13, 2018. |
U.S. Appl. No. 15/729,564 Office Action dated Jan. 8, 2018. |
U.S. Appl. No. 15/729,564 Office Action dated Jun. 6, 2018. |
U.S. Appl. No. 15/844,395 Restriction Requirement dated May 17, 2019. |
U.S. Appl. No. 15/860,445 Final Office Action dated Dec. 13, 2018. |
U.S. Appl. No. 15/860,445 Office Action dated May 30, 2018. |
U.S. Appl. No. 15/151,316 Final Office Action dated Feb. 21, 2019. |
Van Der Werf et al. Limonene-1,2-epoxide hydrolase from Rhodococcus erythropolis DCL14 belongs to a novel class of epoxide hydrolases. J. Bacteriol. 180:5052-5057 (1998). |
Warr et al. Exome Sequencing: current and future perspectives. G3: (Bethesda) 5(8):1543-1550 (2015). |
Wu, et al. “Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification” PLoS ONE. Oct. 20, 2011, vol. 6, No. 10. |
Yes HMDS vapor prime process application note Prepared by UC Berkeley and University of Texas at Dallas and re-printed by Yield Engineering Systems, Inc., 6 pages (http://www.yieldengineering.eom/Portals/0/HMDS%20Application%20Note.pdf (Published online Aug. 23, 2013). |
Zheng et al. Manipulating the Stereoselectivity of Limonene Epoxide Hydrolase by Directed Evolution Based on Iterative Saturation Mutagenesis. J. Am. Chem. Soc. 132:15744-15751 (2010). |
Zhou, et al. “Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane” Scientific Reports May 9, 2014, vol. 4, No. 4912. |
Alberts et al.: Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. The Generation of Antibody Diversity. https://www.ncbi.nlm.nih.gov/books/NBK26860/. |
Almagro et al.: Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Frontiers in immunology; 8, 1751 (2018) doi:10.3389/fimmu.2017.01751 https://www.frontiersin.org/articles/10.3389/fimmu.2017.01751/full. |
Chervin et al.: Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Therapy. 20(6):634-644 (2012). |
Cui et al.: Information Security Technology Based on DNA Computing. International Workshop on Anti-Counterfeiting, Security and Identification (ASID); IEEE Xplore 4 pages (2007). |
EPP104742EP51 Search Report Opinion dated Nov. 13, 2020. |
European Patent Application No. 17844060.8 Extended Search Report dated Apr. 20, 2020. |
European Patent Application No. 17872347.4 Extended European Search Report dated Jun. 30, 2020. |
European Patent Application No. 17881617.9 European Search Report and Written Opinion dated Jul. 2, 2020. |
Goodwin et al.: immunoglobulin heavy chain variable region, partial [Homo sapiens], Genbank entry (online). National Institute of Biotechnology Information. (2018) https://www.ncbi.nim.nih.goV/protein/AXA12486.1. |
Hauser et al.: Trends in GPCR drug discovery: new agents, targets and indications. Nature Reviews Drug Discovery, 16, 829-842 (2017). doi:10.1038/nrd.2017.178 https://www.nature.com/articles/nrd.2017.178. |
Hopcroft et al.: What is the Young's Modulus of Silicon?. Journal of Microelectromechanical Systems. 19(2):229-238 (2010). |
Hötzel et al.: A strategy for risk mitigation of antibodies with fast clearance. mAbs, 4(6), 753-760 (2012). doi:10.4161/mabs.22189 https://www.ncbi.nlm.nih.gov/pubmed/23778268. |
Jaiswal et al.: An architecture for creating collaborative semantically capable scientific data sharing infrastructures. Proceeding WIDM '06 Proceedings of the 8th annual ACM international workshop on Web information and data management. ACM Digital Library pp. 75-82 (2006). |
Jang et al.: Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing. Oncoimmunology, 4(11):e1030561:1-10 (2015). |
Malecek et al.: Engineering improved T cell receptors using an alanine-scan guided T cell display selection system. Journal of Immunological Methods. Elsevier Science Publishers. 392(1):1-11 (2013). |
