Patent Application
20230141569
The sequence listing provided in the file entitled 0722207066 PCT_US_seqn.txt, which is an ASCII text file that was created on Sep. 21, 2022, and which comprises 2,529 bytes, is hereby incorporated by reference in its entirety.
The present invention relates to the technical field of fluorescent dye, and particularly relates to a fluorescent dye with viscosity responsiveness and low background fluorescence, as well as a preparation method and uses thereof.
Chromophores of fluorescent proteins are mainly imidazolinone dye, which has good biocompatibility, and is also advantageous in photostability and adjustable fluorescence properties. According to research findings, this kind of dye is a molecular rotor, and its fluorescence property changes with viscosity variation, namely, when excited by light, free-state molecular rotors release excited-state energy in a non-radiation form by means of excited-state intra-molecular twist; and, when the molecules are in a relatively viscous or rigid environment, the excited-state intra-molecular twist is limited, and the excited-state energy is mainly released in a form of radio-luminescence and shows the property of fluorescence enhancement. Therefore, molecular rotors are often used for detecting changes in micro-environments, etc.
At present, intra-molecular twist and luminescence based on restricted molecular rotors are not only used for viscosity detection, but also are widely used in the construction of fluorescent sensors, protein labeling, nucleic acid labeling, etc.; for instance: after DCVJ binds to BSA and other proteins, the excited-state intra-molecular twist of the molecular rotors is restricted, and the excited-state energy is released in a form of radio-luminescence and is manifested as fluorescence activation, and thus can be used for the detection and quantification of target proteins; after imidazolinone and other dyes bind to DNA and RNA, molecular conformation is restricted so that fluorescence is illuminated, and thus can be used for the no-clean labeling and detection of DNA and RNA; with DHBI as the target molecule, aptamer that can specifically bind to DHBI can be obtained through SELEX screening, thereby constructing the fluorescent aptamer, overcoming the difficulty of lacking natural fluorescent RNA and making it possible to construct fluorescent RNA; with peacock green as the target molecule, a single-chain antibody that can specifically bind to peacock green derivatives and activate fluorescence is obtained by means of phage display, and can be used for labeling of cell membrane proteins; BODIPY and other molecular rotors can bind to amyloid and tua proteins and light up fluorescence, and thus can be used for researches of diseases such as Alzheimers and Parkinson's.
The types of imidazolinone molecular rotors completely derived from fluorescent protein chromophores are quite limited. Thanks to modification by means of organic synthesis, the spectral range of imidazolinone is significantly expanded, and other properties, such as light stability, oil-water distribution coefficient, etc. can be effective adjusted. However, molecular rotors obtained by this method generally have the disadvantage of high fluorescence background, which causes low detection signal-to-noise ratio and makes it difficult to detect and label samples with small sample sizes, complex components and low substrate abundance, so it is necessary to develop a kind of imidazolinone molecular rotors with low background fluorescence, so as to further expand uses of such molecular rotors.
The object of the present invention is to provide a fluorescent dye with viscosity responsiveness and low background fluorescence, wherein the viscosity responsiveness of this kind of molecular rotors is that a ratio of fluorescence intensity in glycerol to that in methanol is greater than 10 at a condition of 10−5 mol.
For one aspect, the present invention provides a fluorescent dye, which is shown as Formula (I),
wherein:
Ar is arylene or heteroarylene, and optionally, hydrogen atoms in Ar are independently substituted by halogen atoms; D- is HO— or N(X1)(X2)—, and X1 and X2 are independently selected from hydrogen, alkyl or modified alkyl; X1 and X2 are optionally interconnected, and form an alicyclic heterocycle with N atoms; and X1 and X2 are optionally and independently form an alicyclic heterocycle with Ar;
Y is 0 or S;
R1 is hydrogen or alkyl; and
R2 is a halogen atom, —OH or —CN;
wherein:
the “alkyl” is C1-C10 straight or branched alkyl; optionally, the “alkyl” is C1-C6 straight or branched alkyl; optionally, the “alkyl” is C1-C4 straight or branched alkyl; optionally, the “alkyl” is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tertiary butyl, sec-butyl, n-amyl, 1-methyl butyl, 2-methyl butyl, 3-methyl butyl, isoamyl, 1-ethyl propyl, neoamyl, n-hexyl, 1-methyl amyl, 2-methyl amyl, 3-methyl amyl, isohesyl, 1,1-dimethyl butyl, 2,2-dimethyl butyl, 3,3-dimethyl butyl, 1,2-dimethyl butyl, 1,3-dimethyl butyl, 2,3-dimethyl butyl, 2-ethyl butyl, n-heptyl, 2-methyl hexyl, 3-methyl hexyl, 2,2-dimethyl amyl, 3,3 dimethyl amyl, 2,3-dimethyl amyl, 2,4-dimethyl amyl, 3-ethyl amyl or 2,2,3-methyl butyl;
the “modified alkyl” is independently a group obtained by replacing any carbon atom in C1-C16 straight or branched alkyl with one or more groups selected from halogen atom, —OH, —CO—, —O—, —CN, —SO3H—, primary amino group, secondary amino group and tertiary amino group, or the carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond;
the replacement of carbon atoms refers to that carbon atoms or the carbon atoms and hydrogen atoms thereon together are replaced by a corresponding group;
