This application is the U.S. national phase of International Application No. PCT/NL2010/000045 filed 16 Mar. 2010, which designated the U.S., and claims priority to EP Application No. 09003750 filed 16 Mar. 2009, the entire contents of which is hereby incorporated by reference.
The present invention relates to a fungal host strain of Chrysosporium lucknowense. The invention relates furthermore to a method for homologous and/or heterologous production of a pure protein with a purity of higher than 75%, to a method for production of artificial protein mixes and to a method for simplified screening of strains functionally expressing a desired enzyme. The invention relates furthermore to an isolated promoter sequence suitable for the transcriptional control of gene expression in Chrysosporium lucknowense and to a method for isolating a fungal host strain of Chrysosporium lucknowense wherein the protease secretion is less than 20% of the protease secretion of Chrysosporium lucknowense strain UV 18-25.
Fungi have been proven to be excellent hosts for the production of a variety of enzymes. Strains like Aspergillus, Trichoderma, Penicillium and recently the fungus Chrysosporium lucknowense C1, have been applied in the industrial production of a wide range of enzymes. Super-producing strains have been developed that secrete up to 100 g/L or more protein in the fermentation broth (see for instance in Hans Visser et al., Abstracts, J. of Biotechnology, S211-S241 (2007). The large protein-secreting capacity of these fungi make it preferred hosts for the targeted production of specific enzymes or enzyme mixes. However, typically, these hosts secrete a mix of many different enzymes, making the crude protein product undefined and yielding, besides the desired enzyme activity, a range of non-relevant or even contra-productive activities. This also holds true for the use of such fungal hosts for production of specific enzyme activities by over-expression of selected genes via genetic modification approaches. Also in these cases the target enzyme will only constitute a minor part of the total secreted protein.
A microbial production system able to secrete high amounts of a specific enzyme without the presence of high levels of other proteins would be highly desirable. It would enable simplified screening of hosts functionally expressing a desired enzyme. It would enable production of relatively pure enzyme. It would also enable simplified large scale purification of the desired enzyme. These advantages would greatly contribute to e.g. easy generation of artificial enzyme mixes tailored for different applications, e.g. plant biomass hydrolysis (biofuels and chemicals), textile finishing, applications in paper and pulp industry.
The relatively clean production of specific extracellular enzymes to high levels by micro-organisms that do not intrinsically secrete high levels of protein would be a non-preferred approach. The limited enzyme secreting capacity of such organisms would prevent high level production of the enzyme of interest.
The object of the present invention comprises the isolation of mutants of a fungal strain with high secretion capacity that unexpectedly no longer produce high levels of many non-desired proteins, while maintaining good growth characteristics, and amenability to genetic modification. These mutant strains were should be able to function as a host for high level production of specific enzymes.
In order to achieve the intended object of the invention the invention provides a fungal host strain of Chrysosporium lucknowense wherein the endogenous cellulase secretion is less than 20% of the endogenous cellulase secretion of Chrysosporium lucknowense strain UV 18-25, preferably less than 15%, more preferably less than 10%, specifically less than 5%, more specifally less than 2%, more specifically less than 1%, most specifically less than 0.5%, or less than 0.1%. The strain Chrysosporium lucknowense strain UV 18-25 has been described in the international patent application WO 0020555. Preferably, the secretion of one or more of the group consisting of endogenous protease, endogenous β-glucanase and endogenous cellobiohydrolase of the fungal host strain according to the invention is less than 20%, more preferably less than 15%, most preferably less than 10%, especially less than 5%, more especially less than 1% most especially less than 0.5% or 0.1% of the secretion of endogenous protease, endogenous β-glucanase and endogenous cellobiohydrolase respectively of the Chrysosporium lucknowense strain UV 18-25. All percentages mentioned apply to the secretion of protease, β-glucanase and cellobiohydrolase independently.
Preferably the strains according to the present invention are further characterized in that secretion of endogenous cellobiohydrolase 1 (Cbh1) is absent. Most preferably the strain according to the present invention is strain W1L, deposited at the Centraal Bureau Schimmelcultures (CBS) under accession nr 122189 or W1L#100.1 deposited at the CBS under accession number 122190.