Mazor et al.: Isolation of Full-Length IgG Antibodies from Combinatorial Libraries Expressed in Escherichia coli; Antony S. Dimitrov (ed.), Therapeutic Antibodies: Methods and Protocols, vol. 525, Chapter 11, pp. 217-239 (2009). |
(Novartis Institutes for Biomedical Research) Immunoglobulin Heavy Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1ttps://https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1. |
Novartis Institutes for Biomedical Research) Immunoglobulin Lambda Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1. |
PCT/US2018/037152 International Preliminary Report on Patentability dated Dec. 17, 2019. |
PCT/US2018/037161 International Preliminary Report on Patentability dated Dec. 17, 2019. |
PCT/US2018/050511 International Preliminary Report on Patentability dated Mar. 17, 2020. |
PCT/US2018/056783 International Preliminary Report on Patentability dated Apr. 30, 2020. |
PCT/US2018/057857 International Preliminary Report on Patentability dated Apr. 28, 2020. |
PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019. |
PCT/US2019/012218 International Preliminary Report on Patentability dated Jul. 16, 2020. |
PCT/US2019/032992 International Preliminary Report on Patentability dated Nov. 24, 2020. |
PCT/US2020/019371 International Search Report and Written Opinion dated Jun. 25, 2020. |
PCT/US2020/019986 International Search Report and Written Opinion dated Jul. 29, 2020. |
PCT/US2020/019986 Invitation to Pay Additional Fees dated Jun. 5, 2020. |
PCT/US2020/019988 International Search Report and Written Opinion dated Jul. 29, 2020. |
PCT/US2020/019988 Invitation to Pay Additional Fees dated Jun. 8, 2020. |
PCT/US2020/038679 International Search Report and Written Opinion dated Oct. 28, 2020. |
PubChem Data Sheet Dichloromethane. Printed from website https://pubchem.ncbi.nlm.nih.gov/compound/Dichloromethane (2020). |
U.S. Appl. No. 15/151,316 Final Office Action dated Jul. 9, 2020. |
U.S. Appl. No. 15/156,134 Office Action dated Nov. 25, 2020. |
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2019. |
U.S. Appl. No. 15/619,322 Office Action dated Nov. 4, 2020. |
U.S. Appl. No. 15/709,274 Notice of Allowance dated Apr. 3, 2019. |
U.S. Appl. No. 15/729,564 Office Action dated May 30, 2019. |
U.S. Appl. No. 15/816,995 Office Action dated May 19, 2020. |
U.S. Appl. No. 15/816,995 Restriction Requirement dated Apr. 4, 2019. |
U.S. Appl. No. 15/835,342 Final Office Action dated Sep. 8, 2020. |
U.S. Appl. No. 15/921,479 Final Office Action dated Jun. 15, 2020. |
U.S. Appl. No. 15/921,479 Restriction Requirement dated May 24, 2019. |
U.S. Appl. No. 15/991,992 Office Action dated May 21, 2020. |
U.S. Appl. No. 16/031,784 Office Action dated May 12, 2020. |
U.S. Appl. No. 16/039,256 Office Action dated Aug. 20, 2020. |
U.S. Appl. No. 16/039,256 Restriction Requirement dated May 18, 2020. |
U.S. Appl. No. 16/128,372 Office Action dated Oct. 8, 2020. |
U.S. Appl. No. 16/128,372 Restriction Requirement dated May 18, 2020. |
U.S. Appl. No. 16/239,453 Office Action dated May 11, 2020. |
U.S. Appl. No. 16/384,678 Final Office Action dated Oct. 15, 2020. |
U.S. Appl. No. 16/535,777 Final Office Action dated Oct. 20, 2020. |
Van der Velde: Thesis. Finding the Strength of Glass. Delft University of Technology. 1-16 (2015). |
Xu et al.: Coordination between the Polymerase and 5 ′-Nuclease Components of DNA Polymerase I of Escherichia coli. The Journal of Biological Chemistry. 275(27):20949-20955 (2000). |
European Patent Application No. 16871446.7 First Official Action dated Nov. 13, 2019. |