the “halogen atom” is independently F, Cl, Br or I;
the “alicyclic heterocycle” is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic alicyclic heterocycle containing one or more heteroatoms of N, O, S or Si on the ring, and the alicyclic heterocycle containing S heteroatom(s) on the ring include the ones that contain —S—, —SO— or —SO2— on the ring; the alicyclic heterocycle is optionally substituted by a halogen atom, an alkyl, an aryl or a modified alkyl;
the “arylene” is independently a 5- to 13-membered (optionally 6- or 10-membered) monocyclic or dicyclic or fused dicyclic or fused polycyclic subaromatic group;
the “heteroarylene” is independently a 5- to 13-membered (optionally 6- or 10-membered) monocyclic or dicyclic or fused dicyclic or fused polycyclic sub-heteroaromatic group containing one or more heteroatoms selected from N, O, S or Si on the ring;
the “primary amino group” is R′NH2 group;
the “secondary amino group” is R′NHR″ group;
the “tertiary amino group” is R′NR″R″ group;
each R′, R″, R′″ is independently a single bond, hydrogen, alkyl, or alkylene;
the “alkylene” is C1-C10 straight or branched alkylene; optionally, it is C1-C7 straight or branched alkylene; optionally, it is C1-C5 straight or branched alkylene;
optionally, the “modified alkylene” is a group containing one or more groups selected from —OH, —O—, —NH2, ethylene glycol unit (—(CH2CH2O)n—), —CN —O—CO—, —NH—CO—, —SO2—O—, —SO—, Me2N—, Et2N—, —CH═CH—, —C≡CH, F, Cl, Br, I, and cyano group; and optionally, Ar is a structure selected from the following Formulae (II-1) to (II-7):
Optionally, the compound represented by Formula (I) is selected from the compounds below:
A second aspect of the present invention is to provide a method for preparing the afore-mentioned fluorescent dye, including a step of aldol condensation reaction between a compound of Formula (a) and a compound of Formula (b):
A third aspect of the present invention is to provide uses of the afore-mentioned fluorescent dye in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.
A fourth aspect of the present invention is to provide uses of the afore-mentioned fluorescent dye in preparing reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.
A fifth aspect of the present invention is to provide a fluorescent activated and lighted-up probe, comprising the afore-mentioned fluorescent dye.
A sixth aspect of the present invention is to provide uses of the afore-mentioned fluorescent activated and lighted-up probe in protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.
A seventh aspect of the present invention is to provide uses of the afore-mentioned fluorescent activated and lighted-up probe in preparing reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.
The fluorescent dye of the present invention can be used for measuring viscosity of samples, such as for the tests of micro-viscosity. According to the embodiments of another aspect, the obtained fluorescent dye can specifically bind to corresponding antibody, aptamer or amyloid, or bind to the protein tag or enzyme via a ligand or inhibitor, thereby obtaining a series of fluorescent activated and lighted-up probes used for fluorescent labeling, quantification or monitoring of proteins, enzymes or nucleic acids.
IV-20 (1×10−6 M) in PBS;
IV-5 (1×10−6 M) in PBS;
IV-1 (1×10−6 M) in PBS;
To a stirred solution of Compound 1 (0.504 g, 2 mmol), anhydrous zinc chloride (0.545 g, 4 mmol) in 100 mL THF, 4-Cyanobenzaidehyde (0.626 g, 5 mmol) was added. The complete solution were stirred at 80° C. under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solution allowing the reaction to cool to room temperature. The solvent is evaporated to dryness, to give a crude product, then purified by silica gel column chromatography to afford a target compound (0.292 g, 40%). 1H NMR (400 MHz, DMSO-d6) δ11.07 (s, 1H), 8.10 (d, J=8.5 Hz, 2H), 8.06 (dd, J=7.8, 2.1 Hz, 2H), 8.03 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H).MS(ESI): m/z Calcd. For C20H13F2N3O2 365.0976; found 364.0902, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.475 g, 65%)○1H NMR (400 MHz, DMSO-d6) δ11.04 (s, 1H), 8.49 (d, J=1.9 Hz, 1H), 8.21 (dt, J=8.0, 1.4 Hz, 1H), 8.10-8.02 (m, 2H), 8.00 (s, 1H), 7.88 (dt, J=7.7, 1.4 Hz, 1H), 7.67 (t, J=7.8 Hz, 1H), 7.43 (d, J=16.0 Hz, 1H), 7.01 (s, 1H), 3.29 (s, 3H).MS(ESI): m/z Calcd. For C20H13F2N3O2 365.0976; found 364.0903, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.221 g, 31%)○1H NMR (400 MHz, DMSO-d6) δ10.94 (s, 1H), 10.11 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.74 (d, J=8.7 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.90 (s, 1H), 6.87-6.83 (m, 2H), 3.26 (s, 3H).MS(ESI): m/z Calcd. For C19H14F2N2O3 356.0972; found 355.0901, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.207 g, 29%)○1H NMR (400 MHz, DMSO-d6) δ9.70 (s, 1H), 8.05 (d, J=8.9 Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J=6.2 Hz, 1H), 7.26 (d, J=8.9 Hz, 1H), 7.15 (d, J=15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J=7.5 Hz, 1H), 3.27 (s, 3H).MS(ESI): m/z Calcd. For C19H14F2N2O3 356.0972; found 355.0900, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.186 g, 26%)○1H NMR (400 MHz, DMSO-d6) δ8.16 (d, J=8.5 Hz, 2H), 7.99-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H).MS(ESI): m/z Calcd. For C19H13F3N2O2 358.0929; found 357.0856, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 31%)○1H NMR (400 MHz, DMSO-d6) δ11.02 (s, 1H), 8.09-8.03 (m, 2H), 8.01 (d, J=15.8 Hz, 1H), 7.85 (dt, =10.6, 2.1 Hz, 1H), 7.72 (d, =7.8 Hz, 1H), 7.51 (td, =8.0, 6.1 Hz, 1H), 7.34 (d, J=15.9 Hz, 1H), 7.28 (td, J=8.7, 2.7 Hz, 1H), 7.00 (s, 1H), 3.28 (s, 3H).MS(ESI): m/z Calcd. For C19H13F3N2O2 358.0929; found 357.0857, [M−H]−.