More preferably from the strains according to the present invention the gene encoding endochitinase 1 (chit) has been disrupted. Most preferably, one or more genes selected from the group consisting of those encoding alkaline protease 1 (alp1), alkaline protease 2 (alp2), proteinase A (pep4), glucoamylase (Gla1), exo-chitinase (Chi2) and laminarinase (Lam1) have been disrupted. Especially, the strains according to the invention are W1L#100.lΔalp1Δpyr5 or W1L#100.lΔalp1Δchi1Δpyr5.
The invention also relates to a method for homologous and/or heterologous production of a pure protein with a purity of higher than 75%, preferably of higher than 80%, more preferably of higher than 85, 90 or 95%, comprising expressing a gene encoding said protein in a strain according to the invention. Especially the invention provides a method for production of artificial protein mixes comprising expressing genes encoding each of said proteins of the mix in a strain according to the invention. In this way protein mixes may be prepared for different applications, e.g. plant biomass hydrolysis (bio fuels and chemicals), textile finishing, applications in paper and pulp industry). Furthermore the invention provides a method for simplified screening of strains functionally expressing a desired enzyme by application of strains according to the present invention.
According to another aspect of the invention an isolated promoter sequence is provided suitable for the transcriptional control of gene expression in Chrysosporium lucknowense, selected from the group consisting of
Also a chimeric gene comprising said promoter sequence and a host comprising said promoter and chimeric gene are provided by the present invention.
Finally a method for isolating a fungal host strain of Chrysosporium lucknowense wherein the cellulase and protease secretion is less than 20% of the cellulase respectively protease secretion of Chrysosporium lucknowense strain UV 18-25, comprising the steps of
If in this patent application patent hosts are defined by comparing the level of production of various enzymes with the Chrysosporium lucknowense strain UV 18-25 then of course the production of one and the same enzyme in the host has to be compared with that in the Chrysosporium lucknowense strain UV 18-25.
The proteins mentioned in this patent application as for instance protease, β-glucanase, cellobiohydrolase, proteinase A, β-glucanase, exo-chitinase and laminarinase have been defined as described in WO 2009/0918537 in the name of Dyadic International INC.
To emphasize the advantages provided by the present invention: it relates to the isolation of novel fungal hosts that have lost their intrinsic capability to secrete high levels variety of background proteins, while retaining the ability to secrete high levels of only few enzyme activities. The invention also relates to the use of these hosts to produce specific enzymes at high levels without co-production of high levels of non-specific proteins. In addition the invention relates to the generation of defined artificial enzyme mixes tailored for different applications.
The invention will now be elucidated by the following non-limiting examples.
Legends to the figures mentioned:
C1 strain UV18-25 (described in WO/2000/020555) was mutated using UV light to produce the strain UV26-2 (Appendix 1 to the Examples). UV26-2 exhibited large clearing zones on ASC (acid swollen cellulose) plates, indicating overproduction of cellulase.
UV26-2 was not a stable mutant and successive streaking of UV26-2 resulted in generation of cellulase negative mutants as shown by the absence of clearing zones on ASC plates. These colonies exhibited enhanced sporulation and white color, while normal, cellulase-producing, colonies were cream colored and showed no sporulation on ASC plates.
Two white colonies (UV26-2W1 and UV26-2W2) were picked from ASC plates along with two normal colonies and cellulase production was evaluated using a shake flask screening procedure. The white colonies produced 6 and 4 U/ml of AzoCMC cellulase activity, while the two normal colonies produced 278 and 294 U/ml of cellulase activity. This confirmed the white colonies to be cellulase-negative mutants.
The purification of strain UV26-2W1 on RM-ASP medium plates (Appendix 2 to the Examples) resulted in the identification of 2 types of colonies: colonies with light colored spores like UV18-25 (UV26-2W1L further indicated as strain W1L), and colonies with dark (pink) colored spores (UV26-2W1D further indicated as strain W1D).
In additional experiments batches of spores of both W1L and W1D were irradiated with UV (Appendix 1 to the Examples) and used in a direct selection procedure for protease-deficient mutants (Braaksma et al., 2008). Positive clones were analyzed on skim milk plates for their protease activity.