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:1-9 (2017). |
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S1 figure (2017). |
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S1 Table (2017). |
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S2 figure (2017). |
International Application No. PCT/US2018/019268 International Preliminary Report on Patentability dated Sep. 6, 2019. |
International Application No. PCT/US2019/032992 International Search Report and Written Opinion dated Oct. 28, 2019. |
International Application No. PCT/US2019/032992 Invitation to Pay Additional Fees dated Sep. 6, 2019. |
Paul et al.: Acid binding and detritylation during oligonucleotide synthesis. Nucleic Acids Research. 15. pp. 3048-3052 (1996). |
PCT/US2019/068435 International Search Report and Written Opinion dated Apr. 23, 2020. |
PubChem Data Sheet Acetonitrile. Printed from website https://pubchem.ncbi.nlm.nig.gov/ pp. 1-124 (2020). |
PubChem Data Sheet Methylene Chloride. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-140 (2020). |
Rajpal et al.: A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc. Natl. Acad. Sci. 102(24):8466-8471 (2005). |
Solomon et al.: Genomics at Agilent: Driving Value in DNA Sequencing.https://www.agilent.com/labs/features/2010_genomics.html, 8 pages (Aug. 5, 2010). |
U.S. Appl. No. 15/015,059 Final Office Action dated Jul. 17, 2019. |
U.S. Appl. No. 15/015,059 Office Action dated Aug. 19, 2019. |
U.S. Appl. No. 15/151,316 Office Action dated Oct. 4, 2019. |
U.S. Appl. No. 15/156,134 Final Office Action dated Jan. 3, 2020. |
U.S. Appl. No. 15/187,714 Final Office Action dated Sep. 17, 2019. |
U.S. Appl. No. 15/268,422 Final Office Action dated Oct. 3, 2019. |
U.S. Appl. No. 15/603,013 Final Office Action dated Nov. 6, 2019. |
U.S. Appl. No. 15/619,322 Final Office Action dated Mar. 30, 2020. |
U.S. Appl. No. 15/619,322 Office Action dated Aug. 14, 2019. |
U.S. Appl. No. 15/816,995 Office Action dated Sep. 20, 2019. |
U.S. Appl. No. 15/835,342 Office Action dated Dec. 2, 2019. |
U.S. Appl. No. 15/835,342 Restriction Requirement dated Sep. 10, 2019. |
U.S. Appl. No. 15/844,395 Office Action dated Jan. 24, 2020. |
U.S. Appl. No. 15/921,479 Office Action dated Nov. 12, 2019. |
U.S. Appl. No. 15/960,319 Office Action dated Aug. 16, 2019. |
U.S. Appl. No. 15/991,992 Restriction Requirement dated Mar. 10, 2020. |
U.S. Appl. No. 16/006,581 Office Action dated Sep. 25, 2019. |
U.S. Appl. No. 16/165,952 Office Action dated Mar. 12, 2020. |
U.S. Appl. No. 16/239,453 Office Action dated Nov. 7, 2019. |
U.S. Appl. No. 16/384,678 Office Action dated Jan. 21, 2020. |
U.S. Appl. No. 16/409,608 Office Action dated Sep. 9, 2019. |
U.S. Appl. No. 16/530,717 Final Office Action dated Apr. 15, 2020. |
U.S. Appl. No. 16/530,717 Office Action dated Sep. 6, 2019. |
U.S. Appl. No. 16/535,777 Office Action dated Jan. 23, 2020. |
U.S. Appl. No. 16/535,779 First Action Interview dated Feb. 10, 2020. |
U.S. Patent Application No. 15/921,537Office Action dated Apr. 1, 2020. |
Agbavwe et al.: Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. Journal of Nanobiotechnology. 9(57):1-17 (2011). |
Bai. A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity. PLoS One. 10(10):1-18(2015). |
Berg: Biochemistry. 5th ED. New York (2002) 148-149. |
Borda et al.: Secret writing by DNA hybridization. Acta Technica Napocensis Electronics and Telecommunications. 50(2):21-24 (2008). |
De Graff et al.: Glucagon-Like Peptide-1 and its Class B G Protein-Coupled Receptors: A Long March to Therapeutic Successes. Pharmacol Rev. 68(4):954-1013 (2016). |