To a stirred solution of compound IV-5 (0.716 g, 2.0 mmol), TBSCI (0.450 g, 3.0 mmol), in 50 mL dry DMF, and imidazole (0.204 g, 3.0 mmol) was added. The complet solution was stirred for 3 hours at room temperature under Ar atmosphere. The mixture was poured into 150 mL water and extracted with DCM. The organic layer was dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford the compound 2 (0.927 g, 98%). 1H NMR (400 MHz, DMSO-d6) δ8.16 (d, J=8.5 Hz, 2H), 7.99-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H), 1.50 (s, 9H), 0.2 (s, 6H).MS(ESI): m/z Calcd. For C25H28F3N2O2Si 473.2; found 473.2, [M+H]+.
Compound 2 (0.473 g, 1 mmol), Lawesson's reagent (0.808 g, 2 mmol) was in 250 mL three neck boles and dissolved in 100 mi toluene. Two drops of aniline was added. The reaction mixture was reflexed until the TLC showed the complete the reaction. The solvent was removed under reduce pressure to give the crude product which was redissolved in 50 mL DCM, then TBAF (0.313 g, 1.2 mmol) was added. The mixture was stirred at rt under Ar atomophere. After complete the reaction, the solvent was removed under reduce pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound IV-7 (0.209 g, 56%). 1H NMR (400 MHz, DMSO-d6) δ8.17 (d, J=8.5 Hz, 2H), 7.98-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H).MS(ESI): m/z Calcd. For C18H13F3N2NaOS 397.0598; found 397.0597, [M+Na]+.
This compound was obtained by following the general procedure for Compound IV-1 Compound 2, (0.932 g, 99%)○1H NMR (400 MHz, DMSO-d6) δ8.10 (d, J=8.5 Hz, 2H), 8.06 (dd, J=7.8, 2.1 Hz, 2H), 8.03 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H), 1.51 (s, 9H), 0.29 (s, 9H).MS(ESI): m/z Calcd. For C26H28F2N3O2Si 480.2; found 480.2, [M+H]+.
This compound was obtained by following the general procedure for Compound IV-7, (0.332 g, 49%)○1H NMR (400 MHz, DMSO-d6) δ11.00 (s, 1H), 8.11 (d, J=8.5 Hz, 2H), 8.07 (dd, J=7.8, 2.1 Hz, 2H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H).HMS(ESI): m/z Calcd. For C20H13F2N3NaOS 404.0645; found 404.0646, [M+Na]+.
To a stirred solution of 3-Fluoro-4-hydroxybenzaldehyde (0.560 g, 4.0 mmol) and 5 mL 33% methylamine aqueous solution in 40 mL anhydrous ethanol, 10 g Na2SO4 was added in one portion. The obtained mixture was stirred and kept at room temperature for 24 hr, then filtered and dried with additional Na2SO4. The solvent was removed under reduce pressure to give the intermediate which was used directly without any further purification. After re-dissolved in 10 mL anhydrous methanol, compound 4 (0.790 g, 5.0 mmol) was added. The complex was stirred and kept at room temperature for 12 hr, the precipitated product was filtered and washed with cooled methanol for three times to give the yellow compound 5. (0.796 g, 85%). 1H NMR (400 MHz, DMSO-d6) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.09 (s, 3H), 2.34 (s, 3H). MS(ESI): m/z Calcd. For C12H10FN2O2234.2; found 234.2, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.239 g, 21%)○1H NMR (400 MHz, DMSO-d6) δ10.52 (s, 1H), 8.11 (d, J=8.5 Hz, 2H), 8.07 (d, J=7.8 Hz, 2H), 7.84 (d, J=8.0 Hz, 1H), 7.67 (d, J=8.4 Hz, 1H), 7.32 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 6.78 (m, 1H), 2.34 (s, 3H). HR-MS(ESI): m/z Calcd. For C20H13FN3O2346.0997; found 346.0998, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○1H NMR (400 MHz, CD3OD) δ7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.59 (t, J=5.6 Hz, 3H), 3.12 (s, 3H), 1.23 (q, J=5.6 Hz, 3H). MS(ESI): m/z Calcd. For C13H11ClFN2O2281.0; found 281.0, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.239 g, 21%)○1H NMR (400 MHz, CD3OD) δ7.84 (s, 2H), 7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.12 (s, 3H), 1.23 (q, J=5.6 Hz, 3H). HR-MS(ESI): m/z Calcd. For C21H14ClFN3O2395.0837; found 394.0764, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○1H NMR (400 MHz, CD3OD) δ7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.81 (s, 3H), 3.12 (s, 3H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). MS(ESI): m/z Calcd. For C15H15BrFN2O2353.0; found 3.0, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.209 g, 22%)○1H NMR (400 MHz, CD3OD) δ8.15 (d, J=8.8 Hz, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.74 (d, J=8.7 Hz, 2H), 7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.87-6.83 (m, 2H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). HR-MS(ESI): m/z Calcd. For C23H19BrFN3O2467.0645; found 466.0572, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 3.79 (t, J=5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J=4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J=4.8 Hz, 3H). MS(ESI): m/z Calcd. For C14H214FIN2O2388.0; found 388.0, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 7.98-7.86 (m, 3H), 7.76 (d, J=8.5 Hz, 2H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 3.79 (t, J=5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J=4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J=4.8 Hz, 3H). HR-MS(ESI): m/z Calcd. For C21H17ClFIN2O2510.0007; found 408.9936, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 3.10 (s, 3H), 2.39 (s, 3H). MS(ESI): m/z Calcd. For C12H10Cl2N2O3284.0; found 283.0, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 3.10 (s, 3H), 2.39 (s, 3H).HR-MS(ESI): m/z Calcd. For C19H13BrCl2N2O2449.9537; found 448.9455, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○1H NMR (400 MHz, DMSO-d6) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.01 (q, J=4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J=4.8 Hz, 3H). MS(ESI): m/z Calcd. For C13H13ClN2O2264.1; found 263.1, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○1H NMR (400 MHz, DMSO-d6) δ10.52 (s, 1H), 8.19 (m, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (m, 1H), 7.01 (d, J=15.7 Hz, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 6.87-6.83 (m, 2H), 3.01 (q, J=4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J=4.8 Hz, 3H). HR-MS(ESI): m/z Calcd. For C21H13ClIN2O2486.9716; found 486.9715, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 3H), 2.34 (s, 3H). MS(ESI): m/z Calcd. For C12H11BrN2O2294.0; found 293.0, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 8.19 (m, 1H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (m, 1H), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.01 (d, J=15.7 Hz, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 2H), 2.34 (s, 3H). HR-MS(ESI): m/z Calcd. For C19H14BrClN2O2415.9927; found 414.9854, [M−H]−.