After several rounds of purification and selection on skim milk plates, two mutants of W1L (W1L#50.c and W1L#100.l) and three mutants of W1D (W1D #50.g, W1D #50.n and W1D #100.b) with a reduced halo on skim milk plates were selected for cultivation for in vitro degradation assays. In a first cultivation experiment these mutants and their parent strains were cultivated in medium #2 Appendix 1 to the Examples) for 240 hours at 35° C. Apparently, the low cellulase activity in these strains did not allow for growth in high density cellulose based medium. In following cultivation experiments W1L#50.c, W1L#100.l, W1 D #50.g and W1D #100.b and their parents were grown in low (#1) and high (#2) density cellulose medium for 240 hours at 35° C. Also UV18-25 was taken as a control. The parent strains 2W1D, 2W1L and UV18-25 were also cultivated in medium #2. None of the W1L or W1D strains grew in high density cellulose medium #2. In medium #1 good growth could be observed for the ‘white’ strains and their protease-deficient mutants, although the cellulose in the medium was hardly used by the ‘white’ strains. Unexpectedly, it was noted that the UV26-2W1D parent strain, which showed an unstable growth phenotype on agar plates, did use the cellulose in the medium.
The medium samples of the W1L parent strain showed less protease activity on skim milk plates compared to medium samples of W1D parent strain and UV18-25 (Table 1). This is contrary to what was observed when the strains were grown directly on skim milk plates. In that case a large halo could be detected around the colony of UV18-25 and of W1L after 72 hours growth at 30° C., while a small halo could only be detected after 144 hours for W1D. The medium samples of protease mutant W1D #50.g showed a smaller halo on milk plates until 162 hours of cultivation. After 186 hours cultivation, halos were similar as observed for its parent strain.
Analysis of 282 hours medium samples of these strains on SDS-PAGE gels showed that the ‘white strains’ produced much less protein than UV18-25 (
From this first screening for protease-less mutants in a UV26-2W1 background the strains W1D #50.g and W1L#100.l were selected for further analysis.
Different enzyme activities in the extracellular protein content of UV 18-25 and W1L#100.l samples were determined (Table 2). Based on these data it was concluded that W1L#100.l secretes very little specific cellulase activity (less than 1% of UV 18-25) and has very little or no detectable protease activity when compared to UV18-25.
In addition, the levels of hydrolases bearing other substrate specificities (e.g. hemi-cellulose) were reduced as well.
As described above, the white strain is missing the extracellular cellulolytic enzyme spectrum when compared to its parental strain. Hence, the extracellular protein content in white strain cultures, as analyzed by SDS-PAGE, is low. This strain characteristic is beneficial with regard to protein production and purification, since the relative amount of any target protein expressed in such strain will be high. Furthermore, the (nearly) absence of cellulase activity makes the white strain an ideal host strain for testing new or modified cellulases. The same is valid for xylanases as no major xylanase activity was detectable.
To further reduce the protein background level, several major protein bands present in an SDS-PAGE gel from a W1L#100.1 and derivative strain cultures were excised and identified by N-terminal sequencing and/or MS-MS analysis. The most abundant protein was the endochitinase Chi1 (gene identifier: CL06081, peptides MVYDYAG, MPIYGRS, and MFXEASA). Other major proteins were identified as a glucoamylase (Gla1, CL09507, peptides TGGWSVVWPVLK (SEQ ID No 1) and VVGSSSEL(I)GNWDTGR (SEQ ID No 2)), exo-chitinase (Chi2, CL00367, peptides TIDAMAWSK (SEQ ID No 3), NFLPVADILR (SEQ ID No 4), GAYHPSQTYSPEDVEK (SEQ ID No 5), and SWQLVYQHDPTAGLTAEEAK (SEQ ID No 6) and a laminarinase (Lam1, CL08253, peptides PQYESAGSVVPSSFLSVR (SEQ ID No 7) and VSGQVELTDFLVSTQGR (SEQ ID No 8). Also an alkaline protease Alp1 (CL04253) has been identified in W1L#100.l culture broth. Alp1 degrades extracellular proteins, and may degrade proteins of interest.