Diehl et al.: Beaming: single-molecule PCR on microparticles in water-in-oil emulsions. Nature Methods. 3(7):551-559 (2006). |
Fernández-Quintero et al.: Characterizing the Diversity of the CDR-H3 Loop Conformational Ensembles in Relationship to Antibody Binding Properties. Front. Immunol. 9:1-11 (2019). |
GE Healthcare. AKTA oligopilot plus. Data File 18-114-66 ADC. 8 pages (2006). |
GE Healthcare. Robust and cost-efficient oligonucleotide synthesis. Application Note 28-4058-08 AA. 4 pages (2005). |
Geetha et al.: Survey on Security Mechanisms for Public Cloud Data. 2016 International Conference on Emerging Trends in Engineering, Technology and Science (ICETETS). 8 pages (2016). |
Hood et al.: The digital code of DNA. Nature 421.6921:444-448 (2003). |
HUDSON: Matrix Assisted Synthetic Transformations: A Mosaic of Diverse Contributions. Journal of Combinatorial Chemistry. 1(6):403-457 (1999). |
Kalva et al.: Gibson Deletion: a novel application of isothermal in vitro recombination. Biological Procedures Online. 20(1):1-10 (2018). |
Lebl et al.: Economical Parallel Oligonucleotide and Peptide Synthesizer—Pet Oligator. Int. J. Peptide Res. Ther. 13(1-2):367-376 (2007). |
MLAB 2321 Molecular Diagnostics for Clinical Laboratory Science. Mar. 6, 2015. |
Momentiv. Technical Data Sheet. Silquest A-1100. Momentiv. 1-6 (2020). |
Nucleic acid thermodynamics. Wikipedia. Feb. 4, 2021. |
O'Driscoll et al.: Synthetic DNA: The next generation of big data storage. Bioengineered. 4(3):123-125 (2013). |
Opposition to European Patent No. 3030682 filed Mar. 3, 2021. |
PCT/US2019/068435 International Preliminary Report on Patentability dated Jul. 8, 2021. |
PCT/US2020/019371 International Preliminary Report on Patentability dated Sep. 2, 2021. |
PCT/US2020/019986 International Preliminary Report on Patentability dated Sep. 10, 2021. |
PCT/US2020/019988 International Preliminary Report on Patentability dated Sep. 10, 2021. |
PCT/US2020/052291 International Search Report and Written Opinion dated Mar. 10, 2021. |
PCT/US2020/052291 Invitation to Pay Additional Fees dated Dec. 31, 2020. |
PCT/US2020/052306 International Search Report and Written Opinion dated Mar. 2, 2021. |
PCT/US2020/052306 Invitation to Pay Additional Fees dated Dec. 18, 2020. |
PCT/US2020/064106 International Search Report and Written Opinion dated Jun. 3, 2021. |
PCT/US2020/064106 Invitation to Pay Additional Fees dated Apr. 9, 2021. |
Pigott et al.: The Use of a Novel Discovery Platform to Identify Peptide-Grafted Antibodies that Activate GLP-1 Receptor Signaling. Innovative Targeting Solutions Inc. (2013) XP055327428 retrieved from the internet: http://www.innovativetargeting.com/wo-content/uploads/2013/12/Pigott-et-al-Antibody-Engineering-2013.pdf. |
Ponsel. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules. 16:3675-3700 (2011). |
Regep et al.: The H3 loop of antibodies shows unique structural characteristics. Proteins. 85(7):1311-1318 (2017). |
Shipman et al.: Molecular recordings by directed CRISPR spacer acquisition. Science. 353(6298):1-16 (2016). |
U.S. Appl. No. 15/921,479 Final Office Action dated Dec. 20, 2021. |
U.S. Appl. No. 15/156,134 Final Office Action dated Aug. 18, 2021. |
U.S. Appl. No. 15/245,054 Notice of Allowance dated Dec. 14, 2017. |
U.S. Appl. No. 15/619,322 Final Office Action dated Jul. 9, 2021. |
U.S. Appl. No. 15/835,342 Office Action dated Apr. 16, 2021. |
U.S. Appl. No. 15/902,855 Office Action dated Dec. 9, 2021. |
U.S. Appl. No. 15/902,855 Restriction Requirement dated Apr. 6, 2021. |
U.S. Appl. No. 15/921,479 Office Action dated Apr. 27, 2021. |