This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○1H NMR (400 MHz, CD3 OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 2.39 (s, 3H). MS(ESI): m/z Calcd. For C11H8Cl2N2O2270.0; found 271.0, [M+H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 2.39 (s, 3H).HR-MS(ESI): m/z Calcd. For C18H11BrCl2N2O2435.9381; found 436.9459, [M+H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.286 g, 28%)○1H NMR (400 MHz, DMSO-d6): δ8.15 (d, J=8.6 Hz, 2H), 7.82 (d, J=15.8 Hz, 1H), 7.31-7.22 (m, 2H), 7.21-7.17 (m, 1H), 7.10 (d, J=15.8 Hz, 1H), 6.94 (s, 1H), 6.88-6.73 (m, 3H), 3.59 (t, J=5.8 Hz, 2H), 3.51 (t, J=6.0 Hz, 2H), 3.26 (s, 3H), 3.05 (s, 3H). HR-MS (ESI): m/z Calcd. For C22H24N3O3 378.1818; found 378.1819, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.486 g, 60%)○1H NMR (400 MHz, DMSO-d6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). HR-MS(ESI): m/z Calcd. For C23H23N4O2 387.1821; found 387.1822, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.286 g, 38%)○1H NMR (400 MHz, DMSO-d6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C22H23N3O3F 380.1774; found 380.1775, [M+H]30.
This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 30%). 1H NMR (400 MHz, DMSO-d6): 8.14 (d, J=8.5 Hz, 2H), 7.84 (d, J=15.7 Hz, 1H), 7.68 (d, J=8.4 Hz, 2H), 6.97 (d, J=15.8 Hz, 1H), 6.88 (s, 1H), 6.84 (d, J=8.5 Hz, 2H), 6.79 (d, J=8.8 Hz, 2H), 3.59 (q, J=5.4 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.24 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C22H24N3O3 378.1818; found 378.1819, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.352 g, 56%)○1H NMR (400 MHz, DMSO-d6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C23H23N4O2 387.1821; found 387.1820, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.252 g, 32%)○1H NMR (400 MHz, DMSO-d6): δ8.16 (d, J=8.5 Hz, 2H), 7.93 (t, J=4.4 Hz, 2H), 7.90 (d, J=6.1 Hz, 1H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C22H23FN3O2 380.1774; found 380.1775, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.252 g, 32%)○1H NMR (400 MHz, DMSO-d6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C23H23N4O2 387.2; found 387.2, [M+H]+.
2 ml Allyl bromide was added to the mixture of compound 13 (0.774 g, 2.0 mmol), K2CO3 (0.276 g, 2.0 mmol) in acetonitrile (100 ml) with constant stirring. This reaction mixture was heated to reflux. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction mixture was filtered then the solvent was removed under reduce pressure to Ove the crude product, then purified by silica gel column chromatography to afford a target compound 14. 1H NMR (400 MHz, DMSO-d6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.81 (s, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.41 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C26H27N4O2 427.2; found 427.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-7, (0.152 g, 72%)○1H NMR (400 MHz, DMSO-d6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.81 (s, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.41 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C26H27N4OS 443.1906; found 443.1905, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.692 g, 82%)○1H NMR (400 MHz, CD3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.09 (s, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). MS(ESI): m/z Calcd. For C15H21N4O 273.2; found 273.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.452 g, 34%)○1H NMR (400 MHz, CD3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.95 (m, 2H), 7.68-7.50 (m, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.34-7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J=15.7 Hz, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). MS(ESI): m/z Calcd. For C22H24FN4O 379.2; found 379.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-7, (0.152 g, 72%)○1H NMR (400 MHz, CD3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.95 (m, 2H), 7.68-7.50 (m, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.34-7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J=15.7 Hz, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). HR-MS(ESI): m/z Calcd. For C22H24FN4S 395.1706; found 395.1705, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.892 g, 80%)○1H NMR (400 MHz, CD3OD) δ8.41 (d, J=1.5 Hz, 1H), 7.97 (d, J=1.5 Hz, 1H), 7.31 (s, 1H), 5.86 (s, 1H), 3.46 (t, J=6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS(ESI): m/z Calcd. For C22H36N5O 386.3; found 386.3, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.452 g, 34%)○1H NMR (400 MHz, CD3OD) δ8.41 (d, J=1.5 Hz, 1H), 7.97 (d, J=1.5 Hz, 1H), 