The vector pChi3-4 (see Example 9, Isolation of the endochitinase 1 encoding gene) was used for the construction of the gene disruption vector. A 1.1-kb MscI/StuI fragment was replaced with the amdS-rep selection marker or the pyr5-rep selection marker, resulting in the vectors pΔchi1-amdS and pΔchi1-pyr5, respectively. The disruption fragment Δchi1-amdS was isolated from pΔchi1-amdS by digestion with EcoRI. The disruption fragment Δchi1-pyr5 was isolated from pΔchi1-pyr5 by digestion with SmaI. Transformation of strain W1L#100.lΔpyr5#172-12 using the disruption fragments resulted in 215Δchi1-pyr5 transformants and 32Δchi1-amdS transformants. All the obtained transformants were purified and analyzed with colony hybridization. Southern analysis of these transformants confirmed the isolation of one W1L#100.l transformant with a disrupted chi gene (W1L#100.1Δpyr5Δchi1-pyr5#46 (pyr5+)).
Shake flask cultures on C1 low density medium were performed from a selection of W1L#100.lΔpyr5Δchi1 mutant strains. The samples were analyzed on SDS-PAGE to evaluate the protein profiles for absence of Chi1 protein (
The remaining most prominent extracellular proteins in white strain W1L#100.lΔalp1Δchi1 and derivative strains correspond to glucoamylase (Gla1), exo-chitinase (Chi2) and laminarinase (Lam1). These enzymes were purified from the culture medium. The enzymatic activities of these proteins were verified using (among others) starch, chitosan and laminarin, respectively, as substrates. Furthermore, mass spectrometry analyses data (see Example 4) combined with C1 genome sequence data revealed the corresponding genes. In order to further reduce the extracellular protein background, the Gla1, Chi2, and Lam1 encoding genes were disrupted and thereby inactivated. Disruption was based on the exchange of the gene promoter and part of the 5′ coding sequence by an amdS selection marker via homologous recombination using approximately 1.5 kbp upstream and downstream sequences that flank these gene promoter and part of the 5′ coding sequence. The gene disruption vectors therefore contained the amdS expression cassette plus these flanking 1.5 kb homologous gene sequences. White strains W1L#100.lΔalp1Δchi1 and derivative strains were transformed with the gla1, chi2 and lam1 gene disruption vectors and transformants were screened for the correct genotype using PCR. As such, white strains with a further reduced extracellular protein composition/content were obtained. Target proteins produced by these strains were more than 80% pure in the crude cell-free culture liquid.
In general, protease encoding genes were disrupted using disruption DNA fragments that contained selection markers (amdS, pyr4 or pyr5) flanked by approximately 1.5 kb large DNA fragments homologous to regions up- and downstream of the gene to be disrupted. Upon introduction of these disruption DNA fragments into the white host, an homologous recombination exchanged the gene to be disrupted for the selection marker fragment. Corresponding transformants were selected as such. Genes that were disrupted this way either encoded disadvantageous (with regard to target protein stability) protease activities e.g. alp1, alp2, pep4) or significant background protein (chi1) or were to be used as selection marker (pyr4, pyr5). Via this approach numerous white C1-strains have been constructed that can be used as hosts for target protein expression (Table 3).
Several major protein bands were isolated from fermentation samples of W1L#100.l grown in low density cellulose medium in order to identify and isolate strong promoters that can be used for gene expression in the W1L strain and its derivatives. N-terminal sequencing of a mixture of peptides obtained after CNBr treatment of the major 45 kDa protein of W1L#100.1 resulted in the identification of four different peptides. Three of these peptides (MVYAG, MPIYGRS and MFXEASA) showed homology with an endochitinase of Aphanocladium album/Trichoderma harzianum (CHI_APHAL P32470).
Based on 3 of these peptide sequences, primers were designed in order to obtain PCR fragments containing a part of the endochitinase encoding gene (Table 4). The PCR primers were designed based on the preferred codon usage of C1.