U.S. Appl. No. 16/039,256 Final Office Action dated Mar. 30, 2021. |
U.S. Appl. No. 16/128,372 Final Office Action dated Mar. 18, 2021. |
U.S. Appl. No. 16/128,372 Office Action dated Dec. 13, 2021. |
U.S. Appl. No. 16/535,777 Office Action dated Feb. 8, 2021. |
U.S. Appl. No. 16/712,678 Office Action dated Nov. 26, 2021. |
U.S. Appl. No. 16/712,678 Restriction Requirement dated Aug. 25, 2021. |
U.S. Appl. No. 16/737,401 Office Action dated Jan. 5, 2022. |
U.S. Appl. No. 16/737,401 Restriction Requirement dated Nov. 15, 2021. |
U.S. Appl. No. 16/798,275 Final Office Action dated Aug. 30, 2021. |
U.S. Appl. No. 16/798,275 Office Action dated Feb. 10, 2021. |
U.S. Appl. No. 16/802,423 Restriction Requirement dated Dec. 29, 2021. |
U.S. Appl. No. 16/802,439 Restriction Requirement dated Oct. 1, 2021. |
U.S. Appl. No. 16/854,719 Office Action dated Nov. 24, 2021. |
U.S. Appl. No. 16/854,719 Restriction Requirement dated Jul. 28, 2021. |
U.S. Appl. No. 16/879,705 Office Action dated Sep. 9, 2021. |
U.S. Appl. No. 16/906,555 Office Action dated Aug. 17, 2021. |
U.S. Appl. No. 17/154,906 Office Action dated Nov. 10, 2021. |
U.S. Appl. No. 17/154,906 Restriction Requirement dated Jul. 26, 2021. |
Wikipedia. Central dogma of molecular biology. URL: https://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology. 9 pages (2021). |
Williams et al.: Amplification of complex gene libraries by emulsion PCR. Nature Methods. 3(7):545-550(2006). |
Yazdi et al.: DNA-Based Storage: Trends and Methods. IEEE Transactions on Molecular, Biological and Multi-Scale Communications. IEEE. 1(3):230-248 (2016). |
Altshuler et al.: Generation of Recombinant Antibodies and Means for Increasing Their Affinity. Biochemistry (Moscow). 75(13:1584-1605 (2010). |
Damha et al.: An improved procedure forderivatization of controlled-pore glass beads for solidphase oligonucleotide synthesis. Nucleic Acids Research. 18(13):3813-3821 (1990). |
PCT/US2020/052291 International Preliminary Report on Patentability dated Apr. 7, 2022. |
PCT/US2020/052306 International Preliminary Report on Patentability dated Mar. 15, 2022. |
PCT/US2022/023936 International Search Report and Written Opinion dated Jul. 14, 2022. |
Smith et al.: Changing the peptide specificity of a human T-cell receptor by directed evolution. Nature Communications. 5:1-13 (2014). |
Sommermeyer et al.: Minimal Amino Acid Exchange in Human TCR Constant Regions Fosters Improved Function of TCR Gene-Modified T Cells. Journal of Immunology. 184:6223-6231 (2010). |
U.S. Appl. No. 16/737,401 Final Office Action dated Jun. 13, 2022. |
U.S. Appl. No. 15/835,342 Office Action dated Jun. 17, 2022. |
U.S. Appl. No. 15/902,855 Final Office Action dated Aug. 11, 2022. |
U.S. Appl. No. 15/921,479 Office Action dated Apr. 28, 2022. |
U.S. Appl. No. 16/039,256 Office Action dated May 10, 2022. |
U.S. Appl. No. 16/417,023 Final Office Action dated Aug. 2, 2022. |
U.S. Appl. No. 16/417,023 Office Action dated Feb. 22, 2022. |
U.S. Appl. No. 16/590,301 Office Action dated Jul. 20, 2022. |
U.S. Appl. No. 16/590,301 Restriction Requirement dated Apr. 28, 2022. |
U.S. Appl. No. 16/726,073 Office Action dated Jun. 30, 2022. |
U.S. Appl. No. 16/802,423 Notice of Allowance dated Jul. 25, 2022. |
U.S. Appl. No. 16/802,439 Office Action dated Mar. 17, 2022. |
U.S. Appl. No. 16/854,719 Office Action dated Jun. 2, 2022. |
U.S. Appl. No. 17/154,906 Office Action dated May 17, 2022. |
Number | Date | Country | |
---|---|---|---|
20170081716 A1 | Mar 2017 | US |
Number | Date | Country | |
---|---|---|---|
62222020 | Sep 2015 | US |