7.85 (d, J=15.7 Hz, 1H), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.31 (s, 1H), 7.01 (d, J=15.7 Hz, 1H), 5.86 (s, 1H), 3.46 (t, J=6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS(ESI): m/z Calcd. For C29H39ClN5O 508.2843; found 508.2842, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.812 g, 81%)○1H NMR (400 MHz, CDCl3) δ7.93 (s, 2H), 7.31 (s, 1H), 4.24 (t, J=6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS(ESI): m/z Calcd. For Cl4H12N6O 285.1; found 285.1, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.312 g, 26%)○1H NMR (400 MHz, CDCl3) δ=8.02 (d, J=15.7 Hz, 1H), 7.93 (m, 3H), 7.68-7.50 (n, 1H), 7.31 (s, 1H), 7.24-7.06 (m, 2H), 7.01 (d, J=15.7 Hz, 1H), 4.24 (t, J=6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS(ESI): m/z Calcd. For C21H20IN6O 499.0743; found 499.0742, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.932 g, 85%)○1H NMR (400 MHz, CDCl3) δ=7.59 (s, 2H), 6.71 (s, 1H), 3.24 (t, J=5.6 Hz, 4H), 3.06 (t, J=8.4 Hz, 2H), 2.67 (t, J=6.2 Hz, 4H), 2.29 (s, 3H), 1.86-1.82 (m, 4H) 1.46 (m, 2H), 1.21 (t, J=8.4 Hz, 3H). MS(ESI): m/z Calcd. For C20H25N3O 323.2; found 324.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.932 g, 85%) ○1H NMR (400 MHz, CDCl3) δ=8.31 (dd, J=8.3 Hz, J=2.1 Hz, 1H), 8.16 (s, 1H), 7.94 (d, J=8.3 Hz, 1H), 7.95 (d, J=15.7 Hz, 1H), 7.59 (s, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.71 (s, 1H), 3.24 (t, J=5.6 Hz, 4H), 3.06 (t, J=8.4 Hz, 2H), 2.67 (t, J=6.2 Hz, 4H), 2.29 (s, 3 II), 1.86-1.82 (m, 4H), 1.46 (m, 2H), 1.21 (s, J=8.4 Hz, 3H). MS(ESI): m/z Calcd. For C28H28N4O2 436.2263; found 437.2340, [M+H]+.
To a stirred solution of compound IV-21 (0.792 g, 2.0 mmol), p-toluenesulfonyl chloride (0.476 g, 2.5 mmol) in 100 mL dry DCM, TEA (0.303 g, 3.0 mmol) was added at rt under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction was poured into 200 mL water, and extracted with DCM three times. The organic layer was dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound 27 (0.822 g, 76%).1H-NMR (400 MHz, DMSO-d6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.18 (d, J=8.2 Hz, 2H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 6.47 (d, J=8.2 Hz, 2H), 4.06 (t, J=6.1 Hz, 2H), 3.49 (t, J=6.1 Hz, 2H), 3.28 (s, 3H), 2.77 (s, 3H), 2.31 (s, 3H). MS(ESI): m/z Calcd. For C30H29N4O4S 541.2; found 541.2, [M+H]+.
To a stirred solution of compound 20 (0.541 g, 1.0 mmol) in 20 mL dry DMF, sodium sulfite (0.630 g, 5.0 mmol) was added, the mixture solution was heated to 50° C. and stirred for 24 hrs under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound 27 (0.301 g, 60%). 1H-NMR(400 MHz, DMSO-d6): 58.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 3.85 (m, 4H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.28 (s, 3H), 3.16 (m, 4H), 2.77 (s, 3H). MS(ESI): m/z Calcd. For C23H21N4O4S 499.1289; found 499.1288, [M−H]−.
To a stirred solution of compound IV-21 (0.386 g, 1.0 mmol), compound 31 (0.265 g, 1.2 mmol), EDCl (0.382 g, 2.0 mmol) in 30 mL dry DMF, DMAP (0.183 g, 1.5 mmol) was added. The mixture solution was stirred at rt under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound IV-29 (0.490 g, 83%). 1H-NMR(400 MHz, DMSO-d6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 4.17 (s, 2H), 3.75 (s, 3H), 3.6-3.7 (m, 10H), 3.57 (m, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.38 (s, 3H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C32H39N4O7S 591.2819; found 591.2820, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.612 g, 87%)○1H NMR (400 MHz, CDCl3) δ8.15 (d, J=9.0 Hz, 2H), 8.14 (d, J=9.0 Hz, 2H), 7.21 (s, 1H), 4.23 (s, 2H), 4.11 (s, 3H), 3.38 (t, J=6.4 Hz, 2H), 3.01 (s, 3H), 2.92 (t, J=6.4 Hz, 2H), 2.41 (s, 3H). MS(ESI): m/z Calcd. For C18H25N4O3 345.2; found 345.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.422 g, 36%)○1H NMR (400 MHz, CDCl3) δ8.15 (d, J=9.0 Hz, 2H), 8.14 (d, J=9.0 Hz, 2H), 7.95 (d, J=16.0 Hz, 1H), 7.82 (d, J=8.4 Hz, 2H), 7.32 (d, J=8.4 Hz, 2H), 7.21 (s, 1H), 7.01 (d, J=16.0 Hz, 1H), 4.23 (s, 2H), 4.11 (s, 3H), 3.38 (t, J=6.4 Hz, 2H), 3.01 (s, 3H), 2.92 (t, J=6.4 Hz, 2H).MS(ESI): m/z Calcd. For C25H28BrN4O3 511.1345; found 511.1344, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-23, (0.912 g, 89%)○1H NMR (400 MHz, DMSO-d6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 7.18 (d, J=8.2 Hz, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 6.47 (d, J=8.2 Hz, 2H), 4.06 (t, J=6.1 Hz, 2H), 3.49 (t, J=6.1 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H), 2.77 (s, 3H), 2.31 (s, 3H). MS(ESI): m/z Calcd. For C29H29FN3O4S 534.2; found 534.2, [M+H]+.