PCR reactions with these primers were carried out using chromosomal DNA of UV 18-25 as template DNA. PCR fragments were cloned and sequence analysis showed that one of the cloned PCR fragments obtained with Endochitpep1c and Endochitpep2revc (173 bp) contained a part of an endochitinase-encoding gene (chi1). Hybridization analysis of chromosomal DNA of UV18-25 digested BamHI and HindIII with this chi1 fragment as probe showed a clear hybridization signal confirming that the PCR fragment originated from C1 DNA. This fragment was used to clone the complete gene from the ordered C1-cosmid gene library. The fragment sequence (SEQ ID No 18) was as follows:
For the construction of the C1 cosmid library the non commercial cosmid cloning vector, pAOpyrGcosarp1 (
A cosmid library of UV 18-25 was constructed in E. coli and stored as glycerol stocks in the −80° C. The average insert size was 20-35 kb. In total, 6800 clones were obtained, which represents a genome coverage of about 5 fold. To order these clones in 384-wells plates, dilutions of the glycerol stocks were plated on LB-agar plates, containing ampicillin. 7680 individual colonies were manually picked and inoculated in twenty 384-wells plates. These twenty 384-wells plates represent the ordered cosmid library of UV 18-25 in E. coli.
The individual colonies in the twenty 384-wells plates were spotted on nylon filters (Hybond), using a Staccato 384-pintool (Zymarks). The ordered cosmid library was spotted in octuplicate (in total 160 filters). These filters were placed on LB-ampicillin medium plates and incubated at 37° C. to allow colonies to grow on the filters. Subsequently, the colonies were lysed and the cosmid DNA was bound to the filters using standard procedures.
The 173-bp chi1 PCR fragment was used as a radio-active labelled probe for hybridization of duplicate filters of the cosmid library. Hybridization of the cosmid gene library using this chi1 fragment resulted in 3 positive clones. DNA was isolated from these clones and restriction analysis followed by Southern analysis was carried out. A 4.8 kb HindIII fragment and a 3.4 kb BglII fragment showed hybridization using the chi1 probe. The 4.8 kb HindIII and 3.4 kb BglII fragments containing the chi1 gene were isolated and subcloned in pMTL24, resulting in the vectors pCHI4.8 (
For overexpression of endochitinase the 3.4 kb BglII fragment containing the chi1 gene was isolated from pChi3-4. Putative chi1 multi-copy strains in W1L#100.lΔpyr5 were generated by co-transformation of the 3.4 kb BglII chi1 fragment and a pyr5 selection fragment and correct transformants were confirmed by colony hybridization. Shake-flask cultures on C1 low density medium were performed from a selection of W1L#100.l chi1-multicopy strains. The samples were analyzed on SDS-PAGE to evaluate the protein profiles for the overproduction of Chi1 (
Therefore, a general C1 expression cloning vector (pPchi1(0.8)-Tcbh1 NotI) was constructed containing the chi-promoter (Pchi) to direct the overexpression of cloned genes. Initially, the EcoRI site upstream op Pchi1 in pCHI #4.8 was removed by a partial EcoRI digestion and treatment of the linear fragment with Klenow yielding pCHI1#4.8ΔEcoRI. From this vector the 1.9-kb SacI-SphI fragment was cloned in the corresponding site of pPcbh1-glaA(II)-Tcbh1 (
The 0.8 kb chi1 promoter sequence in pCHI #4.8 could be more than sufficient to drive chi1 expression. However, a longer chi1 promoter was also generated by amplifying the a PstI-HindIII fragment (upstream of the HindIII site at position −775 relative to the ATG start codon), using one of the previously identified positive cosmid clone as template DNA. The resulting fragment was cloned in pGEM-T-Easy and sequenced. From this plasmid the PstI-HindIII fragment was isolated and cloned in the corresponding sites of pPchi1-xyl1-Tcbh1 yielding pPchi1(1.8)-xyl1-Tcbh1, in which the promoter size is 1.8 kb. The fragment was also cloned in the corresponding site of pPchi1-Tcbh1 NotI #7.1, yielding the general expression vector pPchi1(1.8)-Tcbh1 NotI (
The levels of gene expression directed by the extended chitinase promoter (Pchi1(1.8)) and by the initially used chitinase promoter (Pchi1 (0.8)) were compared by the expression of two reporter genes, xyl1 and alp1. White strain transformants were generated that either expressed xyl1 (encoding a xylanase) or alp1 (encoding an alkaline protease) (Table 5).
Surprisingly, the reporter gene expression was higher in case of the extended chi1 promoter (1.8 kb), which indicates the necessity of the further upstream regions. In conclusion, a Pchi1 based expression system was developed for high level expression of genes in White C1 strains.
A different approach for searching strong promoters was performed using the quantitive detection of messenger RNA levels from W1L or W1L#100.1 RNA. The RNA samples were isolated from mycelium which was sampled at different time points during a fed-batch fermentation process. A number of genes were identified as being strongly or stronger expressed. To verify the expression level of these genes, the RNA samples were also separated on gel, blotted and hybridized to probes specific for these genes (Table 6).
The cbh1 promoter, which is a strong promoter in UV 18.25 strains, is not active in the white strains. The chi1 promoter was the strongest both under glucose and xylose feed conditions. The hex1 promoter is a strong constitutive promoter during all phases of fermentation and under both sugar feed conditions. The xyl6 promoter is highly active under the xylose feed condition only. The pep4, his2a and bgl1 promoters are moderately active. For high level gene expression in the white strains the chi1, hex1 and xyl6 promoters are very useful. Alternative promoters that also give high expression are those of the pep4, his2a and bgl1 genes. Additional northern experiments also indicated that the promoters of the xyl 4 and xyl8 genes can be used for high level gene expression in the white strains when grown on xylose. Glucoamylase (Gla1, gene identifier: CL09507) has been shown to be a major protein in white C1 strains. The gla1 promoter is therefore also a good candidate to be used for the high level expression of genes of interest in white strains. It was shown that glucoamylase was highly abundant in a white strain grown in the presence of starch. This indicated that the gla1 promoter is strong and inducible by starch and its degradation products, like maltose.
The nucleotide sequences of Pchi1(0.8), Pchi1(1.8), Phex1, Pxy16 and Pgla1 are given below. Note that the ATG start codons of the corresponding coding regions are given in bold italics.
Two expression vectors were designed for expression of genes in W1L and derivatives: pPchi1(1.8)-Tcbh1 Not1 was as described above. Additionally, pCRS Pchi1-Tcbh1 (
Many genes have been cloned and expressed in W1L or derivatives. The general procedure was as follows:
In the international patent application WO 2009/018537 has been described:
In the international patent application WO 2009/033071 has been described:
Abf3, Abn2, Abn3, Abn4, Abn5, Abn7, Abn9, Agu1, Axe2, Axe3, Bga2, Bxl1, Bxl2, Abf5(formerly known as Bxl3), GH61 genes (gene identifiers: CL09768, CL10518, CL05022, CL04725, CL04750, CL06230, CL05366), Gln, Pgx1, Rga1, Rgx1, Xgl1, Xyl7, Xyl8, Xyl9, Xyl10, Xyl11.
Alp1: The Alp1 DNA sequence is given by SEQ ID NO 30. The Alp1 amino acid sequence is given in SEQ ID NO 31.
The alp1 gene was expressed and Alp1 showed protease activity (Table 5). The “Protease colorimetric detection kit” (Sigma, product number PC0100) was used to determine Alp1 protease activity.
A GH61 protein-encoding gene (identifier CL10518) was overexpressed in C1 strains W1L#100.L Δalp1Δpyr5 and W1L#100.lΔalp1Δchi1Δpyr5. Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with Coomassie brilliant blue (CBB). The CL10518 protein is ±26 kDa (
The functional analysis of this protein has been described in International patent application WO 2009/033071.
The CBH2 encoding gene (identifier CL09854) was overexpressed in C1 strain W1L#100.L Δalp1Δpyr5. Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with coomassie brilliant blue (CBB). The CBH2 protein migrates at about 55 kDa (
The functional analysis of this protein has been described in International patent application WO 2009/018537.
The PGX encoding gene (identifier CL10389) was overexpressed in C1 strain W1L#100.L Δalp1Δchi1Δpyr5. Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with coomassie brilliant blue (CBB). The PGX protein migrates at about 60 kDa (
The following assay was used to measure polygalacturonase activity. This assay measures the amount of reducing sugars released from polygalacturonic acid (PGA) by the action of a polygalacturonase. One unit of activity was defined as 1 μmole of reducing sugars liberated per minute under the specified reaction conditions.