To a stirred solution of compound 23 (0.534 g, 1.0 mmol) in 35 mL dry DMF, NaN3 (0.195 g, 3.0 mmol) was added carefully. The mixture solution heated to 50° C. over night under Ar atomophere. The solution was cooled down to rt and poured into 100 ml water and extracted with DCM for three times. The organic layer was dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to give the crude product, which was used for next step without further purification.
To a stirred solution of crud production and Ph3P (0.524 g, 2.0 mmol) in 30 mL THF, 2 mL water was added. The mixture solution was stirred at rt under Ar atomophere over night. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.301 g, 79%). 1H-NMR(400 MHz, DMSO-d6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.38 (t, J=6.4 Hz, 2H), 2.92 (t, J=6.4 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C22H24FN4O 379.1934; found 379.1935, [M+H]+.
To a stirred solution of compound 24 (0.534 g, 1.0 mmol) in 50 mL ethanol, Dimethylamine aqueous solution, the complet mixture was heated to reflux under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction cooled down to rt and the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.276 g, 68%). 1H-NMR(400 MHz, DMSO-d6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.47 (t, J=7.6 Hz, 2H), 2.96 (s, 3H), 2.49 (t, J=7.6 Hz, 2H), 2.31 (s, 6H). MS(ESI): m/z Calcd. For C24H28FN4O 407.2247; found 407.2246, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.842 g, 89%)○1H-NMR (400 MHz, CDCl3) δ=7.97 (d, J=8.6 Hz, 1H), 7.88 (s, 1H), 6.85 (s, 1H), 6.56 (d, J=8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 2.31 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H). MS(ESI): m/z Calcd. For C19H24N3O 310.2; found 310.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 21%)○1H NMR (400 MHz, CDCl3) δ=7.97 (d, J=8.6 Hz, 1H), 7.90 (d, J=16.0 Hz, 1H), 7.88 (s, 1H), 7.87 (d, J=4.0 Hz, 2H), 7.43 (d, J=4.0 Hz, 2H), 7.01 (d, J=16.0 Hz, 1H), 6.85 (s, 1H), 6.56 (d, J=8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H).MS(ESI): m/z Calcd. For C27H26N4O 422.2107; found 423.2186, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.732 g, 81%)○1H NMR (400 MHz, CDCl3) δ=7.40 (dd, J=8.32, 1.93 Hz, 1H), 7.29 (d, J=1.89 Hz, 1H), 7.15 (s, 1H), 6.68 (d, J=8.35 Hz, 1H), 4.23-4.31 (m, 2H), 3.40-3.49 (m, 2H), 3.21 (s, 3H), 3.03 (s, 3H), 2.42 (s, 3H). MS(ESI): m/z Calcd. For C15H18N3O2 227.1; found 227.1, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 21%)○1H NMR (400 MHz, CDCl3) δ=7.95 (d, J=16.0 Hz, 1H), 7.87 (d, J=4.0 Hz, 2H), 7.43 (d, J=4.0 Hz, 2H), 7.40 (dd, J=8.32, 1.93 Hz, 1H), 7.29 (d, J=1.89 Hz, 1H), 7.15 (s, 1H), 7.01 (d, J=16.0 Hz, 1H), 6.68 (d, J=8.35 Hz, 1H), 4.23-4.31 (m, 2H), 3.40-3.49 (m, 2H), 3.03 (s, 3H), 2.42 (s, 3H).MS(ESI): m/z Calcd. For C22H20FN3O2 377.1540; found 378.1681, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.732 g, 39%)○1H NMR (400 MHz, CDCl3) δ8.19 (d, J=8.5 Hz, 2H), 8.07 (m, 4H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C20H17N4O3359.1; found 359.1, [M+H]+.
To a stirred solution of compound 28 (0.718 g, 2.0 mmol) in 100 mL ethyl acetate, Anhydrous stannous chloride (0.758 g, 4.0 mmol) was added. The complet mixture was heated to reflux under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction was poured into 150 mL water, and extracted with ethyl acetate for three times. The ° manic layer was dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.586 g, 89%). 1H NMR (400 MHz, CDCl3) 8.19 (d, J=8.5 Hz, 2H), 7.97 (m, 4H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C20H17N4O 329.1402; found 329.1403, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.756 g, 74%)○1H NMR (400 MHz, CDCl3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.95 (s, 1H), 6.88 (1H, d, J=3.0 Hz), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C19H21N3O2 323.2; found 324.2, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.272 g, 24%)○1H NMR (400 MHz, CDCl3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.95 (s, 1H), 6.88 (1H, d, J=3.0 Hz), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C26H25N3O3 427.1896; found 428.1974, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-13, (0.322 g, 79%)○1H NMR(400 MHz, DMSO-d6): δ8.16 (d, J=8.5 Hz, 2H), 7.93 (t, J=4.4 Hz, 2H), 7.90 (d, J=6.1 Hz, 1H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 4.21 (s, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C25H25FN3O2 418.1931; found 418.1932, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-5, (0.816 g, 89%) ○1H NMR (400 MHz, CDCl3) δ9.02 (d, 1H, J=2.1 Hz), 8.59 (d, 1H, J=2.1 Hz), 7.93 (d, 1H, J=9.1 Hz), 7.34 (dd, 1H, J=9.1, 2.5 Hz), 7.21 (s, 1H), 7.00 (d, 1H, J=2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C17H18N4O 294.1; found 295.1, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.272 g, 24%)○1H NMR (400 MHz, CDCl3) δ=9.02 (d, 1H, J=2.1 Hz), 8.59 (d, 1H, J=2.1 Hz), 7.95 (d, J=16.0 Hz, 1H), 7.93 (d, 1H, J=9.1 Hz), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.34 (dd, 1H, J=9.1, 2.5 Hz), 7.21 (s, 1H), 7.15 (d, J=16.0 Hz, 1H), 7.00 (d, 1H, J=2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C25H21N5O 407.1821; found 408.1825, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.275 g, 75%)○1H NMR (400 MHz, DMSO-d6) δ11.00 (s, 1H), 8.08-8.04 (m, 2H), 8.02 (d, J=15.9 Hz, 1H), 7.92-7.87 (m, 2H), 7.49-7.45 (m, 2H), 7.26 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C19H13F2N3O2 339.0951; found 339.0950, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.327 g, 55%)○1H NMR (400 MHz, DMSO-d6) δ9.70 (s, 1H), 8.05 (d, J=8.9 Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J=6.2 Hz, 1H), 7.26 (d, J=8.9 Hz, 1H), 7.15 (d, J=15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J=7.5 Hz, 1H), 3.27 (s, 3H). MS(ESI): m/z Calcd. For C18H12F2N3O2 340.0903; found 340.090, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.342 g, 46%) ○1H NMR(400 MHz, DMSO-d6): δ=8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.50-7.43 (m, 2H), 7.42 (d, J=2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H). MS(ESI): m/z Calcd. For C22H24N3O2 362.1869; found 362.1868, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.312 g, 43%)○1H NMR (400 MHz, CDCl3) δ=8.15 (1H, s), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.20 (s, 1H), 7.50-7.43 (m, 3H), 7.42 (d, 1H, J=16 Hz), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.88 (1H, d, J=3.0 Hz), 3.65 (t, J=7.2 Hz, 2H), 3.45 (t, J=7.2 Hz, 2H), 3.35 (s, 3H) 3.03 (s, 3H).MS(ESI): m/z Calcd. For C26H26N3O2 412.2025; found 412.2026, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.412 g, 46%) ○1H NMR(400 MHz, DMSO-d6): δ=8,72 (s, 2H), 8.00 (d, 1H, J=16 Hz), 7.50-7.43 (m, 2H), 7.42 (d, J=2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 3.75 (t, J=6.8 Hz, 2H), 3.60 (t, 2H, J=6.8 Hz), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C21H21IN6O 373.1777; found 373.1778, [M+H]+.
This compound was obtained by following the general procedure for CompoundIV-1, (0.192 g, 33%) ○1H NMR (400 MHz, DMSO-d6) δ7.96-7.99 (m, 4H), 7.33-7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m/z Calcd. For C19H12F4N2O2 376.0835; found 376.0830, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, (0.192 g, 33%) ○1H NMR (400 MHz, DMSO-d6) δ7.96-7.99 (m, 4H), 7.33-7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m/z Calcd. For C19H12F4N2O2 376.0835; found 376.0830, [M−H]−.
This compound was obtained by following the general procedure for CompoundIV-1, 1H NMR (400 MHz, DMSO-d6) δ ppm 10.70 (s, 1H), 8.35 (s, 2H), 8.15 (s, 2H), 7.82 (d, J=15.8 Hz, 1H), 7.22 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 3.27 (s, 3H); HRMS (ESI) m/z: 546.8647 found (calcd for C19H12Br2C12N2O3, [M+H]+ 546.8644).
This compound was obtained by following the general procedure for CompoundIV-1, 1H NMR (400 MHz, DMSO-d6) δ ppm 10.38 (s, 1H), 8.18 (d, J=2.0 Hz, 2H), 8.12 (s, 2H), 7.81 (d, J=4.8 Hz, 1H), 7.18 (d, J=4.8 Hz, 1H), 6.93 (s, 1H), 6.78 (d, J=2.0 Hz, 2H), 3.25 (s, 3H), 3.04 (s, 6H); HRMS (ESI) m/z: 505.9855 found (calcd for C21H19Br2N3O2, [M+H]+ 505.9896).
This compound was obtained by following the general procedure for CompoundIV-1, 1H NMR (400 MHz, DMSO-d6) δ ppm 10.38 (s, 1H), 8.16 (d, J=2.0 Hz, 2H), 8.11 (s, 2H), 7.80 (d, J=4.8 Hz, 1H), 7.18 (d, J=4.8 Hz, 1H), 6.91 (s, 1H), 6.74 (d, J=2.0 Hz, 2H), 3.44 (d, J=4.8 Hz, 2H), 3.25 (s, 3H), 1.14 (t, J=4.8 Hz, 6H); HRMS (ESI) m/z: 534.0154 found (calcd for C23H23Br2N3O2, [M+H]+534.0209).
This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%) ○1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 4.12 (s, 3H), 3.62 (s, 3H), 1.50 (s, 9H).HR-MS(ESI): m/z Calcd. For C24H21F3N2O4 457.5381; found 457.5380, [M−H]−.