Reagents
The ΔA410 of Pgx1 (CL10389) was found to be 0.78 with a DF of 1 for enzyme produced in microtiter plate cultures. No standard curve was analyzed, therefore no reliable activity can be calculated. The only conclusion to be drawn is that the enzyme was found to be active towards polygalacturonic acid, and therefore it is suggested that it is a polygalacturonase.
The functional analysis of this protein has been described in International patent application WO 2009/033071.
The Xyl1 encoding gene (identifier CL00649) was overexpressed in C1 strain W1L#100.L Δalp1Δchi1Δpyr5. Two Xyl1 variants were produced: either full length Xyl1 or Xyl1 without its carbohydrate binding domain (cbd). Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with coomassie brilliant blue (CBB) (
The following assay is used to measure the xylanase activity towards AZO-wheat arabinoxylan. This substrate is insoluble in buffered solutions, but rapidly hydrates to form gel particles which are readily and rapidly hydrolysed by specific endo-xylanases releasing soluble dye-labeled fragments.
Reagents
The functional analysis of this protein has been described in International patent application WO 2009/018537.
The Abn2 encoding gene (identifier CL03602) was overexpressed in C1 strain W1L#100.L Δalp1Δchi1Δpyr5. Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with coomassie brilliant blue (CBB). The Abn2 protein migrates at about 50 kDa (
The functional analysis of this protein has been described in International patent application WO 2009/033071.
The Chi1 encoding gene (identifier CL06081) was overexpressed in C1 strain W1L#100.L Δalp1Δpyr5. Culture supernatant samples were analyzed by SDS-PAGE and protein bands were stained with coomassie brilliant blue (CBB). The Chi1 protein migrates at about 40 kDa (
The functional analysis of this protein has been described in International patent application WO 2009/018537.
The Aspergillus niger poly-galacturonase II encoding-gene (accession number X58893) was expressed in C1 strain W1L#100.lΔalp1Δchi1Δpyr5. After fermentation the enzyme was purified using ion exchange chromatography and size exclusion chromatography. The purified endo-PGII migrated at about 40 kDa on SDS-PAGE gel (
This heterologous enzyme was functional as was shown by activity on polygalacturonic acid using the following assay.
Reducing Sugars Assay: PAHBAH Method
Stock Solutions:
An artificial enzyme mixture was created by mixing crude protein from C1 UV18-25Δalp1 with crude protein from white strains expressing C1-β-glucosidase Bgl1, C1-arabinofuranosidase Abf3 and Abn7, C1-xylanase Xyl2 and C1-β-xylosidase Bxl1, being W1L#100.LΔalp1Δpyr5[Bgl1/pyr5], W1L#100.LΔalp1Δchi1Δpyr5[Abf3/pyr5], W1L#100.LΔalp1Δchi1Δpyr5[Abn7/pyr5], W1L#100.LΔalp1Δpyr5[Xyl2/pyr5], and W1L#100.LΔalp1Δchi1[Bxl1/AmdS], respectively. The ratio of the different components on a protein basis was 10 (UV18-25Δalp1): 1 (white strain proteins).
The saccharification efficiency of the crude protein from UV18-25Δalp1 alone was tested on wheat bran substrate and compared to the efficiency of the artificial mixture. 10 mg protein/g dry matter wheat bran was used. Conditions were as follows: temperature 50° C., pH 5.0, time 72 hours.
It was shown that the enzyme mixture from UV18-25Δalp1 alone liberated approximately 30% of the glucose, approximately 5% of the xylose and 12% of the arabinose from the wheat bran. The artificial mixture liberated at least 60% of the glucose, 60% of the xylose and 25% of the arabinose from the wheat bran.
A gene library from genomic DNA of C1 strain UV18-25 was constructed in C1-strain W1L#100.lΔalp1Δchi1Δpyr5 by methods previously described by Verdoes et al. (2007). The library was screened for xylanase activity as described by Example 4 in chapter 4, which yielded several positive clones that expressed different xylanases. SDS-page analysis revealed the presence of extra protein bands in the positive clones. PCR analysis using different primer combinations based on the sequence of the known C1 xylanases and the vector sequence revealed the presence of 3 different C1-xylanases. This result was confirmed by Southern analysis.