This compound was obtained by following the published procedure (JACS, 2018, 140, 7381-7384.)○1H NMR (400 MHz, CD3OD) δ8.17 (d, J=8.3 Hz, 2H), 7.79 (d, J=15.6 Hz, 1H), 7.55 (d, J=8.8 Hz, 2H), 6.84 (s, 1H), 6.80 (dd, J=9.9, 2.8 Hz, 2H), 6.75 (dd, J=8.8, 5.6 Hz, 2H), 6.66 (d, J=15.6 Hz, 1H), 4.82 (s, 2H), 4.38 (s, 2H), 3.59-3.43 (m 8H), 3.41-3.35 (m, 2H), 3.20-3.13 (m, 2H), 3.04 (s, 6H), 2.12-1.17 (m, 18H). HR-MS(ESI): m/z Calcd. For C37H44ClF3N4O6 732.2901; found 733.2980, [M−H]−.
This compound was obtained by following the published procedure (JACS, 2018, 140, 7381-7384.)○1H NMR (400 MHz, CD3OD) δ8.17 (d, J=8.3 Hz, 2H), 7.79 (d, J=15.6 Hz, 1H), 7.55 (d, J=8.8 Hz, 2H), 6.84 (s, 1H), 6.80 (dd, J=9.9, 2.8 Hz, 2H), 6.75 (dd, J=8.8, 5.6 Hz, 2H), 6.66 (d, J=15.6 Hz, 1H), 4.82 (s, 2H), 4.38 (s, 2H), 3.59-3.43 (m 8H), 3.41-3.35 (m, 2H), 3.20-3.13 (m, 2H), 3.04 (s, 6H), 2.12-1.17 (m, 18H). HR-MS(ESI): m/z Calcd. For C38H44ClF3N5O6 739.2948; found 740.3026, [M+H]−.
Fluorescent dyes IV-1 to IV-38 (molecular rotors) prepared in Embodiments 1 to 38 were respectively dissolved in dimethyl sulfoxide to respectively prepare mother liquor with a concentration of 1×10−2 M, wherein each mother liquor was respectively added to glycerin and methanol and blended, and thus respectively preparing a solution with a final concentration of 1×10−5 M; according to different fluorescent dyes, fluorescence emission spectra thereof were successively detected by means of the maximum excitation wavelength of each fluorescent dye under the same condition, and the results are shown in Table 1, indicating that the fluorescent dye of the present disclosure sensitively responds to viscosity variations.
Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 were added to a diethanol-glycerol mixed solution to prepare a solution with a final concentration of 1×10−5 M, wherein the solution was excited at 480 nm, fluorescence emission spectra at different viscosity conditions are shown as
Molecular rotors (IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8; IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22; IV-42 and IV-36; IV-45, IV-46 and IV-3; IV-47, IV-48 and IV-20; IV-49, IV-50 and IV-5; IV-51 and IV-1) were dissolved in DMSO to prepare mother liquor of 1×10−3 M, wherein the afore-mentioned mother liquor was respectively taken and added to a PBS solution to prepare a solution with a final concentration of 1×10−6 M, and was respectively excited by the maximum excitation wavelength of each compound, so that fluorescent intensities thereof in PBS were detected and each sample was normalized with the strongest fluorescence in each group as 100, as respectively shown in
Compounds IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 specifically bound to RNA aptamer (UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUU GUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGAC ACUUCCGGCGGACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA), and the compound fluorescence after binding was noticeably activated and emitted bright fluorescence when being excited by excitation light at a suitable wavelength, see Table 2 for the optical properties after binding; the compounds could also bind to this aptamer in cells, and cells expressing the RNA aptamer had bright fluorescence, as shown in
Stable cell line (293 T/17) of mRNA cytoskeletal protein, which is labeled by continuously-expressing RNA aptamer (AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUGUGCAAGGCCGGCUUCGC GGGCGACGAUGCCCCCCGGGCCGUCUUCCCCUCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAU GGUGGGCAUGGGUCAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCCUCA CCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGACAUGGAGAAAAUCUGGCACCA CACCUUCUACAAUGAGCUGCGUGUGGCUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUG AACCCCAAGGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCCCAGCCAUGU ACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGGCCGUACCACUGGCAUCGUGAUGGACU CCGGUGACGGGGUCACCCACACUGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCG UCUGGACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGAGCGCGGCUACAG CUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGACAUUAAGGAGAAGCUGUGCUACGUCGCCCU GGACUUCGAGCAAGAGAUGGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCC UGACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGCACUCUUCCAGCCUUC CUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAAACUACCUUCAACUCCAUCAUGAAGUGUGACGU GGACAUCCGCAAAGACCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAUU GCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUGAAGAUCAAGAUCAUUGCU CCUCCUGAGCGCAAGUACUCCGUGUGGAUCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAG CAGAUGUGGAUCAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUGCUUC UAGCACUCGCUAGAGCAUGGUUAAGCUUGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCC GGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUU CCGGCGGACACUUCCGGCGGACACUUCC) and control cells (293T/17) grew under a conventional mammalian cell culture condition (37° C., 5% carbon dioxide, 100% relative humidity), and the cells were digested after a cell confluence of 90% and were centrifuged at 800 rpm; then the cells were re-suspended with PBS containing 0.2 μM of IV-21 and IV-41 molecules, and were incubated for 5 minutes before flow detection, see
| Number | Date | Country | Kind |
|---|---|---|---|
| 202010207772.8 | Mar 2020 | CN | national |
The present application is a U.S. National Phase of International Application Number PCT/CN2021/080926, filed Mar. 16, 2021, and claims priority to Chinese Application Number 202010207772.8, filed Mar. 23, 2020.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/080926 | 3/16/2021 | WO |