Appendix 1 to the Examples: UV Mutation Procedure for C1 Strains
Adjust pH to 7.5 with HCl and sterilize 30 minutes at 121° C. After sterilization add 20 ml of 25 g/l DOC (deoxycholic acid), sterile filtered. Pour about 20 ml/plate. Spread UV-mutated spores to ASC plates and incubate for 7-14 days to allow colony growth and cellulose clearing.
RM-ASP Medium
Adjust pH to 6.5 prior to autoclaving. Sterilize glucose separately as a 50% solution.
Low and High Density Cellulose Media
Adjust to pH 7.0.
TGGTCCTCGATACCGGTAGCTCCAACCTGTGGGTTCCATCAGTCGAGTGCGGCTCGATTG
| Number | Date | Country | Kind |
|---|---|---|---|
| 09003750 | Mar 2009 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/NL2010/000045 | 3/16/2010 | WO | 00 | 12/5/2011 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2010/107303 | 9/23/2010 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 6573086 | Emalfarb et al. | Jun 2003 | B1 |
| 20070173431 | Day et al. | Jul 2007 | A1 |
| 20080194005 | Emalfarb et al. | Aug 2008 | A1 |
| Number | Date | Country |
|---|---|---|
| 1237207 | Dec 1999 | CN |
| 1330717 | Jan 2002 | CN |
| 1380905 | Nov 2002 | CN |
| WO 9815633 | Apr 1998 | WO |
| WO 0020555 | Apr 2000 | WO |
| WO 0179507 | Oct 2001 | WO |
| WO 2005001036 | Jan 2005 | WO |
| WO 2008073914 | Jun 2008 | WO |
| WO 2009018537 | Feb 2009 | WO |
| WO 2009033071 | Mar 2009 | WO |
| Entry |
|---|
| Search Report issued in connection with Application No. 201080020447.5, dated Aug. 31, 2012 (in Chinese). |
| English translation of Office Action issued in connection with Application No. 201080020447.5, dated Aug. 31, 2012. |
| Braaksma et al, “Aspergillus as a Cell Factory for Protein Production: Controlling Protease Activity in Fungal Production”, The Aspergilli: Genomics, Medical Aspects, Biotechnology, and Research Methods CRC Press, Boca Raton, 441-455 (2008). |
| Verdoes et al, “A dedicated vector for efficient library construction and high throughput screening in the hyphal fungus Chrysosporium lucknowense”, Industrial Biotechnology 3, 48-57 (2007). |
| Visser et al, “Chrysosporium lucknowense is a versatile fungal host for gene discovery and protein production”, Abstracts, J. of Biotechnology, S211-S241 (2007). |
| Lever, “A New Reaction for Colorimetric Determination of Carbohydrates”, Analytical Biochemistry 47, 273-279 (1972). |
| Punt et al, “Fungal Protein Production: Design and Production of Chimeric Proteins”, Annu. Rev. Microbiol. 2011, 65:57-69. |
| International Search Report for PCT/NL2010/000045, mailed Oct. 26, 2010. |
| Hinz, Sandra W.A. et al., “Hemicellulase Production in Chrysosporium Lucknowense C1”, Journal of Cereal Science, vol. 50, No. 3, (Nov. 2009), pp. 318-323. |
| Hallemeersch, I. et al., “Regulation of Cellulase and Hemicellulase Synthesis in the Fungus Chrysosporium SP”, Communications in Agricultural and Applied Biological Sciences, vol. 68, No. 2, (Jan. 1, 2008), pp. 301-304. |
| Verdoes, Jan C. et al., “Original Research: A Dedicated Vector for Efficient Library Construction and High Throughput Screening in the Hyphal Fungus Chrysosporium Lucknowense”, Industrial Biotechnology, vol. 3, No. 1, (Jan. 1, 2007), pp. 48-57. |
| Number | Date | Country | |
|---|---|---|---|
| 20120107856 A1 | May 2012 | US |